Detecting drug-target binding in cells using fluorescence-activated cell sorting coupled with mass spectrometry analysis.

PubMed

Wilson, Kris; Webster, Scott P; Iredale, John P; Zheng, Xiaozhong; Homer, Natalie Z; Pham, Nhan T; Auer, Manfred; Mole, Damian J

2017-12-15

The assessment of drug-target engagement for determining the efficacy of a compound inside cells remains challenging, particularly for difficult target proteins. Existing techniques are more suited to soluble protein targets. Difficult target proteins include those with challenging in vitro solubility, stability or purification properties that preclude target isolation. Here, we report a novel technique that measures intracellular compound-target complex formation, as well as cellular permeability, specificity and cytotoxicity-the toxicity-affinity-permeability-selectivity (TAPS) technique. The TAPS assay is exemplified here using human kynurenine 3-monooxygenase (KMO), a challenging intracellular membrane protein target of significant current interest. TAPS confirmed target binding of known KMO inhibitors inside cells. We conclude that the TAPS assay can be used to facilitate intracellular hit validation on most, if not all intracellular drug targets.

Detecting drug-target binding in cells using fluorescence-activated cell sorting coupled with mass spectrometry analysis

NASA Astrophysics Data System (ADS)

Wilson, Kris; Webster, Scott P.; Iredale, John P.; Zheng, Xiaozhong; Homer, Natalie Z.; Pham, Nhan T.; Auer, Manfred; Mole, Damian J.

2018-01-01

The assessment of drug-target engagement for determining the efficacy of a compound inside cells remains challenging, particularly for difficult target proteins. Existing techniques are more suited to soluble protein targets. Difficult target proteins include those with challenging in vitro solubility, stability or purification properties that preclude target isolation. Here, we report a novel technique that measures intracellular compound-target complex formation, as well as cellular permeability, specificity and cytotoxicity-the toxicity-affinity-permeability-selectivity (TAPS) technique. The TAPS assay is exemplified here using human kynurenine 3-monooxygenase (KMO), a challenging intracellular membrane protein target of significant current interest. TAPS confirmed target binding of known KMO inhibitors inside cells. We conclude that the TAPS assay can be used to facilitate intracellular hit validation on most, if not all intracellular drug targets.

Measurement of monomolecular binding constants of neutral phenols into the beta-cyclodextrin by continuous frontal analysis in capillary and microchip electrophoresis via a competitive assay.

PubMed

Le Saux, Thomas; Hisamoto, Hideaki; Terabe, Shigeru

2006-02-03

Measurement of binding constant by chip electrophoresis is a very promising technique for the high throughput screening of non-covalent interactions. Among the different electrophoretic methods available that yield the binding parameters, continuous frontal analysis is the most appropriate for a transposition from capillary electrophoresis (CE) to microchip electrophoresis. Implementation of this methodology in microchip was exemplified by the measurement of inclusion constants of 2-naphtalenesulfonate and neutral phenols (phenol, 4-chlorophenol and 4-nitrophenol) into beta-cyclodextrin by competitive assays. The issue of competitor choice is discussed in relation to its appropriateness for proper monitoring of the interaction.

Radioreceptor assay for analysis of fentanyl and its analogs in biological samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alburges, M.E.

The assay is based on the competition of these drugs with ({sup 3}H) fentanyl for opioid receptors in membrane preparations of rat forebrain in vitro. The binding in stereospecific, reversible and saturable. Scatchard plots of saturation suggest the presence of high and low affinity binding sites. Morphine and hydromorphone complete with ({sup 3}H)fentanyl for the opioid receptor, but other morphine-like compounds were relatively weak displacers of ({sup 3}H)fentanyl. Many other commonly abused drugs do not compete with ({sup 3}H)fentanyl for the opioid receptors. Urine samples from animals injected with fentanyl, ({plus minus})-cis-3-methylfentanyl, alpha-methylfentanyl, butyrylfentanyl and benzylfentanyl were analyzed by radioreceptormore » assay, radioimmunoassay, and gas chromatography/mass spectrometry. Urinary analysis of fentanyl showed a good correlation with these three methods; however, discrepancies were observed in the analysis of fentanyl analogs. This radioreceptor assay is well-suited as an initial assay for the detection of active analogs of fentanyl in urine with good correlation with other techniques in the analysis of fentanyl; however, there is substantial disagreement between techniques in the quantitation of fentanyl analogs. The implications of these discrepancies are discussed.« less

Evaluation of a new serological technique for detecting rabies virus antibodies following vaccination.

PubMed

Ma, Xiaoyue; Niezgoda, Michael; Blanton, Jesse D; Recuenco, Sergio; Rupprecht, Charles E

2012-08-03

Two major techniques are currently used to estimate rabies virus antibody values: neutralization assays, such as the rapid fluorescent focus inhibition test (RFFIT), and enzyme-linked immunosorbent assays (ELISAs). The RFFIT is considered the gold standard assay and has been used to assess the titer of rabies virus neutralizing antibodies for more than three decades. In the late 1970s, ELISA began to be used to estimate the level of rabies virus antibody and has recently been used by some laboratories as an alternate screening test for animal sera. Although the ELISA appears simpler, safer and more efficient, the assay is less sensitive in detecting low values of rabies virus neutralizing antibodies than neutralization tests. This study was designed to evaluate a new ELISA-based method for detecting rabies virus binding antibody. This new technique uses electro-chemi-luminescence labels and carbon electrode plates to detect binding events. In this comparative study, the RFFIT and the new ELISA-based technique were used to evaluate the level of rabies virus antibodies in human and animal serum samples. By using a conservative approximation of 0.15 IU/ml as a cutoff point, the new ELISA-based technique demonstrated a sensitivity of 100% and a specificity of 95% for human samples and for experimental animal samples. The sensitivity and specificity for field animal samples was 96% and 95%, respectively. The preliminary results from this study appear promising and demonstrate a higher sensitivity than traditional ELISA methods. Published by Elsevier Ltd.

Structure–activity relationships for the binding of polymyxins with human α-1-acid glycoprotein

PubMed Central

Azad, Mohammad A.K.; Huang, Johnny X.; Cooper, Matthew A.; Roberts, Kade D.; Thompson, Philip E.; Nation, Roger L.; Li, Jian; Velkov, Tony

2012-01-01

Here, for the first time, we have characterized binding properties of the polymyxin class of antibiotics for human α-1-acid glycoprotein (AGP) using a combination of biophysical techniques. The binding affinity of colistin, polymyxin B, polymyxin B3, colistin methansulfonate, and colistin nona-peptide was determined by isothermal titration calorimetry (ITC), surface plasma resonance (SPR) and fluorometric assay methods. All assay techniques indicated colistin, polymyxin B and polymyxin B3 display a moderate binding affinity for AGP. ITC and SPR showed there was no detectable binding affinity for colistin methansulfonate and colistin nona-peptide, suggesting both the positive charges of the diaminobutyric acid (Dab) side chains and the N-terminal fatty acyl chain of the polymyxin molecule are required to drive binding to AGP. In addition, the ITC and fluorometric data suggested that endogenous lipidic substances bound to AGP provide part of the polymyxin binding surface. A molecular model of the polymyxin B3–AGP F1*S complex was presented that illustrates the pivotal role of the N-terminal fatty acyl chain and the D-Phe6-L-Leu7 hydrophobic motif of polymyxin B3 for binding to the cleft-like ligand binding cavity of AGP F1*S variant. The model conforms with the entropy driven binding interaction characterized by ITC which suggests hydrophobic interactions coupled to desolvation events and conformational changes are the primary driving force for polymyxins binding to AGP. Collectively, the data are consistent with a role of this acute-phase reactant protein in the transport of polymyxins in plasma. PMID:22587817

Radioimmunoassays and 2-site immunoradiometric "sandwich" assays: basic principles.

PubMed

Rodbard, D

1988-10-01

The "sandwich" or noncompetitive reagent-excess, 2-site immunoradiometric assay (2-site IRMA), ELISA, USERIA, and related techniques, have several advantages compared with the traditional or competitive radioimmunoassays. IRMAs can provide improved sensitivity and specificity. However, IRMAs present some practical problems with nonspecific binding, increased consumption of antibody, biphasic dose response curve, (high dose hook effect), and may require special techniques for dose response curve analysis. We anticipate considerable growth in the popularity and importance of 2-site IRMA.

How to Illustrate Ligand-Protein Binding in a Class Experiment: An Elementary Fluorescent Assay.

ERIC Educational Resources Information Center

Marty, Alain; And Others

1986-01-01

Describes an experiment (taking approximately five hours) which illustrates the binding of a small molecule to a protein. By using an appropriate fluorescent ligand and a given protein, the fluorescent probe technique is applied to measure the number of bonding sites, and number of site classes, and their association constants. (JN)

Comparison of techniques of detecting immunoglobulin-binding protein reactivity to immunoglobulin produced by different avian and mammalian species.

PubMed

Justiz-Vaillant, A A; Akpaka, P E; McFarlane-Anderson, N; Smikle, M F

2013-01-01

The rationale of this study was to use several immunological assays to investigate the reactivity of immunoglobulin binding protein (IBP) to immunoglobulins from various avian and mammalian species. The IBP studied were Staphylococcal protein A (SpA), Streptococcal protein G (SpG), Peptostreptococcal protein L (SpL) and recombinant protein LA (SpLA). The various immunological techniques used were double immunodiffusion (Ouchterlony technique) that tested positive high protein reactivities, direct and competitive enzyme-linked immunosorbent assays (ELISAs) that tested moderate and low positive protein binding capacities, respectively. In addition to sandwich ELISAs, immunoblot analyses and Ig-purification by SpA-affinity chromatography, which were sensitive tests and helpful in the screening and confirmatory tests were also used. The Ouchterlony technique showed that compared to the other proteins, SpLA had the highest range of reactivity with animal sera and purified immunoglobulins while SpL was least reactive. With the direct ELISA, SpL reacted with the raccoon sera, rabbit IgG and with IgY from bantam hens and pigeons. While with the direct ELISA, SpA reacted with sera from skunk, coyote, raccoon, mule, donkey and human. The sandwich ELISA revealed high reactivity of both SpG and SpLA with mammalian sera titres ranging from 1:32 (raccoon serum) to 1:1024 (mule and donkey sera). These results suggest that IBP can be used for the detection of immunoglobulin using various immunological assays and this is important for the diagnosis of infectious diseases in animal and bird populations studied and in the purification of immunoglobulins.

Analytical applications of MIPs in diagnostic assays: future perspectives.

PubMed

Bedwell, Thomas S; Whitcombe, Michael J

2016-03-01

Many efforts have been made to produce artificial materials with biomimetic properties for applications in binding assays. Among these efforts, the technique of molecular imprinting has received much attention because of the high selectivity obtainable for molecules of interest, robustness of the produced polymers, simple and short synthesis, and excellent cost efficiency. In this review, progress in the field of molecularly imprinted sorbent assays is discussed-with a focus on work conducted from 2005 to date.

New Horizons on Molecular Pharmacology Applied to Drug Discovery: When Resonance Overcomes Radioligand Binding.

PubMed

Pernomian, Larissa; Gomes, Mayara Santos; Moreira, Josimar Dornelas; da Silva, Carlos Henrique Tomich de Paula; Rosa, Joaquin Maria Campos; Cardoso, Cristina Ribeiro de Barros

2017-01-01

One of the cornerstones of rational drug development is the measurement of molecular parameters derived from ligand-receptor interaction, which guides therapeutic windows definition. Over the last decades, radioligand binding has provided valuable contributions in this field as key method for such purposes. However, its limitations spurred the development of more exquisite techniques for determining such parameters. For instance, safety risks related to radioactivity waste, expensive and controlled disposal of radioisotopes, radiotracer separation-dependence for affinity analysis, and one-site mathematical models-based fitting of data make radioligand binding a suboptimal approach in providing measures of actual affinity conformations from ligands and G proteincoupled receptors (GPCR). Current advances on high-throughput screening (HTS) assays have markedly extended the options of sparing sensitive ways for monitoring ligand affinity. The advent of the novel bioluminescent donor NanoLuc luciferase (Nluc), engineered from Oplophorus gracilirostris luciferase, allowed fitting bioluminescence resonance energy transfer (BRET) for monitoring ligand binding. Such novel approach named Nluc-based BRET (NanoBRET) binding assay consists of a real-time homogeneous proximity assay that overcomes radioligand binding limitations but ensures the quality in affinity measurements. Here, we cover the main advantages of NanoBRET protocol and the undesirable drawbacks of radioligand binding as molecular methods that span pharmacological toolbox applied to Drug Discovery. Also, we provide a novel perspective for the application of NanoBRET technology in affinity assays for multiple-state binding mechanisms involving oligomerization and/or functional biased selectivity. This new angle was proposed based on specific biophysical criteria required for the real-time homogeneity assigned to the proximity NanoBRET protocol. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Lipid Microarray Biosensor for Biotoxin Detection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Anup K.; Throckmorton, Daniel J.; Moran-Mirabal, Jose C.

2006-05-01

We present the use of micron-sized lipid domains, patterned onto planar substrates and within microfluidic channels, to assay the binding of bacterial toxins via total internal reflection fluorescence microscopy (TIRFM). The lipid domains were patterned using a polymer lift-off technique and consisted of ganglioside-populated DSPC:cholesterol supported lipid bilayers (SLBs). Lipid patterns were formed on the substrates by vesicle fusion followed by polymer lift-off, which revealed micron-sized SLBs containing either ganglioside GT1b or GM1. The ganglioside-populated SLB arrays were then exposed to either Cholera toxin subunit B (CTB) or Tetanus toxin fragment C (TTC). Binding was assayed on planar substrates bymore » TIRFM down to 1 nM concentration for CTB and 100 nM for TTC. Apparent binding constants extracted from three different models applied to the binding curves suggest that binding of a protein to a lipid-based receptor is strongly affected by the lipid composition of the SLB and by the substrate on which the bilayer is formed. Patterning of SLBs inside microfluidic channels also allowed the preparation of lipid domains with different compositions on a single device. Arrays within microfluidic channels were used to achieve segregation and selective binding from a binary mixture of the toxin fragments in one device. The binding and segregation within the microfluidic channels was assayed with epifluorescence as proof of concept. We propose that the method used for patterning the lipid microarrays on planar substrates and within microfluidic channels can be easily adapted to proteins or nucleic acids and can be used for biosensor applications and cell stimulation assays under different flow conditions. KEYWORDS. Microarray, ganglioside, polymer lift-off, cholera toxin, tetanus toxin, TIRFM, binding constant.4« less

The Dot Blot ELISA.

ERIC Educational Resources Information Center

Gerbig, Donald G., Jr.; Fenk, Christopher J.; Goodhart, Amy S.

2000-01-01

Uses two laboratory techniques, Enzyme Linked Immunosorbent Assay (ELISA) and Western Blot, to demonstrate antibody-antigen binding concepts. Includes a list of required materials and directions for the procedure, and makes suggestions for classroom applications. (Contains 13 references.) (YDS)

Molecular mechanisms of lymphocyte extravasation. II. Studies of in vitro lymphocyte adherence to high endothelial venules.

PubMed

Braaten, B A; Spangrude, G J; Daynes, R A

1984-07-01

Lymphocyte migration from the blood into the lymph nodes in most species occurs across post-capillary high endothelial venules (HEV). In a previous study, we proposed that lymphocyte extravasation involves receptor-mediated binding followed by adenylate cyclase-dependent activation of lymphocyte motility. This hypothesis was, in part, based on observations of in vitro lymphocyte adherence to HEV by employing pertussigen, which is a known inhibitor of lymphocyte recirculation. In vitro lymphocyte-HEV binding requires a cold (6 degrees C) incubation step and binding is poor to nil if the assay is attempted at room (23 degrees C) or physiologic temperature. We decided to investigate why this assay is temperature restricted, because of the possibility that pertussigen or fucoidin -treated lymphocytes might interact with HEV differently at higher temperatures. We now report that O.C.T. compound (OCT), the embedding matrix generally used to cut frozen lymph node sections, is toxic to lymphocytes at temperatures above 6 degrees C. Exclusion of OCT from the assay system will allow lymphocyte-HEV binding to occur at 23 degrees C and to a lesser extent at 37 degrees C. With this modified protocol, lymphocytes treated with either pertussigen, fucoidin , or neuraminidase were tested for adherence to HEV at 23 degrees C. No essential difference in binding properties was observed from what had been reported at 6 degrees C. In contrast, trypsin-treated lymphocytes that did not bind to HEV with the standard technique at 6 degrees C did adhere to a minimal extent to HEV at 23 degrees C using the modified procedure. We also report some preliminary work, using the modified assay, on in vitro lymphocyte-HEV binding of rat, rabbit, and guinea pig lymphocytes to sections of lymph nodes from the respective species.

The binding of human and guinea-pig IgG subclasses to homologous macrophage and monocyte Fc receptors.

PubMed Central

Alexander, M D; Andrews, J A; Leslie, R G; Wood, N J

1978-01-01

Guinea-pig IgG2 and IgT1 bind to contiguous Fc receptors on homologous peritoneal macrophages. Equilibrium association constants determined for the binding of human IgG subclasses to homologous peripheral blood monocytes show that the order of binding is IgG1 greater than IgG3 greater than IgG4 greater than IgG2. Direct binding and rosette assay techniques independently established that both guinea-pig IgG2 and human IgG bind to homologous macrophage-monocyte Fc receptors through a site present in whole Fc (CH2. CH3)2, but absent in pFc' subfragments (CH3)2. PMID:680795

Rapid Generation of a Nanocrystal-Labeled Peptide Library for Specific Identification of the Bacterium Clostrium Botulinum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tok, J B

2004-11-11

Several peptide libraries containing up to 2 million unique peptide ligands have been synthesized. The peptides are attached onto a 80 micron resin and the length of these peptide ligands ranges from 5 to 9 amino acid residues. Using a novel calorimetric assay, the libraries were screened for binding to the ganglioside-binding domain of Clostridium Tetanus Toxin, a structural similar analog of the Clostridium Botulinum toxin. Several binding peptide sequences were identified, in which the detailed binding kinetics are currently underway using the Surface Plasmon Resonance (SPR) technique.

Thermometric enzyme linked immunosorbent assay: TELISA.

PubMed

Mattiasson, B; Borrebaeck, C; Sanfridson, B; Mosbach, K

1977-08-11

A new method, thermometric enzyme linked immunosorbent assay (TELISA), for the assay of endogenous and exogenous compounds in biological fluids is described. It is based on the previously described enzyme linked immunosorbent assay technique, ELISA, but utilizes enzymic heat formation which is measured in an enzyme thermistor unit. In the model system studied determination of human serum albumin down to a concentration of 10(-10) M (5 ng/ml) was achieved, with both normal and catalase labelled human serum albumin competing for the binding sites on the immunosorbent, which was rabbit antihuman serum albumin immobilized onto Sepharose CL-4B.

Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.

PubMed

Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun

2017-03-16

Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.

Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

PubMed

Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

2012-08-01

CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

Antibodies against toluene diisocyanate protein conjugates. Three methods of measurement.

PubMed

Patterson, R; Harris, K E; Zeiss, C R

1983-12-01

With the use of canine antisera against toluene diisocyanate (TDI)-dog serum albumin (DSA), techniques for measuring antibody against TDI-DSA were evaluated. The use of an ammonium sulfate precipitation assay showed suggestive evidence of antibody binding but high levels of TDI-DSA precipitation in the absence of antibody limit any usefulness of this technique. Double-antibody co-precipitation techniques will measure total antibody or Ig class antibody against 125I-TDI-DSA. These techniques are quantitative. The polystyrene tube radioimmunoassay is a highly sensitive method of detecting and quantitatively estimating IgG antibody. The enzyme linked immunosorbent assay is a rapidly adaptable method for the quantitative estimation of IgG, IgA, and IgM against TDI-homologous proteins. All these techniques were compared and results are demonstrated by using the same serum sample for analysis.

Targeting Anti-Cancer Active Compounds: Affinity-Based Chromatographic Assays

PubMed Central

de Moraes, Marcela Cristina; Cardoso, Carmen Lucia; Seidl, Claudia; Moaddel, Ruin; Cass, Quezia Bezerra

2016-01-01

Affinity-based chromatography assays encompass the use of solid supports containing immobilized biological targets to monitor binding events in the isolation , identification and/or characterization of bioactive compounds. This powerful bioanalytical technique allows the screening of potential binders through fast analyses that can be directly performed using isolated substances or complex matrices. An overview of the recent researches in frontal and zonal affinity-based chromatography screening assays, which has been used as a tool in the identification and characterization of new anti-cancer agents, is discussed. In addition, a critical evaluation of the recently emerged ligands fishing assays in complex mixtures is also discussed. PMID:27306095

Critical ligand binding reagent preparation/selection: when specificity depends on reagents.

PubMed

Rup, Bonita; O'Hara, Denise

2007-05-11

Throughout the life cycle of biopharmaceutical products, bioanalytical support is provided using ligand binding assays to measure the drug product for pharmacokinetic, pharmacodynamic, and immunogenicity studies. The specificity and selectivity of these ligand binding assays are highly dependent on the ligand binding reagents. Thus the selection, characterization, and management processes for ligand binding reagents are crucial to successful assay development and application. This report describes process considerations for selection and characterization of ligand binding reagents that are integral parts of the different phases of assay development. Changes in expression, purification, modification, and storage of the ligand binding reagents may have a profound effect on the ligand binding assay performance. Thus long-term management of the critical ligand binding assay reagents is addressed including suggested characterization criteria that allow ligand binding reagents to be used in as consistent a manner as possible. Examples of challenges related to the selection, modification, and characterization of ligand binding reagents are included.

Analysis of Ethylene Receptors: Ethylene-Binding Assays.

PubMed

Binder, Brad M; Schaller, G Eric

2017-01-01

Plant ethylene receptors bind ethylene with high affinity. Most of the characterization of ethylene binding to the receptors has been carried out using a radioligand-binding assay on functional receptors expressed in yeast. In this chapter, we describe methods for expressing ethylene receptors in yeast and conducting ethylene-binding assays on intact yeast and yeast membranes. The ethylene-binding assays can be modified to analyze ethylene binding to intact plants and other organisms as well as membranes isolated from any biological source.

Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology.

PubMed

Nakagawa, Kazuhiro; Yamamoto, Takuro; Yasuda, Akio

2010-09-15

An isothermal signal amplification technique for specific DNA sequences, known as cycling probe technology (CPT), has enabled rapid acquisition of genomic information. Here we report an analogous technique for the detection of an activated transcription factor, a transcription element-binding assay with fluorescent amplification by apurinic/apyrimidinic (AP) site lysis cycle (TEFAL). This simple amplification assay can detect activated transcription factors by using a unique nucleic acid probe containing a consensus binding sequence and an AP site, which enables the CPT reaction with AP endonuclease. In this article, we demonstrate that this method detects the functional CLOCK/BMAL1 heterodimer via the TEFAL probe containing the E-box consensus sequence to which the CLOCK/BMAL1 heterodimer binds. Using TEFAL combined with immunoassays, we measured oscillations in the amount of CLOCK/BMAL1 heterodimer in serum-stimulated HeLa cells. Furthermore, we succeeded in measuring the circadian accumulation of the functional CLOCK/BMAL1 heterodimer in human buccal mucosa cells. TEFAL contributes greatly to the study of transcription factor activation in mammalian tissues and cell extracts and is a powerful tool for less invasive investigation of human circadian rhythms. 2010 Elsevier Inc. All rights reserved.

Monoclonal antibodies to human vitamin D-binding protein.

PubMed Central

Pierce, E A; Dame, M C; Bouillon, R; Van Baelen, H; DeLuca, H F

1985-01-01

Monoclonal antibodies to vitamin D-binding protein isolated from human serum have been produced. The antibodies obtained have been shown to be specific for human vitamin D-binding protein by three independent assays. The antibodies recognize human vitamin D-binding protein specifically in an enzyme-linked immunosorbent assay. Human vitamin D-binding protein is detected specifically in both pure and crude samples by a radiometric immunosorbent assay (RISA) and by an immunoprecipitation assay. The anti-human vitamin D-binding protein antibodies cross-react with monkey and pig vitamin D-binding protein, but not with vitamin D-binding protein from rat, mouse, or chicken, as determined by the RISA and immunoprecipitation assays. Images PMID:3936035

Application of mass spectrometry technologies for the discovery of low-molecular weight modulators of enzymes and protein-protein interactions.

PubMed

Zehender, Hartmut; Mayr, Lorenz M

2007-10-01

In recent years, mass spectrometry has gained widespread use as an assay and screening technology in drug discovery because it enables sensitive, label-free detection of low-molecular weight modulators of biomolecules as well as sensitive and accurate detection of high-molecular weight modifications of biomolecules. Electrospray and matrix-assisted laser desorption ionization are the most widely used ionization techniques to identify chemical compounds interfering with enzymatic function, receptor-ligand binding or molecules modulating a protein-protein interaction of interest. Mass spectrometry based techniques are no longer restricted to screening in biochemical assay systems but have now become also applicable to imaging of biomolecules and chemical compounds in cell-based assay systems and even in highly complex tissue sections.

Visualizing repetitive diffusion activity of double-strand RNA binding proteins by single molecule fluorescence assays.

PubMed

Koh, Hye Ran; Wang, Xinlei; Myong, Sua

2016-08-01

TRBP, one of double strand RNA binding proteins (dsRBPs), is an essential cofactor of Dicer in the RNA interference pathway. Previously we reported that TRBP exhibits repetitive diffusion activity on double strand (ds)RNA in an ATP independent manner. In the TRBP-Dicer complex, the diffusion mobility of TRBP facilitates Dicer-mediated RNA cleavage. Such repetitive diffusion of dsRBPs on a nucleic acid at the nanometer scale can be appropriately captured by several single molecule detection techniques. Here, we provide a step-by-step guide to four different single molecule fluorescence assays by which the diffusion activity of dsRBPs on dsRNA can be detected. One color assay, termed protein induced fluorescence enhancement enables detection of unlabeled protein binding and diffusion on a singly labeled RNA. Two-color Fluorescence Resonance Energy Transfer (FRET) in which labeled dsRBPs is applied to labeled RNA, allows for probing the motion of protein along the RNA axis. Three color FRET reports on the diffusion movement of dsRBPs from one to the other end of RNA. The single molecule pull down assay provides an opportunity to collect dsRBPs from mammalian cells and examine the protein-RNA interaction at single molecule platform. Copyright © 2016 Elsevier Inc. All rights reserved.

Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua

2018-03-01

The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

PubMed

Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

PubMed Central

Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

2016-01-01

Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

Design and development of a field applicable gold nanosensor for the detection of luteinizing hormone.

PubMed

Zambre, Ajit; Chanda, Nripen; Prayaga, Sudhirdas; Almudhafar, Rosana; Afrasiabi, Zahra; Upendran, Anandhi; Kannan, Raghuraman

2012-11-06

In this paper, we describe a novel strategy for the fabrication of a nanosensor for detecting luteinizing hormone (LH) of sheep using a gold nanoparticle-peptide conjugate. A new peptide sequence "CDHPPLPDILFL" (leutinizing hormone peptide, LHP) has been identified, using BLAST and Clustal W analysis, to detect antibody of LH (sheep). LHP has been synthesized and characterized, and their affinity toward anti-LH was established using enzyme linked immunosorbant assay (ELISA) technique. The thiol group in LHP directly binds with gold nanoparticles (AuNPs) to yield AuNP-LHP construct. Detailed physicochemical analysis of AuNP-LHP construct was determined using various analytical techniques. Nanosensor using gold nanoparticle peptide conjugate was developed on the basis of competitive binding of AuNP-LHP and LH toward anti-LH. Nitrocellulose membrane, precoated with anti-LH, was soaked in the mixture of AuNP-LHP and sample of analysis (LH). In the absence of LH (sheep), anti-LH coated on the membrane binds with AuNP-LHP, leading to a distinctive red color, while in the presence of LH, no color appeared in the membrane due to the interaction of anti-LH with LH thereby preventing the binding of AuNP-LHP with membrane bound anti-LH. The sensor assay developed in this study can detect LH (sheep) up to a minimal concentration of ∼50 ppm with a high degree of reproducibility and selectivity. The gold-nanoparticle-peptide based nanosensor would be a simple, portable, effective, and low cost technique for infield applications.

Food sensing: selection and characterization of DNA aptamers to Alicyclobacillus spores for trapping and detection from orange juice.

PubMed

Hünniger, Tim; Fischer, Christin; Wessels, Hauke; Hoffmann, Antonia; Paschke-Kratzin, Angelika; Haase, Ilka; Fischer, Markus

2015-03-04

The quality of the beverage industry's products has to be constantly monitored to fulfill consumers' high expectations. The thermo-acidophilic Gram-positive Alicyclobacillus spp. are not pathogenic, but their heat-resistant endospores can survive juice-processing conditions and have become a major economic concern for the fruit juice industry. Current detection methods rely on cultivation, isolation, and organism identification, which can take up to a week, resulting in economic loss. This work presents the selection and identification of DNA aptamers targeting Alicyclobacillus spores by spore-SELEX (systematic evolution of ligands by exponential enrichment) in orange-juice-simulating buffer. The selection process was verified by various techniques, including flow cytometric binding assays, radioactive binding assays, and agarose gel electrophoresis. The subsequent aptamer characterization included the determination of dissociations constants and selectivity by different techniques, such as surface plasmon resonance spectroscopy and fluorescence microscopy. In summary, 10 different aptamers with an affinity to Alicyclobacillus spp. have been developed, analyzed, and characterized in terms of affinity and specificity.

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Comparison of functional assays used in the clinical development of a placental malaria vaccine.

PubMed

Pehrson, Caroline; Heno, Kristine K; Adams, Yvonne; Resende, Mafalda; Mathiesen, Line; Soegaard, Max; de Jongh, Willem A; Theander, Thor G; Salanti, Ali; Nielsen, Morten A

2017-01-23

Malaria in pregnancy is associated with significant morbidity in pregnant women and their offspring. Plasmodium falciparum infected erythrocytes (IE) express VAR2CSA that mediates binding to chondroitin sulphate A (CSA) in the placenta. Two VAR2CSA-based vaccines for placental malaria are in clinical development. The purpose of this study was to evaluate the robustness and comparability of binding inhibition assays used in the clinical development of placental malaria vaccines. The ability of sera from animals immunised with different VAR2CSA constructs to inhibit IE binding to CSA was investigated in three in vitro assays using 96-well plates, petri dishes, capillary flow and an ex vivo placental perfusion assay. The inter-assay variation was not uniform between assays and ranged from above ten-fold in the flow assay to two-fold in the perfusion assay. The intra-assay variation was highest in the petri dish assay. A positive correlation between IE binding avidity and the level of binding after antibody inhibition in the petri dish assay indicate that high avidity IE binding is more difficult to inhibit. The highest binding inhibition sensitivity was found in the 96-well and petri dish assays compared to the flow and perfusion assays where binding inhibition required higher antibody titers. The inhibitory capacity of antibodies is not easily translated between assays and the high sensitivity of the 96-well and petri dish assays stresses the need for comparing serial dilutions of serum. Furthermore, IE binding avidity must be in the same range when comparing data from different days. There was an overall concordance in the capacity of antibody-mediated inhibition, when comparing the in vitro assays with the perfusion assay, which more closely represents in vivo conditions. Importantly the ID1-ID2a protein in a liposomal formulation, currently in a phase I trial, effectively induced antibodies that inhibited IE adhesion in placental tissue. Copyright © 2016. Published by Elsevier Ltd.

Discovery of a polystyrene binding peptide isolated from phage display library and its application in peptide immobilization.

PubMed

Qiang, Xu; Sun, Keyong; Xing, Lijun; Xu, Yifeng; Wang, Hong; Zhou, Zhengpin; Zhang, Juan; Zhang, Fang; Caliskan, Bilgen; Wang, Min; Qiu, Zheng

2017-06-01

Phage peptide display is a powerful technique for discovery of various target-specific ligands. However, target-unrelated peptides can often be obtained and cause ambiguous results. Peptide PB-TUP has been isolated repeatedly in our laboratory on different targets and we conducted a research on PB-TUP phage to investigate their binding properties and rate of propagation. ELISA and phage recovery assay demonstrated that PB-TUP phage had a significant superior affinity to polystyrene solid surface compared with control phage clones. In this study, some incidental bindings are excluded like blocking agents and non-specific binding of secondary antibodies. Propagation rate assays of the selected phage clones showed that the growth rate of PB-TUP phage was not superior to the control phages. Furthermore, the binding of PB-TUB to polystyrene was concentration dependent and varied with solution pH. Molecular modeling revealed that stable structures of α-helix and β-turn may contribute to the binding of PB-TUP to polystyrene plate. The PB-TUP sequence was fused to the N-terminus of peptide P2 and the fusion peptide significantly increased the binding affinity to polystyrene. The fusion peptide also enhanced the cell adhesion ability of peptide P2 with human umbilical vein endothelial cell (HUVEC). The addition of the polystyrene binding peptide provided a convenient method for peptide immobilization.

Applications of isothermal titration calorimetry - the research and technical developments from 2011 to 2015.

PubMed

Falconer, Robert J

2016-10-01

Isothermal titration calorimetry is a widely used biophysical technique for studying the formation or dissociation of molecular complexes. Over the last 5 years, much work has been published on the interpretation of isothermal titration calorimetry (ITC) data for single binding and multiple binding sites. As over 80% of ITC papers are on macromolecules of biological origin, this interpretation is challenging. Some researchers have attempted to link the thermodynamics constants to events at the molecular level. This review highlights work carried out using binding sites characterized using x-ray crystallography techniques that allow speculation about individual bond formation and the displacement of individual water molecules during ligand binding and link these events to the thermodynamic constants for binding. The review also considers research conducted with synthetic binding partners where specific binding events like anion-π and π-π interactions were studied. The revival of assays that enable both thermodynamic and kinetic information to be collected from ITC data is highlighted. Lastly, published criticism of ITC research from a physical chemistry perspective is appraised and practical advice provided for researchers unfamiliar with thermodynamics and its interpretation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

In Situ Protein Binding Assay Using Fc-Fusion Proteins.

PubMed

Padmanabhan, Nirmala; Siddiqui, Tabrez J

2017-01-01

This protocol describes an in situ protein-protein interaction assay between tagged recombinant proteins and cell-surface expressed synaptic proteins. The assay is arguably more sensitive than other traditional protein binding assays such as co-immunoprecipitation and pull-downs and provides a visual readout for binding. This assay has been widely used to determine the dissociation constant of binding of trans-synaptic adhesion proteins. The step-wise description in the protocol should facilitate the adoption of this method in other laboratories.

A force-based, parallel assay for the quantification of protein-DNA interactions.

PubMed

Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E

2014-01-01

Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.

Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

PubMed

Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

2007-02-27

Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay.

PubMed

Lebani, Kebaneilwe; Jones, Martina L; Watterson, Daniel; Ranzoni, Andrea; Traves, Renee J; Young, Paul R; Mahler, Stephen M

2017-01-01

The multidimensional nature of dengue virus (DENV) infections, which can be caused by four distinct serotypes of the virus, complicates the sensitivity of assays designed for the diagnosis of infection. Different viral markers can be optimally detected at different stages of infection. Of particular clinical importance is the early identification of infection, which is pivotal for disease management and the development of blood screening assays. Non-structural protein 1 (NS1) is an early surrogate marker of infection and its detection in serum coincides with detectable viraemia. The aim of this work was to isolate and characterise serotype-specific monoclonal antibodies that bind to NS1 for each of the four DENV serotypes. This was achieved using phage display and a subtractive biopanning strategy to direct the antibody selection towards serotype-specific epitopes. This antibody isolation strategy has advantages over immunisation techniques where it is difficult to avoid antibody responses to cross-reactive, immunodominant epitopes. Serotype specificity to recombinant antigen for each of the antibodies was confirmed by Enzyme Linked Immunosorbent Assay (ELISA) and Surface Plasmon Resonance. Confirmation of binding to native DENV NS1 was achieved using ELISA and immunofluorescence assay on DENV infected Vero cells. No cross-reactivity with Zika or Kunjin viruses was observed. A previously isolated pan-reactive antibody that binds to an immunodominant epitope was able to pair with each of the serotype-specific antibodies in a sandwich ELISA, indicating that the serotype specific antibodies bind to epitopes which are all spatially distinct from the immunodominant epitope. These antibodies were suitable for use in a multiplexed assay for simultaneous detection and serotyping of DENV NS1 in human serum. This work demonstrates that phage display coupled with novel biopanning strategies is a valuable in vitro methodology for isolation of binders that can discern amongst antigens with high homology for diagnostic applicability.

International Validation of Two Human Recombinant Estrogen ...

EPA Pesticide Factsheets

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay using a ligand-binding domain of the human ER. Twenty three compounds were tested in 6 laboratories for the FW assay and 5 for the CERJ assay, which included three controls (used with every run), 9 uncoded, and 14 coded chemicals across 3 subtasks. The overall goal of this validation study was to demonstrate the ability of each of the two assays to reliably classify the test chemicals as binders or non-binders. Laboratories had little trouble with the ER binders that produced a full binding curve when using either the CERI or FW assays. As is typical with all ER competitive binding assays, the weak binders proved to be more challenging. However, overall results from both the FW and CERI assays were consistent and in agreement with expected classifications regardless of the form of the hrER (i.e., full length ER versus an ER ligand binding domain) or the subtle differences in the protocols for conducting each assay. The reproducibility and accuracy for classification of chemicals as potential ER binders and non- binders using the FW and CERI hrER binding assays were comparable to that of the U.S.EPA’s existing ER binding test guideline OPPTS 890.1250, while providing an improved, highe

Characterization of binding affinity of CJ-023,423 for human prostanoid EP4 receptor.

PubMed

Murase, Akio; Nakao, Kazunari; Takada, Junji

2008-01-01

In order to characterize the receptor binding pharmacology of CJ-023,423, a potent and selective EP4 antagonist, we performed a radioligand receptor binding assay under various assay conditions. An acidic (pH 6) and hypotonic buffer is a conventional, well-known buffer for prostaglandin E2 receptor binding assays. CJ-023,423 showed moderate binding affinity for human EP4 receptor under conventional buffer conditions. However, its binding affinity was greatly increased under neutral (pH 7.4) and isotonic buffer conditions. In this report, the binding mechanism between CJ-023,423 and human EP4 receptor is discussed based on the binding affinities determined under various assay conditions. Copyright 2008 S. Karger AG, Basel.

Use of a benzimidazole derivative BF-188 in fluorescence multispectral imaging for selective visualization of tau protein fibrils in the Alzheimer's disease brain.

PubMed

Harada, Ryuichi; Okamura, Nobuyuki; Furumoto, Shozo; Yoshikawa, Takeo; Arai, Hiroyuki; Yanai, Kazuhiko; Kudo, Yukitsuka

2014-02-01

Selective visualization of amyloid-β and tau protein deposits will help to understand the pathophysiology of Alzheimer's disease (AD). Here, we introduce a novel fluorescent probe that can distinguish between these two deposits by multispectral fluorescence imaging technique. Fluorescence spectral analysis was performed using AD brain sections stained with novel fluorescence compounds. Competitive binding assay using [(3)H]-PiB was performed to evaluate the binding affinity of BF-188 for synthetic amyloid-β (Aβ) and tau fibrils. In AD brain sections, BF-188 clearly stained Aβ and tau protein deposits with different fluorescence spectra. In vitro binding assays indicated that BF-188 bound to both amyloid-β and tau fibrils with high affinity (K i  < 10 nM). In addition, BF-188 showed an excellent blood-brain barrier permeability in mice. Multispectral imaging with BF-188 could potentially be used for selective in vivo imaging of tau deposits as well as amyloid-β in the brain.

Parallel Force Assay for Protein-Protein Interactions

PubMed Central

Aschenbrenner, Daniela; Pippig, Diana A.; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E.

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay. PMID:25546146

Parallel force assay for protein-protein interactions.

PubMed

Aschenbrenner, Daniela; Pippig, Diana A; Klamecka, Kamila; Limmer, Katja; Leonhardt, Heinrich; Gaub, Hermann E

2014-01-01

Quantitative proteome research is greatly promoted by high-resolution parallel format assays. A characterization of protein complexes based on binding forces offers an unparalleled dynamic range and allows for the effective discrimination of non-specific interactions. Here we present a DNA-based Molecular Force Assay to quantify protein-protein interactions, namely the bond between different variants of GFP and GFP-binding nanobodies. We present different strategies to adjust the maximum sensitivity window of the assay by influencing the binding strength of the DNA reference duplexes. The binding of the nanobody Enhancer to the different GFP constructs is compared at high sensitivity of the assay. Whereas the binding strength to wild type and enhanced GFP are equal within experimental error, stronger binding to superfolder GFP is observed. This difference in binding strength is attributed to alterations in the amino acids that form contacts according to the crystal structure of the initial wild type GFP-Enhancer complex. Moreover, we outline the potential for large-scale parallelization of the assay.

Fully Automated RNAscope In Situ Hybridization Assays for Formalin‐Fixed Paraffin‐Embedded Cells and Tissues

PubMed Central

Anderson, Courtney M.; Zhang, Bingqing; Miller, Melanie; Butko, Emerald; Wu, Xingyong; Laver, Thomas; Kernag, Casey; Kim, Jeffrey; Luo, Yuling; Lamparski, Henry; Park, Emily; Su, Nan

2016-01-01

ABSTRACT Biomarkers such as DNA, RNA, and protein are powerful tools in clinical diagnostics and therapeutic development for many diseases. Identifying RNA expression at the single cell level within the morphological context by RNA in situ hybridization provides a great deal of information on gene expression changes over conventional techniques that analyze bulk tissue, yet widespread use of this technique in the clinical setting has been hampered by the dearth of automated RNA ISH assays. Here we present an automated version of the RNA ISH technology RNAscope that is adaptable to multiple automation platforms. The automated RNAscope assay yields a high signal‐to‐noise ratio with little to no background staining and results comparable to the manual assay. In addition, the automated duplex RNAscope assay was able to detect two biomarkers simultaneously. Lastly, assay consistency and reproducibility were confirmed by quantification of TATA‐box binding protein (TBP) mRNA signals across multiple lots and multiple experiments. Taken together, the data presented in this study demonstrate that the automated RNAscope technology is a high performance RNA ISH assay with broad applicability in biomarker research and diagnostic assay development. J. Cell. Biochem. 117: 2201–2208, 2016. © 2016 The Authors. Journal of Cellular Biochemistry Published by Wiley Periodicals, Inc. PMID:27191821

Nanophotonic detection of freely interacting molecules on a single influenza virus

NASA Astrophysics Data System (ADS)

Kang, Pilgyu; Schein, Perry; Serey, Xavier; O'Dell, Dakota; Erickson, David

2015-07-01

Biomolecular interactions, such as antibody-antigen binding, are fundamental to many biological processes. At present, most techniques for analyzing these interactions require immobilizing one or both of the interacting molecules on an assay plate or a sensor surface. This is convenient experimentally but can constrain the natural binding affinity and capacity of the molecules, resulting in data that can deviate from the natural free-solution behavior. Here we demonstrate a label-free method for analyzing free-solution interactions between a single influenza virus and specific antibodies at the single particle level using near-field optical trapping and light-scattering techniques. We determine the number of specific antibodies binding to an optically trapped influenza virus by analyzing the change of the Brownian fluctuations of the virus. We develop an analytical model that determines the increased size of the virus resulting from antibodies binding to the virus membrane with uncertainty of ±1-2 nm. We present stoichiometric results of 26 ± 4 (6.8 ± 1.1 attogram) anti-influenza antibodies binding to an H1N1 influenza virus. Our technique can be applied to a wide range of molecular interactions because the nanophotonic tweezer can handle molecules from tens to thousands of nanometers in diameter.

Synthesis, characterization of α-amino acid Schiff base derived Ru/Pt complexes: Induces cytotoxicity in HepG2 cell via protein binding and ROS generation

NASA Astrophysics Data System (ADS)

Alsalme, Ali; Laeeq, Sameen; Dwivedi, Sourabh; Khan, Mohd. Shahnawaz; Al Farhan, Khalid; Musarrat, Javed; Khan, Rais Ahmad

2016-06-01

We have synthesized two new complexes of platinum (1) and ruthenium (2) with α-amino acid, L-alanine, and 2,3-dihydroxybenzaldehyde derived Schiff base (L). The ligand and both complexes were characterized by using elemental analysis and several other spectroscopic techniques viz; IR, 1H, 13C NMR, EPR, and ESI-MS. Furthermore, the protein-binding ability of synthesized complexes was monitored by UV-visible, fluorescence and circular dichroism techniques with a model protein, human serum albumin (HSA). Both the PtL2 and RuL2 complexes displayed significant binding towards HSA. Also, in vitro cytotoxicity assay for both complexes was carried out on human hepatocellular carcinoma cancer (HepG2) cell line. The results showed concentration-dependent inhibition of cell viability. Moreover, the generation of reactive oxygen species was also evaluated, and results exhibited substantial role in cytotoxicity.

Metal-Catalyzed Cleavage of tRNA[superscript Phe

ERIC Educational Resources Information Center

Kirk, Sarah R.; Silverstein, Todd P.; McFarlane Holman, Karen L.

2008-01-01

This laboratory project is one component of a semester-long advanced biochemistry laboratory course that uses several complementary techniques to study tRNA[superscript Phe] conformational changes induced by ligand binding. In this article we describe a set of experiments in which students assay metal-catalyzed hydrolysis of tRNA[superscript Phe]…

Development of an online p38α mitogen-activated protein kinase binding assay and integration of LC–HR-MS

PubMed Central

Falck, David; de Vlieger, Jon S. B.; Niessen, Wilfried M. A.; Kool, Jeroen; Honing, Maarten; Irth, Hubertus

2010-01-01

A high-resolution screening method was developed for the p38α mitogen-activated protein kinase to detect and identify small-molecule binders. Its central role in inflammatory diseases makes this enzyme a very important drug target. The setup integrates separation by high-performance liquid chromatography with two parallel detection techniques. High-resolution mass spectrometry gives structural information to identify small molecules while an online enzyme binding detection method provides data on p38α binding. The separation step allows the individual assessment of compounds in a mixture and links affinity and structure information via the retention time. Enzyme binding detection was achieved with a competitive binding assay based on fluorescence enhancement which has a simple principle, is inexpensive, and is easy to interpret. The concentrations of p38α and the fluorescence tracer SK&F86002 were optimized as well as incubation temperature, formic acid content of the LC eluents, and the material of the incubation tubing. The latter notably improved the screening of highly lipophilic compounds. For optimization and validation purposes, the known kinase inhibitors BIRB796, TAK715, and MAPKI1 were used among others. The result is a high-quality assay with Z′ factors around 0.8, which is suitable for semi-quantitative affinity measurements and applicable to various binding modes. Furthermore, the integrated approach gives affinity data on individual compounds instead of averaged ones for mixtures. Figure P38 α online screening platform Electronic supplementary material The online version of this article (doi:10.1007/s00216-010-4087-8) contains supplementary material, which is available to authorized users. PMID:20730527

Selection and identification of a DNA aptamer targeted to Vibrio parahemolyticus.

PubMed

Duan, Nuo; Wu, Shijia; Chen, Xiujuan; Huang, Yukun; Wang, Zhouping

2012-04-25

A whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX) method was applied to a combinatorial library of FAM-labeled single-stranded DNA molecules to identify DNA aptamers demonstrating specific binding to Vibrio parahemolyticus . FAM-labeled aptamer sequences with high binding affinity to V. parahemolyticus were identified by flow cytometric analysis. Aptamer A3P, which showed a particularly high binding affinity in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K(d)) of 16.88 ± 1.92 nM. Binding assays to assess the specificity of aptamer A3P showed a high binding affinity (76%) for V. parahemolyticus and a low apparent binding affinity (4%) for other bacteria. Whole-bacterium SELEX is a promising technique for the design of aptamer-based molecular probes for microbial pathogens that does not require the labor-intensive steps of isolating and purifying complex markers or targets.

Elucidation of the binding mechanism of renin using a wide array of computational techniques and biological assays.

PubMed

Tzoupis, Haralambos; Leonis, Georgios; Avramopoulos, Aggelos; Reis, Heribert; Czyżnikowska, Żaneta; Zerva, Sofia; Vergadou, Niki; Peristeras, Loukas D; Papavasileiou, Konstantinos D; Alexis, Michael N; Mavromoustakos, Thomas; Papadopoulos, Manthos G

2015-11-01

We investigate the binding mechanism in renin complexes, involving three drugs (remikiren, zankiren and enalkiren) and one lead compound, which was selected after screening the ZINC database. For this purpose, we used ab initio methods (the effective fragment potential, the variational perturbation theory, the energy decomposition analysis, the atoms-in-molecules), docking, molecular dynamics, and the MM-PBSA method. A biological assay for the lead compound has been performed to validate the theoretical findings. Importantly, binding free energy calculations for the three drug complexes are within 3 kcal/mol of the experimental values, thus further justifying our computational protocol, which has been validated through previous studies on 11 drug-protein systems. The main elements of the discovered mechanism are: (i) minor changes are induced to renin upon drug binding, (ii) the three drugs form an extensive network of hydrogen bonds with renin, whilst the lead compound presented diminished interactions, (iii) ligand binding in all complexes is driven by favorable van der Waals interactions and the nonpolar contribution to solvation, while the lead compound is associated with diminished van der Waals interactions compared to the drug-bound forms of renin, and (iv) the environment (H2O/Na(+)) has a small effect on the renin-remikiren interaction. Copyright © 2015 Elsevier Inc. All rights reserved.

Direct replacement of antibodies with molecularly imprinted polymer nanoparticles in ELISA--development of a novel assay for vancomycin.

PubMed

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J Sarah; Piletska, Elena V; De Vargas Sansalvador, Isabel M Perez; Whitcombe, Michael J; Piletsky, Sergey A

2013-09-03

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop assays similar to the enzyme-linked immunosorbent assay (ELISA) is presented here for the first time. NanoMIPs were synthesized by a solid-phase approach with an immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering, and electron microscopy. Immobilization, blocking, and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a horseradish peroxidase-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range of 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was 3 orders of magnitude better than a previously described ELISA based on antibodies. In these experiments, nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA.

Due diligence in the characterization of matrix effects in a total IL-13 Singulex™ method.

PubMed

Fraser, Stephanie; Soderstrom, Catherine

2014-04-01

After obtaining her PhD in Cellular and Molecular biology from the University of Nevada, Reno, Stephanie has spent the last 15 years in the field of bioanalysis. She has held positions in academia, biotech, contract research and large pharma where she has managed ligand binding assay (discovery to Phase IIb clinical) and flow cytometry (preclinical) laboratories as well as taken the lead on implementing new/emergent technologies. Currently Stephanie leads Pfizer's Regulated Bioanalysis Ligand Binding Assay group, focusing on early clinical biomarker support. Interleukin (IL)-13, a Th2 cytokine, drives a range of physiological responses associated with the induction of allergic airway diseases and inflammatory bowel diseases. Analysis of IL-13 as a biomarker has provided insight into its role in disease mechanisms and progression. Serum IL-13 concentrations are often too low to be measured by standard enzyme-linked immunosorbent assay techniques, necessitating the implementation of a highly sensitive assay. Previously, the validation of a Singulex™ Erenna(®) assay for the quantitation of IL-13 was reported. Herein we describe refinement of this validation; defining the impact of matrix interference on the lower limit of quantification, adding spiked matrix QC samples, and extending endogenous IL-13 stability. A fit-for-purpose validation was conducted and the assay was used to support a Phase II clinical trial.

[Binding of tylosin, tilmicosin and oxytetracycline to proteins from honeybees, larvae and beehive products].

PubMed

Reynaldi, F J; Lacunza, J; Alippi, A M; Rule, R

2010-01-01

American Foulbrood (AFB) caused by the spore-forming bacterium Paenibacillus larvae is the most serious disease of bacterial origin affecting larvae and pupae of honeybees. Antibiotics are used in many countries for the control of AFB in high incidence areas, but their misuse may lead to antibiotic resistance of bacterial strains and honey contamination. The objective of the present work was to determine, through a biological method, the protein binding of tylosin, tilmicosin and oxytetracycline to worker jelly; honey; pollen; adult bees and larvae in order to propose their kinetic routes. The sensitivity limit of the technique used was 0.05 μg/ml for tylosin and tilmicosin and 0.01 μg/ml for oxytetracycline, respectively. The method had intra and inter-assay correlation coefficients over 0.90, respectively and a coefficient variation of intra-and inter-assay for all antibiotics and processed samples under 5%. Tylosin and oxytetracycline presented lower percentages of protein binding in tissues and hive products (average 15%) in relation to those observed for tilmicosin (29%). In conclusion, tylosin is useful for AFB control in honey bee colonies due to its chemical characteristics, antimicrobial activity and levels of protein binding in bees, larvae, and beehive products.

International Validation of Two Human Recombinant Estrogen Receptor (ERa) Binding Assays

EPA Science Inventory

An international validation study has been successfully completed for 2 competitive binding assays using human recombinant ERa. Assays evaluated included the Freyberger-Wilson (FW) assay using a full length human ER, and the Chemical Evaluation and Research Institute (CERI) assay...

Direct replacement of antibodies with molecularly imprinted polymer (MIP) nanoparticles in ELISA – development of a novel assay for vancomycin

PubMed Central

Chianella, Iva; Guerreiro, Antonio; Moczko, Ewa; Caygill, J. Sarah; Piletska, Elena V.; Perez De Vargas Sansalvador, Isabel M.; Whitcombe, Michael J.; Piletsky, Sergey A.

2016-01-01

A simple and straightforward technique for coating microplate wells with molecularly imprinted polymer nanoparticles (nanoMIPs) to develop ELISA type assays is presented here for the first time. NanoMIPs were synthesized by a solid phase approach with immobilized vancomycin (template) and characterized using Biacore 3000, dynamic light scattering and electron microscopy. Immobilization, blocking and washing conditions were optimized in microplate format. The detection of vancomycin was achieved in competitive binding experiments with a HRP-vancomycin conjugate. The assay was capable of measuring vancomycin in buffer and in blood plasma within the range 0.001-70 nM with a detection limit of 0.0025 nM (2.5 pM). The sensitivity of the assay was three orders of magnitude better than a previously described ELISA based on antibodies. In these experiments nanoMIPs have shown high affinity and minimal interference from blood plasma components. Immobilized nanoMIPs were stored for 1 month at room temperature without any detrimental effects to their binding properties. The high affinity of nanoMIPs and the lack of a requirement for cold chain logistics make them an attractive alternative to traditional antibodies used in ELISA. PMID:23947402

Enhanced target-specific signal detection using an Escherichia coli lysate in multiplex microbead immunoassays with E. coli-derived recombinant antigens.

PubMed

Crestani, Sandra; Leitolis, Amanda; Lima, Lucianna Freitas Oliveira; Krieger, Marco A; Foti, Leonardo

2016-08-01

Diverse techniques have been developed to analyze antibody-mediated responses to infections. However, the most common tests, i.e., enzyme-linked immunosorbent assays, require separate reactions for each antigen and consequently necessitate large sample volumes. Luminex technology allows the detection of multiple antibodies in a single experiment, but nonspecific binding can impair the results. Therefore, we examined the use of Escherichia coli lysates to reduce nonspecific binding and improve the results of liquid microarrays based on Luminex technology. Anti-bacteria antibodies were detected in human serum samples, as evidenced by high median fluorescence intensity (MFI) in assays performed with paramagnetic microspheres coupled with E. coli lysates. Moreover, the addition of an E. coli lysate as a blocker reduced the nonspecific binding of antigens produced by E. coli in a concentration-dependent manner. Tris-HCl reduced MFI values in negative samples, but did not affect MFI for positive samples. For microspheres coupled with different antigens, an E. coli lysate blocker significantly improved the fluorescence signals from positive samples. The addition of Tris-HCl and the E. coli lysate induced antigen-specific differences in MFI. This combination of the E. coli lysate blocker and Tris-HCl yielded a statistically significant improvement in MFI in the assays for Chagas disease and hepatitis C virus samples. However, for the Treponema pallidum p47 antigen improvement in MFI was only observed for the preparation with the E. coli blocker at a concentration of 3%. In conclusion, the addition of an E. coli lysate and Tris-HCl to the microarray assay reduced the nonspecific binding of human anti-bacteria antibodies and, therefore, increased the specific MFI. Copyright © 2016 Elsevier B.V. All rights reserved.

Adaptive Focused Acoustics (AFA) Improves the Performance of Microtiter Plate ELISAs.

PubMed

Green, David J; Rudd, Edwin A; Laugharn, James A

2014-08-01

We investigated the use of Adaptive Focused Acoustics (AFA) technology to improve the performance of microtiter plate enzyme-linked immunosorbent assays (ELISAs). Experiments were performed with commercially available AFA instrumentation and off-the-shelf 96-well microtiter plate sandwich ELISAs. AFA was applied over a range of acoustic energies, temperatures, and durations to the antigen/antibody binding step of an ELISA for measuring HIV-1 p24 in tissue culture samples. AFA-mediated antigen/antibody binding was enhanced up to 2-fold over passive binding at comparable temperatures and was superior or comparable at low temperature (8-10 °C) to passive binding at 37 °C. Lower nonspecific binding (NSB), lower inter- and intra-assay coefficients of variation (CVs), higher Z' factors, and lower limits of detection (LODs) were measured in AFA-mediated assays compared with conventional passive binding. In a more limited study, AFA enhancement of antigen/antibody binding and lower NSB was measured in an ELISA for measuring IGFBP-3 in human plasma. We conclude from this study that application of AFA to antigen/antibody binding steps in microtiter plate ELISAs can enhance key assay performance parameters, particularly Z' factors and LODs. These features render AFA-mediated binding assays potentially more useful in applications such as high-throughput screening and in vitro diagnostics than assays processed with conventional passive antigen/antibody binding steps. © 2014 Society for Laboratory Automation and Screening.

Characterization of ELISA Antibody-Antigen Interaction using Footprinting-Mass Spectrometry and Negative Staining Transmission Electron Microscopy

NASA Astrophysics Data System (ADS)

Lin, Margaret; Krawitz, Denise; Callahan, Matthew D.; Deperalta, Galahad; Wecksler, Aaron T.

2018-05-01

We describe epitope mapping data using multiple covalent labeling footprinting-mass spectrometry (MS) techniques coupled with negative stain transmission electron microscopy (TEM) data to analyze the antibody-antigen interactions in a sandwich enzyme-linked immunosorbant assay (ELISA). Our hydroxyl radical footprinting-MS data using fast photochemical oxidation of proteins (FPOP) indicates suppression of labeling across the antigen upon binding either of the monoclonal antibodies (mAbs) utilized in the ELISA. Combining these data with Western blot analysis enabled the identification of the putative epitopes that appeared to span regions containing N-linked glycans. An additional structural mapping technique, carboxyl group footprinting-mass spectrometry using glycine ethyl ester (GEE) labeling, was used to confirm the epitopes. Deglycosylation of the antigen resulted in loss of potency in the ELISA, supporting the FPOP and GEE labeling data by indicating N-linked glycans are necessary for antigen binding. Finally, mapping of the epitopes onto the antigen crystal structure revealed an approximate 90° relative spatial orientation, optimal for a noncompetitive binding ELISA. TEM data shows both linear and diamond antibody-antigen complexes with a similar binding orientation as predicted from the two footprinting-MS techniques. This study is the first of its kind to utilize multiple bottom-up footprinting-MS techniques and TEM visualization to characterize the monoclonal antibody-antigen binding interactions of critical reagents used in a quality control (QC) lot-release ELISA. [Figure not available: see fulltext.

Characterization of ELISA Antibody-Antigen Interaction using Footprinting-Mass Spectrometry and Negative Staining Transmission Electron Microscopy.

PubMed

Lin, Margaret; Krawitz, Denise; Callahan, Matthew D; Deperalta, Galahad; Wecksler, Aaron T

2018-05-01

We describe epitope mapping data using multiple covalent labeling footprinting-mass spectrometry (MS) techniques coupled with negative stain transmission electron microscopy (TEM) data to analyze the antibody-antigen interactions in a sandwich enzyme-linked immunosorbant assay (ELISA). Our hydroxyl radical footprinting-MS data using fast photochemical oxidation of proteins (FPOP) indicates suppression of labeling across the antigen upon binding either of the monoclonal antibodies (mAbs) utilized in the ELISA. Combining these data with Western blot analysis enabled the identification of the putative epitopes that appeared to span regions containing N-linked glycans. An additional structural mapping technique, carboxyl group footprinting-mass spectrometry using glycine ethyl ester (GEE) labeling, was used to confirm the epitopes. Deglycosylation of the antigen resulted in loss of potency in the ELISA, supporting the FPOP and GEE labeling data by indicating N-linked glycans are necessary for antigen binding. Finally, mapping of the epitopes onto the antigen crystal structure revealed an approximate 90° relative spatial orientation, optimal for a noncompetitive binding ELISA. TEM data shows both linear and diamond antibody-antigen complexes with a similar binding orientation as predicted from the two footprinting-MS techniques. This study is the first of its kind to utilize multiple bottom-up footprinting-MS techniques and TEM visualization to characterize the monoclonal antibody-antigen binding interactions of critical reagents used in a quality control (QC) lot-release ELISA. Graphical Abstract ᅟ.

Characterization of ELISA Antibody-Antigen Interaction using Footprinting-Mass Spectrometry and Negative Staining Transmission Electron Microscopy

NASA Astrophysics Data System (ADS)

Lin, Margaret; Krawitz, Denise; Callahan, Matthew D.; Deperalta, Galahad; Wecksler, Aaron T.

2018-03-01

We describe epitope mapping data using multiple covalent labeling footprinting-mass spectrometry (MS) techniques coupled with negative stain transmission electron microscopy (TEM) data to analyze the antibody-antigen interactions in a sandwich enzyme-linked immunosorbant assay (ELISA). Our hydroxyl radical footprinting-MS data using fast photochemical oxidation of proteins (FPOP) indicates suppression of labeling across the antigen upon binding either of the monoclonal antibodies (mAbs) utilized in the ELISA. Combining these data with Western blot analysis enabled the identification of the putative epitopes that appeared to span regions containing N-linked glycans. An additional structural mapping technique, carboxyl group footprinting-mass spectrometry using glycine ethyl ester (GEE) labeling, was used to confirm the epitopes. Deglycosylation of the antigen resulted in loss of potency in the ELISA, supporting the FPOP and GEE labeling data by indicating N-linked glycans are necessary for antigen binding. Finally, mapping of the epitopes onto the antigen crystal structure revealed an approximate 90° relative spatial orientation, optimal for a noncompetitive binding ELISA. TEM data shows both linear and diamond antibody-antigen complexes with a similar binding orientation as predicted from the two footprinting-MS techniques. This study is the first of its kind to utilize multiple bottom-up footprinting-MS techniques and TEM visualization to characterize the monoclonal antibody-antigen binding interactions of critical reagents used in a quality control (QC) lot-release ELISA. [Figure not available: see fulltext.

Integrated Summary Report: Validation of Two Binding Assays ...

EPA Pesticide Factsheets

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (hrERα), to identify chemicals that may impact estrogen signaling through binding to the ER. The purpose of the ISR is to support the peer review of the findings obtained during the validation process.The two assays evaluated during this validation process are: The Freyberger-Wilson Assay (FW) using a full length human ER, and The Chemical Evaluation and Research Institute (CERI) Assay using a ligand-binding domain of the human ER.The two assays are mechanistically and functionally similar in that each measures the ability of a test chemical to competitively inhibit binding of [3H]17β-estradiol to the human recombinant ER. The essential elements of the FW and the CERI assays were developed at the laboratories of Bayer Pharma AG, Wuppertal, Germany (Freyberger et al., 2010) and CERI, Tokyo, Japan (Akahori et al., 2008), respectively.The ER competitive binding assay has long been in use, and is a well characterized approach, but historically uses rodent or other animal tissues as a source of the ER. Validation of the FW and CERI assays using human recombinant estrogen receptors ( subtype) will provide an updated alternative for the Agency’s current test guideline (OPPTS 89

Total protein measurement in canine cerebrospinal fluid: agreement between a turbidimetric assay and 2 dye-binding methods and determination of reference intervals using an indirect a posteriori method.

PubMed

Riond, B; Steffen, F; Schmied, O; Hofmann-Lehmann, R; Lutz, H

2014-03-01

In veterinary clinical laboratories, qualitative tests for total protein measurement in canine cerebrospinal fluid (CSF) have been replaced by quantitative methods, which can be divided into dye-binding assays and turbidimetric methods. There is a lack of validation data and reference intervals (RIs) for these assays. The aim of the present study was to assess agreement between the turbidimetric benzethonium chloride method and 2 dye-binding methods (Pyrogallol Red-Molybdate method [PRM], Coomassie Brilliant Blue [CBB] technique) for measurement of total protein concentration in canine CSF. Furthermore, RIs were determined for all 3 methods using an indirect a posteriori method. For assay comparison, a total of 118 canine CSF specimens were analyzed. For RIs calculation, clinical records of 401 canine patients with normal CSF analysis were studied and classified according to their final diagnosis in pathologic and nonpathologic values. The turbidimetric assay showed excellent agreement with the PRM assay (mean bias 0.003 g/L [-0.26-0.27]). The CBB method generally showed higher total protein values than the turbidimetric assay and the PRM assay (mean bias -0.14 g/L for turbidimetric and PRM assay). From 90 of 401 canine patients, nonparametric reference intervals (2.5%, 97.5% quantile) were calculated (turbidimetric assay and PRM method: 0.08-0.35 g/L (90% CI: 0.07-0.08/0.33-0.39); CBB method: 0.17-0.55 g/L (90% CI: 0.16-0.18/0.52-0.61). Total protein concentration in canine CSF specimens remained stable for up to 6 months of storage at -80°C. Due to variations among methods, RIs for total protein concentration in canine CSF have to be calculated for each method. The a posteriori method of RIs calculation described here should encourage other veterinary laboratories to establish RIs that are laboratory-specific. ©2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.

[AntiEGFRnano inhibites proliferation and migration of estrogen-dependent Ishikawa cells of human endometrial cancer cell line].

PubMed

Diao, Zhen-yu; Lu, Wu-guang; Cao, Peng; Hu, Yun-long; Zhou, Xing; Xue, Ping-ping; Shen, Li; Sun, Hai-xiang

2012-10-01

Nanobody is a kind of antibody from camel, which misses light chain. Nanobody has the same antigen binding specificity and affinity as mAb. Moreover, because of its small molecular weight, high stability and easy preparation, nanobody has great value of biomedical applications. In this study, we successfully prepared highly pure antiEGFR nanobody in E.coli using genetic engineering techniques. Cell proliferation assay (CCK-8 assay) and migration experiments (cell scratch test and Transwell assay) indicated that the recombinant antiEGFRnano can significantly inhibit the proliferation and migration of endometrial cancer cells. These results provide a new way of thinking and methods for EGFR-targeted therapy of endometrial cancer.

Advances in conservation endocrinology: the application of molecular approaches to the conservation of endangered species.

PubMed

Tubbs, Christopher; McDonough, Caitlin E; Felton, Rachel; Milnes, Matthew R

2014-07-01

Among the numerous societal benefits of comparative endocrinology is the application of our collective knowledge of hormone signaling towards the conservation of threatened and endangered species - conservation endocrinology. For several decades endocrinologists have used longitudinal hormone profiles to monitor reproductive status in a multitude of species. Knowledge of reproductive status among individuals has been used to assist in the management of captive and free-ranging populations. More recently, researchers have begun utilizing molecular and cell-based techniques to gain a more complete understanding of hormone signaling in wildlife species, and to identify potential causes of disrupted hormone signaling. In this review we examine various in vitro approaches we have used to compare estrogen receptor binding and activation by endogenous hormones and phytoestrogens in two species of rhinoceros; southern white and greater one-horned. We have found many of these techniques valuable and practical in species where access to research subjects and/or tissues is limited due to their conservation status. From cell-free, competitive binding assays to full-length receptor activation assays; each technique has strengths and weaknesses related to cost, sensitivity, complexity of the protocols, and relevance to in vivo signaling. We then present a novel approach, in which receptor activation assays are performed in primary cell lines derived from the species of interest, to minimize the artifacts of traditional heterologous expression systems. Finally, we speculate on the promise of next generation sequencing and transcriptome profiling as tools for characterizing hormone signaling in threatened and endangered species. Copyright © 2014 Elsevier Inc. All rights reserved.

Detection of biotin in individual sea urchin oocytes using a bioluminescence binding assay.

PubMed

Feltus, A; Grosvenor, A L; Conover, R C; Anderson, K W; Daunert, S

2001-04-01

The ability to detect biomolecules in single cells is important in order to fully understand the processes by which many biochemical events occur. To that end, we have developed a bioluminescence binding assay capable of measuring the intracellular biotin content of individual cells. The assay depends on competition between an aequorin-biotin conjugate (AEQ-biotin) and free biotin within the oocytes for binding sites on the protein avidin. The assay is performed by microinjecting each component into the oocytes and following the resulting bioluminescence within the oocyte upon triggering of aequorin. Results obtained using sea urchin oocytes show that the assay performed within the cells behaves in a manner consistent with assay theory. Using the assay, the individual biotin content of the oocytes is an average of approximately 20 amol. To our knowledge, this is the first reported multicomponent binding assay to be performed inside an intact single cell.

Interactions of cisplatin analogues with lysozyme: a comparative analysis.

PubMed

Ferraro, Giarita; De Benedictis, Ilaria; Malfitano, Annamaria; Morelli, Giancarlo; Novellino, Ettore; Marasco, Daniela

2017-10-01

The biophysical characterization of drug binding to proteins plays a key role in structural biology and in the discovery and optimization of drug discovery processes. The search for optimal combinations of biophysical techniques that can correctly and efficiently identify and quantify binding of metal-based drugs to their final target is challenging, due to the physicochemical properties of these agents. Different cisplatin derivatives have shown different citotoxicities in most common cancer lines, suggesting that they exert their biological activity via different mechanisms of action. Here we carried out a comparative analysis, by studying the behaviours of three Pt-compounds under the same experimental conditions and binding assays to properly deepen the determinants of the different MAOs. Indeed we compared the results obtained using surface plasmon resonance, isothermal titration calorimetry, fluorescence spectroscopy and thermal shift assays based on circular dichroism experiments in the characterization of the formation of adducts obtained upon reaction of cisplatin, carboplatin and iodinated analogue of cisplatin, cis-Pt (NH 3 ) 2 I 2 , with the model protein hen egg white lysozyme, both at neutral and acid pHs. Further we reasoned on the applicability of employed techniques for the study the thermodynamics and kinetics of the reaction of a metallodrug with a protein and to reveal which information can be obtained using a combination of these analyses. Data were discussed on the light of the existing structural data collected on the platinated protein.

Plasmonic imaging of protein interactions with single bacterial cells.

PubMed

Syal, Karan; Wang, Wei; Shan, Xiaonan; Wang, Shaopeng; Chen, Hong-Yuan; Tao, Nongjian

2015-01-15

Quantifying the interactions of bacteria with external ligands is fundamental to the understanding of pathogenesis, antibiotic resistance, immune evasion, and mechanism of antimicrobial action. Due to inherent cell-to-cell heterogeneity in a microbial population, each bacterium interacts differently with its environment. This large variability is washed out in bulk assays, and there is a need of techniques that can quantify interactions of bacteria with ligands at the single bacterium level. In this work, we present a label-free and real-time plasmonic imaging technique to measure the binding kinetics of ligand interactions with single bacteria, and perform statistical analysis of the heterogeneity. Using the technique, we have studied interactions of antibodies with single Escherichia coli O157:H7 cells and demonstrated a capability of determining the binding kinetic constants of single live bacteria with ligands, and quantify heterogeneity in a microbial population. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of binding assays in microfabricated picoliter vials: an assay for biotin.

PubMed

Grosvenor, A L; Feltus, A; Conover, R C; Daunert, S; Anderson, K W

2000-06-01

A homogeneous binding assay for the detection of biotin in picoliter vials was developed using the photoprotein aequorin as the label. The binding assay was based on the competition of free biotin with biotinylated aequorin (AEQ-biotin) for avidin. A sequential protocol was used, and modification of the assay to reduce the number of steps was examined. Results showed that detection limits on the order of 10(-14) mol of biotin were possible. Reducing the number of steps provided similar detection limits but only if the amount of avidin used was decreased. These binding assays based on picoliter volumes have potential applications in a variety of fields, including microanalysis and single-cell analysis, where the amount of sample is limited. In addition, these assays are suitable for the high-throughput screening of biopharmaceuticals.

Impact of SPR biosensor assay configuration on antibody: Neonatal Fc receptor binding data

PubMed Central

Wang, Xiangdan; McKay, Patrick; Dutina, George; Hass, Philip E.; Nijem, Ihsan; Allison, David; Cowan, Kyra J.; Lin, Kevin; Quarmby, Valerie; Yang, Jihong

2017-01-01

ABSTRACT Binding interactions with the neonatal Fc receptor (FcRn) are one determinant of pharmacokinetic properties of recombinant human monoclonal antibody (rhumAb) therapeutics, and a conserved binding motif in the crystallizable fragment (Fc) region of IgG molecules interacts with FcRn. Surface plasmon resonance (SPR) biosensor assays are often used to characterize interactions between FcRn and rhumAb therapeutics. In such assays, generally either the rhumAb (format 1) or the FcRn protein (format 2) is immobilized on a biosensor chip. However, because evidence suggests that, in some cases, the variable domains of a rhumAb may also affect FcRn binding, we evaluated the effect of SPR assay configuration on binding data. We sought to assess FcRn binding properties of 2 rhumAbs (rhumAb1 and rhumAb2) to FcRn proteins using these 2 biosensor assay formats. The two rhumAbs have greater than 99% sequence identity in the Fc domain but differ in their Fab regions. rhumAb2 contains a positively charged patch in the variable domain that is absent in rhumAb1. Our results showed that binding of rhumAb1 to FcRn was independent of biosensor assay configuration, while binding of rhumAb2 to FcRn was highly SPR assay configuration dependent. Further investigations revealed that the format dependency of rhumAb2-FcRn binding is linked to the basic residues that form a positively charged patch in the variable domain of rhumAb2. Our work highlights the importance of analyzing rhumAb-FcRn binding interactions using 2 alternate SPR biosensor assay configurations. This approach may also provide a simple way to identify the potential for non-Fc-driven FcRn binding interactions in otherwise typical IgGs. PMID:28001487

Online immunoaffinity LC/MS/MS. A general method to increase sensitivity and specificity: How do you do it and what do you need?

PubMed

Dufield, Dawn R; Radabaugh, Melissa R

2012-02-01

There is an increased emphasis on hyphenated techniques such as immunoaffinity LC/MS/MS (IA-LC/MS/MS) or IA-LC/MRM. These techniques offer competitive advantages with respect to sensitivity and selectivity over traditional LC/MS and are complementary to ligand binding assays (LBA) or ELISA's. However, these techniques are not entirely straightforward and there are several tips and tricks to routine sample analysis. We describe here our methods and procedures for how to perform online IA-LC/MS/MS including a detailed protocol for the preparation of antibody (Ab) enrichment columns. We have included sample trapping and Ab methods. Furthermore, we highlight tips, tricks, minimal and optimal approaches. This technology has been shown to be viable for several applications, species and fluids from small molecules to proteins and biomarkers to PK assays. Copyright © 2011 Elsevier Inc. All rights reserved.

Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.

PubMed

Hu, Xiaotang; Li, Hongbin

2014-10-01

Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

A novel assay reveals preferential binding between Rabs, kinesins, and specific endosomal subpopulations

PubMed Central

Bentley, Marvin; Decker, Helena; Luisi, Julie

2015-01-01

Identifying the proteins that regulate vesicle trafficking is a fundamental problem in cell biology. In this paper, we introduce a new assay that involves the expression of an FKBP12-rapamycin–binding domain–tagged candidate vesicle-binding protein, which can be inducibly linked to dynein or kinesin. Vesicles can be labeled by any convenient method. If the candidate protein binds the labeled vesicles, addition of the linker drug results in a predictable, highly distinctive change in vesicle localization. This assay generates robust and easily interpretable results that provide direct experimental evidence of binding between a candidate protein and the vesicle population of interest. We used this approach to compare the binding of Kinesin-3 family members with different endosomal populations. We found that KIF13A and KIF13B bind preferentially to early endosomes and that KIF1A and KIF1Bβ bind preferentially to late endosomes and lysosomes. This assay may have broad utility for identifying the trafficking proteins that bind to different vesicle populations. PMID:25624392

One Question, Multiple Answers: Biochemical and Biophysical Screening Methods Retrieve Deviating Fragment Hit Lists.

PubMed

Schiebel, Johannes; Radeva, Nedyalka; Köster, Helene; Metz, Alexander; Krotzky, Timo; Kuhnert, Maren; Diederich, Wibke E; Heine, Andreas; Neumann, Lars; Atmanene, Cedric; Roecklin, Dominique; Vivat-Hannah, Valérie; Renaud, Jean-Paul; Meinecke, Robert; Schlinck, Nina; Sitte, Astrid; Popp, Franziska; Zeeb, Markus; Klebe, Gerhard

2015-09-01

Fragment-based lead discovery is gaining momentum in drug development. Typically, a hierarchical cascade of several screening techniques is consulted to identify fragment hits which are then analyzed by crystallography. Because crystal structures with bound fragments are essential for the subsequent hit-to-lead-to-drug optimization, the screening process should distinguish reliably between binders and non-binders. We therefore investigated whether different screening methods would reveal similar collections of putative binders. First we used a biochemical assay to identify fragments that bind to endothiapepsin, a surrogate for disease-relevant aspartic proteases. In a comprehensive screening approach, we then evaluated our 361-entry library by using a reporter-displacement assay, saturation-transfer difference NMR, native mass spectrometry, thermophoresis, and a thermal shift assay. While the combined results of these screening methods retrieve 10 of the 11 crystal structures originally predicted by the biochemical assay, the mutual overlap of individual hit lists is surprisingly low, highlighting that each technique operates on different biophysical principles and conditions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Label-Free, LC-MS-Based Assays to Quantitate Small-Molecule Antagonist Binding to the Mammalian BLT1 Receptor.

PubMed

Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W

2017-08-01

We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.

LC-MS/MS quantification of next-generation biotherapeutics: a case study for an IgE binding Nanobody in cynomolgus monkey plasma.

PubMed

Sandra, Koen; Mortier, Kjell; Jorge, Lucie; Perez, Luis C; Sandra, Pat; Priem, Sofie; Poelmans, Sofie; Bouche, Marie-Paule

2014-05-01

Nanobodies(®) are therapeutic proteins derived from the smallest functional fragments of heavy chain-only antibodies. The development and validation of an LC-MS/MS-based method for the quantification of an IgE binding Nanobody in cynomolgus monkey plasma is presented. Nanobody quantification was performed making use of a proteotypic tryptic peptide chromatographically enriched prior to LC-MS/MS analysis. The validated LLOQ at 36 ng/ml was measured with an intra- and inter-assay precision and accuracy <20%. The required sensitivity could be obtained based on the selectivity of 2D LC combined with MS/MS. No analyte specific tools for affinity purification were used. Plasma samples originating from a PK/PD study were analyzed and compared with the results obtained with a traditional ligand-binding assay. Excellent correlations between the two techniques were obtained, and similar PK parameters were estimated. A 2D LC-MS/MS method was successfully developed and validated for the quantification of a next generation biotherapeutic.

Determination of the biotin content of select foods using accurate and sensitive HPLC/avidin binding

PubMed Central

Staggs, C.G.; Sealey, W.M.; McCabe, B.J.; Teague, A.M.; Mock, D.M.

2006-01-01

Assessing dietary biotin content, biotin bioavailability, and resulting biotin status are crucial in determining whether biotin deficiency is teratogenic in humans. Accuracy in estimating dietary biotin is limited both by data gaps in food composition tables and by inaccuracies in published data. The present study applied sensitive and specific analytical techniques to determine values for biotin content in a select group of foods. Total biotin content of 87 foods was determined using acid hydrolysis and the HPLC/avidin-binding assay. These values are consistent with published values in that meat, fish, poultry, egg, dairy, and some vegetables are relatively rich sources of biotin. However, these biotin values disagreed substantially with published values for many foods. Assay values varied between 247 times greater than published values for a given food to as much as 36% less than the published biotin value. Among 51 foods assayed for which published values were available, only seven agreed within analytical variability (720%). We conclude that published values for biotin content of foods are likely to be inaccurate. PMID:16648879

Online assay of bone specific alkaline phosphatase with a flow injection-bead injection system.

PubMed

Hartwell, Supaporn Kradtap; Somprayoon, Duangporn; Kongtawelert, Prachya; Ongchai, Siriwan; Arppornchayanon, Olarn; Ganranoo, Lucksagoon; Lapanantnoppakhun, Somchai; Grudpan, Kate

2007-09-26

Alkaline phosphatase (ALP) has been used as one of the biomarkers for bone resorption and liver diseases. Normally, total alkaline phosphatase is quantified along with other symptoms to determine the releasing source of the alkaline phosphatase. A semi-automated flow injection-bead injection system was proposed to conveniently and selectively assay bone alkaline phosphatase (BALP) based on its specific binding to wheat germ coated beads. Amount of BALP in serum was determined from the intensity of the yellow product produced from bound BALP on the retained beads and its substrate pNPP. The used beads were discarded and the fresh ones were introduced for the next analysis. The reaction cell was designed to be opened and closed using a computer controlled solenoid valve for a precise incubation time. The performance of the proposed system was evaluated by using it to assay BALP in human serum. The results were compared to those obtained by using a commercial ELISA kit. The system is proposed to be an easy and cost effective system for quantification of BALP as an alternative to batch wise wheat germ specific binding technique.

The influence of different techniques in characterizing human antibodies to cow's milk proteins

PubMed Central

McCaffery, T. D.; Kraft, S. C.; Rothberg, R. M.

1972-01-01

Sera from 760 subjects with and without inflammatory bowel disease (IBD) were studied selectively using both primary and secondary antibody assay techniques and different cow's milk antigens. Techniques which demonstrate antibody–antigen binding revealed that the incidence, amount and immunoglobulin class of detectable antibody to bovine serum albumin (BSA) were not significantly different among IBD and control subjects. Only 13 of the 138 sera with the most anti-BSA by primary binding techniques had the capacity to precipitate spontaneously either BSA or antigens in raw (RSM) and pasteurized (PSM) skimmed milk. In passive haemagglutination studies, 41% of these 138 sera had the capacity to agglutinate BSA-coated erythrocytes, while the respective figures for RSM and PSM were 56% and 77%. Only in studies employing the passive haemagglutination of RSM-coated erythrocytes were high titres found more frequently in sera from patients with IBD than in sera from control subjects. Taken as a whole, this study fails to provide evidence for the pathogenetic significance of milk antibodies in IBD. PMID:4625158

Predicting changes in cardiac myocyte contractility during early drug discovery with in vitro assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morton, M.J., E-mail: michael.morton@astrazeneca.com; Armstrong, D.; Abi Gerges, N.

2014-09-01

Cardiovascular-related adverse drug effects are a major concern for the pharmaceutical industry. Activity of an investigational drug at the L-type calcium channel could manifest in a number of ways, including changes in cardiac contractility. The aim of this study was to define which of the two assay technologies – radioligand-binding or automated electrophysiology – was most predictive of contractility effects in an in vitro myocyte contractility assay. The activity of reference and proprietary compounds at the L-type calcium channel was measured by radioligand-binding assays, conventional patch-clamp, automated electrophysiology, and by measurement of contractility in canine isolated cardiac myocytes. Activity inmore » the radioligand-binding assay at the L-type Ca channel phenylalkylamine binding site was most predictive of an inotropic effect in the canine cardiac myocyte assay. The sensitivity was 73%, specificity 83% and predictivity 78%. The radioligand-binding assay may be run at a single test concentration and potency estimated. The least predictive assay was automated electrophysiology which showed a significant bias when compared with other assay formats. Given the importance of the L-type calcium channel, not just in cardiac function, but also in other organ systems, a screening strategy emerges whereby single concentration ligand-binding can be performed early in the discovery process with sufficient predictivity, throughput and turnaround time to influence chemical design and address a significant safety-related liability, at relatively low cost. - Highlights: • The L-type calcium channel is a significant safety liability during drug discovery. • Radioligand-binding to the L-type calcium channel can be measured in vitro. • The assay can be run at a single test concentration as part of a screening cascade. • This measurement is highly predictive of changes in cardiac myocyte contractility.« less

Synthesis and characterization of time-resolved fluorescence probes for evaluation of competitive binding to melanocortin receptors.

PubMed

Alleti, Ramesh; Vagner, Josef; Dehigaspitiya, Dilani Chathurika; Moberg, Valerie E; Elshan, N G R D; Tafreshi, Narges K; Brabez, Nabila; Weber, Craig S; Lynch, Ronald M; Hruby, Victor J; Gillies, Robert J; Morse, David L; Mash, Eugene A

2013-09-01

Probes for use in time-resolved fluorescence competitive binding assays at melanocortin receptors based on the parental ligands MSH(4), MSH(7), and NDP-α-MSH were prepared by solid phase synthesis methods, purified, and characterized. The saturation binding of these probes was studied using HEK-293 cells engineered to overexpress the human melanocortin 4 receptor (hMC4R) as well as the human cholecystokinin 2 receptor (hCCK2R). The ratios of non-specific binding to total binding approached unity at high concentrations for each probe. At low probe concentrations, receptor-mediated binding and uptake was discernable, and so probe concentrations were kept as low as possible in determining Kd values. The Eu-DTPA-PEGO-MSH(4) probe exhibited low specific binding relative to non-specific binding, even at low nanomolar concentrations, and was deemed unsuitable for use in competition binding assays. The Eu-DTPA-PEGO probes based on MSH(7) and NDP-α-MSH exhibited Kd values of 27±3.9nM and 4.2±0.48nM, respectively, for binding with hMC4R. These probes were employed in competitive binding assays to characterize the interactions of hMC4R with monovalent and divalent MSH(4), MSH(7), and NDP-α-MSH constructs derived from squalene. Results from assays with both probes reflected only statistical enhancements, suggesting improper ligand spacing on the squalene scaffold for the divalent constructs. The Ki values from competitive binding assays that employed the MSH(7)-based probe were generally lower than the Ki values obtained when the probe based on NDP-α-MSH was employed, which is consistent with the greater potency of the latter probe. The probe based on MSH(7) was also competed with monovalent, divalent, and trivalent MSH(4) constructs that previously demonstrated multivalent binding in competitive binding assays against a variant of the probe based on NDP-α-MSH. Results from these assays confirm multivalent binding, but suggest a more modest increase in avidity for these MSH(4) constructs than was previously reported. Copyright © 2013 Elsevier Ltd. All rights reserved.

Direct /sup 125/I-radioligand assays for serum progesterone compared with assays involving extraction of serum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ratcliffe, W.A.; Corrie, J.E.; Dalziel, A.H.

1982-06-01

Researchers compared two direct radioimmunoassays for progesterone in 50 microL of unextracted serum or plasma with assays involving extraction of serum. The direct assays include the use of either danazol at pH 7.4 or 8-anilino-1-naphthalenesulfonic acid at pH 4.0 to displace progesterone from serum binding-proteins. Progesterone is then assayed by using an antiserum to a progesterone 11 alpha hemisuccinyl conjugate and the radioligand /sup 125/I-labeled progesterone 11 alpha-glucuronyl tyramine, with separation by double-antibody techniques. Direct assays with either displacing agent gave good analytical recovery of progesterone added to human serum, and progesterone values for patients' specimens correlated well (r greatermore » than 0.96) with results of assays involving extraction of serum. Precision was similar with each displacing agent over the working range 2.5-100 nmol/L and superior to that of extraction assays. Researchers conclude that these direct assays of progesterone are analytically valid and more robust, precise, and technically convenient than many conventional methods involving extraction of serum.« less

Direct /sup 125/I-radioligand assays for serum progesterone compared with assays involving extraction of serum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ratcliffe, W.A.; Corrie, J.E.T.; Dalziel, A.H.

1982-06-01

Two direct radioimmunoassays for progesterone in 50 ..mu..L of unextracted serum or plasma with assays involving extraction of serum were compared. The direct assays include the use of either danazol at pH 7.4 or 8-anilino-1-naphthalenesulfonic acid at pH 4.0 to displace progesterone from serum binding-proteins. Progesterone is then assayed by using an antiserum to a progesterone 11..cap alpha..-hemisuccinyl conjugate and the radioligand /sup 125/I-labeled progesterone 11..cap alpha..-glucuronyl tyramine, with separation by double-antibody techniques. Direct assays with either displacing agent gave good analytical recovery of progesterone added to human serum, and progesterone values for patients' specimens correlated well (r > 0.96)more » with results of assays involving extraction of serum. Precision was similar with each displacing agent over the working range 2.5-100 nmol/L and superior to that of extraction assays. We conclude that these direct assays of progesterone are analytically valid and more robust, precise, and technically convenient than many conventional methods involving extraction of serum.« less

Competition-based cellular peptide binding assays for 13 prevalent HLA class I alleles using fluorescein-labeled synthetic peptides.

PubMed

Kessler, Jan H; Mommaas, Bregje; Mutis, Tuna; Huijbers, Ivo; Vissers, Debby; Benckhuijsen, Willemien E; Schreuder, Geziena M Th; Offringa, Rienk; Goulmy, Els; Melief, Cornelis J M; van der Burg, Sjoerd H; Drijfhout, Jan W

2003-02-01

We report the development, validation, and application of competition-based peptide binding assays for 13 prevalent human leukocyte antigen (HLA) class I alleles. The assays are based on peptide binding to HLA molecules on living cells carrying the particular allele. Competition for binding between the test peptide of interest and a fluorescein-labeled HLA class I binding peptide is used as read out. The use of cell membrane-bound HLA class I molecules circumvents the need for laborious biochemical purification of these molecules in soluble form. Previously, we have applied this principle for HLA-A2 and HLA-A3. We now describe the assays for HLA-A1, HLA-A11, HLA-A24, HLA-A68, HLA-B7, HLA-B8, HLA-B14, HLA-B35, HLA-B60, HLA-B61, and HLA-B62. Together with HLA-A2 and HLA-A3, these alleles cover more than 95% of the Caucasian population. Several allele-specific parameters were determined for each assay. Using these assays, we identified novel HLA class I high-affinity binding peptides from HIVpol, p53, PRAME, and minor histocompatibility antigen HA-1. Thus these convenient and accurate peptide-binding assays will be useful for the identification of putative cytotoxic T lymphocyte epitopes presented on a diverse array of HLA class I molecules.

Quantitatively and Kinetically Identifying Binding Motifs of Amelogenin Proteins to Mineral Crystals Through Biochemical and Spectroscopic Assays

PubMed Central

Zhu, Li; Hwang, Peter; Witkowska, H. Ewa; Liu, Haichuan; Li, Wu

2014-01-01

Tooth enamel is the hardest tissue in vertebrate animals. Consisting of millions of carbonated hydroxyapatite crystals, this highly mineralized tissue develops from a protein matrix in which amelogenin is the predominant component. The enamel matrix proteins are eventually and completely degraded and removed by proteinases to form mineral-enriched tooth enamel. Identification of the apatite-binding motifs in amelogenin is critical for understanding the amelogenin–crystal interactions and amelogenin–proteinases interactions during tooth enamel biomineralization. A stepwise strategy is introduced to kinetically and quantitatively identify the crystal-binding motifs in amelogenin, including a peptide screening assay, a competitive adsorption assay, and a kinetic-binding assay using amelogenin and gene-engineered amelogenin mutants. A modified enzyme-linked immunosorbent assay on crystal surfaces is also applied to compare binding amounts of amelogenin and its mutants on different planes of apatite crystals. We describe the detailed protocols for these assays and provide the considerations for these experiments in this chapter. PMID:24188774

A Ligand-observed Mass Spectrometry Approach Integrated into the Fragment Based Lead Discovery Pipeline

PubMed Central

Chen, Xin; Qin, Shanshan; Chen, Shuai; Li, Jinlong; Li, Lixin; Wang, Zhongling; Wang, Quan; Lin, Jianping; Yang, Cheng; Shui, Wenqing

2015-01-01

In fragment-based lead discovery (FBLD), a cascade combining multiple orthogonal technologies is required for reliable detection and characterization of fragment binding to the target. Given the limitations of the mainstream screening techniques, we presented a ligand-observed mass spectrometry approach to expand the toolkits and increase the flexibility of building a FBLD pipeline especially for tough targets. In this study, this approach was integrated into a FBLD program targeting the HCV RNA polymerase NS5B. Our ligand-observed mass spectrometry analysis resulted in the discovery of 10 hits from a 384-member fragment library through two independent screens of complex cocktails and a follow-up validation assay. Moreover, this MS-based approach enabled quantitative measurement of weak binding affinities of fragments which was in general consistent with SPR analysis. Five out of the ten hits were then successfully translated to X-ray structures of fragment-bound complexes to lay a foundation for structure-based inhibitor design. With distinctive strengths in terms of high capacity and speed, minimal method development, easy sample preparation, low material consumption and quantitative capability, this MS-based assay is anticipated to be a valuable addition to the repertoire of current fragment screening techniques. PMID:25666181

Avoiding false positives and optimizing identification of true ...

EPA Pesticide Factsheets

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented from screening 94 chemicals from 54 chemical groups for estrogen receptor (ER) activation in a competitive rainbow trout ER (rtER) binding assay and a trout liver slice vitellogenin mRNA expression assay. Results from true competitive agonists and antagonists, and inactive chemicals with little or no indication of ER binding or gene activation were easily interpreted. However, results for numerous industrial chemicals were more challenging to interpret, including chemicals with: (1) apparent competitive binding curves but no gene activation, (2) apparent binding and gene inhibition with evidence of either cytotoxicity or changes in assay media pH, (3) apparent binding but non-competitive gene inhibition of unknown cause, or (4) no rtER binding and gene inhibition not due to competitive ER interaction but due to toxicity, pH change, or some unknown cause. The use of endpoints such as toxicity, pH, precipitate formation, and determination of inhibitor dissociation constants (Ki) for interpreting the results of antagonism and binding assays for diverse chemicals is presented. Of the 94 chemicals tested for antagonism only two, tamoxifen and ICI-182,780, were found to be true competitive

A novel BRET-based binding assay for interaction studies of relaxin family peptide receptor 3 with its ligands.

PubMed

Wang, Jia-Hui; Shao, Xiao-Xia; Hu, Meng-Jun; Wei, Dian; Liu, Ya-Li; Xu, Zeng-Guang; Guo, Zhan-Yun

2017-05-01

Relaxin family peptide receptor 3 (RXFP3) is an A-class G protein-coupled receptor that is implicated in the regulation of food intake and stress response upon activation by its cognate agonist relaxin-3. To study its interaction with various ligands, we developed a novel bioluminescence resonance energy transfer (BRET)-based binding assay using the brightest NanoLuc as an energy donor and a newly developed cyan-excitable orange fluorescent protein (CyOFP) as an energy acceptor. An engineered CyOFP without intrinsic cysteine residues but with an introduced cysteine at the C-terminus was overexpressed in Escherichia coli and chemically conjugated to the A-chain N-terminus of an easily labeled chimeric R3/I5 peptide via an intermolecular disulfide linkage. After the CyOFP-conjugated R3/I5 bound to a shortened human RXFP3 (removal of 33 N-terminal residues) fused with the NanoLuc reporter at the N-terminus, high BRET signals were detected. Saturation binding and real-time binding assays demonstrated that this BRET pair retained high binding affinity with fast association/dissociation. Using this BRET pair, binding potencies of various ligands with RXFP3 were conveniently measured through competition binding assays. Thus, the novel BRET-based binding assay facilitates interaction studies of RXFP3 with various ligands. The engineered CyOFP without intrinsic cysteine residues may also be applied to other BRET-based binding assays in future studies.

Development of a Surface Plasmon Resonance Assay for the Characterization of Small-Molecule Binding Kinetics and Mechanism of Binding to Kynurenine 3-Monooxygenase.

PubMed

Poda, Suresh B; Kobayashi, Masakazu; Nachane, Ruta; Menon, Veena; Gandhi, Adarsh S; Budac, David P; Li, Guiying; Campbell, Brian M; Tagmose, Lena

2015-10-01

Kynurenine 3-monooxygenase (KMO), a pivotal enzyme in the kynurenine pathway, was identified as a potential therapeutic target for treating neurodegenerative and psychiatric disorders. In this article, we describe a surface plasmon resonance (SPR) assay that delivers both kinetics and the mechanism of binding (MoB) data, enabling a detailed characterization of KMO inhibitors for the enzyme in real time. SPR assay development included optimization of the protein construct and the buffer conditions. The stability and inhibitor binding activity of the immobilized KMO were significantly improved when the experiments were performed at 10°C using a buffer containing 0.05% n-dodecyl-β-d-maltoside (DDM) as the detergent. The KD values of the known KMO inhibitors (UPF648 and RO61-8048) from the SPR assay were in good accordance with the biochemical LC/MS/MS assay. Also, the SPR assay was able to differentiate the binding kinetics (k(a) and k(d)) of the selected unknown KMO inhibitors. For example, the inhibitors that showed comparable IC50 values in the LC/MS/MS assay displayed differences in their residence time (τ = 1/k(d)) in the SPR assay. To better define the MoB of the inhibitors to KMO, an SPR-based competition assay was developed, which demonstrated that both UPF648 and RO61-8048 bound to the substrate-binding site. These results demonstrate the potential of the SPR assay for characterizing the affinity, the kinetics, and the MoB profiles of the KMO inhibitors.

Cholera toxin binding affinity and specificity for gangliosides determined by surface plasmon resonance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuziemko, G.M.; Stroh, M.; Stevens, R.C.

1996-05-21

The present study determines the affinity of cholera toxin for the ganglioside series GM1, GM2, GM3, GD1A, GD1B, GT1B, asialo GM1, globotriosyl ceramide, and lactosyl ceramide using real time biospecific interaction analysis (surface plasmon resonance, SPR). SPR shows that cholera toxin preferably binds to gangliosides in the following sequence: GM1 > GM2 > GD1A > GM3 > GT1B > GD1B > asialo-GM1. The measured binding affinity of cholera toxin for the ganglioside sequence ranges from 4.61 {times} 10{sup {minus}12} M for GM1 to 1.88 {times} 10{sup {minus}10} M for asialo GM1. The picomolar values obtained by surface plasmon resonance aremore » similar to K{sub d} values determined with whole-cell binding assays. Both whole-cell assays ans SPR measurements on synthetic membranes are higher than free solution measurements by several orders of magnitude. This difference may be caused by the effects of avidity and charged lipid head-groups, which may play a major role in the binding between cholera toxin, the receptor, and the membrane surface. The primary difference between free solution binding studies and surface plasmon resonance studies is that the latter technique is performed on surfaces resembling the cell membrane. Surface plasmon resonance has the further advantage of measuring apparent kinetic association and dissociation rates in real time, providing direct information about binding events at the membrane surface. 34 refs., 8 figs., 2 tabs.« less

Efficient interrupting skills of amino acid metallointercalators with DNA at physiological pH: Evaluation of biological assays

NASA Astrophysics Data System (ADS)

Raman, Natarajan; Selvaganapathy, Muthusamy; Radhakrishnan, Srinivasan

2014-06-01

The 4-aminoantipyrine derivatives (sbnd NO2, sbnd OCH3) and their mixed-ligand complexes with amino acids have been synthesized and investigated for their binding with CT DNA using UV-visible spectroscopy, cyclic voltammetry, and viscosity measurements under physiological conditions of pH (stomach 4.7; blood 7.4). The results from all techniques i.e. binding constant (Kb), and free energy change (ΔG) were in good agreement and inferred spontaneous compound-DNA complexes formation via intercalation. Among all the compounds 1 and 4 showed comparatively greater binding at pH 7.4 as evident from its greater Kb values. All the complexes exhibit oxidative cleavage of supercoiled (SC) pBR322 plasmid DNA in the presence of H2O2 as an activator. It is remarkable that at 25 μM concentration 1 and 4 completely degrade SC DNA into undetectable minor fragments and thus they act as efficient chemical nucleases. Among the new complexes, complexes 1 and 4 have highest potential against all the microorganisms tested. The results of the above biological experiments also reveal that the choice of different metal ions has little influence on the DNA binding, DNA cleavage and antimicrobial assay.

Sensitive and rapid immunoassay for parathyroid hormone using magnetic particle labels and magnetic actuation.

PubMed

Dittmer, W U; de Kievit, P; Prins, M W J; Vissers, J L M; Mersch, M E C; Martens, M F W C

2008-09-30

A rapid method for the sensitive detection of proteins using actuated magnetic particle labels, which are measured with a giant magneto-resistive (GMR) biosensor, is described. The technique involves a 1-step sandwich immunoassay with no fluid replacement steps. The various assay binding reactions as well as the bound/free separation are entirely controlled by magnetic forces induced by electromagnets above and below the sensor chip. During the assay, particles conjugated with tracer antibodies are actuated through the sample for target capture, and rapidly brought to the sensor surface where they bind to immobilized capture antibodies. Weakly or unbound labels are removed with a magnetic force oriented away from the GMR sensor surface. For the measurement of parathyroid hormone (PTH), a detection limit in the 10 pM range is obtained with a total assay time of 15 min when 300 nm particles are used. The same sensitivity can be achieved in 5 min when 500 nm particles are used. If 500 nm particles are employed in a 15-minute assay, then 0.8 pM of PTH is detectable. The low sample volume, high analytical performance and high speed of the test coupled with the compact GMR biosensor make the system especially suitable for sensitive testing outside of laboratory environments.

Identifying Metabolically Active Chemicals Using a Consensus ...

EPA Pesticide Factsheets

Traditional toxicity testing provides insight into the mechanisms underlying toxicological responses but requires a high investment in a large number of resources. The new paradigm of testing approaches involves rapid screening studies able to evaluate thousands of chemicals across hundreds of biological targets through use of in vitro assays. Endocrine disrupting chemicals (EDCs) are of concern due to their ability to alter neurodevelopment, behavior, and reproductive success of humans and other species. A recent integrated computational model examined results across 18 ER-related assays in the ToxCast in vitro screening program to eliminate chemicals that produce a false signal by possibly interfering with the technological attributes of an individual assay. However, in vitro assays can also lead to false negatives when the complex metabolic processes that render a chemical bioactive in a living system might be unable to be replicated in an in vitro environment. In the current study, the influence of metabolism was examined for over 1,400 chemicals considered inactive using the integrated computational model. Over 2,000 first-generation and over 4,000 second-generation metabolites were generated for the inactive chemicals using in silico techniques. Next, a consensus model comprised of individual structure activity relationship (SAR) models was used to predict ER-binding activity for each of the metabolites. Binding activity was predicted for 8-10% of the meta

Evaluation of potential endocrine activity of 2,4-dichlorophenoxyacetic acid using in vitro assays.

PubMed

Coady, Katherine K; Kan, H Lynn; Schisler, Melissa R; Gollapudi, B Bhaskar; Neal, Barbara; Williams, Amy; LeBaron, Matthew J

2014-08-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) was evaluated in five in vitro screening assays to assess the potential for interaction with the androgen, estrogen and steroidogenesis pathways in the endocrine system. The assays were conducted to meet the requirements of the in vitro component of Tier 1 of the United States Environmental Protection Agency's Endocrine Disruptor Screening Program (EDSP), and included assays for estrogen receptor (ER) binding (rat uterine cytosol ER binding assay), ER-mediated transcriptional activation (HeLa-9903-ERα transactivation assay), androgen receptor (AR) binding (rat prostate cytosol AR binding assay), aromatase enzymatic activity inhibition (recombinant human CYP19 aromatase inhibition assay), and interference with steroidogenesis (H295R steroidogenesis assay). Results from these five assays demonstrated that 2,4-D does not have the potential to interact in vitro with the estrogen, androgen, or steroidogenesis pathways. These in vitro data are consistent with a corresponding lack of endocrine effects observed in apical in vivo animal studies, and thus provide important supporting data valuable in a comprehensive weight of evidence evaluation indicating a low potential of 2,4-D to interact with the endocrine system. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Assays of HbA1c and Amadori products in human biology].

PubMed

Gillery, P

2014-09-01

Different Amadori products, formed during the early steps of the non-enzymatic glycation of proteins, may be assayed in current practice in human biology. The most important marker is HbA1c, resulting from the binding of glucose to the N-terminal extremity of HbA beta chains. HbA1c may be evaluated by various techniques (ion exchange or affinity high performance liquid chromatography, capillary electrophoresis, immunoassay, enzymatic technique) and is considered the best marker of diabetic patient survey. Due to its irreversible and cumulative formation, it provides a retrospective information on the glycemic balance over the four to eight weeks preceding blood collection. It benefits from an international standardization, based on a reference method using liquid chromatography coupled to capillary electrophoresis or mass spectrometry, maintained by an international network of reference laboratories. When HbA1c assay cannot be used (anemia, hemolysis, hemoglobinopathy) or when a shorter period of glycemic equilibrium must be evaluated (child and adolescent, pregnancy, therapeutic changes), other Amadori products may be assayed, like plasma fructosamine (all plasma glycated proteins) or glycated albumin. Nevertheless, these assays are less used in practice, because their semiological value has been less evidenced. Besides, fructosamine assay lacks specificity, and glycated albumin assay has been described recently. An expanding use of HbA1c assay is expected, especially for the diagnosis of diabetes mellitus and the evaluation of other risks, especially cardiovascular ones. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Development of magnetic resonance imaging based detection methods for beta amyloids via sialic acid-functionalized magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Kouyoumdjian, Hovig

The development of a non-invasive method for the detection of Alzheimer's disease is of high current interest, which can be critical in early diagnosis and in guiding preventive treatment of the disease. The aggregates of beta amyloids are a pathological hallmark of Alzheimer's disease. Carbohydrates such as sialic acid terminated gangliosides have been shown to play significant roles in initiation of amyloid aggregation. Herein, we report a biomimetic approach using sialic acid coated iron oxide superparamagnetic nanoparticles for in vitro detection in addition to the assessment of the in vivo mouse-BBB (Blood brain barrier) crossing of the BSA (bovine serum albumin)-modified ones. The sialic acid functionalized dextran nanoparticles were shown to bind with beta amyloids through several techniques including ELISA (enzyme linked immunosorbent assay), MRI (magnetic resonance imaging), TEM (transmission electron microscopy), gel electrophoresis and tyrosine fluorescence assay. The superparamagnetic nature of the nanoparticles allowed easy detection of the beta amyloids in mouse brains in both in vitro and ex vivo model by magnetic resonance imaging. Furthermore, the sialic acid nanoparticles greatly reduced beta amyloid induced cytotoxicity to SH-SY5Y neuroblastoma cells, highlighting the potential of the glyconanoparticles for detection and imaging of beta amyloids. Sialic acid functionalized BSA (bovine serum albumin) nanoparticles also showed significant binding to beta amyloids, through ELISA and ex vivo mouse brain MRI experiments. Alternatively, the BBB crossing was demonstrated by several techniques such as confocal microscopy, endocytosis, exocytosis assays and were affirmed by nanoparticles transcytosis assays through bEnd.3 endothelial cells. Finally, the BBB crossing was confirmed by analyzing the MRI signal of nanoparticle-injected CD-1 mice.

Application of the novel bioluminescent ligand-receptor binding assay to relaxin-RXFP1 system for interaction studies.

PubMed

Wu, Qing-Ping; Zhang, Lei; Shao, Xiao-Xia; Wang, Jia-Hui; Gao, Yu; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun

2016-04-01

Relaxin is a prototype of the relaxin family peptide hormones and plays important biological functions by binding and activating the G protein-coupled receptor RXFP1. To study their interactions, in the present work, we applied the newly developed bioluminescent ligand-receptor binding assay to the relaxin-RXFP1 system. First, a fully active easily labeled relaxin, in which three Lys residues of human relaxin-2 were replaced by Arg, was prepared through overexpression of a single-chain precursor in Pichia pastoris and in vitro enzymatic maturation. Thereafter, the B-chain N-terminus of the easily labeled relaxin was chemically cross-linked with a C-terminal cysteine residue of an engineered NanoLuc through a disulfide linkage. Receptor-binding assays demonstrated that the NanoLuc-conjugated relaxin retained high binding affinity with the receptor RXFP1 (K d = 1.11 ± 0.08 nM, n = 3) and was able to sensitively monitor binding of a variety of ligands with RXFP1. Using the novel bioluminescent binding assay, we demonstrated that three highly conserved B-chain Arg residues of relaxin-3 had distinct contributions to binding of the receptor RXFP1. In summary, our present work provides a novel bioluminescent ligand-receptor binding assay for the relaxin-RXFP1 system to facilitate their interaction studies, such as characterization of relaxin analogues or screening novel agonists or antagonists of RXFP1.

HPV binding assay to Laminin-332/integrin α6β4 on human keratinocytes.

PubMed

Brendle, Sarah A; Christensen, Neil D

2015-01-01

Human papillomaviruses (HPVs) have been shown to bind to Laminin-332 (Ln-332) on the extracellular matrix (ECM) secreted by human keratinocytes. The assay described here is an important tool to study HPV receptor binding to the ECM. The assay can also be modified to study the receptors required for HPV infection and for binding to tissues. We previously showed that Ln-332 is essential for the binding of HPV11 to human keratinocytes and that infectious entry of HPV11 requires α6β4 integrin for the transfer of HPV11 from ECM to host cells (Culp et al., J Virol 80:8940-8950, 2006). We also demonstrated that several of the high-risk HPV types (16, 18, 31 and 45) bind to Ln-332 and/or other components of the ECM in vitro (Broutian et al., J Gen Virol 91:531-540, 2010). The exact binding and internalization mechanism(s) for HPV are still under investigation. A better understanding of these mechanisms will aid in the design of therapeutics against HPVs and ultimately help prevent many cancers. In this chapter, we describe the HPV binding assay to Ln-332/integrin α6β4 on human keratinocytes (ECM). We also present data and suggestions for modifying the assay for testing the specificity of HPV for receptors (by blocking receptors) and binding to human tissues (basement membrane, BM) in order to study binding mechanisms.

A novel assay to identify the trafficking proteins that bind to specific vesicle populations

PubMed Central

Bentley, Marvin; Banker, Gary

2016-01-01

Here we describe a method capable of identifying interactions between candidate trafficking proteins and a defined vesicle population in intact cells. The assay involves the expression of an FKBP12-rapamycin–binding domain (FRB)–tagged candidate vesicle-binding protein that can be inducibly linked to an FKBP-tagged molecular motor. If the FRB-tagged candidate protein binds the labeled vesicles, then linking the FRB and FKBP domains recruits motors to the vesicles and causes a predictable, highly distinctive change in vesicle trafficking. We describe two versions of the assay: a general protocol for use in cells with a typical microtubule-organizing center and a specialized protocol designed to detect protein-vesicle interactions in cultured neurons. We have successfully used this assay to identify kinesins and Rabs that bind to a variety of different vesicle populations. In principle, this assay could be used to investigate interactions between any category of vesicle trafficking proteins and any vesicle population that can be specifically labeled. PMID:26621371

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques.

PubMed

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-30

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5  M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

PubMed Central

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-01-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124

Sparteine monooxygenase in brain and liver: Identified by the dopamine uptake blocker ( sup 3 H)GBR-12935

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalow, W.; Tyndale, R.F.; Niznik, H.B.

1990-02-26

P450IID6 (human sparteine monooxygenase) metabolizes many drugs including neuroleptics, antidepressants, and beta-blockers. The P450IID6 exists in human, bovine, rat and canine brains, but in very low quantities causing methodological difficulties in its assessment. Work with ({sup 3}H)GBR-12935; 1-(2-(diphenylmethoxy) ethyl)-4-(3-phenyl propyl) piperazine has shown that it binds a neuronal/hepatic protein with high affinity ({approximately}7nM) and a rank order of inhibitory potency suggesting that the binding protein is cytochrome P450IID6. The binding was used to predict that d-amphetamine and methamphetamine would interact with P450IID6. Inhibition studies indicated that these compounds were competitive inhibitors of P450IID6. Haloperidol (HAL) and it's metabolite hydroxy-haloperidol (RHAL)more » are both competitive inhibitors of P450IID6 activity and were found to inhibit ({sup 3}H)GBR-12935 binding. K{sub i} values of twelve compounds (known to interact with the DA transporter or P450IID6) for ({sup 3}H)GRB-12935 binding and P450IID6 activity. The techniques are now available for measurements of cytochrome P450IID6 in healthy and diseased brain/liver tissue using radio-receptor binding assay techniques with ({sup 3}H)GBR-12935.« less

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

NASA Astrophysics Data System (ADS)

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

Characterization of the Saccharomyces cerevisiae ATP-Interactome using the iTRAQ-SPROX Technique

NASA Astrophysics Data System (ADS)

Geer, M. Ariel; Fitzgerald, Michael C.

2016-02-01

The stability of proteins from rates of oxidation (SPROX) technique was used in combination with an isobaric mass tagging strategy to identify adenosine triphosphate (ATP) interacting proteins in the Saccharomyces cerevisiae proteome. The SPROX methodology utilized in this work enabled 373 proteins in a yeast cell lysate to be assayed for ATP interactions (both direct and indirect) using the non-hydrolyzable ATP analog, adenylyl imidodiphosphate (AMP-PNP). A total of 28 proteins were identified with AMP-PNP-induced thermodynamic stability changes. These protein hits included 14 proteins that were previously annotated as ATP-binding proteins in the Saccharomyces Genome Database (SGD). The 14 non-annotated ATP-binding proteins included nine proteins that were previously found to be ATP-sensitive in an earlier SPROX study using a stable isotope labeling with amino acids in cell culture (SILAC)-based approach. A bioinformatics analysis of the protein hits identified here and in the earlier SILAC-SPROX experiments revealed that many of the previously annotated ATP-binding protein hits were kinases, ligases, and chaperones. In contrast, many of the newly discovered ATP-sensitive proteins were not from these protein classes, but rather were hydrolases, oxidoreductases, and nucleic acid-binding proteins.

Mechanism of cinnamic acid-induced trypsin inhibition: A multi-technique approach

NASA Astrophysics Data System (ADS)

Zhang, Hongmei; Zhou, Qiuhua; Cao, Jian; Wang, Yanqing

2013-12-01

In order to investigate the association of the protease trypsin with cinnamic acid, the interaction was characterized by using fluorescence, UV-vis absorption spectroscopy, molecular modeling and an enzymatic inhibition assay. The binding process may be outlined as follows: cinnamic acid can interact with trypsin with one binding site to form cinnamic acid-trypsin complex, resulting in inhibition of trypsin activity; the spectroscopic data show that the interaction is a spontaneous process with the estimated enthalpy and entropy changes being -8.95 kJ mol-1 and 50.70 J mol-1 K-1, respectively. Noncovalent interactions make the main contribution to stabilize the trypsin-cinnamic acid complex; cinnamic acid can enter into the primary substrate-binding pocket and alter the environment around Trp and Tyr residues.

Population Studies of Intact Vitamin D Binding Protein by Affinity Capture ESI-TOF-MS

PubMed Central

Borges, Chad R.; Jarvis, Jason W.; Oran, Paul E.; Rogers, Stephen P.; Nelson, Randall W.

2008-01-01

Blood plasma proteins with molecular weights greater than approximately 30 kDa are refractory to comprehensive, high-throughput qualitative characterization of microheterogeneity across human populations. Analytical techniques for obtaining high mass resolution for targeted, intact protein characterization and, separately, high sample throughput exist, but efficient means of coupling these assay characteristics remain rather limited. This article discusses the impetus for analyzing intact proteins in a targeted manner across populations and describes the methodology required to couple mass spectrometric immunoassay with electrospray ionization mass spectrometry for the purpose of qualitatively characterizing a prototypical large plasma protein, vitamin D binding protein, across populations. PMID:19137103

Microarray-based screening of heat shock protein inhibitors.

PubMed

Schax, Emilia; Walter, Johanna-Gabriela; Märzhäuser, Helene; Stahl, Frank; Scheper, Thomas; Agard, David A; Eichner, Simone; Kirschning, Andreas; Zeilinger, Carsten

2014-06-20

Based on the importance of heat shock proteins (HSPs) in diseases such as cancer, Alzheimer's disease or malaria, inhibitors of these chaperons are needed. Today's state-of-the-art techniques to identify HSP inhibitors are performed in microplate format, requiring large amounts of proteins and potential inhibitors. In contrast, we have developed a miniaturized protein microarray-based assay to identify novel inhibitors, allowing analysis with 300 pmol of protein. The assay is based on competitive binding of fluorescence-labeled ATP and potential inhibitors to the ATP-binding site of HSP. Therefore, the developed microarray enables the parallel analysis of different ATP-binding proteins on a single microarray. We have demonstrated the possibility of multiplexing by immobilizing full-length human HSP90α and HtpG of Helicobacter pylori on microarrays. Fluorescence-labeled ATP was competed by novel geldanamycin/reblastatin derivatives with IC50 values in the range of 0.5 nM to 4 μM and Z(*)-factors between 0.60 and 0.96. Our results demonstrate the potential of a target-oriented multiplexed protein microarray to identify novel inhibitors for different members of the HSP90 family. Copyright © 2014 Elsevier B.V. All rights reserved.

Lectin binding assays for in-process monitoring of sialylation in protein production.

PubMed

Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong

2010-07-01

Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.

Dye-binding assays for evaluation of the effects of small molecule inhibitors on amyloid (aβ) self-assembly.

PubMed

Jameson, Laramie P; Smith, Nicholas W; Dzyuba, Sergei V

2012-11-21

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors' potential toward Aβ peptides, species involved in Alzheimer's disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays.

Dye-Binding Assays for Evaluation of the Effects of Small Molecule Inhibitors on Amyloid (Aβ) Self-Assembly

PubMed Central

2012-01-01

Dye-binding assays, such as those utilizing Congo red and thioflavin T, are among the most widely used tools to probe the aggregation of amyloidogenic biomolecules and for the evaluation of small molecule inhibitors of amyloid aggregation and fibrillization. A number of recent reports have indicated that these dye-binding assays could be prone to false positive effects when assessing inhibitors’ potential toward Aβ peptides, species involved in Alzheimer’s disease. Specifically, this review focuses on the application of thioflavin T for determining the efficiency of small molecule inhibitors of Aβ aggregation and addresses potential reasons that might be associated with the false positive effects in an effort to increase reliability of dye-binding assays. PMID:23173064

Flow cytometer measurement of binding assays

DOEpatents

Saunders, George C.

1987-01-01

A method of measuring the result of a binding assay that does not require separation of fluorescent smaller particles is disclosed. In a competitive binding assay the smaller fluorescent particles coated with antigen compete with antigen in the sample being analyzed for available binding sites on larger particles. In a sandwich assay, the smaller, fluorescent spheres coated with antibody attach themselves to molecules containing antigen that are attached to larger spheres coated with the same antibody. The separation of unattached, fluorescent smaller particles is made unnecessary by only counting the fluorescent events triggered by the laser of a flow cytometer when the event is caused by a particle with a light scatter measurement within a certain range corresponding to the presence of larger particles.

A High-Throughput TNP-ATP Displacement Assay for Screening Inhibitors of ATP-Binding in Bacterial Histidine Kinases

PubMed Central

Guarnieri, Michael T.; Blagg, Brian S. J.

2011-01-01

Abstract Bacterial histidine kinases (HK) are members of the GHKL superfamily, which share a unique adenosine triphosphate (ATP)-binding Bergerat fold. Our previous studies have shown that Gyrase, Hsp90, MutL (GHL) inhibitors bind to the ATP-binding pocket of HK and may provide lead compounds for the design of novel antibiotics targeting these kinases. In this article, we developed a competition assay using the fluorescent ATP analog, 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate. The method can be used for high-throughput screening of compound libraries targeting HKs or other ATP-binding proteins. We utilized the assay to screen a library of GHL inhibitors targeting the bacterial HK PhoQ, and discuss the applications of the 2′,3′-O-(2,4,6-trinitrophenyl) adenosine 5′-triphosphate competition assay beyond GHKL inhibitor screening. PMID:21050069

Concerted application of LC-MS and ligand binding assays to better understand exposure of a large molecule drug.

PubMed

Xu, Weifeng; Jiang, Hao; Titsch, Craig; Gadkari, Snaehal; Batog, Alicja; Wang, Bonnie; Hippeli, Lauren; Yamamoto, Brent; Chadwick, Kristina; Wheeler, Jennifer; Thompson, Chris; Stahl, James; Willett, Scott; DeSilva, Binodh S; Myler, Heather; Dodge, Robert W; Pillutla, Renuka C

2018-06-20

A ligand-binding assay (LBA) was used to measure exposure of PRM-151, the recombinant form of human pentraxin-2 (PTX-2), a complex pentamer with multiple binding partners. However, the assay showed a lack of dose-dependent exposure in select preclinical species and it could not differentiate the infused PRM-151 from the endogenous PTX-2 in nonhuman primates. Instead of assessing interference from its multiple binding partners, which could be time consuming and laborious, a LC-MS assay avoid of these interference was implemented to measure 'total' drug without the use of immunoaffinity capture reagents. The resultant LC-MS data confirmed the original data and the lack of dose-dependent exposure is now understood to be due to the multiple and diverse targets and functions and resultant complex biodistribution rather than an assay artifact.

Evaluation of OASIS QSAR Models Using ToxCast™ in Vitro Estrogen and Androgen Receptor Binding Data and Application in an Integrated Endocrine Screening Approach

PubMed Central

Bhhatarai, Barun; Wilson, Daniel M.; Price, Paul S.; Marty, Sue; Parks, Amanda K.; Carney, Edward

2016-01-01

Background: Integrative testing strategies (ITSs) for potential endocrine activity can use tiered in silico and in vitro models. Each component of an ITS should be thoroughly assessed. Objectives: We used the data from three in vitro ToxCast™ binding assays to assess OASIS, a quantitative structure-activity relationship (QSAR) platform covering both estrogen receptor (ER) and androgen receptor (AR) binding. For stronger binders (described here as AC50 < 1 μM), we also examined the relationship of QSAR predictions of ER or AR binding to the results from 18 ER and 10 AR transactivation assays, 72 ER-binding reference compounds, and the in vivo uterotrophic assay. Methods: NovaScreen binding assay data for ER (human, bovine, and mouse) and AR (human, chimpanzee, and rat) were used to assess the sensitivity, specificity, concordance, and applicability domain of two OASIS QSAR models. The binding strength relative to the QSAR-predicted binding strength was examined for the ER data. The relationship of QSAR predictions of binding to transactivation- and pathway-based assays, as well as to in vivo uterotrophic responses, was examined. Results: The QSAR models had both high sensitivity (> 75%) and specificity (> 86%) for ER as well as both high sensitivity (92–100%) and specificity (70–81%) for AR. For compounds within the domains of the ER and AR QSAR models that bound with AC50 < 1 μM, the QSAR models accurately predicted the binding for the parent compounds. The parent compounds were active in all transactivation assays where metabolism was incorporated and, except for those compounds known to require metabolism to manifest activity, all assay platforms where metabolism was not incorporated. Compounds in-domain and predicted to bind by the ER QSAR model that were positive in ToxCast™ ER binding at AC50 < 1 μM were active in the uterotrophic assay. Conclusions: We used the extensive ToxCast™ HTS binding data set to show that OASIS ER and AR QSAR models had high sensitivity and specificity when compounds were in-domain of the models. Based on this research, we recommend a tiered screening approach wherein a) QSAR is used to identify compounds in-domain of the ER or AR binding models and predicted to bind; b) those compounds are screened in vitro to assess binding potency; and c) the stronger binders (AC50 < 1 μM) are screened in vivo. This scheme prioritizes compounds for integrative testing and risk assessment. Importantly, compounds that are not in-domain, that are predicted either not to bind or to bind weakly, that are not active in in vitro, that require metabolism to manifest activity, or for which in vivo AR testing is in order, need to be assessed differently. Citation: Bhhatarai B, Wilson DM, Price PS, Marty S, Parks AK, Carney E. 2016. Evaluation of OASIS QSAR models using ToxCast™ in vitro estrogen and androgen receptor binding data and application in an integrated endocrine screening approach. Environ Health Perspect 124:1453–1461; http://dx.doi.org/10.1289/EHP184 PMID:27152837

Interaction between bioactive compound 11a-N-tosyl-5-deoxi-pterocarpan (LQB-223) and Calf thymus DNA: Spectroscopic approach, electrophoresis and theoretical studies.

PubMed

Silva, Marina M; Nascimento, Eduarda O O; Silva, Edeíldo F; Araújo, João Xavier de; Santana, Camilla C; Grillo, Luciano Aparecido M; de Oliveira, Rafaela S; R R Costa, Paulo; Buarque, Camilla D; Santos, Josué Carinhanha C; Figueiredo, Isis M

2017-03-01

The interaction of small molecules with DNA has been quite important, since this biomolecule is currently the major target for a wide range of drugs in clinical use or advanced clinical research phase. Thus, the present work aimed to assess the interaction process between the bioactive compound 11a-N-tosyl-5-carba-pterocarpan, (LQB-223), that presents antitumor activity, with DNA, employing spectroscopic techniques, electrophoresis, viscosity and theoretical studies. Through UV-vis and molecular fluorescence spectroscopy, it was possible to infer that the preferential quenching mechanism was static, characterized by non-fluorescent supramolecular complex formation between the LQB-223 and DNA. The binding constant was 1.94∙10 3 Lmol -1 (30°C) and, according to the thermodynamic parameters, the main forces involved in the interaction process are hydrophobic. Potassium iodide assay, competition with ethidium bromide, fluorescence contact energy transfer and melting temperature profile of DNA were employed to evaluate the binding mode. Except for KI assay, all results obtained indicated minor groove as the preferential binding mode of LQB-223 to DNA. These observations were supported by ionic strength assay, viscosity and molecular dynamics and docking studies. Finally, electrophoresis analysis demonstrated that the interaction does not promote DNA fragmentation, but it leads to variation in the migration profile after increasing the ligand concentration. Copyright © 2016 Elsevier B.V. All rights reserved.

Glucocorticoid receptor ligand binding in monocytic cells using a microplate assay.

PubMed

Jansen, J; Uitdehaag, B; Koper, J W; van Den Berg, T K

1999-01-01

Glucocorticoids have profound effects on macrophage function and are widely used as anti-inflammatory drugs. Glucocorticoids receptor (GR) ligand binding capacity is a major determinant of cellular glucocorticoid sensitivity. The number and affinity of GR can be measured in a whole cell binding assay using (3)H-dexamethasone. Here, we describe a rapid and simple microplate assay for GR measurement using the human promonocytic cell line THP-1. Copyright 2000 S. Karger AG, Basel.

Unlabeled probes for the detection and typing of herpes simplex virus.

PubMed

Dames, Shale; Pattison, David C; Bromley, L Kathryn; Wittwer, Carl T; Voelkerding, Karl V

2007-10-01

Unlabeled probe detection with a double-stranded DNA (dsDNA) binding dye is one method to detect and confirm target amplification after PCR. Unlabeled probes and amplicon melting have been used to detect small deletions and single-nucleotide polymorphisms in assays where template is in abundance. Unlabeled probes have not been applied to low-level target detection, however. Herpes simplex virus (HSV) was chosen as a model to compare the unlabeled probe method to an in-house reference assay using dual-labeled, minor groove binding probes. A saturating dsDNA dye (LCGreen Plus) was used for real-time PCR. HSV-1, HSV-2, and an internal control were differentiated by PCR amplicon and unlabeled probe melting analysis after PCR. The unlabeled probe technique displayed 98% concordance with the reference assay for the detection of HSV from a variety of archived clinical samples (n = 182). HSV typing using unlabeled probes was 99% concordant (n = 104) to sequenced clinical samples and allowed for the detection of sequence polymorphisms in the amplicon and under the probe. Unlabeled probes and amplicon melting can be used to detect and genotype as few as 10 copies of target per reaction, restricted only by stochastic limitations. The use of unlabeled probes provides an attractive alternative to conventional fluorescence-labeled, probe-based assays for genotyping and detection of HSV and might be useful for other low-copy targets where typing is informative.

Bead mediated separation of microparticles in droplets.

PubMed

Wang, Sida; Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A

2017-01-01

Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead's solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield.

Bead mediated separation of microparticles in droplets

PubMed Central

Sung, Ki-Joo; Lin, Xiaoxia Nina; Burns, Mark A.

2017-01-01

Exchange of components such as particles and cells in droplets is important and highly desired in droplet microfluidic assays, and many current technologies use electrical or magnetic fields to accomplish this process. Bead-based microfluidic techniques offer an alternative approach that uses the bead’s solid surface to immobilize targets like particles or biological material. In this paper, we demonstrate a bead-based technique for exchanging droplet content by separating fluorescent microparticles in a microfluidic device. The device uses posts to filter surface-functionalized beads from a droplet and re-capture the filtered beads in a new droplet. With post spacing of 7 μm, beads above 10 μm had 100% capture efficiency. We demonstrate the efficacy of this system using targeted particles that bind onto the functionalized beads and are, therefore, transferred from one solution to another in the device. Binding capacity tests performed in the bulk phase showed an average binding capacity of 5 particles to each bead. The microfluidic device successfully separated the targeted particles from the non-targeted particles with up to 98% purity and 100% yield. PMID:28282412

Homogeneous bioluminescence competitive binding assay for folate based on a coupled glucose-6-phosphate dehydrogenase--bacterial luciferase enzyme system.

PubMed

Huang, W; Feltus, A; Witkowski, A; Daunert, S

1996-05-01

A homogeneous bioluminescence competitive binding assay for folate was developed by using a coupled enzyme system of glucose-6-phosphate dehydrogenase (G6PDH) and bacterial luciferase. A highly substituted G6PDH-folate conjugate was prepared by employing an N-hydroxysuccinimide/carbodiimide method. Folate binding protein inhibits the activity of the conjugate. In the presence of folate, there is a competition between folate and the G6PDH-folate conjugate for the binding site of the folate binding protein, and the activity of the conjugate is recovered. Thus, the concentration of folate can be related to the activity of the G6PDH-folate conjugate, which is directly related to the bioluminescence produced by the coupled enzyme reaction. Using this assay, dose-response curves with a detection limit of 2.5 x 10(-8) M folate were obtained, which is an improvement of an order of magnitude with respect to an assay that monitors G6PDH activity spectrophotometrically. The assay was validated using vitamin tablets and a cell culture medium.

Avoiding false positives and optimizing identification of true negatives in estrogen receptor binding and agonist/antagonist assays

EPA Science Inventory

The potential for chemicals to affect endocrine signaling is commonly evaluated via in vitro receptor binding and gene activation, but these assays, especially antagonism assays, have potential artifacts that must be addressed for accurate interpretation. Results are presented fr...

Integrated Summary Report: Validation of Two Binding Assays Using Human Recombinant Estrogen Receptor Alpha (hrERa)

EPA Science Inventory

This Integrated Summary Report (ISR) summarizes, in a single document, the results from an international multi-laboratory validation study conducted for two in vitro estrogen receptor (ER) binding assays. These assays both use human recombinant estrogen receptor, alpha subtype (h...

Three-dimensional structure-activity relationship modeling of cocaine binding to two monoclonal antibodies by comparative molecular field analysis.

PubMed

Paula, Stefan; Tabet, Michael R; Keenan, Susan M; Welsh, William J; Ball, W James

2003-01-17

Successful immunotherapy of cocaine addiction and overdoses requires cocaine-binding antibodies with specific properties, such as high affinity and selectivity for cocaine. We have determined the affinities of two cocaine-binding murine monoclonal antibodies (mAb: clones 3P1A6 and MM0240PA) for cocaine and its metabolites by [3H]-radioligand binding assays. mAb 3P1A6 (K(d) = 0.22 nM) displayed a 50-fold higher affinity for cocaine than mAb MM0240PA (K(d) = 11 nM) and also had a greater specificity for cocaine. For the systematic exploration of both antibodies' binding specificities, we used a set of approximately 35 cocaine analogues as structural probes by determining their relative binding affinities (RBAs) using an enzyme-linked immunosorbent competition assay. Three-dimensional quantitative structure-activity relationship (3D-QSAR) models on the basis of comparative molecular field analysis (CoMFA) techniques correlated the binding data with structural features of the ligands. The analysis indicated that despite the mAbs' differing specificities for cocaine, the relative contributions of the steric (approximately 80%) and electrostatic (approximately 20%) field interactions to ligand-binding were similar. Generated three-dimensional CoMFA contour plots then located the specific regions about cocaine where the ligand/receptor interactions occurred. While the overall binding patterns of the two mAbs had many features in common, distinct differences were observed about the phenyl ring and the methylester group of cocaine. Furthermore, using previously published data, a 3D-QSAR model was developed for cocaine binding to the dopamine reuptake transporter (DAT) that was compared to the mAb models. Although the relative steric and electrostatic field contributions were similar to those of the mAbs, the DAT cocaine-binding site showed a preference for negatively charged ligands. Besides establishing molecular level insight into the interactions that govern cocaine binding specificity by biopolymers, the three-dimensional images obtained reflect the properties of the mAbs binding pockets and provide the initial information needed for the possible design of novel antibodies with properties optimized for immunotherapy. Copyright 2003 Elsevier Science Ltd.

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

NASA Astrophysics Data System (ADS)

Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

2016-03-01

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.

PubMed

Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T

2018-06-01

To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.

Mechanism of cinnamic acid-induced trypsin inhibition: a multi-technique approach.

PubMed

Zhang, Hongmei; Zhou, Qiuhua; Cao, Jian; Wang, Yanqing

2013-12-01

In order to investigate the association of the protease trypsin with cinnamic acid, the interaction was characterized by using fluorescence, UV-vis absorption spectroscopy, molecular modeling and an enzymatic inhibition assay. The binding process may be outlined as follows: cinnamic acid can interact with trypsin with one binding site to form cinnamic acid-trypsin complex, resulting in inhibition of trypsin activity; the spectroscopic data show that the interaction is a spontaneous process with the estimated enthalpy and entropy changes being -8.95 kJ mol(-1) and 50.70 J mol(-1) K(-1), respectively. Noncovalent interactions make the main contribution to stabilize the trypsin-cinnamic acid complex; cinnamic acid can enter into the primary substrate-binding pocket and alter the environment around Trp and Tyr residues. Copyright © 2013 Elsevier B.V. All rights reserved.

Optical sensors for therapeutic drug monitoring of antidepressants for a better medication adjustment

NASA Astrophysics Data System (ADS)

Krieg, Anne K.; Hess, Stefan; Gauglitz, Günter

2013-05-01

Therapeutic drug monitoring provides the attending physicians with detailed information on a patient's individual serum level especially during long-term medication. Due to the fact that each patient tolerates drugs or their metabolites differently a medication adjustment can reduce the number and intensity of noticeable side-effects. In particular, psychotropic drugs can cause unpleasant side-effects that affect a patient's life almost as much as the mental disease itself. The tricyclic antidepressants amitriptyline is commonly used for treatment of depressions and was selected for the development of an immunoassay using the direct optical sensor technique Reflectometric Interference Spectroscopy (RIfS). RIfS is a simple, robust and label-free method for direct monitoring of binding events on glass surfaces. Binding to the surface causes a shift of the interference spectrum by a change of the refractive index or physical thickness. This technique can be used for time-resolved observation of association and dissociation of amitriptyline (antigen) and a specific antibody using the binding inhibition test format. An amitriptyline derivative is immobilized on the sensor surface and a specific amount of antibodies can bind to the surface unless the binding is inhibited by free amitriptyline in a sample. No fluorescent label is needed making the whole assay less expensive than label-based methods. With this recently developed immunoassay amitriptyline concentrations in buffer (PBS) can easily be detected down to 500 ng/L.

Beyond conventional dose-response curves: Sensorgram comparison in SPR allows single concentration activity and similarity assessment.

PubMed

Gassner, C; Karlsson, R; Lipsmeier, F; Moelleken, J

2018-05-30

Previously we have introduced two SPR-based assay principles (dual-binding assay and bridging assay), which allow the determination of two out of three possible interaction parameters for bispecific molecules within one assay setup: two individual interactions to both targets, and/or one simultaneous/overall interaction, which potentially reflects the inter-dependency of both individual binding events. However, activity and similarity are determined by comparing report points over a concentration range, which also mirrors the way data is generated by conventional ELISA-based methods So far, binding kinetics have not been specifically considered in generic approaches for activity assessment. Here, we introduce an improved slope-ratio model which, together with a sensorgram comparison based similarity assessment, allows the development of a detailed, USP-conformal ligand binding assay using only a single sample concentration. We compare this novel analysis method to the usual concentration-range approach for both SPR-based assay principles and discuss its impact on data quality and increased sample throughput. Copyright © 2018 Elsevier B.V. All rights reserved.

A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

PubMed

Banasik, Michał; Sachadyn, Paweł

2016-09-01

A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

Application of an in vitro DNA protection assay to visualize stress mediation properties of the Dps protein.

PubMed

Karas, Vlad O; Westerlaken, Ilja; Meyer, Anne S

2013-05-31

Oxidative stress is an unavoidable byproduct of aerobic life. Molecular oxygen is essential for terrestrial metabolism, but it also takes part in many damaging reactions within living organisms. The combination of aerobic metabolism and iron, which is another vital compound for life, is enough to produce radicals through Fenton chemistry and degrade cellular components. DNA degradation is arguably the most damaging process involving intracellular radicals, as DNA repair is far from trivial. The assay presented in this article offers a quantitative technique to measure and visualize the effect of molecules and enzymes on radical-mediated DNA damage. The DNA protection assay is a simple, quick, and robust tool for the in vitro characterization of the protective properties of proteins or chemicals. It involves exposing DNA to a damaging oxidative reaction and adding varying concentrations of the compound of interest. The reduction or increase of DNA damage as a function of compound concentration is then visualized using gel electrophoresis. In this article we demonstrate the technique of the DNA protection assay by measuring the protective properties of the DNA-binding protein from starved cells (Dps). Dps is a mini-ferritin that is utilized by more than 300 bacterial species to powerfully combat environmental stressors. Here we present the Dps purification protocol and the optimized assay conditions for evaluating DNA protection by Dps.

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva† †Electronic supplementary information (ESI) available: Optimization of Mg2+ and ATMND concentrations for our CBSA-based ATMND-binding assay; ATMND-reported calibration curve for CBSA-5325 at various cocaine concentrations; ATMND binding affinity for the cocaine-assembled CBSA-5325; K D of 38-GC and different 38-GC mutants for cocaine as characterized by ITC; stem length effects on cocaine-induced CBSA assembly; spectra of CBSA-5335-based fluorescence detection of cocaine in 1× binding buffer; characterization of cocaine binding affinity of CBSA-5335 and PSA using ITC; fluorescence detection of cocaine in saliva with our fluorophore/quencher modified CBSA-5335; calibration curve of our CBSA-5335-based fluorophore/quencher assay in 1× binding buffer and 10% saliva at cocaine concentrations ranging from 0 to 10 μM; bias and precision of the CBSA-5335-based fluorophore/quencher assay; comparison of amplification-free split-aptamer assays for cocaine detection; sequence ID and DNA sequences used in this work. See DOI: 10.1039/c6sc01833e Click here for additional data file.

PubMed Central

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157

Highly variable sensitivity of five binding and two bio-assays for TSH-receptor antibodies.

PubMed

Diana, T; Wüster, C; Kanitz, M; Kahaly, G J

2016-10-01

TSH-receptor (TSHR) antibodies (Ab) can be measured with binding or bio-assays. Sensitivity and specificity of five binding and two bio-assays were compared. TSHR-blocking (TBAb) and TSHR-stimulating (TSAb) Ab were measured with reporter bio-assays. Blocking activity was defined as percent inhibition of luciferase expression relative to induction with bTSH alone. TSAb was reported as percentage of specimen-to-reference ratio (SRR%). TSHR-binding inhibitory immunoglobulins (TBII) were measured with Kronus, Dynex, Kryptor, Cobas, and Immulite. Sixty patients with Graves' disease (GD), 20 with Hashimoto's thyroiditis (HT), and 20 healthy controls (C) were included. C tested negative in all assays (specificity 100 %) while all 60 hyperthyroid GD patients tested positive in the TSAb bio-assay (sensitivity 100 %). Among these 60 GD patients, 20 had low TSAb positivity (SRR% 140-279), but were TBII positive in only 20 (100 %), 7 (35 %), 9 (45 %), 11 (55 %), and 18 (90 %) using the Kronus, Dynex, Kryptor, Cobas, and Immulite, respectively. In 20 moderate TSAb-positive (SRR% 280-420) patients, TBII tested positive in 20 (100 %), 14 (70 %), 13 (65 %), 16 (80 %), and 19 (95 %), respectively. The high (SRR% > 420) TSAb-positive patients were all TBII positive. All 20 hypothyroid HT patients tested TBAb positive (sensitivity 100 %) in the bio-assay while they tested TBII positive in 20 (100 %), 18 (90 %), 20, 20, and 18, respectively. Results obtained with two luminometers correlated for TSAb positive (r = 0.99, p < 0.001), TBAb positive (r = 0.88, p < 0.001), and C (r = 0.86, p < 0.001). None of the binding assays differentiated between TSAb and TBAb. Sensitivity is highly variable between binding and bio-assays for TSHR-Abs.

Editor's Highlight: Structure-Based Investigation on the Binding and Activation of Typical Pesticides With Thyroid Receptor.

PubMed

Xiang, Dandan; Han, Jian; Yao, Tingting; Wang, Qiangwei; Zhou, Bingsheng; Mohamed, Abou Donia; Zhu, Guonian

2017-12-01

A broad range of pesticides have been reported to interfere with the normal function of the thyroid endocrine system. However, the precise mechanism(s) of action has not yet been thoroughly elucidated. In this study, 21 pesticides were assessed for their binding interactions and the potential to disrupt thyroid homeostasis. In the GH3 luciferase reporter gene assays, 5 of the pesticides tested had agonistic effects in the order of procymidone > imidacloprid > mancozeb > fluroxypyr > atrazine. 11 pesticides inhibited luciferase activity of T3 to varying degrees, demonstrating their antagonistic activity. And there are 4 pesticides showed mixed effects when treated with different concentrations. Surface plasmon resonance (SPR) biosensor technique was used to directly measure the binding interactions of these pesticides to the human thyroid hormone receptor (hTR). 13 pesticides were observed to bind directly with TR, with a KD ranging from 4.80E-08 M to 9.44E-07 M. The association and disassociation of the hTR/pesticide complex revealed 2 distinctive binding modes between the agonists and antagonists. At the same time, a different binding mode was displayed by the pesticides showed mix agonist and antagonist activity. In addition, the molecular docking simulation analyses indicated that the interaction energy calculated by CDOCKER for the agonists and antagonists correlated well with the KD values measured by the surface plasmon resonance assay. These results help to explain the differences of the TR activities of these tested pesticides. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Noncompetitive blocking of human GLUT1 hexose transporter by methylxanthines reveals an exofacial regulatory binding site.

PubMed

Ojeda, Paola; Pérez, Alejandra; Ojeda, Lorena; Vargas-Uribe, Mauricio; Rivas, Coralia I; Salas, Monica; Vera, Juan Carlos; Reyes, Alejandro M

2012-09-01

Glucose transporter (GLUT)1 has become an attractive target to block glucose uptake in malignant cells since most cancer cells overexpress GLUT1 and are sensitive to glucose deprivation. Methylxanthines are natural compounds that inhibit glucose uptake; however, the mechanism of inhibition remains unknown. Here, we used a combination of binding and glucose transport kinetic assays to analyze in detail the effects of caffeine, pentoxifylline, and theophylline on hexose transport in human erythrocytes. The displacement of previously bound cytochalasin B revealed a direct interaction between the methylxanthines and GLUT1. Methylxanthines behave as noncompetitive blockers (inhibition constant values of 2-3 mM) in exchange and zero-trans efflux assays, whereas mixed inhibition with a notable uncompetitive component is observed in zero-trans influx assays (inhibition constant values of 5-12 mM). These results indicate that methylxanthines do not bind to either exofacial or endofacial d-glucose-binding sites but instead interact at a different site accessible by the external face of the transporter. Additionally, infinite-cis exit assays (Sen-Widdas assays) showed that only pentoxifylline disturbed d-glucose for binding to the exofacial substrate site. Interestingly, coinhibition assays showed that methylxanthines bind to a common site on the transporter. We concluded that there is a methylxanthine regulatory site on the external surface of the transporter, which is close but distinguishable from the d-glucose external site. Therefore, the methylxanthine moiety may become an attractive framework for the design of novel specific noncompetitive facilitative GLUT inhibitors.

Homogeneous time-resolved G protein-coupled receptor-ligand binding assay based on fluorescence cross-correlation spectroscopy.

PubMed

Antoine, Thomas; Ott, David; Ebell, Katharina; Hansen, Kerrin; Henry, Luc; Becker, Frank; Hannus, Stefan

2016-06-01

G protein-coupled receptors (GPCRs) mediate many important physiological functions and are considered as one of the most successful therapeutic target classes for a wide spectrum of diseases. Drug discovery projects generally benefit from a broad range of experimental approaches for screening compound libraries and for the characterization of binding modes of drug candidates. Owing to the difficulties in solubilizing and purifying GPCRs, assay formats have been so far mainly limited to cell-based functional assays and radioligand binding assays. In this study, we used fluorescence cross-correlation spectroscopy (FCCS) to analyze the interaction of detergent-solubilized receptors to various types of GPCR ligands: endogenous peptides, small molecules, and a large surrogate antagonist represented by a blocking monoclonal antibody. Our work demonstrates the suitability of the homogeneous and time-resolved FCCS assay format for a robust, high-throughput determination of receptor-ligand binding affinities and kinetic rate constants for various therapeutically relevant GPCRs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Label-free quantitative 1H NMR spectroscopy to study low-affinity ligand–protein interactions in solution: A contribution to the mechanism of polyphenol-mediated astringency

PubMed Central

Delius, Judith; Frank, Oliver

2017-01-01

Nuclear magnetic resonance (NMR) spectroscopy is well-established in assessing the binding affinity between low molecular weight ligands and proteins. However, conventional NMR-based binding assays are often limited to small proteins of high purity and may require elaborate isotopic labeling of one of the potential binding partners. As protein–polyphenol complexation is assumed to be a key event in polyphenol-mediated oral astringency, here we introduce a label-free, ligand-focused 1H NMR titration assay to estimate binding affinities and characterize soluble complex formation between proteins and low molecular weight polyphenols. The method makes use of the effects of NMR line broadening due to protein–ligand interactions and quantitation of the non-bound ligand at varying protein concentrations by quantitative 1H NMR spectroscopy (qHNMR) using electronic reference to access in vivo concentration (ERETIC 2). This technique is applied to assess the interaction kinetics of selected astringent tasting polyphenols and purified mucin, a major lubricating glycoprotein of human saliva, as well as human whole saliva. The protein affinity values (BC50) obtained are subsequently correlated with the intrinsic mouth-puckering, astringent oral sensation imparted by these compounds. The quantitative NMR method is further exploited to study the effect of carboxymethyl cellulose, a candidate “anti-astringent” protein binding antagonist, on the polyphenol–protein interaction. Consequently, the NMR approach presented here proves to be a versatile tool to study the interactions between proteins and low-affinity ligands in solution and may find promising applications in the discovery of bioactives. PMID:28886151

Persistent Graves' hyperthyroidism despite rapid negative conversion of thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results: a case report.

PubMed

Ohara, Nobumasa; Kaneko, Masanori; Kitazawa, Masaru; Uemura, Yasuyuki; Minagawa, Shinichi; Miyakoshi, Masashi; Kaneko, Kenzo; Kamoi, Kyuzi

2017-02-06

Graves' disease is an autoimmune thyroid disorder characterized by hyperthyroidism, and patients exhibit thyroid-stimulating hormone receptor antibody. The major methods of measuring circulating thyroid-stimulating hormone receptor antibody include the thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Although the diagnostic accuracy of these assays has been improved, a minority of patients with Graves' disease test negative even on second-generation and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulins. We report a rare case of a thyroid-stimulating hormone-binding inhibitory immunoglobulin-positive patient with Graves' disease who showed rapid lowering of thyroid-stimulating hormone-binding inhibitory immunoglobulin levels following administration of the anti-thyroid drug thiamazole, but still experienced Graves' hyperthyroidism. A 45-year-old Japanese man presented with severe hyperthyroidism (serum free triiodothyronine >25.0 pg/mL; reference range 1.7 to 3.7 pg/mL) and tested weakly positive for thyroid-stimulating hormone-binding inhibitory immunoglobulins on second-generation tests (2.1 IU/L; reference range <1.0 IU/L). Within 9 months of treatment with oral thiamazole (30 mg/day), his thyroid-stimulating hormone-binding inhibitory immunoglobulin titers had normalized, but he experienced sustained hyperthyroidism for more than 8 years, requiring 15 mg/day of thiamazole to correct. During that period, he tested negative on all first-generation, second-generation, and third-generation thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, but thyroid scintigraphy revealed diffuse and increased uptake, and thyroid ultrasound and color flow Doppler imaging showed typical findings of Graves' hyperthyroidism. The possible explanations for serial changes in the thyroid-stimulating hormone-binding inhibitory immunoglobulin results in our patient include the presence of thyroid-stimulating hormone receptor antibody, which is bioactive but less reactive on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays, or the effect of reduced levels of circulating thyroid-stimulating hormone receptor antibody upon improvement of thyroid autoimmunity with thiamazole treatment. Physicians should keep in mind that patients with Graves' disease may show thyroid-stimulating hormone-binding inhibitory immunoglobulin assay results that do not reflect the severity of Graves' disease or indicate the outcome of the disease, and that active Graves' disease may persist even after negative results on thyroid-stimulating hormone-binding inhibitory immunoglobulin assays. Timely performance of thyroid function tests in combination with sensitive imaging tests, including thyroid ultrasound and scintigraphy, are necessary to evaluate the severity of Graves' disease and treatment efficacy.

Measuring Norfloxacin Binding to Trypsin Using a Fluorescence Quenching Assay in an Upper-Division, Integrated Laboratory Course

ERIC Educational Resources Information Center

Hicks, Katherine A.

2016-01-01

Fluorescence quenching assays are often used to measure dissociation constants that quantify the binding affinity between small molecules and proteins. In an upper-division undergraduate laboratory course, where students work on projects using a guided inquiry-based approach, a binding titration experiment at physiological pH is performed to…

Complementary Spectroscopic Assays for Investigating Protein-Ligand Binding Activity: A Project for the Advanced Chemistry Laboratory

ERIC Educational Resources Information Center

Mascotti, David P.; Waner, Mark J.

2010-01-01

A protein-ligand binding, guided-inquiry laboratory project with potential application across the advanced undergraduate curriculum is described. At the heart of the project are fluorescence and spectrophotometric assays utilizing biotin-4-fluorescein and streptavidin. The use of the same stock solutions for an assay that may be examined by two…

DEVELOPMENT AND CHARACTERIZATION OF A CELL LINE THAT STABLY EXPRESSES AN ESTROGEN-RESPONSIVE LUCIFERASE REPORTER FOR THE DETECTION OF ESTROGEN RECEPTOR AGONIST AND ANTAGONISTS

EPA Science Inventory

Screening for endocrine disrupting chemicals (EDCs) that act as estrogens or antiestrogens relies on the use of in vitro binding and gene expression assays coupled with short-term diagnostic in vivo assays. Although binding assays are useful to identify chemicals that are competi...

Lipid A binding sites in membranes of macrophage tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.

1988-10-15

Lipopolysaccharide affects a variety of eukaryotic cells and mammalian organisms. These actions are involved in the pathogenesis of Gram-negative septicemia. Many of the actions of lipopolysaccharide are believed to be caused by its active moiety, lipid A. Our laboratory has previously identified a bioactive lipid A precursor, termed lipid IVA, which can be labeled with 32P of high specific activity and purified. In this work we have used the labeled probe, 4'-32P-lipid IVA, to develop a novel assay for the specific binding of lipid IVA to whole cells. We have also demonstrated its use in a ligand blotting assay ofmore » immobilized cellular proteins. Using the whole cell assay, we show that 4'-32P-lipid IVA specifically binds to RAW 264.7 macrophage-like cultured cells. The binding is saturable, is inhibited with excess unlabeled lipid IVA, and is proteinase K-sensitive. It displays cellular and pharmacological specificity. Using the ligand blotting assay, we show that several RAW 264.7 cell proteins can bind 4'-32P-lipid IVA. The two principal binding proteins have Mr values of 31 and 95 kDa, as judged by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Fractionation studies indicate that the 31-kDa protein is enriched in the nuclear fraction and may be a histone, whereas the 95-kDa protein is enriched in the membrane fraction. The binding assays that we have developed should lead to a clearer understanding of lipid A/animal cell interactions.« less

Novel Multiplexed Assay for Identifying SH2 Domain Antagonists of STAT Family Proteins

PubMed Central

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z’ values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors. PMID:23977103

Novel multiplexed assay for identifying SH2 domain antagonists of STAT family proteins.

PubMed

Takakuma, Kazuyuki; Ogo, Naohisa; Uehara, Yutaka; Takahashi, Susumu; Miyoshi, Nao; Asai, Akira

2013-01-01

Some of the signal transducer and activator of transcription (STAT) family members are constitutively activated in a wide variety of human tumors. The activity of STAT depends on their Src homology 2 (SH2) domain-mediated binding to sequences containing phosphorylated tyrosine. Thus, antagonizing this binding is a feasible approach to inhibiting STAT activation. We have developed a novel multiplexed assay for STAT3- and STAT5b-SH2 binding, based on amplified luminescent proximity homogeneous assay (Alpha) technology. AlphaLISA and AlphaScreen beads were combined in a single-well assay, which allowed the binding of STAT3- and STAT5b-SH2 to phosphotyrosine peptides to be simultaneously monitored. Biotin-labeled recombinant human STAT proteins were obtained as N- and C-terminal deletion mutants. The spacer length of the DIG-labeled peptide, the reaction time, and the concentration of sodium chloride were optimized to establish a HTS system with Z' values of greater than 0.6 for both STAT3- and STAT5b-SH2 binding. We performed a HTS campaign for chemical libraries using this multiplexed assay and identified hit compounds. A 2-chloro-1,4-naphthalenedione derivative, Compound 1, preferentially inhibited STAT3-SH2 binding in vitro, and the nuclear translocation of STAT3 in HeLa cells. Initial structure activity relationship (SAR) studies using the multiplexed assay showed the 3-substituent effect on both the activity and selectivity of STAT3 and STAT5b inhibition. Therefore, this multiplexed assay is useful for not only searching for potential lead compounds but also obtaining SAR data for developing new STAT3/STAT5b inhibitors.

Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

PubMed

Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions.

PubMed

Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

2017-01-19

A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.

Application of NMR Methods to Identify Detection Reagents for Use in the Development of Robust Nanosensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Krishnan, V V; Balhorn, R

2004-04-29

Nuclear Magnetic Resonance (NMR) spectroscopy is a powerful technique for studying bi-molecular interactions at the atomic scale. Our NMR lab is involved in the identification of small molecules, or ligands that bind to target protein receptors, such as tetanus (TeNT) and botulinum (BoNT) neurotoxins, anthrax proteins and HLA-DR10 receptors on non-Hodgkin's lymphoma cancer cells. Once low affinity binders are identified, they can be linked together to produce multidentate synthetic high affinity ligands (SHALs) that have very high specificity for their target protein receptors. An important nanotechnology application for SHALs is their use in the development of robust chemical sensors ormore » biochips for the detection of pathogen proteins in environmental samples or body fluids. Here, we describe a recently developed NMR competition assay based on transferred nuclear Overhauser effect spectroscopy (trNOESY) that enables the identification of sets of ligands that bind to the same site, or a different site, on the surface of TeNT fragment C (TetC) than a known ''marker'' ligand, doxorubicin. Using this assay, we can identify the optimal pairs of ligands to be linked together for creating detection reagents, as well as estimate the relative binding constants for ligands competing for the same site.« less

Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions

NASA Astrophysics Data System (ADS)

Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

2017-01-01

A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.

Antioxidant and Antiplasmodial Activities of Bergenin and 11-O-Galloylbergenin Isolated from Mallotus philippensis

PubMed Central

Khan, Hamayun; Amin, Hazrat; Ullah, Asad; Saba, Sumbal; Rafique, Jamal; Khan, Khalid; Ahmad, Nasir; Badshah, Syed Lal

2016-01-01

Two important biologically active compounds were isolated from Mallotus philippensis. The isolated compounds were characterized using spectroanalytical techniques and found to be bergenin (1) and 11-O-galloylbergenin (2). The in vitro antioxidant and antiplasmodial activities of the isolated compounds were determined. For the antioxidant potential, three standard analytical protocols, namely, DPPH radical scavenging activity (RSA), reducing power assay (RPA), and total antioxidant capacity (TAC) assay, were adopted. The results showed that compound 2 was found to be more potent antioxidant as compared to 1. Fascinatingly, compound 2 displayed better EC50 results as compared to α-tocopherol while being comparable with ascorbic acid. The antiplasmodial assay data showed that both the compound exhibited good activity against chloroquine sensitive strain of Plasmodium falciparum (D10) and IC50 values were found to be less than 8 μM. The in silico molecular docking analyses were also performed for the determination of binding affinity of the isolated compounds using P. falciparum proteins PfLDH and Pfg27. The results showed that compound 2 has high docking score and binding affinity to both protein receptors as compared to compound 1. The demonstrated biological potentials declared that compound 2 could be the better natural antioxidant and antiplasmodial candidate. PMID:26998192

Identification of a small-molecule ligand of the epigenetic reader protein Spindlin1 via a versatile screening platform

PubMed Central

Wagner, Tobias; Greschik, Holger; Burgahn, Teresa; Schmidtkunz, Karin; Schott, Anne-Kathrin; McMillan, Joel; Baranauskienė, Lina; Xiong, Yan; Fedorov, Oleg; Jin, Jian; Oppermann, Udo; Matulis, Daumantas; Schüle, Roland; Jung, Manfred

2016-01-01

Epigenetic modifications of histone tails play an essential role in the regulation of eukaryotic transcription. Writer and eraser enzymes establish and maintain the epigenetic code by creating or removing posttranslational marks. Specific binding proteins, called readers, recognize the modifications and mediate epigenetic signalling. Here, we present a versatile assay platform for the investigation of the interaction between methyl lysine readers and their ligands. This can be utilized for the screening of small-molecule inhibitors of such protein–protein interactions and the detailed characterization of the inhibition. Our platform is constructed in a modular way consisting of orthogonal in vitro binding assays for ligand screening and verification of initial hits and biophysical, label-free techniques for further kinetic characterization of confirmed ligands. A stability assay for the investigation of target engagement in a cellular context complements the platform. We applied the complete evaluation chain to the Tudor domain containing protein Spindlin1 and established the in vitro test systems for the double Tudor domain of the histone demethylase JMJD2C. We finally conducted an exploratory screen for inhibitors of the interaction between Spindlin1 and H3K4me3 and identified A366 as the first nanomolar small-molecule ligand of a Tudor domain containing methyl lysine reader. PMID:26893353

Development of a β-Lactoglobulin Sensor Based on SPR for Milk Allergens Detection.

PubMed

Ashley, Jon; D'Aurelio, Roberta; Piekarska, Monika; Temblay, Jeff; Pleasants, Mike; Trinh, Linda; Rodgers, Thomas L; Tothill, Ibtisam E

2018-03-27

A sensitive and label-free surface plasmon resonance (SPR) based sensor was developed in this work for the detection of milk allergens. β-lactoglobulin (BLG) protein was used as the biomarker for cow milk detection. This is to be used directly in final rinse samples of cleaning in-place (CIP) systems of food manufacturers. The affinity assay was optimised and characterised before a standard curve was performed in pure buffer conditions, giving a detection limit of 0.164 µg mL -1 as a direct binding assay. The detection limit can be further enhanced through the use of a sandwich assay and amplification with nanomaterials. However, this was not required here, as the detection limit achieved exceeded the required allergen detection levels of 2 µg mL -1 for β-lactoglobulin. The binding affinities of the polyclonal antibody for BLG, expressed by the dissociation constant (K D ), were equal to 2.59 × 10 -9 M. The developed SPR-based sensor offers several advantages in terms of label-free detection, real-time measurements, potential on-line system and superior sensitivity when compared to ELISA-based techniques. The method is novel for this application and could be applied to wider food allergen risk management decision(s) in food manufacturing.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA

NASA Astrophysics Data System (ADS)

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-01

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA.

PubMed

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-15

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging. Copyright © 2015 Elsevier B.V. All rights reserved.

Droplet microfluidics with magnetic beads: a new tool to investigate drug-protein interactions.

PubMed

Lombardi, Dario; Dittrich, Petra S

2011-01-01

In this study, we give the proof of concept for a method to determine binding constants of compounds in solution. By implementing a technique based on magnetic beads with a microfluidic device for segmented flow generation, we demonstrate, for individual droplets, fast, robust and complete separation of the magnetic beads. The beads are used as a carrier for one binding partner and hence, any bound molecule is separated likewise, while the segmentation into small microdroplets ensures fast mixing, and opens future prospects for droplet-wise analysis of drug candidate libraries. We employ the method for characterization of drug-protein binding, here warfarin to human serum albumin. The approach lays the basis for a microfluidic droplet-based screening device aimed at investigating the interactions of drugs with specific targets including enzymes and cells. Furthermore, the continuous method could be employed for various applications, such as binding assays, kinetic studies, and single cell analysis, in which rapid removal of a reactive component is required.

DNA-protective activities of hyperforin and aristoforin.

PubMed

Ševčovičová, A; Šemeláková, M; Plšíková, J; Loderer, D; Imreová, P; Gálová, E; Kožurková, M; Miadoková, E; Fedoročko, P

2015-04-01

The aim of this study was to explain the molecular mechanisms of action of hyperforin, a phluoroglucinol derivative found in Hypericum perforatum L. and its more stable derivative aristoforin. DNA-topology assay revealed partial DNA-protective activities of hyperforin and aristoforin against Fe(2+)-induced DNA breaks. In order to assess molecular mechanisms underlying DNA-protective activity, the potential antioxidant activity of hyperforin and aristoforin was investigated using DPPH and OH scavenging assays, reducing power assay and Fe(2+)-chelating assay. We also studied interaction of hyperforin and aristoforin with DNA using established protocols for fluorescence titration. The ability of the studied compounds to relax topoisomerase I with electrophoretic techniques was investigated. The reduction in the fluorescence of hyperforin indicated an interaction between hyperforin and DNA with a binding constant of 0.2×10(8)M(-1). We suggest that a mechanism of hyperforin/aristoforin DNA-protective abilities is based on free radicals (mainly OH) scavenging activity. Copyright © 2015 Elsevier Ltd. All rights reserved.

Indirect radioimmunoassay for thymus leukemia (TL) antigens. [Mice, /sup 125/I tracer technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Esmon, N.L.; Little, J.R.

1976-09-01

An indirect radioimmunoassay for thymus leukemia TL antigens has been developed and its specificity documented. The assay makes use of anti-TL antibodies produced in congenic mice (A-Tla/sup b/) and radioiodinated purified rabbit anti-mouse IgG. Using this assay, differences can be detected in the amounts of antigen expressed on thymocytes of the three known phenotypes (TL.1,2,3; TL.2; TL/sup -/) of inbred mouse strains. Significant differences are also detected in comparison of the thymocytes from homozygous TL.1,2,3 mice (A-Tla/sup a/) and heterozygotes from Tla/sup a/ and Tla/sup b/ parents. Optimum conditions for the assay have been established. Its ability to detect antigensmore » on glutaraldehyde-fixed cells and the binding of noncytolytic antibodies on both viable and fixed cells are documented. The assay has also been used to quantitate the changes in TL antigen expression on cells incubated in anti-TL antisera under conditions of antigenic modulation.« less

Development and validation of an LC-ESI-MS/MS method for the quantification of D-84, reboxetine and citalopram for their use in MS Binding Assays addressing the monoamine transporters hDAT, hSERT and hNET.

PubMed

Neiens, Patrick; De Simone, Angela; Ramershoven, Anna; Höfner, Georg; Allmendinger, Lars; Wanner, Klaus T

2018-03-03

MS Binding Assays represent a label-free alternative to radioligand binding assays. In this study, we present an LC-ESI-MS/MS method for the quantification of (R,R)-4-(2-benzhydryloxyethyl)-1-(4-fluorobenzyl)piperidin-3-ol [(R,R)-D-84, (R,R)-1], (S,S)-reboxetine [(S,S)-2], and (S)-citalopram [(S)-3] employed as highly selective nonlabeled reporter ligands in MS Binding Assays addressing the dopamine [DAT, (R,R)-D-84], norepinephrine [NET, (S,S)-reboxetine] and serotonin transporter [SERT, (S)-citalopram], respectively. The developed LC-ESI-MS/MS method uses a pentafluorphenyl stationary phase in combination with a mobile phase composed of acetonitrile and ammonium formate buffer for chromatography and a triple quadrupole mass spectrometer in the multiple reaction monitoring mode for mass spectrometric detection. Quantification is based on deuterated derivatives of all three analytes serving as internal standards. The established LC-ESI-MS/MS method enables fast, robust, selective and highly sensitive quantification of all three reporter ligands in a single chromatographic run. The method was validated according to the Center for Drug Evaluation and Research (CDER) guideline for bioanalytical method validation regarding selectivity, accuracy, precision, calibration curve and sensitivity. Finally, filtration-based MS Binding Assays were performed for all three monoamine transporters based on this LC-ESI-MS/MS quantification method as read out. The affinities determined in saturation experiments for (R,R)-D-84 toward hDAT, for (S,S)-reboxetine toward hNET, and for (S)-citalopram toward hSERT, respectively, were in good accordance with results from literature, clearly demonstrating that the established MS Binding Assays have the potential to be an efficient alternative to radioligand binding assays widely used for this purpose so far. Copyright © 2018 John Wiley & Sons, Ltd.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Development of rapid and sensitive high throughput pharmacologic assays for marine phycotoxins.

PubMed

Van Dolah, F M; Finley, E L; Haynes, B L; Doucette, G J; Moeller, P D; Ramsdell, J S

1994-01-01

The lack of rapid, high throughput assays is a major obstacle to many aspects of research on marine phycotoxins. Here we describe the application of microplate scintillation technology to develop high throughput assays for several classes of marine phycotoxin based on their differential pharmacologic actions. High throughput "drug discovery" format microplate receptor binding assays developed for brevetoxins/ciguatoxins and for domoic acid are described. Analysis for brevetoxins/ciguatoxins is carried out by binding competition with [3H] PbTx-3 for site 5 on the voltage dependent sodium channel in rat brain synaptosomes. Analysis of domoic acid is based on binding competition with [3H] kainic acid for the kainate/quisqualate glutamate receptor using frog brain synaptosomes. In addition, a high throughput microplate 45Ca flux assay for determination of maitotoxins is described. These microplate assays can be completed within 3 hours, have sensitivities of less than 1 ng, and can analyze dozens of samples simultaneously. The assays have been demonstrated to be useful for assessing algal toxicity and for assay-guided purification of toxins, and are applicable to the detection of biotoxins in seafood.

FcUni-RLuc: an engineered Renilla luciferase with Fc binding ability and light emission activity.

PubMed

Farzannia, A; Roghanian, R; Zarkesh-Esfahani, S H; Nazari, M; Emamzadeh, R

2015-03-07

A novel and advanced Fc-binding probe – FcUni-RLuc namely – has been produced and functionally assayed for labelling IgGs. The Fc antibody binding sequence – HWRGWV – was fused to Renilla luciferase, and the purified probe was employed for bioluminescence enzyme-linked immunoabsorbance assay of Her2 positive cells.

In vivo biotinylation and incorporation of a photo-inducible unnatural amino acid to an antibody-binding domain improve site-specific labeling of antibodies.

PubMed

Kanje, Sara; Hober, Sophia

2015-04-01

Antibodies are important molecules in many research fields, where they play a key role in various assays. Antibody labeling is therefore of great importance. Currently, most labeling techniques take advantage of certain amino acid side chains that commonly appear throughout proteins. This makes it hard to control the position and exact degree of labeling of each antibody. Hence, labeling of the antibody may affect the antibody-binding site. This paper presents a novel protein domain based on the IgG-binding domain C2 of streptococcal protein G, containing the unnatural amino acid BPA, that can cross-link other molecules. This novel domain can, with improved efficiency compared to previously reported similar domains, site-specifically cross-link to IgG at the Fc region. An efficient method for simultaneous in vivo incorporation of BPA and specific biotinylation in a flask cultivation of Escherichia coli is described. In comparison to a traditionally labeled antibody sample, the C2-labeled counterpart proved to have a higher proportion of functional antibodies when immobilized on a solid surface and the same limit of detection in an ELISA. This method of labeling is, due to its efficiency and simplicity, of high interest for all antibody-based assays where it is important that labeling does not interfere with the antibody-binding site. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

PubMed Central

Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

2009-01-01

The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

Development of an enzyme-linked immunosorbent assay and a beta-1 adrenergic receptor-based assay for monitoring the drug atenolol.

PubMed

Sapir, A; Shalev, A Hariton; Skalka, N; Bronshtein, A; Altstein, M

2013-03-01

Two approaches for monitoring atenolol (ATL) were applied: an immunochemical assay and a competitive-binding assay, based on the interaction between ATL and its target receptor, β1 adrenergic receptor (β1AR). Polyclonal antibodies (Abs) for ATL were generated, and a highly specific microplate immunochemical assay, that is, an enzyme-linked immunosorbent assay (ELISA), for its detection was developed. The ATL ELISA exhibited I50 and limit of detection (I20) values of 0.15 ± 0.048 and 0.032 ± 0.016 ng/ml, respectively, and the Abs did not cross-react with any of the tested beta-blocker drugs. Furthermore, a human β1AR (h-β1AR) was stably expressed in Spodoptera frugiperda cells (Sf9). The receptor was employed to develop a competitive-binding assay that monitored binding of ATL in the presence of isoproteranol by quantification of secondary messenger, cyclic adenosine monophosphate (cAMP), levels in the transfected cells. The assay showed that the recombinant h-β1AR was functional, could bind the agonistic ligand isoproterenol as well as the antagonist ATL, as indicated by a dose-dependent elevation of cAMP in the presence of isoproteranol, and decrease after ATL addition. The highly efficient and sensitive ELISA and the receptor assay represent two methods suitable for efficient and cost-effective large-scale, high-throughput monitoring of ATL in environmental, agricultural, and biological samples. Copyright © 2012 SETAC.

ApoHRP-based assay to measure intracellular regulatory heme.

PubMed

Atamna, Hani; Brahmbhatt, Marmik; Atamna, Wafa; Shanower, Gregory A; Dhahbi, Joseph M

2015-02-01

The majority of the heme-binding proteins possess a "heme-pocket" that stably binds to heme. Usually known as housekeeping heme-proteins, they participate in a variety of metabolic reactions (e.g., catalase). Heme also binds with lower affinity to the "Heme-Regulatory Motifs" (HRM) in specific regulatory proteins. This type of heme binding is known as exchangeable or regulatory heme (RH). Heme binding to HRM proteins regulates their function (e.g., Bach1). Although there are well-established methods for assaying total cellular heme (e.g., heme-proteins plus RH), currently there is no method available for measuring RH independent of the total heme (TH). The current study describes and validates a new method to measure intracellular RH. This method is based on the reconstitution of apo-horseradish peroxidase (apoHRP) with heme to form holoHRP. The resulting holoHRP activity is then measured with a colorimetric substrate. The results show that apoHRP specifically binds RH but not with heme from housekeeping heme-proteins. The RH assay detects intracellular RH. Furthermore, using conditions that create positive (hemin) or negative (N-methyl protoporphyrin IX) controls for heme in normal human fibroblasts (IMR90), the RH assay shows that RH is dynamic and independent of TH. We also demonstrated that short-term exposure to subcytotoxic concentrations of lead (Pb), mercury (Hg), or amyloid-β (Aβ) significantly alters intracellular RH with little effect on TH. In conclusion the RH assay is an effective assay to investigate intracellular RH concentration and demonstrates that RH represents ∼6% of total heme in IMR90 cells.

Surface plasmon resonance-based competition assay to assess the sera reactivity of variants of humanized antibodies.

PubMed

Gonzales, Noreen R; Schuck, Peter; Schlom, Jeffrey; Kashmiri, Syed V S

2002-10-15

While clinical trials are the only way to evaluate the immunogenicity, in patients, of murine or genetically engineered humanized variants of a potentially therapeutic or diagnostic monoclonal antibody (MAb), ethical and logistical considerations of clinical trials do not permit the evaluation of variants of a given MAb that are generated to minimize its immunogenicity. The most promising variant could be identified by comparing the reactivities of the parental antibody (Ab) and its variants to the sera of patients containing anti-variable region (anti-VR) Abs to the administered parental Ab. We have developed a surface plasmon resonance (SPR) biosensor-based assay to monitor the binding of the sera anti-VR Abs to the parental Ab and the inhibition of this binding by the variants. SPR biosensors allow the real-time detection and monitoring of the binding between an immobilized protein and its soluble ligand without the need for prior purification and labeling of the mobile analyte. This new assay requires no radiolabeling, is relatively less time-consuming, and uses only small amounts of serum (5-20 microl of diluted serum) through a new microfluidic sample handling technique. To validate the assay, we have tested the relative reactivities of the CDR-grafted anti-carcinoma Ab, HuCC49, and its two variants, designated V5 and V10, to the sera of patients who were earlier administered radiolabeled murine CC49 in a clinical trial. A comparison of IC(50)s (the concentrations of the competitor Abs required for 50% inhibition of the binding of sera to immobilized HuCC49) showed that V5 and V10 were less reactive than HuCC49 to the three patients' sera tested. We have also demonstrated, for the first time, the specific detection and comparison of relative amounts of anti-VR Abs present in the sera of different patients without prior removal of anti-murine Fc Abs and/or circulating antigen. This may facilitate the rapid screening, for the presence of anti-VR Abs, of the sera of patients undergoing clinical trials.

Mathematical simulations for bioanalytical assay development: the (un-)necessity and (im-)possibility of free drug quantification.

PubMed

Staack, Roland F; Jordan, Gregor; Heinrich, Julia

2012-02-01

For every drug development program it needs to be discussed whether discrimination between free and total drug concentrations is required to accurately describe its pharmacokinetic behavior. This perspective describes the application of mathematical simulation approaches to guide this initial decision based on available knowledge about target biology, binding kinetics and expected drug concentrations. We provide generic calculations that can be used to estimate the necessity of free drug quantification for different drug molecules. In addition, mathematical approaches are used to simulate various assay conditions in bioanalytical ligand-binding assays: it is demonstrated that due to the noncovalent interaction between the binding partners and typical assay-related interferences in the equilibrium, a correct quantification of the free drug concentration is highly challenging and requires careful design of different assay procedure steps.

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation.

PubMed

Ohuchi, Shoji J; Sagawa, Fumihiko; Sakamoto, Taiichi; Inoue, Tan

2015-10-23

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. The results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique. Copyright © 2015 Elsevier Inc. All rights reserved.

Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

NASA Astrophysics Data System (ADS)

Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

2016-10-01

New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

In vitro DNA binding studies of therapeutic and prophylactic drug citral.

PubMed

Alam, Md Fazle; Varshney, Supriya; Khan, Masood Alam; Laskar, Amaj Ahmed; Younus, Hina

2018-07-01

The study of drug-DNA interactions is of great importance, as it paves the way towards the design of better therapeutic agents. Here, the interaction of DNA with a therapeutic and prophylactic drug citral has been studied. We have attempted to ascertain the mode of binding of citral with calf thymus DNA (Ct-DNA) through various biophysical techniques. Analysis of the UV-visible absorbance spectra and fluorescence spectra indicated the formation of a complex between citral and Ct-DNA. Competitive binding assays with ethidium bromide (EB), acridine orange (AO) and Hoechst 33258 reflected that citral possibly intercalates within the Ct-DNA. These observations were further confirmed by circular dichroism (CD) spectral analysis, viscosity measurements, DNA melting and molecular docking studies. This study is expected to contribute to a better understanding of molecular mechanisms of citral, and design of new drugs in the future. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohuchi, Shoji J.; Sagawa, Fumihiko; Sakamoto, Taiichi

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. Themore » results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique.« less

Microbioassay of Antimicrobial Agents

PubMed Central

Simon, Harold J.; Yin, E. Jong

1970-01-01

A previously described agar-diffusion technique for microbioassay of antimicrobial agents has been modified to increase sensitivity of the technique and to extend the range of antimicrobial agents to which it is applicable. This microtechnique requires only 0.02 ml of an unknown test sample for assay, and is capable of measuring minute concentrations of antibiotics in buffer, serum, and urine. In some cases, up to a 20-fold increase in sensitivity is gained relative to other published standardized methods and the error of this method is less than ±5%. Buffer standard curves have been established for this technique, concurrently with serum standard curves, yielding information on antimicrobial serum-binding and demonstrating linearity of the data points compared to the estimated regression line for the microconcentration ranges covered by this technique. This microassay technique is particularly well suited for pediatric research and for other investigations where sample volumes are small and quantitative accuracy is desired. Dilution of clinical samples to attain concentrations falling with the range of this assay makes the technique readily adaptable and suitable for general clinical pharmacological studies. The microassay technique has been standardized in buffer solutions and in normal human serum pools for the following antimicrobials: ampicillin, methicillin, penicillin G, oxacillin, cloxacillin, dicloxacillin, cephaloglycin, cephalexin, cephaloridine, cephalothin, erythromycin, rifamycin amino methyl piperazine, kanamycin, neomycin, streptomycin, colistin, polymyxin B, doxycycline, minocycline, oxytetracycline, tetracycline, and chloramphenicol. PMID:4986725

Integration of Microsphere Resonators with Bioassay Fluidics for Whispering Gallery Mode Imaging

PubMed Central

Kim, Daniel C.; Armendariz, Kevin P.

2013-01-01

Whispering gallery mode resonators are small, radially symmetric dielectrics that trap light through continuous total internal reflection. The resonant condition at which light is efficiently confined within the structure is linked with refractive index, which has led to the development of sensitive label-free sensing schemes based on whispering gallery mode resonators. One resonator design uses inexpensive high index glass microspheres that offer intrinsically superior optical characteristics, but have proven difficult to multiplex and integrate with the fluidics for sample delivery and fluid exchange necessary for assay development. Recently, we introduced a fluorescence imaging approach that enables large scale multiplexing with microsphere resonators, thus removing one obstacle for assay development. Here we report an approach for microsphere immobilization that overcomes limitations arising from their integration with fluidic delivery. The approach is an adaptation of a calcium-assisted glass bonding method originally developed for microfluidic glass chip fabrication. Microspheres bonded to glass using this technique are shown to be stable with respect to fluid flow and show no detectable loss in optical performance. Measured Q-factors, for example, remain unchanged following sphere bonding to the substrate. The stability of the immobilized resonators is further demonstrated by transferring lipid films onto the immobilized spheres using the Langmuir-Blodgett technique. Bilayers of DOPC doped with GM1 were transferred onto immobilized resonators to detect the binding of cholera toxin to GM1. Binding curves generated from shifts in the whispering gallery mode resonance result in a measured Kd of 1.5 × 10−11 with a limit of detection of 3.3 pM. These results are discussed in terms of future assay development using microsphere resonators. PMID:23615457

Identification and Characterization of Strychnine-Binding Peptides Using Phage-Display Screening.

PubMed

Zhang, Fang; Wang, Min; Qiu, Zheng; Wang, Xiao-Meng; Xu, Chun-Lei; Zhang, Xia

2017-01-01

In drug development, phage display is a high-throughput method for identifying the specific cellular targets of drugs. However, insoluble small chemicals remain intractable to this technique because of the difficulty of presenting molecules to phages without occupying or destroying the limited functional groups. In the present study, we selected Strychnine (Stry) as a model compounda and sought to develope an alternative in vitro biopanning strategy against insoluble suspension. A phage library displaying random sequences of fifteen peptides was employed to screen for interactions between Stry and its cellular selective binding peptides, which are of great value to have a complete understanding of the mechanism of Stry for its antitumor activity. After four rounds of biopanning, a selection of 100 binding clones was randomly picked and subjected to modified proliferation and diffusion assays to evaluate the binding affinity of the clones. Finally, eleven clones were identified as positive binders. The corresponding peptides were synthesized and detected for their binding activities using surface plasmon resonance imaging (SPRi). Our study provides a feasible scheme for confirming the interaction of chemical compounds and cellular binding peptides. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

DNA binding properties and biological evaluation of dihydropyrimidinones derivatives as potential antitumor agents.

PubMed

Wang, Gongke; Li, Xiangrong; Gou, Yaping; Chen, Yuhan; Yan, Changling; Lu, Yan

2013-10-01

The binding properties of two medicinally important dihydropyrimidinones derivatives 5-(Ethoxycarbonyl)-6-methyl-4-phenyl-3,4-dihydropyrimidin-2(1H)-one (EMPD) and 5-(Ethoxycarbonyl)-6-methyl-4-(4-chlorophenyl)-3,4-dihydropyrimidin-2(1H)-one (EMCD) with calf-thymus DNA (ctDNA) were investigated by spectroscopy, viscosity, isothermal titration calorimetry (ITC) and molecular modeling techniques. Simultaneously, their biological activities were evaluated with MTT assay method. The binding constants determined with spectroscopic titration and ITC were found to be in the same order of 10(4)M(-1). According to the results of viscosity studies, fluorescence competitive binding experiment and ITC investigations, intercalative binding was evaluated as the dominant binding modes between the two compounds and ctDNA. Furthermore, the results of molecular modeling corroborated those obtained from spectroscopic, viscosimetric and ITC investigations. Evaluation of the antitumor activities of the two derivatives against different tumor cell lines proved that they exhibited significant tumor cell inhibition rate, accordingly blocking DNA transcription and replication. The present results favor the development of potential drugs related with dihydropyrimidinones derivatives in the treatment of some diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection of Hepatitis C core antibody by dual-affinity yeast chimera and smartphone-based electrochemical sensing.

PubMed

Aronoff-Spencer, Eliah; Venkatesh, A G; Sun, Alex; Brickner, Howard; Looney, David; Hall, Drew A

2016-12-15

Yeast cell lines were genetically engineered to display Hepatitis C virus (HCV) core antigen linked to gold binding peptide (GBP) as a dual-affinity biobrick chimera. These multifunctional yeast cells adhere to the gold sensor surface while simultaneously acting as a "renewable" capture reagent for anti-HCV core antibody. This streamlined functionalization and detection strategy removes the need for traditional purification and immobilization techniques. With this biobrick construct, both optical and electrochemical immunoassays were developed. The optical immunoassays demonstrated detection of anti-HCV core antibody down to 12.3pM concentrations while the electrochemical assay demonstrated higher binding constants and dynamic range. The electrochemical format and a custom, low-cost smartphone-based potentiostat ($20 USD) yielded comparable results to assays performed on a state-of-the-art electrochemical workstation. We propose this combination of synthetic biology and scalable, point-of-care sensing has potential to provide low-cost, cutting edge diagnostic capability for many pathogens in a variety of settings. Copyright © 2016 Elsevier B.V. All rights reserved.

Discovery of HIV Type 1 Aspartic Protease Hit Compounds through Combined Computational Approaches.

PubMed

Xanthopoulos, Dimitrios; Kritsi, Eftichia; Supuran, Claudiu T; Papadopoulos, Manthos G; Leonis, Georgios; Zoumpoulakis, Panagiotis

2016-08-05

A combination of computational techniques and inhibition assay experiments was employed to identify hit compounds from commercial libraries with enhanced inhibitory potency against HIV type 1 aspartic protease (HIV PR). Extensive virtual screening with the aid of reliable pharmacophore models yielded five candidate protease inhibitors. Subsequent molecular dynamics and molecular mechanics Poisson-Boltzmann surface area free-energy calculations for the five ligand-HIV PR complexes suggested a high stability of the systems through hydrogen-bond interactions between the ligands and the protease's flaps (Ile50/50'), as well as interactions with residues of the active site (Asp25/25'/29/29'/30/30'). Binding-energy calculations for the three most promising compounds yielded values between -5 and -10 kcal mol(-1) and suggested that van der Waals interactions contribute most favorably to the total energy. The predicted binding-energy values were verified by in vitro inhibition assays, which showed promising results in the high nanomolar range. These results provide structural considerations that may guide further hit-to-lead optimization toward improved anti-HIV drugs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multi-Laboratory Study of Five Methods for the Determination of Brevetoxins in Shellfish Tissue Extracts.

PubMed

Dickey, Robert W; Plakas, Steven M; Jester, Edward L E; El Said, Kathleen R; Johannessen, Jan N; Flewelling, Leanne J; Scott, Paula; Hammond, Dan G; Van Dolah, Frances M; Leighfield, Tod A; Bottein Dachraoui, Marie-Yasmine; Ramsdell, John S; Pierce, Richard H; Henry, Mike S; Poli, Mark A; Walker, Calvin; Kurtz, Jan; Naar, Jerome; Baden, Daniel G; Musser, Steve M; White, Kevin D; Truman, Penelope; Miller, Aaron; Hawryluk, Timothy P; Wekell, Marleen M; Stirling, David; Quilliam, Michael A; Lee, Jung K

A thirteen-laboratory comparative study tested the performance of four methods as alternatives to mouse bioassay for the determination of brevetoxins in shellfish. The methods were N2a neuroblastoma cell assay, two variations of the sodium channel receptor binding assay, competitive ELISA, and LC/MS. Three to five laboratories independently performed each method using centrally prepared spiked and naturally incurred test samples. Competitive ELISA and receptor binding (96-well format) compared most favorably with mouse bioassay. Between-laboratory relative standard deviations (RSDR) ranged from 10 to 20% for ELISA and 14 to 31% for receptor binding. Within-laboratory (RSDr) ranged from 6 to 15% for ELISA, and 5 to 31% for receptor binding. Cell assay was extremely sensitive but data variation rendered it unsuitable for statistical treatment. LC/MS performed as well as ELISA on spiked test samples but was inordinately affected by lack of toxin-metabolite standards, uniform instrumental parameters, or both, on incurred test samples. The ELISA and receptor binding assay are good alternatives to mouse bioassay for the determination of brevetoxins in shellfish.

Microbubble Enzyme-Linked Immunosorbent Assay for the Detection of Targeted Microbubbles in in Vitro Static Binding Assays.

PubMed

Wischhusen, Jennifer; Padilla, Frederic

2017-07-01

Targeted microbubbles (MBs) are ultrasound contrast agents that are functionalized with a ligand for ultrasound molecular imaging of endothelial markers. Novel targeted MBs are characterized in vitro by incubation in protein-coated wells, followed by binding quantification by microscopy or ultrasound imaging. Both methods provide operator-dependent results: Between 3 and 20 fields of view from a heterogeneous sample are typically selected for analysis by microscopy, and in ultrasound imaging, different acoustic settings affect signal intensities. This study proposes a new method to reproducibly quantify MB binding based on enzyme-linked immunosorbent assay (ELISA), in which bound MBs are revealed with an enzyme-linked antibody. MB-ELISA was adapted to in vitro static binding assays, incubating the MBs in inverted position or by agitation, and compared with microscopy. The specificity and sensitivity of MB-ELISA enable the reliable quantification of MB binding in a rapid, high-throughput and whole-well analysis, facilitating the characterization of new targeted contrast agents. Copyright © 2017 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

Assessment of a robust model protocol with accelerated throughput for a human recombinant full length estrogen receptor-alpha binding assay: protocol optimization and intralaboratory assay performance as initial steps towards validation.

PubMed

Freyberger, Alexius; Wilson, Vickie; Weimer, Marc; Tan, Shirlee; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite about two decades of research in the field of endocrine active compounds, still no validated human recombinant (hr) estrogen receptor-alpha (ERalpha) binding assay is available, although hr-ERalpha is available from several sources. In a joint effort, US EPA and Bayer Schering Pharma with funding from the EU-sponsored 6th framework project, ReProTect, developed a model protocol for such a binding assay. Important features of this assay are the use of a full length hr-ERalpha and performance in a 96-well plate format. A full length hr-ERalpha was chosen, as it was considered to provide the most accurate and human-relevant results, whereas truncated receptors could perform differently. Besides three reference compounds [17beta-estradiol, norethynodrel, dibutylphthalate] nine test compounds with different affinities for the ERalpha [diethylstilbestrol (DES), ethynylestradiol, meso-hexestrol, equol, genistein, o,p'-DDT, nonylphenol, n-butylparaben, and corticosterone] were used to explore the performance of the assay. Three independent experiments per compound were performed on different days, and dilutions of test compounds from deep-frozen stocks, solutions of radiolabeled ligand and receptor preparation were freshly prepared for each experiment. The ERalpha binding properties of reference and test compounds were well detected. As expected dibutylphthalate and corticosterone were non-binders in this assay. In terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using a human recombinant ERalpha ligand binding domain. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.5. Our data demonstrate that the assay was robust and reliably ranked compounds with strong, weak, and no affinity for the ERalpha with high accuracy. It avoids the manipulation and use of animals, i.e., the preparation of uterine cytosol as receptor source from ovariectomized rats, as a recombinant protein is used and thus contributes to the 3R concept (reduce, replace, and refine). Furthermore, in contrast to other assays, this assay could be adjusted to an intermediate/high throughput format. On the whole, this assay is a promising candidate for further validation. Copyright 2010 Elsevier Inc. All rights reserved.

Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.

PubMed

Smith, Joshua E; Griffin, Daniel K; Leny, Juliann K; Hagen, Joshua A; Chávez, Jorge L; Kelley-Loughnane, Nancy

2014-04-01

The feasibility of using aptamer-gold nanoparticle conjugates (Apt-AuNPs) to design colorimetric assays for in the field detection of small molecules was investigated. An assay to detect cocaine was designed using two clones of a known cocaine-binding aptamer. The assay was based on the AuNPs difference in affinity for single-stranded DNA (non-binding) and double stranded DNA (target bound). In the first assay, a commonly used design was followed, in which the aptamer and target were incubated to allow binding followed by exposure to the AuNPs. Interactions between the non-bound analytes and the AuNPs surface resulted in a number of false positives. The assay was redesigned by incubating the AuNPs and the aptamer prior to target addition to passivate the AuNPs surface. The adsorbed aptamer was able to bind the target while preventing non-specific interactions. The assay was validated with a number of masking and cutting agents and other controlled substances showing minimal false positives. Studies to improve the assay performance in the field were performed, showing that assay activity could be preserved for up to 2 months. To facilitate the assay analysis, an android application for automatic colorimetric characterization was developed. The application was validated by challenging the assay with cocaine standards of different concentrations, and comparing the results to a conventional plate reader, showing outstanding agreement. Finally, the rapid identification of cocaine in mixtures mimicking street samples was demonstrated. This work established that Apt-AuNPs can be used to design robust assays to be used in the field. Copyright © 2013 Elsevier B.V. All rights reserved.

A novel and sensitive radioreceptor assay for serum melatonin levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tenn, C.; Niles, L.

A simple and sensitive radioreceptor assay (RRA) has been developed to measure melatonin levels in serum. The assay is based on competition between 2-({sup 125}I)iodomelatonin (({sup 125}I)MEL) and melatonin for binding to high-affinity binding sites in chick forebrain. To measure the amount of melatonin present in a serum sample, it was extracted with dichloromethane and added to the assay medium. The percentage inhibition of radioligand binding in the presence of the extracted serum was determined and compared to the percent displacement by known amounts of melatonin in a standard curve. There was little or no cross-reactivity with other structurally relatedmore » compounds. The sensitivity of the assay is {approximately}1.5pg/0.15 mL and the intra- and inter-assay variations are approximately 8%. Since the RRA results are comparable to that of an established radioimmunoassay (RIA), it provides a sensitive and rapid alternative to the more time consuming RIA.« less

Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Miranda Santos, I.K.; Pereira, M.E.

1984-09-01

Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

Concentration Gradient Immunoassay I. A Rapid Immunoassay Based on Interdiffusion and Surface Binding in a Microchannel

PubMed Central

Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul

2008-01-01

We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332

Immunodiagnosis of Canine Visceral Leishmaniasis Using Mimotope Peptides Selected from Phage Displayed Combinatorial Libraries

PubMed Central

Toledo-Machado, Christina Monerat; Machado de Avila, Ricardo Andrez; NGuyen, Christophe; Granier, Claude; Bueno, Lilian Lacerda; Carneiro, Claudia Martins; Menezes-Souza, Daniel; Carneiro, Rubens Antonio; Chávez-Olórtegui, Carlos; Fujiwara, Ricardo Toshio

2015-01-01

ELISA and RIFI are currently used for serodiagnosis of canine visceral leishmaniasis (CVL). The accuracy of these tests is controversial in endemic areas where canine infections by Trypanosoma cruzi may occur. We evaluated the usefulness of synthetic peptides that were selected through phage display technique in the serodiagnosis of CVL. Peptides were chosen based on their ability to bind to IgGs purified from infected dogs pooled sera. We selected three phage clones that reacted only with those IgGs. Peptides were synthesized, polymerized with glutaraldehyde, and used as antigens in ELISA assays. Each individual peptide or a mix of them was reactive with infected dogs serum. The assay was highly sensitive and specific when compared to soluble Leishmania antigen that showed cross-reactivity with anti-T. cruzi IgGs. Our results demonstrate that phage display technique is useful for selection of peptides that may represent valuable synthetic antigens for an improved serodiagnosis of CVL. PMID:25710003

Mimtags: the use of phage display technology to produce novel protein-specific probes.

PubMed

Ahmed, Nayyar; Dhanapala, Pathum; Sadli, Nadia; Barrow, Colin J; Suphioglu, Cenk

2014-03-01

In recent times the use of protein-specific probes in the field of proteomics has undergone evolutionary changes leading to the discovery of new probing techniques. Protein-specific probes serve two main purposes: epitope mapping and detection assays. One such technique is the use of phage display in the random selection of peptide mimotopes (mimtags) that can tag epitopes of proteins, replacing the use of monoclonal antibodies in detection systems. In this study, phage display technology was used to screen a random peptide library with a biologically active purified human interleukin-4 receptor (IL-4R) and interleukin-13 (IL-13) to identify mimtag candidates that interacted with these proteins. Once identified, the mimtags were commercially synthesised, biotinylated and used for in vitro immunoassays. We have used phage display to identify M13 phage clones that demonstrated specific binding to IL-4R and IL-13 cytokine. A consensus in binding sequences was observed and phage clones characterised had identical peptide sequence motifs. Only one was synthesised for use in further immunoassays, demonstrating significant binding to either IL-4R or IL-13. We have successfully shown the use of phage display to identify and characterise mimtags that specifically bind to their target epitope. Thus, this new method of probing proteins can be used in the future as a novel tool for immunoassay and detection technique, which is cheaper and more rapidly produced and therefore a better alternative to the use of monoclonal antibodies. Copyright © 2014 Elsevier B.V. All rights reserved.

Integrated In Silico-In Vitro Identification and Characterization of the SH3-Mediated Interaction between Human PTTG and its Cognate Partners in Medulloblastoma.

PubMed

Liu, Jiangang; Wang, Dapeng; Li, Yanyan; Yao, Hui; Zhang, Nan; Zhang, Xuewen; Zhong, Fangping; Huang, Yulun

2018-06-01

The human pituitary tumor-transforming gene is an oncogenic protein which serves as a central hub in the cellular signaling network of medulloblastoma. The protein contains two vicinal PxxP motifs at its C terminus that are potential binding sites of peptide-recognition SH3 domains. Here, a synthetic protocol that integrated in silico analysis and in vitro assay was described to identify the SH3-binding partners of pituitary tumor-transforming gene in the gene expression profile of medulloblastoma. In the procedure, a variety of structurally diverse, non-redundant SH3 domains with high gene expression in medulloblastoma were compiled, and their three-dimensional structures were either manually retrieved from the protein data bank database or computationally modeled through bioinformatics technique. The binding capability of these domains towards the two PxxP-containing peptides m1p: 161 LGPPSPVK 168 and m2p: 168 KMPSPPWE 175 of pituitary tumor-transforming gene were ranked by structure-based scoring and fluorescence-based assay. Consequently, a number of SH3 domains, including MAP3K and PI3K, were found to have moderate or high affinity for m1p and/or m2p. Interestingly, the two overlapping peptides exhibits a distinct binding profile to these identified domain partners, suggesting that the binding selectivity of m1p and m2p is optimized across the medulloblastoma expression spectrum by competing for domain candidates. In addition, two redesigned versions of m1p peptide ware obtained via a structure-based rational mutation approach, which exhibited an increased affinity for the domain as compared to native peptide.

Multispectroscopic and calorimetric studies on the binding of the food colorant tartrazine with human hemoglobin.

PubMed

Basu, Anirban; Suresh Kumar, Gopinatha

2016-11-15

Interaction of the food colorant tartrazine with human hemoglobin was studied using multispectroscopic and microcalorimetric techniques to gain insights into the binding mechanism and thereby the toxicity aspects. Hemoglobin spectrum showed hypochromic changes in the presence of tartrazine. Quenching of the fluorescence of hemoglobin occurred and the quenching mechanism was through a static mode as revealed from temperature dependent and time-resolved fluorescence studies. According to the FRET theory the distance between β-Trp37 of hemoglobin and bound tartrazine was evaluated to be 3.44nm. Synchronous fluorescence studies showed that tartrazine binding led to alteration of the microenvironment around the tryptophans more in comparison to tyrosines. 3D fluorescence and FTIR data provided evidence for conformational changes in the protein on binding. Circular dichroism studies revealed that the binding led to significant loss in the helicity of hemoglobin. The esterase activity assay further complemented the circular dichroism data. Microcalorimetric study using isothermal titration calorimetry revealed the binding to be exothermic and driven largely by positive entropic contribution. Dissection of the Gibbs energy change proposed the protein-dye complexation to be dominated by non-polyelectrolytic forces. Negative heat capacity change also corroborated the involvement of hydrophobic forces in the binding process. Copyright © 2016 Elsevier B.V. All rights reserved.

Improved flow cytometer measurement of binding assays

DOEpatents

Saunders, G.C.

1984-05-30

The invention relates to a method of measuring binding assays carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also a known quantity of smaller particles with a coating of binder reactant. The binding reactant is the same as the binding reactant present in the sample. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number and strength of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating. (LEW)

Screening and Identification of Peptides Specifically Targeted to Gastric Cancer Cells from a Phage Display Peptide Library

PubMed

Sahin, Deniz; Taflan, Sevket Onur; Yartas, Gizem; Ashktorab, Hassan; Smoot, Duane T

2018-04-25

Background: Gastric cancer is the second most common cancer among the malign cancer types. Inefficiency of traditional techniques both in diagnosis and therapy of the disease makes the development of alternative and novel techniques indispensable. As an alternative to traditional methods, tumor specific targeting small peptides can be used to increase the efficiency of the treatment and reduce the side effects related to traditional techniques. The aim of this study is screening and identification of individual peptides specifically targeted to human gastric cancer cells using a phage-displayed peptide library and designing specific peptide sequences by using experimentally-eluted peptide sequences. Methods: Here, MKN-45 human gastric cancer cells and HFE-145 human normal gastric epithelial cells were used as the target and control cells, respectively. 5 rounds of biopannning with a phage display 12-peptide library were applied following subtraction biopanning with HFE-145 control cells. The selected phage clones were established by enzyme-linked immunosorbent assay and immunofluorescence detection. We first obtain random phage clones after five biopanning rounds, determine the binding levels of each individual clone. Then, we analyze the frequencies of each amino acid in best binding clones to determine positively overexpressed amino acids for designing novel peptide sequences. Results: DE532 (VETSQYFRGTLS) phage clone was screened positive, showing specific binding on MKN-45 gastric cancer cells. DE-Obs (HNDLFPSWYHNY) peptide, which was designed by using amino acid frequencies of experimentally selected peptides in the 5th round of biopanning, showed specific binding in MKN-45 cells. Conclusion: Selection and characterization of individual clones may give us specifically binding peptides, but more importantly, data extracted from eluted phage clones may be used to design theoretical peptides with better binding properties than even experimentally selected ones. Both peptides, experimental and designed, may be potential candidates to be developed as useful diagnostic or therapeutic ligand molecules in gastric cancer research. Creative Commons Attribution License

The minor house dust mite allergen Der p 13 is a fatty acid-binding protein and an activator of a TLR2-mediated innate immune response.

PubMed

Satitsuksanoa, P; Kennedy, M; Gilis, D; Le Mignon, M; Suratannon, N; Soh, W T; Wongpiyabovorn, J; Chatchatee, P; Vangveravong, M; Rerkpattanapipat, T; Sangasapaviliya, A; Piboonpocanun, S; Nony, E; Ruxrungtham, K; Jacquet, A

2016-10-01

The house dust mite (HDM) allergen Der p 13 could be a lipid-binding protein able to activate key innate signaling pathways in the initiation of the allergic response. We investigated the IgE reactivity of recombinant Der p 13 (rDer p 13), its lipid-binding activities, and its capacity to stimulate airway epithelium cells. Purified rDer p 13 was characterized by mass spectrometry, circular dichroism, fluorescence-based lipid-binding assays, and in silico structural prediction. IgE-binding activity and allergenic potential of Der p 13 were examined by ELISA, basophil degranulation assays, and in vitro airway epithelial cell activation assays. Protein modeling and biophysical analysis indicated that Der p 13 adopts a β-barrel structure with a predominately apolar pocket representing a potential binding site for hydrophobic ligands. Fluorescent lipid-binding assays confirmed that the protein is highly selective for ligands and that it binds a fatty acid with a dissociation constant typical of lipid transporter proteins. The low IgE-binding frequency (7%, n = 224) in Thai HDM-allergic patients as well as the limited propensity to activate basophil degranulation classifies Der p 13 as a minor HDM allergen. Nevertheless, the protein with its presumptively associated lipid(s) triggered the production of IL-8 and GM-CSF in respiratory epithelial cells through a TLR2-, MyD88-, NF-kB-, and MAPK-dependent signaling pathway. Although a minor allergen, Der p 13 may, through its lipid-binding capacity, play a role in the initiation of the HDM-allergic response through TLR2 activation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

Synthesis and characterization of a Eu-DTPA-PEGO-MSH(4) derivative for evaluation of binding of multivalent molecules to melanocortin receptors.

PubMed

Xu, Liping; Vagner, Josef; Alleti, Ramesh; Rao, Venkataramanarao; Jagadish, Bhumasamudram; Morse, David L; Hruby, Victor J; Gillies, Robert J; Mash, Eugene A

2010-04-15

A labeled variant of MSH(4), a tetrapeptide that binds to the human melanocortin 4 receptor (hMC4R) with low microM affinity, was prepared by solid-phase synthesis methods, purified, and characterized. The labeled ligand, Eu-DTPA-PEGO-His-dPhe-Arg-Trp-NH(2), exhibited a K(d) for hMC4R of 9.1+/-1.4 microM, approximately 10-fold lower affinity than the parental ligand. The labeled MSH(4) derivative was employed in a competitive binding assay to characterize the interactions of hMC4R with monovalent and divalent MSH(4) constructs derived from squalene. The results were compared with results from a similar assay that employed a more potent labeled ligand, Eu-DTPA-NDP-alpha-MSH. While results from the latter assay reflected only statistical effects, results from the former assay reflected a mixture of statistical, proximity, and/or cooperative binding effects. Copyright 2010 Elsevier Ltd. All rights reserved.

Screening Anti-Cancer Drugs against Tubulin using Catch-and-Release Electrospray Ionization Mass Spectrometry

NASA Astrophysics Data System (ADS)

Rezaei Darestani, Reza; Winter, Philip; Kitova, Elena N.; Tuszynski, Jack A.; Klassen, John S.

2016-05-01

Tubulin, which is the building block of microtubules, plays an important role in cell division. This critical role makes tubulin an attractive target for the development of chemotherapeutic drugs to treat cancer. Currently, there is no general binding assay for tubulin-drug interactions. The present work describes the application of the catch-and-release electrospray ionization mass spectrometry (CaR-ESI-MS) assay to investigate the binding of colchicinoid drugs to αβ-tubulin dimers extracted from porcine brain. Proof-of-concept experiments using positive (ligands with known affinities) and negative (non-binders) controls were performed to establish the reliability of the assay. The assay was then used to screen a library of seven colchicinoid analogues to test their binding to tubulin and to rank their affinities.

Detection of potential (anti)progestagenic endocrine disruptors using a recombinant human progesterone receptor binding and transactivation assay.

PubMed

Viswanath, Gunda; Halder, Sujata; Divya, Gunda; Majumder, Chandrajeet B; Roy, Partha

2008-11-25

The present work describes the identification of (anti)progestin endocrine disrupting chemicals (EDC) using a two step screening system. In the first step a competitive binding assay was developed using recombinant human progesterone receptor (hPR). The tested chemicals were of various classes like insecticides, their metabolites, industrial chemicals and waste water treatment plant (WWTP) effluents. All the tested chemicals demonstrated a high affinity binding for hPR. The average IC50 values of the test chemicals were within the range of 1-25microM. In the second step of screening, a mammalian cell-based hPR transactivation assay was developed where HEK 293 cells were co-transfected with hPR and luciferase reporter gene under the control of progesterone-response element. Stimulation of the cells with progesterone resulted in about 25-fold up regulation of luciferase activity, with EC50 value of 4nM. Potent anti-progesterone, RU486, significantly inhibited progesterone-induced transactivation and non-progestagenic steroids failed to transactivate hPR till 1microM concentrations. The chemicals showing high binding affinities in competitive binding assays were then tested in transactivation assay and all of them were found to be anti-progestative except WWTP effluents. Transactivation assays using extracted water samples from five different WWTP effluents showed that it was rich in progestative compounds. The levels of induction caused by these effluents were in the range of 15-25% of induction by progesterone and they represented about 6ng/l equivalent progesterone activities. In conclusion, we demonstrated that this two step assay provides an efficient screening tool for the detection of (anti)progestative EDC in various samples.

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

Lipid-Coated Gold Nanoparticles and FRET Allow Sensitive Monitoring of Liposome Clustering Mediated by the Synaptotagmin-7 C2A Domain.

PubMed

Hamilton, Desmond J; Coffman, Matthew D; Knight, Jefferson D; Reed, Scott M

2017-09-12

Synaptotagmin (Syt) family proteins contain tandem C2 domains, C2A and C2B, which insert into anionic membranes in response to increased cytosolic Ca 2+ concentration and facilitate exocytosis in neuronal and endocrine cells. The C2A domain from Syt7 binds lipid membranes much more tightly than the corresponding domain from Syt1, but the implications of this difference for protein function are not yet clear. In particular, the ability of the isolated Syt7 C2A domain to initiate membrane apposition and/or aggregation has been previously unexplored. Here, we demonstrate that Syt7 C2A induces apposition and aggregation of liposomes using Förster resonance energy transfer (FRET) assays, dynamic light scattering, and spectroscopic techniques involving lipid-coated gold nanoparticles (LCAuNPs). Protein-membrane binding, membrane apposition, and macroscopic aggregation are three separate phenomena with distinct Ca 2+ requirements: the threshold Ca 2+ concentration for membrane binding is lowest, followed by apposition and aggregation. However, aggregation is highly sensitive to protein concentration and can occur even at submicromolar Syt7 C2A; thus, highly sensitive assays are needed for measuring apposition without complications arising from aggregation. Notably, the localized surface plasmon resonance of the LCAuNP is sensitive to ≤10 nM Syt7 C2A concentrations. Furthermore, when the LCAuNPs were added into a FRET-based liposome apposition assay, the resultant energy transfer increased; possible explanations are discussed. Overall, LCAuNP-based methods allow for highly sensitive detection of protein-induced membrane apposition under conditions that miminize large-scale aggregation.

Chelerythrine down regulates expression of VEGFA, BCL2 and KRAS by arresting G-Quadruplex structures at their promoter regions

PubMed Central

Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu

2017-01-01

A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer. PMID:28102286

New detection targets for amyloid-reactive probes: spectroscopic recognition of bacterial spores

NASA Astrophysics Data System (ADS)

Jones, Guilford, II; Landsman, Pavel

2005-05-01

We report characteristic changes in fluorescence of amyloid-binding dyes Thioflavin T (TfT), pinacyanol (PIN) and related dyes, caused by their interaction with suspended Bacillus spore cultures (B. subtilis, B thuringiensis). The gain in TfT emission in the presence of spores allowed their immediate detection in aqueous suspensions, with a sensitivity limit of < 105 spores per ml. The spectroscopic signatures are consistent with a large number of binding sites for the two dyes on spore coats. The possible structural relationship of these dye binding loci with characteristic motifs (β-stacks) of amyloid deposits and other misfolded protein formations suggests new designs for probing biocontamination and also for clinical studies of non-microbial human pathogens (e.g., amyloid-related protein aggregates in prion-related transmissible encephalopathies or in Alzheimer's disease). Also reported is a special screening technique that was designed and used herein for calibration of new detection probes and assays for spore detection. It employed spectroscopic interactions between the candidate amyloid stains and poly(vinylpyrrolidone)-coated colloid silica (Percoll) nanoparticles that also display remarkable parallelism with the corresponding dye-amyloid and dye-spore reactivities. Percoll may thus find new applications as a convenient non-biological structural model mimicking the putative probe-targeted motifs in both classes of bioanalytes. These findings are important in the design of new probes and assays for important human pathogens (i.e. bacterial spores and amyloidogenic protein aggregates).

Nickel(II) and palladium(II) triphenylphosphine complexes incorporating tridentate Schiff base ligands: Synthesis, characterization and biocidal activities

NASA Astrophysics Data System (ADS)

Shabbir, Muhammad; Akhter, Zareen; Ashraf, Ahmad Raza; Ismail, Hammad; Habib, Anum; Mirza, Bushra

2017-12-01

Nickel(II) and palladium(II) triphenylphosphine complexes incorporating tridentate Schiff bases have been prepared and characterized by elemental analysis as well as by spectroscopic techniques (FTIR & NMR). The synthesized compounds were assessed to check their potential biocidal activity by using different biological assays (brine shrimp cytotoxicity, antimicrobial, antioxidant, antitumor and drug-DNA interaction). Results of brine shrimp cytotoxicity assay showed that ligand molecules are more bioactive than metal complexes with LD50 as low as 12.4 μg/mL. The prominent antitumor activity was shown by nickel complexes while the palladium complexes exhibited moderate activity. The synthesized compounds have shown high propensity for DNA binding either through intercalation or groove binding which represents the mechanism of antitumor effect of these compounds. Additionally, ligand molecules and nickel metal complexes showed significant antioxidant activity with IC50 values as low as 3.1 μg/mL and 18.9 μg/mL respectively while palladium complexes exhibited moderate activity. Moreover, in antimicrobial assays H2L1, Ni(L1)PPh3 and H2L3 showed dual inhibition against bacterial and fungal strains while for the rest of the compounds varying degree of activity was recorded against different strains. Overall comparison of results suggests that the synthesized compounds can be promising candidate for drug formulation and development.

Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

PubMed

Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

2014-11-01

A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

Development of a Novel Green Fluorescent Protein-Based Binding Assay to Study the Association of Plakins with Intermediate Filament Proteins.

PubMed

Favre, Bertrand; Begré, Nadja; Bouameur, Jamal-Eddine; Borradori, Luca

2016-01-01

Protein-protein interactions are fundamental for most biological processes, such as the formation of cellular structures and enzymatic complexes or in signaling pathways. The identification and characterization of protein-protein interactions are therefore essential for understanding the mechanisms and regulation of biological systems. The organization and dynamics of the cytoskeleton, as well as its anchorage to specific sites in the plasma membrane and organelles, are regulated by the plakins. These structurally related proteins anchor different cytoskeletal networks to each other and/or to other cellular structures. The association of several plakins with intermediate filaments (IFs) is critical for maintenance of the cytoarchitecture. Pathogenic mutations in the genes encoding different plakins can lead to dramatic manifestations, occurring principally in the skin, striated muscle, and/or nervous system, due to cytoskeletal disorganization resulting in abnormal cell fragility. Nevertheless, it is still unclear how plakins bind to IFs, although some general rules are slowly emerging. We here describe in detail a recently developed protein-protein fluorescence binding assay, based on the production of recombinant proteins tagged with green fluorescent protein (GFP) and their use as fluid-phase fluorescent ligands on immobilized IF proteins. Using this method, we have been able to assess the ability of C-terminal regions of GFP-tagged plakin proteins to bind to distinct IF proteins and IF domains. This simple and sensitive technique, which is expected to facilitate further studies in this area, can also be potentially employed for any kind of protein-protein interaction studies. © 2016 Elsevier Inc. All rights reserved.

An SPR based sensor for allergens detection.

PubMed

Ashley, J; Piekarska, M; Segers, C; Trinh, L; Rodgers, T; Willey, R; Tothill, I E

2017-02-15

A simple, sensitive and label-free optical sensor method was developed for allergens analysis using α-casein as the biomarker for cow's milk detection, to be used directly in final rinse samples of cleaning in place systems (CIP) of food manufacturers. A Surface Plasmon Resonance (SPR) sensor chip consisting of four sensing arrays enabling the measurement of samples and control binding events simultaneously on the sensor surface was employed in this work. SPR offers several advantages in terms of label free detection, real time measurements and superior sensitivity when compared to ELISA based techniques. The gold sensor chip was used to immobilise α-casein-polyclonal antibody using EDC/NHS coupling procedure. The performance of the assay and the sensor was first optimised and characterised in pure buffer conditions giving a detection limit of 58ngmL -1 as a direct binding assay. The assay sensitivity can be further improved by using sandwich assay format and amplified with nanoparticles. However, at this stage this is not required as the detection limit achieved exceeded the required allergens detection levels of 2µgmL -1 for α-S1-casein. The sensor demonstrated good selectivity towards the α-casein as the target analyte and adequate recoveries from CIP final rinse wash samples. The sensor would be useful tool for monitoring allergen levels after cleaning procedures, providing additional data that may better inform upon wider food allergen risk management decision(s) that are made by food manufacturer. In particular, this sensor could potentially help validate or optimise cleaning practices for a given food manufacturing process. Copyright © 2016 Elsevier B.V. All rights reserved.

Relative Chemical Binding Affinities for Trout and Human Estrogen Receptor Using Different Competitive Binding Assays

EPA Science Inventory

Rainbow trout-based assays for estrogenicity are currently being used for development of predictive models based upon quantitative structure activity relationships. A predictive model based on a single species raises the question of whether this information is valid for other spe...

Integrated Model of Chemical Perturbations of a Biological PathwayUsing 18 In Vitro High Throughput Screening Assays for the Estrogen Receptor

EPA Science Inventory

We demonstrate a computational network model that integrates 18 in vitro, high-throughput screening assays measuring estrogen receptor (ER) binding, dimerization, chromatin binding, transcriptional activation and ER-dependent cell proliferation. The network model uses activity pa...

High-Throughput, Protein-Targeted Biomolecular Detection Using Frequency-Domain Faraday Rotation Spectroscopy.

PubMed

Murdock, Richard J; Putnam, Shawn A; Das, Soumen; Gupta, Ankur; Chase, Elyse D Z; Seal, Sudipta

2017-03-01

A clinically relevant magneto-optical technique (fd-FRS, frequency-domain Faraday rotation spectroscopy) for characterizing proteins using antibody-functionalized magnetic nanoparticles (MNPs) is demonstrated. This technique distinguishes between the Faraday rotation of the solvent, iron oxide core, and functionalization layers of polyethylene glycol polymers (spacer) and model antibody-antigen complexes (anti-BSA/BSA, bovine serum albumin). A detection sensitivity of ≈10 pg mL -1 and broad detection range of 10 pg mL -1 ≲ c BSA ≲ 100 µg mL -1 are observed. Combining this technique with predictive analyte binding models quantifies (within an order of magnitude) the number of active binding sites on functionalized MNPs. Comparative enzyme-linked immunosorbent assay (ELISA) studies are conducted, reproducing the manufacturer advertised BSA ELISA detection limits from 1 ng mL -1 ≲ c BSA ≲ 500 ng mL -1 . In addition to the increased sensitivity, broader detection range, and similar specificity, fd-FRS can be conducted in less than ≈30 min, compared to ≈4 h with ELISA. Thus, fd-FRS is shown to be a sensitive optical technique with potential to become an efficient diagnostic in the chemical and biomolecular sciences. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Deterministic bead-in-droplet ejection utilizing an integrated plug-in bead dispenser for single bead-based applications

NASA Astrophysics Data System (ADS)

Kim, Hojin; Choi, In Ho; Lee, Sanghyun; Won, Dong-Joon; Oh, Yong Suk; Kwon, Donghoon; Sung, Hyung Jin; Jeon, Sangmin; Kim, Joonwon

2017-04-01

This paper presents a deterministic bead-in-droplet ejection (BIDE) technique that regulates the precise distribution of microbeads in an ejected droplet. The deterministic BIDE was realized through the effective integration of a microfluidic single-particle handling technique with a liquid dispensing system. The integrated bead dispenser facilitates the transfer of the desired number of beads into a dispensing volume and the on-demand ejection of bead-encapsulated droplets. Single bead-encapsulated droplets were ejected every 3 s without any failure. Multiple-bead dispensing with deterministic control of the number of beads was demonstrated to emphasize the originality and quality of the proposed dispensing technique. The dispenser was mounted using a plug-socket type connection, and the dispensing process was completely automated using a programmed sequence without any microscopic observation. To demonstrate a potential application of the technique, bead-based streptavidin-biotin binding assay in an evaporating droplet was conducted using ultralow numbers of beads. The results evidenced the number of beads in the droplet crucially influences the reliability of the assay. Therefore, the proposed deterministic bead-in-droplet technology can be utilized to deliver desired beads onto a reaction site, particularly to reliably and efficiently enrich and detect target biomolecules.

Deterministic bead-in-droplet ejection utilizing an integrated plug-in bead dispenser for single bead-based applications.

PubMed

Kim, Hojin; Choi, In Ho; Lee, Sanghyun; Won, Dong-Joon; Oh, Yong Suk; Kwon, Donghoon; Sung, Hyung Jin; Jeon, Sangmin; Kim, Joonwon

2017-04-10

This paper presents a deterministic bead-in-droplet ejection (BIDE) technique that regulates the precise distribution of microbeads in an ejected droplet. The deterministic BIDE was realized through the effective integration of a microfluidic single-particle handling technique with a liquid dispensing system. The integrated bead dispenser facilitates the transfer of the desired number of beads into a dispensing volume and the on-demand ejection of bead-encapsulated droplets. Single bead-encapsulated droplets were ejected every 3 s without any failure. Multiple-bead dispensing with deterministic control of the number of beads was demonstrated to emphasize the originality and quality of the proposed dispensing technique. The dispenser was mounted using a plug-socket type connection, and the dispensing process was completely automated using a programmed sequence without any microscopic observation. To demonstrate a potential application of the technique, bead-based streptavidin-biotin binding assay in an evaporating droplet was conducted using ultralow numbers of beads. The results evidenced the number of beads in the droplet crucially influences the reliability of the assay. Therefore, the proposed deterministic bead-in-droplet technology can be utilized to deliver desired beads onto a reaction site, particularly to reliably and efficiently enrich and detect target biomolecules.

Deterministic bead-in-droplet ejection utilizing an integrated plug-in bead dispenser for single bead–based applications

PubMed Central

Kim, Hojin; Choi, In Ho; Lee, Sanghyun; Won, Dong-Joon; Oh, Yong Suk; Kwon, Donghoon; Sung, Hyung Jin; Jeon, Sangmin; Kim, Joonwon

2017-01-01

This paper presents a deterministic bead-in-droplet ejection (BIDE) technique that regulates the precise distribution of microbeads in an ejected droplet. The deterministic BIDE was realized through the effective integration of a microfluidic single-particle handling technique with a liquid dispensing system. The integrated bead dispenser facilitates the transfer of the desired number of beads into a dispensing volume and the on-demand ejection of bead-encapsulated droplets. Single bead–encapsulated droplets were ejected every 3 s without any failure. Multiple-bead dispensing with deterministic control of the number of beads was demonstrated to emphasize the originality and quality of the proposed dispensing technique. The dispenser was mounted using a plug-socket type connection, and the dispensing process was completely automated using a programmed sequence without any microscopic observation. To demonstrate a potential application of the technique, bead-based streptavidin–biotin binding assay in an evaporating droplet was conducted using ultralow numbers of beads. The results evidenced the number of beads in the droplet crucially influences the reliability of the assay. Therefore, the proposed deterministic bead-in-droplet technology can be utilized to deliver desired beads onto a reaction site, particularly to reliably and efficiently enrich and detect target biomolecules. PMID:28393911

Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

PubMed

Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

2012-08-01

In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

A practical approach to automate randomized design of experiments for ligand-binding assays.

PubMed

Tsoi, Jennifer; Patel, Vimal; Shih, Judy

2014-03-01

Design of experiments (DOE) is utilized in optimizing ligand-binding assay by modeling factor effects. To reduce the analyst's workload and error inherent with DOE, we propose the integration of automated liquid handlers to perform the randomized designs. A randomized design created from statistical software was imported into custom macro converting the design into a liquid-handler worklist to automate reagent delivery. An optimized assay was transferred to a contract research organization resulting in a successful validation. We developed a practical solution for assay optimization by integrating DOE and automation to increase assay robustness and enable successful method transfer. The flexibility of this process allows it to be applied to a variety of assay designs.

Improved flow cytometer measurement of binding assays

NASA Astrophysics Data System (ADS)

Saunders, G. C.

1984-05-01

A method of measuring binding assays is carried out with different size particles wherein the binding assay sample is run through a flow cytometer without separating the sample from the marking agent. The amount of a binding reactant present in a sample is determined by providing particles with a coating of binder and also known quantity of smaller particles with a coating of binder reactant. The smaller particles also contain a fluorescent chemical. The particles are combined with the sample and the binding reaction is allowed to occur for a set length of time followed by combining the smaller particles with the mixture of the particles and the sample produced and allowing the binding reactions to proceed to equilibrium. The fluorescence and light scatter of the combined mixture is then measured as the combined mixture passes through a flow cytometer equipped with a laser to bring about fluorescence, and the number of fluorescent events are compared. A similar method is also provided for determining the amount of antigen present in the sample by providing spheres with an antibody coating and some smaller spheres with an antigen coating.

D2 dopaminergic and 5-HT1A serotonergic activity of 2-(1-naphthyl)ethyl- and 2-(2-naphthyl)ethyl amines.

PubMed

Šukalović, V; Roglić, G; Husinec, S; Kostić-Rajaćić, S; Andrić, D; Šoškić, Vukić

2003-11-01

Several tertiary 2-phenylethyl, 2-(1-naphthyl)ethyl and 2-(2-naphthyl)ethyl amines were synthesized and their binding affinities for dopamine D(1), D(2) and serotonin 5-HT(1A) receptors evaluated in radioligand binding assays. All compounds were inactive in D(1) dopamine radioligand binding assay. The 2-(1-naphthyl)ethyl analogues expressed a low but significant binding affinity for the D(2) and moderate one for the 5-HT(1A) receptor subtypes. Most of the remaining compounds expressed binding affinity at the 5-HT(1A) receptor subtype but were inactive in D(2) receptor binding assay. Based on these results and considering the chemical characteristics of the compounds synthesized and evaluated for dopaminergic and serotonergic activity throughout the present study it can be concluded that hydrophobic type of interaction (stacking or edge-to-face) plays a significant role in the formation of receptor-ligand complexes of 2-(1-naphthyl)ethyl amines. This structural motive can be applied to design and synthesize new, more potent dopaminergic/serotonergic ligands by slight chemical modifications.

Binding of environmental carcinogens to asbestos and mineral fibres.

PubMed Central

Harvey, G; Pagé, M; Dumas, L

1984-01-01

A rapid method has been developed for measuring the binding capacity of asbestos and other mineral fibres for environmental carcinogens. Benzo(alpha)pyrene (B(alpha)P), nitrosonornicotine (NNN), and N-acetyl-2-aminofluorene (NAAF) were assayed in the presence of Canadian grade 4T30 chrysotile, chrysotile A, amosite, crocidolite, glass microfibres, glasswool, attapulgite, and titanium dioxide. Chrysotile binds significantly more carcinogens than the other mineral fibres. This binding assay is reproducible with coefficients of variation of less than 8% and 6% respectively for inter and intra assay. The influence of pH was also studied, and there is good correlation between the carcinogen binding and the charge of the tested mineral fibres. The in vitro cytotoxicity on macrophage like cell line P388D1 and the haemolytic activity of various mineral fibres were also measured; a good correlation was found between the binding capacity and the cytotoxicity of tested mineral fibres on P388D1 cells. These results give some explanations for the reported synergism between exposure to asbestos and the smoking habits of workers. PMID:6331497

DNA-aptamers binding aminoglycoside antibiotics.

PubMed

Nikolaus, Nadia; Strehlitz, Beate

2014-02-21

Aptamers are short, single stranded DNA or RNA oligonucleotides that are able to bind specifically and with high affinity to their non-nucleic acid target molecules. This binding reaction enables their application as biorecognition elements in biosensors and assays. As antibiotic residues pose a problem contributing to the emergence of antibiotic-resistant pathogens and thereby reducing the effectiveness of the drug to fight human infections, we selected aptamers targeted against the aminoglycoside antibiotic kanamycin A with the aim of constructing a robust and functional assay that can be used for water analysis. With this work we show that aptamers that were derived from a Capture-SELEX procedure targeting against kanamycin A also display binding to related aminoglycoside antibiotics. The binding patterns differ among all tested aptamers so that there are highly substance specific aptamers and more group specific aptamers binding to a different variety of aminoglycoside antibiotics. Also the region of the aminoglycoside antibiotics responsible for aptamer binding can be estimated. Affinities of the different aptamers for their target substance, kanamycin A, are measured with different approaches and are in the micromolar range. Finally, the proof of principle of an assay for detection of kanamycin A in a real water sample is given.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

SH2-PLA: a sensitive in-solution approach for quantification of modular domain binding by proximity ligation and real-time PCR.

PubMed

Thompson, Christopher M; Bloom, Lee R; Ogiue-Ikeda, Mari; Machida, Kazuya

2015-06-26

There is a great interest in studying phosphotyrosine dependent protein-protein interactions in tyrosine kinase pathways that play a critical role in many aspects of cellular function. We previously established SH2 profiling, a phosphoproteomic approach based on membrane binding assays that utilizes purified Src Homology 2 (SH2) domains as a molecular tool to profile the global tyrosine phosphorylation state of cells. However, in order to use this method to investigate SH2 binding sites on a specific target in cell lysate, additional procedures such as pull-down or immunoprecipitation which consume large amounts of sample are required. We have developed PLA-SH2, an alternative in-solution modular domain binding assay that takes advantage of Proximity Ligation Assay and real-time PCR. The SH2-PLA assay utilizes oligonucleotide-conjugated anti-GST and anti-EGFR antibodies recognizing a GST-SH2 probe and cellular EGFR, respectively. If the GST-SH2 and EGFR are in close proximity as a result of SH2-phosphotyrosine interactions, the two oligonucleotides are brought within a suitable distance for ligation to occur, allowing for efficient complex amplification via real-time PCR. The assay detected signal across at least 3 orders of magnitude of lysate input with a linear range spanning 1-2 orders and a low femtomole limit of detection for EGFR phosphotyrosine. SH2 binding kinetics determined by PLA-SH2 showed good agreement with established far-Western analyses for A431 and Cos1 cells stimulated with EGF at various times and doses. Further, we showed that PLA-SH2 can survey lung cancer tissues using 1 μl lysate without requiring phospho-enrichment. We showed for the first time that interactions between SH2 domain probes and EGFR in cell lysate can be determined in a microliter-scale assay using SH2-PLA. The obvious benefit of this method is that the low sample requirement allows detection of SH2 binding in samples which are difficult to analyze using traditional protein interaction assays. This feature along with short assay runtime makes this method a useful platform for the development of high throughput assays to determine modular domain-ligand interactions which could have wide-ranging applications in both basic and translational cancer research.

Assessment of a method for measuring serum thyroxine by radioimmunoassay, with use of polyethylene glycol precipitation. [/sup 125/I tracer technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farid, N.R.; Kennedy, C.

We assessed the efficacy of a new thyroxine radioimmunoassay kit (Abbott) in which polyethylene glycol is used to separate bound from free hormone. Mean serum thyroxine was 88 +- 15 (+-SD) ..mu..g/liter for 96 normal persons. Results for hypothyroid and hyperthyroid persons were clearly separated from those for normal individuals. Women taking oral contraceptive preparations showed variable increases in their serum thyroxine values. The coefficient of variation ranged from 1 to 3% within assay and from 5.4 to 11% among different assays. Excellent parallelism was demonstrated between thyroxine values estimated by this method and those obtained either by competitive proteinmore » binding or by a separate radioimmunoassay for the hormone.« less

A solid-phase assay for studying direct binding of progranulin to TNFR and progranulin antagonism of TNF/TNFR interactions.

PubMed

Tian, Qingyun; Zhao, Shuai; Liu, Chuanju

2014-01-01

The discovery that TNF receptors (TNFR) serve as the binding receptors for progranulin (PGRN) reveals the significant role of PGRN in inflammatory and autoimmune diseases, including inflammatory arthritis. Herein we describe a simple, antibody-free analytical assay, i.e., a biotin-based solid-phase binding assay, to examine the direct interaction of PGRN/TNFR and the PGRN inhibition of TNF/TNFR interactions. Briefly, a 96-well high-binding microplate is first coated with the first protein (protein A), and after blocking, the coated microplate is incubated with the biotin-labeled second protein (protein B) in the absence or presence of the third protein (protein C). Finally the streptavidin conjugated with a detecting enzyme is added, followed by a signal measurement. Also discussed in this chapter are the advantages of the strategy, key elements to obtain reliable results, and discrepancies among various PGRN proteins in view of the binding activity with TNFR.

Comprehensive analysis of T cell epitope discovery strategies using 17DD yellow fever virus structural proteins and BALB/c (H2d) mice model.

PubMed

Maciel, Milton; Kellathur, Srinivasan N; Chikhlikar, Pryia; Dhalia, Rafael; Sidney, John; Sette, Alessandro; August, Thomas J; Marques, Ernesto T A

2008-08-15

Immunomics research uses in silico epitope prediction, as well as in vivo and in vitro approaches. We inoculated BALB/c (H2d) mice with 17DD yellow fever vaccine to investigate the correlations between approaches used for epitope discovery: ELISPOT assays, binding assays, and prediction software. Our results showed a good agreement between ELISPOT and binding assays, which seemed to correlate with the protein immunogenicity. PREDBALB/c prediction software partially agreed with the ELISPOT and binding assay results, but presented low specificity. The use of prediction software to exclude peptides containing no epitopes, followed by high throughput screening of the remaining peptides by ELISPOT, and the use of MHC-biding assays to characterize the MHC restrictions demonstrated to be an efficient strategy. The results allowed the characterization of 2 MHC class I and 17 class II epitopes in the envelope protein of the YF virus in BALB/c (H2d) mice.

Development of binding assays for the SH2 domain of Grb7 and Grb2 using fluorescence polarization.

PubMed

Luzy, Jean-Philippe; Chen, Huixiong; Gril, Brunilde; Liu, Wang-Qing; Vidal, Michel; Perdereau, Dominique; Burnol, Anne-Françoise; Garbay, Christiane

2008-02-01

Adaptor proteins Grb7 and Grb2 have been implicated as being 2 potential therapeutic targets in several human cancers, especially those that overexpress ErbB2. These 2 proteins contain both a SH2 domain (Src homology 2) that binds to phosphorylated tyrosine residues contained within ErbB2 and other specific protein targets. Two assays based on enzyme-linked immunosorbent assay and fluorescence polarization methods have been developed and validated to find and rank inhibitors for both proteins binding to the pY(1139). Fluorescence polarization assays allowed the authors to determine quickly and reproducibly affinities of peptides from low nanomolar to high micromolar range and to compare them directly for Grb7 and Grb2. As a result, the assays have identified a known peptidomimetic Grb2 SH2 inhibitor (mAZ-pTyr-(alphaMe)pTyr-Asn-NH(2)) that exhibits the most potent affinity for the Grb7 SH2 domain described to date.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Modular Architecture and Unique Teichoic Acid Recognition Features of Choline-Binding Protein L (CbpL) Contributing to Pneumococcal Pathogenesis

NASA Astrophysics Data System (ADS)

Gutiérrez-Fernández, Javier; Saleh, Malek; Alcorlo, Martín; Gómez-Mejía, Alejandro; Pantoja-Uceda, David; Treviño, Miguel A.; Voß, Franziska; Abdullah, Mohammed R.; Galán-Bartual, Sergio; Seinen, Jolien; Sánchez-Murcia, Pedro A.; Gago, Federico; Bruix, Marta; Hammerschmidt, Sven; Hermoso, Juan A.

2016-12-01

The human pathogen Streptococcus pneumoniae is decorated with a special class of surface-proteins known as choline-binding proteins (CBPs) attached to phosphorylcholine (PCho) moieties from cell-wall teichoic acids. By a combination of X-ray crystallography, NMR, molecular dynamics techniques and in vivo virulence and phagocytosis studies, we provide structural information of choline-binding protein L (CbpL) and demonstrate its impact on pneumococcal pathogenesis and immune evasion. CbpL is a very elongated three-module protein composed of (i) an Excalibur Ca2+-binding domain -reported in this work for the very first time-, (ii) an unprecedented anchorage module showing alternate disposition of canonical and non-canonical choline-binding sites that allows vine-like binding of fully-PCho-substituted teichoic acids (with two choline moieties per unit), and (iii) a Ltp_Lipoprotein domain. Our structural and infection assays indicate an important role of the whole multimodular protein allowing both to locate CbpL at specific places on the cell wall and to interact with host components in order to facilitate pneumococcal lung infection and transmigration from nasopharynx to the lungs and blood. CbpL implication in both resistance against killing by phagocytes and pneumococcal pathogenesis further postulate this surface-protein as relevant among the pathogenic arsenal of the pneumococcus.

Laboratory Testing for von Willebrand Disease: The Past, Present, and Future State of Play for von Willebrand Factor Assays that Measure Platelet Binding Activity, with or without Ristocetin.

PubMed

Just, Sarah

2017-02-01

von Willebrand disease (VWD) was first described nearly a century ago in 1924 by Erik Adolf von Willebrand. Diagnostic testing at the time was very limited and it was not until the mid to late 1900s that more tests became available to assist with the diagnosis and classification of VWD. Two of these tests are based on ristocetin, one being ristocetin-induced platelet aggregation (RIPA) and the other the von Willebrand factor (VWF) ristocetin cofactor assay (VWF:RCo). The VWF:RCo assay provides functional assessment of in vitro VWF binding to the platelet glycoprotein (Gp) complex, GPIb-IX-V. Despite some advancements and newer technologies utilizing the principles of the original VWF:RCo assay, the original assay is still referred to as the gold standard for measurement of VWF activity. This article will review the history of VWD diagnostic assays, including RIPA and VWF:RCo over the past 40 years, as well as the newer assays that measure platelet binding with or without ristocetin, and which have been developed with the aim to potentially replace platelet-based ristocetin-dependent assays. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Structural Transformation Detection Contributes to Screening of Behaviorally Active Compounds: Dynamic Binding Process Analysis of DhelOBP21 from Dastarcus helophoroides.

PubMed

Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun

2017-12-01

In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.

Fluorescent carbohydrate probes for cell lectins

NASA Astrophysics Data System (ADS)

Galanina, Oxana; Feofanov, Alexei; Tuzikov, Alexander B.; Rapoport, Evgenia; Crocker, Paul R.; Grichine, Alexei; Egret-Charlier, Marguerite; Vigny, Paul; Le Pendu, Jacques; Bovin, Nicolai V.

2001-09-01

Fluorescein labeled carbohydrate (Glyc) probes were synthesized as analytical tools for the study of cellular lectins, i.e. SiaLe x-PAA-flu, Sia 2-PAA-flu, GlcNAc 2-PAA-flu, LacNAc-PAA-flu and a number of similar ones, with PAA a soluble polyacrylamide carrier. The binding of SiaLe x-PAA-flu was assessed using CHO cells transfected with E-selectin, and the binding of Sia 2-PAA-flu was assessed by COS cells transfected with siglec-9. In flow cytometry assays, the fluorescein probes demonstrated a specific binding to the lectin-transfected cells that was inhibited by unlabeled carbohydrate ligands. The intense binding of SiaLe x-PAA- 3H to the E-selectin transfected cells and the lack of binding to both native and permeabilized control cells lead to the conclusion that the polyacrylamide carrier itself and the spacer arm connecting the carbohydrate moiety with PAA did not contribute anymore to the binding. Tumors were obtained from nude mice by injection of CHO E-selectin or mock transfected cells. The fluorescent SiaLe x-PAA-flu probe could bind to the tumor sections from E-selectin positive CHO cells, but not from the control ones. Thus, these probes can be used to reveal specifically the carbohydrate binding sites on cells in culture as well as cells in tissue sections. The use of the confocal spectral imaging technique with Glyc-PAA-flu probes offered the unique possibility to detect lectins in different cells, even when the level of lectin expression was rather low. The confocal mode of spectrum recording provided an analysis of the probe localization with 3D submicron resolution. The spectral analysis (as a constituent part of the confocal spectral imaging technique) enabled interfering signals of the probe and intrinsic cellular fluorescence to be accurately separated, the distribution of the probe to be revealed and its local concentration to be measured.

Binding determinants in the interplay between porcine aminopeptidase N and enterotoxigenic Escherichia coli F4 fimbriae.

PubMed

Xia, Pengpeng; Quan, Guomei; Yang, Yi; Zhao, Jing; Wang, Yiting; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Jianzhong; Liu, Siguo; Zhu, Guoqiang

2018-02-26

The binding of F4 + enterotoxigenic Escherichia coli (ETEC) and the specific receptor on porcine intestinal epithelial cells is the initial step in F4 + ETEC infection. Porcine aminopeptidase N (APN) is a newly discovered receptor for F4 fimbriae that binds directly to FaeG adhesin, which is the major subunit of the F4 fimbriae variants F4ab, F4ac, and F4ad. We used overlapping peptide assays to map the APN-FaeG binding sites, which has facilitated in the identifying the APN-binding amino acids that are located in the same region of FaeG variants, thereby limiting the major binding regions of APN to 13 peptides. To determine the core sequence motif, a panel of FaeG peptides with point mutations and FaeG mutants were constructed. Pull-down and binding reactivity assays using piglet intestines determined that the amino acids G159 of F4ab, N209 and L212 of F4ac, and A200 of F4ad were the critical residues for APN binding of FaeG. We further show using ELISA and confocal microscopy assay that amino acids 553-568, and 652-670 of the APN comprise the linear epitope for FaeG binding in all three F4 fimbriae variants.

Substitution of synthetic chimpanzee androgen receptor for human androgen receptor in competitive binding and transcriptional activation assays for EDC screening

EPA Science Inventory

The potential effect of receptor-mediated endocrine modulators across species is of increasing concern. In attempts to address these concerns we are developing androgen and estrogen receptor binding assays using recombinant hormone receptors from a number of species across differ...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

Rainbow Trout Androgen Receptor Alpha And Human Androgen Receptor: Comparisons in the COS Whole Cell Binding Assay
Mary C. Cardon, L. Earl Gray, Jr. and Vickie S. Wilson
U.S. Environmental Protection Agency, ORD, NHEERL, Reproductive Toxicology Division, Research Triangle...

Preclinical Evaluation of [(18)F]THK-5105 Enantiomers: Effects of Chirality on Its Effectiveness as a Tau Imaging Radiotracer.

PubMed

Tago, Tetsuro; Furumoto, Shozo; Okamura, Nobuyuki; Harada, Ryuichi; Adachi, Hajime; Ishikawa, Yoichi; Yanai, Kazuhiko; Iwata, Ren; Kudo, Yukitsuka

2016-04-01

Noninvasive imaging of tau and amyloid-β pathologies would facilitate diagnosis of Alzheimer's disease (AD). Recently, we have developed [(18)F]THK-5105 for selective detection of tau pathology by positron emission tomography (PET). The purpose of this study was to clarify biological properties of optically pure [(18)F]THK-5105 enantiomers. Binding for tau aggregates in AD brain section was evaluated by autoradiography (ARG). In vitro binding assays were performed to evaluate the binding properties of enantiomers for AD brain homogenates. The pharmacokinetics in the normal mouse brains was assessed by ex vivo biodistribution assay The ARG of enantiomers showed the high accumulation of radioactivity corresponding to the distribution of tau deposits. In vitro binding assays revealed that (S)-[(18)F]THK-5105 has slower dissociation from tau than (R)-[(18)F]THK-5105. Biodistribution assays indicated that (S)-[(18)F]THK-5105 eliminated faster from the mouse brains and blood compared with (R)-[(18)F]THK-5105. (S)-[(18)F]THK-5105 could be more suitable than (R)-enantiomer for a tau imaging agent.

Spectroscopic investigation on the interaction of copper porphyrazines and phthalocyanine with human telomeric G-quadruplex DNA.

PubMed

Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham

2014-01-01

The G-quadruplex DNA is a novel target for anticancer drug discovery and many scientific groups are investigating interaction of small molecules with G-quadruplex DNA to discover therapeutic agents for cancer. Here, interaction of a phthalocyanine (Cu(PcTs)) and two tetrapyridinoporphyrazines ([Cu(2,3-tmtppa)](4+) and [Cu(3,4-tmtppa)](4+)) with Na(+) and K(+) forms of human telomeric G-quadruplex DNA has been investigated by spectroscopic techniques. The results indicated that interaction of the cationic porphyrazines is remarkably stronger than the anionic phthalocyanine and they presumably bind to the G-quadruplex DNA through end-stacking. Fluorescent intercalator displacement assay implied the displacement ability of the complexes with thiazole orange. In addition, circular dichroism spectra of both quadruplex forms converge to the Na(+) isoform after binding to the porphyrazines. In conclusion, the porphyrazines as the complexes that bind to the G-quadruplex DNA, could be suitable candidates for further investigations about inhibition of telomerase enzyme. Copyright © 2013 Elsevier B.V. All rights reserved.

Electrokinetic Microstrirring to Enhance Immunoassays

NASA Astrophysics Data System (ADS)

Feldman, Hope; Sigurdson, Marin; Meinhart, Carl

2006-11-01

Electrokinetic microstirring is used to improve the sensitivity of microfluidic heterogeneous immuno-sensors by enhancing the transport in diffusion-limited reactions. The AC electrokinetic force, Electrothermal Flow, is exploited to create a circular stirring fluid motion, thereby providing more binding opportunities between suspended and wall-immobilized molecules. This process can significantly reduce test times, important for both field-portable biosensors and for lab-based assays. A 2-D numerical simulation model is used to predict the effect of electrothermal flow on a heterogeneous immunoassay resulting from an AC potential applied to two parallel electrodes. The binding is increased by a factor of 7 for an applied voltage of 10 Vrms. The effect was investigated experimentally using a high affinity biotin-streptavidin reaction. Microstirred reaction rates were compared with passive reactions. The measurements show on average an order of magnitude increase in binding between immobilized biotin and fluorescently-labeled streptavidin after 5 minutes. Therefore, this technique shows significant promise for reducing incubation time and enhancing the sensitivity of immunoassays.

Purification of anti-bromelain antibodies by affinity precipitation using pNIPAm-linked bromelain.

PubMed

Mahmood, Rubab

2016-01-01

Affinity precipitation has emerged as a very useful technique for the purification of proteins. Here it has been employed for the purification of anti-bromelain antibodies from rabbit serum. A system has been developed for reversibly binding and thermoprecipitating antibodies. Anti-bromelain antibodies were raised in rabbit by immunizing it with bromelain. Poly-N-isopropylacrylamide (pNIPAm)-bromelain conjugate was prepared and incubated with rabbit serum. After that the temperature was raised for thermal precipitation of the polymer. Antibodies were then eluted from the complex by incubating it with a small volume of buffer, pH 3.0. This method is very effective in concentrating the antibodies. Purity and specificity of the antibodies were checked by gel electrophoresis and enzyme-linked immunosorbent assay (ELISA), respectively. The study of the effect of pH and temperature on the binding of the antibodies to the conjugate showed that the optimum binding occurred at pH 8.0 and 25°C.The polymer enzyme conjugate was further used for another cycle.

Food proteins and maturation of small intestinal microvillus membranes (MVM). I. Binding characteristics of cow's milk proteins and concanavalin A to MVM from newborn and adult rats.

PubMed

Stern, M; Gellermann, B

1988-01-01

To study maturational changes of food protein and lectin binding to rat small intestinal microvillus membranes (MVM), MVM were prepared from newborn and adult animals by a modified CaCl2 precipitation technique. Radiolabeled cow's milk proteins [alpha-lactalbumin, alpha-casein, beta-lactoglobulin, bovine serum albumin (BSA)] and the lectin concanavalin A (Con A) were used for incubations. Binding assays were done using miniature ultracentrifugation for separation of unbound material. Binding of Con A to MVM from newborn and adult rats was strong, specific, and saturable. Binding of Con A was inhibited by cold Con A and by the sugar ligand polymer mannan. Adult MVM bound more Con A than newborn preparations. Unlike Con A, binding of cow's milk proteins by MVM was weak, nonspecific, and noninhibitable. Newborn MVM bound more cow's milk proteins than adult controls. This was true for all the proteins tested (p less than 0.001). Binding rose with decreased molecular weight of cow's milk proteins, but molecular weight was not the only determining factor for binding. Trypsin treatment of MVM caused a marked increase of BSA binding in adult but not in newborn preparations. This finding indicated the importance of protein components of MVM for cow's milk protein binding. Maturational changes in protein-lipid interactions and membrane fluidity possibly influence nonspecific cow's milk protein binding to MVM. Differences in binding between newborns and adults were not directly related to maturational shifts in membrane glycosylation that are indicated by differential Con A binding. Increased cow's milk protein binding in newborn individuals might increase the potential risk to develop an adverse reaction to food proteins.

Identification of Proteinaceous Binders in Ancient Tripitaka by the Use of an Enzyme-linked Immunosorbent Assay.

PubMed

Liu, Yi; Li, Yi; Chang, Runxing; Zheng, Hailing; Li, Menglu; Hu, Zhiwen; Zhou, Yang; Wang, Bing

2016-01-01

Proteinaceous materials, such as ovabumin and collagen, were commonly used as binding media, and as adhesives and protective coatings. However, the identification of ancient proteinaceous binders is a great challenge for archaeologists, due to their limited sample size, complex combinations of various ingredients and reduced availability of the binder during the process of protein degradation. In this paper, an enzyme-linked immunosorbent assay (ELISA) provides to be a particularly promising method for the detection of proteinaceous binding materials in ancient relics. The present work focused on the specific identification of proteins in archaeological binders, which was brushed on the Tripitaka. Two samples, the adhesion area (S1) and the ink area (S2), were tested by ELISA. The results showed that both S1 and S2 reacted positively when treated with an anti-collagen-I antibody. It proved the existence of proteinaceous binders in Ancient Tripitaka, and the percentage of collagen in S1 and S2 was 61.44 and 15.4%, respectively. Compared with other conventional techniques, ELISA has advantages of high specificity, sensitivity, rapidity and low cost, making it especially suitable for the protein detection in the archaeological field.

Nuclear blebbing of biologically active organoselenium compound towards human cervical cancer cell (HeLa): in vitro DNA/HSA binding, cleavage and cell imaging studies.

PubMed

Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj

2015-01-27

New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Functional coupling between adenosine A1 receptors and G-proteins in rat and postmortem human brain membranes determined with conventional guanosine-5'-O-(3-[35S]thio)triphosphate ([35S]GTPγS) binding or [35S]GTPγS/immunoprecipitation assay.

PubMed

Odagaki, Yuji; Kinoshita, Masakazu; Ota, Toshio; Meana, J Javier; Callado, Luis F; Matsuoka, Isao; García-Sevilla, Jesús A

2018-06-01

Adenosine signaling plays a complex role in multiple physiological processes in the brain, and its dysfunction has been implicated in pathophysiology of neuropsychiatric diseases such as schizophrenia and affective disorders. In the present study, the coupling between adenosine A 1 receptor and G-protein was assessed by means of two [ 35 S]GTPγS binding assays, i.e., conventional filtration method and [ 35 S]GTPγS binding/immunoprecipitation in rat and human brain membranes. The latter method provides information about adenosine A 1 receptor-mediated Gα i-3 activation in rat as well as human brain membranes. On the other hand, adenosine-stimulated [ 35 S]GTPγS binding determined with conventional assay derives from functional activation of Gα i/o proteins (not restricted only to Gα i-3 ) coupled to adenosine A 1 receptors. The determination of adenosine concentrations in the samples used in the present study indicates the possibility that the assay mixture under our experimental conditions contains residual endogenous adenosine at nanomolar concentrations, which was also suggested by the results on the effects of adenosine receptor antagonists on basal [ 35 S]GTPγS binding level. The effects of adenosine deaminase (ADA) on basal binding also support the presence of adenosine. Nevertheless, the varied patterns of ADA discouraged us from adding ADA into assay medium routinely. The concentration-dependent increases elicited by adenosine were determined in 40 subjects without any neuropsychiatric disorders. The increases in %E max values determined by conventional assay according to aging and postmortem delay should be taken into account in future studies focusing on the effects of psychiatric disorders on adenosine A 1 receptor/G-protein interaction in postmortem human brain tissue.

Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

PubMed

Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

2017-11-21

The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

Method for screening inhibitors of the toxicity of Bacillus anthracis

DOEpatents

Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

2001-01-01

The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

Surface plasmon resonance as a tool for ligand-binding assay reagent characterization in bioanalysis of biotherapeutics.

PubMed

Duo, Jia; Bruno, JoAnne; Kozhich, Alexander; David-Brown, Donata; Luo, Linlin; Kwok, Suk; Santockyte, Rasa; Haulenbeek, Jonathan; Liu, Rong; Hamuro, Lora; Peterson, Jon E; Piccoli, Steven; DeSilva, Binodh; Pillutla, Renuka; Zhang, Yan J

2018-04-01

Ligand-binding assay (LBA) performance depends on quality reagents. Strategic reagent screening and characterization is critical to LBA development, optimization and validation. Application of advanced technologies expedites the reagent screening and assay development process. By evaluating surface plasmon resonance technology that offers high-throughput kinetic information, this article aims to provide perspectives on applying the surface plasmon resonance technology to strategic LBA critical reagent screening and characterization supported by a number of case studies from multiple biotherapeutic programs.

A Comparison of Protein Kinases Inhibitor Screening Methods Using Both Enzymatic Activity and Binding Affinity Determination

PubMed Central

Rudolf, Amalie Frederikke; Skovgaard, Tine; Knapp, Stefan; Jensen, Lars Juhl; Berthelsen, Jens

2014-01-01

Binding assays are increasingly used as a screening method for protein kinase inhibitors; however, as yet only a weak correlation with enzymatic activity-based assays has been demonstrated. We show that the correlation between the two types of assays can be improved using more precise screening conditions. Furthermore a marked improvement in the correlation was found by using kinase constructs containing the catalytic domain in presence of additional domains or subunits. PMID:24915177

Binding Assays Using Recombinant SH2 Domains: Far-Western, Pull-Down, and Fluorescence Polarization.

PubMed

Machida, Kazuya; Liu, Bernard

2017-01-01

Recognition of phosphotyrosine-containing sequences by SH2 domains confers specificity in tyrosine kinase pathways. By assessing interactions between isolated SH2 domains and their binding proteins, it is possible to gain insight into otherwise inaccessible complex cellular systems. Far-Western, pull-down, and fluorescence polarization (FP) have been frequently used for characterization of phosphotyrosine signaling. Here, we outline standard protocols for these established assays using recombinant SH2 domain, emphasizing the importance of appropriate sample preparation and assay controls.

Identification of second arginine-glycine-aspartic acid motif of ovine vitronectin as the complement C9 binding site and its implication in bacterial infection.

PubMed

Prasada, Rao T; Lakshmi, Prasanth T; Parvathy, R; Murugavel, S; Karuna, Devi; Paritosh, Joshi

2017-02-01

Vitronectin (Vn), a multifunctional protein of blood and extracellular matrix, interacts with complement C9. This interaction may modulate innate immunity. Details of Vn-C9 interactions are limited. Vn-C9 interactions were assessed by employing a goat homologous system and observing Vn binding to C9 in three different assays. Using recombinant fragments, C9 binding was mapped to the N-terminus of Vn. Site directed mutagenesis was performed to alter the second arginine glycine aspartic acid (RGD) sequence (RGD-2) of Vn. Changing R to G or D to A in RGD-2 caused significant decrease in Vn binding to C9 whereas changing of R to G in the first RGD motif (RGD-1) had no effect on Vn binding to C9. These results imply that the RGD-2 of goat Vn is involved in C9 binding. In a competitive binding assay, the presence of soluble RGD peptide inhibited Vn binding to C9 whereas heparin had no effect. Vn binding to C9 was also evaluated in terms of bacterial pathogenesis. Serum dependent inhibition of Escherichia coli growth was significantly reverted when Vn or its N-fragment were included in the assay. The C-fragment, which did not support C9 binding, also partly nullified serum-dependent inhibition of bacterial growth, probably through other serum component(s). © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Circulating Immune Complexes in Lyme Arthritis

PubMed Central

Hardin, John A.; Walker, Lesley C.; Steere, Allen C.; Trumble, Thomas C.; Tung, Kenneth S. K.; Williams, Ralph C.; Ruddy, Shaun; Malawista, Stephen E.

1979-01-01

We have found immunoglobulin (Ig) G-containing material consistent with immune complexes in the sera of patients with Lyme arthritis. It was detected in 29 of 55 sera (55%) from 31 patients by at least one of three assays: 125I-C1q binding, C1q solid phase, or Raji cell. The presence of reactive material correlated with clinical aspects of disease activity; it was found early in the illness, was most prominent in sera from the sickest patients, was infrequent during remissions, and often fluctuated in parallel with changes in clinical status. The results in the two C1q assays showed a strong positive correlation (P<0.001). They were each elevated in 45% of the sera and were usually concordant (85%). In contrast, the Raji cell assay was less frequently positive and often discordant with the C1q assays. In sucrose density gradients, putative circulating immune complexes sedimented near 19S; they, too, were detected best by the two assays based on C1q binding. An additional 7S component was found in some sera by the 125I-C1q binding assay. Serum complement was often above the range of normal in patients with mild disease and normal in patients with severe disease but did not correlate significantly with levels of circulating immune complexes. IgM and IgG rheumatoid factors were not detectable. These findings support a role for immune complexes in the pathogenesis of Lyme arthritis. Their measurement, by either the 125I-C1q binding assay or by the C1q solid phase assay, often provides a sensitive index of disease activity. Moreover, the complexes are likely sources of disease-related antigens for further study of this new disorder. PMID:429566

SKLB060 Reversibly Binds to Colchicine Site of Tubulin and Possesses Efficacy in Multidrug-Resistant Cell Lines.

PubMed

Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan

2018-05-22

Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.

Tailored magnetic nanoparticles for in vitro, in vivo and in situ magnetorelaxometry

NASA Astrophysics Data System (ADS)

Pisanic, Thomas R., II

The development of novel methods of probing biological interactions is critical to the advancement of biomedical science. Recent progress in the synthesis and science of nanoscale structures has engendered a renaissance in the evolution of techniques aimed at the analysis of these interactions. The use of nanomaterials provides the researcher with access to the extended quantum behaviors of these materials and the ability to intimately interact with the fundamental subunits of biology. Magnetic materials on this size scale, such as magnetic nanoparticles (MNPs), also exhibit unique properties not available in larger structures and have likewise become of chief interest in the field of nanotechnology. Through exploitation of various synthesis techniques and parameters, the physicochemical and magnetic properties of magnetic nanoparticles can be exquisitely controlled. Magnetorelaxometry is the field of study concerned with the mechanisms of magnetic relaxation and the development of applications that capitalize upon these phenomena. The preferred instrument for the analysis of these magnetic properties is the superconducting quantum interference device (SQUID). This work focuses on the development and chemical modification of MNPs for use with this instrument and the demonstration of novel magnetorelaxometric applications in biomedicine. The basic chemical synthesis of magnetic nanoparticles is first developed and demonstrated, after which the SQUID system and the magnetic properties of a library of synthesis products are analyzed and evaluated for use in magnetorelaxometry. An in vitro assay for sepsis diagnostics is then developed based upon the conjugation of anti-Escherichia coli O157:H7 antibodies to magnetic nanoparticles and the magnetorelaxometric quantification of binding of these MNPs to the target pathogen in buffer, serum and blood. Next, parameters for the conjugation of insecticidic crystal proteins to MNPs are developed and optimized for an in vivo assay for the quantification of toxin binding in the gut of live Caenorhibditis elegans nematodes. Lastly, the concentration dependent effects of MNPs upon PC12 cells are evaluated; followed by the development of an antibody based in situ assay for the detection of tubulin using the TAT peptide for entry into live cells. The results of these assays underscore the utility of magnetorelaxometry for applications in biomedicine.

Two novel assays for the detection of haemin-binding properties of antimalarials evaluated with compounds isolated from medicinal plants.

PubMed

Steele, J C P; Phelps, R J; Simmonds, M S J; Warhurst, D C; Meyer, D J

2002-07-01

Forty-two compounds isolated from nine plants used within South America for the treatment of malaria were tested for haemin binding using two novel, rapid screening methods. The data obtained were analysed with respect to IC(50) values for in vitro toxicity to Plasmodium falciparum trophozoites. One method, a multiwell assay based on the inhibition of the interaction of haemin with glutathione (GSH), is sensitive in the 10 microM range, takes c. 1 h and is suitable for either a high throughput screen or rapid assay during natural product isolation. Of 19 compounds showing antiplasmodial activity (IC(50) < 40 microM), 16 (84%) showed >40% inhibition of GSH-haemin reaction. The sensitivity and specificity of the assay were 0.85 and 0.82, respectively. The positive predictive value was 0.81 and the negative predictive value 0.86. A more sensitive assay (0.1 microM range) is based on the reversal by haemin-binding compounds of the haemin inhibition of the L-dopachrome-methyl ester tautomerase activity of human macrophage migration inhibitory factor. This assay gives a better idea of the affinity of interaction and uses very small amounts of test compound. The log[RI(50)] of eight of the compounds that tested positive in the above assays together with those of quinine and chloroquine showed a positive correlation with log[antiplasmodial IC(50)] for strain T9-96 (r = 0.824) and strain K1 (r = 0.904). Several of the antimalarial compounds that bind haemin are isoquinolines, a class not shown previously to interact with haemin.

Technological advances in diagnostic testing for von Willebrand disease: new approaches and challenges.

PubMed

Hayward, C P M; Moffat, K A; Graf, L

2014-06-01

Diagnostic tests for von Willebrand disease (VWD) are important for the assessment of VWD, which is a commonly encountered bleeding disorder worldwide. Technical innovations have been applied to improve the precision and lower limit of detection of von Willebrand factor (VWF) assays, including the ristocetin cofactor activity assay (VWF:RCo) that uses the antibiotic ristocetin to induce plasma VWF binding to glycoprotein (GP) IbIXV on target platelets. VWF-collagen-binding assays, depending on the type of collagen used, can improve the detection of forms of VWD with high molecular weight VWF multimer loss, although the best method is debatable. A number of innovations have been applied to VWF:RCo (which is commonly performed on an aggregometer), including replacing the target platelets with immobilized GPIbα, and quantification by an enzyme-linked immunosorbent assay (ELISA), immunoturbidimetric, or chemiluminescent end-point. Some common polymorphisms in the VWF gene that do not cause bleeding are associated with falsely low VWF activity by ristocetin-dependent methods. To overcome the need for ristocetin, some new VWF activity assays use gain-of-function GPIbα mutants that bind VWF without the need for ristocetin, with an improved precision and lower limit of detection than measuring VWF:RCo by aggregometry. ELISA of VWF binding to mutated GPIbα shows promise as a method to identify gain-of-function defects from type 2B VWD. The performance characteristics of many new VWF activity assays suggest that the detection of VWD, and monitoring of VWD therapy, by clinical laboratories could be improved through adopting newer generation VWF assays. © 2014 John Wiley & Sons Ltd.

Mapping a Noncovalent Protein-Peptide Interface by Top-Down FTICR Mass Spectrometry Using Electron Capture Dissociation

NASA Astrophysics Data System (ADS)

Clarke, David J.; Murray, Euan; Hupp, Ted; Mackay, C. Logan; Langridge-Smith, Pat R. R.

2011-08-01

Noncovalent protein-ligand and protein-protein complexes are readily detected using electrospray ionization mass spectrometry (ESI MS). Furthermore, recent reports have demonstrated that careful use of electron capture dissociation (ECD) fragmentation allows covalent backbone bonds of protein complexes to be dissociated without disruption of noncovalent protein-ligand interactions. In this way the site of protein-ligand interfaces can be identified. To date, protein-ligand complexes, which have proven tractable to this technique, have been mediated by ionic electrostatic interactions, i.e., ion pair interactions or salt bridging. Here we extend this methodology by applying ECD to study a protein-peptide complex that contains no electrostatics interactions. We analyzed the complex between the 21 kDa p53-inhibitor protein anterior gradient-2 and its hexapeptide binding ligand (PTTIYY). ECD fragmentation of the 1:1 complex occurs with retention of protein-peptide binding and analysis of the resulting fragments allows the binding interface to be localized to a C-terminal region between residues 109 and 175. These finding are supported by a solution-phase competition assay, which implicates the region between residues 108 and 122 within AGR2 as the PTTIYY binding interface. Our study expands previous findings by demonstrating that top-down ECD mass spectrometry can be used to determine directly the sites of peptide-protein interfaces. This highlights the growing potential of using ECD and related top-down fragmentation techniques for interrogation of protein-protein interfaces.

Spectro Analytical, Computational and In Vitro Biological Studies of Novel Substituted Quinolone Hydrazone and it's Metal Complexes.

PubMed

Nagula, Narsimha; Kunche, Sudeepa; Jaheer, Mohmed; Mudavath, Ravi; Sivan, Sreekanth; Ch, Sarala Devi

2018-01-01

Some novel transition metal [Cu (II), Ni (II) and Co (II)] complexes of nalidixic acid hydrazone have been prepared and characterized by employing spectro-analytical techniques viz: elemental analysis, 1 H-NMR, Mass, UV-Vis, IR, TGA-DTA, SEM-EDX, ESR and Spectrophotometry studies. The HyperChem 7.5 software was used for geometry optimization of title compound in its molecular and ionic forms. Quantum mechanical parameters, contour maps of highest occupied molecular orbitals (HOMO) and lowest unoccupied molecular orbitals (LUMO) and corresponding binding energy values were computed using semi empirical single point PM3 method. The stoichiometric equilibrium studies of metal complexes carried out spectrophotometrically using Job's continuous variation and mole ratio methods inferred formation of 1:2 (ML 2 ) metal complexes in respective systems. The title compound and its metal complexes screened for antibacterial and antifungal properties, exemplified improved activity in metal complexes. The studies of nuclease activity for the cleavage of CT- DNA and MTT assay for in vitro cytotoxic properties involving metal complexes exhibited high activity. In addition, the DNA binding properties of Cu (II), Ni (II) and Co (II) complexes investigated by electronic absorption and fluorescence measurements revealed their good binding ability and commended agreement of K b values obtained from both the techniques. Molecular docking studies were also performed to find the binding affinity of synthesized compounds with DNA (PDB ID: 1N37) and "Thymidine phosphorylase from E.coli" (PDB ID: 4EAF) protein targets.

Analysis of molecular determinants of affinity and relative efficacy of a series of R- and S-2-(dipropylamino)tetralins at the 5-HT1A serotonin receptor

PubMed Central

Alder, J Tracy; Hacksell, Uli; Strange, Philip G

2003-01-01

Factors influencing agonist affinity and relative efficacy have been studied for the 5-HT1A serotonin receptor using membranes of CHO cells expressing the human form of the receptor and a series of R-and S-2-(dipropylamino)tetralins (nonhydroxylated and monohydroxylated (5-OH, 6-OH, 7-OH, 8-OH) species). Ligand binding studies were used to determine dissociation constants for agonist binding to the 5-HT1A receptor: Ki values for agonists were determined in competition versus the binding of the agonist [3H]-8-OH DPAT. Competition data were all fitted best by a one-binding site model.Ki values for agonists were also determined in competition versus the binding of the antagonist [3H]-NAD-199. Competition data were all fitted best by a two-binding site model, and agonist affinities for the higher (Kh) and lower affinity (Kl) sites were determined. The ability of the agonists to activate the 5-HT1A receptor was determined using stimulation of [35S]-GTPγS binding. Maximal effects of agonists (Emax) and their potencies (EC50) were determined from concentration/response curves for stimulation of [35S]-GTPγS binding. Kl/Kh determined from ligand binding assays correlated with the relative efficacy (relative Emax) of agonists determined in [35S]-GTPγS binding assays. There was also a correlation between Kl/Kh and Kl/EC50 for agonists determined from ligand binding and [35S]-GTPγS binding assays. Simulations of agonist binding and effect data were performed using the Ternary Complex Model in order to assess the use of Kl/Kh for predicting the relative efficacy of agonists. PMID:12684269

Comparison of Chemical Binding to Recombinant Fathead minnow and Human Estrogen Receptor alpha (ERα) in Whole Cell and Cell-Free Assay Systems.

EPA Science Inventory

Our objectives were to assess whether binding of chemicals differs significantly between recombinant estrogen receptors from fathead minnow (fhERα) and human (hERα) and to evaluate the performance of these receptors using two different in vitro assay systems: a COS whole cell bin...

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND THE HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY

EPA Science Inventory

RAINBOW TROUT ANDROGEN RECEPTOR ALPHA AND HUMAN ANDROGEN RECEPTOR: COMPARISONS IN THE COS WHOLE CELL BINDING ASSAY.
MC Cardon, PC Hartig,LE Gray, Jr. and VS Wilson.
U.S. EPA, ORD, NHEERL, RTD, Research Triangle Park, NC, USA.
Typically, in vitro hazard assessments for ...

Characterization of the swine adipocyte A1 adenosine receptor using an optimized assay system.

PubMed

Dong, Q; Schuchman, J; Carey, G B

1994-07-01

The radioligand binding assay of A1 adenosine receptors in adipocyte crude plasma membrane from Yucatan miniature swine was optimized by evaluating 17 factors involved in the assay. Significant effects of CHAPS, adenosine deaminase, EDTA, pre-rinsing glass fiber filters and pH were found for the binding measurements. Using the optimized procedure, [3H]8-cyclopentyl-1,3-dipropylxanthine, ([3H]-DPCPX) binding to A1 adenosine receptors in swine subcutaneous adipocyte crude plasma membrane was measured; Bmax and Kd values were 479 +/- 77 fmol/mg protein and 0.87 +/- 0.10 nM, respectively. Values for mesenteric adipose tissue from sedentary swine and subcutaneous adipose tissue from exercise-trained swine were also measured.

An innovative and highly drug-tolerant approach for detecting neutralizing antibodies directed to therapeutic antibodies.

PubMed

Sloan, John H; Conway, Richard G; Pottanat, Thomas G; Troutt, Jason S; Higgs, Richard E; Konrad, Robert J; Qian, Yue-Wei

2016-10-01

Immunogenicity testing of biotherapeutic drugs is a regulatory requirement. Herein, we describe a drug-tolerant assay for detecting neutralizing antibodies against a therapeutic antibody. Excess target of the therapeutic antibody was incorporated into the detection step of an affinity capture elution assay. Signal generated from binding of antidrug antibody (ADA) to the therapeutic antibody was compared with signal from binding of ADA to the therapeutic antibody preincubated with its target. The results demonstrated that the target blocked binding of the therapeutic antibody to neutralizing monkey ADA and to two anti-idiotypic antibodies. This highly drug-tolerant novel approach enables the detection of neutralizing antibodies and allows for one basic assay format to achieve complete characterization of ADA responses.

Performance evaluation and multicentre study of a von Willebrand factor activity assay based on GPIb binding in the absence of ristocetin.

PubMed

Patzke, Juergen; Budde, Ulrich; Huber, Andreas; Méndez, Adriana; Muth, Heidrun; Obser, Tobias; Peerschke, Ellinor; Wilkens, Matthias; Schneppenheim, Reinhard

2014-12-01

The functional activity of von Willebrand factor (VWF) is most frequently measured by using the ristocetin cofactor assay (VWF:RCo). However, the method's drawbacks include unsatisfactory precision, sensitivity and availability of automated system applications. We have developed an alternative assay (INNOVANCE VWF Ac) that is based on the binding of VWF to recombinant glycoprotein Ib (GPIb). Two gain-of-function mutations were introduced into a GPIb fragment, allowing an assay format without ristocetin. Fully automated assay applications are available for the BCS/BCS XP systems and the Sysmex CS-2000i, Sysmex CA-7000, Sysmex CA-1500 and Sysmex CA-560 systems.The INNOVANCE VWF Ac assay measuring range extends from 4 to 600% VWF for all systems except the Sysmex CA-560 system. Within-device precision values were found to be between 2 and 7%. The limit of detection was below 2.2% VWF. In a study on the BCS XP system, a total number of 580 sample results yielded a correlation to the VWF:RCo assay of r equal to 0.99 (slope = 0.96). Very similar results were observed when von Willebrand disease samples type 1, 2A, 2B, 2M, 2N and 3 were investigated with the new assay and the VWF:RCo assay. The excellent performance data and comparability to VWF:RCo, together with the ease of use, led us to the conclusion that the ristocetin cofactor assay can be replaced by the new GPIb-binding assay to reliably diagnosing patients with von Willebrand disease.

Comparative study on collagen-binding enzyme-linked immunosorbent assay and ristocetin cofactor activity assays for detection of functional activity of von Willebrand factor.

PubMed

Turecek, Peter L; Siekmann, Jürgen; Schwarz, Hans Peter

2002-04-01

For more than two decades, the ristocetin cofactor (RCo) assay, which measures the von Willebrand factor (vWF)-mediated agglutination of platelets in the presence of the antibiotic ristocetin, has been the most common method for measuring the functional activity of vWF. There is, however, general agreement among clinical analysts that this method has major practical disadvantages in performance and reproducibility. Today, collagen-binding assays (CBA) based on the enzyme-linked immunosorbent assay (ELISA) technique that measure the interaction of vWF and collagen are an alternative analytic procedure based on a more physiological function than that of the RCo procedure. We used both assay systems in a comparative study to assess the functional activity of vWF in plasma as well as in therapeutic preparations. We measured RCo activities of plasma from healthy donors and patients with different types of von Willebrand disease (vWD) and of vWF as a drug substance in factor (F) VIII/vWF concentrates using both the aggregometric and the macroscopic methods. In addition, we measured collagen-binding activity (vWF:CB) using a recently developed commercially available CBA system. To investigate the relation between the structure and the functional activity of vWF, we isolated vWF species with different numbers of multimers from FVIII/vWF concentrates by affinity chromatography on immobilized heparin. The vWF:RCo and vWF:CB of the different fractions were measured, and the multimeric structure of vWF was analyzed by sodium dodecyl sulfate (SDS) agarose gel electrophoresis. (vWF:CB and vWF:RCo are part of the nomenclature proposed by the International Society on Thrombosis and Hemostasis Scientific and Standardization Committee [ISTH SSC] subcommittee on von Willebrand factor, in Maastricht, Germany, June 16, 2000.) Measurement of functional vWF activity by CBA can be carried out with substantially higher interassay reproducibility than can measurement of RCo. Both assay systems can be used for diagnosis and subtyping of vWD, but CBA is more sensitive than either of the two RCo methods. The analysis of vWF multimers in the different fractions obtained by affinity chromatography on heparin Sepharose showed that the activity measured both with RCo assay and CBA correlated with the degree of multimerization. Our results suggest that measurement of the functional activity of vWF by the RCo procedure can be replaced by the more reliable CBA, reflecting the physiological hemostatic activity of vWF. The CBA method appears not only to be more sensitive and easier to carry out than the RCo method is but also to have a higher reproducibility and allow better standardization.

Small Molecule Regulation of Protein Conformation by Binding in the Flap of HIV Protease

PubMed Central

Tiefenbrunn, Theresa; Forli, Stefano; Baksh, Michael M.; Chang, Max W.; Happer, Meaghan; Lin, Ying-Chuan; Perryman, Alexander L.; Rhee, Jin-Kyu; Torbett, Bruce E.; Olson, Arthur J.; Elder, John H.; Finn, M. G.; Stout, C. David

2013-01-01

The fragment indole-6-carboxylic acid (1F1), previously identified as a flap site binder in a fragment-based screen against HIV protease (PR), has been co-crystallized with pepstatin-inhibited PR and with apo-PR. Another fragment, 3-indolepropionic acid (1F1-N), predicted by AutoDock calculations and confirmed in a novel ‘inhibition of nucleation’ crystallization assay, exploits the same interactions in the flap site in two crystal structures. Both 1F1 and 1F1-N bind to the closed form of apo-PR and to pepstatin:PR. In solution, 1F1 and 1F1-N raise the Tm of apo-PR by 3.5–5 °C as assayed by differential scanning fluorimetry (DSF), and show equivalent low-micromolar binding constants to both apo-PR and pepstatin:PR, assayed by backscattering interferometry (BSI). The observed signal intensities in BSI are greater for each fragment upon binding to apo-PR than to pepstatin-bound PR, consistent with greater conformational change in the former binding event. Together, these data indicate that fragment binding in the flap site favors a closed conformation of HIV PR. PMID:23540839

Antibody binding in altered gravity: implications for immunosorbent assay during space flight

NASA Technical Reports Server (NTRS)

Maule, Jake; Fogel, Marilyn; Steele, Andrew; Wainwright, Norman; Pierson, Duane L.; McKay, David S.

2003-01-01

A single antibody-incubation step of an indirect, enzyme-linked immunosorbent assay (ELISA) was performed during microgravity, Martian gravity (0.38 G) and hypergravity (1.8 G) phases of parabolic flight, onboard the NASA KC-135 aircraft. Antibody-antigen binding occurred within 15 seconds; the level of binding did not differ between microgravity, Martian gravity and 1 G (Earth's gravity) conditions. During hypergravity and 1 G, antibody binding was directly proportional to the fluid volume (per microtiter well) used for incubation; this pattern was not observed during microgravity. These effects in microgravity may be due to "fluid spread" within the chamber (observed during microgravity with digital photography), leading to greater fluid-surface contact and subsequently antibody-antigen contact. In summary, these results demonstrate that: i) ELISA antibody-incubation and washing steps can be successfully performed by human operators during microgravity, Martian gravity and hypergravity; ii) there is no significant difference in antibody binding between microgravity, Martian gravity and 1 G conditions; and iii) a smaller fluid volume/well (and therefore less antibody) was required for a given level of binding during microgravity. These conclusions indicate that reduced gravity would not present a barrier to successful operation of immunosorbent assays during spaceflight.

Holotrichia oblita Midgut Proteins That Bind to Bacillus thuringiensis Cry8-Like Toxin and Assembly of the H. oblita Midgut Tissue Transcriptome

PubMed Central

Jiang, Jian; Huang, Ying; Shu, Changlong; Soberón, Mario; Bravo, Alejandra; Liu, Chunqing; Song, Fuping; Lai, Jinsheng

2017-01-01

ABSTRACT The Bacillus thuringiensis strain HBF-18 (CGMCC 2070), containing two cry genes (cry8-like and cry8Ga), is toxic to Holotrichia oblita larvae. Both Cry8-like and Cry8Ga proteins are active against this insect pest, and Cry8-like is more toxic. To analyze the characteristics of the binding of Cry8-like and Cry8Ga proteins to brush border membrane vesicles (BBMVs) in H. oblita larvae, binding assays were conducted with a fluorescent DyLight488-labeled Cry8-like toxin. The results of saturation binding assays demonstrated that Cry8-like bound specifically to binding sites on BBMVs from H. oblita, and heterologous competition assays revealed that Cry8Ga shared binding sites with Cry8-like. Furthermore, Cry8-like-binding proteins in the midgut from H. oblita larvae were identified by pulldown assays and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In addition, the H. oblita midgut transcriptome was assembled by high-throughput RNA sequencing and used for identification of Cry8-like-binding proteins. Eight Cry8-like-binding proteins were obtained from pulldown assays conducted with BBMVs. The LC-MS/MS data for these proteins were successfully matched with the H. oblita transcriptome, and BLASTX results identified five proteins as serine protease, transferrin-like, uncharacterized protein LOC658236 of Tribolium castaneum, ATPase catalytic subunit, and actin. These identified Cry8-like-binding proteins were different from those confirmed previously as receptors for Cry1A proteins in lepidopteran insect species, such as aminopeptidase, alkaline phosphatase, and cadherin. IMPORTANCE Holotrichia oblita is one of the main soil-dwelling pests in China. The larvae damage the roots of crops, resulting in significant yield reductions and economic losses. H. oblita is difficult to control, principally due to its soil-dwelling habits. In recent years, some Cry8 toxins from Bacillus thuringiensis were shown to be active against this pest. Study of the mechanism of action of these Cry8 toxins is needed for their effective use in the control of H. oblita and for their future utilization in transgenic plants. Our work provides important basic data and promotes understanding of the insecticidal mechanism of Cry8 proteins against H. oblita larvae. PMID:28389549

A high-throughput fluorescence polarization assay for inhibitors of gyrase B.

PubMed

Glaser, Bryan T; Malerich, Jeremiah P; Duellman, Sarah J; Fong, Julie; Hutson, Christopher; Fine, Richard M; Keblansky, Boris; Tang, Mary J; Madrid, Peter B

2011-02-01

DNA gyrase, a type II topoisomerase that introduces negative supercoils into DNA, is a validated antibacterial drug target. The holoenzyme is composed of 2 subunits, gyrase A (GyrA) and gyrase B (GyrB), which form a functional A(2)B(2) heterotetramer required for bacterial viability. A novel fluorescence polarization (FP) assay has been developed and optimized to detect inhibitors that bind to the adenosine triphosphate (ATP) binding domain of GyrB. Guided by the crystal structure of the natural product novobiocin bound to GyrB, a novel novobiocin-Texas Red probe (Novo-TRX) was designed and synthesized for use in a high-throughput FP assay. The binding kinetics of the interaction of Novo-TRX with GyrB from Francisella tularensis has been characterized, as well as the effect of common buffer additives on the interaction. The assay was developed into a 21-µL, 384-well assay format and has been validated for use in high-throughput screening against a collection of Food and Drug Administration-approved compounds. The assay performed with an average Z' factor of 0.80 and was able to identify GyrB inhibitors from a screening library.

Method for estimating protein binding capacity of polymeric systems.

PubMed

Sharma, Vaibhav; Blackwood, Keith A; Haddow, David; Hook, Lilian; Mason, Chris; Dye, Julian F; García-Gareta, Elena

2015-01-01

Composite biomaterials made from synthetic and protein-based polymers are extensively researched in tissue engineering. To successfully fabricate a protein-polymer composite, it is critical to understand how strongly the protein binds to the synthetic polymer, which occurs through protein adsorption. Currently, there is no cost-effective and simple method for characterizing this interfacial binding. To characterize this interfacial binding, we introduce a simple three-step method that involves: 1) synthetic polymer surface characterisation, 2) a quick, inexpensive and robust novel immuno-based assay that uses protein extraction compounds to characterize protein binding strength followed by 3) an in vitro 2D model of cell culture to confirm the results of the immuno-based assay. Fibrinogen, precursor of fibrin, was adsorbed (test protein) on three different polymeric surfaces: silicone, poly(acrylic acid)-coated silicone and poly(allylamine)-coated silicone. Polystyrene surface was used as a reference. Characterisation of the different surfaces revealed different chemistry and roughness. The novel immuno-based assay showed significantly stronger binding of fibrinogen to both poly(acrylic acid) and poly(allylamine) coated silicone. Finally, cell studies showed that the strength of the interaction between the protein and the polymer had an effect on cell growth. This novel immuno-based assay is a valuable tool in developing composite biomaterials of synthetic and protein-based polymers with the potential to be applied in other fields of research where protein adsorption onto surfaces plays an important role.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Time-Resolved Fluorescence Resonance Energy Transfer Assay for Discovery of Small-Molecule Inhibitors of Methyl-CpG Binding Domain Protein 2.

PubMed

Wyhs, Nicolas; Walker, David; Giovinazzo, Hugh; Yegnasubramanian, Srinivasan; Nelson, William G

2014-08-01

Methylated DNA binding proteins such as Methyl-CpG Binding Domain Protein 2 (MBD2) can transduce DNA methylation alterations into a repressive signal by recruiting transcriptional co-repressor complexes. Interfering with MBD2 could lead to reactivation of tumor suppressor genes and therefore represents an attractive strategy for epigenetic therapy. We developed and compared fluorescence polarization (FP) and time-resolved fluorescence resonance energy transfer (TR-FRET)-based high-throughput screening (HTS) assays to identify small-molecule inhibitors of the interaction between the methyl binding domain of MBD2 (MBD2-MBD) and methylated DNA. Although both assays performed well in 96-well format, the TR-FRET assay (Z' factor = 0.58) emerged as a superior screening strategy compared with FP (Z' factor = 0.08) when evaluated in an HTS 384-well plate format. Using TR-FRET, we screened the Sigma LOPAC library for MBD2-MBD inhibitors and identified four compounds that also validated in a dose-response series. This included two known DNA intercalators (mitoxantrone and idarubicin) among two other inhibitory compounds (NF449 and aurintricarboxylic acid). All four compounds also inhibited the binding of SP-1, a transcription factor with a GC-rich binding sequence, to a methylated oligonucleotide, demonstrating that the activity was nonspecific. Our results provide proof of principle for using TR-FRET-based HTS to identify small-molecule inhibitors of MBD2 and other DNA-protein interactions. © 2014 Society for Laboratory Automation and Screening.

Assessment of the nickel-albumin binding assay for diagnosis of acute coronary syndrome.

PubMed

da Silva, Sandra Huber; Pereira, Renata da Silva; Hausen, Bruna dos Santos; Signor, Cristiane; Gomes, Patrícia; de Campos, Marli Matiko Anraku; Moresco, Rafael Noal

2011-03-01

Myocardial ischemia may alter the metal binding capacity of circulating serum albumin. Thus, the aim of this study was to describe an automated method to measure ischemia-induced alterations in the binding capacity of serum albumin for exogenous nickel, and to evaluate the diagnostic characteristics of this assay for the assessment of acute coronary syndrome (ACS) in patients presenting to the emergency room (ER) with acute chest pain. We assessed the concentrations of cardiac troponin I (cTnI), serum albumin, ischemia-modified albumin (IMA) measured by the cobalt-albumin binding assay (CABA), and by an automated nickel-albumin binding assay (NABA) in the following groups: ACS (n=63) and non-ischemic chest pain (NICP, n=26). Biochemical markers were determined in blood samples obtained from patients within 3 h of ER admission. cTnI, CABA and NABA concentrations were higher in ACS group in comparison to the NICP group. A significant correlation between NABA and CABA was observed (r=0.5387, p<0.001). Areas under the curve for CABA and NABA were 0.7289 and 0.7582, respectively. Both CABA and NABA have the ability to discriminate patients with ACS. However, NABA has a slightly higher ability to discriminate ACS compared with CABA. Patients with ACS have reduced nickel binding to human serum albumin, and NABA may have an important role as an early marker of myocardial ischemia, particularly in patients presenting to the ER with acute chest pain.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

The 5-HT1A Receptor PET Radioligand 11C-CUMI-101 Has Significant Binding to α1-Adrenoceptors in Human Cerebellum, Limiting Its Use as a Reference Region.

PubMed

Shrestha, Stal S; Liow, Jeih-San; Jenko, Kimberly; Ikawa, Masamichi; Zoghbi, Sami S; Innis, Robert B

2016-12-01

Prazosin, a potent and selective α 1 -adrenoceptor antagonist, displaces 25% of 11 C-CUMI-101 ([O-methyl- 11 C]2-(4-(4-(2-methoxyphenyl)piperazin-1-yl)butyl)-4-methyl-1,2,4-triazine-3,5(2H,4H)dione) binding in monkey cerebellum. We sought to estimate the percentage contamination of 11 C-CUMI-101 binding to α 1 -adrenoceptors in human cerebellum under in vivo conditions. In vitro receptor-binding techniques were used to measure α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors in human, monkey, and rat cerebellum. Binding potential (maximum number of binding sites × affinity [(1/dissociation constant]) was determined using in vitro homogenate binding assays in human, monkey, and rat cerebellum. 3 H-prazosin was used to determine the maximum number of binding sites, as well as the dissociation constant of 3 H-prazosin and the inhibition constant of CUMI-101. α 1 -adrenoceptor density and the affinity of CUMI-101 for these receptors were similar across species. Cerebellar binding potentials were 3.7 for humans, 2.3 for monkeys, and 3.4 for rats. Reasoning by analogy, 25% of 11 C-CUMI-101 uptake in human cerebellum reflects binding to α 1 -adrenoceptors, suggesting that the cerebellum is of limited usefulness as a reference tissue for quantification in human studies. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Diagnostic potential of Fasciola gigantica-derived 14.5 kDa fatty acid binding protein in the immunodiagnosis of bubaline fascioliasis.

PubMed

Allam, G; Bauomy, I R; Hemyeda, Z M; Diab, T M; Sakran, T F

2013-06-01

The 14.5 kDa fatty acid binding protein (FABP) was isolated from the crude extract of adult Fasciola gigantica worms. Polyclonal anti-FABP IgG was generated in rabbits immunized with prepared FABP antigen. Sandwich enzyme-linked immunosorbent assay (ELISA) was applied to detect coproantigen in stools and circulating Fasciola antigen (CA) in sera of 126 water buffaloes by using purified and horseradish peroxidase (HRP)-conjugated anti-FABP IgG. Sandwich ELISA sensitivity was 96.97% and 94.95%; while specificity was 94.12% and 82.35% for coproantigen and CA detection, respectively. However, sensitivity and specificity of the Kato-Katz technique was 73.74% and 100%, respectively. The diagnostic efficacy of sandwich ELISA was 96.55% and 93.1% for coproantigen and CA detection, respectively. In contrast, the diagnostic efficacy of the Kato-Katz technique was 77.59%. In conclusion, these results demonstrate that the purified 14.5 kDa FABP provides a more suitable antigen for immunodiagnosis of early and current bubaline fascioliasis by using sandwich ELISA.

Aptamer-aided target capturing with biocatalytic metal deposition: an electrochemical platform for sensitive detection of cancer cells.

PubMed

Yi, Zi; Li, Xiao-Yan; Gao, Qing; Tang, Li-Juan; Chu, Xia

2013-04-07

A novel aptamer biosensor for cancer cell assay has been reported on the basis of ultrasensitive electrochemical detection. Cancer cell capturing is first accomplished via aptamer-aided recognition, and the cell-aptamer binding events then mediate an alkaline phosphatase-catalyzed silver deposition reaction which can be probed by electrochemical detection. Following biocatalytic silver deposition, an efficient amplification approach for sensitive electrochemical measurements is demonstrated, for cell detection with high sensitivity. Ramos cell are used as a model case, a typical biomarker of the acute blood cell cancer, Burkitt's lymphoma. The results reveal that the developed technique displays desirable selectivity in Ramos cell discrimination, and linear response range from 10 to 10(6) cells with a detection limit as low as 10 cells. Due to the simple procedures, label-free and electrochemistry based detection format, this technique is simple and cost-effective, and exhibits excellent compatibility with miniaturization technologies. The electrochemical cell detection strategy may create an intrinsically specific and sensitive platform for cancer cell assay and associated studies.

Competitive Binding Assay for the G-Protein-Coupled Receptor 30 (GPR30) or G-Protein-Coupled Estrogen Receptor (GPER).

PubMed

Thekkumkara, Thomas; Snyder, Russell; Karamyan, Vardan T

2016-01-01

The role of 2-methoxyestradiol is becoming a major area of investigation because of its therapeutic utility, though its mechanism is not fully explored. Recent studies have identified the G-protein-coupled receptor 30 (GPR30, GPER) as a high-affinity membrane receptor for 2-methoxyestradiol. However, studies aimed at establishing the binding affinities of steroid compounds for specific targets are difficult, as the tracers are highly lipophilic and often result in nonspecific binding in lipid-rich membrane preparations with low-level target receptor expression. 2-Methoxyestradiol binding studies are essential to elucidate the underlying effects of this novel estrogen metabolite and to validate its targets; therefore, this competitive receptor-binding assay protocol was developed in order to assess the membrane receptor binding and affinity of 2-methyoxyestradiol.

GPER Mediates Non-Genomic Effects of Estrogen.

PubMed

Pupo, Marco; Maggiolini, Marcello; Musti, Anna Maria

2016-01-01

Estrogens are important modulators of a broad spectrum of physiological functions in humans. However, despite their beneficial actions, a number of lines of evidence correlate the sustained exposure to exogenous estrogen with increased risk of the onset of various cancers. Mainly these steroid hormones induce their effects by binding and activating estrogen receptors (ERα and ERβ). These receptors belong to the family of ligand-regulated transcription factors, and upon activation they regulate the expression of different target genes by binding directly to specific DNA sequences. On the other hand, in recent years it has become clear that the G protein-coupled estrogen receptor 30 (GPR30/GPER) is able to mediate non-genomic action of estrogens in different cell contexts. In particular, GPER has been shown to specifically bind estrogens, and in turn to functionally cross-react with diverse cell signaling systems such as the epidermal growth factor receptor (EGFR) pathway, the Notch signaling pathway and the mitogen-activated protein kinases (MAPK) pathway. In this chapter we will present some of the different experimental techniques currently used to demonstrate the functional role of GPER in mediating non-genomic actions of estrogens, such as the dual luciferase assay, assessment of the involvement of GPER in the stimulation of cell migration in breast cancer cell lines and in cancer-associated fibroblasts, and chromatin immunoprecipitation assay. Overall, the experimental procedures described herein represent key instruments for assessing the biological role of GPER in mediating non-genomic signals of estrogen.

Quantitative Detection of Small Molecule/DNA Complexes Employing a Force-Based and Label-Free DNA-Microarray

PubMed Central

Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.

2009-01-01

Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688

Optoacoustic sensing of ocular bacterial antigen using targeted gold nanorods

NASA Astrophysics Data System (ADS)

Maswadi, Saher; Page, Leland; Woodward, Lee; Glickman, Randolph D.; Barsalou, Norman

2008-02-01

Bacterial contamination can be detected using a minimally invasive optical method, based on laser-induced optoacoustic spectroscopy, to probe for specific antigens associated with a specific infectious agent. As a model system, we have used a surface antigen (Ag), isolated from Chlamydia trachomatis, and a complementary antibody (Ab). A preparation of 0.2 mg/ml of monoclonal Ab specific to the C. trachomatis surface Ag was conjugated to gold nanorods using standard commercial reagents, in order to produce a targeted contrast agent with a strong optoacoustic signal. The C. trachomatis Ag was absorbed in standard plastic microwells, and the binding of the complementary Ab-nanorod conjugate was tested in an immunoaffinity assay. Optoacoustic signals were elicited from the bound nanorods, using an optical parametric oscillator (OPO) laser system as the optical pump. The wavelength tuneability of the OPO optimized the spectroscopic measurement by exciting the nanorods at their optical absorption maxima. Optoacoustic responses were measured in the microwells using a probe beam deflection technique. Immunoaffinity assays were performed on several dilutions of purified C. trachomatis antigen ranging from 50 μg/ml to 1 pg/ml, in order to determine the detection limit for the optoacoustic-based assay. Only when the antigen was present, and the complementary Ab-NR reagent was introduced into the microwell, was an enhanced optoacoustic signal obtained, which indicated specific binding of the Ab-NR complex. The limit of detection with the current system design is between 1 and 5 pg/ml of bacterial Ag.

Construction of genetically engineered M13K07 helper phage for simultaneous phage display of gold binding peptide 1 and nuclear matrix protein 22 ScFv antibody.

PubMed

Fatemi, Farnaz; Amini, Seyed Mohammad; Kharrazi, Sharmin; Rasaee, Mohammad Javad; Mazlomi, Mohammad Ali; Asadi-Ghalehni, Majid; Rajabibazl, Masoumeh; Sadroddiny, Esmaeil

2017-11-01

The most common techniques of antibody phage display are based on the use of M13 filamentous bacteriophages. This study introduces a new genetically engineered M13K07 helper phage displaying multiple copies of a known gold binding peptide on p8 coat proteins. The recombinant helper phages were used to rescue a phagemid vector encoding the p3 coat protein fused to the nuclear matrix protein 22 (NMP22) ScFv antibody. Transmission electron microscopy (TEM), UV-vis absorbance spectroscopy, and field emission scanning electron microscopy (FE-SEM) with energy dispersive X-ray spectroscopy (EDX) analysis revealed that the expression of gold binding peptide 1 (GBP1) on major coat protein p8 significantly enhances the gold-binding affinity of M13 phages. The recombinant bacteriophages at concentrations above 5×10 4 pfu/ml red-shifted the UV-vis absorbance spectra of gold nanoparticles (AuNPs); however, the surface plasmon resonance of gold nanoparticles was not changed by the wild type bacteriophages at concentrations up to 10 12 pfu/ml. The phage ELISA assay demonstrated the high affinity binding of bifunctional bacteriophages to NMP22 antigen at concentrations of 10 5 and 10 6 pfu/ml. Thus, the p3 end of the bifunctional bacteriophages would be able to bind to specific target antigen, while the AuNPs were assembled along the coat of virus for signal generation. Our results indicated that the complex of antigen-bacteriophages lead to UV-vis spectral changes of AuNPs and NMP22 antigen in concentration range of 10-80μg/ml can be detected by bifunctional bacteriophages at concentration of 10 4 pfu/ml. The ability of bifunctional bacteriophages to bind to antigen and generate signal at the same time, makes this approach applicable for identifying different antigens in immunoassay techniques. Copyright © 2017 Elsevier B.V. All rights reserved.

Cytotoxic activity of proflavine diureas: synthesis, antitumor, evaluation and DNA binding properties of 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas.

PubMed

Kozurková, Mária; Sabolová, Danica; Janovec, Ladislav; Mikes, Jaromír; Koval', Ján; Ungvarský, Ján; Stefanisinová, Miroslava; Fedorocko, Peter; Kristian, Pavol; Imrich, Ján

2008-04-01

The synthesis of novel 1',1''-(acridin-3,6-diyl)-3',3''-dialkyldiureas was reported. Their biological activity to inhibit cell proliferation was assessed by a MTT assay on two cell lines, HeLa and HCT-116, at micromolar concentration. 1',1''-(Acridin-3,6-diyl)-3',3''-dihexyldiurea hydrochloride was active on a HCT-116 cell line with an IC(50) value of 3.1 microM. The interaction of these compounds with calf thymus DNA was investigated by a variety of spectroscopic techniques including UV-vis, fluorescence and CD spectroscopy. From spectrofluorimetric titrations, binding constants for the DNA-drug complexes were determined (K=0.9-4.2x10(5) M(-1)). Antiproliferative activity of synthesized derivatives might be related to their intercalation into DNA.

Techniques for quantitative LC-MS/MS analysis of protein therapeutics: advances in enzyme digestion and immunocapture.

PubMed

Fung, Eliza N; Bryan, Peter; Kozhich, Alexander

2016-04-01

LC-MS/MS has been investigated to quantify protein therapeutics in biological matrices. The protein therapeutics is digested by an enzyme to generate surrogate peptide(s) before LC-MS/MS analysis. One challenge is isolating protein therapeutics in the presence of large number of endogenous proteins in biological matrices. Immunocapture, in which a capture agent is used to preferentially bind the protein therapeutics over other proteins, is gaining traction. The protein therapeutics is eluted for digestion and LC-MS/MS analysis. One area of tremendous potential for immunocapture-LC-MS/MS is to obtain quantitative data where ligand-binding assay alone is not sufficient, for example, quantitation of antidrug antibody complexes. Herein, we present an overview of recent advance in enzyme digestion and immunocapture applicable to protein quantitation.

Timothy-specific IgG antibody levels vary with the pollen seasons.

PubMed

Nordvall, S L; Larsson, P H; Johansson, S G

1986-11-01

Serum samples were collected from eight grass pollen hypersensitive children during a 4-year period. The sera were assayed for contents of timothy-specific IgE antibodies by RAST. Timothy-specific IgG and IgA antibodies were quantified by a refined ELISA in which covalent binding of the antigen to the polystyrene solid phase had been performed. IgG antibodies were also assayed by a Sepharose-protein-A technique with radiolabelled timothy allergens as the antigen. It was possible to register clearcut seasonal variations with postseasonally boosted antibody levels not only of timothy-specific IgE but also of IgG antibody. Both IgG1 and IgG4 antibodies specific for timothy showed seasonal variations of a similar degree. It was not possible to register seasonal variations of the same magnitude of timothy-specific IgA antibodies.

A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva.

PubMed

Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi

2017-01-01

Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.

Quorum sensing inhibitory potential and in silico molecular docking of flavonoids and novel terpenoids from Senegalia nigrescens.

PubMed

Bodede, Olusola; Shaik, Shakira; Chenia, Hafizah; Singh, Parvesh; Moodley, Roshila

2018-04-24

Senegalia nigrescens is used in traditional medicine for the treatment of dysentery and convulsions. This study was aimed at identifying bioactive compounds from S. nigrescens and carrying out in vitro and in silico anti-quorum sensing studies on the compounds. Extracts of S. nigrescens were chromatographed repeatedly. The isolated compounds were characterised using NMR spectroscopy and mass spectrometry. The anti-quorum sensing potential of S. nigrescens crude extracts and selected phytochemicals was quantified using Chromobacterium violaceum quorum sensing-controlled violacein inhibition assays. Qualitative modulation of quorum sensing activity and signal synthesis was investigated using agar diffusion double ring assays and C. violaceum. Molecular docking was conducted to explore the binding conformations of ent-kaurene diterpenes and flavonoids into the binding sites of quorum sensing regulator proteins, CviR and CviR'. Phytochemical investigation of S. nigrescens resulted in the isolation of a new ent-kaurene diterpenoid (ent-kaur-15-en-18,20-diol) alongside ent-kaur-15-en-18-ol, being isolated for the first time from a plant species. Other compounds isolated included 30-hydroxylup-20(29)-en-3β-ol, 3β-hydroxy-20(29)-en-lupan-30-al, lupeol, stigmasterol, a long chain alcohol (tetracosan-1-ol) and three flavonoids (melanoxetin, quercetin and quercetin-3-O-methyl ether). Structures of isolated compounds were elucidated using different spectroscopic techniques including 1D and 2D NMR. Inhibition of violacein production was concentration-dependent, with 56.52% inhibition being obtained with 200 µg of quercetin-3-O-methyl ether, while 53.38% inhibition was obtained with 600 µg of quercetin. Agar diffusion double ring assays indicated CviI synthase/CviR receptor modulation by S. nigrescens phytochemicals, suggesting that quorum signal synthesis was down-regulated and/or targeting binding of signal to the receptor. The computed binding energy data suggested that the flavonoids had a stronger tendency to inhibit both CviR and CviR' with varying binding affinities. S. nigrescens crude extracts together with the novel ent-kaurenoids and flavonoids demonstrated potential anti-quorum sensing activity. S. nigrescens may thus represent a source of anti-quorum sensing therapeutic candidates for the control of existing and emerging infectious diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

ERIC Educational Resources Information Center

John, Nancy J.; Firestone, Gary L.

1987-01-01

Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

Monoclonal Antibody Binding to a Surface-Exposed Epitope on Cowdria ruminantium That Is Conserved among Eight Strains

PubMed Central

Shompole, Sankale; Rurangirwa, Fred R.; Wambugu, Anderson; Sitienei, John; Mwangi, Duncan M.; Musoke, Anthony J.; Mahan, Suman; Wells, Clive W.; McGuire, Travis C.

2000-01-01

Monoclonal antibodies (MAb) binding to Cowdria ruminantium elementary bodies (EB) were identified by enzyme-linked immunosorbent assay, and surface binding of one MAb (446.15) to intact EB was determined by immunofluorescence, immunogold labeling, and transmission electron microscopy. MAb 446.15 bound an antigen of approximately 43 kDa in immunoblots of eight geographically distinct strains. The MAb did not react with Ehrlichia canis antigens or uninfected bovine endothelial cell lysate and may be useful in diagnostic assays and vaccine development. PMID:11063511

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules.

PubMed

Newton, Ana S; Deiana, Luca; Puleo, David E; Cisneros, José A; Cutrona, Kara J; Schlessinger, Joseph; Jorgensen, William L

2017-06-08

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as K d results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses.

JAK2 JH2 Fluorescence Polarization Assay and Crystal Structures for Complexes with Three Small Molecules

PubMed Central

2017-01-01

A competitive fluorescence polarization (FP) assay is reported for determining binding affinities of probe molecules with the pseudokinase JAK2 JH2 allosteric site. The syntheses of the fluorescent 5 and 6 used in the assay are reported as well as Kd results for 10 compounds, including JNJ7706621, NVP-BSK805, and filgotinib (GLPG0634). X-ray crystal structures of JAK2 JH2 in complex with NVP-BSK805, filgotinib, and diaminopyrimidine 8 elucidate the binding poses. PMID:28626520

Lectin functionalized ZnO nanoarrays as a 3D nano-biointerface for bacterial detection.

PubMed

Zheng, Laibao; Wan, Yi; Qi, Peng; Sun, Yan; Zhang, Dun; Yu, Liangmin

2017-05-15

The detection of pathogenic bacteria is essential in various fields, such as food safety, water environmental analysis, or clinical diagnosis. Although rapid and selective techniques have been achieved based on the fast and specific binding of recognitions elements and target, the sensitive detection of bacterial pathogens was limited by their low targets-binding efficiency. The three-dimensional (3D) nano-biointerface, compared with the two-dimensional (2D) flat substrate, has a much higher binding capacity, which can offer more reactive sites to bind with bacterial targets, resulting in a great improvement of detection sensitivity. Herein, a lectin functionalized ZnO nanorod (ZnO-NR) array has been fabricated and employed as a 3D nano-biointerface for Escherichia coli (E. coli) capture and detection by multivalent binding of concanavalin A (ConA) with polysaccharides on the cellular surface of E. coli. The 3D lectin functionalized ZnO-NR array-based assay shows reasonable detection limit and efficiently expanded linear range (1.0×10 3 to 1.0×10 7 cfumL -1 ) for pathogen detection. The platform has a potential for further applications and provides an excellent sensitivity approach for detection of pathogenic bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

Interaction of Flavonoids from Woodwardia unigemmata with Bovine Serum Albumin (BSA): Application of Spectroscopic Techniques and Molecular Modeling Methods.

PubMed

Ma, Rui; Pan, Hong; Shen, Tao; Li, Peng; Chen, Yanan; Li, Zhenyu; Di, Xiaxia; Wang, Shuqi

2017-08-09

Phytochemical investigation on the methanol extract of Woodwardia unigemmata resulted in the isolation of seven flavonoids, including one new flavonol acylglycoside ( 1 ). The structures of these compounds were elucidated on the basis of extensive spectroscopic analysis and comparison of literature data. The multidrug resistance (MDR) reversing activity was evaluated for the isolated compounds using doxorubicin-resistant K562/A02 cells model. Compound 6 showed comparable MDR reversing effect to verapamil. Furthermore, the interaction between compounds and bovine serum albumin (BSA) was investigated by spectroscopic methods, including steady-state fluorescence, synchronous fluorescence, circular dichroism (CD) spectroscopies, and molecular docking approach. The experimental results indicated that the seven flavonoids bind to BSA by static quenching mechanisms. The negative ΔH and ΔS values indicated that van der Waals interactions and hydrogen bonds contributed in the binding of compounds 2 - 6 to BSA. In the case of compounds 1 and 7 systems, the hydrophobic interactions play a major role. The binding of compounds to BSA causes slight changes in the secondary structure of BSA. There are two binding sites of compound 6 on BSA and site I is the main site according to the molecular docking studies and the site marker competitive binding assay.

Characterization of Lactic Acid Bacteria as Poultry Probiotic Candidates with Aflatoxin B1 Binding Activities

NASA Astrophysics Data System (ADS)

Damayanti, E.; Istiqomah, L.; Saragih, J. E.; Purwoko, T.; Sardjono

2017-12-01

Our previous studies have selected lactic acid bacteria (LAB) with antifungal activities from traditional fermented foods made from cassava (G7) and silage feed palm leaf (PDS5 and PDS3). In this study we evaluated their ability to bind aflatoxin B1 (AFB1) and probiotic characteristic. The probiotic characteristic assays of LAB consisted of resistance to acidic conditions (pH 3), gastric juice and bile salts 0.3%. We also carried out an in vitro evaluation of LAB aflatoxin binding ability in viable and non-viable cell for 24 and 48 hours of incubation. The measurement of aflatoxin content was performed by ELISA method using AgraQuant Total Aflatoxin Assay kit. The results showed that all isolates were potential as probiotics and the G7 isolate had the highest viability among other isolates in pH 3 (92.61 %) and the bile salts assay (97.71 %). The percentage of aflatoxin reduction between viable and non-viable cell from each LAB isolate were different. The highest aflatoxin reduction in viable cell assay was performed by G7 isolate (69.11 %) whereas in non-viable cell assay was performed by PDS3 isolate (73.75 %) during incubation time 48 hours. In this study, G7 isolate performed the best probiotic characteristics with the highest viability in acid pH assay, bile salt 0.3% assay and percentage of aflatoxin B1 reduction in viable cell condition. Molecular identification using 16S rRNA sequence analysis showed that G7 isolate had homology with Lactobacillus plantarum (99.9%). It was concluded that Lactobacillus plantarum G7 was potential as probiotic with aflatoxin binding activities.

Flexible Label-Free Quantitative Assay for Antibodies to Influenza Virus Hemagglutinins ▿

PubMed Central

Carney, Paul J.; Lipatov, Aleksandr S.; Monto, Arnold S.; Donis, Ruben O.; Stevens, James

2010-01-01

During the initial pandemic influenza H1N1 virus outbreak, assays such as hemagglutination inhibition and microneutralization provided important information on the relative protection afforded by the population's cross-reactivity from prior infections and immunizations with seasonal vaccines. However, these assays continue to be limited in that they are difficult to automate for high throughput, such as in pandemic situations, as well as to standardize between labs. Thus, new technologies are being sought to improve standardization, reliability, and throughput by using chemically defined reagents rather than whole cells and virions. We now report the use of a cell-free and label-free flu antibody biosensor assay (f-AbBA) for influenza research and diagnostics that utilizes recombinant hemagglutinin (HA) in conjunction with label-free biolayer interferometry technology to measure biomolecular interactions between the HA and specific anti-HA antibodies or sialylated ligands. We evaluated f-AbBA to determine anti-HA antibody binding activity in serum or plasma to assess vaccine-induced humoral responses. This assay can reveal the impact of antigenic difference on antibody binding to HA and also measure binding to different subtypes of HA. We also show that the biosensor assay can measure the ability of HA to bind a model sialylated receptor-like ligand. f-AbBA could be used in global surveillance laboratories since preliminary tests on desiccated HA probes showed no loss of activity after >2 months in storage at room temperature, indicating that the same reagent lots could be used in different laboratories to minimize interlaboratory assay fluctuation. Future development of such reagents and similar technologies may offer a robust platform for future influenza surveillance activities. PMID:20660137

Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

PubMed

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

2012-12-04

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

PubMed Central

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

2014-01-01

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

Domain-based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein.

PubMed

Meng, Q; Li, M; Silberg, M A; Conrad, F; Bettencourt, J; To, R; Huang, C; Ma, J; Meyer, K; Shimizu, R; Cao, L; Tomic, M T; Marks, J D

2012-02-15

Quantitation of individual monoclonal antibodies (mAbs) within a combined antibody drug product is required for preclinical and clinical drug development, including pharmacokinetic (PK), toxicology, stability, and biochemical characterization studies of such drugs. We have developed an antitoxin, XOMA 3AB, consisting of three recombinant mAbs that potently neutralize the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind nonoverlapping BoNT/A epitopes with high affinity. XOMA 3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from Escherichia coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. mAb-specific domains were used to develop an enzyme-linked immunosorbent assay (ELISA) for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay that is robust to interference from components in serum was also developed, and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that binds the same protein and is superior to anti-idiotype approaches. Copyright © 2011 Elsevier Inc. All rights reserved.

Strategic assay deployment as a method for countering analytical bottlenecks in high throughput process development: case studies in ion exchange chromatography.

PubMed

Konstantinidis, Spyridon; Heldin, Eva; Chhatre, Sunil; Velayudhan, Ajoy; Titchener-Hooker, Nigel

2012-01-01

High throughput approaches to facilitate the development of chromatographic separations have now been adopted widely in the biopharmaceutical industry, but issues of how to reduce the associated analytical burden remain. For example, acquiring experimental data by high level factorial designs in 96 well plates can place a considerable strain upon assay capabilities, generating a bottleneck that limits significantly the speed of process characterization. This article proposes an approach designed to counter this challenge; Strategic Assay Deployment (SAD). In SAD, a set of available analytical methods is investigated to determine which set of techniques is the most appropriate to use and how best to deploy these to reduce the consumption of analytical resources while still enabling accurate and complete process characterization. The approach is demonstrated by investigating how salt concentration and pH affect the binding of green fluorescent protein from Escherichia coli homogenate to an anion exchange resin presented in a 96-well filter plate format. Compared with the deployment of routinely used analytical methods alone, the application of SAD reduced both the total assay time and total assay material consumption by at least 40% and 5%, respectively. SAD has significant utility in accelerating bioprocess development activities. Copyright © 2012 American Institute of Chemical Engineers (AIChE).

End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

NASA Astrophysics Data System (ADS)

Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

2008-10-01

We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

Modular Architecture and Unique Teichoic Acid Recognition Features of Choline-Binding Protein L (CbpL) Contributing to Pneumococcal Pathogenesis

PubMed Central

Gutiérrez-Fernández, Javier; Saleh, Malek; Alcorlo, Martín; Gómez-Mejía, Alejandro; Pantoja-Uceda, David; Treviño, Miguel A.; Voß, Franziska; Abdullah, Mohammed R.; Galán-Bartual, Sergio; Seinen, Jolien; Sánchez-Murcia, Pedro A.; Gago, Federico; Bruix, Marta; Hammerschmidt, Sven; Hermoso, Juan A.

2016-01-01

The human pathogen Streptococcus pneumoniae is decorated with a special class of surface-proteins known as choline-binding proteins (CBPs) attached to phosphorylcholine (PCho) moieties from cell-wall teichoic acids. By a combination of X-ray crystallography, NMR, molecular dynamics techniques and in vivo virulence and phagocytosis studies, we provide structural information of choline-binding protein L (CbpL) and demonstrate its impact on pneumococcal pathogenesis and immune evasion. CbpL is a very elongated three-module protein composed of (i) an Excalibur Ca2+-binding domain -reported in this work for the very first time-, (ii) an unprecedented anchorage module showing alternate disposition of canonical and non-canonical choline-binding sites that allows vine-like binding of fully-PCho-substituted teichoic acids (with two choline moieties per unit), and (iii) a Ltp_Lipoprotein domain. Our structural and infection assays indicate an important role of the whole multimodular protein allowing both to locate CbpL at specific places on the cell wall and to interact with host components in order to facilitate pneumococcal lung infection and transmigration from nasopharynx to the lungs and blood. CbpL implication in both resistance against killing by phagocytes and pneumococcal pathogenesis further postulate this surface-protein as relevant among the pathogenic arsenal of the pneumococcus. PMID:27917891

Visualizing double-stranded RNA distribution and dynamics in living cells by dsRNA binding-dependent fluorescence complementation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Xiaofei; College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou, Zhejiang 310036; Deng, Ping

Double-stranded RNA (dsRNA) is an important type of RNA that plays essential roles in diverse cellular processes in eukaryotic organisms and a hallmark in infections by positive-sense RNA viruses. Currently, no in vivo technology has been developed for visualizing dsRNA in living cells. Here, we report a dsRNA binding-dependent fluorescence complementation (dRBFC) assay that can be used to efficiently monitor dsRNA distribution and dynamics in vivo. The system consists of two dsRNA-binding proteins, which are fused to the N- and C-terminal halves of the yellow fluorescent protein (YFP). Binding of the two fusion proteins to a common dsRNA brings themore » split YFP halves in close proximity, leading to the reconstitution of the fluorescence-competent structure and restoration of fluorescence. Using this technique, we were able to visualize the distribution and trafficking of the replicative RNA intermediates of positive-sense RNA viruses in living cells. - Highlights: • A live-cell imaging system was developed for visualizing dsRNA in vivo. • It uses dsRNA binding proteins fused with two halves of a fluorescent protein. • Binding to a common dsRNA enables the reporter to become fluorescent. • The system can efficiently monitor viral RNA replication in living cells.« less

Endogenous benzodiazepine-like compounds and diazepam binding inhibitor in serum of patients with liver cirrhosis with and without overt encephalopathy

PubMed Central

Avallone, R; Zeneroli, M; Venturini, I; Corsi, L; Schreier, P; Kleinschnitz, M; Ferrarese, C; Farina, F; Baraldi, C; Pecora, N; Frigo, M; Baraldi, M

1998-01-01

Background/Aim—Despite some controversy, it has been suggested that endogenous benzodiazepine plays a role in the pathogenesis of hepatic encephalopathy. The aim of the present study was to evaluate the concentrations of endogenous benzodiazepines and the peptide, diazepam binding inhibitor, in the blood of patients with liver cirrhosis with and without overt encephalopathy, and to compare these levels with those of consumers of commercial benzodiazepines. 
Subjects—Normal subjects (90), benzodiazepine consumers (14), and cirrhotic patients (113) were studied. 
Methods—Endogenous benzodiazepines were measured by the radioligand binding technique after high performance liquid chromatography (HPLC) purification. The presence of diazepam and N-desmethyldiazepam was assayed by HPLC-electrospray tandem mass spectrometry. Diazepam binding inhibitor was studied in serum by radioimmunoassay. 
Results—Endogenous benzodiazepines were below the limit of detection in 7% of patients with encephalopathy. When detectable, their levels were at least comparable with those of benzodiazepine consumers and correlated with the liver dysfunction but not the stage of encephalopathy. Serum levels of diazepam binding inhibitor tended to decrease when endogenous benzodiazepines levels increased. 
Conclusions—Endogenous benzodiazepines may accumulate in patients with liver cirrhosis during the course of the disease, and the phenomenon appears to be independent of the presence or absence of encephalopathy. 

 Keywords: benzodiazepine consumers; diazepam binding inhibitor; endogenous benzodiazepines; liver cirrhosis; overt hepatic encephalopathy PMID:9691927

Structure dependent selective efficacy of pyridine and pyrrole based Cu(II) Schiff base complexes towards in vitro cytotoxicity, apoptosis and DNA-bases binding in ground and excited state.

PubMed

Koley Seth, Banabithi; Saha, Arpita; Haldar, Srijan; Chakraborty, Partha Pratim; Saha, Partha; Basu, Samita

2016-09-01

This work highlights a systematic and comparative study of the structure-dependent influence of a series of biologically active Cu(II) Schiff base complexes (CSCs) on their in vitro cytotoxicity, apoptosis and binding with polymeric DNA-bases in ground and photo-excited states. The structure-activity relationship of the closely resembled CSCs towards in vitro cytotoxicity and apoptosis against cervical cancerous HeLa and normal human diploid WI-38 cell lines has been investigated by MTT assay and FACS techniques respectively. The steady-state and time-resolved spectroscopic studies have also been carried out to explore the selective binding affinities of the potential complexes towards different polymeric nucleic acid bases (poly d(A), poly d(T), poly d(G), poly d(C), Poly d(G)-Poly d(C)), which enlighten the knowledge regarding their ability in controlling the structure and medium dependent interactions in 'ground' and 'excited' states. The pyridine containing water soluble complexes (CuL(1) and CuL(3)) are much more cytotoxic than the corresponding pyrrole counterparts (CuL(2) and CuL(4)). Moreover the acidic hydrogens in CuL(1) increase its cytotoxicity much more than methyl substitution as in CuL(3). The results of MTT assay and double staining FACS experiments indicate selective inhibition of cell growth (cell viability 39% (HeLa) versus 85% (WI-38)) and occurrence of apoptosis rather than necrosis. The ground state binding of CuL(1) with polymeric DNA bases, especially with guanine rich DNA (Kb=6.41±0.122×10(5)), that enhances its cytotoxic activity, is further confirmed from its binding isotherms. On the other hand the pyrrole substituted CuL(4) complex exhibits the structure and medium dependent selective electron-transfer in triplet state as observed in laser flash photolysis studies followed by magnetic field (MF) effect. Copyright © 2016 Elsevier B.V. All rights reserved.

SERS and MD simulation studies of a kinase inhibitor demonstrate the emergence of a potential drug discovery tool.

PubMed

Karthigeyan, Dhanasekaran; Siddhanta, Soumik; Kishore, Annavarapu Hari; Perumal, Sathya S R R; Ågren, Hans; Sudevan, Surabhi; Bhat, Akshay V; Balasubramanyam, Karanam; Subbegowda, Rangappa Kanchugarakoppal; Kundu, Tapas K; Narayana, Chandrabhas

2014-07-22

We demonstrate the use of surface-enhanced Raman spectroscopy (SERS) as an excellent tool for identifying the binding site of small molecules on a therapeutically important protein. As an example, we show the specific binding of the common antihypertension drug felodipine to the oncogenic Aurora A kinase protein via hydrogen bonding interactions with Tyr-212 residue to specifically inhibit its activity. Based on SERS studies, molecular docking, molecular dynamics simulation, biochemical assays, and point mutation-based validation, we demonstrate the surface-binding mode of this molecule in two similar hydrophobic pockets in the Aurora A kinase. These binding pockets comprise the same unique hydrophobic patches that may aid in distinguishing human Aurora A versus human Aurora B kinase in vivo. The application of SERS to identify the specific interactions between small molecules and therapeutically important proteins by differentiating competitive and noncompetitive inhibition demonstrates its ability as a complementary technique. We also present felodipine as a specific inhibitor for oncogenic Aurora A kinase. Felodipine retards the rate of tumor progression in a xenografted nude mice model. This study reveals a potential surface pocket that may be useful for developing small molecules by selectively targeting the Aurora family kinases.

Bile Salt-induced Biofilm Formation in Enteric Pathogens: Techniques for Identification and Quantification.

PubMed

Nickerson, Kourtney P; Faherty, Christina S

2018-05-06

Biofilm formation is a dynamic, multistage process that occurs in bacteria under harsh environmental conditions or times of stress. For enteric pathogens, a significant stress response is induced during gastrointestinal transit and upon bile exposure, a normal component of human digestion. To overcome the bactericidal effects of bile, many enteric pathogens form a biofilm hypothesized to permit survival when transiting through the small intestine. Here we present methodologies to define biofilm formation through solid-phase adherence assays as well as extracellular polymeric substance (EPS) matrix detection and visualization. Furthermore, biofilm dispersion assessment is presented to mimic the analysis of events triggering release of bacteria during the infection process. Crystal violet staining is used to detect adherent bacteria in a high-throughput 96-well plate adherence assay. EPS production assessment is determined by two assays, namely microscopy staining of the EPS matrix and semi-quantitative analysis with a fluorescently-conjugated polysaccharide binding lectin. Finally, biofilm dispersion is measured through colony counts and plating. Positive data from multiple assays support the characterization of biofilms and can be utilized to identify bile salt-induced biofilm formation in other bacterial strains.

Solid-phase receptor binding assay for /sup 125/I-hCG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bortolussi, M.; Selmin, O.; Colombatti, A.

1987-01-01

A solid-phase radioligand-receptor assay (RRA) to measure the binding of /sup 125/I-labelled human chorionic gonadotropin (/sup 125/I-hCG) to target cell membranes has been developed. The binding of /sup 125/I-hCG to membranes immobilized on the wells of microtitration plates reached a maximum at about 3 hours at 37 degrees C, was saturable, displayed a high affinity (Ka = 2.4 X 10(9) M-1) and was specifically inhibited by unlabelled hCG. In comparison with RRAs carried out with membranes in suspension, the solid-phase RRA is significantly simpler and much faster to perform as it avoids centrifugation or filtration procedures. The solid-phase RRA wasmore » adapted profitably to process large numbers of samples at the same time. It proved particularly useful as a screening assay to detect anti-hCG monoclonal antibodies with high inhibitory activity for binding of /sup 125/I-hCG to its receptors.« less

Antiviral and Anticancer Optimization Studies of the DNA-binding Marine Natural Product Aaptamine

PubMed Central

Bowling, John J.; Pennaka, Hari K.; Ivey, Kelly; Wahyuono, Subagus; Kelly, Michelle; Schinazi, Raymond F.; Valeriote, Frederick A.; Graves, David E.; Hamann, Mark T.

2016-01-01

Aaptamine has potent cytotoxicity that may be explained by its ability to intercalate DNA. Aaptamine was evaluated for its ability to bind to DNA to validate DNA binding as the primary mechanism of cytotoxicity. Based on UV–vis absorbance titration data, the Kobs for aaptamine was 4.0 (±0.2) × 103 which was essentially equivalent to the known DNA intercalator N-[2-(diethylamino)ethyl]-9-aminoacridine-4-carboxamide. Semi-synthetic core modifications were performed to improve the general structural diversity of known aaptamine analogs and vary its absorption characteristics. Overall, 26 aaptamine derivatives were synthesized which consisted of a simple homologous range of mono and di-N-alkylations as well as some 9-O-sulfonylation and bis-O-isoaaptamine dimer products. Each product was evaluated for activity in a variety of whole cell and viral assays including a unique solid tumor disk diffusion assay. Details of aaptamine's DNA-binding activity and its derivatives’ whole cell and viral assay results are discussed. PMID:18251774

Dye-binding protein assay using a long-wave-absorbing cyanine probe.

PubMed

Zheng, Hong; Mao, Yu Xia; Li, Dong Hui; Zhu, Chang Qing

2003-07-01

A simple and fast protein assay that involves the binding of water-soluble sulfonate heptamethylene cyanine to protein is described. The binding of the dye to protein causes a shift in the absorption maximum of the dye from 778 to 904 nm, and the increase in absorption at 904 nm is monitored. This assay is very reproducible, of good color stability for at least 80 min, and sensitive at the 100 ng/mL level of human serum albumin (HSA) when a spectrophotometer with near-infrared wavelength is used to measure absorbance. Few chemicals except ionic surfactants such as cetyltrimethylammonium bromide and sodium dodecyl sulfonate interfere with the assay. Purified proteins have different capacities to interact with the dye; under the experimental conditions, the linear ranges of bovine serum albumin (BSA), HSA and gamma-IgG were 200-2000, 100-2400, and 200-3000 ng/mL, respectively. The relative standard deviation for the five replicate determinations of 1200 ng/mL BSA is 2.1%.

Lipid-binding analysis using a fat blot assay.

PubMed

Munnik, Teun; Wierzchowiecka, Magdalena

2013-01-01

Protein-lipid interactions play an important role in lipid metabolism, membrane trafficking and cell -signaling by regulating protein localization, activation, and function. The Fat Blot assay is a relatively simple and inexpensive method to examine these interactions using nitrocellulose membrane-immobilized lipids. The assay is adapted from the method by Dowler et al. (Sci STKE 129:pl6, 2002) and provides qualitative and quantitative information on the relative affinity with which a protein binds to a particular lipid. To perform a Fat Blot assay, serial dilutions of different phospholipids are spotted onto a nitrocellulose membrane. These membranes are then incubated with a lipid-binding protein possessing a GST (or other epitope) tag. The membranes are washed and the protein, which is bound to the membrane by virtue of its interaction with the lipid's head group, is detected by immunoblotting with an antibody against GST (or other epitope). The procedure only requires a few micrograms of protein and is quick, simple and cheap to perform.

Advantages and application of label-free detection assays in drug screening.

PubMed

Cunningham, Brian T; Laing, Lance G

2008-08-01

Adoption is accelerating for a new family of label-free optical biosensors incorporated into standard format microplates owing to their ability to enable highly sensitive detection of small molecules, proteins and cells for high-throughput drug discovery applications. Label-free approaches are displacing other detection technologies owing to their ability to provide simple assay procedures for hit finding/validation, accessing difficult target classes, screening the interaction of cells with drugs and analyzing the affinity of small molecule inhibitors to target proteins. This review describes several new drug discovery applications that are under development for microplate-based photonic crystal optical biosensors and the key issues that will drive adoption of the technology. Microplate-based optical biosensors are enabling a variety of cell-based assays, inhibition assays, protein-protein binding assays and protein-small molecule binding assays to be performed with high-throughput and high sensitivity.

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

Stimulation of iodine organification in porcine thyroid cells by thyroid stimulators.

PubMed

Ginsberg, J; Shewring, G; Howells, R; Smith, B R; Hall, R

Several Graves' sera were simultaneously assessed in a bioassay based on the ability of porcine thyroid cells to organify 125I and in a radioreceptor assay for TSH receptor binding activity. Both assay systems were sensitive to 1 mcU/ml (final concentration) of unlabelled bovine TSH. Six Graves' sera were studied in detail over a wide (0-1.0 mcl sera) dose response range in repeat determinations. Two sera exhibited parallel binding and stimulating. However, two sera revealed significant inhibition of 125I-TSH binding prior to the demonstration of stimulation and the other two sera showed stimulatory capabilities before significant binding was evident. IgG was prepared from one serum by ammonium sulphate precipitation and chromatography on Sepharose 6B and then subjected to preparative isoelectric focusing. The isoelectric distribution of the two activities were found to be identical with major peaks of activity at pl=9.5 and pl=8.5. In summary: 1) each Graves' sera exhibits different dose-response curves with respect to binding and stimulation, 2) at certain concentrations of sera, only binding or stimulation were evident, 3) neither assay was consistently more sensitive for the presence of Graves' immunoglobulins, 4) for one Graves' sera, binding and stimulation could not be separated by isoelectric focusing. These studies would suggest each Graves' immunoglobulin has inherently different characteristics in its interaction with the TSH receptor.

Binding of (/sup 3/H)Forskolin to rat brain membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seamon, K.B.; Vaillancourt, R.; Edwards, M.

1984-08-01

(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

PubMed

Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

2017-12-05

Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Alkylating derivative of oxotremorine interacts irreversibly with the muscarinic receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ehlert, F.J.; Jenden, D.J.; Ringdahl, B.

A 2-chloroethylamine derivative of oxotremorine was studied in pharmacological experiments and muscarinic receptor binding assays. The compound, N-(4-(2-chloroethylmethylamino)-2-butynyl)-2-pyrrolidone (BM 123), forms an aziridinium ion in aqueous solution at neutral pH that stimulates contractions of guinea pig ileum with a potency similar to that of oxotremorine. Following the initial stimulation, there is a long lasting period of lack of sensitivity of the guinea pig ileum to muscarinic agonists. BM 123 also produces muscarinic effects in vivo. When homogenates of the rat cerebral cortex were incubated with BM 123 and assayed subsequently in muscarinic receptor binding assays, a loss of binding capacitymore » for the muscarinic antagonist, (/sup 3/H)N-methylscopolamine ((/sup 3/H)NMS), was noted without a change in affinity. Similar observations were made in (/sup 3/H)1-3-quinuclidinyl benzilate ((/sup 3/H)-QNB) binding assays on the forebrains of mice that had been injected with BM 123 24 hr earlier. The loss in receptor capacity for both (/sup 3/H)NMS and (/sup 3/H)-QNB was prevented by atropine treatment. Kinetic studies of the interaction of BM 123 with homogenates of the rat cerebral cortex in vitro showed that the half-time for the loss of (/sup 3/H)-QNB binding sites increased from 10 to 45 min as the concentration of BM 123 decreased from 10 to 1 ..mu..M. In contrast to the aziridinium ion, the parent 2-chloroethylamine compound and the alcoholic hydrolysis product were largely devoid of pharmacological and binding activity.« less

A comparison of sperm agglutination and immobilization assays with a quantitative ELISA for anti-sperm antibody in serum.

PubMed

Lynch, D M; Leali, B A; Howe, S E

1986-08-01

An enzyme-linked immunosorbent assay (ELISA) that quantitates antisperm antibody in serum was compared with standard sperm agglutination and immobilization assays with the use of sera from 40 normal and 292 subfertile individuals. Quantitation of the assay was accomplished by standardizing assay parameters, including the incorporation of a standard reference curve, the number of whole target sperm, the optimal dilution of serum, the selection of microtiter plate, and the time and temperatures involved in the adsorption and incubation phases. With this method, the level of antisperm antibody binding to target sperm in 40 normal fertile individuals was found to be 2.3 (+/- 1.1 standard deviation [SD]) fg immunoglobulin (Ig)/sperm. An increased mean level of 7.4 +/- 3.7 fg Ig/sperm was determined in 84 infertile patients with positive agglutination and/or immobilization tests. In 208 individuals with negative agglutination and immobilization tests the mean concentration of antisperm antibody was 2.5 +/- 1.3 fg Ig/sperm. Postvasectomy patients assayed by this method had a mean Ig binding value of 7.1 +/- 2.4 fg Ig/sperm. The infertile group with positive agglutination and/or immobilization tests had a significantly higher mean antisperm antibody level than the normal fertile group, according to the Student's t-test for independent samples (P less than 0.001). This indirect serum-based assay reproducibly quantitates antisperm antibody binding to whole target sperm, suggests the normal and abnormal levels of antisperm antibody, and correlates with standard functional assays.

A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.

PubMed

Wessels, M R; Muñoz, A; Kasper, D L

1987-12-01

We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.

A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

PubMed

Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

2009-10-07

Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

Automated data processing and radioassays.

PubMed

Samols, E; Barrows, G H

1978-04-01

Radioassays include (1) radioimmunoassays, (2) competitive protein-binding assays based on competition for limited antibody or specific binding protein, (3) immunoradiometric assay, based on competition for excess labeled antibody, and (4) radioreceptor assays. Most mathematical models describing the relationship between labeled ligand binding and unlabeled ligand concentration have been based on the law of mass action or the isotope dilution principle. These models provide useful data reduction programs, but are theoretically unfactory because competitive radioassay usually is not based on classical dilution principles, labeled and unlabeled ligand do not have to be identical, antibodies (or receptors) are frequently heterogenous, equilibrium usually is not reached, and there is probably steric and cooperative influence on binding. An alternative, more flexible mathematical model based on the probability or binding collisions being restricted by the surface area of reactive divalent sites on antibody and on univalent antigen has been derived. Application of these models to automated data reduction allows standard curves to be fitted by a mathematical expression, and unknown values are calculated from binding data. The vitrues and pitfalls are presented of point-to-point data reduction, linear transformations, and curvilinear fitting approaches. A third-order polynomial using the square root of concentration closely approximates the mathematical model based on probability, and in our experience this method provides the most acceptable results with all varieties of radioassays. With this curvilinear system, linear point connection should be used between the zero standard and the beginning of significant dose response, and also towards saturation. The importance is stressed of limiting the range of reported automated assay results to that portion of the standard curve that delivers optimal sensitivity. Published methods for automated data reduction of Scatchard plots for radioreceptor assay are limited by calculation of a single mean K value. The quality of the input data is generally the limiting factor in achieving good precision with automated as it is with manual data reduction. The major advantages of computerized curve fitting include: (1) handling large amounts of data rapidly and without computational error; (2) providing useful quality-control data; (3) indicating within-batch variance of the test results; (4) providing ongoing quality-control charts and between assay variance.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Engineering and exploitation of a fluorescent HIV-1 gp120 for live cell CD4 binding assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costantini, Lindsey M.; Irvin, Susan C.; Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461

The HIV-1 envelope glycoprotein, gp120, binds the host cell receptor, CD4, in the initial step of HIV viral entry and infection. This process is an appealing target for the development of inhibitory drugs and neutralizing antibodies. To study gp120 binding and intracellular trafficking, we engineered a fluorescent fusion of the humanized gp120 JRFL HIV-1 variant and GFP. Gp120-sfGFP is glycosylated with human sugars, robustly expressed, and secreted from cultured human cells. Protein dynamics, quality control, and trafficking can be visualized in live cells. The fusion protein can be readily modified with different gp120 variants or fluorescent proteins. Finally, secreted gp120-sfGFPmore » enables a sensitive and easy binding assay that can quantitatively screen potential inhibitors of gp120-CD4 binding on live cells via fluorescence imaging or laser scanning cytometry. This adaptable research tool should aid in studies of gp120 cell biology and the development of novel anti-HIV drugs. - Highlights: • Development of fluorescent protein labeled HIV-1 envelope gp120. • Imaging of gp120 dynamics and trafficking in live cells. • Quantitative visual assay of antibody-mediated inhibition of gp120 binding to CD4 on live cells.« less

Data quality in drug discovery: the role of analytical performance in ligand binding assays

NASA Astrophysics Data System (ADS)

Wätzig, Hermann; Oltmann-Norden, Imke; Steinicke, Franziska; Alhazmi, Hassan A.; Nachbar, Markus; El-Hady, Deia Abd; Albishri, Hassan M.; Baumann, Knut; Exner, Thomas; Böckler, Frank M.; El Deeb, Sami

2015-09-01

Despite its importance and all the considerable efforts made, the progress in drug discovery is limited. One main reason for this is the partly questionable data quality. Models relating biological activity and structures and in silico predictions rely on precisely and accurately measured binding data. However, these data vary so strongly, such that only variations by orders of magnitude are considered as unreliable. This can certainly be improved considering the high analytical performance in pharmaceutical quality control. Thus the principles, properties and performances of biochemical and cell-based assays are revisited and evaluated. In the part of biochemical assays immunoassays, fluorescence assays, surface plasmon resonance, isothermal calorimetry, nuclear magnetic resonance and affinity capillary electrophoresis are discussed in details, in addition radiation-based ligand binding assays, mass spectrometry, atomic force microscopy and microscale thermophoresis are briefly evaluated. In addition, general sources of error, such as solvent, dilution, sample pretreatment and the quality of reagents and reference materials are discussed. Biochemical assays can be optimized to provide good accuracy and precision (e.g. percental relative standard deviation <10 %). Cell-based assays are often considered superior related to the biological significance, however, typically they cannot still be considered as really quantitative, in particular when results are compared over longer periods of time or between laboratories. A very careful choice of assays is therefore recommended. Strategies to further optimize assays are outlined, considering the evaluation and the decrease of the relevant error sources. Analytical performance and data quality are still advancing and will further advance the progress in drug development.

Attribution of the discrepancy between ELISA and LC-MS/MS assay results of a PEGylated scaffold protein in post-dose monkey plasma samples due to the presence of anti-drug antibodies.

PubMed

Wang, Shujie J; Wu, Steven T; Gokemeijer, Jochem; Fura, Aberra; Krishna, Murli; Morin, Paul; Chen, Guodong; Price, Karen; Wang-Iverson, David; Olah, Timothy; Weiner, Russell; Tymiak, Adrienne; Jemal, Mohammed

2012-01-01

High-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS) and enzyme-linked immunosorbent assay (ELISA) methods were developed for the quantification of a PEGylated scaffold protein drug in monkey plasma samples. The LC-MS/MS method was based on the extraction of the therapeutic protein with a water-miscible organic solvent and the subsequent trypsin digestion of the extract followed by the detection of a surrogate peptide. The assay was linear over a range of 10-3,000 ng/mL. The ELISA method utilized a therapeutic target-binding format in which the recombinant target antigen was used to capture the drug in the sample, followed by detection with an anti-PEG monoclonal antibody. The assay range was 30-2,000 ng/mL. A correlation study between the two methods was performed by measuring the drug concentrations in plasma samples from a single-dose pharmacokinetic (PK) study in cynomolgus monkeys following a 5-mg/kg subcutaneous administration (n = 4). In the early time points of the PK profile, the drug concentrations obtained by the LC-MS/MS method agreed very well with those obtained by the ELISA method. However, at later time points, the drug concentrations measured by the LC-MS/MS method were consistently higher than those measured by the ELISA method. The PK parameters calculated based on the concentration data showed that the two methods gave equivalent peak exposure (C(max)) at 24-48 h. However, the LC-MS/MS results exhibited about 1.53-fold higher total exposure (AUC(tot)) than the ELISA results. The discrepancy between the LC-MS/MS and ELISA results was investigated by conducting immunogenicity testing, anti-drug antibody (ADA) epitope mapping, and Western blot analysis of the drug concentrations coupled with Protein G separation. The results demonstrated the presence of ADA specific to the engineered antigen-binding region of the scaffold protein drug that interfered with the ability of the drug to bind to the target antigen used in the ELISA method. In the presence of the ADAs, the ELISA method measured only the active circulating drug (target-binding), while the LC-MS/MS method measured the total circulating drug. The work presented here indicates that the bioanalysis of protein drugs may be complicated owing to the presence of drug-binding endogenous components or ADAs in the post-dose (incurred) samples. The clear understanding of the behavior of different bioanalytical techniques vis-à-vis the potentially interfering components found in incurred samples is critical in selecting bioanalytical strategies for measuring protein drugs.

Design of Cyclic Peptide Based Glucose Receptors and Their Application in Glucose Sensing.

PubMed

Li, Chao; Chen, Xin; Zhang, Fuyuan; He, Xingxing; Fang, Guozhen; Liu, Jifeng; Wang, Shuo

2017-10-03

Glucose assay is of great scientific significance in clinical diagnostics and bioprocess monitoring, and to design a new glucose receptor is necessary for the development of more sensitive, selective, and robust glucose detection techniques. Herein, a series of cyclic peptide (CP) glucose receptors were designed to mimic the binding sites of glucose binding protein (GBP), and CPs' sequence contained amino acid sites Asp, Asn, His, Asp, and Arg, which constituted the first layer interactions of GBP. The properties of these CPs used as a glucose receptor or substitute for the GBP were studied by using a quartz crystal microbalance (QCM) technique. It was found that CPs can form a self-assembled monolayer at the Au quartz electrode surface, and the monolayer's properties were characterized by using cyclic voltammetry, electrochemical impedance spectroscopy, and atomic force microscopy. The CPs' binding affinity to saccharide (i.e., galactose, fructose, lactose, sucrose, and maltose) was investigated, and the CPs' sensitivity and selectivity toward glucose were found to be dependent upon the configuration,i.e., the amino acids sequence of the CPs. The cyclic unit with a cyclo[-CNDNHCRDNDC-] sequence gave the highest selectivity and sensitivity for glucose sensing. This work suggests that a synthetic peptide bearing a particular functional sequence could be applied for developing a new generation of glucose receptors and would find huge application in biological, life science, and clinical diagnostics fields.

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Simple method provides resolution of albumin, lipoprotein, free fraction, and chylomicron to enhance the utility of protein binding assays.

PubMed

Brockman, Adam H; Oller, Haley R; Moreau, Benoît; Kriksciukaite, Kristina; Bilodeau, Mark T

2015-02-12

Medicinal chemists have been encouraged in recent years to embrace high speed protein binding assays. These methods employ dialysis membranes in 96-well format or spin filters. Membrane-based methods do not separate lipoprotein binding from albumin binding and introduce interference despite membrane binding controls. Ultracentrifugation methods, in contrast, do not introduce interference if density gradients can be avoided and they resolve lipoprotein from albumin. A new generation of compact, fast ultracentrifuges facilitates the rapid and fully informative separation of plasma into albumin, albumin/fatty acid complex, lipoprotein, protein-free, and chylomicron fractions with no need of salt or sugar density gradients. We present a simple and fast ultracentrifuge method here for two platinum compounds and a taxane that otherwise bound irreversibly to dialysis membranes and which exhibited distinctive lipoprotein binding behaviors. This new generation of ultracentrifugation methods underscores a need to further discuss protein binding assessments as they relate to medicinal chemistry efforts.

γ-Aminobutyric acid ameliorates fluoride-induced hypothyroidism in male Kunming mice.

PubMed

Yang, Haoyue; Xing, Ronge; Liu, Song; Yu, Huahua; Li, Pengcheng

2016-02-01

This study evaluated the protective effects of γ-aminobutyric acid (GABA), a non-protein amino acid and anti-oxidant, against fluoride-induced hypothyroidism in mice. Light microscope sample preparation technique and TEM sample preparation technique were used to assay thyroid microstructure and ultrastructure; enzyme immunoassay method was used to assay hormone and protein levels; immunohistochemical staining method was used to assay apoptosis of thyroid follicular epithelium cells. Subacute injection of sodium fluoride (NaF) decreased blood T4, T3 and thyroid hormone-binding globulin (TBG) levels to 33.98 μg/l, 3 2.8 ng/ml and 11.67 ng/ml, respectively. In addition, fluoride intoxication induced structural abnormalities in thyroid follicles. Our results showed that treatment of fluoride-exposed mice with GABA appreciably decreased metabolic toxicity induced by fluoride and restored the microstructural and ultrastructural organisation of the thyroid gland towards normalcy. Compared with the negative control group, GABA treatment groups showed significantly upregulated T4, T3 and TBG levels (42.34 μg/l, 6.54 ng/ml and 18.78 ng/ml, respectively; P<0.05), properly increased TSH level and apoptosis inhibition in thyroid follicular epithelial cells. To the best of our knowledge, this is the first study to establish the therapeutic efficacy of GABA as a natural antioxidant in inducing thyroprotection against fluoride-induced toxicity. Copyright © 2015 Elsevier Inc. All rights reserved.

A Spectrophotometric Assay Optimizing Conditions for Pepsin Activity.

ERIC Educational Resources Information Center

Harding, Ethelynda E.; Kimsey, R. Scott

1998-01-01

Describes a laboratory protocol optimizing the conditions for the assay of pepsin activity using the Coomasie Blue dye binding assay of protein concentration. The dye bonds through strong, noncovalent interactions to basic and aromatic amino acid residues. (DDR)

Inactivation of human norovirus and Tulane virus in simple media and fresh whole strawberries by ionizing radiation.

PubMed

DiCaprio, Erin; Phantkankum, Nuttapong; Culbertson, Doug; Ma, Yuanmei; Hughes, John H; Kingsley, David; Uribe, Roberto M; Li, Jianrong

2016-09-02

Human norovirus (NoV) is a major cause of fresh produce-associated outbreaks and human NoV in irrigation water can potentially lead to viral internalization in fresh produce. Therefore, there is a need to develop novel intervention strategies to target internalized viral pathogens while maintaining fresh produce quality. In this study electron beam (E-beam) and gamma radiation were evaluated for efficacy against a human NoV GII.4 strain and Tulane virus (TV). Virus survival following ionizing radiation treatments was determined using direct quantitative reverse transcriptase PCR (RT-qPCR), the porcine gastric mucin magnetic bead (PGM-MB) binding assay followed by RT-qPCR, and plaque assay. In simple media, a high dose of E-beam treatment was required to completely abolish the receptor binding ability of human NoV (35.3kGy) and TV (19.5-24.1kGy), as assessed using the PGM-MB binding assay. Both human NoV and TV were more susceptible to gamma irradiation than E-beam, requiring 22.4kGy to achieve complete inactivation. In whole strawberries, no human NoV or TV RNA was detected following 28.7kGy of E-beam treatment using the PGM-MB binding assay. Overall, human NoV and TV are highly resistant to ionizing radiation and therefore the technology may not be suitable to eliminate viruses in fresh produce at the currently approved levels. In addition, the PGM-MB binding assay is an improved method to detect viral infectivity compared to direct RT-qPCR. Copyright © 2016. Published by Elsevier B.V.

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

A novel DCX missense mutation in a family with X-linked lissencephaly and subcortical band heterotopia syndrome inherited from a low-level somatic mosaic mother: Genetic and functional studies.

PubMed

Tsai, Meng-Han; Kuo, Pei-Wen; Myers, Candace T; Li, Shih-Wen; Lin, Wei-Che; Fu, Ting-Ying; Chang, Hsin-Yun; Mefford, Heather C; Chang, Yao-Chung; Tsai, Jin-Wu

2016-09-01

To study the genetics and functional alteration of a family with X-linked lissencephaly and subcortical band heterotopia. Five affected patients (one male with lissencephaly, four female with subcortical band heterotopia) and their relatives were studied. Sanger sequencing of DCX gene, allele specific PCR and molecular inversion probe technique were performed. Mutant and wild type of the gene products, namely doublecortin, were expressed in cells followed by immunostaining to explore the localization of doublecortin and microtubules in cells. In vitro microtubule-binding protein spin-down assay was performed to quantify the binding ability of doublecortin to microtubules. We identified a novel DCX mutation c.785A > G, p.Asp262Gly that segregated with the affected members of the family. Allele specific PCR and molecular inversion probe technique demonstrated that the asymptomatic female carrier had an 8% mutant allele fraction in DNA derived from peripheral leukocytes. This mother had 7 children, 4 of whom were affected and all four affected siblings carried the mutation. Functional study showed that the mutant doublecortin protein had a significant reduction of its ability to bind microtubules. Low level mosaicism could be a cause of inherited risk from asymptomatic parents for DCX related lissencephaly-subcortical band heterotopia spectrum. This is particularly important in terms of genetic counselling for recurrent risk of future pregnancies. The reduced binding affinity of mutant doublecortin may contribute to developmental malformation of the cerebral cortex. Copyright © 2016 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling

NASA Astrophysics Data System (ADS)

Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu

2017-11-01

In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots.

PubMed

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-06

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625 /S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

Transcriptional regulation of podoplanin expression by Prox1 in lymphatic endothelial cells.

PubMed

Pan, Yanfang; Wang, Wen-di; Yago, Tadayuki

2014-07-01

Transcription factor prospero homeobox 1 (Prox-1) and podoplanin (PDPN), mucin-type transmembane protein, are both constantly expressed in lymphatic endothelial cells (LECs) and appear to function in an LEC-autonomous manner. Mice globally lacking PDPN (Pdpn(-/-)) develop abnormal and blood-filled lymphatic vessels that highly resemble those in inducible mice lacking Prox-1 (Prox1(-/-)). Prox1 has also been reported to induce PDPN expression in cultured ECs. Thus, we hypothesize that PDPN functions downstream of Prox1 and that its expression is regulated by Prox1 in LECs at the transcriptional level. We first identified four putative binding elements for Prox1 in the 5' upstream regulatory region of Pdpn gene and found that Prox1 directly binds to the 5' regulatory sequence of Pdpn gene in LECs by chromatin immunoprecipitation assay. DNA pull down assay confirmed that Prox1 binds to the putative binding element. In addition, luciferase reporter assay indicated that Prox1 binding to the 5' regulatory sequence of Pdpn regulates Pdpn gene expression. We are therefore the first to experimentally demonstrate that Prox1 regulates PDPN expression at the transcriptional level in the lymphatic vascular system. Copyright © 2014 Elsevier Inc. All rights reserved.

A CE-FL based method for real-time detection of in-capillary self-assembly of the nanoconjugates of polycysteine ligand and quantum dots

NASA Astrophysics Data System (ADS)

Wang, Jianhao; Zhu, Zhilan; Qiu, Lin; Wang, Jianpeng; Wang, Xiang; Xiao, Qicai; Xia, Jiang; Liu, Li; Liu, Xiaoqian; Feng, Wei; Wang, Jinmei; Miao, Peng; Gao, Liqian

2018-07-01

Small molecules with free thiol groups always show high binding affinity to quantum dots (QDs). However, it is still highly challenging to detect the binding capacity between thiol-containing molecules and QDs inside a capillary. To conquer this limitation, a capillary electrophoresis with fluorescence detection (CE-FL) based assay was proposed and established to investigate the binding capacity between QDs and a poly-thiolated peptide (ATTO 590-DDSSGGCCPGCC, ATTO-C4). Interestingly, the results showed that interval time had a great influence on QDs and ATTO-C4 self-assembly, which can be attributed to longer interval time benefitting the binding of QDs to ATTO-C4. The stability assays on ATTO-C4-QD assembly indicated that high concentration of imidazole or GSH had a high capability of competing with the bound ATTO-C4, evidenced by dramatically dropping of S 625/S 565 ratio from 0.78 to 0.30 or 0.29. Therefore, all these results above suggested that this novel CE-FL based detection assay could be successfully applied to the binding studies between QDs and thiol-containing biomolecules.

An exonuclease I-based label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection with a wide concentration range.

PubMed

Wei, Yanli; Chen, Yanxia; Li, Huanhuan; Shuang, Shaomin; Dong, Chuan; Wang, Gufeng

2015-01-15

A novel aptamer-based label-free assay for sensitive and selective detection of ATP was developed. This assay employs a new aptamer/fluorescent probe system that shows resistance to exonuclease I (Exo I) digestion upon binding to ATP molecules. In the absence of ATP, the complex between the ATP-binding aptamer (ATP-aptamer) and a DNA binding dye, berberine, is digested upon the addition of exonuclease I, leading to the release of berberine into solution and consequently, quenched berberine fluorescence. In the presence of ATP, the ATP-binding aptamer folds into a G-quadruplex structure that is resistant to Exo I digestion. Accordingly, berberine is protected in the G-quadruplex structure and high fluorescence intensity is observed. As such, based on the fluorescence signal change, a label-free fluorescence assay for ATP was developed. Factors affecting the analysis of ATP including the concentration of ATP-binding aptamer, reaction time, temperature and the concentration of Exo I were comprehensively investigated. Under optimal conditions, the fluorescence intensity of the sensing system displayed a response for ATP in a wide range up to 17.5 mM with a detection limit of 140 nM.

Evaluation of an Immunochromatographic Assay for Rapid Detection of Penicillin-Binding Protein 2a in Human and Animal Staphylococcus intermedius Group, Staphylococcus lugdunensis, and Staphylococcus schleiferi Clinical Isolates.

PubMed

Arnold, A R; Burnham, C-A D; Ford, B A; Lawhon, S D; McAllister, S K; Lonsway, D; Albrecht, V; Jerris, R C; Rasheed, J K; Limbago, B; Burd, E M; Westblade, L F

2016-03-01

The performance of a rapid penicillin-binding protein 2a (PBP2a) detection assay, the Alere PBP2a culture colony test, was evaluated for identification of PBP2a-mediated beta-lactam resistance in human and animal clinical isolates of Staphylococcus intermedius group, Staphylococcus lugdunensis, and Staphylococcus schleiferi. The assay was sensitive and specific, with all PBP2a-negative and PBP2a-positive strains testing negative and positive, respectively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.

PubMed

Fischer, Cornelia; Sauter, Margret; Dietrich, Petra

2017-01-01

Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.

Real-time optical imaging of the interaction of epidermal growth factor and its receptor in living cells

NASA Astrophysics Data System (ADS)

Lin, Qiaoya; Wang, Liang; Zeng, Shaoqun; Zhang, Zhihong; Zheng, Gang

2009-02-01

Fluorescence resonance energy transfer (FRET) has been widely used in biology in recent years, and permits high spatial resolution assays of protein-protein interactions in living cells. Here, we first use the FRET technique to real-time observe the binding of EGF to EGFR on the surface of A549 cells and EGFR-GFP-ldlA7 cells, and continuously monitor this reaction for 1 hour. In addition, this is the first direct evidence that FRET occurred between different proteins which are in the intramembrane and extramembrane, respectively.

Sensitivity-Enhancement of FRET Immunoassays by Multiple-Antibody Conjugation on Quantum Dots.

PubMed

Annio, Giacomo; Jennings, Travis; Tagit, Oya; Hildebrandt, Niko

2018-05-23

Quantum dots (QDs) are not only advantageous for color-tuning, improved brightness, and high stability, but their nanoparticle surfaces also allow for the attachment of many biomolecules. Because IgG antibodies (ABs) are in the same size range of biocompatible QDs and the AB orientation after conjugation to the QD is often random, it is difficult to predict if few or many ABs per QD will lead to an efficient AB-QD conjugate. This is particularly true for homogeneous Förster resonance energy transfer (FRET) sandwich immunoassays, for which the ABs on the QD must bind a biomarker that needs to bind a second AB-FRET-conjugate. Here, we investigate the performance of Tb-to-QD FRET immunoassays against total prostate specific antigen (TPSA) by changing the number of ABs per QD while leaving all the other assay components unchanged. We first characterize the AB-QD conjugation by various spectroscopic, microscopic, and chromatographic techniques and then quantify the TPSA immunoassay performance regarding sensitivity, limit of detection, and dynamic range. Our results show that an increasing conjugation ratio leads to significantly enhanced FRET immunoassays. These findings will be highly important for developing QD-based immunoassays in which the concentrations of both ABs and QDs can significantly influence the assay performance.

Sol-Gel-Based Titania-Silica Thin Film Overlay for Long Period Fiber Grating-Based Biosensors.

PubMed

Chiavaioli, Francesco; Biswas, Palas; Trono, Cosimo; Jana, Sunirmal; Bandyopadhyay, Somnath; Basumallick, Nandini; Giannetti, Ambra; Tombelli, Sara; Bera, Susanta; Mallick, Aparajita; Baldini, Francesco

2015-12-15

An evanescent wave optical fiber biosensor based on titania-silica-coated long period grating (LPG) is presented. The chemical overlay, which increases the refractive index (RI) sensitivity of the sensor, consists of a sol-gel-based titania-silica thin film, deposited along the sensing portion of the fiber by means of the dip-coating technique. Changing both the sol viscosity and the withdrawal speed during the dip-coating made it possible to adjust the thickness of the film overlay, which is a crucial parameter for the sensor performance. After the functionalization of the fiber surface using a methacrylic acid/methacrylate copolymer, an antibody/antigen (IgG/anti-IgG) assay was carried out to assess the performance of sol-gel based titania-silica-coated LPGs as biosensors. The analyte concentration was determined from the wavelength shift at the end of the binding process and from the initial binding rate. This is the first time that a sol-gel based titania-silica-coated LPG is proposed as an effective and feasible label-free biosensor. The specificity of the sensor was validated by performing the same model assay after spiking anti-IgG into human serum. With this structured LPG, detection limits of the order of tens of micrograms per liter (10(-11) M) are attained.

Single-molecule analysis of steroid receptor and cofactor action in living cells

PubMed Central

Paakinaho, Ville; Presman, Diego M.; Ball, David A.; Johnson, Thomas A.; Schiltz, R. Louis; Levitt, Peter; Mazza, Davide; Morisaki, Tatsuya; Karpova, Tatiana S.; Hager, Gordon L.

2017-01-01

Population-based assays have been employed extensively to investigate the interactions of transcription factors (TFs) with chromatin and are often interpreted in terms of static and sequential binding. However, fluorescence microscopy techniques reveal a more dynamic binding behaviour of TFs in live cells. Here we analyse the strengths and limitations of in vivo single-molecule tracking and performed a comprehensive analysis on the intranuclear dwell times of four steroid receptors and a number of known cofactors. While the absolute residence times estimates can depend on imaging acquisition parameters due to sampling bias, our results indicate that only a small proportion of factors are specifically bound to chromatin at any given time. Interestingly, the glucocorticoid receptor and its cofactors affect each other’s dwell times in an asymmetric manner. Overall, our data indicate transient rather than stable TF-cofactors chromatin interactions at response elements at the single-molecule level. PMID:28635963

Synthesis, characterization, antibacterial activity, SOD mimic and interaction with DNA of drug based copper(II) complexes

NASA Astrophysics Data System (ADS)

Patel, Mohan N.; Dosi, Promise A.; Bhatt, Bhupesh S.; Thakkar, Vasudev R.

2011-02-01

Novel metal complexes of the second-generation quinolone antibacterial agent enrofloxacin with copper(II) and neutral bidentate ligands have been prepared and characterized with elemental analysis reflectance, IR and mass spectroscopy. Complexes have been screened for their in-vitro antibacterial activity against two Gram (+ve)Staphylococcus aureus, Bacillus subtilis, and three Gram (-ve)Serratia marcescens, Escherichia coli and Pseudomonas aeruginosa organisms using the double dilution technique. The binding of this complex with CT-DNA has been investigated by absorption titration, salt effect and viscosity measurements. Binding constant is ranging from 1.3 × 10 4-3.7 × 10 4. The cleavage ability of complexes has been assessed by gel electrophoresis using pUC19 DNA. The catalytic activity of the copper(II) complexes towards the superoxide anion (O 2rad -) dismutation was assayed by their ability to inhibit the reduction of nitroblue tetrazolium (NBT).

Covalent Immobilization of Microtubules on Glass Surfaces for Molecular Motor Force Measurements and Other Single-Molecule Assays

PubMed Central

Nicholas, Matthew P.; Rao, Lu; Gennerich, Arne

2014-01-01

Rigid attachment of microtubules (MTs) to glass cover slip surfaces is a prerequisite for a variety of microscopy experiments in which MTs are used as substrates for MT-associated proteins, such as the molecular motors kinesin and cytoplasmic dynein. We present an MT-surface coupling protocol in which aminosilanized glass is formylated using the cross-linker glutaraldehyde, fluorescence-labeled MTs are covalently attached, and the surface is passivated with highly pure beta-casein. The technique presented here yields rigid MT immobilization while simultaneously blocking the remaining glass surface against nonspecific binding by polystyrene optical trapping microspheres. This surface chemistry is straightforward and relatively cheap and uses a minimum of specialized equipment or hazardous reagents. These methods provide a foundation for a variety of optical tweezers experiments with MT-associated molecular motors and may also be useful in other assays requiring surface-immobilized proteins. PMID:24633798

Lignans from the roots of Urtica dioica and their metabolites bind to human sex hormone binding globulin (SHBG).

PubMed

Schöttner, M; Gansser, D; Spiteller, G

1997-12-01

Polar extracts of the stinging nettle (Urtica dioica L.) roots contain the ligans (+)-neoolivil, (-)-secoisolariciresinol, dehydrodiconiferyl alcohol, isolariciresinol, pinoresinol, and 3,4-divanillyltetrahydrofuran. These compounds were either isolated from Urtica roots, or obtained semisynthetically. Their affinity to human sex hormone binding globulin (SHBG) was tested in an in vitro assay. In addition, the main intestinal transformation products of plant lignans in humans, enterodiol and enterolactone, together with enterofuran were checked for their activity. All lignans except (-)-pinoresinol developed a binding affinity to SHBG in the in vitro assay. The affinity of (-)-3,4-divanillyltetrahydrofuran was outstandingly high. These findings are discussed with respect to potential beneficial effects of plant lignans on benign prostatic hyperplasia (BPH).

Tissue Specific and Hormonal Regulation of Gene Expression

DTIC Science & Technology

1997-08-01

interference assays were performed. These assays identify DNA bases that, when modified, interfere with the binding of the nuclear factor to the hCRH promoter...thymidine residues. The DNA bases that when modified affected the binding of the protein are noted with arrows, and their location in the hCRH...indicated. B. Methylation interference. The fragments were partially methylated using dimethyl sulfate. The DNA bases that when modified affected the

Binding of selected extracellular matrix proteins to enterococci and Streptococcus bovis of animal origin.

PubMed

Styriak, I; Lauková, A; Fallgren, C; Wadström, T

1999-12-01

Thirty-three enterococcal strains and 10 Streptococcus bovis strains were investigated for their protein-binding cell surface components. Seven extracellular matrix (ECM) proteins were immobilized on Difco latex beads to detect these components on the surface of all enterococcal strains and eight non-autoaggregating S. bovis strains by a particle agglutination assay (PAA). Twenty-three selected strains were also examined in microtiter plate assays. According to the absorbance readings (A(570nm)), 11 strains were classified as nonadherent (A(570nm) < 0.1), 10 strains as weakly adherent (0.1 < A(570nm) > 0.3), and 2 strains as strongly adherent (A(570nm) > 0.3) in these assays. A direct correlation was found between the values obtained in PAA and A(570nm) readings of microtiter plate assays. Binding of (125)I-labeled bovine lactoferrin to enterococci and streptococci was in the range of 6%-30% and of (125)I-labeled human vitronectin in the range of 9%-33% to streptococci. The binding of(125)I-labeled ECM proteins to selected strains was much more effectively inhibited by sulfated carbohydrates than by non-sulfated hyaluronic acid, indicating the importance of the sulfate groups of these inhibitors. An inhibition effect of heparin on bLf binding to four selected strains was higher in comparison with fucoidan in the microtiter plates. Thirty-five out of 44 strains had agglutinated rabbit erythrocytes. However, these strains showed no ability to agglutinate bovine or sheep erythrocytes.

Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

1988-09-01

To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

Evaluation of Impermeant, DNA-Binding Dye Fluorescence as a Real-Time Readout of Eukaryotic Cell Toxicity in a High Throughput Screening Format

PubMed Central

Chiaraviglio, Lucius

2014-01-01

Abstract Interpretation of high throughput screening (HTS) data in cell-based assays may be confounded by cytotoxic properties of screening compounds. Therefore, assessing cell toxicity in real time during the HTS process itself would be highly advantageous. Here, we investigate the potential of putatively impermeant, fluorescent, DNA-binding dyes to give cell toxicity readout during HTS. Amongst 19 DNA-binding dyes examined, three classes were identified that were (1) permeant, (2) cytotoxic, or (3) neither permeant nor cytotoxic during 3-day incubation with a macrophage cell line. In the last class, four dyes (SYTOX Green, CellTox Green, GelGreen, and EvaGreen) gave highly robust cytotoxicity data in 384-well screening plates. As proof of principle, successful combination with a luminescence-based assay in HTS format was demonstrated. Here, both intracellular growth of Legionella pneumophila (luminescence) and host cell viability (SYTOX Green exclusion) were assayed in the same screening well. Incorporation of membrane-impermeant, DNA-binding, fluorescent dyes in HTS assays should prove useful by allowing evaluation of cytotoxicity in real time, eliminating reagent addition steps and effort associated with endpoint cell viability analysis, and reducing the need for follow-up cytotoxicity screening. PMID:24831788

Competitive Binding to Cuprous Ions of Protein and BCA in the Bicinchoninic Acid Protein Assay

PubMed Central

Huang, Tao; Long, Mian; Huo, Bo

2010-01-01

Although Bicinchoninic acid (BCA) has been widely used to determine protein concentration, the mechanism of interaction between protein, copper ion and BCA in this assay is still not well known. Using the Micro BCA protein assay kit (Pierce Company), we measured the absorbance at 562 nm of BSA solutions with different concentrations of protein, and also varied the BCA concentration. When the concentration of protein was increased, the absorbance exhibited the known linear and nonlinear increase, and then reached an unexpected plateau followed by a gradual decrease. We introduced a model in which peptide chains competed with BCA for binding to cuprous ions. Formation of the well-known chromogenic complex of BCA-Cu1+-BCA was competed with the binding of two peptide bonds (NTPB) to cuprous ion, and there is the possibility of the existence of two new complexes. A simple equilibrium equation was established to describe the correlations between the substances in solution at equilibrium, and an empirical exponential function was introduced to describe the reduction reaction. Theoretical predictions of absorbance from the model were in good agreement with the measurements, which not only validated the competitive binding model, but also predicted a new complex of BCA-Cu1+-NTPB that might exist in the final solution. This work provides a new insight into understanding the chemical bases of the BCA protein assay and might extend the assay to higher protein concentration. PMID:21625379

Blood collection techniques, heparin and quinidine protein binding.

PubMed

Kessler, K M; Leech, R C; Spann, J F

1979-02-01

With the use of glass syringes without heparin and all glass equipment, the percent of unbound quinidine was measured by ultrafiltration and a double-extraction assay method after addition of 2 microgram/ml of quinidine sulfate. Compared to the all-glass method, collection of blood using Vacutainers resulted in an erroneous and variable decrease in quinidine binding related to blood to rubber-stopper contact. With glass, the unbound quinidine fraction was (mean +/- standard error) 10 +/- 1% in 10 normal volunteers, 8.5 +/- 1.5% in 10 patients with congestive heart failure, and 11 +/- 2% in 11 patients with chronic renal failure (although in 8 of the latter 11 patients the percent of unbound quinidine was 4 or more standard errors from the mean of the normal group). During cardiac catheterization, patients had markedly elevated unbound quinidine fractions: 24 +/- 2% (p less than 0.001). This abnormality coincided with the addition of heparin in vivo and was less apparent after the addition of up to 10 U/ml of heparin in vitro (120% and 29% increase in unbound quinidine fractions, respectively). Quinidine binding should be measured with all glass or equivalent equipment.

Quantitative autoradiographic analysis of muscarinic receptor subtypes and their role in representational memory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Messer, W.S.

1986-01-01

Autoradiographic techniques were used to examine the distribution of muscarinic receptors in rat brain slices. Agonist and selective antagonist binding were examined by measuring the ability for unlabeled ligands to inhibit (/sup 3/H)-1-QNB labeling of muscarinic receptors. The distribution of high affinity pirenzepine binding sites (M/sub 1/ subtype) was distinct from the distribution of high affinity carbamylcholine sites, which corresponded to the M/sub 2/ subtype. In a separate assay, the binding profile for pirenzepine was shown to differ from the profile for scopolamine, a classical muscarinic antagonist. Muscarinic antagonists, when injected into the Hippocampus, impaired performance of a representational memorymore » task. Pirenzepine, the M/sub 1/ selective antagonist, produced representational memory deficits. Scopolamine, a less selective muscarinic antagonist, caused increases in running times in some animals which prevented a definitive interpretation of the nature of the impairment. Pirenzepine displayed a higher affinity for the hippocampus and was more effective in producing a selective impairment of representational memory than scopolamine. The data indicated that cholinergic activity in the hippocampus was necessary for representation memory function.« less

Study on the interaction of triadimenol with calf thymus DNA by multispectroscopic methods and molecular modeling

NASA Astrophysics Data System (ADS)

Zhang, Yepeng; Zhang, Guowen; Fu, Peng; Ma, Yadi; Zhou, Jia

2012-10-01

The binding mechanism of triadimenol (NOL) to calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD), Fourier transform infrared (FT-IR), and nuclear magnetic resonance (1H NMR) spectroscopy, coupled with viscosity measurements and atomic force microscopy (AFM) technique. The results suggested that NOL interacted with ctDNA by intercalation mode. CD and AFM assays showed that NOL can damage the base stacking of ctDNA and result in regional cleavage of the two DNA strands. FT-IR and 1H NMR spectra coupled with molecular docking revealed that a specific binding mainly exists between NOL and G-C base pairs of the ctDNA where two hydrogen bonds form. Moreover, the association constants of NOL with DNA at three different temperatures were determined to be in the 103 L mol-1 range. The calculated thermodynamic parameters suggested that the binding of NOL to ctDNA was driven mainly by hydrogen bond and van der Waals.

Identification and structural analysis of ricin inhibitors. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robertus, J.D.

1996-12-01

Ricin is a potent cytotoxin which has been used by governments and terrorists as a poison. The three-dimensional structure of this toxic molecule was solved by X-ray crystallography, including an atomic description of its active site. The goal of this project was to use computer searches and other molecular modeling techniques to identify an inhibitor or ricin A chain (RTA). The program CHEM-X was used to predict that pteroic acid (PTA) would bind to RTA. This was shown to be the case by kinetic assays, where PTA protected ribosomes against the action of RTA, and by X-ray crystallography. The affinitymore » of PTA is weak, with a Ki estimated at 600 Micrometers. The pterin group of PTA was observed to make many polar interactions with RTA within the specificity site of the enzyme, and to bind more strongly than the natural substrate adenine. Further work will be required to increase the binding affinity of this class of inhibitors, and to improve their solubility if efficacious antidotes are to be designed from this lead.« less

Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

PubMed

Heyduk, T; Niedziela-Majka, A

Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.

New modulated design, docking and synthesis of carbohydrate-conjugate heterobimetallic CuII-SnIV complex as potential topoisomerase II inhibitor: in vitro DNA binding, cleavage and cytotoxicity against human cancer cell lines.

PubMed

Tabassum, Sartaj; Afzal, Mohd; Arjmand, Farukh

2014-03-03

New carbohydrate-conjugate heterobimetallic complexes [C₂₂H₅₀N₆O₁₃CuSnCl₂] (3) and [C₂₂H₅₈N₆O₁₇NiSnCl₂] (4) were synthesized from their monometallic analogs [C₂₂H₅₂N₆O₁₃Cu] (1) and [C₂₂H₆₀N₆O₁₇Ni] (2) containing N-glycoside ligand (L). In vitro DNA binding studies of L and complexes (1-4) with CT DNA were carried out by employing various biophysical and molecular docking techniques which revealed that heterobimetallic complex 3 strongly binds to DNA in comparison to 4, monometallic complexes (1 and 2) and the free ligand. Complex 3 cleaves pBR322 DNA via hydrolytic pathway (confirmed by T4 DNA ligase assay) and inhibited Topo-II activity in a dose-dependent manner. Furthermore, complex 3 was docked into the ATPase domain of human-Topo-II in order to probe the possible mechanism of inhibition. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

New perspectives on the computational characterization of the kinetics of binding-unbinding in drug design: implications for novel therapies.

PubMed

Moreno-Vargas, Liliana M; Prada-Gracia, Diego

The efficiency and the propensity of a drug to be bound to its target protein have been inseparable concepts for decades now. The correlation between the pharmacological activity and the binding affinity has been the first rule to design and optimize a new drug rationally. However, this argument does not prove to be infallible when the results of in vivo assays have to be confronted. Only recently, we understand that other magnitudes as the kinetic rates of binding and unbinding, or the mean residence time of the complex drug-protein, are equally relevant to draw a more accurate model of the mechanism of action of a drug. It is in this scenario where new computational techniques to simulate the all-atom dynamics of the biomolecular system find its valuable place on the challenge of designing new molecules for more effective and less toxic therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

High-Throughput Screens To Identify Autophagy Inducers That Function by Disrupting Beclin 1/Bcl-2 Binding.

PubMed

Chiang, Wei-Chung; Wei, Yongjie; Kuo, Yi-Chun; Wei, Shuguang; Zhou, Anwu; Zou, Zhongju; Yehl, Jenna; Ranaghan, Matthew J; Skepner, Adam; Bittker, Joshua A; Perez, Jose R; Posner, Bruce A; Levine, Beth

2018-06-21

Autophagy, a lysosomal degradation pathway, plays a crucial role in cellular homeostasis, development, immunity, tumor suppression, metabolism, prevention of neurodegeneration, and lifespan extension. Thus, pharmacological stimulation of autophagy may be an effective approach for preventing or treating certain human diseases and/or aging. We sought to establish a method for developing new chemical compounds that specifically induce autophagy. To do this, we developed two assays to identify compounds that target a key regulatory node of autophagy induction-specifically, the binding of Bcl-2 (a negative regulator of autophagy) to Beclin 1 (an allosteric modulator of the Beclin 1/VPS34 lipid kinase complex that functions in autophagy initiation). These assays use either a split-luciferase assay to measure Beclin 1/Bcl-2 binding in cells or an AlphaLISA assay to directly measure direct Beclin 1/Bcl-2 binding in vitro. We screened two different chemical compound libraries, comprising ∼300 K compounds, to identify small molecules that disrupt Beclin 1/Bcl-2 binding and induce autophagy. Three novel compounds were identified that directly inhibit Beclin 1/Bcl-2 interaction with an IC 50 in the micromolar range and increase autophagic flux. These compounds do not demonstrate significant cytotoxicity, and they exert selectivity for disruption of Bcl-2 binding to the BH3 domain of Beclin 1 compared with the BH3 domain of the pro-apoptotic Bcl-2 family members, Bax and Bim. Thus, we have identified candidate molecules that serve as lead templates for developing potent and selective Beclin 1/Bcl-2 inhibitors that may be clinically useful as autophagy-inducing agents.

Involvement of sulfates from cruzipain, a major antigen of Trypanosoma cruzi, in the interaction with immunomodulatory molecule Siglec-E.

PubMed

Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G

2016-02-01

In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.

Quantitative pharmacological analysis of antagonist binding kinetics at CRF1 receptors in vitro and in vivo

PubMed Central

Ramsey, Simeon J; Attkins, Neil J; Fish, Rebecca; van der Graaf, Piet H

2011-01-01

BACKGROUND AND PURPOSE A series of novel non-peptide corticotropin releasing factor type-1 receptor (CRF1) antagonists were found to display varying degrees of insurmountable and non-competitive behaviour in functional in vitro assays. We describe how we attempted to relate this behaviour to ligand receptor-binding kinetics in a quantitative manner and how this resulted in the development and implementation of an efficient pharmacological screening method based on principles described by Motulsky and Mahan. EXPERIMENTAL APPROACH A non-equilibrium binding kinetic assay was developed to determine the receptor binding kinetics of non-peptide CRF1 antagonists. Nonlinear, mixed-effects modelling was used to obtain estimates of the compounds association and dissociation rates. We present an integrated pharmacokinetic–pharmacodynamic (PKPD) approach, whereby the time course of in vivo CRF1 receptor binding of novel compounds can be predicted on the basis of in vitro assays. KEY RESULTS The non-competitive antagonist behaviour appeared to be correlated to the CRF1 receptor off-rate kinetics. The integrated PKPD model suggested that, at least in a qualitative manner, the in vitro assay can be used to triage and select compounds for further in vivo investigations. CONCLUSIONS AND IMPLICATIONS This study provides evidence for a link between ligand offset kinetics and insurmountable/non-competitive antagonism at the CRF1 receptor. The exact molecular pharmacological nature of this association remains to be determined. In addition, we have developed a quantitative framework to study and integrate in vitro and in vivo receptor binding kinetic behaviour of CRF1 receptor antagonists in an efficient manner in a drug discovery setting. PMID:21449919

A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry.

PubMed

Diago-Navarro, Elizabeth; Kamphuis, Monique B; Boelens, Rolf; Barendregt, Arjan; Heck, Albert J; van den Heuvel, Robert H; Díaz-Orejas, Ramón

2009-09-01

Kid, the toxin of the parD (kis, kid) maintenance system of plasmid R1, is an endoribonuclease that preferentially cleaves RNA at the 5' of A in the core sequence 5'-UA(A/C)-3'. A model of the Kid toxin interacting with the uncleavable mimetic 5'-AdUACA-3' is available. To evaluate this model, a significant collection of mutants in some of the key residues proposed to be involved in RNA binding (T46, A55, T69 and R85) or RNA cleavage (R73, D75 and H17) were analysed by mass spectrometry in RNA binding and cleavage assays. A pair of substrates, 5'-AUACA-3', and its uncleavable mimetic 5'-AdUACA-3', used to establish the model and structure of the Kid-RNA complex, were used in both the RNA cleavage and binding assays. A second RNA substrate, 5'-UUACU-3' efficiently cleaved by Kid both in vivo and in vitro, was also used in the cleavage assays. Compared with the wild-type protein, mutations in the residues of the catalytic site abolished RNA cleavage without substantially altering RNA binding. Mutations in residues proposed to be involved in RNA binding show reduced binding efficiency and a corresponding decrease in RNA cleavage efficiency. The cleavage profiles of the different mutants were similar with the two substrates used, but RNA cleavage required much lower protein concentrations when the 5'-UUACU-3' substrate was used. Protein synthesis and growth assays are consistent with there being a correlation between the RNase activity of Kid and its inhibitory potential. These results give important support to the available models of Kid RNase and the Kid-RNA complex.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

Covalent Binding of Antibodies to Cellulose Paper Discs and Their Applications in Naked-eye Colorimetric Immunoassays.

PubMed

Peng, Yanfen; Gelder, Victor Van; Amaladoss, Anburaj; Patel, Kadamb Haribhai

2016-10-21

This report presents two methods for the covalent immobilization of capture antibodies on cellulose filter paper grade No. 1 (medium-flow filter paper) discs and grade No. 113 (fast-flow filter paper) discs. These cellulose paper discs were grafted with amine functional groups through a silane coupling technique before the antibodies were immobilized on them. Periodate oxidation and glutaraldehyde cross-linking methods were used to graft capture antibodies on the cellulose paper discs. In order to ensure the maximum binding capacity of the capture antibodies to their targets after immobilization, the effects of various concentrations of sodium periodate, glutaraldehyde, and capture antibodies on the surface of the paper discs were investigated. The antibodies that were coated on the amine-functionalized cellulose paper discs through a glutaraldehyde cross-linking agent showed enhanced binding activity to the target when compared to the periodate oxidation method. IgG (in mouse reference serum) was used as a reference target in this study to test the application of covalently immobilized antibodies through glutaraldehyde. A new paper-based, enzyme-linked immunosorbent assay (ELISA) was successfully developed and validated for the detection of IgG. This method does not require equipment, and it can detect 100 ng/ml of IgG. The fast-flow filter paper was more sensitive than the medium-flow filter paper. The incubation period of this assay was short and required small sample volumes. This naked-eye, colorimetric immunoassay can be extended to detect other targets that are identified with conventional ELISA.

Identification of a conserved B-cell epitope on duck hepatitis A type 1 virus VP1 protein.

PubMed

Wu, Xiaoying; Li, Xiaojun; Zhang, Qingshan; Wulin, Shaozhou; Bai, Xiaofei; Zhang, Tingting; Wang, Yue; Liu, Ming; Zhang, Yun

2015-01-01

The VP1 protein of duck hepatitis A virus (DHAV) is a major structural protein that induces neutralizing antibodies in ducks; however, B-cell epitopes on the VP1 protein of duck hepatitis A genotype 1 virus (DHAV-1) have not been characterized. To characterize B-cell epitopes on VP1, we used the monoclonal antibody (mAb) 2D10 against Escherichia coli-expressed VP1 of DHAV-1. In vitro, mAb 2D10 neutralized DHAV-1 virus. By using an array of overlapping 12-mer peptides, we found that mAb 2D10 recognized phages displaying peptides with the consensus motif LPAPTS. Sequence alignment showed that the epitope 173LPAPTS178 is highly conserved among the DHAV-1 genotypes. Moreover, the six amino acid peptide LPAPTS was proven to be the minimal unit of the epitope with maximal binding activity to mAb 2D10. DHAV-1-positive duck serum reacted with the epitope in dot blotting assay, revealing the importance of the six amino acids of the epitope for antibody-epitope binding. Competitive inhibition assays of mAb 2D10 binding to synthetic LPAPTS peptides and truncated VP1 protein fragments, detected by Western blotting, also verify that LPAPTS was the VP1 epitope. We identified LPAPTS as a VP1-specific linear B-cell epitope recognized by the neutralizing mAb 2D10. Our findings have potential applications in the development of diagnostic techniques and epitope-based marker vaccines against DHAV-1.

Replacing antibodies with modified DNA aptamers in vaccine potency assays.

PubMed

Trausch, Jeremiah J; Shank-Retzlaff, Mary; Verch, Thorsten

2017-10-04

Vaccine in vitro potency assays are vital regulatory tests that are used to confirm the presence and concentration of an antigen of interest in a form that directly or indirectly relates to protective activity in patients. Current assays come in many forms, but they almost exclusively use antibody reagents for selective detection of the target antigen. Antibodies provide specific recognition of vaccine antigens but also exhibit drawbacks such as stability limitations, cost, and lot-to-lot variation, which can make it challenging to maintain the reagent throughout the lifetime of the vaccine. We explored replacing antibodies with aptamers. Aptamers are macromolecules, such as nucleic acids, which can bind to their targets with high specificity and affinity, similar to that of antibodies. Some of the advantages of using aptamers over antibodies is that aptamers can be more stable, smaller, less expensive to produce, synthesized in vitro, and logistically easier to supply throughout the multi-decade lifespan of a commercial vaccine. We created modified DNA aptamers against the common vaccine carrier protein, CRM 197 . Several aptamers were discovered and one was chosen for further characterization. The binding kinetics of the aptamer revealed an off-rate 16-fold slower than anti-CRM 197 antibodies used for comparison. The aptamers were more sensitive than available antibodies in some assay formats and comparable in others. The aptamer epitope was mapped to the receptor-binding domain of CRM 197 , a site adjacent to a known antibody binding site. These data address some key aspects for a path forward in replacing antibodies with aptamers for use as critical reagents in vaccine assays. We further highlight the possibility of using nucleic acid reagents to develop next generation potency assays. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Characterization of 12 GnRH peptide agonists - a kinetic perspective.

PubMed

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak-Reppel, Katrin; Fernández-Montalván, Amaury E; IJzerman, Adriaan P; Heitman, Laura H

2016-01-01

Drug-target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin-releasing hormone (GnRH) receptor for the treatment of hormone-dependent diseases. Surprisingly, the kinetic receptor-binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor-binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. A novel radioligand-binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [(125) I]-triptorelin. In addition to radioligand-binding studies, a homogeneous time-resolved FRET Tag-lite™ method was developed as an alternative assay for the same purpose. Two novel competition association assays were successfully developed and applied to determine the kinetic receptor-binding characteristics of 12 high-affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. © 2015 The British Pharmacological Society.

Characterization of 12 GnRH peptide agonists – a kinetic perspective

PubMed Central

Nederpelt, Indira; Georgi, Victoria; Schiele, Felix; Nowak‐Reppel, Katrin; Fernández‐Montalván, Amaury E.; IJzerman, Adriaan P.

2015-01-01

Background and Purpose Drug‐target residence time is an important, yet often overlooked, parameter in drug discovery. Multiple studies have proposed an increased residence time to be beneficial for improved drug efficacy and/or longer duration of action. Currently, there are many drugs on the market targeting the gonadotropin‐releasing hormone (GnRH) receptor for the treatment of hormone‐dependent diseases. Surprisingly, the kinetic receptor‐binding parameters of these analogues have not yet been reported. Therefore, this project focused on determining the receptor‐binding kinetics of 12 GnRH peptide agonists, including many marketed drugs. Experimental Approach A novel radioligand‐binding competition association assay was developed and optimized for the human GnRH receptor with the use of a radiolabelled peptide agonist, [125I]‐triptorelin. In addition to radioligand‐binding studies, a homogeneous time‐resolved FRET Tag‐lite™ method was developed as an alternative assay for the same purpose. Key Results Two novel competition association assays were successfully developed and applied to determine the kinetic receptor‐binding characteristics of 12 high‐affinity GnRH peptide agonists. Results obtained from both methods were highly correlated. Interestingly, the binding kinetics of the peptide agonists were more divergent than their affinities with residence times ranging from 5.6 min (goserelin) to 125 min (deslorelin). Conclusions and Implications Our research provides new insights by incorporating kinetic, next to equilibrium, binding parameters in current research and development that can potentially improve future drug discovery targeting the GnRH receptor. PMID:26398856

(+)-3-( sup 123 I)Iodo-MK-801: Synthesis and characterization of binding to the N-methyl-D-aspartate receptor complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ransom, R.W.; Wai-si Eng; Burns, H.D.

1990-01-01

Synthetic methods have been established for preparing high specific activity (+)-3-({sup 123}I)Iodo-MK-801 in high radiochemical yield. The binding of the radiotracer to rat cortical membranes has been examine to assess its potential use as an in vivo imaging agent for the N-methyl-D-aspartate (NMDA) receptor-ion channel complex. Under the conditions of the assay, specific (+)-3-({sup 123}I)Iodo-MK-801 binding to membrane homogenates represented greater than 95% of the total binding. Several structurally distinct, noncompetitive NMDA receptor antagonists inhibited binding with potencies in accordance with their reported inhibitory activity at the receptor complex. The concentration of ({plus minus})-3-Iodo-MK-801 required to inhibit 50% of (+)-3-({supmore » 123}I)Iodo-MK-801 binding (IC{sub 50}) was 3.4 nM when using a low ionic strength assay buffer and 5.5 nM in a physiological buffer. In a thoroughly washed membrane preparation, (+)-3-({sup 123}I)Iodo-MK-801 binding was enhanced by L-glutamate and glycine at concentrations known to activate the NMDA receptor. The results indicate that (+)-3-({sup 123}I)Iodo-MK-801 specifically labels the NMDA receptor complex in rat brain membranes and the retention of high affinity under near physiological assay conditions suggests that it may be useful as a SPECT imaging agent for the receptor in vivo.« less

Zinc finger transcription factor CASZ1 interacts with histones, DNA repair proteins and recruits NuRD complex to regulate gene transcription.

PubMed

Liu, Zhihui; Lam, Norris; Thiele, Carol J

2015-09-29

The zinc finger transcription factor CASZ1 has been found to control neural fate-determination in flies, regulate murine and frog cardiac development, control murine retinal cell progenitor expansion and function as a tumor suppressor gene in humans. However, the molecular mechanism by which CASZ1 regulates gene transcription to exert these diverse biological functions has not been described. Here we identify co-factors that are recruited by CASZ1b to regulate gene transcription using co-immunoprecipitation (co-IP) and mass spectrometry assays. We find that CASZ1b binds to the nucleosome remodeling and histone deacetylase (NuRD) complex, histones and DNA repair proteins. Mutagenesis of the CASZ1b protein assay demonstrates that the N-terminus of CASZ1b is required for NuRD binding, and a poly(ADP-ribose) binding motif in the CASZ1b protein is required for histone H3 and DNA repair proteins binding. The N-terminus of CASZ1b fused to an artificial DNA-binding domain (GAL4DBD) causes a significant repression of transcription (5xUAS-luciferase assay), which could be blocked by treatment with an HDAC inhibitor. Realtime PCR results show that the transcriptional activity of CASZ1b mutants that abrogate NuRD or histone H3/DNA binding is significantly decreased. This indicates a model in which CASZ1b binds to chromatin and recruits NuRD complexes to orchestrate epigenetic-mediated transcriptional programs.

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

PubMed

Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

A High Content Drug Screen Identifies Ursolic Acid as an Inhibitor of Amyloid β Protein Interactions with Its Receptor CD36*

PubMed Central

Wilkinson, Kim; Boyd, Justin D.; Glicksman, Marcie; Moore, Kathryn J.; El Khoury, Joseph

2011-01-01

A pathological hallmark of Alzheimer disease (AD) is deposition of amyloid β (Aβ) in the brain. Aβ binds to microglia via a receptor complex that includes CD36 leading to production of proinflammatory cytokines and neurotoxic reactive oxygen species and subsequent neurodegeneration. Interruption of Aβ binding to CD36 is a potential therapeutic strategy for AD. To identify pharmacologic inhibitors of Aβ binding to CD36, we developed a 384-well plate assay for binding of fluorescently labeled Aβ to Chinese hamster ovary cells stably expressing human CD36 (CHO-CD36) and screened an Food and Drug Administration-approved compound library. The assay was optimized based on the cells' tolerance to dimethyl sulfoxide, Aβ concentration, time required for Aβ binding, reproducibility, and signal-to-background ratio. Using this assay, we identified four compounds as potential inhibitors of Aβ binding to CD36. These compounds were ursolic acid, ellipticine, zoxazolamine, and homomoschatoline. Of these compounds, only ursolic acid, a naturally occurring pentacyclic triterpenoid, successfully inhibited binding of Aβ to CHO-CD36 cells in a dose-dependent manner. The ursolic acid effect reached a plateau at ∼20 μm, with a maximal inhibition of 64%. Ursolic acid also blocked binding of Aβ to microglial cells and subsequent ROS production. Our data indicate that cell-based high-content screening of small molecule libraries for their ability to block binding of Aβ to its receptors is a useful tool to identify novel inhibitors of receptors involved in AD pathogenesis. Our data also suggest that ursolic acid is a potential therapeutic agent for AD via its ability to block Aβ-CD36 interactions. PMID:21835916

A receptor binding assay for paralytic shellfish poisoning toxins: recent advances and applications.

PubMed

Powell, C L; Doucette, G J

1999-01-01

We recently described a high throughput receptor binding assay for paralytic shellfish poisoning (PSP) toxins, the use of the assay for detecting toxic activity in shellfish and algal extracts, and the validation of 11-[3H]-tetrodotoxin as an alternative radioligand to the [3H]-saxitoxin conventionally employed in the assay. Here, we report a dramatic increase in assay efficiency through application of microplate scintillation technology, resulting in an assay turn around time of 4 h. Efforts are now focused on demonstrating the range of applications for which this receptor assay can provide data comparable to the more time consuming, technically demanding HPLC analysis of PSP toxins, currently the method of choice for researchers. To date, we have compared the results of both methods for a variety of sample types, including different genera of PSP toxin producing dinoflagellates (e.g. Alexandrium lusitanicum, r2 = 0.9834, n = 12), size-fractioned field samples of Alexandrium spp. (20-64 microm; r2 = 0.9997, n = 10) as well as its associated zooplankton grazer community (200-500 microm: r2 = 0.6169, n = 10; >500 microm: r2 = 0.5063, n = 10), and contaminated human fluids (r2 = 0.9661, n = 7) from a PSP outbreak. Receptor-based STX equivalent values for all but the zooplankton samples were highly correlated and exhibited close quantitative agreement with those produced by HPLC. While the PSP receptor binding assay does not provide information on toxin composition obtainable by HPLC, it does represent a robust and reliable means of rapidly assessing PSP-like toxicity in laboratory and field samples. Moreover, this assay should be effective as a screening tool for use by public health officials in responding to suspected cases of PSP intoxication.

Biopanning and characterization of peptides with Fe3O4 nanoparticles-binding capability via phage display random peptide library technique.

PubMed

You, Fei; Yin, Guangfu; Pu, Ximing; Li, Yucan; Hu, Yang; Huang, Zhongbin; Liao, Xiaoming; Yao, Yadong; Chen, Xianchun

2016-05-01

Functionalization of inorganic nanoparticles (NPs) play an important role in biomedical applications. A proper functionalization of NPs can improve biocompatibility, avoid a loss of bioactivity, and further endow NPs with unique performances. Modification with vairous specific binding biomolecules from random biological libraries has been explored. In this work, two 7-mer peptides with sequences of HYIDFRW and TVNFKLY were selected from a phage display random peptide library by using ferromagnetic NPs as targets, and were verified to display strong binding affinity to Fe3O4 NPs. Fourier transform infrared spectrometry, fluorescence microscopy, thermal analysis and X-ray photoelectron spectroscopy confirmed the presence of peptides on the surface of Fe3O4 NPs. Sequence analyses revealed that the probable binding mechanism between the peptide and Fe3O4 NPs might be driven by Pearson hard acid-hard base specific interaction and hydrogen bonds, accompanied with hydrophilic interactions and non-specific electrostatic attractions. The cell viability assay indicated a good cytocompatibility of peptide-bound Fe3O4 NPs. Furthermore, TVNFKLY peptide and an ovarian tumor cell A2780 specific binding peptide (QQTNWSL) were conjugated to afford a liner 14-mer peptide (QQTNWSLTVNFKLY). The binding and targeting studies showed that 14-mer peptide was able to retain both the strong binding ability to Fe3O4 NPs and the specific binding ability to A2780 cells. The results suggested that the Fe3O4-binding peptides would be of great potential in the functionalization of Fe3O4 NPs for the tumor-targeted drug delivery and magnetic hyperthermia. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuzuhara, T.; Suganuma, M.; Oka, K.

2007-11-03

Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less

Radioligand Recognition of Insecticide Targets.

PubMed

Casida, John E

2018-04-04

Insecticide radioligands allow the direct recognition and analysis of the targets and mechanisms of toxic action critical to effective and safe pest control. These radioligands are either the insecticides themselves or analogs that bind at the same or coupled sites. Preferred radioligands and their targets, often in both insects and mammals, are trioxabicyclooctanes for the γ-aminobutyric acid (GABA) receptor, avermectin for the glutamate receptor, imidacloprid for the nicotinic receptor, ryanodine and chlorantraniliprole for the ryanodine receptor, and rotenone or pyridaben for NADH + ubiquinone oxidoreductase. Pyrethroids and other Na + channel modulator insecticides are generally poor radioligands due to lipophilicity and high nonspecific binding. For target site validation, the structure-activity relationships competing with the radioligand in the binding assays should be the same as that for insecticidal activity or toxicity except for rapidly detoxified or proinsecticide analogs. Once the radioligand assay is validated for relevance, it will often help define target site modifications on selection of resistant pest strains, selectivity between insects and mammals, and interaction with antidotes and other chemicals at modulator sites. Binding assays also serve for receptor isolation and photoaffinity labeling to characterize the interactions involved.

Streptomyces coelicolor SCO4226 Is a Nickel Binding Protein

PubMed Central

Jin, Hua; Zhang, Rong-Guang; Virolle, Marie-Joelle; Chen, Yuxing; Zhou, Cong-Zhao

2014-01-01

The open reading frame SCO4226 of Streptomyces coelicolor A3(2) encodes an 82-residue hypothetical protein. Biochemical assays revealed that each SCO4226 dimer binds four nickel ions. To decipher the molecular function, we solved the crystal structures of SCO4226 in both apo- and nickel-bound (Ni-SCO4226) forms at 1.30 and 2.04 Å resolution, respectively. Each subunit of SCO4226 dimer adopts a canonical ferredoxin-like fold with five β-strands flanked by two α-helices. In the structure of Ni-SCO4226, four nickel ions are coordinated at the surface of the dimer. Further biochemical assays suggested that the binding of Ni2+ triggers the self-aggregation of SCO4226 in vitro. In addition, RT-qPCR assays demonstrated that the expression of SCO4226 gene in S. coelicolor is specifically up-regulated by the addition of Ni2+, but not other divalent ions such as Cu2+, Mn2+ or Co2+. All these results suggested that SCO4226 acts as a nickel binding protein, probably required for nickel sequestration and/or detoxification. PMID:25285530

A PROP1-binding factor, AES cloned by yeast two-hybrid assay represses PROP1-induced Pit-1 gene expression.

PubMed

Sugiyama, Yuka; Ikeshita, Nobuko; Shibahara, Hiromi; Yamamoto, Daisuke; Kawagishi, Mayuko; Iguchi, Genzo; Iida, Keiji; Takahashi, Yutaka; Kaji, Hidesuke; Chihara, Kazuo; Okimura, Yasuhiko

2013-08-25

PROP1 mutation causes combined pituitary hormone deficiency (CPHD). Several mutations are located in a transactivation domain (TAD) of Prop1, and the loss of TAD binding to cofactors is likely the cause of CPHD. PROP1 cofactors have not yet been identified. In the present study, we aimed to identify the PROP1-interacting proteins from the human brain cDNA library. Using a yeast two-hybrid assay, we cloned nine candidate proteins that may bind to PROP1. Of those nine candidates, amino-terminal enhancer of split (AES) was the most abundant, and we analyzed the AES function. AES dose-dependently decreased the PROP1-induced Pit-1 reporter gene expression. An immunoprecipitation assay revealed the relationship between AES and PROP1. In a mammalian two-hybrid assay, a leucine zipper-like motif of the AES Q domain was identified as a region that interacted with TAD. These results indicated that AES was a corepressor of PROP1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2

PubMed Central

Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.

2008-01-01

Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384

Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.

PubMed

Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S

2008-09-23

Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.

Addressing matrix effects in ligand-binding assays through the use of new reagents and technology.

PubMed

Chilewski, Shannon D; Mora, Johanna R; Gleason, Carol; DeSilva, Binodh

2014-04-01

Ligand-binding assays (LBAs) used in the quantification of biotherapeutics for pharmacokinetic determinations rely on interactions between reagents (antibodies or target molecule) and the biotherapeutic. Most LBAs do not employ an analyte extraction procedure and are susceptible to matrix interference. Here, we present a case study on the development of a LBA for the quantification of a PEGylated domain antibody where matrix interference was observed. The assay used to support the single ascending dose study was a plate-based electrochemiluminescent assay with a lower limit of quantification of 80 ng/mL. To meet sensitivity requirements of future studies, new reagents and the Gyrolab™ Workstation were evaluated. Assay sensitivity improved nearly threefold in the final method utilizing new antibody reagents, a buffer containing blockers to human anti-animal antibodies, and the Gyrolab Workstation. Experimental data indicate that all factors changed played a role in overcoming matrix effects.

Paraffin section immunocytochemistry and cytosol-based ligand-binding assays for ER and PR detection in breast cancer: the time has come for more objectivity.

PubMed

Goussard, J

1998-10-23

The importance of the receptor level in breast cancer as an indicator of hormone response has been extensively studied for more than 20 years. Besides cytosol-based ligand-binding assays (dextran-coated charcoal assay, DCC), new methods using monoclonal antibodies raised against estrogen and progesterone receptors allow for the detection of receptors both in cytosol extracts (enzyme immunoassay, EIA) and in tissue sections (immunocytochemical assay, ICA). The biochemical assays (DCC and EIA) as well as the immunochemical detection (ICA) have specific qualities and produce original information which is useful for the therapeutic decision. While DCC gives a measure of the receptor level, whatever the real source of synthesis (normal and/or neoplastic tissue), ICA locates the positive cells and their relative proportion in the tumor. Both methods present their own advantages and disadvantages which are summarized in this study.

Multiplexed analysis of protein-ligand interactions by fluorescence anisotropy in a microfluidic platform.

PubMed

Cheow, Lih Feng; Viswanathan, Ramya; Chin, Chee-Sing; Jennifer, Nancy; Jones, Robert C; Guccione, Ernesto; Quake, Stephen R; Burkholder, William F

2014-10-07

Homogeneous assay platforms for measuring protein-ligand interactions are highly valued due to their potential for high-throughput screening. However, the implementation of these multiplexed assays in conventional microplate formats is considerably expensive due to the large amounts of reagents required and the need for automation. We implemented a homogeneous fluorescence anisotropy-based binding assay in an automated microfluidic chip to simultaneously interrogate >2300 pairwise interactions. We demonstrated the utility of this platform in determining the binding affinities between chromatin-regulatory proteins and different post-translationally modified histone peptides. The microfluidic chip assay produces comparable results to conventional microtiter plate assays, yet requires 2 orders of magnitude less sample and an order of magnitude fewer pipetting steps. This approach enables one to use small samples for medium-scale screening and could ease the bottleneck of large-scale protein purification.

Single-Molecule Imaging of Cellular Signaling

NASA Astrophysics Data System (ADS)

De Keijzer, Sandra; Snaar-Jagalska, B. Ewa; Spaink, Herman P.; Schmidt, Thomas

Single-molecule microscopy is an emerging technique to understand the function of a protein in the context of its natural environment. In our laboratory this technique has been used to study the dynamics of signal transduction in vivo. A multitude of signal transduction cascades are initiated by interactions between proteins in the plasma membrane. These cascades start by binding a ligand to its receptor, thereby activating downstream signaling pathways which finally result in complex cellular responses. To fully understand these processes it is important to study the initial steps of the signaling cascades. Standard biological assays mostly call for overexpression of the proteins and high concentrations of ligand. This sets severe limits to the interpretation of, for instance, the time-course of the observations, given the large temporal spread caused by the diffusion-limited binding processes. Methods and limitations of single-molecule microscopy for the study of cell signaling are discussed on the example of the chemotactic signaling of the slime-mold Dictyostelium discoideum. Single-molecule studies, as reviewed in this chapter, appear to be one of the essential methodologies for the full spatiotemporal clarification of cellular signaling, one of the ultimate goals in cell biology.

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform

PubMed Central

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-01-01

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329

Characterization of Receptor Binding Profiles of Influenza A Viruses Using An Ellipsometry-Based Label-Free Glycan Microarray Assay Platform.

PubMed

Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong

2015-07-16

A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.

Quantitation of proteins using a dye-metal-based colorimetric protein assay.

PubMed

Antharavally, Babu S; Mallia, Krishna A; Rangaraj, Priya; Haney, Paul; Bell, Peter A

2009-02-15

We describe a dye-metal (polyhydroxybenzenesulfonephthalein-type dye and a transition metal) complex-based total protein determination method. The binding of the complex to protein causes a shift in the absorption maximum of the dye-metal complex from 450 to 660 nm. The dye-metal complex has a reddish brown color that changes to green on binding to protein. The color produced from this reaction is stable and increases in a proportional manner over a broad range of protein concentrations. The new Pierce 660 nm Protein Assay is very reproducible, rapid, and more linear compared with the Coomassie dye-based Bradford assay. The assay reagent is room temperature stable, and the assay is a simple and convenient mix-and-read format. The assay has a moderate protein-to-protein variation and is compatible with most detergents, reducing agents, and other commonly used reagents. This is an added advantage for researchers needing to determine protein concentrations in samples containing both detergents and reducing agents.

Beta-endorphin. Biological activity of synthetic analogs with analgesia inhibiting property in rat vas deferens and guinea pig ileum assays.

PubMed

Ho, C L; Li, C H

1985-03-01

Three synthetic analogs of human beta-endorphin (beta h-EP) (I, [Gln8, Gly31]-beta h-EP-Gly-Gly-NH2; II, [Arg9,12,24,28,29]-beta h-EP and III, [Cys11,26, Phe27, Gly31]-beta h-EP), which have been shown to possess potent inhibiting activity to beta h-EP-induced analgesia, were assayed in rat vas deferens and guinea pig ileum bioassay systems. In the rat vas deferens assay, relative potencies of these analogs were beta h-EP, 100; I, 30; II, 40; III, 1, whereas in the guinea pig ileum assay: beta h-EP, 100; I, 184; II, 81; III, 163. From previous studies on their analgesia potency in mice and opiate receptor-binding activity in rat brain membranes, their activity in rat vas deferens correlates well with the analgesic potency and the activity from guinea pig ileum assay shows good correlations with that from the opiate receptor-binding assay.

DNA wrapping and distortion by an oligomeric homeodomain protein.

PubMed

Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

2008-10-31

Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

Alteration of Cyclic-AMP Response Element Binding Protein in the Postmortem Brain of Subjects with Bipolar Disorder and Schizophrenia

PubMed Central

Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.

2013-01-01

Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789

Cotton and Protein Interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goheen, Steven C.; Edwards, J. V.; Rayburn, Alfred R.

The adsorbent properties of important wound fluid proteins and cotton cellulose are reviewed. This review focuses on the adsorption of albumin to cotton-based wound dressings and some chemically modified derivatives targeted for chronic wounds. Adsorption of elastase in the presence of albumin was examined as a model to understand the interactive properties of these wound fluid components with cotton fibers. In the chronic non-healing wound, elastase appears to be over-expressed, and it digests tissue and growth factors, interfering with the normal healing process. Albumin is the most prevalent protein in wound fluid, and in highly to moderately exudative wounds, itmore » may bind significantly to the fibers of wound dressings. Thus, the relative binding properties of both elastase and albumin to wound dressing fibers are of interest in the design of more effective wound dressings. The present work examines the binding of albumin to two different derivatives of cotton, and quantifies the elastase binding to the same derivatives following exposure of albumin to the fiber surface. An HPLC adsorption technique was employed coupled with a colorimetric enzyme assay to quantify the relative binding properties of albumin and elastase to cotton. The results of wound protein binding are discussed in relation to the porosity and surface chemistry interactions of cotton and wound proteins. Studies are directed to understanding the implications of protein adsorption phenomena in terms of fiber-protein models that have implications for rationally designing dressings for chronic wounds.« less

Probing structurally altered and aggregated states of therapeutically relevant proteins using GroEL coupled to bio-layer interferometry.

PubMed

Naik, Subhashchandra; Kumru, Ozan S; Cullom, Melissa; Telikepalli, Srivalli N; Lindboe, Elizabeth; Roop, Taylor L; Joshi, Sangeeta B; Amin, Divya; Gao, Phillip; Middaugh, C Russell; Volkin, David B; Fisher, Mark T

2014-10-01

The ability of a GroEL-based bio-layer interferometry (BLI) assay to detect structurally altered and/or aggregated species of pharmaceutically relevant proteins is demonstrated. Assay development included optimizing biotinylated-GroEL immobilization to streptavidin biosensors, combined with biophysical and activity measurements showing native and biotinylated GroEL are both stable and active. First, acidic fibroblast growth factor (FGF-1) was incubated under conditions known to promote (40°C) and inhibit (heparin addition) molten globule formation. Heat exposed (40°C) FGF-1 exhibited binding to GroEL-biosensors, which was significantly diminished in the presence of heparin. Second, a polyclonal human IgG solution containing 6-8% non-native dimer showed an increase in higher molecular weight aggregates upon heating by size exclusion chromatography (SEC). The poly IgG solution displayed binding to GroEL-biosensors initially with progressively increased binding upon heating. Enriched preparations of the IgG dimers or monomers showed significant binding to GroEL-biosensors. Finally, a thermally treated IgG1 monoclonal antibody (mAb) solution also demonstrated increased GroEL-biosensor binding, but with different kinetics. The bound complexes could be partially to fully dissociated after ATP addition (i.e., specific GroEL binding) depending on the protein, environmental stress, and the assay's experimental conditions. Transmission electron microscopy (TEM) images of GroEL-mAb complexes, released from the biosensor, also confirmed interaction of bound complexes at the GroEL binding site with heat-stressed mAb. Results indicate that the GroEL-biosensor-BLI method can detect conformationally altered and/or early aggregation states of proteins, and may potentially be useful as a rapid, stability-indicating biosensor assay for monitoring the structural integrity and physical stability of therapeutic protein candidates. © 2014 The Protein Society.

Small molecule antagonists of the urokinase (uPA): urokinase receptor (uPAR) interaction with high reported potencies show only weak effects in cell-based competition assays employing the native uPAR ligand.

PubMed

De Souza, Melissa; Matthews, Hayden; Lee, Jodi A; Ranson, Marie; Kelso, Michael J

2011-04-15

Binding of the urokinase-type plasminogen activator (uPA) to its cell-surface-bound receptor uPAR and upregulation of the plasminogen activation system (PAS) correlates with increased metastasis and poor prognosis in several tumour types. Disruptors of the uPA:uPAR interaction represent promising anti-tumour/metastasis agents and several approaches have been explored for this purpose, including the use of small molecule antagonists. Two highly potent non-peptidic antagonists 1 and 2 (IC(50)1=0.8 nM, IC(50)2=33 nM) from the patent literature were reportedly identified using competition assays employing radiolabelled uPAR-binding uPA fragments and appeared as useful pharmacological tools for studying the PAS. Before proceeding to such studies, confirmation was sought that 1 and 2 retained their potencies in physiologically relevant cell-based competition assays employing uPAR's native binding partner high molecular weight uPA (HMW-uPA). This study describes a new solution phase synthesis of 1, a mixed solid/solution phase synthesis of 2 and reports the activities of 1 and 2 in semi-quantitative competition flow cytometry assays and quantitative cell-based uPA activity assays that employed HMW-uPA as the competing ligand. The flow cytometry experiments revealed that high concentrations of 2 (10-100 μM) are required to compete with HMW-uPA for uPAR binding and that 1 shows no antagonist effects at 100 μM. The cell-based enzyme activity assays similarly revealed that 1 and 2 are poor inhibitors of cell surface-bound HMW-uPA activity (IC(50) >100 μM for 1 and 2). The report highlights the dangers of identifying false-positive lead uPAR antagonists from competition assays employing labelled competing ligands other than the native HMW-uPA. Copyright © 2011 Elsevier Ltd. All rights reserved.

Enrichment of high affinity subclasses and glycoforms from serum-derived IgG using FcγRs as affinity ligands.

PubMed

Boesch, Austin W; Kappel, James H; Mahan, Alison E; Chu, Thach H; Crowley, Andrew R; Osei-Owusu, Nana Y; Alter, Galit; Ackerman, Margaret E

2018-05-01

As antibodies continue to gain predominance in drug discovery and development pipelines, efforts to control and optimize their activity in vivo have matured to incorporate sophisticated abilities to manipulate engagement of specific Fc binding partners. Such efforts to promote diverse functional outcomes include modulating IgG-Fc affinity for FcγRs to alternatively potentiate or reduce effector functions, such as antibody-dependent cellular cytotoxicity and phagocytosis. While a number of natural and engineered Fc features capable of eliciting variable effector functions have been demonstrated in vitro and in vivo, elucidation of these important functional relationships has taken significant effort through use of diverse genetic, cellular and enzymatic techniques. As an orthogonal approach, we demonstrate use of FcγR as chromatographic affinity ligands to enrich and therefore simultaneously identify favored binding species from a complex mixture of serum-derived pooled polycloncal human IgG, a load material that contains the natural repertoire of Fc variants and post-translational modifications. The FcγR-enriched IgG was characterized for subclass and glycoform composition and the impact of this bioseparation step on antibody activity was measured in cell-based effector function assays including Natural Killer cell activation and monocyte phagocytosis. This work demonstrates a tractable means to rapidly distinguish complex functional relationships between two or more interacting biological agents by leveraging affinity chromatography followed by secondary analysis with high-resolution biophysical and functional assays and emphasizes a platform capable of surveying diverse natural post-translational modifications that may not be easily produced with high purity or easily accessible with recombinant expression techniques. © 2018 Wiley Periodicals, Inc.

Development of on-chip fully automated immunoassay system "μTASWako i30" to measure the changes in glycosylation profiles of alpha-fetoprotein in patients with hepatocellular carcinoma.

PubMed

Kurosawa, Tatsuo; Watanabe, Mitsuo

2016-12-01

Glycosylation profiles significantly change during oncogenesis. Aberrant glycosylation can be used as a cancer biomarker in clinical settings. Different glycoforms can be separately detected using lectin affinity electrophoresis and lectin array-based methods. However, most methodologies and procedures need experienced technique to perform the assays and expertise to interpret the results. To apply glycomarkers for clinical practice, a robust assay system with an easy-to-use workflow is required. Wako's μTASWako i30, a fully automated immunoanalyzer, was developed for in vitro diagnostics based on microfluidic technology. It utilizes the principles of liquid-phase binding assay, where immunoreactions are performed in a liquid phase, and electrokinetic analyte transport assay. Capillary electrophoresis on microfluidic chip has enabled the detection of different glycoform types of alpha-fetoprotein (AFP), a serum biomarker for hepatocellular carcinoma. AFP with altered glycosylation can be separated based on the reactivity to Lens culinaris agglutinin on electrophoresis. The glycoform AFP-L3 was reportedly more specific in hepatocellular carcinoma. This assay system can provide a high sensitivity and rapid results in 9 min. The test results for ratio of AFP-L3 to total AFP using μTASWako i30 are correlated with those of conventional methodology. The μTASWako assay system and the technology can be utilized for glycosylation analysis in the postgenomic era. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Radiolabelling and assay of Chinese agkistrodon acutus venom with carrier-free Na 125I].

PubMed

Gong, Y; Deng, C; Li, S; Li, L; Guan, J

1995-03-01

Chinese agkistroden acutus venom (CAAV) was radiolabelled with carrier-free Na 125I by the method of Iodogen. The specific activity and radiochemical purity for radiolabelled products were 4236.5 x 10(10) Bq/mmol and 98%, respectively. Each CAAV molecule carried 0.52 125I atom. Physical and chemical characterization of radiolabelled CAAV was similar to unradiolabelled CAAV. Binding analysis showed that 125I-CAAV was bound to platelet in a saturable manner. Binding sites per platelet were 13,255 +/- 6292/platelet. The dissociation constant (Kd) was 3.2 +/- 0.69 x 10(-10) mol/L. These results are similar to binding sites of other snake venom on platelet. The investigation showed that radiolabelled CAAV made by our laboratory was useful for radioligand binding assay.

Sponsor relationships, analyte stability in ligand-binding assays and critical reagent management: a bioanalytical CRO perspective.

PubMed

Lefor Bradford, Julia

2015-01-01

This perspective article discusses key points to address in the establishment of sound partnerships between sponsors and bioanalytical CROs to assure the timeliness, quality and consistency of bioanalysis throughout biological therapeutic development. The performance of ligand-binding assays can be greatly impacted by low-grade reagents, lot-to-lot variability and lack of stability of the analyte in matrix, impacting both timelines and cost. Thorough characterization of the biologic of interest and its assay-enabling critical reagents will lend itself well to conservation of materials and continuity of assay performance. When unplanned events occur, such as performance declines or premature depletion of material, structured procedures are paramount to supplement the current loosely defined regulatory guidance on critical reagent characterization and method bridging.

Shikonin, a natural product from the root of Lithospermum erythrorhizon, is a cytotoxic DNA-binding agent.

PubMed

Chen, Changmin; Shanmugasundaram, Kumaran; Rigby, Alan C; Kung, Andrew L

2013-04-11

To search for compounds that disrupt binding of the EWS-FLI1 fusion protein to its cognate targets, we developed a homogeneous high-throughput proximity assay and screened 5200 small molecule compounds. Many well-known DNA-binding chemotherapeutic agents, such as actinomycin D, cisplatin, doxorubicin, daunorubicin, and epirubicin scored in the assay and not surprising also disrupted the binding of other transcription factors. Unexpectedly, we found that Shikonin, a natural product from the root of Lithospermum erythrorhizon, similarly disrupted protein-DNA interactions. Mechanistic studies demonstrated that Shikonin displaces SYBR green from binding to the minor groove of DNA and is able to inhibit topoisomerase mediated DNA relaxation. In cells, Shikonin blocked the binding of EWS-FLI1 to the NR0B1 promoter, and attenuated gene expression. Shikonin rapidly induced G2/M arrest and apoptosis in Ewing sarcoma cells. These results demonstrate that contrary to other purported mechanisms of action, Shikonin is a DNA-binding cytotoxic agent. Copyright © 2013 Elsevier B.V. All rights reserved.

Interpretation of the Raji cell assay in sera containing anti-nuclear antibodies and immune complexes.

PubMed Central

Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N

1981-01-01

The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676

An assay that may predict the development of IgG enhancing allergen-specific IgE binding during birch immunotherapy

PubMed Central

Selb, R.; Eckl-Dorna, J.; Vrtala, S.; Valenta, R.; Niederberger, V.

2017-01-01

Background It has been shown that birch pollen immunotherapy can induce IgG antibodies which enhance IgE binding to Bet v 1. We aimed to develop a serological assay to predict the development of antibodies which enhance IgE binding to Bet v 1 during immunotherapy. Methods In 18 patients treated by Bet v 1-fragment-specific immunotherapy, the effects of IgG antibodies specific for the fragments on the binding of IgE antibodies to Bet v 1 were measured by ELISA. Blocking and possible enhancing effects on IgE binding were compared with skin sensitivity to Bet v 1 after treatment. Results We found that fragment-specific IgG enhanced IgE binding to Bet v 1 in two patients who also showed an increase of skin sensitivity to Bet v 1. Conclusion Our results indicate that it may be possible to develop serological tests which predict the induction of unfavourable IgG antibodies enhancing the binding of IgE to Bet v 1 during immunotherapy. PMID:23998344

Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

2013-01-01

Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

Binding of anti-basement membrane antibody to alveolar basement membrane after intratracheal gasoline instillation in rabbits.

PubMed Central

Yamamoto, T.; Wilson, C. B.

1987-01-01

A possible causal relationship has been suggested between hydrocarbon (gasoline, solvents, etc.) exposure and development of anti-basement membrane antibody-associated Goodpasture's syndrome in man. The authors evaluated the effect of hydrocarbons on pulmonary capillary permeability and binding of heterologous anti-basement membrane antibodies in the lungs after intratracheal instillation of minute amounts of unleaded gasoline into rabbits. The anti-glomerular basement membrane (GBM) antibodies used reacted with the alveolar basement membrane (ABM) in vitro by indirect immunofluorescence. The gasoline treatment altered pulmonary capillary permeability, judging from the increased accumulation of systemically administered radioiodinated bovine serum albumin in the alveolar and extravascular spaces of lungs; it also induced focal macroscopic and microscopic pulmonary histologic lesions. The gasoline caused focal in vivo binding of the anti-GBM antibodies to the ABM detectable by immunofluorescence microscopy. No binding was observed in lungs from control rabbits given saline instillations when assayed by immunofluorescence. The paired label radioisotope technique confirmed the increased antibody binding to lungs injured with gasoline (1.08 +/- 0.03 micrograms) versus 0.37 +/- 0.07 microgram after saline (P less than 0.001). These results indicate that gasoline exposure damages a pulmonary barrier that normally prevents binding of anti-GBM/ABM antibody to ABM and suggest that hydrocarbon exposure may be one of perhaps several pneumotoxic events that contribute to the episodic pulmonary hemorrhage in Goodpasture's syndrome by temporarily allowing ABM binding of anti-basement membrane antibodies. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:3548409

Hormone Binding to Recombinant Estrogen Receptors from Human, Alligator, Quail, Salamander, and Fathead Minnow

EPA Science Inventory

In this work, a 96-well plate estrogen receptor binding assay was developed to facilitate the direct comparison of chemical binding to full-length recombinant estrogen receptors across vertebrate classes. Receptors were generated in a baculovirus expression system. This approach ...

Anti-DNA antibodies--quintessential biomarkers of SLE.

PubMed

Pisetsky, David S

2016-02-01

Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Nanoprobe-Enhanced, Split Aptamer-Based Electrochemical Sandwich Assay for Ultrasensitive Detection of Small Molecules.

PubMed

Zhao, Tao; Liu, Ran; Ding, Xiaofan; Zhao, Juncai; Yu, Haixiang; Wang, Lei; Xu, Qing; Wang, Xuan; Lou, Xinhui; He, Miao; Xiao, Yi

2015-08-04

It is quite challenging to improve the binding affinity of antismall molecule aptamers. We report that the binding affinity of anticocaine split aptamer pairs improved by up to 66-fold by gold nanoparticles (AuNP)-attached aptamers due to the substantially increased local concentration of aptamers and multiple and simultaneous ligand interactions. The significantly improved binding affinity enables the detection of small molecule targets with unprecedented sensitivity, as demonstrated in nanoprobe-enhanced split aptamer-based electrochemical sandwich assays (NE-SAESA). NE-SAESA replaces the traditional molecular reporter probe with AuNPs conjugated to multiple reporter probes. The increased binding affinity allowed us to use 1,000-fold lower reporter probe concentrations relative to those employed in SAESA. We show that the near-elimination of background in NE-SAESA effectively improves assay sensitivity by ∼1,000-100,000-fold for ATP and cocaine detection, relative to equivalent SAESA. With the ongoing development of new strategies for the selection of aptamers, we anticipate that our sensor platform should offer a generalizable approach for the high-sensitivity detection of diverse targets. More importantly, we believe that NE-SAESA represents a novel strategy to improve the binding affinity between a small molecule and its aptamer and potentially can be extended to other detection platforms.

Inhibition of HMGA2 binding to DNA by netropsin

PubMed Central

Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

2008-01-01

The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

PubMed

Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

2013-05-01

The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

Identification of berberine as a direct thrombin inhibitor from traditional Chinese medicine through structural, functional and binding studies

NASA Astrophysics Data System (ADS)

Wang, Xing; Zhang, Yuxin; Yang, Ying; Wu, Xia; Fan, Hantian; Qiao, Yanjiang

2017-03-01

Thrombin acts as a key enzyme in the blood coagulation cascade and represents a potential drug target for the treatment of several cardiovascular diseases. The aim of this study was to identify small-molecule direct thrombin inhibitors from herbs used in traditional Chinese medicine (TCM). A pharmacophore model and molecular docking were utilized to virtually screen a library of chemicals contained in compositions of traditional Chinese herbs, and these analyses were followed by in vitro bioassay validation and binding studies. Berberine (BBR) was first confirmed as a thrombin inhibitor using an enzymatic assay. The BBR IC50 value for thrombin inhibition was 2.92 μM. Direct binding studies using surface plasmon resonance demonstrated that BBR directly interacted with thrombin with a KD value of 16.39 μM. Competitive binding assay indicated that BBR could bind to the same argartroban/thrombin interaction site. A platelet aggregation assay demonstrated that BBR had the ability to inhibit thrombin-induced platelet aggregation in washed platelets samples. This study proved that BBR is a direct thrombin inhibitor that has activity in inhibiting thrombin-induced platelet aggregation. BBR may be a potential candidate for the development of safe and effective thrombin-inhibiting drugs.

High-throughput screening and mechanism-based evaluation of estrogenic botanical extracts

PubMed Central

Overk, Cassia R.; Yao, Ping; Chen, Shaonong; Deng, Shixing; Imai, Ayano; Main, Matthew; Schinkovitz, Andreas; Farnsworth, Norman R.; Pauli, Guido F.; Bolton, Judy L.

2009-01-01

Symptoms associated with menopause can greatly affect the quality of life for women. Botanical dietary supplements have been viewed by the public as safe and effective despite a lack of evidence indicating a urgent necessity to standardize these supplements chemically and biologically. Seventeen plants were evaluated for estrogenic biological activity using standard assays: competitive estrogen receptor (ER) binding assay for both alpha and beta subtypes, transient transfection of the estrogen response element luciferase plasmid into MCF-7 cells expressing either ER alpha or ER beta, and the Ishikawa alkaline phosphatase induction assay for both estrogenic and antiestrogenic activities. Based on the combination of data pooled from these assays, the following was determined: a) a high rate of false positive activity for the competitive binding assays, b) some extracts had estrogenic activity despite a lack of ability to bind the ER, c) one extract exhibited selective estrogen receptor modulator (SERM) activity, and d) several extracts show additive/synergistic activity. Taken together, these data indicate a need to reprioritize the order in which the bioassays are performed for maximal efficiency of programs involving bioassay-guided fractionation. In addition, possible explanations for the conflicts in the literature over the estrogenicity of Cimicifuga racemosa (black cohosh) are suggested. PMID:18473738

Establishment and characterization of a new and stable collagen-binding assay for the assessment of von Willebrand factor activity

PubMed Central

Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J

2013-01-01

Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512

The Activation of the Rat Insulin Gene II by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6

PubMed Central

Wolf, Gabriele; Hessabi, Behnam; Karkour, Anke; Henrion, Ulrike; Dahlhaus, Meike; Ostmann, Annett; Giese, Bernd; Fraunholz, Martin; Grabarczyk, Piotr; Jack, Robert; Walther, Reinhard

2010-01-01

The transcriptional transactivator Pax6 binds the pancreatic islet cell-specific enhancer sequence (PISCES) of the rat insulin I gene. However the human, mouse, and rat insulin gene II promoters do not contain a PISCES element. To analyze the role of Pax6 in those PISCES-less promoters, we investigated its influence on rat insulin gene II expression and included in our studies the main activators: pancreatic and duodenal homeobox protein-1 (PDX-1) and BETA2/E47. Luciferase assays, Northern blots, and RIA were used to study effects of Pax6 overexpression, gel shift and chromatin precipitation assays to study its binding to the DNA, and yeast two-hybrid assays and glutathione S transferase capture assays to investigate its interactions with PDX-1 and BETA2. Finally, glucose-dependent intracellular transport of Pax6 was demonstrated by fluorescence microscopy. Overexpression of Pax6 prevents activation of the rat insulin II gene by BETA2 and PDX-1 and hence suppresses insulin synthesis and secretion. In vitro, Pax6 binds to the A-boxes, thereby blocking binding of PDX-1, and at the same time, its paired domain interacts with BETA2. Fluorescence microscopy demonstrated that the nuclear-cytoplasmic localization of Pax6 and PDX-1 are oppositely regulated by glucose. From the results, it is suggested that at low concentrations of glucose, Pax6 is localized in the nucleus and prevents the activation of the insulin gene by occupying the PDX-1 binding site and by interacting with BETA2. PMID:20943817

Characterization of domain-specific interaction of synthesized dye with serum proteins by spectroscopic and docking approaches along with determination of in vitro cytotoxicity and antiviral activity.

PubMed

Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Patel, Biman Kumar; Paul, Suvendu; Mahapatra, Ambikesh

2017-11-20

The interaction between a synthesized dye with proteins, bovine, and human serum albumin (BSA, HSA, respectively) under physiological conditions has been characterized in detail, by means of steady-state and time-resolved fluorescence, UV-vis absorption, and circular dichroism (CD) techniques. An extensive time-resolved fluorescence spectroscopic characterization of the quenching process has been undertaken in conjugation with temperature-dependent fluorescence quenching studies to divulge the actual quenching mechanism. From the thermodynamic observations, it is clear that the binding process is a spontaneous molecular interaction, in which van der Waals and hydrogen bonding interactions play the major roles. The UV-vis absorption and CD results confirm that the dye can induce conformational and micro-environmental changes of both the proteins. In addition, the dye binding provokes the functionality of the native proteins in terms of esterase-like activity. The average binding distance (r) between proteins and dye has been calculated using FRET. Cytotoxicity and antiviral effects of the dye have been found using Vero cell and HSV-1F virus by performing MTT assay. The AutoDock-based docking simulation reveals the probable binding location of dye within the sub-domain IIA of HSA and IB of BSA.

Novel Chemical Ligands to Ebola Virus and Marburg Virus Nucleoproteins Identified by Combining Affinity Mass Spectrometry and Metabolomics Approaches

PubMed Central

Fu, Xu; Wang, Zhihua; Li, Lixin; Dong, Shishang; Li, Zhucui; Jiang, Zhenzuo; Wang, Yuefei; Shui, Wenqing

2016-01-01

The nucleoprotein (NP) of Ebola virus (EBOV) and Marburg virus (MARV) is an essential component of the viral ribonucleoprotein complex and significantly impacts replication and transcription of the viral RNA genome. Although NP is regarded as a promising antiviral druggable target, no chemical ligands have been reported to interact with EBOV NP or MARV NP. We identified two compounds from a traditional Chinese medicine Gancao (licorice root) that can bind both NPs by combining affinity mass spectrometry and metabolomics approaches. These two ligands, 18β-glycyrrhetinic acid and licochalcone A, were verified by defined compound mixture screens and further characterized with individual ligand binding assays. Accompanying biophysical analyses demonstrate that binding of 18β-glycyrrhetinic acid to EBOV NP significantly reduces protein thermal stability, induces formation of large NP oligomers, and disrupts the critical association of viral ssRNA with NP complexes whereas the compound showed no such activity on MARV NP. Our study has revealed the substantial potential of new analytical techniques in ligand discovery from natural herb resources. In addition, identification of a chemical ligand that influences the oligomeric state and RNA-binding function of EBOV NP sheds new light on antiviral drug development. PMID:27403722

The Staphylococcus aureus extracellular matrix protein (Emp) has a fibrous structure and binds to different extracellular matrices.

PubMed

Geraci, Jennifer; Neubauer, Svetlana; Pöllath, Christine; Hansen, Uwe; Rizzo, Fabio; Krafft, Christoph; Westermann, Martin; Hussain, Muzaffar; Peters, Georg; Pletz, Mathias W; Löffler, Bettina; Makarewicz, Oliwia; Tuchscherr, Lorena

2017-10-20

The extracellular matrix protein Emp of Staphylococcus aureus is a secreted adhesin that mediates interactions between the bacterial surface and extracellular host structures. However, its structure and role in staphylococcal pathogenesis remain unknown. Using multidisciplinary approaches, including circular dichroism (CD) and Fourier transform infrared (FTIR) spectroscopy, transmission electron (TEM) and immunogold transmission electron microscopy, functional ELISA assays and in silico techniques, we characterized the Emp protein. We demonstrated that Emp and its truncated forms bind to suprastructures in human skin, cartilage or bone, among which binding activity seems to be higher for skin compounds. The binding domain is located in the C-terminal part of the protein. CD spectroscopy revealed high contents of β-sheets (39.58%) and natively disordered structures (41.2%), and TEM suggested a fibrous structure consisting of Emp polymers. The N-terminus seems to be essential for polymerization. Due to the uncommonly high histidine content, we suggest that Emp represents a novel type of histidine-rich protein sharing structural similarities to leucine-rich repeats proteins as predicted by the I-TASSER algorithm. These new findings suggest a role of Emp in infections of deeper tissue and open new possibilities for the development of novel therapeutic strategies.

Nanoparticle based bio-bar code technology for trace analysis of aflatoxin B1 in Chinese herbs.

PubMed

Yu, Yu-Yan; Chen, Yuan-Yuan; Gao, Xuan; Liu, Yuan-Yuan; Zhang, Hong-Yan; Wang, Tong-Ying

2018-04-01

A novel and sensitive assay for aflatoxin B1 (AFB1) detection has been developed by using bio-bar code assay (BCA). The method that relies on polyclonal antibodies encoded with DNA modified gold nanoparticle (NP) and monoclonal antibodies modified magnetic microparticle (MMP), and subsequent detection of amplified target in the form of bio-bar code using a fluorescent quantitative polymerase chain reaction (FQ-PCR) detection method. First, NP probes encoded with DNA that was unique to AFB1, MMP probes with monoclonal antibodies that bind AFB1 specifically were prepared. Then, the MMP-AFB1-NP sandwich compounds were acquired, dehybridization of the oligonucleotides on the nanoparticle surface allows the determination of the presence of AFB1 by identifying the oligonucleotide sequence released from the NP through FQ-PCR detection. The bio-bar code techniques system for detecting AFB1 was established, and the sensitivity limit was about 10 -8  ng/mL, comparable ELISA assays for detecting the same target, it showed that we can detect AFB1 at low attomolar levels with the bio-bar-code amplification approach. This is also the first demonstration of a bio-bar code type assay for the detection of AFB1 in Chinese herbs. Copyright © 2017. Published by Elsevier B.V.

Split-luciferase complementary assay: applications, recent developments, and future perspectives.

PubMed

Azad, Taha; Tashakor, Amin; Hosseinkhani, Saman

2014-09-01

Bioluminescent systems are considered as potent reporter systems for bioanalysis since they have specific characteristics, such as relatively high quantum yields and photon emission over a wide range of colors from green to red. Biochemical events are mostly accomplished through large protein machines. These molecular complexes are built from a few to many proteins organized through their interactions. These protein-protein interactions are vital to facilitate the biological activity of cells. The split-luciferase complementation assay makes the study of two or more interacting proteins possible. In this technique, each of the two domains of luciferase is attached to each partner of two interacting proteins. On interaction of those proteins, luciferase fragments are placed close to each other and form a complemented luciferase, which produces a luminescent signal. Split luciferase is an effective tool for assaying biochemical metabolites, where a domain or an intact protein is inserted into an internally fragmented luciferase, resulting in ligand binding, which causes a change in the emitted signals. We review the various applications of this novel luminescent biosensor in studying protein-protein interactions and assaying metabolites involved in analytical biochemistry, cell communication and cell signaling, molecular biology, and the fate of the whole cell, and show that luciferase-based biosensors are powerful tools that can be applied for diagnostic and therapeutic purposes.

High-throughput screening of hybridoma supernatants using multiplexed fluorescent cell barcoding on live cells.

PubMed

Lu, Mei; Chan, Brian M; Schow, Peter W; Chang, Wesley S; King, Chadwick T

2017-12-01

With current available assay formats using either immobilized protein (ELISA, enzyme-linked immunosorbent assay) or immunostaining of fixed cells for primary monoclonal antibody (mAb) screening, researchers often fail to identify and characterize antibodies that recognize the native conformation of cell-surface antigens. Therefore, screening using live cells has become an integral and important step contributing to the successful identification of therapeutic antibody candidates. Thus the need for developing high-throughput screening (HTS) technologies using live cells has become a major priority for therapeutic mAb discovery and development. We have developed a novel technique called Multiplexed Fluorescent Cell Barcoding (MFCB), a flow cytometry-based method based upon the Fluorescent Cell Barcoding (FCB) technique and the Luminex fluorescent bead array system, but is applicable to high-through mAb screens on live cells. Using this technique in our system, we can simultaneously identify or characterize the antibody-antigen binding of up to nine unique fluorescent labeled cell populations in the time that it would normally take to process a single population. This has significantly reduced the amount of time needed for the identification of potential lead candidates. This new technology enables investigators to conduct large-scale primary hybridoma screens using flow cytometry. This in turn has allowed us to screen antibodies more efficiently than before and streamline identification and characterization of lead molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

Domain based assays of individual antibody concentrations in an oligoclonal combination targeting a single protein

PubMed Central

Meng, Q.; Li, M.; Silberg, M.A.; Conrad, F.; Bettencourt, J.; To, R.; Huang, C.; Ma, J.; Meyer, K.; Shimizu, R.; Cao, L.; Tomic, M.T.; Marks, J.D.

2014-01-01

Quantitation of individual mAbs within a combined antibody drug product is required for preclinical and clinical drug development including pharmacokinetics (PK), toxicology, stability and biochemical characterization studies of such drugs. We have developed an antitoxin (XOMA 3AB) consisting of three recombinant monoclonal antibodies (mAbs) that potently neutralizes the known subtypes of type A botulinum neurotoxin (BoNT/A). The three mAbs bind non-overlapping BoNT/A epitopes with high affinity. XOMA3AB is being developed as a treatment for botulism resulting from BoNT/A. To develop antibody-specific assays, we cloned, expressed, and purified BoNT/A domains from E. coli. Each mAb bound only to its specific domain with affinity comparable to the binding to holotoxin. MAb specific domains were used to develop an ELISA for characterization of the integrity and binding activity of the three mAbs in the drug product. An electrochemiluminescence bridging assay was also developed that is robust to interference from components in serum and we demonstrate that it can be used for PK assays. This type of antigen engineering to generate mAb-specific domains is a general method allowing quantitation and characterization of individual mAbs in a mAb cocktail that bind the same protein and is superior to anti-idiotype approaches. PMID:22037290

Optimization of Time-Resolved Fluorescence Assay for Detection of Eu-DOTA-labeled Ligand-Receptor Interactions

PubMed Central

De Silva, Channa R.; Vagner, Josef; Lynch, Ronald; Gillies, Robert J.; Hruby, Victor J.

2010-01-01

Lanthanide-based luminescent ligand binding assays are superior to traditional radiolabel assays due to improved sensitivity and affordability in high throughput screening while eliminating the use of radioactivity. Despite significant progress using lanthanide(III)-coordinated chelators such as DTPA derivatives, dissociation-enhanced lanthanide fluoroimmunoassays (DELFIA) have not yet been successfully used with more stable chelators, e.g. DOTA derivatives, due to the incomplete release of lanthanide(III) ions from the complex. Here, a modified and an optimized DELFIA procedure incorporating an acid treatment protocol is introduced for use with Eu(III)-DOTA labeled peptides. Complete release of Eu(III) ions from DOTA labeled ligands was observed using hydrochloric acid (2.0 M) prior to the luminescent enhancement step. NDP-α-MSH labeled with Eu(III)-DOTA was synthesized and the binding affinity to cells overexpressing the human melanocortin-4 receptors (hMC4R) was evaluated using the modified protocol. Binding data indicate that the Eu(III)-DOTA linked peptide bound to these cells with an affinity similar to its DTPA analogue. The modified DELFIA procedure was further used to monitor the binding of an Eu(III)-DOTA labeled heterobivalent peptide to the cells expressing both hMC4R and CCK-2 (Cholecystokinin) receptors. The modified assay provides superior results and is appropriate for high-throughput screening of ligand libraries. PMID:19852924

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Measuring Positive Cooperativity Using the Direct ESI-MS Assay. Cholera Toxin B Subunit Homopentamer Binding to GM1 Pentasaccharide

NASA Astrophysics Data System (ADS)

Lin, Hong; Kitova, Elena N.; Klassen, John S.

2014-01-01

Direct electrospray ionization mass spectrometry (ESI-MS) assay was used to investigate the stepwise binding of the GM1 pentasaccharide β- D-Gal p-(1→3)-β-D-Gal pNAc-(1→4)[α-D-Neu5Ac-(2→3)]-β- D-Gal p-(1→4)-β-D-Glc p (GM1os) to the cholera toxin B subunit homopentamer (CTB5) and to establish conclusively whether GM1os binding is cooperative. Apparent association constants were measured for the stepwise addition of one to five GM1os to CTB5 at pH 6.9 and 22 °C. The intrinsic association constant, which was established from the apparent association constant for the addition of a single GM1os to CTB5, was found to be (3.2 ± 0.2) × 106 M-1. This is in reasonable agreement with the reported value of (6.4 ± 0.3) × 106 M-1, which was measured at pH 7.4 and 25 °C using isothermal titration calorimetry (ITC). Analysis of the apparent association constants provides direct and unambiguous evidence that GM1os binding exhibits small positive cooperativity. Binding was found to be sensitive to the number of ligand-bound nearest neighbor subunits, with the affinities enhanced by a factor of 1.7 and 2.9 when binding occurs next to one or two ligand-bound subunits, respectively. These findings, which provide quantitative support for the binding model proposed by Homans and coworkers [14], highlight the unique strengths of the direct ESI-MS assay for measuring cooperative ligand binding.

Comparison of Relative Binding Affinities for Trout and Human Estrogen Receptor Based upon Different Competitive Binding Assays

EPA Science Inventory

The development of a predictive model based upon a single aquatic species inevitably raises the question of whether this information is valid for other species. To partially address this question, relative binding affinities (RBA) for six alkylphenols (para-substituted, n- and b...

A Novel Assay for Antibody-Dependent Cell-Mediated Cytotoxicity against HIV-1- or SIV-Infected Cells Reveals Incomplete Overlap with Antibodies Measured by Neutralization and Binding Assays

PubMed Central

Alpert, Michael D.; Heyer, Lisa N.; Williams, David E. J.; Harvey, Jackson D.; Greenough, Thomas; Allhorn, Maria

2012-01-01

The resistance of human immunodeficiency virus type 1 (HIV-1) to antibody-mediated immunity often prevents the detection of antibodies that neutralize primary isolates of HIV-1. However, conventional assays for antibody functions other than neutralization are suboptimal. Current methods for measuring the killing of virus-infected cells by antibody-dependent cell-mediated cytotoxicity (ADCC) are limited by the number of natural killer (NK) cells obtainable from individual donors, donor-to-donor variation, and the use of nonphysiological targets. We therefore developed an ADCC assay based on NK cell lines that express human or macaque CD16 and a CD4+ T-cell line that expresses luciferase from a Tat-inducible promoter upon HIV-1 or simian immunodeficiency virus (SIV) infection. NK cells and virus-infected targets are mixed in the presence of serial plasma dilutions, and ADCC is measured as the dose-dependent loss of luciferase activity. Using this approach, ADCC titers were measured in plasma samples from HIV-infected human donors and SIV-infected macaques. For the same plasma samples paired with the same test viruses, this assay was approximately 2 orders of magnitude more sensitive than optimized assays for neutralizing antibodies—frequently allowing the measurement of ADCC in the absence of detectable neutralization. Although ADCC correlated with other measures of Env-specific antibodies, neutralizing and gp120 binding titers did not consistently predict ADCC activity. Hence, this assay affords a sensitive method for measuring antibodies capable of directing ADCC against HIV- or SIV-infected cells expressing native conformations of the viral envelope glycoprotein and reveals incomplete overlap of the antibodies that direct ADCC and those measured in neutralization and binding assays. PMID:22933282

Novel enzyme-linked immunosorbent assay for determination of fluvastatin in plasma at picogram level.

PubMed

Darwish, Ibrahim A; Al-Obaid, Abdul-Rahman M; Al-Malaq, Hamoud A

2009-11-15

For the first time, an enzyme-linked immunosorbent assay (ELISA) has been developed and validated for the determination of fluvastatin (FLV) in plasma samples at picogram level. The assay employed a polyclonal antibody that specifically recognizes FLV with high affinity, and FLV conjugate of bovine serum albumin (FLV-BSA) immobilized onto microplate wells as a solid-phase. The assay involved a competitive binding reaction between FLV, in plasma sample, and the immobilized FLV-BSA for the binding sites on a limited amount of the anti-FLV antibody. The bound anti-FLV antibody was quantified with horseradish peroxidase-labeled second anti-rabbit IgG antibody (HRP-IgG) and 3,3',5,5'-tetramethylbenzidine (TMB) as a substrate for the peroxidase enzyme. The concentration of FLV in the sample was quantified by its ability to inhibit the binding of the anti-FLV antibody to the immobilized FLV-BSA and subsequently the color intensity in the assay wells. The conditions for the proposed ELISA were investigated and the optimum conditions were employed in the determination of FLV in plasma samples. The assay limit of detection was 10 pg mL(-1) and the effective working range at relative standard deviations (RSD) of

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Computational biology of RNA interactions.

PubMed

Dieterich, Christoph; Stadler, Peter F

2013-01-01

The biodiversity of the RNA world has been underestimated for decades. RNA molecules are key building blocks, sensors, and regulators of modern cells. The biological function of RNA molecules cannot be separated from their ability to bind to and interact with a wide space of chemical species, including small molecules, nucleic acids, and proteins. Computational chemists, physicists, and biologists have developed a rich tool set for modeling and predicting RNA interactions. These interactions are to some extent determined by the binding conformation of the RNA molecule. RNA binding conformations are approximated with often acceptable accuracy by sequence and secondary structure motifs. Secondary structure ensembles of a given RNA molecule can be efficiently computed in many relevant situations by employing a standard energy model for base pair interactions and dynamic programming techniques. The case of bi-molecular RNA-RNA interactions can be seen as an extension of this approach. However, unbiased transcriptome-wide scans for local RNA-RNA interactions are computationally challenging yet become efficient if the binding motif/mode is known and other external information can be used to confine the search space. Computational methods are less developed for proteins and small molecules, which bind to RNA with very high specificity. Binding descriptors of proteins are usually determined by in vitro high-throughput assays (e.g., microarrays or sequencing). Intriguingly, recent experimental advances, which are mostly based on light-induced cross-linking of binding partners, render in vivo binding patterns accessible yet require new computational methods for careful data interpretation. The grand challenge is to model the in vivo situation where a complex interplay of RNA binders competes for the same target RNA molecule. Evidently, bioinformaticians are just catching up with the impressive pace of these developments. Copyright © 2012 John Wiley & Sons, Ltd.

[Preparation of anti-hCG single domain antibody by antibody grafting technique using an antigen-binding peptide].

PubMed

Peng, Jing; Wang, Qiong; Cheng, Xiaoling; Liu, Mengwen; Wang, Mei; Xin, Huawei

2018-04-25

We used the antibody grafting technology to prepare anti-hCG single-domain antibodies on the basis of antigen-binding peptide to simplify the single-domain antibody preparation process and improving the biochemical stability of peptide. By using a universal single-domain antibody backbone (cAbBCII10), CDR1 or CDR3 was replaced by the hCG-binding peptide, and the grafted antibody gene sequences were synthesized and cloned into the prokaryotic expression vector pET30a(+) in fusion with a C-terminal sfGFP gene, i.e. pET30a-(His6)-cAbBCII10-CDR1/hCGBP1-sfGFP and pET30a-(His6)-cAbBCII10-CDR3/hCGBP3-sfGFP. The recombinant plasmids were transformed into E. coli BL21(DE3), and the fusion proteins were induced by IPTG. Highly soluble recombinant fusion proteins were obtained and purified by Ni-NTA affinity column. SDS-PAGE confirmed the purified protein as the target protein. The antigen-antibody binding assay showed that both the CDR1 and CDR3 grafted antibodies have hCG-binding activities. While the titers of the two grafted antibodies were similar, the binding affinity of CDR3 grafted antibody was higher than that of CDR1 grafted protein (about 2-3 times). The grafted antibodies retained the relatively high biochemical stability of the single-domain antibody backbone and were relatively thermostable and alkaline tolerant. The obtained antibodies also had a relatively high antigen-binding specificity to hCG. This study provided a reliable experimental basis for further optimization of anti-hCG single domain antibody by antibody grafting technology using antigen-binding peptide.

76 FR 4920 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-27

... appear to be distinct from each other. Available for licensing is a Plk1 ELISA assay using peptide... binding property, an easy and reliable ELISA assay has been developed to quantify Plk1 expression levels... sequence. ELISA assay to quantify Plk1 expression and kinase activity. Advantages: Rapid, highly sensitive...

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

Production of Antiserum to LH-Releasing Hormone (LH-RH) Associated with Gonadal Atrophy in Rabbits: Development of Radioimmunoassays for LH-RH

DOE Office of Scientific and Technical Information (OSTI.GOV)

ARIMURA, A.; SATO, H.; KUMASAKA, T.

1973-11-01

Repeated injections of synthetic LH -- RH decapeptide, adsorbed on polyvinylpyrrolidone and emulsified with complete Freund's adjuvant, resulted in the production of a specific antiserum to LH-- RH in two of three rabbits. The animals that produced this antiserum showed a reduction of pituitary LH content and marked atrophy of the testes. The antiserum-antibody complex was detected by the complement flxation test. The antiserum was capable of binding /sup 125/I- labeled LH--RH. After iodination of LHRH (using /sup 125/I and either the chloramine T or lactoperoxidase method) separation of the iodination products on CMC yielded three main peaks of radioactivity:more » The first was free iodide, the second was labeled peptide with low immunoreactivity, and the third was immunoreactive peptide. This 3rd peak consisted of two or three subpeaks; the leading subpeak(s) were more readily bound by antiserum than the trailing one(s). Binding of these fractions to antiserum was increased in the presence of small amounts of unlabeled LH--RH (a phenomenon called paradoxical binding or hock effect) but inhibited by larger amounts. Both the augmentation and the inhibition effects were dose-related, allowing the development of two different radioimmunoassay (RIA) systems for LH--RH. An ordinary (coinpetitive) type of RIA was developed in which a small amount (0.31 ng/assay tube) of unlabeled LH-- RH was added to the labeled peptide. This saturated the antiserum's capacity for paradoxical binding, so that further addition of LH-- RH (from 0.04 to 2.5 ng/ tube) inhibited binding of labeled LH--RH. The assay developed using paradoxical binding omitted the premixing of labeled and unlabeled LH--RH; in this assay addition of very small amounts (0.5 to 310 pg) of unlabeled LH--RH to the assay tubes increased the amount of label bound to antiserum and allowed construction of a parabolic curve of positive slope when B/T was plotted against arithmetic dose. The assays seem to be highly specific for LH--RH although both polymers and degradation products of LH--RH appeared to have some immunoreactivity.« less

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

λ-Repressor Oligomerization Kinetics at High Concentrations Using Fluorescence Correlation Spectroscopy in Zero-Mode Waveguides

PubMed Central

Samiee, K. T.; Foquet, M.; Guo, L.; Cox, E. C.; Craighead, H. G.

2005-01-01

Fluorescence correlation spectroscopy (FCS) has demonstrated its utility for measuring transport properties and kinetics at low fluorophore concentrations. In this article, we demonstrate that simple optical nanostructures, known as zero-mode waveguides, can be used to significantly reduce the FCS observation volume. This, in turn, allows FCS to be applied to solutions with significantly higher fluorophore concentrations. We derive an empirical FCS model accounting for one-dimensional diffusion in a finite tube with a simple exponential observation profile. This technique is used to measure the oligomerization of the bacteriophage λ repressor protein at micromolar concentrations. The results agree with previous studies utilizing conventional techniques. Additionally, we demonstrate that the zero-mode waveguides can be used to assay biological activity by measuring changes in diffusion constant as a result of ligand binding. PMID:15613638

Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

PubMed

Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

2017-01-01

Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

Comparison of printed glycan array, suspension array and ELISA in the detection of human anti-glycan antibodies.

PubMed

Pochechueva, Tatiana; Jacob, Francis; Goldstein, Darlene R; Huflejt, Margaret E; Chinarev, Alexander; Caduff, Rosemarie; Fink, Daniel; Hacker, Neville; Bovin, Nicolai V; Heinzelmann-Schwarz, Viola

2011-12-01

Anti-glycan antibodies represent a vast and yet insufficiently investigated subpopulation of naturally occurring and adaptive antibodies in humans. Recently, a variety of glycan-based microarrays emerged, allowing high-throughput profiling of a large repertoire of antibodies. As there are no direct approaches for comparison and evaluation of multi-glycan assays we compared three glycan-based immunoassays, namely printed glycan array (PGA), fluorescent microsphere-based suspension array (SA) and ELISA for their efficacy and selectivity in profiling anti-glycan antibodies in a cohort of 48 patients with and without ovarian cancer. The ABO blood group glycan antigens were selected as well recognized ligands for sensitivity and specificity assessments. As another ligand we selected P(1), a member of the P blood group system recently identified by PGA as a potential ovarian cancer biomarker. All three glyco-immunoassays reflected the known ABO blood groups with high performance. In contrast, anti-P(1) antibody binding profiles displayed much lower concordance. Whilst anti-P(1) antibody levels between benign controls and ovarian cancer patients were significantly discriminated using PGA (p=0.004), we got only similar results using SA (p=0.03) but not for ELISA. Our findings demonstrate that whilst assays were largely positively correlated, each presents unique characteristic features and should be validated by an independent patient cohort rather than another array technique. The variety between methods presumably reflects the differences in glycan presentation and the antigen/antibody ratio, assay conditions and detection technique. This indicates that the glycan-antibody interaction of interest has to guide the assay selection. © The Author(s) 2011. This article is published with open access at Springerlink.com

Effects of egg-adaptation on receptor-binding and antigenic properties of recent influenza A (H3N2) vaccine viruses.

PubMed

Parker, Lauren; Wharton, Stephen A; Martin, Stephen R; Cross, Karen; Lin, Yipu; Liu, Yan; Feizi, Ten; Daniels, Rodney S; McCauley, John W

2016-06-01

Influenza A virus (subtype H3N2) causes seasonal human influenza and is included as a component of influenza vaccines. The majority of vaccine viruses are isolated and propagated in eggs, which commonly results in amino acid substitutions in the haemagglutinin (HA) glycoprotein. These substitutions can affect virus receptor-binding and alter virus antigenicity, thereby, obfuscating the choice of egg-propagated viruses for development into candidate vaccine viruses. To evaluate the effects of egg-adaptive substitutions seen in H3N2 vaccine viruses on sialic acid receptor-binding, we carried out quantitative measurement of virus receptor-binding using surface biolayer interferometry with haemagglutination inhibition (HI) assays to correlate changes in receptor avidity with antigenic properties. Included in these studies was a panel of H3N2 viruses generated by reverse genetics containing substitutions seen in recent egg-propagated vaccine viruses and corresponding cell culture-propagated wild-type viruses. These assays provide a quantitative approach to investigating the importance of individual amino acid substitutions in influenza receptor-binding. Results show that viruses with egg-adaptive HA substitutions R156Q, S219Y, and I226N, have increased binding avidity to α2,3-linked receptor-analogues and decreased binding avidity to α2,6-linked receptor-analogues. No measurable binding was detected for the viruses with amino acid substitution combination 156Q+219Y and receptor-binding increased in viruses where egg-adaptation mutations were introduced into cell culture-propagated virus. Substitutions at positions 156 and 190 appeared to be primarily responsible for low reactivity in HI assays with post-infection ferret antisera raised against 2012-2013 season H3N2 viruses. Egg-adaptive substitutions at position 186 caused substantial differences in binding avidity with an insignificant effect on antigenicity.

Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

PubMed Central

Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

2016-01-01

With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

Micro-Dose Calibrator for Pre-clinical Radiotracer Assays | NCI Technology Transfer Center | TTC

Cancer.gov

Pre-clinical radiotracer biomedical research involves the use of compounds labeled with radioisotopes, including cell binding studies, immune cell labeling techniques, and radio-ligand bio-distribution studies. Before this Micro-Dose Calibrator, measurement of pre-clinical level dosage for small animal studies was inaccurate and unreliable. This dose calibrator is a prototype ready for manufacturing. It is designed to accurately measure radioactive doses in the range of 50 nCi (1.8 kBq) to 100 µCi (3.7 MBq) with 1% precision. The NCI seeks co-development or licensing to commercialize it. Alternative uses will be considered.

Relating microstructure to rheology of a bundled and cross-linked F-actin network in vitro

NASA Astrophysics Data System (ADS)

Shin, J. H.; Gardel, M. L.; Mahadevan, L.; Matsudaira, P.; Weitz, D. A.

2004-06-01

The organization of individual actin filaments into higher-order structures is controlled by actin-binding proteins (ABPs). Although the biological significance of the ABPs is well documented, little is known about how bundling and cross-linking quantitatively affect the microstructure and mechanical properties of actin networks. Here we quantify the effect of the ABP scruin on actin networks by using imaging techniques, cosedimentation assays, multiparticle tracking, and bulk rheology. We show how the structure of the actin network is modified as the scruin concentration is varied, and we correlate these structural changes to variations in the resultant network elasticity.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System.

PubMed

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-19

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step.

Kinetic Analyses of Data from a Human Serum Albumin Assay Using the liSPR System

PubMed Central

Henseleit, Anja; Pohl, Carolin; Kaltenbach, Hans-Michael; Hettwer, Karina; Simon, Kirsten; Uhlig, Steffen; Haustein, Natalie; Bley, Thomas; Boschke, Elke

2015-01-01

We used the interaction between human serum albumin (HSA) and a high-affinity antibody to evaluate binding affinity measurements by the bench-top liSPR system (capitalis technology GmbH). HSA was immobilized directly onto a carboxylated sensor layer, and the mechanism of interaction between the antibody and HSA was investigated. The bivalence and heterogeneity of the antibody caused a complex binding mechanism. Three different interaction models (1:1 binding, heterogeneous analyte, bivalent analyte) were compared, and the bivalent analyte model best fit the curves obtained from the assay. This model describes the interaction of a bivalent analyte with one or two ligands (A + L ↔ LA + L ↔ LLA). The apparent binding affinity for this model measured 37 pM for the first reaction step, and 20 pM for the second step. PMID:25607476

A force-based protein biochip

NASA Astrophysics Data System (ADS)

Blank, K.; Mai, T.; Gilbert, I.; Schiffmann, S.; Rankl, J.; Zivin, R.; Tackney, C.; Nicolaus, T.; Spinnler, K.; Oesterhelt, F.; Benoit, M.; Clausen-Schaumann, H.; Gaub, H. E.

2003-09-01

A parallel assay for the quantification of single-molecule binding forces was developed based on differential unbinding force measurements where ligand-receptor interactions are compared with the unzipping forces of DNA hybrids. Using the DNA zippers as molecular force sensors, the efficient discrimination between specific and nonspecific interactions was demonstrated for small molecules binding to specific receptors, as well as for protein-protein interactions on protein arrays. Finally, an antibody sandwich assay with different capture antibodies on one chip surface and with the detection antibodies linked to a congruent surface via the DNA zippers was used to capture and quantify a recombinant hepatitis C antigen from solution. In this case, the DNA zippers enable not only discrimination between specific and nonspecific binding, but also allow for the local application of detection antibodies, thereby eliminating false-positive results caused by cross-reactive antibodies and nonspecific binding.

What Do Chaotrope-Based Avidity Assays for Antibodies to HIV-1 Envelope Glycoproteins Measure?

PubMed Central

Alexander, Marina R.; Ringe, Rajesh; Sanders, Rogier W.; Voss, James E.; Moore, John P.

2015-01-01

ABSTRACT When HIV-1 vaccine candidates that include soluble envelope glycoproteins (Env) are tested in humans and other species, the resulting antibody responses to Env are sifted for correlates of protection or risk. One frequently used assay measures the reduction in antibody binding to Env antigens by an added chaotrope (such as thiocyanate). Based on that assay, an avidity index was devised for assessing the affinity maturation of antibodies of unknown concentration in polyclonal sera. Since a high avidity index was linked to protection in animal models of HIV-1 infection, it has become a criterion for evaluating antibody responses to vaccine candidates. But what does the assay measure and what does an avidity index mean? Here, we have used a panel of monoclonal antibodies to well-defined epitopes on Env (gp120, gp41, and SOSIP.664 trimers) to explore how the chaotrope acts. We conclude that the chaotrope sensitivity of antibody binding to Env depends on several properties of the epitopes (continuity versus tertiary- and quaternary-structural dependence) and that the avidity index has no simple relationship to antibody affinity for functional Env spikes on virions. We show that the binding of broadly neutralizing antibodies against quaternary-structural epitopes is particularly sensitive to chaotrope treatment, whereas antibody binding to epitopes in variable loops and to nonneutralization epitopes in gp41 is generally resistant. As a result of such biases, the avidity index may at best be a mere surrogate for undefined antibody or other immune responses that correlate weakly with protection. IMPORTANCE An effective HIV-1 vaccine is an important goal. Such a vaccine will probably need to induce antibodies that neutralize typically transmitted variants of HIV-1, preventing them from infecting target cells. Vaccine candidates have so far failed to induce such antibody responses, although some do protect weakly against infection in animals and, possibly, humans. In the search for responses associated with protection, an avidity assay based on chemical disruption is often used to measure the strength of antibody binding. We have analyzed this assay mechanistically and found that the epitope specificity of an antibody has a greater influence on the outcome than does its affinity. As a result, the avidity assay is biased toward the detection of some antibody specificities while disfavoring others. We conclude that the assay may yield merely indirect correlations with weak protection, specifically when Env vaccination has failed to induce broad neutralizing responses. PMID:25810537

Assays for the determination of the activity of DNA nucleases based on the fluorometric properties of the YOYO dye.

PubMed

Fernández-Sierra, Mónica; Quiñones, Edwin

2015-03-15

Here we characterize the fluorescence of the YOYO dye as a tool for studying DNA-protein interactions in real time and present two continuous YOYO-based assays for sensitively monitoring the kinetics of DNA digestion by λ-exonuclease and the endonuclease EcoRV. The described assays rely on the different fluorescence intensities between single- and double-stranded DNA-YOYO complexes, allowing straightforward determination of nuclease activity and quantitative determination of reaction products. The assays were also employed to assess the effect of single-stranded DNA-binding proteins on the λ-exonuclease reaction kinetics, showing that the extreme thermostable single-stranded DNA-binding protein (ET-SSB) significantly reduced the reaction rate, while the recombination protein A (RecA) displayed no effect. Copyright © 2015 Elsevier Inc. All rights reserved.

Enzyme-linked immunosorbent assays for determination of plasma aldosterone using highly specific polyclonal antibodies.

PubMed

Schwartz, F; Hadas, E; Harnik, M; Solomon, B

1990-01-01

Two enzyme-linked immunosorbent assays were established and compared for the estimation of plasma aldosterone. In the first method immobilized aldosterone-protein complexes on the ELISA plates compete with aldosterone to be determined for the binding of certain amount of anti-aldosterone antibodies. The sensitivity of this method depends on the protein carrier used to conjugate with aldosterone. In the second method, anti-aldosterone antibodies adsorbed on ELISA plates compete for binding of known amount of the enzyme-labeled aldosterone and aldosterone to be determined. The highly specific rabbit anti-aldosterone antibodies were obtained by injection of aldosterone-oxime thyroglobulin. The detection limit of aldosterone in both methods ranged between 2-20 pg. The proposed assays are suitable for the determination of aldosterone in biological fluids compared with other reported ELISA assays, as well as with RIA.

Production and assay of forskolin antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, L.T.; Ho, R.J.

1986-05-01

Forskolin (Fo), a cardiovascular active diterpene of plant origin, has been widely used as a research tool in regulation of the catalytic activity of adenylate cyclase (AC). A linear relationship of Fo binding to plasma membrane with activation of AC has been reported. The present abstract describes the production and assay of Fo antibodies (AB). 7-0-Hemisuccinyl-7-deacetyl Fo, coupled to either human serum albumin or goat IgG, was injected into goats to elicit AB to Fo haptan. AB to Fo in antiserum or an isolated IgG fraction was tested by two assay methods, a radioimmunoassay using /sup 3/H-Fo as a tracermore » and a colorimetric enzyme-linked immunosorbent assay (ELISA) using horse radish peroxidase-rabbit anti goat IgG as indicator. The titers for Fo antiserum were 4000-10,000. In the defined assay condition, approximately 20-25% of the added /sup 3/H-Fo was found to bind to AB. The bound radioactivity was displaced by Fo-HSA or Fo-goat IgG or free unlabelled Fo ranging from 0.5-50 pmol/tube, or 5-500 nM. The IC/sub 50/ was approximately 8-10 pmol/tube or 80-100 nM. The binding of HRP-rabbit anti goat IgG in the ELISA was inhibited by proper Fo conjugate. The development of methods for production and assay for Fo AB may be useful in the study of mechanism of activation of AC by Fo and Fo-like compound.« less

Functional efficacy of adenosine A2A receptor agonists is positively correlated to their receptor residence time

PubMed Central

Guo, Dong; Mulder-Krieger, Thea; IJzerman, Adriaan P; Heitman, Laura H

2012-01-01

BACKGROUND AND PURPOSE The adenosine A2A receptor belongs to the superfamily of GPCRs and is a promising therapeutic target. Traditionally, the discovery of novel agents for the A2A receptor has been guided by their affinity for the receptor. This parameter is determined under equilibrium conditions, largely ignoring the kinetic aspects of the ligand-receptor interaction. The aim of this study was to assess the binding kinetics of A2A receptor agonists and explore a possible relationship with their functional efficacy. EXPERIMENTAL APPROACH We set up, validated and optimized a kinetic radioligand binding assay (a so-called competition association assay) at the A2A receptor from which the binding kinetics of unlabelled ligands were determined. Subsequently, functional efficacies of A2A receptor agonists were determined in two different assays: a novel label-free impedance-based assay and a more traditional cAMP determination. KEY RESULTS A simplified competition association assay yielded an accurate determination of the association and dissociation rates of unlabelled A2A receptor ligands at their receptor. A correlation was observed between the receptor residence time of A2A receptor agonists and their intrinsic efficacies in both functional assays. The affinity of A2A receptor agonists was not correlated to their functional efficacy. CONCLUSIONS AND IMPLICATIONS This study indicates that the molecular basis of different agonist efficacies at the A2A receptor lies within their different residence times at this receptor. PMID:22324512

Metal-amplified Density Assays, (MADAs), including a Density-Linked Immunosorbent Assay (DeLISA).

PubMed

Subramaniam, Anand Bala; Gonidec, Mathieu; Shapiro, Nathan D; Kresse, Kayleigh M; Whitesides, George M

2015-02-21

This paper reports the development of Metal-amplified Density Assays, or MADAs - a method of conducting quantitative or multiplexed assays, including immunoassays, by using Magnetic Levitation (MagLev) to measure metal-amplified changes in the density of beads labeled with biomolecules. The binding of target analytes (i.e. proteins, antibodies, antigens) to complementary ligands immobilized on the surface of the beads, followed by a chemical amplification of the binding in a form that results in a change in the density of the beads (achieved by using gold nanoparticle-labeled biomolecules, and electroless deposition of gold or silver), translates analyte binding events into changes in density measureable using MagLev. A minimal model based on diffusion-limited growth of hemispherical nuclei on a surface reproduces the dynamics of the assay. A MADA - when performed with antigens and antibodies - is called a Density-Linked Immunosorbent Assay, or DeLISA. Two immunoassays provided a proof of principle: a competitive quantification of the concentration of neomycin in whole milk, and a multiplexed detection of antibodies against Hepatitis C virus NS3 protein and syphilis T. pallidum p47 protein in serum. MADAs, including DeLISAs, require, besides the requisite biomolecules and amplification reagents, minimal specialized equipment (two permanent magnets, a ruler or a capillary with calibrated length markings) and no electrical power to obtain a quantitative readout of analyte concentration. With further development, the method may be useful in resource-limited or point-of-care settings.

Development and validation of receptor occupancy pharmacodynamic assays used in the clinical development of the monoclonal antibody vedolizumab.

PubMed

Wyant, Tim; Estevam, Jose; Yang, Lili; Rosario, Maria

2016-03-01

Vedolizumab is a monoclonal antibody approved for use in ulcerative colitis and Crohn's disease. By specifically binding to α4 β7 integrin, vedolizumab prevents trafficking of lymphocytes to the gut, thereby interfering with disease pathology. During the clinical development program, the pharmacodynamic effect of vedolizumab was evaluated by 2 flow cytometry receptor occupancy assays: act-1 (ACT-1) and mucosal addressin cell adhesion molecule-1 (MAdCAM-1). Here we describe the development and validation of these assays. The ACT-1 assay is a receptor occupancy free-site assay that uses a monoclonal antibody with the same binding epitope as vedolizumab to detect free (unbound) sites on α4 β7 integrin. The MAdCAM-1 assay used a soluble version of the natural ligand for α4 β7 integrin to detect free sites. The assays were validated using a fit-for-purpose approach throughout the clinical development of vedolizumab. Both the ACT-1 assay and the MAdCAM-1 assay demonstrated acceptable reproducibility and repeatability. The assays were sufficiently stable to allow for clinical use. During clinical testing the assays demonstrated that vedolizumab was able to saturate peripheral cells at all doses tested. Two pharmacodynamic receptor occupancy assays were developed and validated to assess the effect of vedolizumab on peripheral blood cells. The results of these assays demonstrated the practical use of flow cytometry to examine pharmacodynamic response in clinical trials. © 2015 International Clinical Cytometry Society.

Ca(2+)-triggered coelenterazine-binding protein from Renilla as an enzyme-dependent label for binding assay.

PubMed

Krasitskaya, V V; Korneeva, S I; Kudryavtsev, A N; Markova, S V; Stepanyuk, G A; Frank, L A

2011-11-01

The recombinant Ca(2+)-triggered coelenterazine-binding protein (CBP) from Renilla muelleri was investigated as a biospecifically labeled molecule for in vitro assay applications. The protein was shown to be stable in solutions in the frozen state, as well as stable under heating and to chemical modifications. Conjugates with biotin, oligonucleotide, and proteins were obtained and applied as biospecific molecules in a solid-phase microassay. CBP detection was performed with intact (no modifications were made) Renilla luciferase in the presence of calcium, and the detection limit was found to be 75 amol. Model experiments indicate that this approach shows much promise, especially with regard to the development of multianalytical systems.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-04-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency.

Beta-Endorphin: dissociation of receptor binding activity from analgesic potency.

PubMed Central

Li, C H; Tseng, L F; Ferrara, P; Yamashiro, D

1980-01-01

Biological activities of synthetic camel beta-endorphin and human beta-endorphin (beta h-EP) have been measured by the radioreceptor binding assay, using [Tyr27-3H]-beta h-EP as the primary ligand and by the tail-flick test for analgesic potency. Four synthetic analogs of beta h-EP, namely [Gly31]-beta h-EP-Gly-NH2, [Gly31]-beta h-EP-Gly-Gly-NH2, [Gln8,Gly31]-beta h-EP-Gly-Gly-NH2, and [CH3(CH2)4NH231]-beta h-EP, have also been assayed by the same procedures. Results indicate a clear dissociation of radioreceptor binding activity from analgesic potency. PMID:6246537

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-09-19

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

System and method for detecting components of a mixture including a valving scheme for competition assays

DOEpatents

Koh, Chung-Yan; Piccini, Matthew E.; Singh, Anup K.

2017-07-11

Examples are described including measurement systems for conducting competition assays. A first chamber of an assay device may be loaded with a sample containing a target antigen. The target antigen in the sample may be allowed to bind to antibody-coated beads in the first chamber. A control layer separating the first chamber from a second chamber may then be opened to allow a labeling agent loaded in a first portion of the second chamber to bind to any unoccupied sites on the antibodies. A centrifugal force may then be applied to transport the beads through a density media to a detection region for measurement by a detection unit.

Detection of molecular interactions

DOEpatents

Groves, John T [Berkeley, CA; Baksh, Michael M [Fremont, CA; Jaros, Michal [Brno, CH

2012-02-14

A method and assay are described for measuring the interaction between a ligand and an analyte. The assay can include a suspension of colloidal particles that are associated with a ligand of interest. The colloidal particles are maintained in the suspension at or near a phase transition state from a condensed phase to a dispersed phase. An analyte to be tested is then added to the suspension. If the analyte binds to the ligand, a phase change occurs to indicate that the binding was successful.

Targeting the UPR to Circumvent Endocrine Resistance in Breast Cancer

DTIC Science & Technology

2015-10-01

were submitted for the screen. Kinase assay protocol (DiscoverX): For most assays, kinase-tagged T7 phage strains were grown in parallel in 24-well...blocks in an E. coli host derived from the BL21 strain. E. coli were grown to log-phase and infected with T7 phage from a frozen stock (multiplicity of...unbound ligand and to reduce non-specific phage binding. Binding reactions were assembled by combining kinases, liganded affinity beads, and test

Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties.

PubMed

Putta, Priya; Rankenberg, Johanna; Korver, Ruud A; van Wijk, Ringo; Munnik, Teun; Testerink, Christa; Kooijman, Edgar E

2016-11-01

Phosphatidic acid (PA) is a crucial membrane phospholipid involved in de novo lipid synthesis and numerous intracellular signaling cascades. The signaling function of PA is mediated by peripheral membrane proteins that specifically recognize PA. While numerous PA-binding proteins are known, much less is known about what drives specificity of PA-protein binding. Previously, we have described the ionization properties of PA, summarized in the electrostatic-hydrogen bond switch, as one aspect that drives the specific binding of PA by PA-binding proteins. Here we focus on membrane curvature stress induced by phosphatidylethanolamine and show that many PA-binding proteins display enhanced binding as a function of negative curvature stress. This result is corroborated by the observation that positive curvature stress, induced by lyso phosphatidylcholine, abolishes PA binding of target proteins. We show, for the first time, that a novel plant PA-binding protein, Arabidopsis Epsin-like Clathrin Adaptor 1 (ECA1) displays curvature-dependence in its binding to PA. Other established PA targets examined in this study include, the plant proteins TGD2, and PDK1, the yeast proteins Opi1 and Spo20, and, the mammalian protein Raf-1 kinase and the C2 domain of the mammalian phosphatidylserine binding protein Lact as control. Based on our observations, we propose that liposome binding assays are the preferred method to investigate lipid binding compared to the popular lipid overlay assays where membrane environment is lost. The use of complex lipid mixtures is important to elucidate further aspects of PA binding proteins. Copyright © 2016. Published by Elsevier B.V.

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

A novel multiplex poliovirus binding inhibition assay applicable for large serosurveillance and vaccine studies, without the use of live poliovirus.

PubMed

Schepp, Rutger M; Berbers, Guy A M; Ferreira, José A; Reimerink, Johan H; van der Klis, Fiona R

2017-03-01

Large-scale serosurveillance or vaccine studies for poliovirus using the "gold standard" WHO neutralisation test (NT) are very laborious and time consuming. With the polio eradication at hand and with the removal of live attenuated Sabin strains from the oral poliovirus vaccine (OPV), starting with type 2 (as of April 2016), laboratories will need to conform to much more stringent laboratory biosafety regulations when handling live poliovirus strains. In this study, a poliovirus binding inhibition multiplex immunoassay (polio MIA) using inactivated poliovirus vaccine (IPV-Salk) was developed for simultaneous quantification of serum antibodies directed to all three poliovirus types. Our assay shows a good correlation with the NT and an excellent correlation with the ELISA-based binding inhibition assay (POBI). The assay is highly type-specific and reproducible. Additionally, serum sample throughput increases about fivefold relative to NT and POBI and the amount of serum needed is reduced by more than 90%. In conclusion, the polio MIA can be used as a safe and high throughput application, especially for large-scale surveillance and vaccine studies, reducing laboratory time and serum amounts needed. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Determination of nuvenzepine in human plasma by a sensitive sup 3 Hpirenzepine radioreceptor binding assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caselli, G.; Ferrari, M.P.; Tonon, G.

1991-02-01

A sensitive method for the quantitation of small amounts of nuvenzepine, a new M1-selective antimuscarinic drug, in plasma is described. The analytical method involves the use of a radioreceptor binding assay based on {sup 3}Hpirenzepine displacement in rat cerebral cortex homogenates; no previous extraction is required. The method is reliable, with an interassay CV ranging from 5 to 10%, and allows the analysis of greater than 100 samples/experiment. The limit of detection is {approximately} 0.1 ng/assay. Using this method we have determined the plasma levels of nuvenzepine in eight healthy volunteers treated PO with 15 or 25 mg of nuvenzepine.HCl.more » The pharmacokinetic parameters obtained were (for 15 and 25 mg): Cmax, 64 and 131 ng/mL; AUC0-infinity, 851 and 1379 ng.h/mL; t1/2, 8.6 and 7.2 h. These values are in good agreement with those obtained using an HPLC method. Therefore, this radioreceptor binding assay proved to be simple, rapid, and specific for the determination of low levels of nuvenzepine in human plasma.« less

Antibodies Against Three Forms of Urokinase

NASA Technical Reports Server (NTRS)

Morrison, Dennis R.; Atassi, M. Zouhair

2007-01-01

Antibodies that bind to preselected regions of the urokinase molecule have been developed. These antibodies can be used to measure small quantities of each of three molecular forms of urokinase that could be contained in microsamples or conditioned media harvested from cultures of mammalian cells. Previously available antibodies and assay techniques do not yield both clear distinctions among, and measurements of, all three forms. Urokinase is a zymogen that is synthesized in a single-chain form, called ScuPA, which is composed of 411 amino acid residues (see figure). ScuPA has very little enzyme activity, but it can be activated in two ways: (1) by cleavage of the peptide bond lysine 158/isoleucine 159 and the loss of lysine 158 to obtain the high molecular-weight (HMW) form of the enzyme or (2) by cleavage of the bond lysine 135/lysine 136 to obtain the low-molecular-weight (LMW) form of the enzyme. The antibodies in question were produced in mice and rabbits by use of peptides as immunogens. The peptides were selected to obtain antibodies that bind to regions of ScuPA that include the lysine 158/isoleucine 159 and the lysine 135/lysine 136 bonds. The antibodies include monoclonal and polyclonal ones that yield indications as to whether either of these bonds is intact. The polyclonal antibodies include ones that preferentially bind to the HMW or LMW forms of the urokinase molecule. The monoclonal antibodies include ones that discriminate between the ScuPA and the HMW form. A combination of these molecular-specific antibodies will enable simultaneous assays of the ScuPA, HMW, and LMW forms in the same specimen of culture medium.

Reactive arthritis and serum levels of mannose binding lectin – lack of association

PubMed Central

LOCHT, H; CHRISTIANSEN, M; LAURSEN, I

2003-01-01

The purpose was to evaluate the possible association of serum mannose binding lectin (s-MBL) levels on type of triggering microbe, duration of diarrhoea, incidence and course of reactive arthritis (ReA) caused by Salmonella, Yersinia and Campylobacter. Sixty patients with ReA of 1–228 months duration, 173 patients with ReA or uncomplicated enterocolitis caused by Campylobacter, 226 sera from patients with elevated antibody levels against Salmonella, Yersinia or Campylobacter, and 114 blood donors were tested for s-MBL using ELISA technique, both direct mannan binding assay and sandwich ELISA. s-MBL was compared with C-reactive protein (CRP) levels and with the ability of activating complement C4. Among the 114 donors 9% had s-MBL <50 µg/l, 16% had from 50–500 µg/l and 75% had >500 µg/l. The distribution of s-MBL levels in the three-patient groups did not differ significantly from the controls. There were no indications that low s-MBL was associated with prolonged duration of arthritis, diarrhoea or individual bacterial infections. The two MBL assays were comparable with respect to serum concentrations, indicating that the actual circulating MBL was also functionally active. s-MBL exhibited acute phase reactant behaviour and correlated to CRP level, but only in patients with s-MBL concentrations exceeding 1000 µg/l. MBL in 10 randomly selected ReA sera were tested for the ability to activate complement C4. The results did not differ from those of donor controls. This study demonstrates that the distributions of s-MBL levels in serum among patients with ReA are not different from donor controls. The course, outcome or triggering bacteria are not associated with a particular level of s-MBL. PMID:12519401

Type and location of fluorescent probes incorporated into the potent mu-opioid peptide [Dmt]DALDA affect potency, receptor selectivity and intrinsic efficacy.

PubMed

Schiller, P W; Berezowska, I; Weltrowska, G; Chen, H; Lemieux, C; Chung, N N

2005-06-01

The dermorphin-derived tetrapeptide H-Dmt-d-Arg-Phe-Lys-NH(2) (Dmt = 2',6'-dimethyltyrosine) ([Dmt(1)]DALDA) is a highly potent and selective mu-opioid agonist capable of crossing the blood-brain barrier and producing a potent, centrally mediated analgesic effect when given systemically. For the purpose of biodistribution studies by fluorescence techniques, [Dmt(1)]DALDA analogues containing various fluorescent labels [dansyl, anthraniloyl (atn), fluorescein, or 6-dimethylamino-2'-naphthoyl] in several different locations of the peptide were synthesized and characterized in vitro in the guinea-pig ileum and mouse vas deferens assays, and in mu-, delta- and kappa-opioid receptor-binding assays. The analogues showed various degrees of mu receptor-binding selectivity, but all of them were less mu-selective than the [Dmt(1)]DALDA parent peptide. Most analogues retained potent, full mu-agonist activity, except for one with fluorescein attached at the C-terminus (3a) (partial mu-agonist) and one containing beta-(6'-dimethylamino-2'-naphthoyl)alanine (aladan) in place of Phe(3) (4) (mu- and kappa-antagonist). The obtained data indicate that the receptor-binding affinity, receptor selectivity and intrinsic efficacy of the prepared analogues vary very significantly, depending on the type of fluorescent label used and on its location in the peptide. The results suggest that the biological activity profile of fluorescence-labeled peptide analogues should always be carefully determined prior to their use in biodistribution studies or other studies. One of the analogues containing the atn group (2a) proved highly useful in a study of cellular uptake and intracellular distribution by confocal laser scanning microscopy.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Development of a high-throughput enzyme-linked immunosorbent assay for the routine detection of the carcinogen acrylamide in food, via rapid derivatisation pre-analysis.

PubMed

Preston, Andrew; Fodey, Terence; Elliott, Christopher

2008-02-11

The spontaneous formation of the neurotoxic carcinogen acrylamide in a wide range of cooked foods has recently been discovered. These foods include bread and other bakery products, crisps, chips, breakfast cereals, and coffee. To date, the diminutive size of acrylamide (71.08 Da) has prevented the development of screening immunoassays for this chemical. In this study, a polyclonal antibody capable of binding the carcinogen was produced by the synthesis of an immunogen comprising acrylamide derivatised with 3-mercaptobenzoic acid (3-MBA), and its conjugation to the carrier protein bovine thyroglobulin. Antiserum from the immunised rabbit was harvested and fully characterised. It displayed no binding affinity for acrylamide or 3-MBA but had a high affinity for 3-MBA-derivitised acrylamide. The antisera produced was utilised in the development of an ELISA based detection system for acrylamide. Spiked water samples were assayed for acrylamide content using a previously published extraction method validated for coffee, crispbread, potato, milk chocolate and potato crisp matrices. Extracted acrylamide was then subjected to a rapid 1-h derivatisation with 3-MBA, pre-analysis. The ELISA was shown to have a high specificity for acrylamide, with a limit of detection in water samples of 65.7 microgkg(-1), i.e. potentially suitable for acrylamide detection in a wide range of food commodities. Future development of this assay will increase sensitivity further. This is the first report of an immunoassay capable of detecting the carcinogen, as its small size has necessitated current analytical detection via expensive, slower, physico-chemical techniques such as Gas or Liquid Chromatography coupled to Mass Spectrometry.

Monitoring methotrexate in clinical samples from cancer patients during chemotherapy with a LSPR-based competitive sensor.

PubMed

Zhao, Sandy Shuo; Bichelberger, Mathilde A; Colin, Damien Y; Robitaille, Robert; Pelletier, Joelle N; Masson, Jean-François

2012-10-21

A competitive binding assay based on localized surface plasmon resonance (LSPR) of folic acid-functionalized gold nanoparticles (FA-AuNPs) and human dihydrofolate reductase enzyme (hDHFR) was developed to detect nanomolar to micromolar concentrations of the widely applied anti-cancer drug, methotrexate (MTX). By the nature of the competitive assay for MTX, the LSPR shift from specific binding between FA-AuNPs and the free enzyme was inversely proportional to the concentration of MTX. In addition, the dynamic range for MTX was tuned from 10(-11) to 10(-6) M by varying the concentration of hDHFR from 1 to 100 nM. Inter-day reproducibility and recovery of MTX spiked in phosphate buffer saline (PBS) were excellent. Potential interferents such as FA, trimethoprim (TMP) and 4-amino-4-deoxy-N-methylpteroic acid (DAMPA) did not occur in the concentration range of interest for MTX. Clinical samples of human serum from patients undergoing MTX chemotherapy were analyzed following a simple solid-phase extraction step to isolate MTX from the serum matrix, with a limit of detection of 155 nM. Validation of the LSPR method was carried out in comparison to Fluorescence Polarization Immunoassay (FPIA), a commonly used method in clinical settings, and LC-MS/MS, a reference technique. The results of the LSPR competitive assay compared well to FPIA and LC-MS/MS, with a slope of 2.4 and 1.1, respectively, for the correlation plots. The method established herein is intended for therapeutic drug monitoring (TDM) of MTX levels in patients undergoing chemotherapy to ensure safety and efficacy of the treatment.

Acetylcholinesterase affinity-based screening assay on Lippia gracilis Schauer extracts.

PubMed

Vanzolini, K L; da F Sprenger, R; Leme, G M; de S Moraes, V R; Vilela, A F L; Cardoso, C L; Cass, Q B

2018-05-10

The use of affinity-based protein assay produced by covalently linking acetylcholinesterase to magnetic beads, followed by chemical characterization of the selective binders using Liquid Chromatography with tandem High-Resolution Mass Spectrometry (LC-HRMS) is herein described for profiling crude aqueous natural product extracts. The fishing assay was first modulated using galanthamine as a reference ligand and then, the assay condition was adjusted for the aqueous leaves extracts obtained from Lippia gracilis Schauer (genotype 201) that was used as the natural combinatory library. From the experiments, a selective binder has been undisclosed with an accurate mass of 449.1131 m/z and identified as eriodictyol 2'-O-glucoside or eriodictyol 3'-O-glucoside. The selectivity of the binding assay was demonstrated, as much as, that erydictiol 7-O-glucoside was not fished, although it was present in the crude aqueous extract. The binding assay platform exhibited high specificity and did not require any sample pretreatment, making it appropriate for profiling binders at natural libraries. Copyright © 2018 Elsevier B.V. All rights reserved.

Quantifying domain-ligand affinities and specificities by high-throughput holdup assay

PubMed Central

Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles

2015-01-01

Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890

Galline Ex-FABP is an Antibacterial Siderocalin and a Lysophosphatidic Acid Sensor Functioning through Dual Ligand Specificities

PubMed Central

Correnti, Colin; Clifton, Matthew C.; Abergel, Rebecca J.; Allred, Ben; Hoette, Trisha M.; Ruiz, Mario; Cancedda, Ranieri; Raymond, Kenneth N.; Descalzi, Fiorella; Strong, Roland K.

2011-01-01

SUMMARY Galline Ex-FABP was identified as another candidate antibacterial, catecholate siderophore binding lipocalin (siderocalin) based on structural parallels with the family archetype, mammalian Siderocalin. Binding assays show that Ex-FABP retains iron in a siderophore-dependent manner in both hypertrophic and dedifferentiated chondrocytes, where Ex-FABP expression is induced after treatment with proinflammatory agents, and specifically binds ferric complexes of enterobactin, parabactin, bacillibactin and, unexpectedly, monoglucosylated enterobactin, which does not bind to Siderocalin. Growth arrest assays functionally confirm the bacteriostatic effect of Ex-FABP in vitro under iron-limiting conditions. The 1.8Å crystal structure of Ex-FABP explains the expanded specificity, but also surprisingly reveals an extended, multi-chambered cavity extending through the protein and encompassing two separate ligand specificities, one for bacterial siderophores (as in Siderocalin) at one end and one specifically binding co-purified lysophosphatidic acid, a potent cell signaling molecule, at the other end, suggesting Ex-FABP employs dual functionalities to explain its diverse endogenous activities. PMID:22153502

Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

NASA Astrophysics Data System (ADS)

Song, Hong Yan; Su, Xiaodi

In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

Exploring blocking assays using Octet, ProteOn, and Biacore biosensors.

PubMed

Abdiche, Yasmina N; Malashock, Dan S; Pinkerton, Alanna; Pons, Jaume

2009-03-15

We demonstrate the use of label-free real-time optical biosensors in competitive binding assays by epitope binning a panel of antibodies. We describe three assay orientations that we term in tandem, premix, and classical sandwich blocking, and we perform each of them on three platforms: ForteBio's Octet QK, Bio-Rad's ProteOn XPR36, and GE Healthcare's Biacore 3000. By testing whether antibodies block one another's binding to their antigen in a pairwise fashion, we establish a blocking profile for each antibody relative to the others in the panel. The blocking information is then used to create "bins" of antibodies with similar epitopes. The advantages and disadvantages of each biosensor, factors to consider when deciding on the most appropriate blocking assay orientation for a particular interaction system, and tips for dealing with ambiguous data are discussed. The data from our different assay orientations and biosensors agree very well, establishing these machines as valuable tools for characterizing antibody epitopes and multiprotein complexes of biological significance.

PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats.

PubMed

Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

2007-11-01

Rimonabant (Acomplia, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPgammaS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPgammaS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist.

PSNCBAM-1, a novel allosteric antagonist at cannabinoid CB1 receptors with hypophagic effects in rats

PubMed Central

Horswill, J G; Bali, U; Shaaban, S; Keily, J F; Jeevaratnam, P; Babbs, A J; Reynet, C; Wong Kai In, P

2007-01-01

Background and purpose: Rimonabant (AcompliaTM, SR141716A), a cannabinoid CB1 receptor inverse agonist, has recently been approved for the treatment of obesity. There are, however, concerns regarding its side effect profile. Developing a CB1 antagonist with a different pharmacological mechanism may lead to a safer alternative. To this end we have screened a proprietary small molecule library and have discovered a novel class of allosteric antagonist at CB1 receptors. Herein, we have characterized an optimized prototypical molecule, PSNCBAM-1, and its hypophagic effects in vivo. Experimental approach: A CB1 yeast reporter assay was used as a primary screen. PSNCBAM-1 was additionally characterized in [35S]-GTPγS, cAMP and radioligand binding assays. An acute rat feeding model was used to evaluate its effects on food intake and body weight in vivo. Key results: In CB1 receptor yeast reporter assays, PSNCBAM-1 blocked the effects induced by agonists such as CP55,940, WIN55212-2, anandamide (AEA) or 2-arachidonoyl glycerol (2-AG). The antagonist characteristics of PSNCBAM-1 were confirmed in [35S]-GTPγS binding and cAMP assays and was shown to be non-competitive by Schild analyses. PSNCBAM-1 did not affect CB2 receptors. In radioligand binding assays, PSNCBAM-1 increased the binding of [3H]CP55,940 despite its antagonist effects. In an acute rat feeding model, PSNCBAM-1 decreased food intake and body weight. Conclusions and implications: PSNCBAM-1 exerted its effects through selective allosteric modulation of the CB1 receptor. The acute effects on food intake and body weight induced in rats provide a first report of in vivo activity for an allosteric CB1 receptor antagonist. PMID:17592509

Functional diagnostics for thyrotropin hormone receptor autoantibodies: bioassays prevail over binding assays.

PubMed

Lytton, Simon David; Schluter, Anke; Banga, Paul J

2018-06-01

Autoantibodies to the thyrotropin hormone receptor (TSH-R) are directly responsible for the hyperthyroidism in Graves' disease and mediate orbital manifestations in Graves' orbitopathy (otherwise known as thyroid eye disease). These autoantibodies are heterogeneous in their function and collectively referred to as TRAbs. Measurement of TRAbs is clinically important for diagnosis of a variety of conditions and different commercial assays with high sensitivity and specificity are available for diagnostic purposes. This review provides overwhelming evidence that the TRAbs detected in binding assays by mainly the automated electrochemical luminescence immunoassays (ECLIA) do not distinguish TRAbs that stimulate the TSH-R (called TSIs or TSAbs) and TRAbs that just inhibit the binding of TSH without stimulating the TSH-R (called TBAbs). However, TSAbs and TBAbs have divergent pathogenic roles, and depending which fraction predominates cause different clinical symptoms and engender different therapeutic regimen. Therefore, diagnostic distinction of TSAbs and TBAbs is of paramount clinical importance. To date, only bioassays such as the Mc4 TSH-R bioassay (Thyretain TM , Quidel) and the Bridge assay (Immulite 2000, Siemens) can measure TSAbs, with only the former being able to distinguish between TSAbs and TBAbs. On this note, it is strongly recommended to only use the term TSI or TSAb when reporting the results of bioassays, whereas the results of automated TRAb binding assays should be reported as TRAbs (of undetermined functional significance). This review aims to present a technical and analytical account of leading commercial diagnostic methods of anti-TSH-R antibodies, a metaanalysis of their clinical performance and a perspective for the use of cell based TSH-R bioassays in the clinical diagnostics of Graves' disease.

Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

PubMed

Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

2005-06-01

Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

Flavonoid Regulation of HCN2 Channels*

PubMed Central

Carlson, Anne E.; Rosenbaum, Joel C.; Brelidze, Tinatin I.; Klevit, Rachel E.; Zagotta, William N.

2013-01-01

The hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels are pacemaker channels whose currents contribute to rhythmic activity in the heart and brain. HCN channels open in response to hyperpolarizing voltages, and the binding of cAMP to their cyclic nucleotide-binding domain (CNBD) facilitates channel opening. Here, we report that, like cAMP, the flavonoid fisetin potentiates HCN2 channel gating. Fisetin sped HCN2 activation and shifted the conductance-voltage relationship to more depolarizing potentials with a half-maximal effective concentration (EC50) of 1.8 μm. When applied together, fisetin and cAMP regulated HCN2 gating in a nonadditive fashion. Fisetin did not potentiate HCN2 channels lacking their CNBD, and two independent fluorescence-based binding assays reported that fisetin bound to the purified CNBD. These data suggest that the CNBD mediates the fisetin potentiation of HCN2 channels. Moreover, binding assays suggest that fisetin and cAMP partially compete for binding to the CNBD. NMR experiments demonstrated that fisetin binds within the cAMP-binding pocket, interacting with some of the same residues as cAMP. Together, these data indicate that fisetin is a partial agonist for HCN2 channels. PMID:24085296

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Computational Assay of H7N9 Influenza Neuraminidase Reveals R292K Mutation Reduces Drug Binding Affinity

NASA Astrophysics Data System (ADS)

Woods, Christopher J.; Malaisree, Maturos; Long, Ben; McIntosh-Smith, Simon; Mulholland, Adrian J.

2013-12-01

The emergence of a novel H7N9 avian influenza that infects humans is a serious cause for concern. Of the genome sequences of H7N9 neuraminidase available, one contains a substitution of arginine to lysine at position 292, suggesting a potential for reduced drug binding efficacy. We have performed molecular dynamics simulations of oseltamivir, zanamivir and peramivir bound to H7N9, H7N9-R292K, and a structurally related H11N9 neuraminidase. They show that H7N9 neuraminidase is structurally homologous to H11N9, binding the drugs in identical modes. The simulations reveal that the R292K mutation disrupts drug binding in H7N9 in a comparable manner to that observed experimentally for H11N9-R292K. Absolute binding free energy calculations with the WaterSwap method confirm a reduction in binding affinity. This indicates that the efficacy of antiviral drugs against H7N9-R292K will be reduced. Simulations can assist in predicting disruption of binding caused by mutations in neuraminidase, thereby providing a computational `assay.'

Spectroscopic and molecular modeling approaches to investigate the interaction of bisphenol A, bisphenol F and their diglycidyl ethers with PPARα.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu

2017-08-01

A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of the receptor-binding domain of Ebola glycoprotein in viral entry.

PubMed

Wang, Jizhen; Manicassamy, Balaji; Caffrey, Michael; Rong, Lijun

2011-06-01

Ebola virus infection causes severe hemorrhagic fever in human and non-human primates with high mortality. Viral entry/infection is initiated by binding of glycoprotein GP protein on Ebola virion to host cells, followed by fusion of virus-cell membrane also mediated by GP. Using an human immunodeficiency virus (HIV)-based pseudotyping system, the roles of 41 Ebola GP1 residues in the receptor-binding domain in viral entry were studied by alanine scanning substitutions. We identified that four residues appear to be involved in protein folding/structure and four residues are important for viral entry. An improved entry interference assay was developed and used to study the role of these residues that are important for viral entry. It was found that R64 and K95 are involved in receptor binding. In contrast, some residues such as I170 are important for viral entry, but do not play a major role in receptor binding as indicated by entry interference assay and/or protein binding data, suggesting that these residues are involved in post-binding steps of viral entry. Furthermore, our results also suggested that Ebola and Marburg viruses share a common cellular molecule for entry.