Structural basis for PPARγ transactivation by endocrine-disrupting organotin compounds

PubMed Central

Harada, Shusaku; Hiromori, Youhei; Nakamura, Shota; Kawahara, Kazuki; Fukakusa, Shunsuke; Maruno, Takahiro; Noda, Masanori; Uchiyama, Susumu; Fukui, Kiichi; Nishikawa, Jun-ichi; Nagase, Hisamitsu; Kobayashi, Yuji; Yoshida, Takuya; Ohkubo, Tadayasu; Nakanishi, Tsuyoshi

2015-01-01

Organotin compounds such as triphenyltin (TPT) and tributyltin (TBT) act as endocrine disruptors through the peroxisome proliferator–activated receptor γ (PPARγ) signaling pathway. We recently found that TPT is a particularly strong agonist of PPARγ. To elucidate the mechanism underlying organotin-dependent PPARγ activation, we here analyzed the interactions of PPARγ ligand-binding domain (LBD) with TPT and TBT by using X-ray crystallography and mass spectroscopy in conjunction with cell-based activity assays. Crystal structures of PPARγ-LBD/TBT and PPARγ-LBD/TPT complexes were determined at 1.95 Å and 1.89 Å, respectively. Specific binding of organotins is achieved through non-covalent ionic interactions between the sulfur atom of Cys285 and the tin atom. Comparisons of the determined structures suggest that the strong activity of TPT arises through interactions with helix 12 of LBD primarily via π-π interactions. Our findings elucidate the structural basis of PPARγ activation by TPT. PMID:25687586

Dynamics and allostery of the ionotropic glutamate receptors and the ligand binding domain.

PubMed

Tobi, Dror

2016-02-01

The dynamics of the ligand-binding domain (LBD) and the intact ionotropic glutamate receptor (iGluR) were studied using Gaussian Network Model (GNM) analysis. The dynamics of LBDs with various allosteric modulators is compared using a novel method of multiple alignment of GNM modes of motion. The analysis reveals that allosteric effectors change the dynamics of amino acids at the upper lobe interface of the LBD dimer as well as at the hinge region between the upper- and lower- lobes. For the intact glutamate receptor the analysis show that the clamshell-like movement of the LBD upper and lower lobes is coupled to the bending of the trans-membrane domain (TMD) helices which may open the channel pore. The results offer a new insight on the mechanism of action of allosteric modulators on the iGluR and support the notion of TMD helices bending as a possible mechanism for channel opening. In addition, the study validates the methodology of multiple GNM modes alignment as a useful tool to study allosteric effect and its relation to proteins dynamics. © 2015 Wiley Periodicals, Inc.

Exploration of the conformational landscape in pregnane X receptor reveals a new binding pocket

PubMed Central

Chandran, Aneesh

2016-01-01

Abstract Ligand‐regulated pregnane X receptor (PXR), a member of the nuclear receptor superfamily, plays a central role in xenobiotic metabolism. Despite its critical role in drug metabolism, PXR activation can lead to adverse drug‐drug interactions and early stage metabolism of drugs. Activated PXR can induce cancer drug resistance and enhance the onset of malignancy. Since promiscuity in ligand binding makes it difficult to develop competitive inhibitors targeting PXR ligand binding pocket (LBP), it is essential to identify allosteric sites for effective PXR antagonism. Here, molecular dynamics (MD) simulation studies unravelled the existence of two different conformational states, namely “expanded” and “contracted”, in apo PXR ligand binding domain (LBD). Ligand binding events shifted this conformational equilibrium and locked the LBD in a single “ligand‐adaptable” conformational state. Ensemble‐based computational solvent mapping identified a transiently open potential small molecule binding pocket between α5 and α8 helices, named “α8 pocket”, whose opening‐closing mechanism directly correlated with the conformational shift in LBD. A virtual hit identified through structure‐based virtual screening against α8 pocket locks the pocket in its open conformation. MD simulations further revealed that the presence of small molecule at allosteric site disrupts the LBD dynamics and locks the LBD in a “tightly‐contracted” conformation. The molecular details provided here could guide new structural studies to understand PXR activation and antagonism. PMID:27515410

Unique Structure and Dynamics of the EphA5 Ligand Binding Domain Mediate Its Binding Specificity as Revealed by X-ray Crystallography, NMR and MD Simulations

PubMed Central

Mitra, Sayantan; Zhu, Wanlong; Qin, Haina; Pasquale, Elena B.; Song, Jianxing

2013-01-01

The 16 EphA and EphB receptors represent the largest family of receptor tyrosine kinases, and their interactions with 9 ephrin-A and ephrin-B ligands initiate bidirectional signals controlling many physiological and pathological processes. Most interactions occur between receptor and ephrins of the same class, and only EphA4 can bind all A and B ephrins. To understand the structural and dynamic principles that enable Eph receptors to utilize the same jellyroll β-sandwich fold to bind ephrins, the VAPB-MSP domain, peptides and small molecules, we have used crystallography, NMR and molecular dynamics (MD) simulations to determine the first structure and dynamics of the EphA5 ligand-binding domain (LBD), which only binds ephrin-A ligands. Unexpectedly, despite being unbound, the high affinity ephrin-binding pocket of EphA5 resembles that of other Eph receptors bound to ephrins, with a helical conformation over the J–K loop and an open pocket. The openness of the pocket is further supported by NMR hydrogen/deuterium exchange data and MD simulations. Additionally, the EphA5 LBD undergoes significant picosecond-nanosecond conformational exchanges over the loops, as revealed by NMR and MD simulations, but lacks global conformational exchanges on the microsecond-millisecond time scale. This is markedly different from the EphA4 LBD, which shares 74% sequence identity and 87% homology. Consequently, the unbound EphA5 LBD appears to comprise an ensemble of open conformations that have only small variations over the loops and appear ready to bind ephrin-A ligands. These findings show how two proteins with high sequence homology and structural similarity are still able to achieve distinctive binding specificities through different dynamics, which may represent a general mechanism whereby the same protein fold can serve for different functions. Our findings also suggest that a promising strategy to design agonists/antagonists with high affinity and selectivity might be to target specific dynamic states of the Eph receptor LBDs. PMID:24086308

Structural insights into selective agonist actions of tamoxifen on human estrogen receptor alpha.

PubMed

Chakraborty, Sandipan; Biswas, Pradip Kumar

2014-08-01

Tamoxifen-an anti-estrogenic ligand in breast tissues used as a first-line treatment in estrogen receptor (ER)-positive breast cancers-is associated with the development of resistance followed by resumption of tumor growth in about 30 % of cases. Whether tamoxifen assists in proliferation in such cases or whether any ligand-independent pathway to transcription exists is not fully understood; also, no ERα mutants have been detected so far that could lead to tamoxifen resistance. Using in silico conformational analysis of the ERα ligand binding domain (LBD), in the absence and presence of selective agonist (diethylstilbestrol; DES), antagonist (Faslodex; ICI), and selective estrogen receptor modulator (SERM; 4-hydroxy tamoxifen; 4-OHT) ligands, we have elucidated ligand-responsive structural modulations of the ERα-LBD dimer in its agonist and antagonist complexes to address the issue of "tamoxifen resistance". DES and ICI were found to stabilize the dimer in their agonist and antagonist conformations, respectively. The ERα-LBD dimer without the presence of any bound ligand also led to a stable structure in agonist conformation. However, binding of 4-OHT to the antagonist structure led to a flexible conformation allowing the protein to visit conformations populated by agonists as was evident from principal component analysis and radius of gyration plots. Further, the relaxed conformations of the 4-OHT bound protein exhibited a diminished size of the co-repressor binding pocket in the LBD, thus signaling a partial blockage of the co-repressor binding motif. Thus, the ability of 4-OHT-bound ERα-LBD to assume flexible conformations visited by agonists and reduced co-repressor binding surface at the LBD provide crucial structural insights into tamoxifen-resistance that complement our existing understanding.

Binding interactions of halogenated bisphenol A with mouse PPARα: In vitro investigation and molecular dynamics simulation.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Guan, Tianzhu; Yu, Hansong; Li, Zhuolin; Wang, Yongzhi; Wang, Yongjun; Zhang, Tiehua

2018-02-01

The binding of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD) was examined by a combination of in vitro investigation and in silico simulation. Fluorescence polarization (FP) assay showed that halogenated BPAs could bind to mPPARα-LBD* as the affinity ligands. The calculated electrostatic potential (ESP) illustrated the different charge distributions of halogenated BPAs with altered halogenation patterns. As electron-attracting substituents, halogens decrease the positive electrostatic potential and thereby have a significant influence on the electrostatic interactions of halogenated BPAs with mPPARα-LBD*. The docking results elucidated that hydrophobic and hydrogen-bonding interactions may also contribute to stabilize the binding of the halogenated BPAs to their receptor molecule. Comparison of the calculated binding energies with the experimentally determined affinities yielded a good correlation (R 2 =0.6659) that could provide a rational basis for designing environmentally benign chemicals with reduced toxicities. This work can potentially be used for preliminary screening of halogenated BPAs. Copyright © 2017 Elsevier B.V. All rights reserved.

Structure, Dynamics, and Allosteric Potential of Ionotropic Glutamate Receptor N-Terminal Domains.

PubMed

Krieger, James; Bahar, Ivet; Greger, Ingo H

2015-09-15

Ionotropic glutamate receptors (iGluRs) are tetrameric cation channels that mediate synaptic transmission and plasticity. They have a unique modular architecture with four domains: the intracellular C-terminal domain (CTD) that is involved in synaptic targeting, the transmembrane domain (TMD) that forms the ion channel, the membrane-proximal ligand-binding domain (LBD) that binds agonists such as L-glutamate, and the distal N-terminal domain (NTD), whose function is the least clear. The extracellular portion, comprised of the LBD and NTD, is loosely arranged, mediating complex allosteric regulation and providing a rich target for drug development. Here, we briefly review recent work on iGluR NTD structure and dynamics, and further explore the allosteric potential for the NTD in AMPA-type iGluRs using coarse-grained simulations. We also investigate mechanisms underlying the established NTD allostery in NMDA-type iGluRs, as well as the fold-related metabotropic glutamate and GABAB receptors. We show that the clamshell motions intrinsically favored by the NTD bilobate fold are coupled to dimeric and higher-order rearrangements that impact the iGluR LBD and ultimately the TMD. Finally, we explore the dynamics of intact iGluRs and describe how it might affect receptor operation in a synaptic environment. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Doubling the Size of the Glucocorticoid Receptor Ligand Binding Pocket by Deacylcortivazol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suino-Powell, Kelly; Xu, Yong; Zhang, Chenghai

A common feature of nuclear receptor ligand binding domains (LBD) is a helical sandwich fold that nests a ligand binding pocket within the bottom half of the domain. Here we report that the ligand pocket of glucocorticoid receptor (GR) can be continuously extended into the top half of the LBD by binding to deacylcortivazol (DAC), an extremely potent glucocorticoid. It has been puzzling for decades why DAC, which contains a phenylpyrazole replacement at the conserved 3-ketone of steroid hormones that are normally required for activation of their cognate receptors, is a potent GR activator. The crystal structure of the GRmore » LBD bound to DAC and the fourth LXXLL motif of steroid receptor coactivator 1 reveals that the GR ligand binding pocket is expanded to a size of 1,070 {angstrom}{sup 3}, effectively doubling the size of the GR dexamethasone-binding pocket of 540 {angstrom}{sup 3} and yet leaving the structure of the coactivator binding site intact. DAC occupies only {approx}50% of the space of the pocket but makes intricate interactions with the receptor around the phenylpyrazole group that accounts for the high-affinity binding of DAC. The dramatic expansion of the DAC-binding pocket thus highlights the conformational adaptability of GR to ligand binding. The new structure also allows docking of various nonsteroidal ligands that cannot be fitted into the previous structures, thus providing a new rational template for drug discovery of steroidal and nonsteroidal glucocorticoids that can be specifically designed to reach the unoccupied space of the expanded pocket.« less

Thermodynamics and structural analysis of positive allosteric modulation of the ionotropic glutamate receptor GluA2.

PubMed

Krintel, Christian; Frydenvang, Karla; Olsen, Lars; Kristensen, Maria T; de Barrios, Oriol; Naur, Peter; Francotte, Pierre; Pirotte, Bernard; Gajhede, Michael; Kastrup, Jette S

2012-01-01

Positive allosteric modulators of the ionotropic glutamate receptor-2 (GluA2) are promising compounds for the treatment of cognitive disorders, e.g. Alzheimer's disease. These modulators bind within the dimer interface of the LBD (ligand-binding domain) and stabilize the agonist-bound conformation slowing receptor desensitization and/or deactivation. In the present study, we employ isothermal titration calorimetry to determine binding affinities and thermodynamic details of binding of modulators of GluA2. A mutant of the LBD of GluA2 (LBD-L483Y-N754S) that forms a stable dimer in solution was used. The potent GluA2 modulator BPAM-97 was used as a reference compound. Evidence that BPAM-97 binds in the same pocket as the well-known GluA2 modulator cyclothiazide was obtained from X-ray structures. The LBD-L483Y-N754S:BPAM-97 complex has a Kd of 5.6 μM (ΔH=-4.9 kcal/mol, -TΔS=-2.3 kcal/mol; where 1 kcal≈4.187 kJ). BPAM-97 was used in a displacement assay to determine a Kd of 0.46 mM (ΔH=-1.2 kcal/mol, -TΔS=-3.3 kcal/mol) for the LBD-L483Y-N754S:IDRA-21 complex. The major structural factors increasing the potency of BPAM-97 over IDRA-21 are the increased van der Waals contacts to, primarily, Met496 in GluA2 imposed by the ethyl substituent of BPAM-97. These results add important information on binding affinities and thermodynamic details, and provide a new tool in the development of drugs against cognitive disorders.

Stilbene Induced Inhibition of Androgen Receptor Dimerization: Implications for AR and ARΔLBD-Signalling in Human Prostate Cancer Cells

PubMed Central

Streicher, Wolfgang; Luedeke, Manuel; Azoitei, Anca; Zengerling, Friedemann; Herweg, Alexander; Genze, Felicitas; Schrader, Mark G.; Schrader, Andres J.; Cronauer, Marcus V.

2014-01-01

Background Advanced castration resistant prostate cancer (CRPC) is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR) variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD) are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. Methodology In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV) and (E)-4-(2, 6-Difluorostyryl)-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS) on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. Results The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. Conclusion RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors. PMID:24887556

Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

2007-07-01

The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

Estrogenicity of halogenated bisphenol A: in vitro and in silico investigations.

PubMed

Zhang, Jie; Li, Tiezhu; Wang, Tuoyi; Yuan, Cuiping; Zhong, Shuning; Guan, Tianzhu; Li, Zhuolin; Wang, Yongzhi; Yu, Hansong; Luo, Quan; Wang, Yongjun; Zhang, Tiehua

2018-03-01

The binding interactions of bisphenol A (BPA) and its halogenated derivatives (halogenated BPAs) to human estrogen receptor α ligand binding domain (hERα-LBD) was investigated using a combined in vitro and in silico approach. First, the recombinant hERα-LBD was prepared as a soluble protein in Escherichia coli BL21(DE3)pLysS. A native fluorescent phytoestrogen, coumestrol, was employed as tracer for the fluorescence polarization assay. The results of the in vitro binding assay showed that bisphenol compounds could bind to hERα-LBD as the affinity ligands. All the tested halogenated BPAs exhibited weaker receptor binding than BPA, which might be explained by the steric effect of substituents. Molecular docking studies elucidated that the halogenated BPAs adopted different conformations in the flexible hydrophobic ligand binding pocket (LBP), which is mainly dependent on their distinct halogenation patterns. The compounds with halogen substituents on the phenolic rings and on the bridging alkyl moiety acted as agonists and antagonists for hERα, respectively. Interestingly, all the compounds in the agonist conformation of hERα formed a hydrogen bond with His524, while the compounds in the antagonist conformation formed a hydrogen bond with Thr347. These docking results suggested a pivotal role of His524/Thr347 in maintaining the hERα structure in the biologically active agonist/antagonist conformation. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation, which might be applicable for the structure-based design of novel bisphenol compounds with reduced toxicities and for environmental risk assessment. In addition, based on hERα-LBD as a recognition element, the proposed fluorescence polarization assay may offer an alternative to chromatographic techniques for the multi-residue determination of bisphenol compounds.

Chemoenzymatic synthesis of new 2,4-syn-functionalized (S)-glutamate analogues and structure-activity relationship studies at ionotropic glutamate receptors and excitatory amino acid transporters.

PubMed

Assaf, Zeinab; Larsen, Anja P; Venskutonytė, Raminta; Han, Liwei; Abrahamsen, Bjarke; Nielsen, Birgitte; Gajhede, Michael; Kastrup, Jette S; Jensen, Anders A; Pickering, Darryl S; Frydenvang, Karla; Gefflaut, Thierry; Bunch, Lennart

2013-02-28

In the mammalian central nervous system, (S)-glutamate (Glu) is released from the presynaptic neuron where it activates a plethora of pre- and postsynaptic Glu receptors. The fast acting ionotropic Glu receptors (iGluRs) are ligand gated ion channels and are believed to be involved in a vast number of neurological functions such as memory and learning, synaptic plasticity, and motor function. The synthesis of 14 enantiopure 2,4-syn-Glu analogues 2b-p is accessed by a short and efficient chemoenzymatic approach starting from readily available cyclohexanone 3. Pharmacological characterization at the iGluRs and EAAT1-3 subtypes revealed analogue 2i as a selective GluK1 ligand with low nanomolar affinity. Two X-ray crystal structures of the key analogue 2i in the ligand-binding domain (LBD) of GluA2 and GluK3 were determined. Partial domain closure was seen in the GluA2-LBD complex with 2i comparable to that induced by kainate. In contrast, full domain closure was observed in the GluK3-LBD complex with 2i, similar to that of GluK3-LBD with glutamate bound.

Mutations of glucocorticoid receptor differentially affect AF2 domain activity in a steroid-selective manner to alter the potency and efficacy of gene induction and repression†

PubMed Central

Tao, Yong-guang; Xu, Yong; Xu, H. Eric; Simons, S. Stoney

2009-01-01

The transcriptional activity of steroid hormones is intimately associated with their structure. Deacylcortivazol (DAC) contains several features that were predicted to make it an inactive glucocorticoid. Nevertheless, gene induction and repression by complexes of glucocorticoid receptor (GR) with DAC occurs with greater potency (lower EC50) than, and equal efficacy (maximal activity, or Amax) to, the very active and smaller synthetic glucocorticoid dexamethasone (Dex). Guided by a recent x-ray structure of DAC bound to the GR ligand binding domain (LBD), we now report that several point mutants in the LBD have little effect on the binding of either agonist steroid. However, these same mutations dramatically alter the Amax and/or EC50 of exogenous and endogenous genes in a manner that depends on steroid structure. In some cases, Dex is no longer a full agonist. These properties appear to result from a preferential inactivation of the AF2 activation domain in the GR LBD of Dex-, but not DAC-, bound receptors. The Dex-bound receptors display normal binding to, but greatly reduced response to, the coactivator TIF2, thus indicating a defect in the transmission efficiency of GR-steroid complex information to the coactivator TIF2. In addition, all GR mutants that are active in gene induction with either Dex or DAC have greatly reduced activity in gene repression. This contrasts with the reports of GR mutations preferentially suppressing GR-mediated induction. The properties of these GR mutants in gene induction support the hypothesis that the Amax and EC50 of GR-controlled gene expression can be independently modified, indicate that the receptor can be modified to favor activity with a specific agonist steroid, and suggest that new ligands with suitable substituents may be able to affect the same LBD conformational changes and thereby broaden the therapeutic applications of glucocorticoid steroids PMID:18578507

Functional Validation of Heteromeric Kainate Receptor Models.

PubMed

Paramo, Teresa; Brown, Patricia M G E; Musgaard, Maria; Bowie, Derek; Biggin, Philip C

2017-11-21

Kainate receptors require the presence of external ions for gating. Most work thus far has been performed on homomeric GluK2 but, in vivo, kainate receptors are likely heterotetramers. Agonists bind to the ligand-binding domain (LBD) which is arranged as a dimer of dimers as exemplified in homomeric structures, but no high-resolution structure currently exists of heteromeric kainate receptors. In a full-length heterotetramer, the LBDs could potentially be arranged either as a GluK2 homomer alongside a GluK5 homomer or as two GluK2/K5 heterodimers. We have constructed models of the LBD dimers based on the GluK2 LBD crystal structures and investigated their stability with molecular dynamics simulations. We have then used the models to make predictions about the functional behavior of the full-length GluK2/K5 receptor, which we confirmed via electrophysiological recordings. A key prediction and observation is that lithium ions bind to the dimer interface of GluK2/K5 heteromers and slow their desensitization. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Inducible model for β-six-mediated site-specific recombination in mammalian cells

PubMed Central

Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio

2006-01-01

The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.)

PubMed Central

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W.; Hochholdinger, Frank

2012-01-01

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize. PMID:22527397

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.).

PubMed

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W; Hochholdinger, Frank

2012-06-05

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize.

Prediction of binding affinity and efficacy of thyroid hormone receptor ligands using QSAR and structure-based modeling methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Politi, Regina; Department of Environmental Sciences and Engineering, University of North Carolina, Chapel Hill, NC 27599; Rusyn, Ivan, E-mail: iir@unc.edu

2014-10-01

The thyroid hormone receptor (THR) is an important member of the nuclear receptor family that can be activated by endocrine disrupting chemicals (EDC). Quantitative Structure–Activity Relationship (QSAR) models have been developed to facilitate the prioritization of THR-mediated EDC for the experimental validation. The largest database of binding affinities available at the time of the study for ligand binding domain (LBD) of THRβ was assembled to generate both continuous and classification QSAR models with an external accuracy of R{sup 2} = 0.55 and CCR = 0.76, respectively. In addition, for the first time a QSAR model was developed to predict bindingmore » affinities of antagonists inhibiting the interaction of coactivators with the AF-2 domain of THRβ (R{sup 2} = 0.70). Furthermore, molecular docking studies were performed for a set of THRβ ligands (57 agonists and 15 antagonists of LBD, 210 antagonists of the AF-2 domain, supplemented by putative decoys/non-binders) using several THRβ structures retrieved from the Protein Data Bank. We found that two agonist-bound THRβ conformations could effectively discriminate their corresponding ligands from presumed non-binders. Moreover, one of the agonist conformations could discriminate agonists from antagonists. Finally, we have conducted virtual screening of a chemical library compiled by the EPA as part of the Tox21 program to identify potential THRβ-mediated EDCs using both QSAR models and docking. We concluded that the library is unlikely to have any EDC that would bind to the THRβ. Models developed in this study can be employed either to identify environmental chemicals interacting with the THR or, conversely, to eliminate the THR-mediated mechanism of action for chemicals of concern. - Highlights: • This is the largest curated dataset for ligand binding domain (LBD) of the THRβ. • We report the first QSAR model for antagonists of AF-2 domain of THRβ. • A combination of QSAR and docking enables prediction of both affinity and efficacy. • Models can be used to identify environmental chemicals interacting with THRβ. • Models can be used to eliminate the THRβ-mediated mechanism of action.« less

Identification of an allosteric binding site for RORγt inhibition

PubMed Central

Scheepstra, Marcel; Leysen, Seppe; van Almen, Geert C.; Miller, J. Richard; Piesvaux, Jennifer; Kutilek, Victoria; van Eenennaam, Hans; Zhang, Hongjun; Barr, Kenneth; Nagpal, Sunil; Soisson, Stephen M.; Kornienko, Maria; Wiley, Kristen; Elsen, Nathaniel; Sharma, Sujata; Correll, Craig C.; Trotter, B. Wesley; van der Stelt, Mario; Oubrie, Arthur; Ottmann, Christian; Parthasarathy, Gopal; Brunsveld, Luc

2015-01-01

RORγt is critical for the differentiation and proliferation of Th17 cells associated with several chronic autoimmune diseases. We report the discovery of a novel allosteric binding site on the nuclear receptor RORγt. Co-crystallization of the ligand binding domain (LBD) of RORγt with a series of small-molecule antagonists demonstrates occupancy of a previously unreported allosteric binding pocket. Binding at this non-canonical site induces an unprecedented conformational reorientation of helix 12 in the RORγt LBD, which blocks cofactor binding. The functional consequence of this allosteric ligand-mediated conformation is inhibition of function as evidenced by both biochemical and cellular studies. RORγt function is thus antagonized in a manner molecularly distinct from that of previously described orthosteric RORγt ligands. This brings forward an approach to target RORγt for the treatment of Th17-mediated autoimmune diseases. The elucidation of an unprecedented modality of pharmacological antagonism establishes a mechanism for modulation of nuclear receptors. PMID:26640126

Identification of boric acid as a novel chemoattractant and elucidation of its chemoreceptor in Ralstonia pseudosolanacearum Ps29.

PubMed

Hida, Akiko; Oku, Shota; Nakashimada, Yutaka; Tajima, Takahisa; Kato, Junichi

2017-08-17

Chemotaxis enables bacteria to move toward more favorable environmental conditions. We observed chemotaxis toward boric acid by Ralstonia pseudosolanacearum Ps29. At higher concentrations, the chemotactic response of R. pseudosolanacearum toward boric acid was comparable to or higher than that toward L-malate, indicating that boric acid is a strong attractant for R. pseudosolanacearum. Chemotaxis assays under different pH conditions suggested that R. pseudosolanacearum recognizes B(OH) 3 (or B(OH 3 ) + B(OH) 4 - ) but not B(OH) 4 - alone. Our previous study revealed that R. pseudosolanacearum Ps29 harbors homologs of all 22R. pseudosolanacearum GMI1000 mcp genes. Screening of 22 mcp single-deletion mutants identified the RS_RS17100 homolog as the boric acid chemoreceptor, which was designated McpB. The McpB ligand-binding domain (LBD) was purified in order to characterize its binding to boric acid. Using isothermal titration calorimetry, we demonstrated that boric acid binds directly to the McpB LBD with a K D (dissociation constant) of 5.4 µM. Analytical ultracentrifugation studies revealed that the McpB LBD is present as a dimer that recognizes one boric acid molecule.

Identification of a novel K311 ubiquitination site critical for androgen receptor transcriptional activity

PubMed Central

Cork, David M.W.; Darby, Steven; Ryan-Munden, Claudia A.; Nakjang, Sirintra; Mendes Côrtes, Leticia; Treumann, Achim; Gaughan, Luke

2017-01-01

Abstract The androgen receptor (AR) is the main driver of prostate cancer (PC) development and progression, and the primary therapeutic target in PC. To date, two functional ubiquitination sites have been identified on AR, both located in its C-terminal ligand binding domain (LBD). Recent reports highlight the emergence of AR splice variants lacking the LBD that can arise during disease progression and contribute to castrate resistance. Here, we report a novel N-terminal ubiquitination site at lysine 311. Ubiquitination of this site plays a role in AR stability and is critical for its transcriptional activity. Inactivation of this site causes AR to accumulate on chromatin and inactivates its transcriptional function as a consequence of inability to bind to p300. Additionally, mutation at lysine 311 affects cellular transcriptome altering the expression of genes involved in chromatin organization, signaling, adhesion, motility, development and metabolism. Even though this site is present in clinically relevant AR-variants it can only be ubiquitinated in cells when AR retains LBD suggesting a role for AR C-terminus in E2/E3 substrate recognition. We report that as a consequence AR variants lacking the LBD cannot be ubiquitinated in the cellular environment and their protein turnover must be regulated via an alternate pathway. PMID:27903893

ESR1 ligand binding domain mutations in hormone-resistant breast cancer

PubMed Central

Toy, Weiyi; Shen, Yang; Won, Helen; Green, Bradley; Sakr, Rita A.; Will, Marie; Li, Zhiqiang; Gala, Kinisha; Fanning, Sean; King, Tari A.; Hudis, Clifford; Chen, David; Taran, Tetiana; Hortobagyi, Gabriel; Greene, Geoffrey; Berger, Michael; Baselga, Jose; Chandarlapaty, Sarat

2013-01-01

Seventy percent of breast cancers express estrogen receptor (ER) and most of these are sensitive to ER inhibition. However, many such tumors become refractory to inhibition of estrogen action in the metastatic setting for unknown reasons. We conducted a comprehensive genetic analysis of two independent cohorts of metastatic ER+ breast tumors and identified mutations in the ligand binding domain (LBD) of ESR1 in 14/80 cases. These included highly recurrent mutations p.Tyr537Ser/Asn and p.Asp538Gly. Molecular dynamics simulations suggest the Tyr537Ser and Asp538Gly structures lead to hydrogen bonding of the mutant amino acid with Asp351, thus favoring the receptor’s agonist conformation. Consistent with this model, mutant receptors drive ER-dependent transcription and proliferation in the absence of hormone and reduce the efficacy of ER antagonists. These data implicate LBD mutant forms of ER in mediating clinical resistance to hormonal therapy and suggest that more potent ER antagonists may have significant therapeutic benefit. PMID:24185512

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels

PubMed Central

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L.

2014-01-01

SUMMARY AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine and phenylalanine which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate and serine. AvGluR1 LBD crystal structures reveal a novel scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, while in the alanine, methionine and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl− lowers affinity for these ligands, but not for glutamate, aspartate or for phenylalanine which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure based studies on iGluR-ligand interactions. PMID:23434404

Presence of a deletion mutation (c.716delA) in the ligand binding domain of the vitamin D receptor in an Indian patient with vitamin D-dependent rickets type II.

PubMed

Kanakamani, Jeyaraman; Tomar, Neeraj; Kaushal, Esha; Tandon, Nikhil; Goswami, Ravinder

2010-01-01

Vitamin D-dependent rickets type II (VDDR-type II) is a rare disorder caused by mutations in the vitamin D receptor (VDR) gene. Here, we describe a patient with VDDR-type II with severe alopecia and rickets. She had hypocalcemia, hypophosphatemia, secondary hyperparathyroidism, and elevated serum alkaline phosphatase and 1,25-dihydroxyvitamin D(3). Sequence analysis of the lymphocyte VDR cDNA revealed deletion mutation c.716delA. Sequence analysis of her genomic DNA fragment amplified from exon 6 of the VDR gene incorporating this mutation confirmed the presence of the mutation in homozygous form. This frameshift mutation in the ligand binding domain (LBD) resulted in premature termination (p.Lys240Argfs) of the VDR protein. The mutant protein contained 246 amino acids, with 239 normal amino acids at the N terminus, followed by seven changed amino acids resulting in complete loss of its LBD. The mutant VDR protein showed evidence of 50% reduced binding with VDR response elements on electrophoretic mobility assay in comparison to the wild-type VDR protein. She was treated with high-dose calcium infusion and oral phosphate. After 18 months of treatment, she gained 6 cm of height, serum calcium and phosphorus improved, alkaline phosphatase levels decreased, and intact PTH normalized. Radiologically, there were signs of healing of rickets. Her parents and one of her siblings had the same c.716delA mutation in heterozygous form. Despite the complete absence of LBD, the rickets showed signs of healing with intravenous calcium.

A Genome-Wide Analysis of the LBD (LATERAL ORGAN BOUNDARIES Domain) Gene Family in Malus domestica with a Functional Characterization of MdLBD11

PubMed Central

Su, Ling; Liu, Xin; Hao, Yujin

2013-01-01

The plant-specific LBD (LATERAL ORGAN BOUNDARIES domain) genes belong to a major family of transcription factor that encode a zinc finger-like domain. It has been shown that LBD genes play crucial roles in the growth and development of Arabidopsis and other plant species. However, no detailed information concerning this family is available for apple. In the present study, we analyzed the apple (Malus domestica) genome and identified 58 LBD genes. This gene family was tested for its phylogenetic relationships with homologous genes in the Arabidopsis genome, as well as its location in the genome, structure and expression. We also transformed one MdLBD gene into Arabidopsis to evaluate its function. Like Arabidopsis, apple LBD genes also have a conserved CX2CX6CX3C zinc finger-like domain in the N terminus and can be divided into two classes. The expression profile indicated that apple LBD genes exhibited a variety of expression patterns, suggesting that they have diverse functions. At the same time, the expression analysis implied that members of this apple gene family were responsive to hormones and stress and that they may participate in hormone-mediated plant organogenesis, which was demonstrated with the overexpression of the apple LBD gene MdLBD11, resulting in an abnormal phenotype. This phenotype included upward curling leaves, delayed flowering, downward-pointing flowers, siliques and other abnormal traits. Based on these data, we concluded that the MdLBD genes may play an important role in apple growth and development as in Arabidopsis and other species. PMID:23468909

A genome-wide analysis of the LBD (LATERAL ORGAN BOUNDARIES domain) gene family in Malus domestica with a functional characterization of MdLBD11.

PubMed

Wang, Xiaofei; Zhang, Shizhong; Su, Ling; Liu, Xin; Hao, Yujin

2013-01-01

The plant-specific LBD (LATERAL ORGAN BOUNDARIES domain) genes belong to a major family of transcription factor that encode a zinc finger-like domain. It has been shown that LBD genes play crucial roles in the growth and development of Arabidopsis and other plant species. However, no detailed information concerning this family is available for apple. In the present study, we analyzed the apple (Malus domestica) genome and identified 58 LBD genes. This gene family was tested for its phylogenetic relationships with homologous genes in the Arabidopsis genome, as well as its location in the genome, structure and expression. We also transformed one MdLBD gene into Arabidopsis to evaluate its function. Like Arabidopsis, apple LBD genes also have a conserved CX2CX6CX3C zinc finger-like domain in the N terminus and can be divided into two classes. The expression profile indicated that apple LBD genes exhibited a variety of expression patterns, suggesting that they have diverse functions. At the same time, the expression analysis implied that members of this apple gene family were responsive to hormones and stress and that they may participate in hormone-mediated plant organogenesis, which was demonstrated with the overexpression of the apple LBD gene MdLBD11, resulting in an abnormal phenotype. This phenotype included upward curling leaves, delayed flowering, downward-pointing flowers, siliques and other abnormal traits. Based on these data, we concluded that the MdLBD genes may play an important role in apple growth and development as in Arabidopsis and other species.

Biosensors Paving the Way to Understanding the Interaction between Cadmium and the Estrogen Receptor Alpha

PubMed Central

Fechner, Peter; Damdimopoulou, Pauliina; Gauglitz, Günter

2011-01-01

Cadmium is a toxic heavy metal ubiquitously present in the environment and subsequently in the human diet. Cadmium has been proposed to disrupt the endocrine system, targeting in particular the estrogen signaling pathway already at environmentally relevant concentrations. Thus far, the reports on the binding affinity of cadmium towards human estrogen receptor alpha (hERα) have been contradicting, as have been the reports on the in vivo estrogenicity of cadmium. Hence, the mode of interaction between cadmium and the receptor remains unclear. Here, we investigated the interaction between cadmium and hERα on a molecular level by applying a novel, label-free biosensor technique based on reflectometric interference spectroscopy (RIfS). We studied the binding of cadmium to hERα, and the conformation of the receptor following cadmium treatment. Our data reveals that cadmium interacts with the ligand binding domain (LBD) of the ERα and affects the conformation of the receptor. However, the binding event, as well as the induced conformation change, greatly depends on the accessibility of the cysteine tails in the LBD. As the LBD cysteine residues have been reported as targets of post-translational modifications in vivo, we present a hypothesis according to which different cellular pools of ERα respond to cadmium differently. Our proposed theory could help to explain some of the previously contradicting results regarding estrogen-like activity of cadmium. PMID:21829690

Mechanistic Insights into Xenon Inhibition of NMDA Receptors from MD Simulations

PubMed Central

Liu, Lu Tian; Xu, Yan; Tang, Pei

2010-01-01

Inhibition of N-methyl-D-aspartate (NMDA) receptors has been viewed as a primary cause of xenon anesthesia, yet the mechanism is unclear. Here, we investigated interactions between xenon and the ligand-binding domain (LBD) of a NMDA receptor and examined xenon-induced structural and dynamical changes that are relevant to functional changes of the NMDA receptor. Several comparative molecular dynamics simulations were performed on two X-ray structures representing the open- and closed-cleft LBD of the NMDA receptor. We identified plausible xenon action sites in the LBD, including those nearby agonist sites, in the hinge region, and at the interface between two subunits. The xenon binding energy varies from −5.3 to −0.7 kcal/mol. Xenon's effect on the NMDA receptor is conformation-dependent and is produced through both competitive and non-competitive mechanisms. Xenon can promote cleft opening in the absence of agonists and consequently stabilizes the closed channel. Xenon can also bind at the interface of two subunits, alter the inter-subunit interaction, and lead to a reduction of the distance between GT-links. This reduction corresponds to a rearrangement of the channel toward a direction of pore size decreasing, implying a closed or desensitized channel. In addition to these non-competitive actions, xenon was found to weaken the glutamate binding, which could lead to low agonist efficacy and appear as competitive inhibition. PMID:20560662

Ligand-specific Deactivation Time Course of GluN1/GluN2D NMDA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

K Vance; N Simorowski; S Traynelis

2011-12-31

N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors that mediate a majority of excitatory synaptic transmission. One unique property of GluN1/GluN2D NMDA receptors is an unusually prolonged deactivation time course following the removal of L-glutamate. Here we show, using x-ray crystallography and electrophysiology, that the deactivation time course of GluN1/GluN2D receptors is influenced by the conformational variability of the ligand-binding domain (LBD) as well as the structure of the activating ligand. L-glutamate and L-CCG-IV induce significantly slower deactivation time courses compared with other agonists. Crystal structures of the isolated GluN2D LBD in complex with various ligands revealmore » that the binding of L-glutamate induces a unique conformation at the backside of the ligand-binding site in proximity to the region at which the transmembrane domain would be located in the intact receptors. These data suggest that the activity of the GluN1/GluN2D NMDA receptor is controlled distinctively by the endogenous neurotransmitter L-glutamate.« less

Functional regeneration of the transected recurrent laryngeal nerve using a collagen scaffold loaded with laminin and laminin-binding BDNF and GDNF

PubMed Central

Wang, Baoxin; Yuan, Junjie; Chen, Xinwei; Xu, Jiafeng; Li, Yu; Dong, Pin

2016-01-01

Recurrent laryngeal nerve (RLN) injury remains a challenge due to the lack of effective treatments. In this study, we established a new drug delivery system consisting of a tube of Heal-All Oral Cavity Repair Membrane loaded with laminin and neurotrophic factors and tested its ability to promote functional recovery following RLN injury. We created recombinant fusion proteins consisting of brain-derived neurotrophic factor (BDNF) and glial cell line-derived neurotrophic factor (GDNF) fused to laminin-binding domains (LBDs) in order to prevent neurotrophin diffusion. LBD-BDNF, LBD-GDNF, and laminin were injected into a collagen tube that was fitted to the ends of the transected RLN in rats. Functional recovery was assessed 4, 8, and 12 weeks after injury. Although vocal fold movement was not restored until 12 weeks after injury, animals treated with the collagen tube loaded with laminin, LBD-BDNF and LBD-GDNF showed improved recovery in vocalisation, arytenoid cartilage angles, compound muscle action potentials and regenerated fibre area compared to animals treated by autologous nerve grafting (p < 0.05). These results demonstrate the drug delivery system induced nerve regeneration following RLN transection that was superior to that induced by autologus nerve grafting. It may have potential applications in nerve regeneration of RLN transection injury. PMID:27558932

Structural Diversity of Ligand-Binding Androgen Receptors Revealed by Microsecond Long Molecular Dynamics Simulations and Enhanced Sampling.

PubMed

Duan, Mojie; Liu, Na; Zhou, Wenfang; Li, Dan; Yang, Minghui; Hou, Tingjun

2016-09-13

Androgen receptor (AR) plays important roles in the development of prostate cancer (PCa). The antagonistic drugs, which suppress the activity of AR, are widely used in the treatment of PCa. However, the molecular mechanism of antagonism about how ligands affect the structures of AR remains elusive. To better understand the conformational variability of ARs bound with agonists or antagonists, we performed long time unbiased molecular dynamics (MD) simulations and enhanced sampling simulations for the ligand binding domain of AR (AR-LBD) in complex with various ligands. Based on the simulation results, we proposed an allosteric pathway linking ligands and helix 12 (H12) of AR-LBD, which involves the interactions among the ligands and the residues W741, H874, and I899. The interaction pathway provides an atomistic explanation of how ligands affect the structure of AR-LBD. A repositioning of H12 was observed, but it is facilitated by the C-terminal of H12, instead of by the loop between helix 11 (H11) and H12. The bias-exchange metadynamics simulations further demonstrated the above observations. More importantly, the free energy profiles constructed by the enhanced sampling simulations revealed the transition process between the antagonistic form and agonistic form of AR-LBD. Our results would be helpful for the design of more efficient antagonists of AR to combat PCa.

Medium Chain Fatty Acids Are Selective Peroxisome Proliferator Activated Receptor (PPAR) γ Activators and Pan-PPAR Partial Agonists

PubMed Central

Ayers, Steven D.; Lin, Jean Z.; Cvoro, Aleksandra; Silveira, Rodrigo L.; Martínez, Leandro; Souza, Paulo C. T.; Saidemberg, Daniel; Deng, Tuo; Amato, Angela Angelica; Togashi, Marie; Hsueh, Willa A.; Phillips, Kevin; Palma, Mário Sérgio; Neves, Francisco A. R.; Skaf, Munir S.; Webb, Paul; Polikarpov, Igor

2012-01-01

Thiazolidinediones (TZDs) act through peroxisome proliferator activated receptor (PPAR) γ to increase insulin sensitivity in type 2 diabetes (T2DM), but deleterious effects of these ligands mean that selective modulators with improved clinical profiles are needed. We obtained a crystal structure of PPARγ ligand binding domain (LBD) and found that the ligand binding pocket (LBP) is occupied by bacterial medium chain fatty acids (MCFAs). We verified that MCFAs (C8–C10) bind the PPARγ LBD in vitro and showed that they are low-potency partial agonists that display assay-specific actions relative to TZDs; they act as very weak partial agonists in transfections with PPARγ LBD, stronger partial agonists with full length PPARγ and exhibit full blockade of PPARγ phosphorylation by cyclin-dependent kinase 5 (cdk5), linked to reversal of adipose tissue insulin resistance. MCFAs that bind PPARγ also antagonize TZD-dependent adipogenesis in vitro. X-ray structure B-factor analysis and molecular dynamics (MD) simulations suggest that MCFAs weakly stabilize C-terminal activation helix (H) 12 relative to TZDs and this effect is highly dependent on chain length. By contrast, MCFAs preferentially stabilize the H2-H3/β-sheet region and the helix (H) 11-H12 loop relative to TZDs and we propose that MCFA assay-specific actions are linked to their unique binding mode and suggest that it may be possible to identify selective PPARγ modulators with useful clinical profiles among natural products. PMID:22649490

Medium chain fatty acids are selective peroxisome proliferator activated receptor (PPAR) γ activators and pan-PPAR partial agonists.

PubMed

Liberato, Marcelo Vizoná; Nascimento, Alessandro S; Ayers, Steven D; Lin, Jean Z; Cvoro, Aleksandra; Silveira, Rodrigo L; Martínez, Leandro; Souza, Paulo C T; Saidemberg, Daniel; Deng, Tuo; Amato, Angela Angelica; Togashi, Marie; Hsueh, Willa A; Phillips, Kevin; Palma, Mário Sérgio; Neves, Francisco A R; Skaf, Munir S; Webb, Paul; Polikarpov, Igor

2012-01-01

Thiazolidinediones (TZDs) act through peroxisome proliferator activated receptor (PPAR) γ to increase insulin sensitivity in type 2 diabetes (T2DM), but deleterious effects of these ligands mean that selective modulators with improved clinical profiles are needed. We obtained a crystal structure of PPARγ ligand binding domain (LBD) and found that the ligand binding pocket (LBP) is occupied by bacterial medium chain fatty acids (MCFAs). We verified that MCFAs (C8-C10) bind the PPARγ LBD in vitro and showed that they are low-potency partial agonists that display assay-specific actions relative to TZDs; they act as very weak partial agonists in transfections with PPARγ LBD, stronger partial agonists with full length PPARγ and exhibit full blockade of PPARγ phosphorylation by cyclin-dependent kinase 5 (cdk5), linked to reversal of adipose tissue insulin resistance. MCFAs that bind PPARγ also antagonize TZD-dependent adipogenesis in vitro. X-ray structure B-factor analysis and molecular dynamics (MD) simulations suggest that MCFAs weakly stabilize C-terminal activation helix (H) 12 relative to TZDs and this effect is highly dependent on chain length. By contrast, MCFAs preferentially stabilize the H2-H3/β-sheet region and the helix (H) 11-H12 loop relative to TZDs and we propose that MCFA assay-specific actions are linked to their unique binding mode and suggest that it may be possible to identify selective PPARγ modulators with useful clinical profiles among natural products.

The Lateral Organ Boundaries Domain Transcription Factor LBD20 Functions in Fusarium Wilt Susceptibility and Jasmonate Signaling in Arabidopsis1[W

PubMed Central

Thatcher, Louise F.; Powell, Jonathan J.; Aitken, Elizabeth A.B.; Kazan, Kemal; Manners, John M.

2012-01-01

The LATERAL ORGAN BOUNDARIES (LOB) DOMAIN (LBD) gene family encodes plant-specific transcriptional regulators functioning in organ development. In a screen of Arabidopsis (Arabidopsis thaliana) sequence-indexed transferred DNA insertion mutants, we found disruption of the LOB DOMAIN-CONTAINING PROTEIN20 (LBD20) gene led to increased resistance to the root-infecting vascular wilt pathogen Fusarium oxysporum. In wild-type plants, LBD20 transcripts were barely detectable in leaves but abundant in roots, where they were further induced after F. oxysporum inoculation or methyl jasmonate treatment. Induction of LBD20 expression in roots was abolished in coronatine insensitive1 (coi1) and myc2 (allelic to jasmonate insensitive1) mutants, suggesting LBD20 may function in jasmonate (JA) signaling. Consistent with this, expression of the JA-regulated THIONIN2.1 (Thi2.1) and VEGETATIVE STORAGE PROTEIN2 (VSP2) genes were up-regulated in shoots of lbd20 following treatment of roots with F. oxysporum or methyl jasmonate. However, PLANT DEFENSIN1.2 expression was unaltered, indicating a repressor role for LBD20 in a branch of the JA-signaling pathway. Plants overexpressing LBD20 (LBD20-OX) had reduced Thi2.1 and VSP2 expression. There was a significant correlation between increased LBD20 expression in the LBD20-OX lines with both Thi2.1 and VSP2 repression, and reduced survival following F. oxysporum infection. Chlorosis resulting from application of F. oxysporum culture filtrate was also reduced in lbd20 leaves relative to the wild type. Taken together, LBD20 is a F. oxysporum susceptibility gene that appears to regulate components of JA signaling downstream of COI1 and MYC2 that are required for full elicitation of F. oxysporum- and JA-dependent responses. To our knowledge, this is the first demonstration of a role for a LBD gene family member in either biotic stress or JA signaling. PMID:22786889

Efficient stable isotope labeling and purification of vitamin D receptor from inclusion bodies

PubMed Central

Zhu, Jinge; Rao, Hongyu; Tonelli, Marco; Westler, Milo; Singarapu, Kiran K.; Markley, John L.; DeLuca, Hector F.; Assadi-Porter, Fariba M.

2012-01-01

Vitamin D receptor (VDR) plays a crucial role in many cellular processes including calcium and phosphate homeostasis. Previous purification methods from prokaryotic and eukaryotic expression systems were challenged by low protein solubility accompanied by multi purification steps resulting in poor protein recovery. The full-length VDR and its ligand binding domain (LBD) were mostly (>90%) insoluble even when expressed at low temperatures in the bacterial system. We describe a one-step procedure that results in the purification of rat VDR and LBD proteins in high-yield from E. coli inclusion bodies. The heterologously expressed protein constructs retain full function as demonstrated by ligand binding and DNA binding assays. Furthermore, we describe an efficient strategy for labeling these proteins with, 13C, and 15N for structural and functional studies by nuclear magnetic resonance (NMR) spectroscopy. This efficient production system will facilitate future studies on the mechanism of vitamin D action including characterization of the large number of synthetic vitamin D analogs that have been developed. PMID:22750673

Anions mediate ligand binding in Adineta vaga glutamate receptor ion channels.

PubMed

Lomash, Suvendu; Chittori, Sagar; Brown, Patrick; Mayer, Mark L

2013-03-05

AvGluR1, a glutamate receptor ion channel from the primitive eukaryote Adineta vaga, is activated by alanine, cysteine, methionine, and phenylalanine, which produce lectin-sensitive desensitizing responses like those to glutamate, aspartate, and serine. AvGluR1 LBD crystal structures reveal an unusual scheme for binding dissimilar ligands that may be utilized by distantly related odorant/chemosensory receptors. Arginine residues in domain 2 coordinate the γ-carboxyl group of glutamate, whereas in the alanine, methionine, and serine complexes a chloride ion acts as a surrogate ligand, replacing the γ-carboxyl group. Removal of Cl(-) lowers affinity for these ligands but not for glutamate or aspartate nor for phenylalanine, which occludes the anion binding site and binds with low affinity. AvGluR1 LBD crystal structures and sedimentation analysis also provide insights into the evolutionary link between prokaryotic and eukaryotic iGluRs and reveal features unique to both classes, emphasizing the need for additional structure-based studies on iGluR-ligand interactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Conformational stability and thermodynamic characterization of the lipoic acid bearing domain of human mitochondrial branched chain α-ketoacid dehydrogenase

PubMed Central

Naik, Mandar T.; Huang, Tai-Huang

2004-01-01

The lipoic acid bearing domain (hbLBD) of human mitochondrial branched chain α-ketoacid dehydrogenase (BCKD) plays important role of substrate channeling in oxidative decarboxylation of the branched chain α-ketoacids. Recently hbLBD has been found to follow two-step folding mechanism without detectable presence of stable or kinetic intermediates. The present study describes the conformational stability underlying the folding of this small β-barrel domain. Thermal denaturation in presence of urea and isothermal urea denaturation titrations are used to evaluate various thermodynamic parameters defining the equilibrium unfolding. The linear extrapolation model successfully describes the two-step; native state ↔denatured state unfolding transition of hbLBD. The average temperature of maximum stability of hbLBD is estimated as 295.6 ± 0.9 K. Cold denaturation of hbLBD is also predicted and discussed. PMID:15322287

Molecular basis for repression of liver X receptor-mediated gene transcription by receptor-interacting protein 140

PubMed Central

Jakobsson, Tomas; Osman, Waffa; Gustafsson, Jan-Åke; Zilliacus, Johanna; Wärnmark, Anette

2007-01-01

Similarities in physiological roles of LXR (liver X receptors) and co-repressor RIP140 (receptor-interacting protein 140) in regulating energy homoeostasis and lipid and glucose metabolism suggest that the effects of LXR could at least partly be mediated by recruitment of the co-repressor RIP140. In the present study, we have elucidated the molecular basis for regulation of LXR transcriptional activity by RIP140. LXR is evenly localized in the nucleus and neither the N-terminal domain nor the LBD (ligand-binding domain) is necessary for nuclear localization. Both LXR subtypes, LXRα and LXRβ, interact with RIP140 and co-localize in diffuse large nuclear domains. Interaction and co-localization are dependent on the LBD of the receptor. The C-terminal domain of RIP140 is sufficient for full repressive effect. None of the C-terminal NR (nuclear receptor)-boxes is required for the co-repressor activity, whereas the NR-box-like motif as well as additional elements in the C-terminal region are required for full repressive function. The C-terminal NR-box-like motif is necessary for interaction with LXRβ, whereas additional elements are needed for strong interaction with LXRα. In conclusion, our results suggest that co-repression of LXR activity by RIP140 involves an atypical binding mode of RIP140 and a repression element in the RIP140 C-terminus. PMID:17391100

The quaternary architecture of RARβ–RXRα heterodimer facilitates domain–domain signal transmission

DOE PAGES

Chandra, Vikas; Wu, Dalei; Li, Sheng; ...

2017-10-11

Assessing the physical connections and allosteric communications in multi-domain nuclear receptor (NR) polypeptides has remained challenging, with few crystal structures available to show their overall structural organizations. Here we report the quaternary architecture of multi-domain retinoic acid receptor beta-retinoic X receptor alpha (RAR beta-RXR alpha) heterodimer bound to DNA, ligands and coactivator peptides, examined through crystallographic, hydrogen-deuterium exchange mass spectrometry, mutagenesis and functional studies. The RAR beta ligand-binding domain (LBD) and DNA-binding domain (DBD) are physically connected to foster allosteric signal transmission between them. Direct comparisons among all the multi-domain NRs studied crystallographically to date show significant variations within theirmore » quaternary architectures, rather than a common architecture adhering to strict rules. RXR remains flexible and adaptive by maintaining loosely organized domains, while its hetero-dimerization partners use a surface patch on their LBDs to form domain-domain interactions with DBDs.« less

The quaternary architecture of RARβ–RXRα heterodimer facilitates domain–domain signal transmission

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Vikas; Wu, Dalei; Li, Sheng

Assessing the physical connections and allosteric communications in multi-domain nuclear receptor (NR) polypeptides has remained challenging, with few crystal structures available to show their overall structural organizations. Here we report the quaternary architecture of multi-domain retinoic acid receptor beta-retinoic X receptor alpha (RAR beta-RXR alpha) heterodimer bound to DNA, ligands and coactivator peptides, examined through crystallographic, hydrogen-deuterium exchange mass spectrometry, mutagenesis and functional studies. The RAR beta ligand-binding domain (LBD) and DNA-binding domain (DBD) are physically connected to foster allosteric signal transmission between them. Direct comparisons among all the multi-domain NRs studied crystallographically to date show significant variations within theirmore » quaternary architectures, rather than a common architecture adhering to strict rules. RXR remains flexible and adaptive by maintaining loosely organized domains, while its hetero-dimerization partners use a surface patch on their LBDs to form domain-domain interactions with DBDs.« less

Prediction of binding affinity and efficacy of thyroid hormone receptor ligands using QSAR and structure based modeling methods

PubMed Central

Politi, Regina; Rusyn, Ivan; Tropsha, Alexander

2016-01-01

The thyroid hormone receptor (THR) is an important member of the nuclear receptor family that can be activated by endocrine disrupting chemicals (EDC). Quantitative Structure-Activity Relationship (QSAR) models have been developed to facilitate the prioritization of THR-mediated EDC for the experimental validation. The largest database of binding affinities available at the time of the study for ligand binding domain (LBD) of THRβ was assembled to generate both continuous and classification QSAR models with an external accuracy of R2=0.55 and CCR=0.76, respectively. In addition, for the first time a QSAR model was developed to predict binding affinities of antagonists inhibiting the interaction of coactivators with the AF-2 domain of THRβ (R2=0.70). Furthermore, molecular docking studies were performed for a set of THRβ ligands (57 agonists and 15 antagonists of LBD, 210 antagonists of the AF-2 domain, supplemented by putative decoys/non-binders) using several THRβ structures retrieved from the Protein Data Bank. We found that two agonist-bound THRβ conformations could effectively discriminate their corresponding ligands from presumed non-binders. Moreover, one of the agonist conformations could discriminate agonists from antagonists. Finally, we have conducted virtual screening of a chemical library compiled by the EPA as part of the Tox21 program to identify potential THRβ-mediated EDCs using both QSAR models and docking. We concluded that the library is unlikely to have any EDC that would bind to the THRβ. Models developed in this study can be employed either to identify environmental chemicals interacting with the THR or, conversely, to eliminate the THR-mediated mechanism of action for chemicals of concern. PMID:25058446

Identification of the Ah-Receptor Structural Determinants for Ligand Preferences

PubMed Central

Xing, Yongna

2012-01-01

The aryl hydrocarbon receptor (AHR) is a transcription factor that responds to diverse ligands and plays a critical role in toxicology, immune function, and cardiovascular physiology. The structural basis of the AHR for ligand promiscuity and preferences is critical for understanding AHR function. Based on the structure of a closely related protein HIF2α, we modeled the AHR ligand binding domain (LBD) bound to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and benzo(a)pyrene (BaP) and identified residues that control ligand preferences by shape and H-bond potential. Mutations to these residues, particularly Q377 and G298, resulted in robust and opposite changes in the potency of TCDD and BaP and up to a 20-fold change in the ratio of TCDD/BaP efficacy. The model also revealed a flexible “belt” structure; molecular dynamic (MD) simulation suggested that the “belt” and several other structural elements in the AHR-LBD are more flexible than HIF2α and likely contribute to ligand promiscuity. Molecular docking of TCDD congeners to a model of human AHR-LBD ranks their binding affinity similar to experimental ranking of their toxicity. Our study reveals key structural basis for prediction of toxicity and understanding the AHR signaling through diverse ligands. PMID:22659362

Enhancing action of positive allosteric modulators through the design of dimeric compounds.

PubMed

Drapier, Thomas; Geubelle, Pierre; Bouckaert, Charlotte; Nielsen, Lise; Laulumaa, Saara; Goffin, Eric; Dilly, Sébastien; Francotte, Pierre; Hanson, Julien; Pochet, Lionel; Kastrup, Jette Sandholm; Pirotte, Bernard

2018-05-18

The present study describes the identification of highly potent dimeric 1,2,4-benzothiadiazine 1,1-dioxide (BTD)-type positive allosteric modulators of the AMPA receptors (AMPApams) obtained by linking two monomeric BTD scaffolds through their respective 6-positions. Using previous X-ray data from monomeric BTDs co-crystallized with the GluA2o ligand-binding domain (LBD), a molecular modeling approach was performed to predict the preferred dimeric combinations. Two 6,6-ethylene-linked dimeric BTD compounds (16 and 22) were prepared and evaluated as AMPApams on HEK293 cells expressing GluA2o(Q) (calcium flux experiment). These compounds were found to be about 10,000 times more potent than their respective monomers, the most active dimeric compound being the bis-4-cyclopropyl-substituted compound 22 [6,6'-(ethane-1,2-diyl)bis(4-cyclopropyl-3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxide], with an EC50 value of 1.4 nM. As a proof of concept, the bis-4-methyl-substituted dimeric compound 16 (EC50 = 13 nM) was successfully co-crystallized with the GluA2o-LBD and was found to occupy the two BTD binding sites at the LBD dimer interface.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

Effect of laminin-binding BDNF on induction of recurrent laryngeal nerve regeneration by miR-222 activation of mTOR signal pathway.

PubMed

Xie, Jin; Jin, Bin; Li, Da-Wei; Shen, Bin; Gong, Ning; Zhang, Tian-Zhen; Dong, Pin

2015-01-01

Recurrent laryngeal nerve injury is a common severe complication in neck surgery, which can cause varying degrees of vocal fold paralysis and respiratory tract problems. In present study, the effects of laminin-binding brain derived neurotrophic factor (LBD-BDNF) on recurrent laryngeal nerve regeneration were explored and its possible mechanism was investigated. LBD-BDNF or NAT-BDNF (BDNF without LBD binding) treatment was performed in laryngeal nerve injured rabbits for sixteen weeks. The laryngeal nerve was removed, and histological examination as well as laryngeal electromyography was employed to evaluate its morphology and function of conduction. PC12 cells were cultured to investigate the mechanisms underlying the effects of LBD-BDNF. Neurite outgrowth, proliferation and migration were determined in nerve cells. The expression of miRNAs and protein of mTOR was quantified by real-time PCR and western blotting respectively. In vivo experiments, LBD-BDNF significantly improved the histological structure and function of recurrent laryngeal nerve compared with NAT-BDNF. LBD-BDNF also markedly promoted neurite outgrowth, proliferation and migration in PC12 cells in vitro experiments. The levels of miR-222 and p-mTOR were up-regulated by LBD-BDNF treatment in both in vivo and in vitro experiments. miR-222 inhibitor attenuated the expression of phosphorylated mTOR and miR-222 mimic enhanced its expression in PC12 cells. In addition, the improved nerve conduction by LBD-BDNF was canceled by miR-222 inhibitor, and the mTOR inhibitor reversed the effects of miR-222 inhibitor on LBD-BDNF treated cells. The present study revealed that LBD-BDNF promoted the recurrent laryngeal nerve regeneration in laryngeal nerve injured rabbits. The underlying mechanism was closely related to activation of p-mTOR by miR-222.

Effect of laminin-binding BDNF on induction of recurrent laryngeal nerve regeneration by miR-222 activation of mTOR signal pathway

PubMed Central

Xie, Jin; Jin, Bin; Li, Da-Wei; Shen, Bin; Gong, Ning; Zhang, Tian-Zhen; Dong, Pin

2015-01-01

Background and Aim: Recurrent laryngeal nerve injury is a common severe complication in neck surgery, which can cause varying degrees of vocal fold paralysis and respiratory tract problems. In present study, the effects of laminin-binding brain derived neurotrophic factor (LBD-BDNF) on recurrent laryngeal nerve regeneration were explored and its possible mechanism was investigated. Methods: LBD-BDNF or NAT-BDNF (BDNF without LBD binding) treatment was performed in laryngeal nerve injured rabbits for sixteen weeks. The laryngeal nerve was removed, and histological examination as well as laryngeal electromyography was employed to evaluate its morphology and function of conduction. PC12 cells were cultured to investigate the mechanisms underlying the effects of LBD-BDNF. Neurite outgrowth, proliferation and migration were determined in nerve cells. The expression of miRNAs and protein of mTOR was quantified by real-time PCR and western blotting respectively. Results: In vivo experiments, LBD-BDNF significantly improved the histological structure and function of recurrent laryngeal nerve compared with NAT-BDNF. LBD-BDNF also markedly promoted neurite outgrowth, proliferation and migration in PC12 cells in vitro experiments. The levels of miR-222 and p-mTOR were up-regulated by LBD-BDNF treatment in both in vivo and in vitro experiments. miR-222 inhibitor attenuated the expression of phosphorylated mTOR and miR-222 mimic enhanced its expression in PC12 cells. In addition, the improved nerve conduction by LBD-BDNF was canceled by miR-222 inhibitor, and the mTOR inhibitor reversed the effects of miR-222 inhibitor on LBD-BDNF treated cells. Conclusions: The present study revealed that LBD-BDNF promoted the recurrent laryngeal nerve regeneration in laryngeal nerve injured rabbits. The underlying mechanism was closely related to activation of p-mTOR by miR-222. PMID:26279751

Mechanism-Based Mathematical Model for Gating of Ionotropic Glutamate Receptors.

PubMed

Dai, Jian; Wollmuth, Lonnie P; Zhou, Huan-Xiang

2015-08-27

We present a mathematical model for ionotropic glutamate receptors (iGluR's) that is built on mechanistic understanding and yields a number of thermodynamic and kinetic properties of channel gating. iGluR's are ligand-gated ion channels responsible for the vast majority of fast excitatory neurotransmission in the central nervous system. The effects of agonist-induced closure of the ligand-binding domain (LBD) are transmitted to the transmembrane channel (TMC) via interdomain linkers. Our model demonstrates that, relative to full agonists, partial agonists may reduce either the degree of LBD closure or the curvature of the LBD free energy basin, leading to less stabilization of the channel open state and hence lower channel open probability. A rigorous relation is derived between the channel closed-to-open free energy difference and the tension within the linker. Finally, by treating LBD closure and TMC opening as diffusive motions, we obtain gating trajectories that resemble stochastic current traces from single-channel recordings and calculate the rate constants for transitions between the channel open and closed states. Our model can be implemented by molecular dynamics simulations to realistically depict iGluR gating and may guide functional experiments in gaining deeper insight into this essential family of channel proteins.

Mechanism of partial agonism in AMPA-type glutamate receptors

PubMed Central

Salazar, Hector; Eibl, Clarissa; Chebli, Miriam; Plested, Andrew

2017-01-01

Neurotransmitters trigger synaptic currents by activating ligand-gated ion channel receptors. Whereas most neurotransmitters are efficacious agonists, molecules that activate receptors more weakly—partial agonists—also exist. Whether these partial agonists have weak activity because they stabilize less active forms, sustain active states for a lesser fraction of the time or both, remains an open question. Here we describe the crystal structure of an α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (AMPAR) ligand binding domain (LBD) tetramer in complex with the partial agonist 5-fluorowillardiine (FW). We validate this structure, and others of different geometry, using engineered intersubunit bridges. We establish an inverse relation between the efficacy of an agonist and its promiscuity to drive the LBD layer into different conformations. These results suggest that partial agonists of the AMPAR are weak activators of the receptor because they stabilize multiple non-conducting conformations, indicating that agonism is a function of both the space and time domains. PMID:28211453

Members of the LATERAL ORGAN BOUNDARIES DOMAIN Transcription Factor Family Are Involved in the Regulation of Secondary Growth in Populus[W

PubMed Central

Yordanov, Yordan S.; Regan, Sharon; Busov, Victor

2010-01-01

Regulation of secondary (woody) growth is of substantial economic and environmental interest but is poorly understood. We identified and subsequently characterized an activation-tagged poplar (Populus tremula × Populus alba) mutant with enhanced woody growth and changes in bark texture caused primarily by increased secondary phloem production. Molecular characterization of the mutation through positioning of the tag and retransformation experiments shows that the phenotype is conditioned by activation of an uncharacterized gene that encodes a novel member of the LATERAL ORGAN BOUNDARIES DOMAIN (LBD) family of transcription factors. Homology analysis showed highest similarity to an uncharacterized LBD1 gene from Arabidopsis thaliana, and we consequently named it Populus tremula × Populus alba (Pta) LBD1. Dominant-negative suppression of Pta LBD1 via translational fusion with the repressor SRDX domain caused decreased diameter growth and suppressed and highly irregular phloem development. In wild-type plants, LBD1 was most highly expressed in the phloem and cambial zone. Two key Class I KNOTTED1-like homeobox genes that promote meristem identity in the cambium were downregulated, while an Altered Phloem Development gene that is known to promote phloem differentiation was upregulated in the mutant. A set of four LBD genes, including the LBD1 gene, was predominantly expressed in wood-forming tissues, suggesting a broader regulatory role of these transcription factors during secondary woody growth in poplar. PMID:21097711

A conserved mechanism for gating in an ionotropic glutamate receptor.

PubMed

Moore, Bryn S; Mirshahi, Uyenlinh L; Ebersole, Tonya L; Mirshahi, Tooraj

2013-06-28

Ionotropic glutamate receptor (iGluR) channels control synaptic activity. The crystallographic structure of GluA2, the prototypical iGluR, reveals a clamshell-like ligand-binding domain (LBD) that closes in the presence of glutamate to open a gate on the pore lining α-helix. How LBD closure leads to gate opening remains unclear. Here, we show that bending the pore helix at a highly conserved alanine residue (Ala-621) below the gate is responsible for channel opening. Substituting Ala-621 with the smaller more flexible glycine resulted in a basally active, nondesensitizing channel with ∼39-fold increase in glutamate potency without affecting surface expression or binding. On GluA2(A621G), the partial agonist kainate showed efficacy similar to a full agonist, and competitive antagonists CNQX and DNQX acted as a partial agonists. Met-629 in GluA2 sits above the gate and is critical in transmitting LBD closure to the gate. Substituting Met-629 with the flexible glycine resulted in reduced channel activity and glutamate potency. The pore regions in potassium channels are structurally similar to iGluRs. Whereas potassium channels typically use glycines as a hinge for gating, iGluRs use the less flexible alanine as a hinge at a similar position to maintain low basal activity allowing for ligand-mediated gating.

Genome-wide identification of nuclear receptor (NR) superfamily genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong

2014-11-18

Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.

Phytoestrogens and Mycoestrogens Induce Signature Structure Dynamics Changes on Estrogen Receptor α

PubMed Central

Chen, Xueyan; Uzuner, Ugur; Li, Man; Shi, Weibing; Yuan, Joshua S.; Dai, Susie Y.

2016-01-01

Endocrine disrupters include a broad spectrum of chemicals such as industrial chemicals, natural estrogens and androgens, synthetic estrogens and androgens. Phytoestrogens are widely present in diet and food supplements; mycoestrogens are frequently found in grains. As human beings and animals are commonly exposed to phytoestrogens and mycoestrogens in diet and environment, it is important to understand the potential beneficial or hazardous effects of estrogenic compounds. Many bioassays have been established to study the binding of estrogenic compounds with estrogen receptor (ER) and provided rich data in the literature. However, limited assays can offer structure information with regard to the ligand/ER complex. Our current study surveys the global structure dynamics changes for ERα ligand binding domain (LBD) when phytoestrogens and mycoestrogens bind. The assay is based on the structure dynamics information probed by hydrogen deuterium exchange mass spectrometry and offers a unique viewpoint to elucidate the mechanism how phytoestrogens and mycoestrogens interact with estrogen receptor. The cluster analysis based on the hydrogen deuterium exchange (HDX) assay data reveals a unique pattern when phytoestrogens and mycoestrogens bind with ERα LBD compared to that of estradiol and synthetic estrogen modulators. Our study highlights that structure dynamics could play an important role in the structure function relationship when endocrine disrupters interact with estrogen receptors. PMID:27589781

Expression and Protein Interaction Analyses Reveal Combinatorial Interactions of LBD Transcription Factors During Arabidopsis Pollen Development.

PubMed

Kim, Mirim; Kim, Min-Jung; Pandey, Shashank; Kim, Jungmook

2016-11-01

LATERAL ORGAN BOUNDARIES DOMAIN (LBD) transcription factor gene family members play key roles in diverse aspects of plant development. LBD10 and LBD27 have been shown to be essential for pollen development in Arabidopsis thaliana. From the previous RNA sequencing (RNA-Seq) data set of Arabidopsis pollen, we identified the mRNAs of LBD22, LBD25 and LBD36 in addition to LBD10 and LBD27 in Arabidopsis pollen. Here we conducted expression and cellular analysis using GFP:GUS (green fluorescent protein:β-glucuronidase) reporter gene and subcellular localization assays using LBD:GFP fusion proteins expressed under the control of their own promoters in Arabidopsis. We found that these LBD proteins display spatially and temporally distinct and overlapping expression patterns during pollen development. Bimolecular fluorescence complementation and GST (glutathione S-transferase) pull-down assays demonstrated that protein-protein interactions occur among the LBDs exhibiting overlapping expression during pollen development. We further showed that LBD10, LBD22, LBD25, LBD27 and LBD36 interact with each other to form heterodimers, which are localized to the nucleus in Arabidopsis protoplasts. Taken together, these results suggest that combinatorial interactions among LBD proteins may be important for their function in pollen development in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Improved Dual-Luciferase Reporter Assays for Nuclear Receptors

PubMed Central

Paguio, Aileen; Stecha, Pete; Wood, Keith V; Fan, Frank

2010-01-01

Nuclear receptors play important roles in many cellular functions through control of gene transcription. It is also a large target class for drug discovery. Luciferase reporter assays are frequently used to study nuclear receptor function because of their wide dynamic range, low endogenous activity, and ease of use. Recent improvements of luciferase genes and vectors have further enhanced their utilities. Here we applied these improvements to two reporter formats for studying nuclear receptors. The first assay contains a Murine Mammary Tumor Virus promoter upstream of a destabilized luciferase. The presence of response elements for nuclear hormone receptor in this promoter allows the studies of endogenous and/or exogenous full length receptors. The second assay contains a ligand binding domain (LBD) of a nuclear receptor fused to the GAL4 DNA binding domain (DBD) on one vector and multiple Gal4 Upstream Activator Sequences (UAS) upstream of luciferase reporter on another vector. We showed that codon optimization of luciferase reporter genes increased expression levels in conjunction with the incorporation of protein destabilizing sequences into luciferase led to a larger assay dynamic range in both formats. The optimum number of UAS to generate the best response was determined. The expression vector for nuclear receptor LBD/GAL4 DBD fusion also constitutively expresses a Renilla luciferase-neoR fusion protein, which provides selection capability (G418 resistance, neoR) as well as an internal control (Renilla luciferase). This dual-luciferase format allowed detecting compound cytotoxicity or off-target change in expression during drug screening, therefore improved data quality. These luciferase reporter assays provided better research and drug discovery tools for studying the functions of full length nuclear receptors and ligand binding domains. PMID:21687560

Structure-dependent binding and activation of perfluorinated compounds on human peroxisome proliferator-activated receptor γ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Lianying; College of Life Science, Dezhou University, Dezhou 253023; Ren, Xiao-Min

2014-09-15

Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group.more » For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.« less

Computationally Discovered Potentiating Role of Glycans on NMDA Receptors

NASA Astrophysics Data System (ADS)

Sinitskiy, Anton V.; Stanley, Nathaniel H.; Hackos, David H.; Hanson, Jesse E.; Sellers, Benjamin D.; Pande, Vijay S.

2017-04-01

N-methyl-D-aspartate receptors (NMDARs) are glycoproteins in the brain central to learning and memory. The effects of glycosylation on the structure and dynamics of NMDARs are largely unknown. In this work, we use extensive molecular dynamics simulations of GluN1 and GluN2B ligand binding domains (LBDs) of NMDARs to investigate these effects. Our simulations predict that intra-domain interactions involving the glycan attached to residue GluN1-N440 stabilize closed-clamshell conformations of the GluN1 LBD. The glycan on GluN2B-N688 shows a similar, though weaker, effect. Based on these results, and assuming the transferability of the results of LBD simulations to the full receptor, we predict that glycans at GluN1-N440 might play a potentiator role in NMDARs. To validate this prediction, we perform electrophysiological analysis of full-length NMDARs with a glycosylation-preventing GluN1-N440Q mutation, and demonstrate an increase in the glycine EC50 value. Overall, our results suggest an intramolecular potentiating role of glycans on NMDA receptors.

Effect of B-ring substitution pattern on binding mode of propionamide selective androgen receptor modulators.

PubMed

Bohl, Casey E; Wu, Zengru; Chen, Jiyun; Mohler, Michael L; Yang, Jun; Hwang, Dong Jin; Mustafa, Suni; Miller, Duane D; Bell, Charles E; Dalton, James T

2008-10-15

Selective androgen receptor modulators (SARMs) are essentially prostate sparing androgens, which provide therapeutic potential in osteoporosis, male hormone replacement, and muscle wasting. Herein we report crystal structures of the androgen receptor (AR) ligand-binding domain (LBD) complexed to a series of potent synthetic nonsteroidal SARMs with a substituted pendant arene referred to as the B-ring. We found that hydrophilic B-ring para-substituted analogs exhibit an additional region of hydrogen bonding not seen with steroidal compounds and that multiple halogen substitutions affect the B-ring conformation and aromatic interactions with Trp741. This information elucidates interactions important for high AR binding affinity and provides new insight for structure-based drug design.

A general strategy to construct small molecule biosensors in eukaryotes.

PubMed

Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

2015-12-29

Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.

Safety and Immunological Efficacy of a DNA Vaccine Encoding the Androgen Receptor Ligand-Binding Domain (AR-LBD).

PubMed

Olson, Brian M; Bradley, Eric S; Sawicki, Thomas; Zhong, Weixiong; Ranheim, Erik A; Bloom, Jordan E; Colluru, Viswa T; Johnson, Laura E; Rekoske, Brian T; Eickhoff, Jens C; McNeel, Douglas G

2017-05-01

The androgen receptor (AR) is a key oncogenic driver of prostate cancer, and has been the primary focus of prostate cancer treatment for several decades. We have previously demonstrated that the AR is also an immunological target antigen, recognized in patients with prostate cancer, and targetable by means of vaccines in rodent models with delays in prostate tumor growth. The current study was performed to determine the safety and immunological efficacy of a GMP-grade plasmid DNA vaccine encoding the ligand-binding domain (LBD) of the AR, pTVG-AR. Groups of male mice (n = 6-10 per group) were evaluated after four or seven immunizations, using different schedules and inclusion of GM-CSF as a vaccine adjuvant. Animals were assessed for toxicity using gross observations, pathological analysis, and analysis of serum chemistries. Animals were analyzed for evidence of vaccine-augmented immunity by tetramer analysis. Survival studies using different immunization schedules and inclusion of GM-CSF were conducted in an autochthonous genetically engineered mouse model. No significant toxicities were observed in terms of animal weights, histopathology, hematological changes, or changes in serum chemistries, although there was a trend to lower serum glucose in animals treated with the vaccine. There was specifically no evidence of toxicity in other tissues that express AR, including liver, muscle, hematopoietic, and brain. Vaccination was found to elicit AR LBD-specific CD8+ T cells. In a subsequent study of tumor-bearing animals, animals treated with vaccine had prolonged survival compared with control-immunized mice. These studies demonstrate that, in immunocompetent mice expressing the target antigen, immunization with the pTVG-AR vaccine was both safe and effective in eliciting AR-specific cellular immune responses, and prolonged the survival of prostate tumor-bearing mice. These findings support the clinical evaluation of pTVG-AR in patients with recurrent prostate cancer. Prostate 77:812-821, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Structural insight into the antagonistic action of diarylheptanoid on human estrogen receptor alpha.

PubMed

Geetha Rani, Yuvaraj; Lakshmi, Baddireddi Subhadra

2018-03-30

Estrogen receptor α (ER α) is an important therapeutic target in the regulation of ligand dependent signaling in breast cancer. The current study investigates the anti-estrogenic potential of the Diarylheptanoid, 5-hydroxy-7-(4-hydroxy-3 methoxyphenyl)-1-phenyl-3-heptanone (DAH) in silico. Rigid Docking analysis of DAH at the ligand binding domain (LBD) of ER α showed hydrogen bond interactions with Arg394 and Glu353 at the active site, similar to the positive controls 4-Hydroxy Tamoxifen (4-OHT) and Fulvestrant (FUL). The protein and the protein-DAH complexes were further analyzed using molecular dynamics simulations for a time scale of 50 ns using GROMACS. Root mean square fluctuation (RMSF) analysis showed large fluctuations at the N-terminal region of Helices (H) 3, 9 and at the C-terminal region of H11, which could be involved in the antagonistic conformational change. Interestingly, H12 appeared to move away from the ligand binding pocket and occupy the co-activator binding groove at the LBD of ER α. Secondary structure analysis of the protein upon binding of DAH and CUR showed structural change from α-helix to Turn conformation at H4. We hypothesize that this structural change at H4, similar to the positive control, could hinder the activity of AF-2 by blocking the binding of co-activator. These conformational changes in ER α indicate an anti-estrogenic and therapeutic potential of the DAH.

Minoxidil may suppress androgen receptor-related functions.

PubMed

Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

2014-04-30

Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a K(d) value of 2.6 µM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases.

Minoxidil may suppress androgen receptor-related functions

PubMed Central

Hsu, Cheng-Lung; Liu, Jai-Shin; Lin, An-Chi; Yang, Chih-Hsun; Chung, Wen-Hung; Wu, Wen-Guey

2014-01-01

Although minoxidil has been used for more than two decades to treat androgenetic alopecia (AGA), an androgen-androgen receptor (AR) pathway-dominant disease, its precise mechanism of action remains elusive. We hypothesized that minoxidil may influence the AR or its downstream signaling. These tests revealed that minoxidil suppressed AR-related functions, decreasing AR transcriptional activity in reporter assays, reducing expression of AR targets at the protein level, and suppressing AR-positive LNCaP cell growth. Dissecting the underlying mechanisms, we found that minoxidil interfered with AR-peptide, AR-coregulator, and AR N/C-terminal interactions, as well as AR protein stability. Furthermore, a crystallographic analysis using the AR ligand-binding domain (LBD) revealed direct binding of minoxidil to the AR in a minoxidil-AR-LBD co-crystal model, and surface plasmon resonance assays demonstrated that minoxidil directly bound the AR with a Kd value of 2.6 μM. Minoxidil also suppressed AR-responsive reporter activity and decreased AR protein stability in human hair dermal papilla cells. The current findings provide evidence that minoxidil could be used to treat both cancer and age-related disease, and open a new avenue for applications of minoxidil in treating androgen-AR pathway-related diseases. PMID:24742982

7-Phenoxy-Substituted 3,4-Dihydro-2H-1,2,4-benzothiadiazine 1,1-Dioxides as Positive Allosteric Modulators of α-Amino-3-hydroxy-5-methyl-4-isoxazolepropionic Acid (AMPA) Receptors with Nanomolar Potency.

PubMed

Goffin, Eric; Drapier, Thomas; Larsen, Anja Probst; Geubelle, Pierre; Ptak, Christopher P; Laulumaa, Saara; Rovinskaja, Karoline; Gilissen, Julie; Tullio, Pascal de; Olsen, Lars; Frydenvang, Karla; Pirotte, Bernard; Hanson, Julien; Oswald, Robert E; Kastrup, Jette Sandholm; Francotte, Pierre

2018-01-11

We report here the synthesis of 7-phenoxy-substituted 3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxides and their evaluation as AMPA receptor positive allosteric modulators (AMPApams). The impact of substitution on the phenoxy ring and on the nitrogen atom at the 4-position was examined. At GluA2(Q) expressed in HEK293 cells (calcium flux experiment), the most potent compound was 11m (4-cyclopropyl-7-(3-methoxyphenoxy)-3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxide, EC 50 = 2.0 nM). The Hill coefficient in the screening and the shape of the dimerization curve in small-angle X-ray scattering (SAXS) experiments using isolated GluA2 ligand-binding domain (GluA2-LBD) are consistent with binding of one molecule of 11m per dimer interface, contrary to most benzothiadiazine dioxides developed to date. This observation was confirmed by the X-ray structure of 11m bound to GluA2-LBD and by NMR. This is the first benzothiadiazine dioxide AMPApam to reach the nanomolar range.

Ritonavir binds to and downregulates estrogen receptors: Molecular mechanism of promoting early atherosclerosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiang, Jin; Wang, Ying; Su, Ke

Estrogenic actions are closely related to cardiovascular disease. Ritonavir (RTV), a human immunodeficiency virus (HIV) protease inhibitor, induces atherosclerosis in an estrogen-related manner. However, how RTV induce pathological phenotypes through estrogen pathway remains unclear. In this study, we found that RTV increases thickness of coronary artery walls of Sprague Dawley rats and plasma free fatty acids (FFA) levels. In addition, RTV could induce foam cell formation, downregulate both estrogen receptor α (ERα) and ERβ expression, upregulate G protein-coupled estrogen receptor (GPER) expression, and all of them could be partially blocked by 17β-estradiol (E2), suggesting RTV acts as an antagonist formore » E2. Computational modeling shows a similar interaction with ERα between RTV and 2-aryl indoles, which are highly subtype-selective ligands for ERα. We also found that RTV directly bound to ERα and selectively inhibited the nuclear localization of ERα, and residue Leu536 in the hydrophobic core of ligand binding domain (LBD) was essential for the interaction with RTV. In addition, RTV did not change the secondary structure of ERα-LBD like E2, which explained how ERα lost the capacity of nuclear translocation under the treatment of RTV. All of the evidences suggest that ritonavir acts as an antagonist for 17β-estradiol in regulating α subtype estrogen receptor function and early events of atherosclerosis. - Graphical abstract: RTV directly binds to ERα and Leu536 in the hydrophobic core of ligand binding domain is essential for the interaction. - Highlights: • RTV increases the thickness of rat coronary artery wall and foam cell formation. • RTV downregulates the expression of ERα and ERβ. • RTV inhibits ERα promoter activity. • RTV directly binds to ERα and the key amino acid is Leu536. • RTV inhibits the nuclear translocation of ERα and GPER.« less

Effects of HO-/MeO-PBDEs on androgen receptor: in vitro investigation and helix 12-involved MD simulation.

PubMed

Wang, Xiaoxiang; Yang, Huaiyu; Hu, Xinxin; Zhang, Xiaowei; Zhang, Qiansen; Jiang, Hualiang; Shi, Wei; Yu, Hongxia

2013-10-15

Hydroxylated and methoxylated polybrominated diphenyl ethers (HO-/MeO-PBDEs) have received increasing attention for their potential endocrine disrupting activities and widely environmental distribution. However, little information is available for the anti-androgenic activities, and the molecular mechanism of interactions with androgen receptor (AR) is not fully understood. In the present study, cell line assay and computational simulation were integrated to systematically explore the molecular mechanism of interactions between chemicals and AR. The metabolites with similar molecular structures exhibited different anti-androgenic activity while none of them showed androgenic activity. According to the multisystem molecular dynamics simulation, minute differences in the structure of ligands induced dramatic different conformational transition of AR-ligand binding domain (LBD). The Helix12 (H12) component of active ligands occupied AR-LBD could become stable, but this component continued to fluctuate in inactive ligands occupied AR-LBD. Settling time and reposition of H12 obtained in dynamics process are important factors governing anti-androgenic activities. The related settling times were characteristic of anti-androgenic potencies of the tested chemicals. Overall, in our study, the stable reposition of H12 is characterized as a computational mark for identifying AR antagonists from PBDE metabolites, or even other various environmental pollutants.

Estrogen Receptor β and Its Domains Interact with Casein Kinase 2, Phosphokinase C, and N-Myristoylation Sites of Mitochondrial and Nuclear Proteins in Mouse Brain*

PubMed Central

Paramanik, Vijay; Thakur, Mahendra Kumar

2012-01-01

The localization of estrogen receptor (ER)β in mitochondria suggests ERβ-dependent regulation of genes, which is poorly understood. Here, we analyzed the ERβ interacting mitochondrial as well as nuclear proteins in mouse brain using pull-down assay and matrix-assisted laser desorption ionization mass spectroscopy (MALDI-MS). In the case of mitochondria, ERβ interacted with six proteins of 35–152 kDa, its transactivation domain (TAD) interacted with four proteins of 37–172 kDa, and ligand binding domain (LBD) interacted with six proteins of 37–161 kDa. On the other hand, in nuclei, ERβ interacted with seven proteins of 30–203 kDa, TAD with ten proteins of 31–160 kDa, and LBD with fourteen proteins of 42–179 kDa. For further identification, these proteins were cleaved by trypsin into peptides and analyzed by MALDI-MS using mascot search engine, immunoprecipitation, immunoblotting, and far-Western blotting. To find the consensus binding motifs in interacting proteins, their unique tryptic peptides were analyzed by the motif scan software. All the interacting proteins were found to contain casein kinase (CK) 2, phosphokinase (PK)C phosphorylation, and N-myristoylation sites. These were further confirmed by peptide pull-down assays using specific mutations in the interacting sites. Thus, the present findings provide evidence for the interaction of ERβ with specific mitochondrial and nuclear proteins through consensus CK2, PKC phosphorylation, and N-myristoylation sites, and may represent an essential step toward designing selective ER modulators for regulating estrogen-mediated signaling. PMID:22566700

A general strategy to construct small molecule biosensors in eukaryotes

DOE PAGES

Feng, Justin; Jester, Benjamin W.; Tinberg, Christine E.; ...

2015-12-29

Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activatesmore » transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. As a result, this work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.« less

A general strategy to construct small molecule biosensors in eukaryotes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Justin; Jester, Benjamin W.; Tinberg, Christine E.

Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activatesmore » transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. As a result, this work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes.« less

A general strategy to construct small molecule biosensors in eukaryotes

PubMed Central

Feng, Justin; Jester, Benjamin W; Tinberg, Christine E; Mandell, Daniel J; Antunes, Mauricio S; Chari, Raj; Morey, Kevin J; Rios, Xavier; Medford, June I; Church, George M; Fields, Stanley; Baker, David

2015-01-01

Biosensors for small molecules can be used in applications that range from metabolic engineering to orthogonal control of transcription. Here, we produce biosensors based on a ligand-binding domain (LBD) by using a method that, in principle, can be applied to any target molecule. The LBD is fused to either a fluorescent protein or a transcriptional activator and is destabilized by mutation such that the fusion accumulates only in cells containing the target ligand. We illustrate the power of this method by developing biosensors for digoxin and progesterone. Addition of ligand to yeast, mammalian, or plant cells expressing a biosensor activates transcription with a dynamic range of up to ~100-fold. We use the biosensors to improve the biotransformation of pregnenolone to progesterone in yeast and to regulate CRISPR activity in mammalian cells. This work provides a general methodology to develop biosensors for a broad range of molecules in eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.10606.001 PMID:26714111

Linked magnolol dimer as a selective PPARγ agonist - Structure-based rational design, synthesis, and bioactivity evaluation.

PubMed

Dreier, Dominik; Latkolik, Simone; Rycek, Lukas; Schnürch, Michael; Dymáková, Andrea; Atanasov, Atanas G; Ladurner, Angela; Heiss, Elke H; Stuppner, Hermann; Schuster, Daniela; Mihovilovic, Marko D; Dirsch, Verena M

2017-10-20

The nuclear receptors peroxisome proliferator-activated receptor γ (PPARγ) and its hetero-dimerization partner retinoid X receptor α (RXRα) are considered as drug targets in the treatment of diseases like the metabolic syndrome and diabetes mellitus type 2. Effort has been made to develop new agonists for PPARγ to obtain ligands with more favorable properties than currently used drugs. Magnolol was previously described as dual agonist of PPARγ and RXRα. Here we show the structure-based rational design of a linked magnolol dimer within the ligand binding domain of PPARγ and its synthesis. Furthermore, we evaluated its binding properties and functionality as a PPARγ agonist in vitro with the purified PPARγ ligand binding domain (LBD) and in a cell-based nuclear receptor transactivation model in HEK293 cells. We determined the synthesized magnolol dimer to bind with much higher affinity to the purified PPARγ ligand binding domain than magnolol (K i values of 5.03 and 64.42 nM, respectively). Regarding their potency to transactivate a PPARγ-dependent luciferase gene both compounds were equally effective. This is likely due to the PPARγ specificity of the newly designed magnolol dimer and lack of RXRα-driven transactivation activity by this dimeric compound.

Assessment of a recombinant androgen receptor binding assay: initial steps towards validation.

PubMed

Freyberger, Alexius; Weimer, Marc; Tran, Hoai-Son; Ahr, Hans-Jürgen

2010-08-01

Despite more than a decade of research in the field of endocrine active compounds with affinity for the androgen receptor (AR), still no validated recombinant AR binding assay is available, although recombinant AR can be obtained from several sources. With funding from the European Union (EU)-sponsored 6th framework project, ReProTect, we developed a model protocol for such an assay based on a simple AR binding assay recently developed at our institution. Important features of the protocol were the use of a rat recombinant fusion protein to thioredoxin containing both the hinge region and ligand binding domain (LBD) of the rat AR (which is identical to the human AR-LBD) and performance in a 96-well plate format. Besides two reference compounds [dihydrotestosterone (DHT), androstenedione] ten test compounds with different affinities for the AR [levonorgestrel, progesterone, prochloraz, 17alpha-methyltestosterone, flutamide, norethynodrel, o,p'-DDT, dibutylphthalate, vinclozolin, linuron] were used to explore the performance of the assay. At least three independent experiments per compound were performed. The AR binding properties of reference and test compounds were well detected, in terms of the relative ranking of binding affinities, there was good agreement with published data obtained from experiments using recombinant AR preparations. Irrespective of the chemical nature of the compound, individual IC(50)-values for a given compound varied by not more than a factor of 2.6. Our data demonstrate that the assay reliably ranked compounds with strong, weak, and no/marginal affinity for the AR with high accuracy. It avoids the manipulation and use of animals, as a recombinant protein is used and thus contributes to the 3R concept. On the whole, this assay is a promising candidate for further validation. Copyright 2009 Elsevier Inc. All rights reserved.

Impaired helix 12 dynamics due to proline 892 substitutions in the androgen receptor are associated with complete androgen insensitivity.

PubMed

Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A

2006-03-15

Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.

Androgen Receptor and its Splice Variant, AR-V7, Differentially Regulate FOXA1 Sensitive Genes in LNCaP Prostate Cancer Cells

PubMed Central

Krause, William C.; Shafi, Ayesha A.; Nakka, Manjula; Weigel, Nancy L.

2014-01-01

Prostate cancer (PCa) is an androgen-dependent disease, and tumors that are resistant to androgen ablation therapy often remain androgen receptor (AR) dependent. Among the contributors to castration-resistant PCa are AR splice variants that lack the ligand-binding domain (LBD). Instead, they have small amounts of unique sequence derived from cryptic exons or from out of frame translation. The AR-V7 (or AR3) variant is constitutively active and is expressed under conditions consistent with CRPC. AR-V7 is reported to regulate a transcriptional program that is similar but not identical to that of AR. However, it is unknown whether these differences are due to the unique sequence in AR-V7, or simply to loss of the LBD. To examine transcriptional regulation by AR-V7, we have used lentiviruses encoding AR-V7 (amino acids 1-627 of AR with the 16 amino acids unique to the variant) to prepare a derivative of the androgen-dependent LNCaP cells with inducible expression of AR-V7. An additional cell line was generated with regulated expression of AR-NTD (amino acids 1-660 of AR); this mutant lacks the LBD but does not have the AR-V7 specific sequence. We find that AR and AR-V7 have distinct activities on target genes that are co-regulated by FOXA1. Transcripts regulated by AR-V7 were similarly regulated by AR-NTD, indicating that loss of the LBD is sufficient for the observed differences. Differential regulation of target genes correlates with preferential recruitment of AR or AR-V7 to specific cis-regulatory DNA sequences providing an explanation for some of the observed differences in target gene regulation. PMID:25008967

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

The Human Orphan Nuclear Receptor Tailless (TLX, NR2E1) Is Druggable

PubMed Central

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S.; Hwang, Peter K.; Leonard, Paul G.; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J.; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open. PMID:24936658

The human orphan nuclear receptor tailless (TLX, NR2E1) is druggable.

PubMed

Benod, Cindy; Villagomez, Rosa; Filgueira, Carly S; Hwang, Peter K; Leonard, Paul G; Poncet-Montange, Guillaume; Rajagopalan, Senapathy; Fletterick, Robert J; Gustafsson, Jan-Åke; Webb, Paul

2014-01-01

Nuclear receptors (NRs) are an important group of ligand-dependent transcriptional factors. Presently, no natural or synthetic ligand has been identified for a large group of orphan NRs. Small molecules to target these orphan NRs will provide unique resources for uncovering regulatory systems that impact human health and to modulate these pathways with drugs. The orphan NR tailless (TLX, NR2E1), a transcriptional repressor, is a major player in neurogenesis and Neural Stem Cell (NSC) derived brain tumors. No chemical probes that modulate TLX activity are available, and it is not clear whether TLX is druggable. To assess TLX ligand binding capacity, we created homology models of the TLX ligand binding domain (LBD). Results suggest that TLX belongs to an emerging class of NRs that lack LBD helices α1 and α2 and that it has potential to form a large open ligand binding pocket (LBP). Using a medium throughput screening strategy, we investigated direct binding of 20,000 compounds to purified human TLX protein and verified interactions with a secondary (orthogonal) assay. We then assessed effects of verified binders on TLX activity using luciferase assays. As a result, we report identification of three compounds (ccrp1, ccrp2 and ccrp3) that bind to recombinant TLX protein with affinities in the high nanomolar to low micromolar range and enhance TLX transcriptional repressive activity. We conclude that TLX is druggable and propose that our lead compounds could serve as scaffolds to derive more potent ligands. While our ligands potentiate TLX repressive activity, the question of whether it is possible to develop ligands to de-repress TLX activity remains open.

The Caenorhabditis elegans DAF-12 nuclear receptor: structure, dynamics, and interaction with ligands.

PubMed

Alvarez, Lautaro D; Mañez, Pau Arroyo; Estrin, Darío A; Burton, Gerardo

2012-07-01

A structure for the ligand binding domain (LBD) of the DAF-12 receptor from Caenorhabditis elegans was obtained from the X-ray crystal structure of the receptor LBD from Strongyloides stercoralis bound to (25R)-Δ(7)-dafachronic acid (DA) (pdb:3GYU). The model was constructed in the presence of the ligand using a combination of Modeller, Autodock, and molecular dynamics (MD) programs, and then its dynamical behavior was studied by MD. A strong ligand binding mode (LBM) was found, with the three arginines in the ligand binding pocket (LBP) contacting the C-26 carboxylate group of the DA. The quality of the ceDAF-12 model was then evaluated by constructing several ligand systems for which the experimental activity is known. Thus, the dynamical behavior of the ceDAF-12 complex with the more active (25S)-Δ(7)-DA showed two distinct binding modes, one of them being energetically more favorable compared with the 25R isomer. Then the effect of the Arg564Cys and Arg598Met mutations on the (25R)-Δ(7)-DA binding was analyzed. The MD simulations showed that in the first case the complex was unstable, consistent with the lack of transactivation activity of (25R)-Δ(7)-DA in this mutant. Instead, in the case of the Arg598Met mutant, known to produce a partial loss of activity, our model predicted smaller effects on the LBM with a more stable MD trajectory. The model also showed that removal of the C-25 methyl does not impede the simultaneous strong interaction of the carboxylate with the three arginines, predicting that 27-nor-DAs are putative ceDAF-12 ligands. Copyright © 2012 Wiley Periodicals, Inc.

Constructing a Graph Database for Semantic Literature-Based Discovery.

PubMed

Hristovski, Dimitar; Kastrin, Andrej; Dinevski, Dejan; Rindflesch, Thomas C

2015-01-01

Literature-based discovery (LBD) generates discoveries, or hypotheses, by combining what is already known in the literature. Potential discoveries have the form of relations between biomedical concepts; for example, a drug may be determined to treat a disease other than the one for which it was intended. LBD views the knowledge in a domain as a network; a set of concepts along with the relations between them. As a starting point, we used SemMedDB, a database of semantic relations between biomedical concepts extracted with SemRep from Medline. SemMedDB is distributed as a MySQL relational database, which has some problems when dealing with network data. We transformed and uploaded SemMedDB into the Neo4j graph database, and implemented the basic LBD discovery algorithms with the Cypher query language. We conclude that storing the data needed for semantic LBD is more natural in a graph database. Also, implementing LBD discovery algorithms is conceptually simpler with a graph query language when compared with standard SQL.

Androgen receptor: structure, role in prostate cancer and drug discovery

PubMed Central

Tan, MH Eileen; Li, Jun; Xu, H Eric; Melcher, Karsten; Yong, Eu-leong

2015-01-01

Androgens and androgen receptors (AR) play a pivotal role in expression of the male phenotype. Several diseases, such as androgen insensitivity syndrome (AIS) and prostate cancer, are associated with alterations in AR functions. Indeed, androgen blockade by drugs that prevent the production of androgens and/or block the action of the AR inhibits prostate cancer growth. However, resistance to these drugs often occurs after 2–3 years as the patients develop castration-resistant prostate cancer (CRPC). In CRPC, a functional AR remains a key regulator. Early studies focused on the functional domains of the AR and its crucial role in the pathology. The elucidation of the structures of the AR DNA binding domain (DBD) and ligand binding domain (LBD) provides a new framework for understanding the functions of this receptor and leads to the development of rational drug design for the treatment of prostate cancer. An overview of androgen receptor structure and activity, its actions in prostate cancer, and how structural information and high-throughput screening have been or can be used for drug discovery are provided herein. PMID:24909511

Rational screening of peroxisome proliferator-activated receptor-γ agonists from natural products: potential therapeutics for heart failure.

PubMed

Chen, Rui; Wan, Jing; Song, Jing; Qian, Yan; Liu, Yong; Gu, Shuiming

2017-12-01

Peroxisome proliferator-activated receptor-γ (PPARγ) is a member of the nuclear hormone receptor superfamily of ligand-activated transcription factors. Activation of PPARγ pathway has been shown to enhance fatty acid oxidation, improve endothelial cell function, and decrease myocardial fibrosis in heart failure. Thus, the protein has been raised as an attractive target for heart failure therapy. This work attempted to discover new and potent PPARγ agonists from natural products using a synthetic strategy of computer virtual screening and transactivation reporter assay. A large library of structurally diverse, drug-like natural products was compiled, from which those with unsatisfactory pharmacokinetic profile and/or structurally redundant compounds were excluded. The binding mode of remaining candidates to PPARγ ligand-binding domain (LBD) was computationally modelled using molecular docking and their relative binding potency was ranked by an empirical scoring scheme. Consequently, eight commercially available hits with top scores were selected and their biological activity was determined using a cell-based reporter-gene assay. Four natural product compounds, namely ZINC13408172, ZINC4292805, ZINC44179 and ZINC901461, were identified to have high or moderate agonistic potency against human PPARγ with EC 50 values of 0.084, 2.1, 0.35 and 5.6 μM, respectively, which are comparable to or even better than that of the approved PPARγ full agonists pioglitazone (EC 50  =   0.16 μM) and rosiglitazone (EC 50  =   0.034 μM). Hydrophobic interactions and van der Waals contacts are the primary chemical forces to stabilize the complex architecture of PPARγ LBD domain with these agonist ligands, while few hydrogen bonds, salt bridges and/or π-π stacking at the complex interfaces confer selectivity and specificity for the domain-agonist recognition. The integrated in vitro-in silico screening strategy can be successfully applied to rational discovery of biologically active compounds. The newly identified natural products with PPARγ agonistic potency are considered as promising lead scaffolds to develop novel chemical therapeutics for heart failure.

Ritonavir binds to and downregulates estrogen receptors: molecular mechanism of promoting early atherosclerosis.

PubMed

Xiang, Jin; Wang, Ying; Su, Ke; Liu, Min; Hu, Peng-Chao; Ma, Tian; Li, Jia-Xi; Wei, Lei; Zheng, Zhongliang; Yang, Fang

2014-10-01

Estrogenic actions are closely related to cardiovascular disease. Ritonavir (RTV), a human immunodeficiency virus (HIV) protease inhibitor, induces atherosclerosis in an estrogen-related manner. However, how RTV induce pathological phenotypes through estrogen pathway remains unclear. In this study, we found that RTV increases thickness of coronary artery walls of Sprague Dawley rats and plasma free fatty acids (FFA) levels. In addition, RTV could induce foam cell formation, downregulate both estrogen receptor α (ERα) and ERβ expression, upregulate G protein-coupled estrogen receptor (GPER) expression, and all of them could be partially blocked by 17β-estradiol (E2), suggesting RTV acts as an antagonist for E2. Computational modeling shows a similar interaction with ERα between RTV and 2-aryl indoles, which are highly subtype-selective ligands for ERα. We also found that RTV directly bound to ERα and selectively inhibited the nuclear localization of ERα, and residue Leu536 in the hydrophobic core of ligand binding domain (LBD) was essential for the interaction with RTV. In addition, RTV did not change the secondary structure of ERα-LBD like E2, which explained how ERα lost the capacity of nuclear translocation under the treatment of RTV. All of the evidences suggest that ritonavir acts as an antagonist for 17β-estradiol in regulating α subtype estrogen receptor function and early events of atherosclerosis. Copyright © 2014 Elsevier Inc. All rights reserved.

Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESR1 Activating Mutations.

PubMed

Jeselsohn, Rinath; Bergholz, Johann S; Pun, Matthew; Cornwell, MacIntosh; Liu, Weihan; Nardone, Agostina; Xiao, Tengfei; Li, Wei; Qiu, Xintao; Buchwalter, Gilles; Feiglin, Ariel; Abell-Hart, Kayley; Fei, Teng; Rao, Prakash; Long, Henry; Kwiatkowski, Nicholas; Zhang, Tinghu; Gray, Nathanael; Melchers, Diane; Houtman, Rene; Liu, X Shirley; Cohen, Ofir; Wagle, Nikhil; Winer, Eric P; Zhao, Jean; Brown, Myles

2018-02-12

Estrogen receptor α (ER) ligand-binding domain (LBD) mutations are found in a substantial number of endocrine treatment-resistant metastatic ER-positive (ER + ) breast cancers. We investigated the chromatin recruitment, transcriptional network, and genetic vulnerabilities in breast cancer models harboring the clinically relevant ER mutations. These mutants exhibit both ligand-independent functions that mimic estradiol-bound wild-type ER as well as allele-specific neomorphic properties that promote a pro-metastatic phenotype. Analysis of the genome-wide ER binding sites identified mutant ER unique recruitment mediating the allele-specific transcriptional program. Genetic screens identified genes that are essential for the ligand-independent growth driven by the mutants. These studies provide insights into the mechanism of endocrine therapy resistance engendered by ER mutations and potential therapeutic targets. Copyright © 2018 Elsevier Inc. All rights reserved.

Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

PubMed

Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

2017-08-01

The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

Diverse Actions and Target-Site Selectivity of Neonicotinoids: Structural Insights

PubMed Central

Matsuda, Kazuhiko; Kanaoka, Satoshi; Akamatsu, Miki; Sattelle, David B.

2009-01-01

The nicotinic acetylcholine receptors (nAChRs) are targets for human and veterinary medicines as well as insecticides. Subtype-selectivity among the diverse nAChR family members is important for medicines targeting particular disorders, and pest-insect selectivity is essential for the development of safer, environmentally acceptable insecticides. Neonicotinoid insecticides selectively targeting insect nAChRs have important applications in crop protection and animal health. Members of this class exhibit strikingly diverse actions on their nAChR targets. Here we review the chemistry and diverse actions of neonicotinoids on insect and mammalian nAChRs. Electrophysiological studies on native nAChRs and on wild-type and mutagenized recombinant nAChRs have shown that basic residues particular to loop D of insect nAChRs are likely to interact electrostatically with the nitro group of neonicotinoids. In 2008, the crystal structures were published showing neonicotinoids docking into the acetylcholine binding site of molluscan acetylcholine binding proteins with homology to the ligand binding domain (LBD) of nAChRs. The crystal structures showed that 1) glutamine in loop D, corresponding to the basic residues of insect nAChRs, hydrogen bonds with the NO2 group of imidacloprid and 2) neonicotinoid-unique stacking and CH-π bonds at the LBD. A neonicotinoid-resistant strain obtained by laboratory-screening has been found to result from target site mutations, and possible reasons for this are also suggested by the crystal structures. The prospects of designing neonicotinoids that are safe not only for mammals but also for beneficial insects such as honey bees (Apis mellifera) are discussed in terms of interactions with non-α nAChR subunits. PMID:19321668

The Differential Interactions of Peroxisome Proliferator-Activated Receptor [gamma] Ligands with Tyr473 Is a Physical Basis for Their Unique Biological Activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Einstein, Monica; Akiyama, Taro E.; Castriota, Gino A.

2008-08-01

Despite their proven antidiabetic efficacy, widespread use of peroxisome proliferator-activated receptor (PPAR){gamma} agonists has been limited by adverse cardiovascular effects. To overcome this shortcoming, selective PPAR{gamma} modulators (SPPAR{gamma}Ms) have been identified that have antidiabetic efficacy comparable with full agonists with improved tolerability in preclinical species. The results of structural studies support the proposition that SPPAR{gamma}Ms interact with PPAR{gamma} differently from full agonists, thereby providing a physical basis for their novel activities. Herein, we describe a novel PPAR{gamma} ligand, SPPAR{gamma}M2. This compound was a partial agonist in a cell-based transcriptional activity assay, with diminished adipogenic activity and an attenuated gene signaturemore » in cultured human adipocytes. X-ray cocrystallography studies demonstrated that, unlike rosiglitazone, SPPAR{gamma}M2 did not interact with the Tyr473 residue located within helix 12 of the ligand binding domain (LBD). Instead, SPPAR{gamma}M2 was found to bind to and activate human PPAR{gamma} in which the Tyr473 residue had been mutated to alanine (hPPAR{gamma}Y473A), with potencies similar to those observed with the wild-type receptor (hPPAR{gamma}WT). In additional studies, we found that the intrinsic binding and functional potencies of structurally distinct SPPAR{gamma}Ms were not diminished by the Y473A mutation, whereas those of various thiazolidinedione (TZD) and non-TZD PPAR{gamma} full agonists were reduced in a correlative manner. These results directly demonstrate the important role of Tyr473 in mediating the interaction of full agonists but not SPPAR{gamma}Ms with the PPAR{gamma} LBD, thereby providing a precise molecular determinant for their differing pharmacologies.« less

Effects of the Hydroxyl Group on Phenyl Based Ligand/ERRγ Protein Binding

PubMed Central

2015-01-01

Bisphenol-A (4,4′-dihydroxy-2,2-diphenylpropane, BPA, or BPA-A) and its derivatives, when exposed to humans, may affect functions of multiple organs by specific binding to the human estrogen-related receptor γ (ERRγ). We carried out atomistic molecular dynamics (MD) simulations of three ligand compounds including BPA-A, 4-α-cumylphenol (BPA-C), and 2,2-diphenylpropane (BPA-D) binding to the ligand binding domain (LBD) of a human ERRγ to study the structures and energies associated with the binding. We used the implicit Molecular Mechanics/Poisson–Boltzmann Surface Area (MM/PBSA) method to estimate the free energies of binding for the phenyl based compound/ERRγ systems. The addition of hydroxyl groups to the aromatic ring had only a minor effect on binding structures and a significant effect on ligand/protein binding energy in an aqueous solution. Free binding energies of BPA-D to the ERRγ were found to be considerably less than those of BPA-A and BPA-C to the ERRγ. These results are well correlated with those from experiments where no binding affinities were determined in the BPA-D/ERRγ complex. No conformational change was observed for the helix 12 (H-12) of ERRγ upon binding of these compounds preserving an active transcriptional conformation state. PMID:25098505

Application of Circular Dichroism Spectroscopy to the Analysis of the Interaction Between the Estrogen Receptor Alpha and Coactivators: The Case of Calmodulin.

PubMed

Miclet, Emeric; Bourgoin-Voillard, Sandrine; Byrne, Cillian; Jacquot, Yves

2016-01-01

The estrogen receptor α ligand-binding domain (ERα-LBD) binds the natural hormone 17β-estradiol (E2) to induce transcription and cell proliferation. This process occurs with the contribution of protein and peptide partners (also called coactivators) that can modulate the structure of ERα, and therefore its specificity of action. As with most transcription factors, ERα exhibits a high content of α helix, making it difficult to routinely run spectroscopic studies capable of deciphering the secondary structure of the different partners under binding conditions. Ca(2+)-calmodulin, a protein also highly structured in α-helix, is a key coactivator for ERα activity. Here, we show how circular dichroism can be used to study the interaction of ERα with Ca(2+)-calmodulin. Our approach allows the determination not only of the conformational changes induced upon complex formation but also the dissociation constant (K d) of this interaction.

Resveratrol modulates the inflammatory response via an estrogen receptor-signal integration network

PubMed Central

Nwachukwu, Jerome C; Srinivasan, Sathish; Bruno, Nelson E; Parent, Alexander A; Hughes, Travis S; Pollock, Julie A; Gjyshi, Olsi; Cavett, Valerie; Nowak, Jason; Garcia-Ordonez, Ruben D; Houtman, René; Griffin, Patrick R; Kojetin, Douglas J; Katzenellenbogen, John A; Conkright, Michael D; Nettles, Kendall W

2014-01-01

Resveratrol has beneficial effects on aging, inflammation and metabolism, which are thought to result from activation of the lysine deacetylase, sirtuin 1 (SIRT1), the cAMP pathway, or AMP-activated protein kinase. In this study, we report that resveratrol acts as a pathway-selective estrogen receptor-α (ERα) ligand to modulate the inflammatory response but not cell proliferation. A crystal structure of the ERα ligand-binding domain (LBD) as a complex with resveratrol revealed a unique perturbation of the coactivator-binding surface, consistent with an altered coregulator recruitment profile. Gene expression analyses revealed significant overlap of TNFα genes modulated by resveratrol and estradiol. Furthermore, the ability of resveratrol to suppress interleukin-6 transcription was shown to require ERα and several ERα coregulators, suggesting that ERα functions as a primary conduit for resveratrol activity. DOI: http://dx.doi.org/10.7554/eLife.02057.001 PMID:24771768

Phenytoin is an estrogen receptor α-selective modulator that interacts with helix 12.

PubMed

Fadiel, A; Song, J; Tivon, D; Hamza, A; Cardozo, T; Naftolin, Frederick

2015-02-01

Phenytoin (Dilantin(®); DPH) is used to treat epilepsy but causes estrogen agonist-antagonist-like side effects. We investigated the interaction of phenytoin with estrogen receptors (ERs) α and β by computational molecular docking, ER competition binding, transcriptional assays, and biological actions, comparing outcomes with estradiol (E2), estrone (E1), and tamoxifen (TMX). (1) The DPH docking to 3-dimensional crystal structures of the ERα ligand-binding domain (LBD) showed a high degree of structural complementarity (-57.15 calculated energy units, approximating kcal/mol) with the ligand-binding pocket, including a contact at leucine (L540) in helix 12. Estrogen receptor β showed slightly less favorable interactions (-54.27 kcal/mol), without contacting L450. Estradiol, E1, and TMX contact points with ERα and ERβ do not include L450. (2) Cellular actions: Incubation of cells transfected with ERα or ERβ and a luciferase promoter phenytoin was several orders weaker than E2 as an agonist through ERα and had no effect through ERβ. However, phenytoin at clinical concentrations (10(-11) to 10(-6) mol/L) powerfully antagonized action of E2 on ERα-expressing cells. Similarly, phenytoin at clinically effective concentrations marginally induced alkaline phosphatase by ERα- and ERβ-expressing endometrial cancer cells but at doses well below clinical effectiveness blocked E2-induced alkaline phosphatase. (3) ER competition: In Scatchard plots comparing phenytoin with 17β-estradiol against endometrial cancer cell cytosol E2-alone more effectively displaced labeled E2 than phenytoin, but phenytoin was approximately equimolar effective to E2 in inhibiting E2's displacement of the radiolabel, further confirming that phenytoin is a strong E2 antagonist. At clinically effective concentrations, phenytoin is a strong ERα cell antagonist but a many-fold weaker agonist. Although it interacts with ERβ LBD residues, phenytoin has no effects on ERβ-only expressing cells. Docking studies indicate phenytoin interacts with the ERα LBD at the hinge of helix 12 and could thereby interfere with the entry of other ER ligands or with the mobility of helix 12, either of which actions could explain phenytoin's antagonism of ER-mediated E2 actions. Our results suggest an explanation for the broad profile of phenytoin's actions and raise possibilities for the use of phenytoin or congeners in the clinical management of ERα-dependent conditions. © The Author(s) 2014.

The multifaceted subunit interfaces of ionotropic glutamate receptors.

PubMed

Green, Tim; Nayeem, Naushaba

2015-01-01

The past fifteen years has seen a revolution in our understanding of ionotropic glutamate receptor (iGluR) structure, starting with the first view of the ligand binding domain (LBD) published in 1998, and in many ways culminating in the publication of the full-length structure of GluA2 in 2009. These reports have revealed not only the central role played by subunit interfaces in iGluR function, but also myriad binding sites within interfaces for endogenous and exogenous factors. Changes in the conformation of inter-subunit interfaces are central to transmission of ligand gating into pore opening (itself a rearrangement of interfaces), and subsequent closure through desensitization. With the exception of the agonist binding site, which is located entirely within individual subunits, almost all modulatory factors affecting iGluRs appear to bind to sites in subunit interfaces. This review seeks to summarize what we currently understand about the diverse roles interfaces play in iGluR function, and to highlight questions for future research. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

A luciferase reporter gene assay and aryl hydrocarbon receptor 1 genotype predict the LD50 of polychlorinated biphenyls in avian species.

PubMed

Manning, Gillian E; Farmahin, Reza; Crump, Doug; Jones, Stephanie P; Klein, Jeff; Konstantinov, Alex; Potter, Dave; Kennedy, Sean W

2012-09-15

Birds differ in sensitivity to the embryotoxic effects of polychlorinated biphenyls (PCBs), which complicates environmental risk assessments for these chemicals. Recent research has shown that the identities of amino acid residues 324 and 380 in the avian aryl hydrocarbon receptor 1 (AHR1) ligand binding domain (LBD) are primarily responsible for differences in avian species sensitivity to selected dibenzo-p-dioxins and furans. A luciferase reporter gene (LRG) assay was developed in our laboratory to measure AHR1-mediated induction of a cytochrome P450 1A5 reporter gene in COS-7 cells transfected with different avian AHR1 constructs. In the present study, the LRG assay was used to measure the concentration-dependent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and PCBs 126, 77, 105 and 118 on luciferase activity in COS-7 cells transfected with AHR1 constructs representative of 86 avian species in order to predict their sensitivity to PCB-induced embryolethality and the relative potency of PCBs in these species. The results of the LRG assay indicate that the identity of amino acid residues 324 and 380 in the AHR1 LBD are the major determinants of avian species sensitivity to PCBs. The relative potency of PCBs did not differ greatly among AHR1 constructs. Luciferase activity was significantly correlated with embryolethality data obtained from the literature (R(2)≥0.87, p<0.0001). Thus, the LRG assay in combination with the knowledge of a species' AHR1 LBD sequence can be used to predict PCB-induced embryolethality in potentially any avian species of interest without the use of lethal methods on a large number of individuals. Copyright © 2012 Elsevier Inc. All rights reserved.

Tamoxifen induces the expression of maspin through estrogen receptor-alpha.

PubMed

Liu, Zesheng; Shi, Heidi Y; Nawaz, Zafar; Zhang, Ming

2004-06-08

Maspin (mammary serine protease inhibitor) is a tumor suppressor gene that plays an important role in inhibiting tumor growth, invasion and metastasis. Maspin expression is down regulated at transcription level in primary and metastatic breast tumor cells. Previous studies on hormonal regulation of maspin prompt us to test whether an estrogen antagonist tamoxifen (TAM) can exert its anti-tumor function by up regulating maspin gene expression. For this purpose, we first tested whether maspin promoter could be activated in normal and several breast tumor cells. We then carried out a series of promoter analysis in which estrogen receptors and TAM were reconstituted in an in vitro cell culture system. Here we report our new finding that tumor suppresser gene maspin is one of the TAM target genes. TAM induces a maspin/luciferase reporter in cell culture and this induction requires the presence of (estrogen receptor alpha) ERalpha but not estrogen receptor-beta (ERbeta). Maspin promoter deletion and mutation analysis showed that the cis element(s) within a region between -90and+87 bp but not the HRE site (-272 bp) was involved in TAM induction of maspin expression. TAM bound ERalpha may directly control maspin gene expression through the interaction with cofactor (s). Analysis using several ERalpha mutants showed that the N-terminal A/B motif (AF-1) was critical for maspin basal level transcription activation. An ERalpha mutant with point mutations at DNA binding domain abolished estrogen induction of an ERE-luciferase reporter but was still active in activating maspin promoter by TAM. LBD-AF2 domain was required for ERalpha-dependent TAM induction. Deletion of LBD-AF2 or a point mutation in the ERalpha LBD-AF2 region (LBDmtL539A) completely abolished the activation of maspin promoter, suggesting that TAM induction of maspin involves the recruitment of cofactor(s) by ERalpha to the maspin promoter region. This finding indicates that one of the pathways for cancer prevention and tumor inhibition by TAM is mediated through the activation of tumor suppressor gene maspin in breast cancer.

ESR1 mutations as a mechanism for acquired endocrine resistance in breast cancer

PubMed Central

Jeselsohn, Rinath; Buchwalter, Gilles; De Angelis, Carmine; Brown, Myles; Schiff, Rachel

2016-01-01

Most breast cancers are estrogen receptor α (ER)-positive (+) and are treated with endocrine therapies targeting ER activity. Despite efforts, the mechanisms of the frequent clinical resistance to these therapies remain largely unknown. Several recent parallel studies unveiled gain-of-function recurrent ESR1 mutations in up to 20% of patients with metastatic ER+ disease who all received endocrine therapies, which for more cases included an aromatase inhibitor. These mutations, clustered in a hotspot within the ligand-binding domain (LBD), lead to ligand independent ER activity and tumor growth, partial resistance to tamoxifen and fulvestrant, and potentially increased metastatic capacity. Together, these findings suggest that the ESR1 LBD mutations account for acquired endocrine resistance in a substantial fraction of patients with metastatic disease. The absence of detectable ESR1 mutations in treatment-naïve disease and the correlation with the number of endocrine treatments indicate a clonal expansion of rare mutant clones, selected under the pressure of treatment. New technologies to detect low/ultra rare ESR1 mutations together with tissue and liquid biopsies are required to fully expose their clinical relevance in prognosis and treatment. Pre-clinical and clinical development of rationale-based novel therapeutic strategies to inhibit these mutants has the potential to substantially improve treatment outcomes. PMID:26122181

A Computational Approach to Evaluate the Androgenic Affinity of Iprodione, Procymidone, Vinclozolin and Their Metabolites

PubMed Central

Fumagalli, Amos; Parravicini, Chiara; Marinovich, Marina; Eberini, Ivano

2014-01-01

Our research is aimed at devising and assessing a computational approach to evaluate the affinity of endocrine active substances (EASs) and their metabolites towards the ligand binding domain (LBD) of the androgen receptor (AR) in three distantly related species: human, rat, and zebrafish. We computed the affinity for all the selected molecules following a computational approach based on molecular modelling and docking. Three different classes of molecules with well-known endocrine activity (iprodione, procymidone, vinclozolin, and a selection of their metabolites) were evaluated. Our approach was demonstrated useful as the first step of chemical safety evaluation since ligand-target interaction is a necessary condition for exerting any biological effect. Moreover, a different sensitivity concerning AR LBD was computed for the tested species (rat being the least sensitive of the three). This evidence suggests that, in order not to over−/under-estimate the risks connected with the use of a chemical entity, further in vitro and/or in vivo tests should be carried out only after an accurate evaluation of the most suitable cellular system or animal species. The introduction of in silico approaches to evaluate hazard can accelerate discovery and innovation with a lower economic effort than with a fully wet strategy. PMID:25111804

A computational approach to evaluate the androgenic affinity of iprodione, procymidone, vinclozolin and their metabolites.

PubMed

Galli, Corrado Lodovico; Sensi, Cristina; Fumagalli, Amos; Parravicini, Chiara; Marinovich, Marina; Eberini, Ivano

2014-01-01

Our research is aimed at devising and assessing a computational approach to evaluate the affinity of endocrine active substances (EASs) and their metabolites towards the ligand binding domain (LBD) of the androgen receptor (AR) in three distantly related species: human, rat, and zebrafish. We computed the affinity for all the selected molecules following a computational approach based on molecular modelling and docking. Three different classes of molecules with well-known endocrine activity (iprodione, procymidone, vinclozolin, and a selection of their metabolites) were evaluated. Our approach was demonstrated useful as the first step of chemical safety evaluation since ligand-target interaction is a necessary condition for exerting any biological effect. Moreover, a different sensitivity concerning AR LBD was computed for the tested species (rat being the least sensitive of the three). This evidence suggests that, in order not to over-/under-estimate the risks connected with the use of a chemical entity, further in vitro and/or in vivo tests should be carried out only after an accurate evaluation of the most suitable cellular system or animal species. The introduction of in silico approaches to evaluate hazard can accelerate discovery and innovation with a lower economic effort than with a fully wet strategy.

Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes

DOE PAGES

Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...

2015-10-12

Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less

Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening

PubMed Central

2013-01-01

Background Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson’s and Alzheimer’s diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. Methods To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. Results and conclusion From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B’ and C’; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function. PMID:23855825

Identification of novel modulators for ionotropic glutamate receptor, iGluA2 by in-silico screening.

PubMed

Padmanabhan, Balasundaram

2013-07-15

Ionotropic glutamate receptors (iGluAs, IUPHAR nomenclature) are the major excitatory amino acid neurotransmitter receptors in the mammalian central nervous system (CNS). iGluAs are potential therapeutic drug targets for various neurological disorders including ischemia, epilepsy, Parkinson's and Alzheimer's diseases. The known iGluA modulators, cyclothiazide (CTZ), IDRA-21, and other benzothiadiazide derivatives (ALTZ, HCTZ, and CLTZ) bind to the ligand-binding domain of flip-form of iGluA2 at the dimer interface, thereby increasing steady-state activation by reducing desensitization. To discover new modulator compounds, we performed virtual screening for the ligand binding domain (LBD) of iGluA2 against NCI Diversity Set III library containing 1597 compounds, and subsequently performed binding-energy analysis for selected compounds. The crystal structure of rat iGluA2 S1S2J (PDB ID: 3IJO) was used for docking studies. From this study, we obtained four compounds: (1) 10-2(methoxyethyl)-3-phenylbenzo[g]pteridine-2,4-dione, (2) 2-benzo[e]benzotriazol-2-yl-aniline, (3) 9-nitro-6H-indolo-(2,3,-b)quinoxaline, and (4) 1-hydroxy-n-(3-nitrophenyl)-2-napthamide. The binding mode of these four compounds is very similar to that of abovementioned established modulators: two molecules of each compound independently bind to the protein symmetrically at the dimer interface; occupy the subsites B, C, B' and C'; potentially interact with Ser518 and Ser775. Binding energy analysis shows that all the four hits are comparable to the drug molecule, CTZ, and hence, we propose that the discovered hits may be potential molecules to develop new chemical libraries for modulating the flip form of iGluA2 function.

Conserved regulation of mesenchymal gene expression by Fgf-8 in face and limb development.

PubMed

Tucker, A S; Al Khamis, A; Ferguson, C A; Bach, I; Rosenfeld, M G; Sharpe, P T

1999-01-01

Clim-2 (NLI, Lbd1) is one of two related mouse proteins that interact with Lim-domain homeoproteins. In the mouse, embryonic expression of Clim-2 is particularly pronounced in facial ectomesenchyme and limb bud mesenchyme in association with Lim genes, Lhx-6 and Lmx-1 respectively. We show that in common with both these Lim genes, Clim-2 expression is regulated by signals from overlying epithelium. In both the developing face and the limb buds we identify Fgf-8 as the likely candidate signalling molecule that regulates Clim-2 expression. We show that in the mandibular arch, as in the limb, Fgf-8 functions in combination with CD44, a cell surface binding protein, and that blocking CD44 binding results in inhibition of Fgf8-induced expression of Clim-2 and Lhx-6. Regulation of gene expression by Fgf8 in association with CD44 is thus conserved between limb and mandibular arch development.

Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

PubMed Central

Chan, Siu Chiu; Selth, Luke A.; Li, Yingming; Nyquist, Michael D.; Miao, Lu; Bradner, James E.; Raj, Ganesh V.; Tilley, Wayne D.; Dehm, Scott M.

2015-01-01

Androgen receptor (AR) variants (AR-Vs) expressed in prostate cancer (PCa) lack the AR ligand binding domain (LBD) and function as constitutively active transcription factors. AR-V expression in patient tissues or circulating tumor cells is associated with resistance to AR-targeting endocrine therapies and poor outcomes. Here, we investigated the mechanisms governing chromatin binding of AR-Vs with the goal of identifying therapeutic vulnerabilities. By chromatin immunoprecipitation and sequencing (ChIP-seq) and complementary biochemical experiments, we show that AR-Vs display a binding preference for the same canonical high-affinity androgen response elements (AREs) that are preferentially engaged by AR, albeit with lower affinity. Dimerization was an absolute requirement for constitutive AR-V DNA binding and transcriptional activation. Treatment with the bromodomain and extraterminal (BET) inhibitor JQ1 resulted in inhibition of AR-V chromatin binding and impaired AR-V driven PCa cell growth in vitro and in vivo. Importantly, this was associated with a novel JQ1 action of down-regulating AR-V transcript and protein expression. Overall, this study demonstrates that AR-Vs broadly restore AR chromatin binding events that are otherwise suppressed during endocrine therapy, and provides pre-clinical rationale for BET inhibition as a strategy for inhibiting expression and chromatin binding of AR-Vs in PCa. PMID:25908785

Androgen receptor splice variants circumvent AR blockade by microtubule-targeting agents

PubMed Central

Zhang, Guanyi; Liu, Xichun; Li, Jianzhuo; Ledet, Elisa; Alvarez, Xavier; Qi, Yanfeng; Fu, Xueqi; Sartor, Oliver; Dong, Yan; Zhang, Haitao

2015-01-01

Docetaxel-based chemotherapy is established as a first-line treatment and standard of care for patients with metastatic castration-resistant prostate cancer. However, half of the patients do not respond to treatment and those do respond eventually become refractory. A better understanding of the resistance mechanisms to taxane chemotherapy is both urgent and clinical significant, as taxanes (docetaxel and cabazitaxel) are being used in various clinical settings. Sustained signaling through the androgen receptor (AR) has been established as a hallmark of CRPC. Recently, splicing variants of AR (AR-Vs) that lack the ligand-binding domain (LBD) have been identified. These variants are constitutively active and drive prostate cancer growth in a castration-resistant manner. In taxane-resistant cell lines, we found the expression of a major variant, AR-V7, was upregulated. Furthermore, ectopic expression of two clinically relevant AR-Vs (AR-V7 and ARV567es), but not the full-length AR (AR-FL), reduced the sensitivities to taxanes in LNCaP cells. Treatment with taxanes inhibited the transcriptional activity of AR-FL, but not those of AR-Vs. This could be explained, at least in part, due to the inability of taxanes to block the nuclear translocation of AR-Vs. Through a series of deletion constructs, the microtubule-binding activity was mapped to the LBD of AR. Finally, taxane-induced cytoplasm sequestration of AR-FL was alleviated when AR-Vs were present. These findings provide evidence that constitutively active AR-Vs maintain the AR signaling axis by evading the inhibitory effects of microtubule-targeting agents, suggesting that these AR-Vs play a role in resistance to taxane chemotherapy. PMID:26160840

Significant fluctuations in ecdysteroid receptor gene (EcR) expression in relation to seasons of molt and reproduction in the grapsid crab, Metopograpsus messor (Brachyura: Decapoda).

PubMed

Shyamal, Sharmishtha; Anilkumar, G; Bhaskaran, R; Doss, G P; Durica, D S

2015-01-15

Metopograpsus messor, a brachyuran crab inhabiting the estuaries of North Kerala (India), is a prolific breeder releasing approximately 14-16 broods a year. The present paper reports the sequence information on the DNA binding domain (C domain, DBD), linker (D domain) and ligand binding domain (E domain, LBD) of M. messor ecdysteroid receptor (MmEcR) gene, the first grapsid brachyuran crab EcR examined. We have also measured MmEcR transcript levels in the ovary and the hepatopancreas throughout the annual cycle, with special reference to seasons of molt and reproduction. MmEcR expression in both the tissues is found to be at its peak (P<0.05) in late premolt crabs (January/May, molt/reproduction season); the expression levels are lowest (P<0.05) during June/July, when the females would neither molt nor reproduce (season for molt/reproduction repose). Intermediate levels of expression were found during the breeding season (August/December). Interestingly, this pattern of gene expression is in concordance with the fluctuating ecdysteroid levels of the hemolymph and Y organ secretory activity. The significant levels of fluctuation in the ovarian expression of MmEcR strongly suggest the ovary as a potential target for ecdysteroid action. A season-wise comparison of the gene expression reveals that ovarian MmEcR transcript levels are higher in breeding crabs (August/December) than the non-breeding animals (June/July), implicating a possible ecdysteroid role in reproduction in M. messor. Copyright © 2014 Elsevier Inc. All rights reserved.

AR mutations in 28 patients with androgen insensitivity syndrome (Prader grade 0-3).

PubMed

Wang, Yi; Gong, Chunxiu; Wang, Xiou; Qin, Miao

2017-07-01

We investigated the androgen receptor (AR) gene mutation profiles of Chinese patients exhibiting severe androgen insensitivity syndrome (AIS) phenotypes. The present study enrolled 28 patients with genetically diagnosed AIS, who presented with severe phenotypes (Prader grade 0-3). Patients and some family members were screened via amplification and sequencing of their AR exons 1-8, including the corresponding intronic flanking regions. Luteinizing (LH), follicle-stimulating (FSH), and testosterone (T) hormone levels were found to be slightly, but not significantly, higher in patients with complete androgen insensitivity syndrome (CAIS) than in patients with partial androgen insensitivity syndrome (PAIS) (P>0.05). We identified 24 different AR mutations, including 12 that were novel. Ten patients (cases 2, 3, 10, 28, 11, 12, 19, 20, 24, and 25) were found to carry five recurrent mutations (p.Y572S, p.P914S, p.S176R, p.Y782N, and p.R841H); of these, p.Y572S, p.S176R, and p.Y782N were novel. Among the mutations identified in patients with CAIS, six (66.7%) were characterized as single-nucleotide missense mutations, and six (66.7%) were found to be located in the AR ligand-binding domain (LBD). Among the mutations identified in patients with PAIS, 15 (93.8%) were found to be missense, and 11 (68.8%) were found to be located in the LBD. Patients 10 and 28 were determined to harbor the same missense mutation (p.P914S), but were diagnosed with CAIS and PAIS, respectively. Sex hormone levels were slightly, but not significantly, elevated in patients with CAIS compared to those with PAIS. Missense mutations spanning AR exons 1-8 were the predominant form of identified mutations, and these were mostly located in the AR LBD. Approximately 50% of the identified mutations were novel, and have enriched the AR gene-mutation database. Patients harboring identical mutations were in some instances found to exhibit divergent phenotypes.

TALEN-engineered AR gene rearrangements reveal endocrine uncoupling of androgen receptor in prostate cancer

PubMed Central

Nyquist, Michael D.; Li, Yingming; Hwang, Tae Hyun; Manlove, Luke S.; Vessella, Robert L.; Silverstein, Kevin A. T.; Voytas, Daniel F.; Dehm, Scott M.

2013-01-01

Androgen receptor (AR) target genes direct development and survival of the prostate epithelial lineage, including prostate cancer (PCa). Thus, endocrine therapies that inhibit the AR ligand-binding domain (LBD) are effective in treating PCa. AR transcriptional reactivation is central to resistance, as evidenced by the efficacy of AR retargeting in castration-resistant PCa (CRPC) with next-generation endocrine therapies abiraterone and enzalutamide. However, resistance to abiraterone and enzalutamide limits this efficacy in most men, and PCa remains the second-leading cause of male cancer deaths. Here we show that AR gene rearrangements in CRPC tissues underlie a completely androgen-independent, yet AR-dependent, resistance mechanism. We discovered intragenic AR gene rearrangements in CRPC tissues, which we modeled using transcription activator-like effector nuclease (TALEN)-mediated genome engineering. This modeling revealed that these AR gene rearrangements blocked full-length AR synthesis, but promoted expression of truncated AR variant proteins lacking the AR ligand-binding domain. Furthermore, these AR variant proteins maintained the constitutive activity of the AR transcriptional program and a CRPC growth phenotype independent of full-length AR or androgens. These findings demonstrate that AR gene rearrangements are a unique resistance mechanism by which AR transcriptional activity can be uncoupled from endocrine regulation in CRPC. PMID:24101480

Molecular Imaging and Updated Diagnostic Criteria in Lewy Body Dementias.

PubMed

Bohnen, Nicolaas I; Müller, Martijn L T M; Frey, Kirk A

2017-08-14

The aims of the study were to review recent advances in molecular imaging in the Lewy body dementias (LBD) and determine if these may support the clinical but contested temporal profile distinction between Parkinson disease (PD) with dementia (PDD) versus dementia with Lewy bodies (DLB). There do not appear to be major regional cerebral metabolic or neurotransmitter distinctions between PDD and DLB. However, recent studies highlight the relative discriminating roles of Alzheimer proteinopathies. PDD patients have lower cortical β-amyloid deposition than DLB. Preliminary tau PET studies suggest a gradient of increasing tau binding from cognitively normal PD (absent to lowest) to cognitively impaired PD (low) to DLB (intermediate) to Alzheimer disease (AD; highest). However, tau binding in DLB, including the medial temporal lobe, is substantially lower than in AD. Alzheimer-type proteinopathies appear to be more common in DLB compared to PDD with relative but no absolute differences. Given the spectrum of overlapping pathologies, future α-synuclein ligands are expected to have the best potential to distinguish the LBD from pure AD.

Identification of a novel selective PPARγ ligand with a unique binding mode and improved therapeutic profile in vitro

PubMed Central

Yi, Wei; Shi, Jingjing; Zhao, Guanguan; Zhou, X. Edward; Suino-Powell, Kelly; Melcher, Karsten; Xu, H. Eric

2017-01-01

Thiazolidinediones (TZD) function as potent anti-diabetic drugs through their direct action on the nuclear receptor peroxisome proliferator-activated receptor γ (PPARγ), but their therapeutic benefits are compromised by severe side effects. To address this concern, here we developed a potent “hit” compound, VSP-51, which is a novel selective PPARγ-modulating ligand with improved therapeutic profiles in vitro compared to the multi-billion dollar TZD drug rosiglitazone (Rosi). Unlike Rosi, VSP-51 is a partial agonist of PPARγ with improved insulin sensitivity due to its ability to bind PPARγ with high affinity without stimulating adipocyte differentiation and the expression of adipogenesis-related genes. We have determined the crystal structure of the PPARγ ligand-binding domain (LBD) in complex with VSP-51, which revealed a unique mode of binding for VSP-51 and provides the molecular basis for the discrimination between VSP-51 from TZDs and other ligands such as telmisartan, SR1663 and SR1664. Taken together, our findings demonstrate that: a) VSP-51 can serve as a promising candidate for anti-diabetic drug discovery; and b) provide a rational basis for the development of future pharmacological agents targeting PPARγ with advantages over current TZD drugs. PMID:28128331

Adaptability and selectivity of human peroxisome proliferator-activated receptor (PPAR) pan agonists revealed from crystal structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oyama, Takuji; Toyota, Kenji; Waku, Tsuyoshi

2009-08-01

The structures of the ligand-binding domains (LBDs) of human peroxisome proliferator-activated receptors (PPARα, PPARγ and PPARδ) in complexes with a pan agonist, an α/δ dual agonist and a PPARδ-specific agonist were determined. The results explain how each ligand is recognized by the PPAR LBDs at an atomic level. Peroxisome proliferator-activated receptors (PPARs) belong to the nuclear hormone receptor family, which is defined as transcriptional factors that are activated by the binding of ligands to their ligand-binding domains (LBDs). Although the three PPAR subtypes display different tissue distribution patterns and distinct pharmacological profiles, they all are essentially related to fatty-acid andmore » glucose metabolism. Since the PPARs share similar three-dimensional structures within the LBDs, synthetic ligands which simultaneously activate two or all of the PPARs could be potent candidates in terms of drugs for the treatment of abnormal metabolic homeostasis. The structures of several PPAR LBDs were determined in complex with synthetic ligands, derivatives of 3-(4-alkoxyphenyl)propanoic acid, which exhibit unique agonistic activities. The PPARα and PPARγ LBDs were complexed with the same pan agonist, TIPP-703, which activates all three PPARs and their crystal structures were determined. The two LBD–ligand complex structures revealed how the pan agonist is adapted to the similar, but significantly different, ligand-binding pockets of the PPARs. The structures of the PPARδ LBD in complex with an α/δ-selective ligand, TIPP-401, and with a related δ-specific ligand, TIPP-204, were also determined. The comparison between the two PPARδ complexes revealed how each ligand exhibits either a ‘dual selective’ or ‘single specific’ binding mode.« less

Discovery of N-(4-aryl-5-aryloxy-thiazol-2-yl)-amides as potent RORγt inverse agonists.

PubMed

Wang, Yonghui; Yang, Ting; Liu, Qian; Ma, Yingli; Yang, Liuqing; Zhou, Ling; Xiang, Zhijun; Cheng, Ziqiang; Lu, Sijie; Orband-Miller, Lisa A; Zhang, Wei; Wu, Qianqian; Zhang, Kathleen; Li, Yi; Xiang, Jia-Ning; Elliott, John D; Leung, Stewart; Ren, Feng; Lin, Xichen

2015-09-01

A novel series of N-(4-aryl-5-aryloxy-thiazol-2-yl)-amides as RORγt inverse agonists was discovered. Binding mode analysis of a RORγt partial agonist (2c) revealed by co-crystal structure in RORγt LBD suggests that the inverse agonists do not directly interfere with the interaction between H12 and the RORγt LBD. Detailed SAR exploration led to identification of potent RORγt inverse agonists such as 3m with a pIC50 of 8.0. Selected compounds in the series showed reasonable activity in Th17 cell differentiation assay as well as low intrinsic clearance in mouse liver microsomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

A Single Glycine-Alanine Exchange Directs Ligand Specificity of the Elephant Progestin Receptor

PubMed Central

Wierer, Michael; Schrey, Anna K.; Kühne, Ronald; Ulbrich, Susanne E.

2012-01-01

The primary gestagen of elephants is 5α-dihydroprogesterone (DHP), which is unlike all other mammals studied until now. The level of DHP in elephants equals that of progesterone in other mammals, and elephants are able to bind DHP with similar affinity to progesterone indicating a unique ligand-binding specificity of the elephant progestin receptor (PR). Using site-directed mutagenesis in combination with in vitro binding studies we here report that this change in specificity is due to a single glycine to alanine exchange at position 722 (G722A) of PR, which specifically increases DHP affinity while not affecting binding of progesterone. By conducting molecular dynamics simulations comparing human and elephant PR ligand-binding domains (LBD), we observed that the alanine methyl group at position 722 is able to push the DHP A-ring into a position similar to progesterone. In the human PR, the DHP A-ring position is twisted towards helix 3 of PR thereby disturbing the hydrogen bond pattern around the C3-keto group, resulting in a lower binding affinity. Furthermore, we observed that the elephant PR ligand-binding pocket is more rigid than the human analogue, which probably explains the higher affinity towards both progesterone and DHP. Interestingly, the G722A substitution is not elephant-specific, rather it is also present in five independent lineages of mammalian evolution, suggesting a special role of the substitution for the development of distinct mammalian gestagen systems. PMID:23209719

Inhibition of Androgen Receptor Function and Level in Castration-Resistant Prostate Cancer Cells by 2-[(isoxazol-4-ylmethyl)thio]-1-(4-phenylpiperazin-1-yl)ethanone.

PubMed

Masoodi, Khalid Z; Eisermann, Kurtis; Yang, Zhenyu; Dar, Javid A; Pascal, Laura E; Nguyen, Minh; O'Malley, Katherine; Parrinello, Erica; Feturi, Firuz G; Kenefake, Alex N; Nelson, Joel B; Johnston, Paul A; Wipf, Peter; Wang, Zhou

2017-10-01

The androgen receptor (AR) plays a critical role in the development of castration-resistant prostate cancer (CRPC) as well as in the resistance to the second-generation AR antagonist enzalutamide and the selective inhibitor of cytochrome P450 17A1 (CYP17A1) abiraterone. Novel agents targeting AR may inhibit the growth of prostate cancer cells resistant to enzalutamide and/or abiraterone. Through a high-throughput/high-content screening of a 220,000-member small molecule library, we have previously identified 2-[(isoxazol-4-ylmethyl)thio]-1-(4-phenylpiperazin-1-yl)ethanone (IMTPPE) (SID 3712502) as a novel small molecule capable of inhibiting AR transcriptional activity and protein level in C4-2 prostate cancer cells. In this study, we show that IMTPPE inhibits AR-target gene expression using real-time polymerase chain reaction, Western blot, and luciferase assays. IMTPPE inhibited proliferation of AR-positive, but not AR-negative, prostate cancer cells in culture. IMTPPE inhibited the transcriptional activity of a mutant AR lacking the ligand-binding domain (LBD), indicating that IMTPPE inhibition of AR is independent of the LBD. Furthermore, animal studies showed that IMTPPE inhibited the growth of 22Rv1 xenograft tumor, a model for enzalutamide-resistant prostate cancer. These findings suggest that IMTPPE is a potential lead compound for developing clinical candidates for the treatment of CRPC, including those resistant to enzalutamide. Copyright © 2017 Endocrine Society.

A new biochromatography model based on DNA origami assembled PPARγ: construction and evaluation.

PubMed

Zhou, Jie; Meng, Lingchang; Sun, Chong; Chen, Shanshan; Sun, Fang; Luo, Pei; Zhao, Yongxing

2017-05-01

As drug targets, receptors have potential to screen drugs. Silica is an attractive support to immobilize receptors; however, the lack of biocompatibility makes it easier for receptors to lose bioactivity, which remains an obstacle to its widespread use. With the advantage of biocompatibility, DNA origami can be used as a biological carrier to improve the biocompatibility of silica and assemble receptors. In this study, a new biochromatography model based on DNA origami was constructed. A large quantity of M13ssDNA was used as a scaffold, leading to significant costs, so M13ssDNA was self-produced from the bacteriophage particles. This approach is demonstrated using the ligand binding domain of gamma isoform peroxisome proliferator-activated receptor (PPARγ-LBD) as a research object. PPARγ-LBD was assembled on DNA origami carrier and then coupled on the surface of silica. The products were packed into the column as stationary phase to construct the biochromatography with the ability to recognize drugs. Affinity and specificity of the biochromatography model were evaluated by HPLC. The final results showed that the biochromatography could recognize rosiglitazone specifically, which further proved that the model could screen chemical compositions interacted with PPARγ. It was the first time to take advantage of DNA origami to assemble PPARγ to construct biochromatography. The new biochromatography model has the advantages of being efficient, convenient, and high-throughput. This method affords a new way to rapidly and conveniently screen active ingredients from complex sample plant extracts and natural product-like libraries.

A new ALF from Litopenaeus vannamei and its SNPs related to WSSV resistance

NASA Astrophysics Data System (ADS)

Liu, Jingwen; Yu, Yang; Li, Fuhua; Zhang, Xiaojun; Xiang, Jianhai

2014-11-01

Anti-lipopolysaccharide factors (ALFs) are basic components of the crustacean immune system that defend against a range of pathogens. The cDNA sequence of a new ALF, designated nLvALF2, with an open reading frame encoding 132 amino acids was cloned. Its deduced amino acid sequence contained the conserved functional domain of ALFs, the LPS binding domain (LBD). Its genomic sequence consisted of three exons and four introns. nLvALF2 was mainly expressed in the Oka organ and gills of shrimps. The transcriptional level of nLvALF2 increased significantly after white spot syndrome virus (WSSV) infection, suggesting its important roles in protecting shrimps from WSSV. Single nucleotide polymorphisms (SNPs) were found in the genomic sequence of nLvALF2, of which 38 were analyzed for associations with the susceptibility/resistance of shrimps to WSSV. The loci g.2422 A>G, g.2466 T>C, and g.2529 G>A were significantly associated with the resistance to WSSV ( P<0.05). These SNP loci could be developed as markers for selection of WSSV-resistant varieties of Litopenaeus vannamei.

BAY 1024767 blocks androgen receptor mutants found in castration-resistant prostate cancer patients

PubMed Central

Sugawara, Tatsuo; Lejeune, Pascale; Köhr, Silke; Neuhaus, Roland; Faus, Hortensia; Gelato, Kathy A.; Busemann, Matthias; Cleve, Arwed; Lücking, Ulrich; von Nussbaum, Franz; Brands, Michael; Mumberg, Dominik; Jung, Klaus; Stephan, Carsten; Haendler, Bernard

2016-01-01

Androgen receptor (AR) mutations arise in patients developing resistance to hormone deprivation therapies. Here we describe BAY 1024767, a thiohydantoin derivative with strong antagonistic activity against nine AR variants with mutations located in the AR ligand-binding domain (LBD), and against wild-type AR. Antagonism was maintained, though reduced, at increased androgen levels. Anti-tumor efficacy was evidenced in vivo in the KuCaP-1 prostate cancer model which bears the W741C bicalutamide resistance mutation and in the syngeneic prostate cancer rat model Dunning R3327-G. The prevalence of six selected AR mutations was determined in plasma DNA originating from 100 resistant patients and found to be at least 12%. Altogether the results show BAY 1024767 to be a strong antagonist for several AR mutants linked to therapy resistance, which opens the door for next-generation compounds that can benefit patients based on their mutation profile. PMID:26760770

Changes in bone metabolic parameters following oral calcium supplementation in an adult patient with vitamin D-dependent rickets type 2A.

PubMed

Kinoshita, Yuka; Ito, Nobuaki; Makita, Noriko; Nangaku, Masaomi; Fukumoto, Seiji

2017-06-29

Vitamin D-dependent rickets type 2A (VDDR2A) is a rare inherited disorder with decreased tissue responsiveness to 1,25-dihydroxyvitamin D [1,25(OH) 2 D], caused by loss of function mutations in the vitamin D receptor (VDR) gene. Approximately 50 types of mutations have been identified so far that change amino acids in either the N-terminal DNA binding domain (DBD) or the C-terminal ligand binding domain (LBD) of the VDR protein. The degree of responsiveness to 1,25(OH) 2 D varies between patients with VDDR2A, which may depend on their residual VDR function. In this report, we describe a female patient with VDDR2A caused by an early stop codon (R30X) in the VDR gene that resulted in a severely truncated VDR protein. She developed alopecia and bowed legs within a year after birth and was diagnosed with rickets at the age of 2. She had been treated with active vitamin D and oral calcium supplementation until 22 years of age, when she developed secondary hyperparathyroidism and high bone turnover. The genetic diagnosis of VDDR2A promoted the discontinuation of active vitamin D treatment in favor of monotherapy with oral calcium supplementation. We observed amelioration of the secondary hyperparathyroidism and normalization of bone metabolic parameters within 6 years.

Cloning and characterization of an Echinococcus granulosus ecdysteroid hormone nuclear receptor HR3-like gene

PubMed Central

Yang, Mei; Li, Jun; Wu, Jun; Wang, Hui; Guo, Baoping; Wu, Chuanchuan; Shou, Xi; Yang, Ning; Zhang, Zhuangzhi; McManus, Donald P.; Zhang, Fuchun; Zhang, Wenbao

2017-01-01

Cystic echinococcosis is an important parasitic zoonosis caused by the dog tapeworm Echinococcus granulosus. Little is known about adult worm development at the molecular level. Transcription analysis showed that the E. granulosus hormone receptor 3-like (EgHR3) gene was expressed in protoscoleces and adult worms, indicating its role in early adult development. In this study, we cloned and characterized EgHR3 showing that its cDNA contains an open reading frame (ORF) of 1890 bp encoding a 629 amino acid protein, which has a DNA-binding domain (DBD) and a ligand-binding domain (LBD). Immunolocalization revealed the protein was localized in the parenchyma of protoscoleces and adult worms. Real-time PCR analysis showed that EgHR3 was expressed significantly more in adults than in other stages of development (p<0.01) and that its expression was especially high in the early stage of adult worm development induced by bile acids. EgHR3 siRNA silenced 69–78% of the level of transcription in protoscoleces, which resulted in killing 43.6–60.9% of protoscoleces after 10 days of cultivation in vitro. EgHR3 may play an essential role in early adult worm development and in maintaining adult biological processes and may represent a novel drug or vaccine target against echinococcosis. PMID:28971798

10 Things You Should Know About LBD

MedlinePlus

... breakdown that can lead to kidney failure. Early recognition, diagnosis and treatment of LBD can improve the ... families living with LBD should not have to face this disease alone: LBD affects every aspect of ...

Molecular adaptation and resilience of the insect’s nuclear receptor USP

PubMed Central

2012-01-01

Background The maintenance of biological systems requires plasticity and robustness. The function of the ecdysone receptor, a heterodimer composed of the nuclear receptors ECR (NR1H1) and USP (NR2B4), was maintained in insects despite a dramatic divergence that occurred during the emergence of Mecopterida. This receptor is therefore a good model to study the evolution of plasticity. We tested the hypothesis that selection has shaped the Ligand-Binding Domain (LBD) of USP during evolution of Mecopterida. Results We isolated usp and cox1 in several species of Drosophilidae, Tenebrionidae and Blattaria and estimated non-synonymous/synonymous rate ratios using maximum-likelihood methods and codon-based substitution models. Although the usp sequences were mainly under negative selection, we detected relaxation at residues located on the surface of the LBD within Mecopterida families. Using branch-site models, we also detected changes in selective constraints along three successive branches of the Mecopterida evolution. Residues located at the bottom of the ligand-binding pocket (LBP) underwent strong positive selection during the emergence of Mecopterida. This change is correlated with the acquisition of a large LBP filled by phospholipids that probably allowed the stabilisation of the new Mecopterida structure. Later, when the two subgroups of Mecopterida (Amphiesmenoptera: Lepidoptera, Trichoptera; Antliophora: Diptera, Mecoptera, Siphonaptera) diverged, the same positions became under purifying selection. Similarly, several positions of the heterodimerisation interface experienced positive selection during the emergence of Mecopterida, rapidly followed by a phase of constrained evolution. An enlargement of the heterodimerisation surface is specific for Mecopterida and was associated with a reinforcement of the obligatory partnership between ECR and USP, at the expense of homodimerisation. Conclusions In order to explain the episodic mode of evolution of USP, we propose a model in which the molecular adaptation of this protein is seen as a process of resilience for the maintenance of the ecdysone receptor functionality. PMID:23039844

A luciferase reporter gene assay and aryl hydrocarbon receptor 1 genotype predict the LD{sub 50} of polychlorinated biphenyls in avian species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manning, Gillian E., E-mail: gmann017@uottawa.ca; Environment Canada, National Wildlife Research Centre, Ottawa, ON, Canada K1A 0H3; Farmahin, Reza, E-mail: mfarm070@uottawa.ca

2012-09-15

Birds differ in sensitivity to the embryotoxic effects of polychlorinated biphenyls (PCBs), which complicates environmental risk assessments for these chemicals. Recent research has shown that the identities of amino acid residues 324 and 380 in the avian aryl hydrocarbon receptor 1 (AHR1) ligand binding domain (LBD) are primarily responsible for differences in avian species sensitivity to selected dibenzo-p-dioxins and furans. A luciferase reporter gene (LRG) assay was developed in our laboratory to measure AHR1-mediated induction of a cytochrome P450 1A5 reporter gene in COS-7 cells transfected with different avian AHR1 constructs. In the present study, the LRG assay was usedmore » to measure the concentration-dependent effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and PCBs 126, 77, 105 and 118 on luciferase activity in COS-7 cells transfected with AHR1 constructs representative of 86 avian species in order to predict their sensitivity to PCB-induced embryolethality and the relative potency of PCBs in these species. The results of the LRG assay indicate that the identity of amino acid residues 324 and 380 in the AHR1 LBD are the major determinants of avian species sensitivity to PCBs. The relative potency of PCBs did not differ greatly among AHR1 constructs. Luciferase activity was significantly correlated with embryolethality data obtained from the literature (R{sup 2} ≥ 0.87, p < 0.0001). Thus, the LRG assay in combination with the knowledge of a species' AHR1 LBD sequence can be used to predict PCB-induced embryolethality in potentially any avian species of interest without the use of lethal methods on a large number of individuals. -- Highlights: ► PCB embryolethality in birds can be predicted from a species' AHR1 genotype. ► The reporter gene assay is useful for predicting species sensitivity to PCBs. ► The relative potency of PCBs does not appear to differ between AHR1 genotypes. ► Contamination of PCB 105 and PCB 118 did not affect their relative potency values.« less

7-ketocholesteryl-9-carboxynonanoate enhances ATP binding cassette transporter A1 expression mediated by PPARγ in THP-1 macrophages.

PubMed

Chi, Yan; Wang, Le; Liu, Yuanyuan; Ma, Yanhua; Wang, Renjun; Han, Xiaofei; Qiao, Hui; Lin, Jiabin; Matsuura, Eiji; Liu, Shuqian; Liu, Qingping

2014-06-01

ATP binding cassette transporter A1 (ABCA1) is a member of the ATP-binding cassette transporter family. It plays an essential role in mediating the efflux of excess cholesterol. It is known that peroxisome proliferator-activated receptor gamma (PPARγ) promoted ABCA1 expression. We previously found 7-ketocholesteryl-9-carboxynonanoate (oxLig-1) upregulated ABCA1 partially through CD36 mediated signals. In the present study, we intended to test if PPARγ signally is involved in the upregulation mediated by oxLig-1. First, we docked oxLig-1 and the ligand-binding domain (LBD) of PPARγ by using AutoDock 3.05 and subsequently confirmed the binding by ELISA assay. Western blotting analyses showed that oxLig-1 induces liver X receptor alpha (LXRα), PPARγ and consequently ABCA1 expression. Furthermore, oxLig-1 significantly enhanced ApoA-I-mediated cholesterol efflux. Pretreatment with an inhibitor for PPARγ (GW9662) or/and LXRα (GGPP) attenuated oxLig-1-induced ABCA1 expression. Under PPARγ knockdown by using PPARγ-shRNA, oxLig-1-induced ABCA1 expression and cholesterol efflux in THP-1 macrophages was blocked by 62% and 25% respectively. These observations suggest that oxLig-1 is a novel PPARγ agonist, promoting ApoA-I-mediated cholesterol efflux from THP-1 macrophages by increasing ABCA1 expression via induction of PPARγ. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Selective binding of the fluorescent dye 1-anilinonaphthalene-8-sulfonic acid to peroxisome proliferator-activated receptor gamma allows ligand identification and characterization.

PubMed

Zorrilla, Silvia; Garzón, Beatriz; Pérez-Sala, Dolores

2010-04-01

Peroxisome proliferator-activated receptor gamma (PPARgamma) is a member of the nuclear receptor superfamily involved in insulin sensitization, atherosclerosis, inflammation, and carcinogenesis. PPARgamma transcriptional activity is modulated by specific ligands that promote conformational changes allowing interaction with coactivators. Here we show that the fluorophore 1-anilinonaphthalene-8-sulfonic acid (ANS) binds to PPARgamma-LBD (ligand binding domain), displaying negligible interaction with other nuclear receptors such as PPARalpha and retinoid X receptor alpha (RXRalpha). ANS binding is competed by PPARgamma agonists such as rosiglitazone, 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)), and 9,10-dihydro-15-deoxy-Delta(12,14)-prostaglandin J(2) (CAY10410). Moreover, the affinity of PPARgamma for these ligands, determined through ANS competition titrations, is within the range of that reported previously, thereby suggesting that ANS competition could be useful in the screening and characterization of novel PPARgamma agonists. In contrast, gel-based competition assays showed limited performance with noncovalently bound ligands. We applied the ANS binding assay to characterize a biotinylated analog of 15d-PGJ(2) that does not activate PPAR in cells. We found that although this compound bound to PPARgamma with low affinity, it failed to promote PPARgamma interaction with a fluorescent SRC-1 peptide, indicating a lack of receptor activation. Therefore, combined approaches using ANS and fluorescent coactivator peptides to monitor PPARgamma binding and interactions may provide valuable strategies to fully understand the role of PPARgamma ligands. Copyright 2009 Elsevier Inc. All rights reserved.

Genome-wide identification, characterization and classification of ionotropic glutamate receptor genes (iGluRs) in the malaria vector Anopheles sinensis (Diptera: Culicidae).

PubMed

Wang, Ting-Ting; Si, Feng-Ling; He, Zheng-Bo; Chen, Bin

2018-01-15

Ionotropic glutamate receptors (iGluRs) are conserved ligand-gated ion channel receptors, and ionotropic receptors (IRs) were revealed as a new family of iGluRs. Their subdivision was unsettled, and their characteristics are little known. Anopheles sinensis is a major malaria vector in eastern Asia, and its genome was recently well sequenced and annotated. We identified iGluR genes in the An. sinensis genome, analyzed their characteristics including gene structure, genome distribution, domains and specific sites by bioinformatic methods, and deduced phylogenetic relationships of all iGluRs in An. sinensis, Anopheles gambiae and Drosophila melanogaster. Based on the characteristics and phylogenetics, we generated the classification of iGluRs, and comparatively analyzed the intron number and selective pressure of three iGluRs subdivisions, iGluR group, Antenna IR and Divergent IR subfamily. A total of 56 iGluR genes were identified and named in the whole-genome of An. sinensis. These genes were located on 18 scaffolds, and 31 of them (29 being IRs) are distributed into 10 clusters that are suggested to form mainly from recent gene duplication. These iGluRs can be divided into four groups: NMDA, non-NMDA, Antenna IR and Divergent IR based on feature comparison and phylogenetic analysis. IR8a and IR25a were suggested to be monophyletic, named as Putative in the study, and moved from the Antenna subfamily in the IR family to the non-NMDA group as a sister of traditional non-NMDA. The generated iGluRs of genes (including NMDA and regenerated non-NMDA) are relatively conserved, and have a more complicated gene structure, smaller ω values and some specific functional sites. The iGluR genes in An. sinensis, An. gambiae and D. melanogaster have amino-terminal domain (ATD), ligand binding domain (LBD) and Lig_Chan domains, except for IR8a that only has the LBD and Lig_Chan domains. However, the new concept IR family of genes (including regenerated Antenna IR, and Divergent IR), especially for Divergent IR are more variable, have a simpler gene structure (intron loss phenomenon) and larger ω values, and lack specific functional sites. These IR genes have no other domains except for Antenna IRs that only have the Lig_Chan domain. This study provides a comprehensive information framework for iGluR genes in An. sinensis, and generated the classification of iGluRs by feature and bioinformatics analyses. The work lays the foundation for further functional study of these genes.

Lewy Body Disease: Clinical and Pathological "Overlap Syndrome" Between Synucleinopathies (Parkinson Disease) and Tauopathies (Alzheimer Disease).

PubMed

Foguem, Clovis; Manckoundia, Patrick

2018-04-08

Lewy body disease (LBD) is a neurodegenerative disease resulting in dementia. It shares clinical and pathological features with Parkinson disease (PD), the most frequent synucleinopathy, Parkinson disease dementia (PDD), and Alzheimer disease (AD), a tauopathy. Even though the diagnostic criteria for these neurodegenerative diseases are clearly established, and recently revised for LBD, their precise clinical diagnosis is often difficult because LBD, PD, PDD, and AD share epidemiological, clinical, and pathological characteristics. This manuscript discusses current understanding of overlapping symptoms and the particular features of LBD, PD, and AD. It also describes features that could facilitate the diagnosis of each of these diseases. We concluded that the concept of neurodegenerative "overlap" syndrome, which includes the accepted diagnosis of LBD, may be taken in account and should contribute to clarifying LBD and definitions of close differential diagnoses. This should allow clinicians to suspect LBD at an earlier stage and provide better patient care.

Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Springer, Patricia S

2010-07-12

The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes thatmore » encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.« less

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs).

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Han, Jeonghoon; Kim, Hui-Su; Hwang, Dae-Sik; Lee, Jae-Seong

2017-02-01

Ecdysteroid hormones are pivotal in the development, growth, and molting of arthropods, and the hormone pathway is triggered by binding ecdysteroid to a heterodimer of the two nuclear receptors; ecdysone receptors (EcR) and ultraspiracle (USP). We have characterized EcR and USP genes, and their 5'-untranslated region (5'-UTR) from the copepod Paracyclopina nana, and studied mRNA transcription levels in post-embryonic stages and in response to water accommodated fractions (WAFs) of crude oil. The open reading frames (ORF) of EcR and USP were 1470 and 1287bp that encoded 490 and 429 amino acids with molecular weight of 121.18 and 105.03kDa, respectively. Also, a well conserved DNA-binding domain (DBD) and ligand-binding domain (LBD) were identified which confirmed by phylogenetic analysis. Messenger RNA transcriptional levels of EcR and USP were developmental stage-specific in early post-embryonic stages (N3-4). However, an evoked expression of USP was observed throughout copepodid stage and in adult females. WAFs (40 and 80%) were acted as an ecdysone agonist in P. nana, and elicited the mRNA transcription levels in adults. Developmental stage-specific transcriptional activation of EcR and USP in response to WAFs was observed. USP gene was down-regulated in the nauplius in response to WAF, whereas up-regulation of USP was observed in the adults. This study represents the first data of molecular elucidation of EcR and USP genes and their regulatory elements from P. nana and the developmental stage specific expression in response to WAFs, which can be used as potential biomarkers for environmental stressors with ecotoxicological evaluations in copepods. Copyright © 2016 Elsevier Inc. All rights reserved.

Discovery of an Oxybenzylglycine Based Peroxisome Proliferator Activated Receptor Alpha Selective

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, J.; Kennedy, L; Shi, Y

2010-01-01

An 1,3-oxybenzylglycine based compound 2 (BMS-687453) was discovered to be a potent and selective peroxisome proliferator activated receptor (PPAR) {alpha} agonist, with an EC{sub 50} of 10 nM for human PPAR{alpha} and {approx}410-fold selectivity vs human PPAR{gamma} in PPAR-GAL4 transactivation assays. Similar potencies and selectivity were also observed in the full length receptor co-transfection assays. Compound 2 has negligible cross-reactivity against a panel of human nuclear hormone receptors including PPAR{delta}. Compound 2 demonstrated an excellent pharmacological and safety profile in preclinical studies and thus was chosen as a development candidate for the treatment of atherosclerosis and dyslipidemia. The X-ray cocrystalmore » structures of the early lead compound 12 and compound 2 in complex with PPAR{alpha} ligand binding domain (LBD) were determined. The role of the crystal structure of compound 12 with PPAR{alpha} in the development of the SAR that ultimately resulted in the discovery of compound 2 is discussed.« less

Lewy Body Dementia Association

MedlinePlus

... Services Local LBD Support Groups Caregiver Link Caregiving Materials Virtual Groups Caregiver Resources Related Organizations LBD stories submit a caregiver story forums Research Research News LBD: State of the Science Learn About Clinical Trials Participate in Research Funding ...

Paired Studies Comparing Clinical Profiles of Lewy Body Dementia with Alzheimer's and Parkinson's Diseases.

PubMed

Scharre, Douglas W; Chang, Shu-Ing; Nagaraja, Haikady N; Park, Ariane; Adeli, Anahita; Agrawal, Punit; Kloos, Anne; Kegelmeyer, Deb; Linder, Shannon; Fritz, Nora; Kostyk, Sandra K; Kataki, Maria

2016-10-04

Limited data compares clinical profiles of Lewy Body Dementia (LBD) with Alzheimer's disease (AD) and Parkinson's disease (PD). Twenty-one mildly demented ambulatory LBD subjects were individually matched by MMSE score with 21 AD subjects and by UPDRS motor score with 21 PD subjects. Matched by age, gender, education, and race, pairs were compared using cognitive, functional, behavioral, and motor measures. LBD group performed worse than PD on axial motor, gait, and balance measures. AD had more amnesia and orientation impairments, but less executive and visuospatial deficits than LBD subjects. LBD group had more sleepiness, cognitive/behavioral fluctuations, hallucinations, and sleep apnea than AD or PD. Axial motor, gait, and balance disturbances correlated with executive, visuospatial, and global cognition deficits. LBD is differentiated from AD and PD by retrieval memory, visuospatial, and executive deficits; axial motor, gait and balance impairments; sleepiness, cognitive/behavioral fluctuations, hallucinations, and sleep apnea.

Novel mutations of the SRD5A2 and AR genes in Thai patients with 46, XY disorders of sex development.

PubMed

Ittiwut, Chupong; Pratuangdejkul, Jaturong; Supornsilchai, Vichit; Muensri, Sasipa; Hiranras, Yodporn; Sahakitrungruang, Taninee; Watcharasindhu, Suttipong; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

2017-01-01

Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.

Visual Hallucinations in Eye Disease and Lewy Body Disease.

PubMed

Urwyler, Prabitha; Nef, Tobias; Müri, René; Archibald, Neil; Makin, Selina Margaret; Collerton, Daniel; Taylor, John-Paul; Burn, David; McKeith, Ian; Mosimann, Urs Peter

2016-05-01

Visual hallucinations (VH) most commonly occur in eye disease (ED), Parkinson disease (PD), and Lewy body dementia (LBD). The phenomenology of VH is likely to carry important information about the brain areas within the visual system generating them. Data from five controlled cross-sectional VH studies (164 controls, 135 ED, 156 PD, 79 [PDD 48 + DLB 31] LBD) were combined and analyzed. The prevalence, phenomenology, frequency, duration, and contents of VH were compared across diseases and sex. Simple VH were most common in ED patients (ED 65% versus LBD 22% versus PD 9%, χ(2) = 31.43, df = 2, p < 0.001), whereas complex VH were more common in LBD (LBD 76% versus ED 38%, versus PD 28%, χ(2) = 96.80, df = 2, p < 0.001). The phenomenology of complex VH was different across diseases and sex. ED patients reported more "flowers" (ED 21% versus LBD 6% versus PD 0%, χ(2) = 10.04, df = 2, p = 0.005) and "body parts" (ED 40% versus LBD 17% versus PD 13%, χ(2) = 11.14, df = 2, p = 0.004); in contrast, LBD patients reported "people" (LBD 85% versus ED 67% versus PD 63%, χ(2) = 6.20, df = 2, p = 0.045) and "animals/insects" (LBD 50% versus PD 42% versus ED 21%, χ(2) = 9.76, df = 2, p = 0.008). Men reported more "machines" (13% versus 2%, χ(2) = 6.94, df = 1, p = 0.008), whereas women reported more "family members/children" (48% versus 29%, χ(2) = 5.10, df = 1, p = 0.024). The phenomenology of VH is likely related to disease-specific dysfunctions within the visual system and to past, personal experiences. Copyright © 2016 American Association for Geriatric Psychiatry. Published by Elsevier Inc. All rights reserved.

Marine Invertebrate Xenobiotic-Activated Nuclear Receptors: Their Application as Sensor Elements in High-Throughput Bioassays for Marine Bioactive Compounds

PubMed Central

Richter, Ingrid; Fidler, Andrew E.

2014-01-01

Developing high-throughput assays to screen marine extracts for bioactive compounds presents both conceptual and technical challenges. One major challenge is to develop assays that have well-grounded ecological and evolutionary rationales. In this review we propose that a specific group of ligand-activated transcription factors are particularly well-suited to act as sensors in such bioassays. More specifically, xenobiotic-activated nuclear receptors (XANRs) regulate transcription of genes involved in xenobiotic detoxification. XANR ligand-binding domains (LBDs) may adaptively evolve to bind those bioactive, and potentially toxic, compounds to which organisms are normally exposed to through their specific diets. A brief overview of the function and taxonomic distribution of both vertebrate and invertebrate XANRs is first provided. Proof-of-concept experiments are then described which confirm that a filter-feeding marine invertebrate XANR LBD is activated by marine bioactive compounds. We speculate that increasing access to marine invertebrate genome sequence data, in combination with the expression of functional recombinant marine invertebrate XANR LBDs, will facilitate the generation of high-throughput bioassays/biosensors of widely differing specificities, but all based on activation of XANR LBDs. Such assays may find application in screening marine extracts for bioactive compounds that could act as drug lead compounds. PMID:25421319

Inhibition of androgen receptor by decoy molecules delays progression to castration-recurrent prostate cancer.

PubMed

Myung, Jae-Kyung; Wang, Gang; Chiu, Helen H L; Wang, Jun; Mawji, Nasrin R; Sadar, Marianne D

2017-01-01

Androgen receptor (AR) is a member of the steroid receptor family and a therapeutic target for all stages of prostate cancer. AR is activated by ligand binding within its C-terminus ligand-binding domain (LBD). Here we show that overexpression of the AR NTD to generate decoy molecules inhibited both the growth and progression of prostate cancer in castrated hosts. Specifically, it was shown that lentivirus delivery of decoys delayed hormonal progression in castrated hosts as indicated by increased doubling time of tumor volume, prolonged time to achieve pre-castrate levels of serum prostate-specific antigen (PSA) and PSA nadir. These clinical parameters are indicative of delayed hormonal progression and improved therapeutic response and prognosis. Decoys reduced the expression of androgen-regulated genes that correlated with reduced in situ interaction of the AR with androgen response elements. Decoys did not reduce levels of AR protein or prevent nuclear localization of the AR. Nor did decoys interact directly with the AR. Thus decoys did not inhibit AR transactivation by a dominant negative mechanism. This work provides evidence that the AR NTD plays an important role in the hormonal progression of prostate cancer and supports the development of AR antagonists that target the AR NTD.

Inhibition of androgen receptor by decoy molecules delays progression to castration-recurrent prostate cancer

PubMed Central

Myung, Jae-Kyung; Wang, Gang; Chiu, Helen H. L.; Wang, Jun; Mawji, Nasrin R.; Sadar, Marianne D.

2017-01-01

Androgen receptor (AR) is a member of the steroid receptor family and a therapeutic target for all stages of prostate cancer. AR is activated by ligand binding within its C-terminus ligand-binding domain (LBD). Here we show that overexpression of the AR NTD to generate decoy molecules inhibited both the growth and progression of prostate cancer in castrated hosts. Specifically, it was shown that lentivirus delivery of decoys delayed hormonal progression in castrated hosts as indicated by increased doubling time of tumor volume, prolonged time to achieve pre-castrate levels of serum prostate-specific antigen (PSA) and PSA nadir. These clinical parameters are indicative of delayed hormonal progression and improved therapeutic response and prognosis. Decoys reduced the expression of androgen-regulated genes that correlated with reduced in situ interaction of the AR with androgen response elements. Decoys did not reduce levels of AR protein or prevent nuclear localization of the AR. Nor did decoys interact directly with the AR. Thus decoys did not inhibit AR transactivation by a dominant negative mechanism. This work provides evidence that the AR NTD plays an important role in the hormonal progression of prostate cancer and supports the development of AR antagonists that target the AR NTD. PMID:28306720

Formononetin promotes angiogenesis through the estrogen receptor alpha-enhanced ROCK pathway

PubMed Central

Li, Shang; Dang, Yuanye; Zhou, Xuelin; Huang, Bin; Huang, Xiaohui; Zhang, Zherui; Kwan, Yiu Wa; Chan, Shun Wan; Leung, George Pak Heng; Lee, Simon Ming Yuen; Hoi, Maggie Pui Man

2015-01-01

Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay demonstrated that formononetin displayed direct binding to the ligand-binding domain (LBD) of estrogen receptor alpha (ERα) with an agonistic property. Results from Human Umbilical Vein Endothelial Cells (HUVEC) by using real-time migration xCELLigence system, immunofluorescence and western blotting provided strong evidences of formononetin induced endothelial cell migration and dramatic actin cytoskeleton spatial modification through ERα-enhanced-ROCK-II/MMP2/9 signaling pathways. In addition, results from co-immunoprecipitation suggested formononetin induced cell migration via recruiting of ERα/ROCK-II activated complex formation. More interestingly, in zebrafish embryo we observed that formononetin significantly promoted angiogenic sproutings in the subintestinal vessels (SIVs) that could be completely abolished by ROCK inhibitor. In this study, we elucidated the underlying mechanisms that formononetin produced proangiogenesis effects through an ERα-enhanced ROCK-II signaling pathways. Results from the present study also expand our knowledge about the enigmatic underlying mechanisms of phytoestrogenic compounds in the promotion of angiogenesis in relation to ERα and ROCK interaction in endothelial cells and their relationship with actin assembly and cell migration. PMID:26568398

Formononetin promotes angiogenesis through the estrogen receptor alpha-enhanced ROCK pathway.

PubMed

Li, Shang; Dang, Yuanye; Zhou, Xuelin; Huang, Bin; Huang, Xiaohui; Zhang, Zherui; Kwan, Yiu Wa; Chan, Shun Wan; Leung, George Pak Heng; Lee, Simon Ming Yuen; Hoi, Maggie Pui Man

2015-11-16

Formononetin is an isoflavone that has been shown to display estrogenic properties and induce angiogenesis activities. However, the interrelationship between the estrogenic properties and angiogenesis activities of formononetin are not well defined. In the present study, docking and enzymatic assay demonstrated that formononetin displayed direct binding to the ligand-binding domain (LBD) of estrogen receptor alpha (ERα) with an agonistic property. Results from Human Umbilical Vein Endothelial Cells (HUVEC) by using real-time migration xCELLigence system, immunofluorescence and western blotting provided strong evidences of formononetin induced endothelial cell migration and dramatic actin cytoskeleton spatial modification through ERα-enhanced-ROCK-II/MMP2/9 signaling pathways. In addition, results from co-immunoprecipitation suggested formononetin induced cell migration via recruiting of ERα/ROCK-II activated complex formation. More interestingly, in zebrafish embryo we observed that formononetin significantly promoted angiogenic sproutings in the subintestinal vessels (SIVs) that could be completely abolished by ROCK inhibitor. In this study, we elucidated the underlying mechanisms that formononetin produced proangiogenesis effects through an ERα-enhanced ROCK-II signaling pathways. Results from the present study also expand our knowledge about the enigmatic underlying mechanisms of phytoestrogenic compounds in the promotion of angiogenesis in relation to ERα and ROCK interaction in endothelial cells and their relationship with actin assembly and cell migration.

Complex Actions of Thyroid Hormone Receptor Antagonist NH-3 on Gene Promoters in Different Cell Lines

PubMed Central

Shah, Vanya; Nguyen, Phuong; Nguyen, Ngoc-Ha; Togashi, Marie; Scanlan, Thomas S.; Baxter, John D.; Webb, Paul

2014-01-01

It is desirable to obtain new antagonists for thyroid hormone (TRs) and other nuclear receptors (NRs). We previously used X-ray structural models of TR ligand binding domains (LBDs) to design compounds, such as NH-3, that impair coactivator binding to activation function 2 (AF-2) and block thyroid hormone (triiodothyronine, T3) actions. However, TRs bind DNA and are transcriptionally active without ligand. Thus, NH-3 could modulate TR activity via effects on other coregulator interaction surfaces, such as activation function (AF-1) and corepressor binding sites. Here, we find that NH-3 blocks TR-LBD interactions with coactivators and corepressors and also inhibits activities of AF-1 and AF-2 in transfections. While NH-3 lacks detectable agonist activity at T3-activated genes in GC pituitary cells it nevertheless activates spot 14 (S14) in HTC liver cells with the latter effect accompanied by enhanced histone H4 acetylation and coactivator recruitment at the S14 promoter. Surprisingly, T3 promotes corepressor recruitment to target promoters. NH-3 effects vary; we observe transient recruitment of N-CoR to S14 in GC cells and dismissal and rebinding of N-CoR to the same promoter in HTC cells. We propose that NH-3 will generally behave as an antagonist by blocking AF-1 and AF-2 but that complex effects on coregulator recruitment may result in partial/mixed agonist effects that are independent of blockade of T3 binding in some contexts. These properties could ultimately be utilized in drug design and development of new selective TR modulators. PMID:18930112

Uptake Index of 123I-metaiodobenzylguanidine Myocardial Scintigraphy for Diagnosing Lewy Body Disease

PubMed Central

Kamiya, Yoshito; Ota, Satoru; Okumiya, Shintaro; Yamashita, Kosuke; Takaki, Akihiro; Ito, Shigeki

2017-01-01

Objective(s): Iodine-123 metaiodobenzylguanidine (123I-MIBG) myocardial scintigraphy has been used to evaluate cardiac sympathetic denervation in Lewy body disease (LBD), including Parkinson’s disease (PD) and dementia with Lewy bodies (DLB). The heart-to-mediastinum ratio (H/M) in PD and DLB is significantly lower than that in Parkinson’s plus syndromes and Alzheimer’s disease. Although this ratio is useful for distinguishing LBD from non-LBD, it fluctuates depending on the system performance of the gamma cameras. Therefore, a new, simple quantification method using 123I-MIBG uptake analysis is required for clinical study. The purpose of this study was to develop a new uptake index with a simple protocol to determine 123I-MIBG uptake on planar images. Methods: The 123I-MIBG input function was obtained from the input counts of the pulmonary artery (PA), which were assessed by analyzing the PA time-activity curves. The heart region of interest used for determining the H/M was used for calculating the uptake index, which was obtained by dividing the heart count by the input count. Results: Forty-eight patients underwent 123I-MIBG chest angiography and planar imaging, after clinical feature assessment and tracer injection. The H/M and 123I-MIBG uptake index were calculated and correlated with clinical features. Values for LBD were significantly lower than those for non-LBD in all analyses (P<0.001). The overlapping ranges between non-LBD and LBD were 2.15 to 2.49 in the H/M method, and 1.04 to 1.22% in the uptake index method. The diagnostic accuracy of the uptake index (area under the curve (AUC), 0.98; sensitivity, 96%; specificity, 91%; positive predictive value (PPV), 90%; negative predictive value (NPV), 93%; and accuracy, 92%) was approximately equal to that of the H/M (AUC, 0.95; sensitivity, 93%; specificity, 91%; PPV, 90%; NPV, 93%; and accuracy, 92%) for discriminating patients with LBD and non-LBD. Conclusion: A simple uptake index method was developed using 123I-MIBG planar imaging and the input counts determined by analyzing chest radioisotope angiography images of the PA. The diagnostic accuracy of the uptake index was approximately equal to that of the H/M for discriminating patients with LBD and non-LBD. PMID:28840137

Hippocampal Sclerosis but Not Normal Aging or Alzheimer Disease Is Associated With TDP-43 Pathology in the Basal Forebrain of Aged Persons.

PubMed

Cykowski, Matthew D; Takei, Hidehiro; Van Eldik, Linda J; Schmitt, Frederick A; Jicha, Gregory A; Powell, Suzanne Z; Nelson, Peter T

2016-05-01

Transactivating responsive sequence (TAR) DNA-binding protein 43-kDa (TDP-43) pathology has been described in various brain diseases, but the full anatomical distribution and clinical and biological implications of that pathology are incompletely characterized. Here, we describe TDP-43 neuropathology in the basal forebrain, hypothalamus, and adjacent nuclei in 98 individuals (mean age, 86 years; median final mini-mental state examination score, 27). On examination blinded to clinical and pathologic diagnoses, we identified TDP-43 pathology that most frequently involved the ventromedial basal forebrain in 19 individuals (19.4%). As expected, many of these brains had comorbid pathologies including those of Alzheimer disease (AD), Lewy body disease (LBD), and/or hippocampal sclerosis of aging (HS-Aging). The basal forebrain TDP-43 pathology was strongly associated with comorbid HS-Aging (odds ratio = 6.8, p = 0.001), whereas there was no significant association between basal forebrain TDP-43 pathology and either AD or LBD neuropathology. In this sample, there were some cases with apparent preclinical TDP-43 pathology in the basal forebrain that may indicate that this is an early affected area in HS-Aging. We conclude that TDP-43 pathology in the basal forebrain is strongly associated with HS-Aging. These results raise questions about a specific pathogenetic relationship between basal forebrain TDP-43 and non-HS-Aging comorbid diseases (AD and LBD). © 2016 American Association of Neuropathologists, Inc. All rights reserved.

Hippocampal Sclerosis but Not Normal Aging or Alzheimer Disease Is Associated With TDP-43 Pathology in the Basal Forebrain of Aged Persons

PubMed Central

Takei, Hidehiro; Van Eldik, Linda J.; Schmitt, Frederick A.; Jicha, Gregory A.; Powell, Suzanne Z.; Nelson, Peter T.

2016-01-01

Transactivating responsive sequence (TAR) DNA-binding protein 43-kDa (TDP-43) pathology has been described in various brain diseases, but the full anatomical distribution and clinical and biological implications of that pathology are incompletely characterized. Here, we describe TDP-43 neuropathology in the basal forebrain, hypothalamus, and adjacent nuclei in 98 individuals (mean age, 86 years; median final mini-mental state examination score, 27). On examination blinded to clinical and pathologic diagnoses, we identified TDP-43 pathology that most frequently involved the ventromedial basal forebrain in 19 individuals (19.4%). As expected, many of these brains had comorbid pathologies including those of Alzheimer disease (AD), Lewy body disease (LBD), and/or hippocampal sclerosis of aging (HS-Aging). The basal forebrain TDP-43 pathology was strongly associated with comorbid HS-Aging (odds ratio = 6.8, p = 0.001), whereas there was no significant association between basal forebrain TDP-43 pathology and either AD or LBD neuropathology. In this sample, there were some cases with apparent preclinical TDP-43 pathology in the basal forebrain that may indicate that this is an early affected area in HS-Aging. We conclude that TDP-43 pathology in the basal forebrain is strongly associated with HS-Aging. These results raise questions about a specific pathogenetic relationship between basal forebrain TDP-43 and non-HS-Aging comorbid diseases (AD and LBD). PMID:26971127

O-GlcNAc site-mapping of liver X receptor-α and O-GlcNAc transferase.

PubMed

Fan, Qiong; Moen, Anders; Anonsen, Jan Haug; Bindesbøll, Christian; Sæther, Thomas; Carlson, Cathrine Rein; Grønning-Wang, Line M

2018-05-05

The Liver X Receptor α (LXRα) belongs to the nuclear receptor superfamily and plays an essential role in regulating cholesterol, lipid and glucose metabolism and inflammatory responses. We have previously shown that LXRα is post-translationally modified by O-linked β-N-acetyl-glucosamine (O-GlcNAc) with increased transcriptional activity. Moreover, we showed that LXRα associates with O-GlcNAc transferase (OGT) in vitro and in vivo in mouse liver. In this study, we report that human LXRα is O-GlcNAc modified in its N-terminal domain (NTD) by identifying a specific O-GlcNAc site S49 and a novel O-GlcNAc modified peptide 20 LWKPGAQDASSQAQGGSSCILRE 42 . However, O-GlcNAc site-mutations did not modulate LXRα transactivation of selected target gene promoters in vitro. Peptide array and co-immunoprecipitation assays demonstrate that LXRα interacts with OGT in its NTD and ligand-binding domain (LBD) in a ligand-independent fashion. Moreover, we map two new O-GlcNAc sites in the longest OGT isoform (ncOGT): S437 in the tetratricopeptide repeat (TPR) 13 domain and T1043 in the far C-terminus, and a new O-GlcNAc modified peptide (amino acids 826-832) in the intervening region (Int-D) within the catalytic domain. We also map four new O-GlcNAc sites in the short isoform sOGT: S391, T393, S399 and S437 in the TPRs 11-13 domain. Future studies will reveal the biological role of identified O-GlcNAc sites in LXRα and OGT. Copyright © 2018 Elsevier Inc. All rights reserved.

Mechanical problem-solving strategies in left-brain damaged patients and apraxia of tool use.

PubMed

Osiurak, François; Jarry, Christophe; Lesourd, Mathieu; Baumard, Josselin; Le Gall, Didier

2013-08-01

Left brain damage (LBD) can impair the ability to use familiar tools (apraxia of tool use) as well as novel tools to solve mechanical problems. Thus far, the emphasis has been placed on quantitative analyses of patients' performance. Nevertheless, the question still to be answered is, what are the strategies employed by those patients when confronted with tool use situations? To answer it, we asked 16 LBD patients and 43 healthy controls to solve mechanical problems by means of several potential tools. To specify the strategies, we recorded the time spent in performing four kinds of action (no manipulation, tool manipulation, box manipulation, and tool-box manipulation) as well as the number of relevant and irrelevant tools grasped. We compared LBD patients' performance with that of controls who encountered difficulties with the task (controls-) or not (controls+). Our results indicated that LBD patients grasped a higher number of irrelevant tools than controls+ and controls-. Concerning time allocation, controls+ and controls- spent significantly more time in performing tool-box manipulation than LBD patients. These results are inconsistent with the possibility that LBD patients could engage in trial-and-error strategies and, rather, suggest that they tend to be perplexed. These findings seem to indicate that the inability to reason about the objects' physical properties might prevent LBD patients from following any problem-solving strategy. Copyright © 2013 Elsevier Ltd. All rights reserved.

Iodine-123 metaiodobenzylguanidine scintigraphy and iodine-123 ioflupane single photon emission computed tomography in Lewy body diseases: complementary or alternative techniques?

PubMed

Treglia, Giorgio; Cason, Ernesto; Cortelli, Pietro; Gabellini, Anna; Liguori, Rocco; Bagnato, Antonio; Giordano, Alessandro; Fagioli, Giorgio

2014-01-01

To compare myocardial sympathetic imaging using (123)I-Metaiodobenzylguanidine (MIBG) scintigraphy and striatal dopaminergic imaging using (123)I-Ioflupane (FP-CIT) single photon emission computed tomography (SPECT) in patients with suspected Lewy body diseases (LBD). Ninety-nine patients who performed both methods within 2 months for differential diagnosis between Parkinson's disease (PD) and other parkinsonism (n = 68) or between dementia with Lewy bodies (DLB) and other dementia (n = 31) were enrolled. Sensitivity, specificity, accuracy, positive and negative predictive values of both methods were calculated. For (123) I-MIBG scintigraphy, the overall sensitivity, specificity, accuracy, positive and negative predictive values in LBD were 83%, 79%, 82%, 86%, and 76%, respectively. For (123)I-FP-CIT SPECT, the overall sensitivity, specificity, accuracy, positive and negative predictive values in LBD were 93%, 41%, 73%, 71%, and 80%, respectively. There was a statistically significant difference between these two methods in patients without LBD, but not in patients with LBD. LBD usually present both myocardial sympathetic and striatal dopaminergic impairments. (123)I-FP-CIT SPECT presents high sensitivity in the diagnosis of LBD; (123)I-MIBG scintigraphy may have a complementary role in differential diagnosis between PD and other parkinsonism. These scintigraphic methods showed similar diagnostic accuracy in differential diagnosis between DLB and other dementia. Copyright © 2012 by the American Society of Neuroimaging.

Defective imitation of finger configurations in patients with damage in the right or left hemispheres: An integration disorder of visual and somatosensory information?

PubMed

Okita, Manabu; Yukihiro, Takashi; Miyamoto, Kenzo; Morioka, Shu; Kaba, Hideto

2017-04-01

To explore the mechanism underlying the imitation of finger gestures, we devised a simple imitation task in which the patients were instructed to replicate finger configurations in two conditions: one in which they could see their hand (visual feedback: VF) and one in which they could not see their hand (non-visual feedback: NVF). Patients with left brain damage (LBD) or right brain damage (RBD), respectively, were categorized into two groups based on their scores on the imitation task in the NVF condition: the impaired imitation groups (I-LBD and I-RBD) who failed two or more of the five patterns and the control groups (C-LBD and C-RBD) who made one or no errors. We also measured the movement-production times for imitation. The I-RBD group performed significantly worse than the C-RBD group even in the VF condition. In contrast, the I-LBD group was selectively impaired in the NVF condition. The I-LBD group performed the imitations at a significantly slower rate than the C-LBD group in both the VF and NVF conditions. These results suggest that impaired imitation in patients with LBD is partly due to an abnormal integration of visual and somatosensory information based on the task specificity of the NVF condition. Copyright © 2017 Elsevier Inc. All rights reserved.

Discovery of an Oxybenzylglycine Based Peroxisome Proliferator Activated Receptor [alpha] Selective Agonist 2-((3-((2-(4-Chlorophenyl)-5-methyloxazol-4-yl)methoxy)benzyl)(methoxycarbonyl)amino)acetic Acid (BMS-687453)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jun; Kennedy, Lawrence J.; Shi, Yan

2010-04-12

An 1,3-oxybenzylglycine based compound 2 (BMS-687453) was discovered to be a potent and selective peroxisome proliferator activated receptor (PPAR) {alpha} agonist, with an EC{sub 50} of 10 nM for human PPAR{alpha} and 410-fold selectivity vs human PPAR{gamma} in PPAR-GAL4 transactivation assays. Similar potencies and selectivity were also observed in the full length receptor co-transfection assays. Compound 2 has negligible cross-reactivity against a panel of human nuclear hormone receptors including PPAR{delta}. Compound 2 demonstrated an excellent pharmacological and safety profile in preclinical studies and thus was chosen as a development candidate for the treatment of atherosclerosis and dyslipidemia. The X-ray cocrystalmore » structures of the early lead compound 12 and compound 2 in complex with PPAR{alpha} ligand binding domain (LBD) were determined. The role of the crystal structure of compound 12 with PPAR{alpha} in the development of the SAR that ultimately resulted in the discovery of compound 2 is discussed.« less

Synthesis and biological activities of turkesterone 11α-acyl derivatives

PubMed Central

Dinan, Laurence; Bourne, Pauline; Whiting, Pensri; Tsitsekli, Ada; Saatov, Ziyadilla; Dhadialla, Tarlochan S.; Hormann, Robert E.; Lafont, René; Coll, Josep

2003-01-01

Turkesterone is a phytoecdysteroid possessing an 11α-hydroxyl group. It is an analogue of the insect steroid hormone 20-hydroxyecdysone. Previous ecdysteroid QSAR and molecular modelling studies predicted that the cavity of the ligand binding domain of the ecdysteroid receptor would possess space in the vicinity of C-11/C-12 of the ecdysteroid. We report the regioselective synthesis of a series of turkesterone 11α-acyl derivatives in order to explore this possibility. The structures of the analogues have been unambiguously determined by spectroscopic means (NMR and low-resolution mass spectrometry). Purity was verified by HPLC. Biological activities have been determined in Drosophila melanogaster BII cell-based bioassay for ecdysteroid agonists and in an in vitro radioligand-displacement assay using bacterially-expressed D. melanogaster EcR/USP receptor proteins. The 11α-acyl derivatives do retain a significant amount of biological activity relative to the parent ecdysteroid. Further, although activity initially drops with the extension of the acyl chain length (C2 to C4), it then increases (C6 to C10), before decreasing again (C14 and C20). The implications of these findings for the interaction of ecdysteroids with the ecdysteroid receptor and potential applications in the generation of affinity-labelled and fluorescently-tagged ecdysteroids are discussed. Abbreviation: CoMFA comparative molecular field analysis DCM dichloromethane DMF dimethylformamide DMP 2,2-dimethoxypropane 4D-QSAR 4-dimensional quantitative structure-activity relationship EcR ecdysteroid receptor EcRE ecdysteroid response element HPLC high-performance liquid chromatography LBD ligand-binding domain NMR nuclear magnetic resonance ponA ponasterone A QSAR quantitative structure-activity relationship RXR retinoid X receptor SAR structure-activity relationship SPE solid-phase extraction THF tetrahydrofuran TLC thin-layer chromatography p-TsOH para-toluenesulphonic acid USP ultraspiracle UV-VIS ultraviolet-visible PMID:15841223

Regulation of AR and (beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2006-10-01

hrs. cells were harvested for Luciferase reporter Assay. C, CV-1 cells were transfected with Renilla (2.5ng), G5-Luc (10ng), pBIND-LBD (50ng), pACT-AR...stimulation, cells were cultured in 5 to 10% CDS-FBS. Firefly and internal control Renilla lucif- erase activities were determined using a dual luciferase...reporter assay kit (Pro- mega, Madison, WI), and Renilla activities were not consistently affected by any of the cotransfected vectors. The firefly

Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer.

PubMed

Hartmaier, R J; Trabucco, S E; Priedigkeit, N; Chung, J H; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V

2018-04-01

Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287-395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3' partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations. Collectively, these data indicate that N-terminal ESR1 fusions involving exons 6-7 are a recurrent driver of endocrine therapy resistance and are impervious to ER-targeted therapies.

Mitochondrial targeting sequence variants of the CHCHD2 gene are a risk for Lewy body disorders

PubMed Central

Ogaki, Kotaro; Koga, Shunsuke; Heckman, Michael G.; Fiesel, Fabienne C.; Ando, Maya; Labbé, Catherine; Lorenzo-Betancor, Oswaldo; Moussaud-Lamodière, Elisabeth L.; Soto-Ortolaza, Alexandra I.; Walton, Ronald L.; Strongosky, Audrey J.; Uitti, Ryan J.; McCarthy, Allan; Lynch, Timothy; Siuda, Joanna; Opala, Grzegorz; Rudzinska, Monika; Krygowska-Wajs, Anna; Barcikowska, Maria; Czyzewski, Krzysztof; Puschmann, Andreas; Nishioka, Kenya; Funayama, Manabu; Hattori, Nobutaka; Parisi, Joseph E.; Petersen, Ronald C.; Graff-Radford, Neill R.; Boeve, Bradley F.; Springer, Wolfdieter; Wszolek, Zbigniew K.; Dickson, Dennis W.

2015-01-01

Objective: To assess the role of CHCHD2 variants in patients with Parkinson disease (PD) and Lewy body disease (LBD) in Caucasian populations. Methods: All exons of the CHCHD2 gene were sequenced in a US Caucasian patient-control series (878 PD, 610 LBD, and 717 controls). Subsequently, exons 1 and 2 were sequenced in an Irish series (355 PD and 365 controls) and a Polish series (394 PD and 350 controls). Immunohistochemistry and immunofluorescence studies were performed on pathologic LBD cases with rare CHCHD2 variants. Results: We identified 9 rare exonic variants of unknown significance. These variants were more frequent in the combined group of PD and LBD patients compared to controls (0.6% vs 0.1%, p = 0.013). In addition, the presence of any rare variant was more common in patients with LBD (2.5% vs 1.0%, p = 0.050) compared to controls. Eight of these 9 variants were located within the gene's mitochondrial targeting sequence. Conclusions: Although the role of variants of the CHCHD2 gene in PD and LBD remains to be further elucidated, the rare variants in the mitochondrial targeting sequence may be a risk factor for Lewy body disorders, which may link CHCHD2 to other genetic forms of parkinsonism with mitochondrial dysfunction. PMID:26561290

Exploring relation types for literature-based discovery.

PubMed

Preiss, Judita; Stevenson, Mark; Gaizauskas, Robert

2015-09-01

Literature-based discovery (LBD) aims to identify "hidden knowledge" in the medical literature by: (1) analyzing documents to identify pairs of explicitly related concepts (terms), then (2) hypothesizing novel relations between pairs of unrelated concepts that are implicitly related via a shared concept to which both are explicitly related. Many LBD approaches use simple techniques to identify semantically weak relations between concepts, for example, document co-occurrence. These generate huge numbers of hypotheses, difficult for humans to assess. More complex techniques rely on linguistic analysis, for example, shallow parsing, to identify semantically stronger relations. Such approaches generate fewer hypotheses, but may miss hidden knowledge. The authors investigate this trade-off in detail, comparing techniques for identifying related concepts to discover which are most suitable for LBD. A generic LBD system that can utilize a range of relation types was developed. Experiments were carried out comparing a number of techniques for identifying relations. Two approaches were used for evaluation: replication of existing discoveries and the "time slicing" approach.(1) RESULTS: Previous LBD discoveries could be replicated using relations based either on document co-occurrence or linguistic analysis. Using relations based on linguistic analysis generated many fewer hypotheses, but a significantly greater proportion of them were candidates for hidden knowledge. The use of linguistic analysis-based relations improves accuracy of LBD without overly damaging coverage. LBD systems often generate huge numbers of hypotheses, which are infeasible to manually review. Improving their accuracy has the potential to make these systems significantly more usable. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association.

CoMSIA and Docking Study of Rhenium Based Estrogen Receptor Ligand Analogs

PubMed Central

Wolohan, Peter; Reichert, David E.

2007-01-01

OPLS all atom force field parameters were developed in order to model a diverse set of novel rhenium based estrogen receptor ligands whose relative binding affinities (RBA) to the estrogen receptor alpha isoform (ERα) with respect to 17β-Estradiol were available. The binding properties of these novel rhenium based organometallic complexes were studied with a combination of Comparative Molecular Similarity Indices Analysis (CoMSIA) and docking. A total of 29 estrogen receptor ligands consisting of 11 rhenium complexes and 18 organic ligands were docked inside the ligand-binding domain (LBD) of ERα utilizing the program Gold. The top ranked pose was used to construct CoMSIA models from a training set of 22 of the estrogen receptor ligands which were selected at random. In addition scoring functions from the docking runs and the polar volume (PV) were also studied to investigate their ability to predict RBA ERα. A partial least-squares analysis consisting of the CoMSIA steric, electrostatic and hydrophobic indices together with the polar volume proved sufficiently predictive having a correlation coefficient, r2, of 0.94 and a cross-validated correlation coefficient, q2, utilizing the leave one out method of 0.68. Analysis of the scoring functions from Gold showed particularly poor correlation to RBA ERα which did not improve when the rhenium complexes were extracted to leave the organic ligands. The combined CoMSIA and polar volume model ranked correctly the ligands in order of increasing RBA ERα, illustrating the utility of this method as a prescreening tool in the development of novel rhenium based estrogen receptor ligands. PMID:17280694

Lovelock-Brans-Dicke gravity

NASA Astrophysics Data System (ADS)

Wenjie Tian, David; Booth, Ivan

2016-02-01

According to Lovelock’s theorem, the Hilbert-Einstein and the Lovelock actions are indistinguishable from their field equations. However, they have different scalar-tensor counterparts, which correspond to the Brans-Dicke and the Lovelock-Brans-Dicke (LBD) gravities, respectively. In this paper the LBD model of alternative gravity with the Lagrangian density {{L}}{LBD}=\\frac{1}{16π }≤ft[φ ≤ft(R+\\frac{a}{\\sqrt{-g}}{}*{RR}+b{ G }\\right)-\\frac{{ω }{{L}}}{φ }{{{\

Comparison of risk factor profiles in incidental Lewy body disease and Parkinson disease.

PubMed

Frigerio, Roberta; Fujishiro, Hiroshige; Maraganore, Demetrius M; Klos, Kevin J; DelleDonne, Anthony; Heckman, Michael G; Crook, Julia E; Josephs, Keith A; Parisi, Joseph E; Boeve, Bradley F; Dickson, Dennis W; Ahlskog, J Eric

2009-09-01

To explore whether associations of potential risk factors for incidental Lewy body disease (iLBD) are similar to those for Parkinson disease (PD). Brain autopsy study (1988-2004) of subjects without evidence of neurodegenerative disease or tremor who were evaluated by at least 1 physician within 1 year of death. Researchers analyzed incidental Lewy pathology blinded to clinical abstraction. Olmsted County, Minnesota. Subjects Residents of Olmsted County and the immediate vicinity aged older than 60 years. Whether risk factors previously associated with PD in Olmsted County are also associated with iLBD. Of 235 subjects, 34 had iLBD (14.5%). The overall risk factor profiles for iLBD and PD were fairly similar between the 2 sets of odds ratio (OR) estimates, with 11 of 16 ORs in the same direction. Prior Olmsted County studies documented 7 risk factors with statistically significant associations with PD; for physician occupation and caffeine intake, the ORs for iLBD were in the same direction and statistically significant, whereas for education, head injury, and number of children, they were in the same direction but not significant; they were in the opposite direction but not statistically significant for depression and anxiety. Incidental Lewy body disease was not associated with various end-of-life conditions or causes of death, though these patients were slightly older and more likely cachectic. Based on this exploratory study, iLBD and PD appear to have similar risk factor profiles. Thus, at least some cases of iLBD could represent preclinical PD, arrested PD, or a partial syndrome due to a lesser burden of causative factors. Incidental Lewy body disease is not explained by nonspecific end-of-life brain insults.

Learning Rotation-Invariant Local Binary Descriptor.

PubMed

Duan, Yueqi; Lu, Jiwen; Feng, Jianjiang; Zhou, Jie

2017-08-01

In this paper, we propose a rotation-invariant local binary descriptor (RI-LBD) learning method for visual recognition. Compared with hand-crafted local binary descriptors, such as local binary pattern and its variants, which require strong prior knowledge, local binary feature learning methods are more efficient and data-adaptive. Unlike existing learning-based local binary descriptors, such as compact binary face descriptor and simultaneous local binary feature learning and encoding, which are susceptible to rotations, our RI-LBD first categorizes each local patch into a rotational binary pattern (RBP), and then jointly learns the orientation for each pattern and the projection matrix to obtain RI-LBDs. As all the rotation variants of a patch belong to the same RBP, they are rotated into the same orientation and projected into the same binary descriptor. Then, we construct a codebook by a clustering method on the learned binary codes, and obtain a histogram feature for each image as the final representation. In order to exploit higher order statistical information, we extend our RI-LBD to the triple rotation-invariant co-occurrence local binary descriptor (TRICo-LBD) learning method, which learns a triple co-occurrence binary code for each local patch. Extensive experimental results on four different visual recognition tasks, including image patch matching, texture classification, face recognition, and scene classification, show that our RI-LBD and TRICo-LBD outperform most existing local descriptors.

Neural correlates of cognitive dysfunction in Lewy body diseases and tauopathies: combined assessment with FDG-PET and the CERAD test battery.

PubMed

Hellwig, Sabine; Frings, Lars; Bormann, Tobias; Kreft, Annabelle; Amtage, Florian; Spehl, Timo S; Weiller, Cornelius; Tüscher, Oliver; Meyer, Philipp T

2013-11-01

We investigated disease-specific cognitive profiles and their neural correlates in Lewy-body diseases (LBD) and tauopathies by CERAD assessment and FDG-PET. Analyses revealed a significant interaction between reduced semantic fluency in tauopathies and impaired verbal learning in LBD. Semantic fluency discriminated between groups with high accuracy (83%). Compared to LBD, tauopathy patients showed bilateral hypometabolism of midbrain, thalamus, middle cingulate gyrus and supplementary motor/premotor cortex. In the reverse contrast, LBD patients exhibited bilateral hypometabolism in posterior parietal cortex, precuneus and inferior temporal gyrus extending into occipital and frontal cortices. In diagnosis-independent voxel-based analyses, verbal learning/memory correlated with left temporal and right parietal metabolism, while fluency was coupled to bilateral striatal and frontal metabolism. Naming correlated with left frontal metabolism and drawing with metabolism in bilateral temporal and left frontal regions. In line with disease-specific patterns of regional glucose metabolism, tauopathies and LBD show distinct cognitive profiles, which may assist clinical differentiation. Copyright © 2013 Elsevier Inc. All rights reserved.

A compound-based proteomic approach discloses 15-ketoatractyligenin methyl ester as a new PPARγ partial agonist with anti-proliferative ability

NASA Astrophysics Data System (ADS)

Vasaturo, Michele; Fiengo, Lorenzo; de Tommasi, Nunziatina; Sabatino, Lina; Ziccardi, Pamela; Colantuoni, Vittorio; Bruno, Maurizio; Cerchia, Carmen; Novellino, Ettore; Lupo, Angelo; Lavecchia, Antonio; Piaz, Fabrizio Dal

2017-01-01

Proteomics based approaches are emerging as useful tools to identify the targets of bioactive compounds and elucidate their molecular mechanisms of action. Here, we applied a chemical proteomic strategy to identify the peroxisome proliferator-activated receptor γ (PPARγ) as a molecular target of the pro-apoptotic agent 15-ketoatractyligenin methyl ester (compound 1). We demonstrated that compound 1 interacts with PPARγ, forms a covalent bond with the thiol group of C285 and occupies the sub-pocket between helix H3 and the β-sheet of the ligand-binding domain (LBD) of the receptor by Surface Plasmon Resonance (SPR), mass spectrometry-based studies and docking experiments. 1 displayed partial agonism of PPARγ in cell-based transactivation assays and was found to inhibit the AKT pathway, as well as its downstream targets. Consistently, a selective PPARγ antagonist (GW9662) greatly reduced the anti-proliferative and pro-apoptotic effects of 1, providing the molecular basis of its action. Collectively, we identified 1 as a novel PPARγ partial agonist and elucidated its mode of action, paving the way for therapeutic strategies aimed at tailoring novel PPARγ ligands with reduced undesired harmful side effects.

A compound-based proteomic approach discloses 15-ketoatractyligenin methyl ester as a new PPARγ partial agonist with anti-proliferative ability

PubMed Central

Vasaturo, Michele; Fiengo, Lorenzo; De Tommasi, Nunziatina; Sabatino, Lina; Ziccardi, Pamela; Colantuoni, Vittorio; Bruno, Maurizio; Cerchia, Carmen; Novellino, Ettore; Lupo, Angelo; Lavecchia, Antonio; Piaz, Fabrizio Dal

2017-01-01

Proteomics based approaches are emerging as useful tools to identify the targets of bioactive compounds and elucidate their molecular mechanisms of action. Here, we applied a chemical proteomic strategy to identify the peroxisome proliferator-activated receptor γ (PPARγ) as a molecular target of the pro-apoptotic agent 15-ketoatractyligenin methyl ester (compound 1). We demonstrated that compound 1 interacts with PPARγ, forms a covalent bond with the thiol group of C285 and occupies the sub-pocket between helix H3 and the β-sheet of the ligand-binding domain (LBD) of the receptor by Surface Plasmon Resonance (SPR), mass spectrometry-based studies and docking experiments. 1 displayed partial agonism of PPARγ in cell-based transactivation assays and was found to inhibit the AKT pathway, as well as its downstream targets. Consistently, a selective PPARγ antagonist (GW9662) greatly reduced the anti-proliferative and pro-apoptotic effects of 1, providing the molecular basis of its action. Collectively, we identified 1 as a novel PPARγ partial agonist and elucidated its mode of action, paving the way for therapeutic strategies aimed at tailoring novel PPARγ ligands with reduced undesired harmful side effects. PMID:28117438

A compound-based proteomic approach discloses 15-ketoatractyligenin methyl ester as a new PPARγ partial agonist with anti-proliferative ability.

PubMed

Vasaturo, Michele; Fiengo, Lorenzo; De Tommasi, Nunziatina; Sabatino, Lina; Ziccardi, Pamela; Colantuoni, Vittorio; Bruno, Maurizio; Cerchia, Carmen; Novellino, Ettore; Lupo, Angelo; Lavecchia, Antonio; Piaz, Fabrizio Dal

2017-01-24

Proteomics based approaches are emerging as useful tools to identify the targets of bioactive compounds and elucidate their molecular mechanisms of action. Here, we applied a chemical proteomic strategy to identify the peroxisome proliferator-activated receptor γ (PPARγ) as a molecular target of the pro-apoptotic agent 15-ketoatractyligenin methyl ester (compound 1). We demonstrated that compound 1 interacts with PPARγ, forms a covalent bond with the thiol group of C285 and occupies the sub-pocket between helix H3 and the β-sheet of the ligand-binding domain (LBD) of the receptor by Surface Plasmon Resonance (SPR), mass spectrometry-based studies and docking experiments. 1 displayed partial agonism of PPARγ in cell-based transactivation assays and was found to inhibit the AKT pathway, as well as its downstream targets. Consistently, a selective PPARγ antagonist (GW9662) greatly reduced the anti-proliferative and pro-apoptotic effects of 1, providing the molecular basis of its action. Collectively, we identified 1 as a novel PPARγ partial agonist and elucidated its mode of action, paving the way for therapeutic strategies aimed at tailoring novel PPARγ ligands with reduced undesired harmful side effects.

Immuno-detection of dioxins using a recombinant protein of aryl hydrocarbon receptor (AhR) fused with sfGFP.

PubMed

Faiad, Walaa; Hanano, Abdulsamie; Kabakibi, Mohamed Maher; Abbady, Abdul Qader

2016-06-21

Dioxins are one of the most toxic groups of persistent organic pollutants. Their bioaccumulation through the food chain constitutes a potential risk for human health. Upon cell entry, dioxins bind specifically and firmly to the aryl hydrocarbon receptor (AhR), leading to the stimulation of several enzymes responsible for its detoxification. Dioxin/AhR interaction could be exploited as an affordable alternative to a variety of analytical methods for detecting dioxin contamination in the environment. In this work, the ligand binding domain (LBD) of the AhR was cloned downstream a superfolder form of the green fluorescent protein (sfGFP), resulting in the construct pRSET-sfGFP-AhR. High level of expressed sfGFP-AhR fusion protein (50 kDa) was recovered from the inclusion bodies of E. coli by simple solubilization with the Arginine, and purified by affinity chromatography via its N-terminal 6 × His tag. Its purity was confirmed by SDS-PAGE analysis and immunoblotting with anti-His or anti-GFP antibodies. Indirect ELISA revealed the ability of the sfGFP-AhR, but not the sfGFP, to bind to the immobilized dioxin with the possibility to detect such interaction by both its 6 × His and GFP tags,Competitive ELISA showed that anti-dioxin antibody was more sensitive to low dioxin concentrations than sfGFP-AhR. Nevertheless,the detection range of sfGFP-AhR fusion was much wider and the detection limit was of about 10 ppt (parts per trillion) of free dioxin in the tested artificial samples. this highly expressed and functional sfGFP-AhR fusion protein provides a promising molecular tool for detecting and quantifying different congeners of dioxins.

Lysosomes, autophagosomes and Alzheimer pathology in dementia with Lewy body disease.

PubMed

Gurney, Rowan; Davidson, Yvonne S; Robinson, Andrew C; Richardson, Anna; Jones, Matthew; Snowden, Julie S; Mann, David M A

2018-05-10

A failure of protein degradation may underpin Lewy body disease (LBD) where α-synuclein is assimilated into the pathognomic Lewy bodies and Lewy neurites. We investigated histological alterations in lysosomes and autophagosomes in the substantia nigra (SN) and cingulate gyrus (CG) in 34 patients with LBD employing antibodies against phosphorylated α-synuclein and lysosomal (lysosomal associated membrane proteins 1 and 2 (LAMP-1 and LAMP-2), cathepsin D (CTSD)) and autophagosomal (microtubule-associated protein light chain 3α (LC3A)) proteins. Immunostained sections were qualitatively and semi-quantitatively assessed for the appearance, distribution and intensity of staining. Four LBD patients had mutations in GBA1. There was significantly less LAMP-1, LAMP-2 and CTSD immunostaining in neurons of the SN in LBD cases compared to control cases and marginally less LAMP-1 in patients with GBA1 mutations compared to those without. Loss of LAMP-1 and CTSD immunoreactivity correlated with cell loss from the SN. There were no changes in LC3A immunoreactivity in the SN, nor any major changes in the CG, or glial cell activity in the SN and CG, for any of the markers. A proportion of amyloid plaques in both the LBD and control cases was immunoreactive for LAMP-1 and LAMP-2, but not CTSD or LC3A proteins. These immunohisochemical features were seen in glial cells, which were negative for amyloid-β. Alterations in lysosomal structure or function, but not macroautophagy, may underpin the pathogenesis of LBD. © 2018 Japanese Society of Neuropathology.

Development and Evaluation of Ergonomic Interventions for Bucket Handling on Farms

PubMed Central

Fathallah, Fadi A.; Tang, Steven C.H.; Waters, Thomas R.

2016-01-01

Objective The aim of this study was to introduce and evaluate two interventions, Ergo Bucket Carrier (EBC) and Easy Lift (EL), for youths (and adults) to handle water/feed buckets on farms. Background The physical activities of both adult and youth farm workers contribute to the development of low-back disorders (LBDs). Many of the activities youths perform on farms are associated with increased LBD risk, particularly, the handling of water and feed buckets. Methods Seventeen adult and youth participants (10 males and seven females) participated in this study. To assess the risk of LBDs, the participants were instrumented with a three-dimensional spinal electrogoniometer while lifting, carrying, and dumping water buckets using traditional method and the two interventions. Results For both the adult and youth groups, the results showed that the two interventions significantly decrease the magnitudes of LBD risk in many of the tasks evaluated. Overall, the use of the EBC resulted in a 41% reduction in the level of LBD risk for the carrying task, and a reduction of 69% for the dumping task. Using the EL, on the other hand, is especially effective for lifting tasks (55% reduction in LBD risk). Results of the subjective response were consistent with the objective evaluations. Conclusion This study demonstrated the potential for ergonomic interventions in reducing LBD risk during the common farming task of bucket handling. Application Potential application of this study includes the introduction of the EBC and EL in family farms to reduce the LBD risk among youth and adult farmers. PMID:26994024

Specific flexion-related low back pain and sitting: comparison of seated discomfort on two different chairs.

PubMed

O'Keeffe, Mary; Dankaerts, Wim; O'Sullivan, Peter; O'Sullivan, Leonard; O'Sullivan, Kieran

2013-01-01

No study has examined the effectiveness of prescribing seating modifications according to the individual clinical presentation of people with low back pain (LBP). A dynamic, forward-inclined chair ('Back App') can reduce seated paraspinal muscle activation among pain-free participants. This study examined 21 participants whose LBP was specifically aggravated by prolonged sitting and was eased by standing. Low back discomfort (LBD) and overall body discomfort (OBD) were assessed every 15 min while participants sat for 1 h on both the dynamic, forward-inclined chair and a standard office chair. LBD increased significantly more (p = 0.005) on the standard office chair, with no significant difference (p = 0.178) in OBD between the chairs. The results demonstrate that, in a specific flexion-related subgroup of people with LBP, increased LBD during sitting can be minimised through modifying chair design. Mechanisms that minimise seated discomfort may be of relevance in LBP management, as part of a biopsychosocial management plan. This study examined low back discomfort (LBD) during a typing task among people with low back pain (LBP). Sitting on a dynamic, forward-inclined chair resulted in less seated LBD than sitting on a standard office chair. Further research is required to examine the long-term effectiveness of ergonomics interventions in LBP.

Novel Tool Selection in Left Brain-Damaged Patients With Apraxia of Tool Use: A Study of Three Cases.

PubMed

Osiurak, François; Granjon, Marine; Bonnevie, Isabelle; Brogniart, Joël; Mechtouff, Laura; Benoit, Amandine; Nighoghossian, Norbert; Lesourd, Mathieu

2018-05-01

Recent evidence indicates that some left brain-damaged (LBD) patients have difficulties to use familiar tools because of the inability to reason about physical object properties. A fundamental issue is to understand the residual capacity of those LBD patients in tool selection. Three LBD patients with tool use disorders, three right brain-damaged (RBD) patients, and six matched healthy controls performed a novel tool selection task, consisting in extracting a target out from a box by selecting the relevant tool among eight, four, or two tools. Three criteria were manipulated to make relevant and irrelevant tools (size, rigidity, shape). LBD patients selected a greater number of irrelevant tools and had more difficulties to solve the task compared to RBD patients and controls. All participants committed more errors for selecting relevant tools based on rigidity and shape than size. In some LBD patients, the difficulties persisted even in the 2-Choice condition. Our findings confirm that tool use disorders result from impaired technical reasoning, leading patients to meet difficulties in selecting tools based on their physical properties. We also go further by showing that these difficulties can decrease as the choice is reduced, at least for some properties, opening new avenues for rehabilitation programs. (JINS, 2018, 24, 524-529).

Steered Molecular Dynamics Simulations Predict Conformational Stability of Glutamate Receptors.

PubMed

Musgaard, Maria; Biggin, Philip C

2016-09-26

The stability of protein-protein interfaces can be essential for protein function. For ionotropic glutamate receptors, a family of ligand-gated ion channels vital for normal function of the central nervous system, such an interface exists between the extracellular ligand binding domains (LBDs). In the full-length protein, the LBDs are arranged as a dimer of dimers. Agonist binding to the LBDs opens the ion channel, and briefly after activation the receptor desensitizes. Several residues at the LBD dimer interface are known to modulate desensitization, and conformational changes around these residues are believed to be involved in the state transition. The general hypothesis is that the interface is disrupted upon desensitization, and structural evidence suggests that the disruption might be substantial. However, when cross-linking the central part of this interface, functional data suggest that the receptor can still undergo desensitization, contradicting the hypothesis of major interface disruption. Here, we illustrate how opening the dimer interface using steered molecular dynamics (SMD) simulations, and analyzing the work values required, provides a quantitative measure for interface stability. For one subtype of glutamate receptors, which is regulated by ion binding to the dimer interface, we show that opening the interface without ions bound requires less work than with ions present, suggesting that ion binding indeed stabilizes the interface. Likewise, for interface mutants with longer-lived active states, the interface is more stable, while the work required to open the interface is reduced for less active mutants. Moreover, a cross-linked mutant can still undergo initial interface opening motions similar to the native receptor and at similar energetic cost. Thus, our results support that interface opening is involved in desensitization. Furthermore, they provide reconciliation of apparently opposing data and demonstrate that SMD simulations can give relevant biological insight into longer time scale processes without the need for expensive calculations.

Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer

PubMed Central

Trabucco, S E; Priedigkeit, N; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V

2018-01-01

Abstract Background Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. Patients and methods To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287–395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. Results We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3′ partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations. Conclusions Collectively, these data indicate that N-terminal ESR1 fusions involving exons 6–7 are a recurrent driver of endocrine therapy resistance and are impervious to ER-targeted therapies. PMID:29360925

Artemisia scoparia Enhances Adipocyte Development and Endocrine Function In Vitro and Enhances Insulin Action In Vivo

PubMed Central

Richard, Allison J.; Fuller, Scott; Fedorcenco, Veaceslav; Beyl, Robbie; Burris, Thomas P.; Mynatt, Randall; Ribnicky, David M.; Stephens, Jacqueline M.

2014-01-01

Background Failure of adipocytes to expand during periods of energy excess can result in undesirable metabolic consequences such as ectopic fat accumulation and insulin resistance. Blinded screening studies have indicated that Artemisia scoparia (SCO) extracts can enhance adipocyte differentiation and lipid accumulation in cultured adipocytes. The present study tested the hypothesis that SCO treatment modulates fat cell development and function in vitro and insulin sensitivity in adipose tissue in vivo. Methods In vitro experiments utilized a Gal4-PPARγ ligand binding domain (LBD) fusion protein-luciferase reporter assay to examine PPARγ activation. To investigate the ability of SCO to modulate adipogenesis and mature fat cell function in 3T3-L1 cells, neutral lipid accumulation, gene expression, and protein secretion were measured by Oil Red O staining, qRT-PCR, and immunoblotting, respectively. For the in vivo experiments, diet-induced obese (DIO) C57BL/6J mice were fed a high-fat diet (HFD) or HFD containing 1% w/w SCO for four weeks. Body weight and composition, food intake, and fasting glucose and insulin levels were measured. Phospho-activation and expression of insulin-sensitizing proteins in epididymal adipose tissue (eWAT) were measured by immunoblotting. Results Ethanolic extracts of A. scoparia significantly activated the PPARγ LBD and enhanced lipid accumulation in differentiating 3T3-L1 cells. SCO increased the transcription of several PPARγ target genes in differentiating 3T3-L1 cells and rescued the negative effects of tumor necrosis factor α on production and secretion of adiponectin and monocyte chemoattractant protein-1 in fully differentiated fat cells. DIO mice treated with SCO had elevated adiponectin levels and increased phosphorylation of AMPKα in eWAT when compared to control mice. In SCO-treated mice, these changes were also associated with decreased fasting insulin and glucose levels. Conclusion SCO has metabolically beneficial effects on adipocytes in vitro and adipose tissue in vivo, highlighting its potential as a metabolically favorable botanical supplement. PMID:24915004

CSF tau and β-amyloid predict cerebral synucleinopathy in autopsied Lewy body disorders.

PubMed

Irwin, David J; Xie, Sharon X; Coughlin, David; Nevler, Naomi; Akhtar, Rizwan S; McMillan, Corey T; Lee, Edward B; Wolk, David A; Weintraub, Daniel; Chen-Plotkin, Alice; Duda, John E; Spindler, Meredith; Siderowf, Andrew; Hurtig, Howard I; Shaw, Leslie M; Grossman, Murray; Trojanowski, John Q

2018-03-20

To test the association of antemortem CSF biomarkers with postmortem pathology in Lewy body disorders (LBD). Patients with autopsy-confirmed LBD (n = 24) and autopsy-confirmed Alzheimer disease (AD) (n = 23) and cognitively normal (n = 36) controls were studied. In LBD, neuropathologic criteria defined Lewy body α-synuclein (SYN) stages with medium/high AD copathology (SYN + AD = 10) and low/no AD copathology (SYN - AD = 14). Ordinal pathology scores for tau, β-amyloid (Aβ), and SYN pathology were averaged across 7 cortical regions to obtain a global cerebral score for each pathology. CSF total tau (t-tau), phosphorylated tau at threonine 181 , and Aβ 1-42 levels were compared between LBD and control groups and correlated with global cerebral pathology scores in LBD with linear regression. Diagnostic accuracy for postmortem categorization of LBD into SYN + AD vs SYN - AD or neocortical vs brainstem/limbic SYN stage was tested with receiver operating curves. SYN + AD had higher CSF t-tau (mean difference 27.0 ± 8.6 pg/mL) and lower Aβ 1-42 (mean difference -84.0 ± 22.9 g/mL) compared to SYN - AD ( p < 0.01, both). Increasing global cerebral tau and plaque scores were associated with higher CSF t-tau ( R 2 = 0.15-0.16, p < 0.05, both) and lower Aβ 1-42 ( R 2 = 0.43-0.49, p < 0.001, both), while increasing cerebral SYN scores were associated with lower CSF Aβ 1-42 ( R 2 = 0.31, p < 0.001) and higher CSF t-tau/Aβ 1-42 ratio ( R 2 = 0.27, p = 0.01). CSF t-tau/Aβ 1-42 ratio had 100% specificity and 90% sensitivity for SYN + AD, and CSF Aβ 1-42 had 77% specificity and 82% sensitivity for neocortical SYN stage. Higher antemortem CSF t-tau/Aβ 1-42 and lower Aβ 1-42 levels are predictive of increasing cerebral AD and SYN pathology. These biomarkers may identify patients with LBD vulnerable to cortical SYN pathology who may benefit from both SYN and AD-targeted disease-modifying therapies. © 2018 American Academy of Neurology.

Synthesis and evaluation of 2-halogenated-1,1-bis(4-hydroxyphenyl)-2-(3-hydroxyphenyl)-ethylenes as potential estrogen receptor-targeted radiodiagnostic and radiotherapeutic agents.

PubMed

Hanson, Robert N; Tongcharoensirikul, Pakamas; Barnsley, Kelton; Ondrechen, Mary Jo; Hughes, Alun; DeSombre, Eugene R

2015-04-01

A series of three 1,1-bis(4-hydroxyphenyl)-2-(3-hydroxyphenyl)-ethylene derivatives was prepared and evaluated as potential estrogen receptor imaging agents. The compounds display high binding affinity compared to estradiol, with the 2-iodo and 2-bromo-derivatives expressing higher affinity than the parent 2-nonhalogenated derivative. Evaluation in immature female rats also indicate that the compounds were all full estrogenic agonists with potencies in the same order of activity (I∼Br>H). Computational analysis of the interactions between the ligands and ERα-LBD demonstrated positive contribution of halide to binding properties. In preparation for studies using the radiohalogenated analogs, the corresponding protected 2-(tributylstannyl) derivative was prepared and converted to the corresponding 2-iodo-product. Copyright © 2015 Elsevier Inc. All rights reserved.

Teaching Strategies to Promote Concept Learning by Design Challenges

ERIC Educational Resources Information Center

Van Breukelen, Dave; Van Meel, Adrianus; De Vries, Marc

2017-01-01

Background: This study is the second study of a design-based research, organised around four studies, that aims to improve student learning, teaching skills and teacher training concerning the design-based learning approach called Learning by Design (LBD). Purpose: LBD uses the context of design challenges to learn, among other things, science.…

Stress and burden among caregivers of patients with Lewy body dementia.

PubMed

Leggett, Amanda N; Zarit, Steven; Taylor, Angela; Galvin, James E

2011-02-01

Patients with Lewy body dementia (LBD) may present a unique set of symptoms and challenges to family caregivers compared with other types of dementia. Prominent difficulties include motor impairment, activities of daily living (ADLs) disability, recurrent behavioral and emotional problems (BEPs), and diagnostic difficulties. These problems are likely to affect caregivers' subjective burden. The present study used data from an Internet survey conducted by the Lewy Body Dementia Association. Respondents were 611 people who indicated that they were currently involved in the care of their relative with LBD. Subjective burden was assessed with a 12-item short version of the Zarit Burden Interview. A factor analysis revealed 3 dimensions of burden: role strain, personal strain, and worry about performance. Multiple regressions were used to examine predictors of these dimensions. BEPs, ADL disability, isolation, caregiver age, and patient gender were significant predictors of specific factors. Falls, formal service use, difficulty finding a physician, and evaluation of the physician had no significant associations with burden. These findings highlight burden experiences by caregivers of patients with LBD and the impact of BEPs, ADL assistance, and awareness about LBD on subjective burden.

False Recognition in Lewy-Body Disease and Frontotemporal Dementia

ERIC Educational Resources Information Center

de Boysson, C.; Belleville, S.; Phillips, N. A.; Johns, E. K.; Goupil, D.; Souchay, C.; Bouchard, R.; Chertkow, H.

2011-01-01

The primary goal of this study was to evaluate the false recognition phenomenon in persons with frontotemporal dementia (FTD) and those with Lewy-body disease (LBD). Patients with LBD (n=10) or FTD (n=15) and their corresponding controls (n=30) were subjected to the Deese-Roediger-McDermott (DRM) paradigm to induce false recognition. Patients were…

Concept Learning by Direct Current Design Challenges in Secondary Education

ERIC Educational Resources Information Center

van Breukelen, Dave H. J.; de Vries, Marc J.; Schure, Frank A.

2017-01-01

This paper presents a mixed methods study in which 77 students and 3 teachers took part, that investigated the practice of Learning by Design (LBD). The study is part of a series of studies, funded by the Netherlands Organisation for Scientific Research, that aims to improve student learning, teaching skills and teacher training. LBD uses the…

46 CFR 69.209 - Calculation of tonnages.

Code of Federal Regulations, 2010 CFR

2010-10-01

....67 LBD/100. (2) The gross tonnage of a vessel with a hull that approximates in shape a rectangular geometric solid (barge-shape) is 0.84 LBD/100. (3) The gross tonnage of a multi-hull vessel is the sum of... structure in tons of 100 cubic feet is added to the tonnage of the hull to establish the vessel's gross...

A Location-Based Duplex Scheme for Cost Effective Rural Broadband Connectivity Using IEEE 802.22 Cognitive Radio Based Wireless Regional Area Networks

NASA Astrophysics Data System (ADS)

Kalidoss, R.; Bhagyaveni, M. A.; Vishvaksenan, K. S.

2014-08-01

The search for a method of utilizing the scarce spectrum in an efficient manner is an active area of research in both academic and industrial communities. IEEE 802.22 is a standard for wireless regional area network (WRAN) based on cognitive radio (CR) that operates over underutilized portions of TV bands (54-862 MHz). Time division duplex (TDD)-based WRAN cells have such advantages as dynamic traffic allocation, traffic asymmetry to users and ease of spectrum allocation. However, these cells suffer from severe cross time slot (CTS) interference when the frames of the cells are not synchronized with adjacent WRAN cells. In this paper, we evaluate the location-based duplex (LBD) scheme for eliminating the CTS interference. The proposed LBD system is much more flexible and efficient in providing asymmetric data service and eliminating CTS interference by exploiting the advantages of both TDD and frequency division duplex (FDD) schemes. We also compare the performance of LBD systems with virtual cell concepts. Furthermore, our simulation results reveal that LBD-based systems outperform the virtual cell approach in terms of the low signal-to-interference (SIR) ratio requirement by mitigating the effects of CTS.

Healing process of vascular cutting edge using an Nd:YAG laser bipolar dissector.

PubMed

Morita, T; Ishida, K; Ookubo, K; Tanaka, K; Nakamura, H; Daikuzono, N

1995-08-01

The wound healing process was histopathologically investigated in a rabbit femoral artery (n = 48) after transection using a laser bipolar dissector (LBD, 1064nm the Nd:YAG bipolar contact laser) with laser power of 13W in 0.5-sec pulses. The cutting edges were harvested immediately (n = 6) and at 1 (n = 6), 4 (n = 6), and 7 (n = 6) days, 2 (n = 6), 3 (n = 6), and 4 (n = 6) weeks, and 6 months (n = 6), and evaluated by light microscopy. During the postoperative period, no perforation was seen in the 48 transected sites with the LBD. The healing process after LBD transection was accomplished within 2 weeks by organization of the intraluminal thrombus and by the formation of granulation tissue outside the adventitia of vessels. Characteristic morphological changes after LBD transection were recognized in the tapering area, i.e., cartilage and bone formation. Cartilaginous foci (n = 6) were observed in the media at 4 weeks after transection, and osseous foci (n = 3) in subendothelial space at 6 months. These observations may suggest that the heterotopic cartilaginous and osseous metaplasia of a vessel wall may be a result of the biostimulative effects of the Nd:YAG laser.

Bisphenol A affects androgen receptor function via multiple mechanisms.

PubMed

Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R

2013-05-25

Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.

Targeting androgen receptor and JunD interaction for prevention of prostate cancer progression.

PubMed

Mehraein-Ghomi, Farideh; Kegel, Stacy J; Church, Dawn R; Schmidt, Joseph S; Reuter, Quentin R; Saphner, Elizabeth L; Basu, Hirak S; Wilding, George

2014-05-01

Multiple studies show that reactive oxygen species (ROS) play a major role in prostate cancer (PCa) development and progression. Previously, we reported an induction of Spermidine/Spermine N(1) -Acetyl Transferase (SSAT) by androgen-activated androgen receptor (AR)-JunD protein complex that leads to over-production of ROS in PCa cells. In our current research, we identify small molecules that specifically block AR-JunD in this ROS-generating metabolic pathway. A high throughput assay based on Gaussia Luciferase reconstitution was used to identify inhibitors of the AR-JunD interaction. Selected hits were further screened using a fluorescence polarization competitor assay to eliminate those that bind to the AR Ligand Binding Domain (LBD), in order to identify molecules that specifically target events downstream to androgen activation of AR. Eleven molecules were selected for studies on their efficacy against ROS generation and growth of cultured human PCa cells by DCFH dye-oxidation assay and DNA fluorescence assay, respectively. In situ Proximity Ligation Assay (PLA), SSAT promoter-luciferase reporter assay, and western blotting of apoptosis and cell cycle markers were used to study mechanism of action of the lead compound. Selected lead compound GWARJD10 with EC(50) 10 μM against ROS production was shown to block AR-JunD interaction in situ as well as block androgen-induced SSAT gene expression at IC(50) 5 μM. This compound had no effect on apoptosis markers, but reduced cyclin D1 protein level. Inhibitor of AR-JunD interaction, GWARJD10 shows promise for prevention of progression of PCa at an early stage of the disease by blocking growth and ROS production. © 2014 Wiley Periodicals, Inc.

A calreticulin-dependent nuclear export signal is involved in the regulation of liver receptor homologue-1 protein folding.

PubMed

Yang, Feng-Ming; Feng, Shan-Jung; Lai, Tsai-Chun; Hu, Meng-Chun

2015-10-15

As an orphan member of the nuclear receptor family, liver receptor homologue-1 (LRH-1) controls a tremendous range of transcriptional programmes that are essential for metabolism and hormone synthesis. Our previous studies have shown that nuclear localization of the LRH-1 protein is mediated by two nuclear localization signals (NLSs) that are karyopherin/importin-dependent. It is unclear whether LRH-1 can be actively exported from the nucleus to the cytoplasm. In the present study, we describe a nuclear export domain containing two leucine-rich motifs [named nuclear export signal (NES)1 and NES2] within the ligand-binding domain (LBD). Mutation of leucine residues in NES1 or NES2 abolished nuclear export, indicating that both NES1 and NES2 motifs are essential for full nuclear export activity. This NES-mediated nuclear export was insensitive to the chromosomal region maintenance 1 (CRM1) inhibitor leptomycin B (LMB) or to CRM1 knockdown. However, knockdown of calreticulin (CRT) prevented NES-mediated nuclear export. Furthermore, our data show that CRT interacts with LRH-1 and is involved in the nuclear export of LRH-1. With full-length LRH-1, mutation of NES1 led to perinuclear accumulation of the mutant protein. Immunofluorescence analysis showed that these perinuclear aggregates were co-localized with the centrosome marker, microtubule-associated protein 1 light chain 3 (LC3), ubiquitin and heat shock protein 70 (Hsp70), indicating that the mutant was misfolded and sequestered into aggresome-like structures via the autophagic clearance pathway. Our study demonstrates for the first time that LRH-1 has a CRT-dependent NES which is not only required for cytoplasmic trafficking, but also essential for correct protein folding to avoid misfolding-induced aggregation. © 2015 Authors; published by Portland Press Limited.

Motor performance differentiates individuals with Lewy body dementia, Parkinson's and Alzheimer's disease.

PubMed

Fritz, Nora E; Kegelmeyer, Deborah A; Kloos, Anne D; Linder, Shannon; Park, Ariane; Kataki, Maria; Adeli, Anahita; Agrawal, Punit; Scharre, Douglas W; Kostyk, Sandra K

2016-10-01

Differential diagnosis of dementia with Lewy bodies (DLB), Parkinson's disease with dementia (PDD), Parkinson's disease (PD) and Alzheimer's disease (AD) is challenging. Comparative motor profiles of these neurodegenerative disorders may aid in earlier diagnosis but have not been extensively studied. Groups were rigorously matched by age, education, and sex. DLB/PDD participants were matched by Mini-Mental State Examination Score to individuals with AD and by Unified Parkinson's Disease Rating Scale motor scores to individuals with PD. Gait, balance, dual task walking and hand dexterity measures were compared between a combined group (n=21) of individuals with Lewy body dementia (LBD) consisting of those with DLB (n=11) and PDD (n=10) to individuals with PD (n=21) or AD (n=21). Individuals at the same disease stage with LBD walked significantly slower with shorter stride lengths (p<0.05), demonstrated poorer balance on both the Tinetti and Berg Balance Scale, and poorer performance on dual-task and figure-of-eight walking compared to PD and AD (p<0.05 for all) groups. Upper extremity coordination on the 9-hole peg test differentiated LBD from both PD and AD and was the only motor test in which individuals with AD performed worse than those with PD. Tinetti balance subscores were significantly lower in PDD compared to DLB participants (10.4±2.3 versus 12.8±2.3; p=0.027). Motor features distinguish individuals with LBD from those with AD and PD. Measures of gait, balance and finger dexterity provide an additional means of differentiating individuals with LBD from those with AD and PD. Copyright © 2016 Elsevier B.V. All rights reserved.

TBECH, 1,2-dibromo-4-(1,2 dibromoethyl) cyclohexane, alters androgen receptor regulation in response to mutations associated with prostate cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kharlyngdoh, Joubert Banjop; Asnake, Solomon; Prad

Point mutations in the AR ligand-binding domain (LBD) can result in altered AR structures leading to changes of ligand specificity and functions. AR mutations associated to prostate cancer (PCa) have been shown to result in receptor activation by non-androgenic substances and anti-androgenic drugs. Two AR mutations known to alter the function of anti-androgens are the AR{sub T877A} mutation, which is frequently detected mutation in PCa tumors and the AR{sub W741C} that is rare and has been derived in vitro following exposure of cells to the anti-androgen bicalutamide. AR activation by non-androgenic environmental substances has been suggested to affect PCa progression.more » In the present study we investigated the effect of AR mutations (AR{sub W741C} and AR{sub T877A}) on the transcriptional activation following exposure of cells to an androgenic brominated flame retardant, 1,2-dibromo-4-(1,2 dibromoethyl) cyclohexane (TBECH, also named DBE-DBCH). The AR mutations resulted in higher interaction energies and increased transcriptional activation in response to TBECH diastereomer exposures. The AR{sub T877A} mutation rendered AR highly responsive to low levels of DHT and TBECH and led to increased AR nuclear translocation. Gene expression analysis showed a stronger induction of AR target genes in LNCaP cells (AR{sub T877A}) compared to T-47D cells (AR{sub WT}) following TBECH exposure. Furthermore, AR knockdown experiments confirmed the AR dependency of these responses. The higher sensitivity of AR{sub T877A} and AR{sub W741C} to low levels of TBECH suggests that cells with these AR mutations are more susceptible to androgenic endocrine disrupters. - Highlights: • TBECH, is an endocrine disrupting compound that differ in activity depending on AR structure and sequence. • TBECH interaction with the human AR-LBD containing the mutations W741C and T877A is increased compared to the wild type receptor • The mutations, W741C and T877A, are more potent than the wild type receptor at inducing AR nuclear translocation and transcriptional activation following TBECH exposure. • TBECH mediates action on androgen response genes via AR signaling.« less

Structural and Functional Neuroimaging of Visual Hallucinations in Lewy Body Disease: A Systematic Literature Review

PubMed Central

Cagnin, Annachiara; Bandmann, Oliver; Venneri, Annalena

2017-01-01

Patients with Lewy body disease (LBD) frequently experience visual hallucinations (VH), well-formed images perceived without the presence of real stimuli. The structural and functional brain mechanisms underlying VH in LBD are still unclear. The present review summarises the current literature on the neural correlates of VH in LBD, namely Parkinson’s disease (PD), and dementia with Lewy bodies (DLB). Following a systematic literature search, 56 neuroimaging studies of VH in PD and DLB were critically reviewed and evaluated for quality assessment. The main structural neuroimaging results on VH in LBD revealed grey matter loss in frontal areas in patients with dementia, and parietal and occipito-temporal regions in PD without dementia. Parietal and temporal hypometabolism was also reported in hallucinating PD patients. Disrupted functional connectivity was detected especially in the default mode network and fronto-parietal regions. However, evidence on structural and functional connectivity is still limited and requires further investigation. The current literature is in line with integrative models of VH suggesting a role of attention and perception deficits in the development of VH. However, despite the close relationship between VH and cognitive impairment, its associations with brain structure and function have been explored only by a limited number of studies. PMID:28714891

Narrative Organization Deficit in Lewy Body Disorders Is Related to Alzheimer Pathology

PubMed Central

Grossman, Murray; Irwin, David J.; Jester, Charles; Halpin, Amy; Ash, Sharon; Rascovsky, Katya; Weintraub, Daniel; McMillan, Corey T.

2017-01-01

Background: Day-to-day interactions depend on conversational narrative, and we examine here the neurobiological basis for difficulty organizing narrative discourse in patients with Lewy body disorders (LBD). Method: Narrative organization was examined in 56 non-aphasic LBD patients, including a non-demented cohort (n = 30) with Parkinson's disease (PD) or PD-Mild Cognitive Impairment PD-MCI,) and a cohort with mild dementia (n = 26) including PD-dementia (PDD) and dementia with Lewy bodies (DLB), with similar age and education but differing in MMSE (p < 0.001). We used a previously reported procedure that probes patients' judgments of the organization of brief, familiar narratives (e.g., going fishing, wrapping a present). A subgroup of 24 patients had MRI assessment of regional gray matter (GM) atrophy and cerebrospinal fluid (CSF) levels of biomarkers for Alzheimer's disease (AD) pathology, including beta amyloid (Aβ), total-tau (t-tau), and phosphorylated-tau (p-tau). Results: Mildly demented LBD patients had a significant deficit judging narratives compared to non-demented patients, but this deficit was not correlated with MMSE. Regression analyses instead related narrative organization to regions of frontal GM atrophy, and CSF levels of Aβ and t-tau associated with presumed AD pathology in these frontal regions. Conclusion: These findings are consistent with the hypothesis that CSF markers of AD pathology associated with frontal regions play a role in difficulty organizing narratives in LBD. PMID:28228714

Tool use in left-brain-damaged patients: Difficulties in reasoning but not in estimating the physical properties of objects.

PubMed

Faye, Alexandrine; Jacquin-Courtois, Sophie; Osiurak, François

2018-03-01

The purpose of this study was to deepen our understanding of the cognitive bases of human tool use based on the technical reasoning hypothesis (i.e., the reasoning-based approach). This approach assumes that tool use is supported by the ability to reason about an object's physical properties (e.g., length, weight, strength, etc.) to perform mechanical actions (e.g., lever). In this framework, an important issue is to understand whether left-brain-damaged (LBD) individuals with tool-use deficits are still able to estimate the physical object's properties necessary to use the tool. Eleven LBD patients and 12 control participants performed 3 original experimental tasks: Use-Length (visual evaluation of the length of a stick to bring down a target), Visual-Length (to visually compare objects of different lengths) and Addition-Length (to visually compare added lengths). Participants were also tested on conventional tasks: Familiar Tool Use and Mechanical Problem-Solving (novel tools). LBD patients had more difficulties than controls on both conventional tasks. No significant differences were observed for the 3 experimental tasks. These results extend the reasoning-based approach, stressing that it might not be the representation of length that is impaired in LBD patients, but rather the ability to generate mechanical actions based on physical object properties. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Narrative Organization Deficit in Lewy Body Disorders Is Related to Alzheimer Pathology.

PubMed

Grossman, Murray; Irwin, David J; Jester, Charles; Halpin, Amy; Ash, Sharon; Rascovsky, Katya; Weintraub, Daniel; McMillan, Corey T

2017-01-01

Background: Day-to-day interactions depend on conversational narrative, and we examine here the neurobiological basis for difficulty organizing narrative discourse in patients with Lewy body disorders (LBD). Method: Narrative organization was examined in 56 non-aphasic LBD patients, including a non-demented cohort ( n = 30) with Parkinson's disease (PD) or PD-Mild Cognitive Impairment PD-MCI,) and a cohort with mild dementia ( n = 26) including PD-dementia (PDD) and dementia with Lewy bodies (DLB), with similar age and education but differing in MMSE ( p < 0.001). We used a previously reported procedure that probes patients' judgments of the organization of brief, familiar narratives (e.g., going fishing, wrapping a present). A subgroup of 24 patients had MRI assessment of regional gray matter (GM) atrophy and cerebrospinal fluid (CSF) levels of biomarkers for Alzheimer's disease (AD) pathology, including beta amyloid (Aβ), total-tau ( t -tau), and phosphorylated-tau ( p -tau). Results: Mildly demented LBD patients had a significant deficit judging narratives compared to non-demented patients, but this deficit was not correlated with MMSE. Regression analyses instead related narrative organization to regions of frontal GM atrophy, and CSF levels of Aβ and t -tau associated with presumed AD pathology in these frontal regions. Conclusion: These findings are consistent with the hypothesis that CSF markers of AD pathology associated with frontal regions play a role in difficulty organizing narratives in LBD.

Updating impairments and the failure to explore new hypotheses following right brain damage.

PubMed

Stöttinger, Elisabeth; Guay, Carolyn Louise; Danckert, James; Anderson, Britt

2018-06-01

We have shown recently that damage to the right hemisphere impairs the ability to update mental models when evidence suggests an old model is no longer appropriate. We argue that this deficit is generic in the sense that it crosses multiple cognitive and perceptual domains. Here, we examined the nature of this updating impairment to determine more precisely the underlying mechanisms. We had right (RBD, N = 12) and left brain damaged (LBD, N = 10) patients perform versions of our picture-morphing task in which pictures gradually morph from one object (e.g., shark) to another (e.g., plane). Performance was contrasted against two groups of healthy older controls, one matched on age (HCO-age-matched, N = 9) and another matched on general level of cognitive ability (HCO-cognitively-matched, N = 9). We replicated our earlier findings showing that RBD patients took longer than LBD patients and HCOs to report seeing the second object in a sequence of morphing images. The groups did not differ when exposed to a morphing sequence a second time, or when responding to ambiguous images outside the morphing context. This indicates that RBD patients have little difficulty alternating between known representations or labeling ambiguous images. Instead, the difficulty lies in generating alternate hypotheses for ambiguous information. Lesion overlay analyses, although speculative given the sample size, are consistent with our fMRI work in healthy individuals in implicating the anterior insular cortex as critical for updating mental models.

The effect of a backrest and seatpan inclination on sitting discomfort and trunk muscle activation in subjects with extension-related low back pain.

PubMed

Curran, Máire; Dankaerts, Wim; O'Sullivan, Peter; O'Sullivan, Leonard; O'Sullivan, Kieran

2014-01-01

Few studies have demonstrated that seating modifications reduce low back pain (LBP). One recent study found that a forward-inclined seatpan reduced low back discomfort (LBD), however this was only examined in people with flexion-related LBP. No study has yet investigated its effectiveness among people with extension-related LBP. This crossover study examined 12 subjects with extension-related LBP. Sitting discomfort and surface electromyography of three trunk muscles were recorded during a 10-minute typing task while sitting with two different seatpan inclinations, both with and without a backrest. LBD (p < 0.001) and overall body discomfort (OBD) (p = 0.016) were significantly greater on the forward-inclined seatpan. The backrest did not alter trunk muscle activation or sitting discomfort. The results demonstrate that in a specific subgroup of people with extension-related LBP, increasing forward seatpan inclination significantly increased LBD and OBD. Future research should consider matching ergonomics prescriptions according to the individual presentation of people with LBP.

Tool use disorders after left brain damage.

PubMed

Baumard, Josselin; Osiurak, François; Lesourd, Mathieu; Le Gall, Didier

2014-01-01

In this paper we review studies that investigated tool use disorders in left-brain damaged (LBD) patients over the last 30 years. Four tasks are classically used in the field of apraxia: Pantomime of tool use, single tool use, real tool use and mechanical problem solving. Our aim was to address two issues, namely, (1) the role of mechanical knowledge in real tool use and (2) the cognitive mechanisms underlying pantomime of tool use, a task widely employed by clinicians and researchers. To do so, we extracted data from 36 papers and computed the difference between healthy subjects and LBD patients. On the whole, pantomime of tool use is the most difficult task and real tool use is the easiest one. Moreover, associations seem to appear between pantomime of tool use, real tool use and mechanical problem solving. These results suggest that the loss of mechanical knowledge is critical in LBD patients, even if all of those tasks (and particularly pantomime of tool use) might put differential demands on semantic memory and working memory.

Tool use disorders after left brain damage

PubMed Central

Baumard, Josselin; Osiurak, François; Lesourd, Mathieu; Le Gall, Didier

2014-01-01

In this paper we review studies that investigated tool use disorders in left-brain damaged (LBD) patients over the last 30 years. Four tasks are classically used in the field of apraxia: Pantomime of tool use, single tool use, real tool use and mechanical problem solving. Our aim was to address two issues, namely, (1) the role of mechanical knowledge in real tool use and (2) the cognitive mechanisms underlying pantomime of tool use, a task widely employed by clinicians and researchers. To do so, we extracted data from 36 papers and computed the difference between healthy subjects and LBD patients. On the whole, pantomime of tool use is the most difficult task and real tool use is the easiest one. Moreover, associations seem to appear between pantomime of tool use, real tool use and mechanical problem solving. These results suggest that the loss of mechanical knowledge is critical in LBD patients, even if all of those tasks (and particularly pantomime of tool use) might put differential demands on semantic memory and working memory. PMID:24904487

Parkinson's disease--the debate on the clinical phenomenology, aetiology, pathology and pathogenesis.

PubMed

Jenner, Peter; Morris, Huw R; Robbins, Trevor W; Goedert, Michel; Hardy, John; Ben-Shlomo, Yoav; Bolam, Paul; Burn, David; Hindle, John V; Brooks, David

2013-01-01

The definition of Parkinson's disease (PD) is changing with the expansion of clinical phenomenology and improved understanding of environmental and genetic influences that impact on the pathogenesis of the disease at the cellular and molecular level. This had led to debate and discussion with as yet, no general acceptance of the direction that change should take either at the level of diagnosis or of what should and should not be sheltered under an umbrella of PD. This article is one contribution to this on-going discussion. There are two different themes running through the article--widening the definition of PD/LBD/synucleinopathies and the heterogeneity that exists within PD itself from a clinical, pathological and genetic perspective. The conclusion reached is that in the future, further diagnostic categories will need to be recognized. These are likely to include--Parkinson's syndrome, Parkinson's syndrome likely to be Lewy body PD, clinical PD (defined by QSBB criteria), Lewy body disease (PD, LBD, REM SBD) and synucleinopathies (including LBD, MSA).

Practical uses for ecdysteroids in mammals including humans: an update

PubMed Central

Lafont, R.; Dinan, L.

2003-01-01

Ecdysteroids are widely used as inducers for gene-switch systems based on insect ecdysteroid receptors and genes of interest placed under the control of ecdysteroid-response elements. We review here these systems, which are currently mainly used in vitro with cultured cells in order to analyse the role of a wide array of genes, but which are expected to represent the basis for future gene therapy strategies. Such developments raise several questions, which are addressed in detail. First, the metabolic fate of ecdysteroids in mammals, including humans, is only poorly known, and the rapid catabolism of ecdysteroids may impede their use as in vivo inducers. A second set of questions arose in fact much earlier with the pioneering “heterophylic” studies of Burdette in the early sixties on the pharmacological effects of ecdysteroids on mammals. These and subsequent studies showed a wide range of effects, most of them being beneficial for the organism (e.g. hypoglycaemic, hypocholesterolaemic, anabolic). These effects are reviewed and critically analysed, and some hypotheses are proposed to explain the putative mechanisms involved. All of these pharmacological effects have led to the development of a wide array of ecdysteroid-containing preparations, which are primarily used for their anabolic and/or “adaptogenic” properties on humans (or horses or dogs). In the same way, increasing numbers of patents have been deposited concerning various beneficial effects of ecdysteroids in many medical or cosmetic domains, which make ecdysteroids very attractive candidates for several practical uses. It may be questioned whether all these pharmacological actions are compatible with the development of ecdysteroid-inducible gene switches for gene therapy, and also if ecdysteroids should be classified among doping substances. Abbreviation: 20E 20-hydroxyecdysone 2d20E 2-deoxy-20-hydroxyecdysone 2dE 2-deoxyecdysone BAH bisacylhydrazine BmEcR Bombyx mori EcR CfEcR Choristoneura fumiferana EcR CfUSP Choristoneura fumiferana USP CHO Chinese hamster ovary CMV cytomegalovirus DBD DNA-binding domain DmEcR Drosophila melanogaster EcR AbbE ecdysone EcR ecdysteroid receptor EcRE ecdysteroid response element EHT effective half-time ERE oestrogen response element GR glucocorticoid receptor GRE glucocorticoid response element HEK human embryonic kidney HvEcR Heliothis virescens EcR LBD ligand binding domain murA muristerone A PKA protein kinase A polB polypodine B ponA ponasterone A PPAR peroxisome proliferator-activated receptor RAR retinoic acid receptor RXR retinoid X receptor TR thyroid receptor USP ultraspiracle VDR vitamin D receptor VEGF vascular endothelial growth factor PMID:15844229

Proteomic identification of Profilin1 as a corepressor of estrogen receptor alpha in MCF7 breast cancer cells.

PubMed

Kanaujiya, Jitendra Kumar; Lochab, Savita; Kapoor, Isha; Pal, Pooja; Datta, Dipak; Bhatt, Madan L B; Sanyal, Sabyasachi; Behre, Gerhard; Trivedi, Arun Kumar

2013-07-01

Nuclear receptor coregulators play an important role in the transcriptional regulation of nuclear receptors. In the present study, we aimed to identify estrogen receptor α (ERα) interacting proteins in Tamoxifen treated MCF7 cells. Using in vitro GST-pull down assay with ERα ligand-binding domain (ERα-LBD) and MS-based proteomics approach we identified Profilin1 as a novel ERα interacting protein. Profilin1 contains I/LXX/L/H/I amino acid signature motif required for corepressor interaction with ERα. We show that these two proteins physically interact with each other both in vitro as well as in vivo by GST-pull down and coimmunoprecipitation, respectively. We further show that these two proteins also colocalize together in the nucleus. Previous studies have reported reduced expression of Profilin1 in breast cancer; and here we found that Tamoxifen increases Profilin1 expression in MCF7 cells. Our data demonstrate that over expression of Profilin1 inhibits ERα-mediated transcriptional activation as well as its downstream target genes in ERα positive breast cancer cells MCF7. In addition, Profilin1 overexpression in MCF7 cells leads to inhibition of cell proliferation that apparently is due to enhanced apoptosis. In nutshell, these data indicate that MS-based proteomics approach identifies a novel ERα interacting protein Profilin1 that serves as a putative corepressor of ERα functions. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Gain-of-Function Alleles in Caenorhabditis elegans Nuclear Hormone Receptor nhr-49 Are Functionally Distinct

PubMed Central

Lee, Kayoung; Goh, Grace Ying Shyen; Wong, Marcus Andrew; Klassen, Tara Leah

2016-01-01

Nuclear hormone receptors (NHRs) are transcription factors that regulate numerous physiological and developmental processes and represent important drug targets. NHR-49, an ortholog of Hepatocyte Nuclear Factor 4 (HNF4), has emerged as a key regulator of lipid metabolism and life span in the nematode worm Caenorhabditis elegans. However, many aspects of NHR-49 function remain poorly understood, including whether and how it regulates individual sets of target genes and whether its activity is modulated by a ligand. A recent study identified three gain-of-function (gof) missense mutations in nhr-49 (nhr-49(et7), nhr-49(et8), and nhr-49(et13), respectively). These substitutions all affect the ligand-binding domain (LBD), which is critical for ligand binding and protein interactions. Thus, these alleles provide an opportunity to test how three specific residues contribute to NHR-49 dependent gene regulation. We used computational and molecular methods to delineate how these mutations alter NHR-49 activity. We find that despite originating from a screen favoring the activation of specific NHR-49 targets, all three gof alleles cause broad upregulation of NHR-49 regulated genes. Interestingly, nhr-49(et7) and nhr-49(et8) exclusively affect nhr-49 dependent activation, whereas the nhr-49(et13) surprisingly affects both nhr-49 mediated activation and repression, implicating the affected residue as dually important. We also observed phenotypic non-equivalence of these alleles, as they unexpectedly caused a long, short, and normal life span, respectively. Mechanistically, the gof substitutions altered neither protein interactions with the repressive partner NHR-66 and the coactivator MDT-15 nor the subcellular localization or expression of NHR-49. However, in silico structural modeling revealed that NHR-49 likely interacts with small molecule ligands and that the missense mutations might alter ligand binding, providing a possible explanation for increased NHR-49 activity. In sum, our findings indicate that the three nhr-49 gof alleles are non-equivalent, and highlight the conserved V411 residue affected by et13 as critical for gene activation and repression alike. PMID:27618178

Tool use and mechanical problem solving in apraxia.

PubMed

Goldenberg, G; Hagmann, S

1998-07-01

Moorlaas (1928) proposed that apraxic patients can identify objects and can remember the purpose they have been made for but do not know the way in which they must be used to achieve that purpose. Knowledge about the use of objects and tools can have two sources: It can be based on retrieval of instructions of use from semantic memory or on a direct inference of function from structure. The ability to infer function from structure enables subjects to use unfamiliar tools and to detect alternative uses of familiar tools. It is the basis of mechanical problem solving. The purpose of the present study was to analyze retrieval of instruction of use, mechanical problem solving, and actual tool use in patients with apraxia due to circumscribed lesions of the left hemisphere. For assessing mechanical problem solving we developed a test of selection and application of novel tools. Access to instruction of use was tested by pantomime of tool use. Actual tool use was examined for the same familiar tools. Forty two patients with left brain damage (LBD) and aphasia, 22 patients with right brain damage (RBD) and 22 controls were examined. Only LBD patients differed from controls on all tests. RBD patients had difficulties with the use but not with the selection of novel tools. In LBD patients there was a significant correlation between pantomime of tool use and novel tool selection but there were single cases who scored in the defective range on one of these tests and normally on the other. Analysis of LBD patients' lesions suggested that frontal lobe damage does not disturb novel tool selection. Only LBD patients who failed on pantomime of object use and on novel tool selection committed errors in actual use of familiar tools. The finding that mechanical problem solving is invariably defective in apraxic patients who commit errors with familiar tools is in good accord with clinical observations, as the gravity of their errors goes beyond what one would expect as a mere sequel of loss of access to instruction of use.

Idiopathic REM Sleep Behavior Disorder in the development of Parkinson’s Disease

PubMed Central

Boeve, Bradley F.

2016-01-01

Summary Parkinson’s disease (PD) is a progressive neurodegenerative disorder associated with Lewy body disease (LBD) pathology in central and peripheral nervous system structures. While the etiology of PD is not fully understood, recent clinicopathologic analyses by Braak and colleagues have led to the development of a staging system of LBD pathology in the evolution of prototypical PD. This system posits a relatively predictable topography of progression of LBD pathology in the central nervous system, from olfactory structures and the medulla, which then progresses rostrally from the medulla to the pons, then midbrain/substantia nigra, then limbic, and then neocortical structures. If this topography and temporal evolution of LBD pathology indeed occur, one could hypothesize that other manifestations of LBD which reflect degeneration of olfactory and pontomedullary structures may begin many years prior to the development of prominent nigral degeneration and the associated parkinsonian features of classic PD. One such manifestation of prodromal PD is rapid eye movement (REM) sleep behavior disorder (RBD), which is a parasomnia manifested by vivid dreams associated with dream enactment behavior during REM sleep. Animal and human studies have implicated lesions or dysfunction in REM sleep and motor control circuitry in the pontomedullary structures cause RBD phenomenology, and degeneration of these structures could explain the presence of RBD years or decades prior to the onset of parkinsonism in those who develop PD. This review incorporates the rapidly growing literature on RBD and other prodromal features of PD as it pertains to the Braak staging system, and presents a framework from which many hypotheses can be (and already are being) tested. An important outcome of this framework will be to determine the natural history of RBD and associated features in the evolution to PD in the current era of no disease-modifying therapies – these natural history data will permit the development of clinical trail methodology with key measures and adequate power to detect if such therapies delay the onset or prevent the development of PD and associated morbidity. PMID:23578773

Molecular Transducers from Roots Are Triggered in Arabidopsis Leaves by Root-Knot Nematodes for Successful Feeding Site Formation: A Conserved Post-Embryogenic De novo Organogenesis Program?

PubMed Central

Olmo, Rocío; Cabrera, Javier; Moreno-Risueno, Miguel A.; Fukaki, Hidehiro; Fenoll, Carmen; Escobar, Carolina

2017-01-01

Root-knot nematodes (RKNs; Meloidogyne spp.) induce feeding cells (giant cells; GCs) inside a pseudo-organ (gall) from still unknown root cells. Understanding GCs ontogeny is essential to the basic knowledge of RKN–plant interaction and to discover novel and effective control strategies. Hence, we report for the first time in a model plant, Arabidopsis, molecular, and cellular features concerning ectopic de novo organogenesis of RKNs GCs in leaves. RKNs induce GCs in leaves with irregular shape, a reticulated cytosol, and fragmented vacuoles as GCs from roots. Leaf cells around the nematode enter G2-M shown by ProCycB1;1:CycB1;1(NT)-GUS expression, consistent to multinucleated GCs. In addition, GCs nuclei present irregular and varied sizes. All these characteristics mentioned, being equivalent to GCs in root-galls. RKNs complete their life cycle forming a gall/callus-like structure in the leaf vascular tissues resembling auxin-induced callus with an auxin-response maxima, indicated by high expression of DR5::GUS that is dependent on leaf auxin-transport. Notably, induction of leaves calli/GCs requires molecular components from roots crucial for lateral roots (LRs), auxin-induced callus and root-gall formation, i.e., LBD16. Hence, LBD16 is a xylem pole pericycle specific and local marker in LR primordia unexpectedly induced locally in the vascular tissue of leaves after RKN infection. LBD16 is also fundamental for feeding site formation as RKNs could not stablish in 35S::LBD16-SRDX leaves, and likely it is also a conserved molecular hub between biotic and developmental signals in Arabidopsis either in roots or leaves. Moreover, RKNs induce the ectopic development of roots from leaf and root-galls, also formed in mutants compromised in LR formation, arf7/arf19, slr, and alf4. Therefore, nematodes must target molecular signatures to induce post-embryogenic de novo organogenesis through the LBD16 callus formation pathway partially different from those prevalent during normal LR development. PMID:28603536

Molecular Transducers from Roots Are Triggered in Arabidopsis Leaves by Root-Knot Nematodes for Successful Feeding Site Formation: A Conserved Post-Embryogenic De novo Organogenesis Program?

PubMed

Olmo, Rocío; Cabrera, Javier; Moreno-Risueno, Miguel A; Fukaki, Hidehiro; Fenoll, Carmen; Escobar, Carolina

2017-01-01

Root-knot nematodes (RKNs; Meloidogyne spp.) induce feeding cells (giant cells; GCs) inside a pseudo-organ (gall) from still unknown root cells. Understanding GCs ontogeny is essential to the basic knowledge of RKN-plant interaction and to discover novel and effective control strategies. Hence, we report for the first time in a model plant, Arabidopsis, molecular, and cellular features concerning ectopic de novo organogenesis of RKNs GCs in leaves. RKNs induce GCs in leaves with irregular shape, a reticulated cytosol, and fragmented vacuoles as GCs from roots. Leaf cells around the nematode enter G2-M shown by ProCycB1;1:CycB1;1(NT)-GUS expression, consistent to multinucleated GCs. In addition, GCs nuclei present irregular and varied sizes. All these characteristics mentioned, being equivalent to GCs in root-galls. RKNs complete their life cycle forming a gall/callus-like structure in the leaf vascular tissues resembling auxin-induced callus with an auxin-response maxima, indicated by high expression of DR5::GUS that is dependent on leaf auxin-transport. Notably, induction of leaves calli/GCs requires molecular components from roots crucial for lateral roots (LRs), auxin-induced callus and root-gall formation, i.e., LBD16. Hence, LBD16 is a xylem pole pericycle specific and local marker in LR primordia unexpectedly induced locally in the vascular tissue of leaves after RKN infection. LBD16 is also fundamental for feeding site formation as RKNs could not stablish in 35S::LBD16-SRDX leaves, and likely it is also a conserved molecular hub between biotic and developmental signals in Arabidopsis either in roots or leaves. Moreover, RKNs induce the ectopic development of roots from leaf and root-galls, also formed in mutants compromised in LR formation, arf7/arf19 , slr , and alf4 . Therefore, nematodes must target molecular signatures to induce post-embryogenic de novo organogenesis through the LBD16 callus formation pathway partially different from those prevalent during normal LR development.

Mechanical problem-solving strategies in Alzheimer's disease and semantic dementia.

PubMed

Lesourd, Mathieu; Baumard, Josselin; Jarry, Christophe; Etcharry-Bouyx, Frédérique; Belliard, Serge; Moreaud, Olivier; Croisile, Bernard; Chauviré, Valérie; Granjon, Marine; Le Gall, Didier; Osiurak, François

2016-07-01

The goal of this study was to explore whether the tool-use disorders observed in Alzheimer's disease (AD) and semantic dementia (SD) are of the same nature as those observed in left brain-damaged (LBD) patients. Recent evidence indicates that LBD patients with apraxia of tool use encounter difficulties in solving mechanical problems, characterized by the absence of specific strategies. This pattern may show the presence of impaired mechanical knowledge, critical for both familiar and novel tool use. So, we explored the strategies followed by AD and SD patients in mechanical problem-solving tasks in order to determine whether mechanical knowledge is also impaired in these patients. We used a mechanical problem-solving task in both choice (i.e., several tools were proposed) and no-choice (i.e., only 1 tool was proposed) conditions. We analyzed quantitative data and strategy profiles. AD patients but not SD patients met difficulties in solving mechanical problem-solving tasks. However, the key finding is that AD patients, despite their difficulties, showed strategy profiles that are similar to that of SD patients or controls. Moreover, AD patients exhibited a strategy profile distinct from the one previously observed in LBD patients. Those observations lead us to consider that difficulties met by AD patients to solve mechanical problems or even to use familiar tools may not be caused by mechanical knowledge impairment per se. In broad terms, what we call apraxia of tool use in AD is certainly not the same as apraxia of tool use observed in LBD patients. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

The perception of positive and negative facial expressions by unilateral stroke patients.

PubMed

Abbott, Jacenta D; Wijeratne, Tissa; Hughes, Andrew; Perre, Diana; Lindell, Annukka K

2014-04-01

There remains conflict in the literature about the lateralisation of affective face perception. Some studies have reported a right hemisphere advantage irrespective of valence, whereas others have found a left hemisphere advantage for positive, and a right hemisphere advantage for negative, emotion. Differences in injury aetiology and chronicity, proportion of male participants, participant age, and the number of emotions used within a perception task may contribute to these contradictory findings. The present study therefore controlled and/or directly examined the influence of these possible moderators. Right brain-damaged (RBD; n=17), left brain-damaged (LBD; n=17), and healthy control (HC; n=34) participants completed two face perception tasks (identification and discrimination). No group differences in facial expression perception according to valence were found. Across emotions, the RBD group was less accurate thanthe HC group, however RBD and LBD group performancedid not differ. The lack of difference between RBD and LBD groups indicates that both hemispheres are involved in positive and negative expression perception. The inclusion of older adults and the well-defined chronicity range of the brain-damaged participants may have moderated these findings. Participant sex and general face perception ability did not influence performance. Furthermore, while the RBD group was less accurate than the LBD group when the identification task tested two emotions, performance of the two groups was indistinguishable when the number of emotions increased (four or six). This suggests that task demand moderates a study's ability to find hemispheric differences in the perception of facial emotion. Copyright © 2014 Elsevier Inc. All rights reserved.

Origin, timing, and gene expression profile of adventitious rooting in Arabidopsis hypocotyls and stems.

PubMed

Welander, Margareta; Geier, Thomas; Smolka, Anders; Ahlman, Annelie; Fan, Jing; Zhu, Li-Hua

2014-02-01

Adventitious root (AR) formation is indispensable for vegetative propagation, but difficult to achieve in many crops. Understanding its molecular mechanisms is thus important for such species. Here we aimed at developing a rooting protocol for direct AR formation in stems, locating cellular AR origins in stems and exploring molecular differences underlying adventitious rooting in hypocotyls and stems. In-vitro-grown hypocotyls or stems of wild-type and transgenic ecotype Columbia (Col-0) of Arabidopsis thaliana were rooted on rooting media. Anatomy of AR formation, qRT-PCR of some rooting-related genes and in situ GUS expression were carried out during rooting from hypocotyls and stems. We developed a rooting protocol for AR formation in stems and traced back root origins in stems by anatomical and in situ expression studies. Unlike rooting in hypocotyls, rooting in stems was slower, and AR origins were mainly from lateral parenchyma of vascular bundles and neighboring starch sheath cells as well as, to a lesser extent, from phloem cap and xylem parenchyma. Transcript levels of GH3-3, LBD16, LBD29, and LRP1 in hypocotyls and stems were similar, but transcript accumulation was delayed in stems. In situ expression signals of DR5::GUS, LBD16::GUS, LBD29::GUS, and rolB::GUS reporters in stems mainly occurred at the root initiation sites, suggesting their involvement in AR formation. We have developed an efficient rooting protocol using half-strength Lepoivre medium for studying AR formation in stems, traced back the cellular AR origins in stems, and correlated expression of rooting-related genes with root initiation sites.

Association between traditional clinical high-risk features and gene expression profile classification in uveal melanoma.

PubMed

Nguyen, Brandon T; Kim, Ryan S; Bretana, Maria E; Kegley, Eric; Schefler, Amy C

2018-02-01

To evaluate the association between traditional clinical high-risk features of uveal melanoma patients and gene expression profile (GEP). This was a retrospective, single-center, case series of patients with uveal melanoma. Eighty-three patients met inclusion criteria for the study. Patients were examined for the following clinical risk factors: drusen/retinal pigment epithelium (RPE) changes, vascularity on B-scan, internal reflectivity on A-scan, subretinal fluid (SRF), orange pigment, apical tumor height/thickness, and largest basal dimensions (LBD). A novel point system was created to grade the high-risk clinical features of each tumor. Further analyses were performed to assess the degree of association between GEP and each individual risk factor, total clinical risk score, vascularity, internal reflectivity, American Joint Committee on Cancer (AJCC) tumor stage classification, apical tumor height/thickness, and LBD. Of the 83 total patients, 41 were classified as GEP class 1A, 17 as class 1B, and 25 as class 2. The presence of orange pigment, SRF, low internal reflectivity and vascularity on ultrasound, and apical tumor height/thickness ≥ 2 mm were not statistically significantly associated with GEP class. Lack of drusen/RPE changes demonstrated a trend toward statistical association with GEP class 2 compared to class 1A/1B. LBD and advancing AJCC stage was statistically associated with higher GEP class. In this cohort, AJCC stage classification and LBD were the only clinical features statistically associated with GEP class. Clinicians should use caution when inferring the growth potential of melanocytic lesions solely from traditional funduscopic and ultrasonographic risk factors without GEP data.

Choline Kinase Alpha as an Androgen Receptor Chaperone and Prostate Cancer Therapeutic Target

PubMed Central

Asim, Mohammad; Massie, Charles E.; Orafidiya, Folake; Pértega-Gomes, Nelma; Warren, Anne Y.; Esmaeili, Mohsen; Selth, Luke A.; Zecchini, Heather I.; Luko, Katarina; Qureshi, Arham; Baridi, Ajoeb; Menon, Suraj; Madhu, Basetti; Escriu, Carlos; Lyons, Scott; Vowler, Sarah L.; Zecchini, Vincent R.; Shaw, Greg; Hessenkemper, Wiebke; Russell, Roslin; Mohammed, Hisham; Stefanos, Niki; Lynch, Andy G.; Grigorenko, Elena; D’Santos, Clive; Taylor, Chris; Lamb, Alastair; Sriranjan, Rouchelle; Yang, Jiali; Stark, Rory; Dehm, Scott M.; Rennie, Paul S.; Carroll, Jason S.; Griffiths, John R.; Tavaré, Simon; Mills, Ian G.; McEwan, Iain J.; Baniahmad, Aria; Tilley, Wayne D.; Neal, David E.

2016-01-01

Background: The androgen receptor (AR) is a major drug target in prostate cancer (PCa). We profiled the AR-regulated kinome to identify clinically relevant and druggable effectors of AR signaling. Methods: Using genome-wide approaches, we interrogated all AR regulated kinases. Among these, choline kinase alpha (CHKA) expression was evaluated in benign (n = 195), prostatic intraepithelial neoplasia (PIN) (n = 153) and prostate cancer (PCa) lesions (n = 359). We interrogated how CHKA regulates AR signaling using biochemical assays and investigated androgen regulation of CHKA expression in men with PCa, both untreated (n = 20) and treated with an androgen biosynthesis inhibitor degarelix (n = 27). We studied the effect of CHKA inhibition on the PCa transcriptome using RNA sequencing and tested the effect of CHKA inhibition on cell growth, clonogenic survival and invasion. Tumor xenografts (n = 6 per group) were generated in mice using genetically engineered prostate cancer cells with inducible CHKA knockdown. Data were analyzed with χ2 tests, Cox regression analysis, and Kaplan-Meier methods. All statistical tests were two-sided. Results: CHKA expression was shown to be androgen regulated in cell lines, xenografts, and human tissue (log fold change from 6.75 to 6.59, P = .002) and was positively associated with tumor stage. CHKA binds directly to the ligand-binding domain (LBD) of AR, enhancing its stability. As such, CHKA is the first kinase identified as an AR chaperone. Inhibition of CHKA repressed the AR transcriptional program including pathways enriched for regulation of protein folding, decreased AR protein levels, and inhibited the growth of PCa cell lines, human PCa explants, and tumor xenografts. Conclusions: CHKA can act as an AR chaperone, providing, to our knowledge, the first evidence for kinases as molecular chaperones, making CHKA both a marker of tumor progression and a potential therapeutic target for PCa. PMID:26657335

The fate of the duplicated androgen receptor in fishes: a late neofunctionalization event?

PubMed Central

2008-01-01

Background Based on the observation of an increased number of paralogous genes in teleost fishes compared with other vertebrates and on the conserved synteny between duplicated copies, it has been shown that a whole genome duplication (WGD) occurred during the evolution of Actinopterygian fish. Comparative phylogenetic dating of this duplication event suggests that it occurred early on, specifically in teleosts. It has been proposed that this event might have facilitated the evolutionary radiation and the phenotypic diversification of the teleost fish, notably by allowing the sub- or neo-functionalization of many duplicated genes. Results In this paper, we studied in a wide range of Actinopterygians the duplication and fate of the androgen receptor (AR, NR3C4), a nuclear receptor known to play a key role in sex-determination in vertebrates. The pattern of AR gene duplication is consistent with an early WGD event: it has been duplicated into two genes AR-A and AR-B after the split of the Acipenseriformes from the lineage leading to teleost fish but before the divergence of Osteoglossiformes. Genomic and syntenic analyses in addition to lack of PCR amplification show that one of the duplicated copies, AR-B, was lost in several basal Clupeocephala such as Cypriniformes (including the model species zebrafish), Siluriformes, Characiformes and Salmoniformes. Interestingly, we also found that, in basal teleost fish (Osteoglossiformes and Anguilliformes), the two copies remain very similar, whereas, specifically in Percomorphs, one of the copies, AR-B, has accumulated substitutions in both the ligand binding domain (LBD) and the DNA binding domain (DBD). Conclusion The comparison of the mutations present in these divergent AR-B with those known in human to be implicated in complete, partial or mild androgen insensitivity syndrome suggests that the existence of two distinct AR duplicates may be correlated to specific functional differences that may be connected to the well-known plasticity of sex determination in fish. This suggests that three specific events have shaped the present diversity of ARs in Actinopterygians: (i) early WGD, (ii) parallel loss of one duplicate in several lineages and (iii) putative neofunctionalization of the same duplicate in percomorphs, which occurred a long time after the WGD. PMID:19094205

Parkinson’s Disease – the Debate on the Clinical Phenomenology, Aetiology, Pathology and Pathogenesis

PubMed Central

Jenner, Peter; Morris, Huw R.; Robbins, Trevor W.; Goedert, Michel; Hardy, John; Ben-Shlomo, Yoav; Bolam, Paul; Burn, David; Hindle, John V.; Brooks, David

2014-01-01

The definition of Parkinson’s disease (PD) is changing with the expansion of clinical phenomenology and improved understanding of environmental and genetic influences that impact on the pathogenesis of the disease at the cellular and molecular level. This had led to debate and discussion with as yet, no general acceptance of the direction that change should take either at the level of diagnosis or of what should and should not be sheltered under an umbrella of PD. This article is one contribution to this on-going discussion. There are two different themes running through the article - widening the definition of PD/LBD/synucleinopathies and the heterogeneity that exists within PD itself from a clinical, pathological and genetic per-spective. The conclusion reached is that in the future, further diagnostic categories will need to be recognized. These are likely to include - Parkinson’s syndrome, Parkinson’s syndrome likely to be Lewy body PD, clinical PD (defined by QSBB criteria), Lewy body disease (PD, LBD, REM SBD) and synucleinopathies (including LBD, MSA). PMID:23938306

Intrinsically disordered RGG/RG domains mediate degenerate specificity in RNA binding

PubMed Central

Ozdilek, Bagdeser A.; Thompson, Valery F.; Ahmed, Nasiha S.; White, Connor I.

2017-01-01

Abstract RGG/RG domains are the second most common RNA binding domain in the human genome, yet their RNA-binding properties remain poorly understood. Here, we report a detailed analysis of the RNA binding characteristics of intrinsically disordered RGG/RG domains from Fused in Sarcoma (FUS), FMRP and hnRNPU. For FUS, previous studies defined RNA binding as mediated by its well-folded domains; however, we show that RGG/RG domains are the primary mediators of binding. RGG/RG domains coupled to adjacent folded domains can achieve affinities approaching that of full-length FUS. Analysis of RGG/RG domains from FUS, FMRP and hnRNPU against a spectrum of contrasting RNAs reveals that each display degenerate binding specificity, while still displaying different degrees of preference for RNA. PMID:28575444

Tool use in left brain damage and Alzheimer's disease: What about function and manipulation knowledge?

PubMed

Jarry, Christophe; Osiurak, François; Besnard, Jérémy; Baumard, Josselin; Lesourd, Mathieu; Croisile, Bernard; Etcharry-Bouyx, Frédérique; Chauviré, Valérie; Le Gall, Didier

2016-03-01

Tool use disorders are usually associated with difficulties in retrieving function and manipulation knowledge. Here, we investigate tool use (Real Tool Use, RTU), function (Functional Association, FA) and manipulation knowledge (Gesture Recognition, GR) in 17 left-brain-damaged (LBD) patients and 14 AD patients (Alzheimer disease). LBD group exhibited predicted deficit on RTU but not on FA and GR while AD patients showed deficits on GR and FA with preserved tool use skills. These findings question the role played by function and manipulation knowledge in actual tool use. © 2016 The British Psychological Society.

Structural and Histone Binding Ability Characterizations of Human PWWP Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

2013-09-25

The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less

Elucidation of the binding preferences of peptide recognition modules: SH3 and PDZ domains.

PubMed

Teyra, Joan; Sidhu, Sachdev S; Kim, Philip M

2012-08-14

Peptide-binding domains play a critical role in regulation of cellular processes by mediating protein interactions involved in signalling. In recent years, the development of large-scale technologies has enabled exhaustive studies on the peptide recognition preferences for a number of peptide-binding domain families. These efforts have provided significant insights into the binding specificities of these modular domains. Many research groups have taken advantage of this unprecedented volume of specificity data and have developed a variety of new algorithms for the prediction of binding specificities of peptide-binding domains and for the prediction of their natural binding targets. This knowledge has also been applied to the design of synthetic peptide-binding domains in order to rewire protein-protein interaction networks. Here, we describe how these experimental technologies have impacted on our understanding of peptide-binding domain specificities and on the elucidation of their natural ligands. We discuss SH3 and PDZ domains as well characterized examples, and we explore the feasibility of expanding high-throughput experiments to other peptide-binding domains. Copyright © 2012. Published by Elsevier B.V.

Functional domains of plant chimeric calcium/calmodulin-dependent protein kinase: regulation by autoinhibitory and visinin-like domains

NASA Technical Reports Server (NTRS)

Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.

1997-01-01

A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.

Patterns of anti-inflammatory drug use and risk of dementia: a matched case-control study.

PubMed

Dregan, A; Chowienczyk, P; Armstrong, D

2015-11-01

There is limited primary-care-based evidence about a potential association between anti-inflammatory therapy and dementia subtypes. The present study addressed this limitation by using electronic health records from a large primary care database. A case-control study was implemented using electronic medical records. Cases had a diagnosis of dementia between 1992 and 2014. Up to four controls matched on age, gender, family practice and index date were selected for each case. Use of non-steroidal anti-inflammatory drugs (NSAIDs) and glucocorticoid drugs represented the exposure variables. Primary outcome measures included all-cause dementia and main dementia subtypes, including Alzheimer disease (AD), vascular dementia (VaD) and Lewy body dementia (LBD). Data were analysed using conditional logistic regression. The study identified 31,083 patients with AD, 23,465 with VaD and 1694 with LBD. Ever-used NSAIDs were associated with a modest increase in the risk of all-cause dementia (odds ratio 1.04, 95% confidence interval 1.02-1.05, P < 0.006), whilst no association was apparent for ever-used glucocorticoids (0.98, 0.96-1.01, P = 0.152). There was no evidence for an association between NSAIDs and AD (1.03, 0.99-1.06, P = 0.07) or LBD (1.13, 0.99-1.29, P = 0.08). However, a significant increase in the risk for VaD (1.33, 1.29-1.38, P < 0.001) was observed. Similar patterns emerged for glucocorticoid therapy. In a large primary care population, there was no robust evidence for a potential association between anti-inflammatory drugs and risk of AD or LBD. NSAIDs and glucocorticoid drugs were associated with higher risk of VaD. © 2015 EAN.

Tool use without a tool: kinematic characteristics of pantomiming as compared to actual use and the effect of brain damage.

PubMed

Hermsdörfer, Joachim; Li, Yong; Randerath, Jennifer; Goldenberg, Georg; Johannsen, Leif

2012-04-01

Movement goals and task mechanics differ substantially between actual tool use and corresponding pantomimes. In addition, apraxia seems to be more severe during pantomime than during actual tool use. Comparisons of these two modes of action execution using quantitative methods of movement analyses are rare. In the present study, repetitive scooping movements with a ladle from a bowl into a plate were recorded and movement kinematics was analyzed. Brain-damaged patients using their ipsilesional hand and healthy control subjects were tested in three conditions: pantomime, demonstration with the tool only, and actual use in the normal context. Analysis of the hand trajectories during the transport component revealed clear differences between the tasks, such as slower actual use and moderate deficits in patients with left brain damage (LBD). LBD patients were particularly impaired in the scooping component: LBD patients with apraxia exhibited reduced hand rotation at the bowl and the plate. The deficit was most obvious during pantomime but actual use was also affected, and reduced hand rotation was consistent across conditions as indicated by strong pair-wise correlations between task conditions. In healthy control subjects, correlations between movement parameters were most evident between the pantomime and demonstration conditions but weak in correlation pairs involving actual use. From these findings and published neuroimaging evidence, we conclude that for a specific tool-use action, common motor schemas are activated but are adjusted and modified according to the actual task constraints and demands. An apraxic LBD individual can show a deficit across all three action conditions, but the severity can differ substantially between conditions.

Effects of Bout Duration on Players' Internal and External Loads During Small-Sided Games in Young Soccer Players.

PubMed

Köklü, Yusuf; Alemdaroğlu, Utku; Cihan, Hamit; Wong, Del P

2017-11-01

To investigate the effects of different bout durations on internal and external loads of young soccer players during different small-sided games (SSGs). Fifteen young male soccer players (average age 17 ± 1 y) participated in 2 vs 2, 3 vs 3, and 4 vs 4 SSGs. All games lasted 12 min playing time in total, but each SSG format further consisted of 4 bout durations: continuous (CON: 1 bout × 12 min) or interval with short (SBD: 6 bouts  × 2 min), medium (MBD: 3 bouts × 4 min), or long (LBD: 2 bouts × 6 min) bout durations. During the SSGs, heart-rate (HR) responses and distance covered in different speed zones (walking and low-intensity, moderate-intensity, and high-intensity running) were measured. Rating of perceived exertion (RPE) and blood lactate (La - ) were determined at the end of each SSG. The SBD format elicited significantly lower %HR max responses compared to LBD and CON in all formats (P < .05). The SBD format also showed significantly shorter distances covered in walking and greater distances covered in moderate-intensity running, as well as significantly greater total distance covered compared to LBD and CON in all formats (P < .05). In addition, LBD produced significantly lower La - and RPE responses than SBD and CON in all formats (P < .05). These results suggest that coaches and sport scientists who want to achieve higher internal loads could use SBD and CON timing protocols, while those who want to achieve higher external loads might prefer to use SBD and MBD when planning all SSG formats.

Longitudinal associations between different dementia diagnoses and medication use jointly accounting for dropout.

PubMed

Agogo, George O; Ramsey, Christine M; Gnjidic, Danijela; Moga, Daniela C; Allore, Heather

2018-04-18

ABSTRACTBackground:Longitudinal studies of older adults are characterized by high dropout rates, multimorbid conditions, and multiple medication use, especially proximal to death. We studied the association between multiple medication use and incident dementia diagnoses including Alzheimer's disease (AD), vascular dementia (VD), and Lewy-body dementia (LBD), simultaneously accounting for dropout. Using the National Alzheimer's Coordinating Center data with three years of follow-up, a set of covariate-adjusted models that ignore dropout was fit to complete-case data, and to the whole-cohort data. Additionally, covariate-adjusted joint models with shared random effects accounting for dropout were fit to the whole-cohort data. Multiple medication use was defined as polypharmacy (⩾ five medications), hyperpolypharmacy (⩾ ten medications), and total number of medications. Incident diagnoses were 2,032 for AD, 135 for VD, and 139 for LBD. Percentages of dropout at the end of follow-up were as follows: 71.8% for AD, 81.5% for VD, and 77.7% for LBD. The odds ratio (OR) estimate for hyperpolypharmacy among those with LBD versus AD was 2.19 (0.78, 6.15) when estimated using complete-case data and 3.00 (1.66, 5.40) using whole-cohort data. The OR reduced to 1.41 (0.76, 2.64) when estimated from the joint model accounting for dropout. The OR for polypharmacy using complete-case data differed from the estimates using whole-cohort data. The OR for dementia diagnoses on total number of medications was similar, but non-significant when estimated using complete-case data. Reasons for dropout should be investigated and appropriate statistical methods should be applied to reduce bias in longitudinal studies among high-risk dementia cohorts.

Argyrophilic grain disease as a neurodegenerative substrate in late-onset schizophrenia and delusional disorders.

PubMed

Nagao, Shigeto; Yokota, Osamu; Ikeda, Chikako; Takeda, Naoya; Ishizu, Hideki; Kuroda, Shigetoshi; Sudo, Koichiro; Terada, Seishi; Murayama, Shigeo; Uchitomi, Yosuke

2014-06-01

To study the relationship between neurodegenerative diseases including argyrophilic grain disease (AGD) and late-onset schizophrenia and delusional disorders (LOSD; onset ≥40 years of age), we pathologically examined 23 patients with LOSD, 71 age-matched normal controls, and 22 psychiatric disease controls (11 depression, six personality disorder, two bipolar disorders, and three neurotic disorders cases). In all LOSD cases (compared to age-matched normal controls), the frequencies of Lewy body disease (LBD), AGD, and corticobasal degeneration (CBD) were 26.1 % (11.3 %), 21.7 % (8.5 %), and 4.3 % (0.0 %), respectively. There was no case of pure Alzheimer's disease (AD). The total frequency of LBD, AGD, and CBD was significantly higher in LOSD cases than in normal controls. Argyrophilic grains were significantly more severe in LOSD than in controls, but were almost completely restricted to the limbic system and adjacent temporal cortex. In LOSD patients whose onset occurred at ≥65 years of age (versus age-matched normal controls), the frequencies of LBD and AGD were 36.4 % (19.4 %) and 36.4 % (8.3 %), respectively, and AGD was significantly more frequent in LOSD patients than in normal controls. In LOSD patients whose onset occurred at <65 years of age, the frequencies of LBD, AGD, and CBD were 16.7, 8.3, and 8.3 %, comparable to those of age-matched normal controls (10.2, 5.1, and 0.0 %). In all psychiatric cases, delusion was significantly more frequent in AGD cases than in cases bearing minimal AD pathology alone. Given these findings, LOSD patients may have heterogeneous pathological backgrounds, and AGD may be associated with the occurrence of LOSD especially after 65 years of age.

Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

PubMed Central

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

2015-01-01

SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

Transactivation Assays that Identify Indirect and Direct Activators of Human Pregnane X Receptor (PXR, NR1I2) and Constitutive Androstane Receptor (CAR, NR1I3).

PubMed

Pinne, Marija; Ponce, Elsa; Raucy, Judy L

2017-01-01

Nuclear Receptors (NRs), including PXR and CAR, are presumed to be ligand-dependent transcription factors, but ligand binding is not an absolute requirement for activation. Indeed, many compounds activate PXR and CAR by indirect mechanisms. Detecting these indirect activators of specific nuclear receptors in vitro has been difficult. As NR activation of either or both PXR and CAR can lead to drug-drug interactions and adverse drug effects, false negatives obtained with screening tools incapable of detecting indirect activators could present liabilities. The aim of this study was to establish assays that identify indirect activators of human PXR and CAR. Commercially available human PXR and CAR transactivation assays were used for analyses. We show that transactivation assays containing full-length nuclear receptors with native promoters can identify indirect activators of human CAR and PXRwhen compared to those of commercially available assays containing only the LBD of PXR and CAR. Of these two assay systems, only human PXR and CAR1 assays with full-length receptors and native promoters are capable of detecting indirect and ligand activators. With this capability, several kinase inhibitors were identified that activate PXR and CAR by indirect mechanisms. Furthermore by using both the LBD and full-length receptors, phenobarbital and midostaurin were found to be direct and indirect activators of PXR while human CAR activation by phenobarbital occurs by indirect mechanisms only. Cell based transactivation assays employing the full-length receptors and native promoters identify both direct and indirect activators of either or both human PXR and CAR. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Characterization of diverse internal binding specificities of PDZ domains by yeast two-hybrid screening of a special peptide library.

PubMed

Mu, Yi; Cai, Pengfei; Hu, Siqi; Ma, Sucan; Gao, Youhe

2014-01-01

Protein-protein interactions (PPIs) are essential events to play important roles in a series of biological processes. There are probably more ways of PPIs than we currently realized. Structural and functional investigations of weak PPIs have lagged behind those of strong PPIs due to technical difficulties. Weak PPIs are often short-lived, which may result in more dynamic signals with important biological roles within and/or between cells. For example, the characteristics of PSD-95/Dlg/ZO-1 (PDZ) domain binding to internal sequences, which are primarily weak interactions, have not yet been systematically explored. In the present study, we constructed a nearly random octapeptide yeast two-hybrid library. A total of 24 PDZ domains were used as baits for screening the library. Fourteen of these domains were able to bind internal PDZ-domain binding motifs (PBMs), and PBMs screened for nine PDZ domains exhibited strong preferences. Among 11 PDZ domains that have not been reported their internal PBM binding ability, six were confirmed to bind internal PBMs. The first PDZ domain of LNX2, which has not been reported to bind C-terminal PBMs, was found to bind internal PBMs. These results suggest that the internal PBMs binding ability of PDZ domains may have been underestimated. The data provided diverse internal binding properties for several PDZ domains that may help identify their novel binding partners.

Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin.

PubMed

Rooijakkers, Bart J M; Ikonen, Martina S; Linder, Markus B

2018-01-01

Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain's sequence-function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed.

Distribution of PASTA domains in penicillin-binding proteins and serine/threonine kinases of Actinobacteria.

PubMed

Ogawara, Hiroshi

2016-09-01

PASTA domains (penicillin-binding protein and serine/threonine kinase-associated domains) have been identified in penicillin-binding proteins and serine/threonine kinases of Gram-positive Firmicutes and Actinobacteria. They are believed to bind β-lactam antibiotics, and be involved in peptidoglycan metabolism, although their biological function is not definitively clarified. Actinobacteria, especially Streptomyces species, are distinct in that they undergo complex cellular differentiation and produce various antibiotics including β-lactams. This review focuses on the distribution of PASTA domains in penicillin-binding proteins and serine/threonine kinases in Actinobacteria. In Actinobacteria, PASTA domains are detectable exclusively in class A but not in class B penicillin-binding proteins, in sharp contrast to the cases in other bacteria. In penicillin-binding proteins, PASTA domains distribute independently from taxonomy with some distribution bias. Particularly interesting thing is that no Streptomyces species have penicillin-binding protein with PASTA domains. Protein kinases in Actinobacteria possess 0 to 5 PASTA domains in their molecules. Protein kinases in Streptomyces can be classified into three groups: no PASTA domain, 1 PASTA domain and 4 PASTA domain-containing groups. The 4 PASTA domain-containing groups can be further divided into two subgroups. The serine/threonine kinases in different groups may perform different functions. The pocket region in one of these subgroup is more dense and extended, thus it may be involved in binding of ligands like β-lactams more efficiently.

Characterization of the microtubule binding domain of microtubule actin crosslinking factor (MACF): identification of a novel group of microtubule associated proteins.

PubMed

Sun, D; Leung, C L; Liem, R K

2001-01-01

MACF (microtubule actin cross-linking factor) is a large, 608-kDa protein that can associate with both actin microfilaments and microtubules (MTs). Structurally, MACF can be divided into 3 domains: an N-terminal domain that contains both a calponin type actin-binding domain and a plakin domain; a rod domain that is composed of 23 dystrophin-like spectrin repeats; and a C-terminal domain that includes two EF-hand calcium-binding motifs, as well as a region that is homologous to two related proteins, GAR22 and Gas2. We have previously demonstrated that the C-terminal domain of MACF binds to MTs, although no homology was observed between this domain and other known microtubule-binding proteins. In this report, we describe the characterization of this microtubule-binding domain of MACF by transient transfection studies and in vitro binding assays. We found that the C-terminus of MACF contains at least two microtubule-binding regions, a GAR domain and a domain containing glycine-serine-arginine (GSR) repeats. In transfected cells, the GAR domain bound to and partially stabilized MTs to depolymerization by nocodazole. The GSR-containing domain caused MTs to form bundles that are still sensitive to nocodazole-induced depolymerization. When present together, these two domains acted in concert to bundle MTs and render them stable to nocodazole treatment. Recently, a study has shown that the N-terminal half of the plakin domain (called the M1 domain) of MACF also binds MTs. We therefore examined the microtubule binding ability of the M1 domain in the context of the entire plakin domain with and without the remaining N-terminal regions of two different MACF isoforms. Interestingly, in the presence of the surrounding sequences, the M1 domain did not bind MTs. In addition to MACF, cDNA sequences encoding the GAR and GSR-containing domains are also found in the partial human EST clone KIAA0728, which has high sequence homology to the 3' end of the MACF cDNA; hence, we refer to it as MACF2. The C-terminal domain of mouse MACF2 was cloned and characterized. The microtubule-binding properties of MACF2 C-terminal domain are similar to that of MACF. The GAR domain was originally found in Gas 2 protein and here we show that it can associate with MTs in transfected cells. Plectin and desmoplakin have GSR-containing domains at their C-termini and we further demonstrate that the GSR-containing domain of plectin, but not desmoplakin, can bind to MTs in vivo.

Comparison of Saccharomyces cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site.

PubMed

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R; Kenniston, Jon A; Mendrola, Jeannine M; Ferguson, Kathryn M; Lemmon, Mark A

2015-02-03

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparison of Saccharomyces cerevisiae F-BAR Domain Structures Reveals a Conserved Inositol Phosphate Binding Site

DOE PAGES

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...

2015-01-22

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less

Crystal Structure of the Chromodomain Helicase DNA-binding Protein 1 (Chd1) DNA-binding Domain in Complex with DNA*

PubMed Central

Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.

2011-01-01

Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calvo, Eric; Mans, Ben J.; Ribeiro, José M.C.

The mosquito D7 salivary proteins are encoded by a multigene family related to the arthropod odorant-binding protein (OBP) superfamily. Forms having either one or two OBP domains are found in mosquito saliva. Four single-domain and one two-domain D7 proteins from Anopheles gambiae and Aedes aegypti (AeD7), respectively, were shown to bind biogenic amines with high affinity and with a stoichiometry of one ligand per protein molecule. Sequence comparisons indicated that only the C-terminal domain of AeD7 is homologous to the single-domain proteins from A. gambiae, suggesting that the N-terminal domain may bind a different class of ligands. Here, we describemore » the 3D structure of AeD7 and examine the ligand-binding characteristics of the N- and C-terminal domains. Isothermal titration calorimetry and ligand complex crystal structures show that the N-terminal domain binds cysteinyl leukotrienes (cysLTs) with high affinities (50-60 nM) whereas the C-terminal domain binds biogenic amines. The lipid chain of the cysLT binds in a hydrophobic pocket of the N-terminal domain, whereas binding of norepinephrine leads to an ordering of the C-terminal portion of the C-terminal domain into an alpha-helix that, along with rotations of Arg-176 and Glu-268 side chains, acts to bury the bound ligand.« less

SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

PubMed

Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

2016-04-07

The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Ligand Binding to WW Tandem Domains of YAP2 Transcriptional Regulator Is Under Negative Cooperativity

PubMed Central

Schuchardt, Brett J.; Mikles, David C.; Hoang, Lawrence M.; Bhat, Vikas; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

2014-01-01

YAP2 transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well-documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

Characterization of αX I-Domain Binding to Receptors for Advanced Glycation End Products (RAGE).

PubMed

Buyannemekh, Dolgorsuren; Nham, Sang-Uk

2017-05-31

The β2 integrins are cell surface transmembrane proteins regulating leukocyte functions, such as adhesion and migration. Two members of β2 integrin, αMβ2 and αXβ2, share the leukocyte distribution profile and integrin αXβ2 is involved in antigen presentation in dendritic cells and transendothelial migration of monocytes and macrophages to atherosclerotic lesions. Receptor for advanced glycation end products (RAGE), a member of cell adhesion molecules, plays an important role in chronic inflammation and atherosclerosis. Although RAGE and αXβ2 play an important role in inflammatory response and the pathogenesis of atherosclerosis, the nature of their interaction and structure involved in the binding remain poorly defined. In this study, using I-domain as a ligand binding motif of αXβ2, we characterize the binding nature and the interacting moieties of αX I-domain and RAGE. Their binding requires divalent cations (Mg 2+ and Mn 2+ ) and shows an affinity on the sub-micro molar level: the dissociation constant of αX I-domains binding to RAGE being 0.49 μM. Furthermore, the αX I-domains recognize the V-domain, but not the C1 and C2-domains of RAGE. The acidic amino acid substitutions on the ligand binding site of αX I-domain significantly reduce the I-domain binding activity to soluble RAGE and the alanine substitutions of basic amino acids on the flat surface of the V-domain prevent the V-domain binding to αX I-domain. In conclusion, the main mechanism of αX I-domain binding to RAGE is a charge interaction, in which the acidic moieties of αX I-domains, including E244, and D249, recognize the basic residues on the RAGE V-domain encompassing K39, K43, K44, R104, and K107.

Fluorescent-responsive synthetic C1b domains of protein kinase Cδ as reporters of specific high-affinity ligand binding.

PubMed

Ohashi, Nami; Nomura, Wataru; Narumi, Tetsuo; Lewin, Nancy E; Itotani, Kyoko; Blumberg, Peter M; Tamamura, Hirokazu

2011-01-19

Protein kinase C (PKC) is a critical cell signaling pathway involved in many disorders such as cancer and Alzheimer-type dementia. To date, evaluation of PKC ligand binding affinity has been performed by competitive studies against radiolabeled probes that are problematic for high-throughput screening. In the present study, we have developed a fluorescent-based binding assay system for identifying ligands that target the PKC ligand binding domain (C1 domain). An environmentally sensitive fluorescent dye (solvatochromic fluorophore), which has been used in multiple applications to assess protein-binding interactions, was inserted in proximity to the binding pocket of a novel PKCδ C1b domain. These resultant fluorescent-labeled δC1b domain analogues underwent a significant change in fluorescent intensity upon ligand binding, and we further demonstrate that the fluorescent δC1b domain analogues can be used to evaluate ligand binding affinity.

Src binds cortactin through an SH2 domain cystine-mediated linkage.

PubMed

Evans, Jason V; Ammer, Amanda G; Jett, John E; Bolcato, Chris A; Breaux, Jason C; Martin, Karen H; Culp, Mark V; Gannett, Peter M; Weed, Scott A

2012-12-15

Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions.

Src binds cortactin through an SH2 domain cystine-mediated linkage

PubMed Central

Evans, Jason V.; Ammer, Amanda G.; Jett, John E.; Bolcato, Chris A.; Breaux, Jason C.; Martin, Karen H.; Culp, Mark V.; Gannett, Peter M.; Weed, Scott A.

2012-01-01

Summary Tyrosine-kinase-based signal transduction mediated by modular protein domains is critical for cellular function. The Src homology (SH)2 domain is an important conductor of intracellular signaling that binds to phosphorylated tyrosines on acceptor proteins, producing molecular complexes responsible for signal relay. Cortactin is a cytoskeletal protein and tyrosine kinase substrate that regulates actin-based motility through interactions with SH2-domain-containing proteins. The Src kinase SH2 domain mediates cortactin binding and tyrosine phosphorylation, but how Src interacts with cortactin is unknown. Here we demonstrate that Src binds cortactin through cystine bonding between Src C185 in the SH2 domain within the phosphotyrosine binding pocket and cortactin C112/246 in the cortactin repeats domain, independent of tyrosine phosphorylation. Interaction studies show that the presence of reducing agents ablates Src-cortactin binding, eliminates cortactin phosphorylation by Src, and prevents Src SH2 domain binding to cortactin. Tandem MS/MS sequencing demonstrates cystine bond formation between Src C185 and cortactin C112/246. Mutational studies indicate that an intact cystine binding interface is required for Src-mediated cortactin phosphorylation, cell migration, and pre-invadopodia formation. Our results identify a novel phosphotyrosine-independent binding mode between the Src SH2 domain and cortactin. Besides Src, one quarter of all SH2 domains contain cysteines at or near the analogous Src C185 position. This provides a potential alternative mechanism to tyrosine phosphorylation for cysteine-containing SH2 domains to bind cognate ligands that may be widespread in propagating signals regulating diverse cellular functions. PMID:23097045

Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

PubMed

Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

2006-12-01

The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.

Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

PubMed

Zhou, Huan-Xiang

2006-11-01

Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin

PubMed Central

Rooijakkers, Bart J. M.

2018-01-01

Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain’s sequence–function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed. PMID:29782536

MIT domain of Vps4 is a Ca2+-dependent phosphoinositide-binding domain.

PubMed

Iwaya, Naoko; Takasu, Hirotoshi; Goda, Natsuko; Shirakawa, Masahiro; Tanaka, Toshiki; Hamada, Daizo; Hiroaki, Hidekazu

2013-05-01

The microtubule interacting and trafficking (MIT) domain is a small protein module that is conserved in proteins of diverged function, such as Vps4, spastin and sorting nexin 15 (SNX15). The molecular function of the MIT domain is protein-protein interaction, in which the domain recognizes peptides containing MIT-interacting motifs. Recently, we identified an evolutionarily related domain, 'variant' MIT domain at the N-terminal region of the microtubule severing enzyme katanin p60. We found that the domain was responsible for binding to microtubules and Ca(2+). Here, we have examined whether the authentic MIT domains also bind Ca(2+). We found that the loop between the first and second α-helices of the MIT domain binds a Ca(2+) ion. Furthermore, the MIT domains derived from Vps4b and SNX15a showed phosphoinositide-binding activities in a Ca(2+)-dependent manner. We propose that the MIT domain is a novel membrane-associating domain involved in endosomal trafficking.

Polypeptides having xylanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spodsberg, Nikolaj; Shaghasi, Tarana

The present invention relates to polypeptides having xylanase activity, catalytic domains, and carbohydrate binding domains, and polynucleotides encoding the polypeptides, catalytic domains, and carbohydrate binding domains. The present invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains, and carbohydrate binding domains.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spodsberg, Nikolaj; Shagasi, Tarana

The present invention relates to isolated polypeptides having endoglucanase activity, catalytic domains, cellulose binding domains and polynucleotides encoding the polypeptides, catalytic domains or cellulose binding domains. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains or cellulose binding domains.

Polypeptides having endoglucanase activity and polynucleotides encoding same

DOEpatents

Spodsberg, Nikolaj; Shagasi, Tarana

2015-06-30

The present invention relates to isolated polypeptides having endoglucanase activity, catalytic domains, cellulose binding domains and polynucleotides encoding the polypeptides, catalytic domains or cellulose binding domains. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains or cellulose binding domains.

Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stringer, Mary Ann; McBrayer, Brett

2016-11-29

The present invention relates to isolated polypeptides having cellobiohydrolase activity, catalytic domains, and cellulose binding domains and polynucleotides encoding the polypeptides, catalytic domains, and cellulose binding domains. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides, catalytic domains, or cellulose binding domains.

A low-complexity region in the YTH domain protein Mmi1 enhances RNA binding.

PubMed

Stowell, James A W; Wagstaff, Jane L; Hill, Chris H; Yu, Minmin; McLaughlin, Stephen H; Freund, Stefan M V; Passmore, Lori A

2018-06-15

Mmi1 is an essential RNA-binding protein in the fission yeast Schizosaccharomyces pombe that eliminates meiotic transcripts during normal vegetative growth. Mmi1 contains a YTH domain that binds specific RNA sequences, targeting mRNAs for degradation. The YTH domain of Mmi1 uses a noncanonical RNA-binding surface that includes contacts outside the conserved fold. Here, we report that an N-terminal extension that is proximal to the YTH domain enhances RNA binding. Using X-ray crystallography, NMR, and biophysical methods, we show that this low-complexity region becomes more ordered upon RNA binding. This enhances the affinity of the interaction of the Mmi1 YTH domain with specific RNAs by reducing the dissociation rate of the Mmi1-RNA complex. We propose that the low-complexity region influences RNA binding indirectly by reducing dynamic motions of the RNA-binding groove and stabilizing a conformation of the YTH domain that binds to RNA with high affinity. Taken together, our work reveals how a low-complexity region proximal to a conserved folded domain can adopt an ordered structure to aid nucleic acid binding. © 2018 Stowell et al.

The Wundt-Jastrow illusion in the study of spatial hemi-inattention.

PubMed

Massironi, M; Antonucci, G; Pizzamiglio, L; Vitale, M V; Zoccolotti, P

1988-01-01

A new test to detect unilateral neglect was devised using a modified version of the Wundt-Jastrow area illusion. The test was given to three groups of subjects: left brain damaged (LBD), right brain damaged (RBD) patients and controls. Of RBD patients, 40.4% but no LBD patient or control, showed responses inconsistent with the visual illusion when the determinant features of the illusion pointed to the left visual field. These unexpected responses were highly related to a clinical evaluation of the severity of the hemi-inattention disorder. The sensitivity of this test and of other standard measures of hemi-neglect were compared. The possibility of identifying qualitatively different forms of hemi-neglect was also discussed.

A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

PubMed

Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

1997-03-11

We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

Ligand binding to WW tandem domains of YAP2 transcriptional regulator is under negative cooperativity.

PubMed

Schuchardt, Brett J; Mikles, David C; Hoang, Lawrence M; Bhat, Vikas; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

2014-12-01

YES-associated protein 2 (YAP2) transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of the WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. © 2014 FEBS.

Lipid binding by the Unique and SH3 domains of c-Src suggests a new regulatory mechanism

PubMed Central

Pérez, Yolanda; Maffei, Mariano; Igea, Ana; Amata, Irene; Gairí, Margarida; Nebreda, Angel R.; Bernadó, Pau; Pons, Miquel

2013-01-01

c-Src is a non-receptor tyrosine kinase involved in numerous signal transduction pathways. The kinase, SH3 and SH2 domains of c-Src are attached to the membrane-anchoring SH4 domain through the flexible Unique domain. Here we show intra- and intermolecular interactions involving the Unique and SH3 domains suggesting the presence of a previously unrecognized additional regulation layer in c-Src. We have characterized lipid binding by the Unique and SH3 domains, their intramolecular interaction and its allosteric modulation by a SH3-binding peptide or by Calcium-loaded calmodulin binding to the Unique domain. We also show reduced lipid binding following phosphorylation at conserved sites of the Unique domain. Finally, we show that injection of full-length c-Src with mutations that abolish lipid binding by the Unique domain causes a strong in vivo phenotype distinct from that of wild-type c-Src in a Xenopus oocyte model system, confirming the functional role of the Unique domain in c-Src regulation. PMID:23416516

GW domains of the Listeria monocytogenes invasion protein InlB are SH3-like and mediate binding to host ligands

PubMed Central

Marino, Michael; Banerjee, Manidipa; Jonquières, Renaud; Cossart, Pascale; Ghosh, Partho

2002-01-01

InlB, a surface-localized protein of Listeria monocytogenes, induces phagocytosis in non-phagocytic mammalian cells by activating Met, a receptor tyrosine kinase. InlB also binds glycosaminoglycans and the protein gC1q-R, two additional host ligands implicated in invasion. We present the structure of InlB, revealing a highly elongated molecule with leucine-rich repeats that bind Met at one end, and GW domains that dissociably bind the bacterial surface at the other. Surprisingly, the GW domains are seen to resemble SH3 domains. Despite this, GW domains are unlikely to act as functional mimics of SH3 domains since their potential proline-binding sites are blocked or destroyed. However, we do show that the GW domains, in addition to binding glycosaminoglycans, bind gC1q-R specifically, and that this binding requires release of InlB from the bacterial surface. Dissociable attachment to the bacterial surface via the GW domains may be responsible for restricting Met activation to a small, localized area of the host cell and for coupling InlB-induced host membrane dynamics with bacterial proximity during invasion. PMID:12411480

The HhH(2)/NDD Domain of the Drosophila Nod Chromokinesin-like Protein Is Required for Binding to Chromosomes in the Oocyte Nucleus

PubMed Central

Cui, Wei; Hawley, R. Scott

2005-01-01

Nod is a chromokinesin-like protein that plays a critical role in segregating achiasmate chromosomes during female meiosis. The C-terminal half of the Nod protein contains two putative DNA-binding domains. The first of these domains, known as the HMGN domain, consists of three tandemly repeated high-mobility group N motifs. This domain was previously shown to be both necessary and sufficient for binding of the C-terminal half of Nod to mitotic chromosomes in embryos. The second putative DNA-binding domain, denoted HhH(2)/NDD, is a helix-hairpin-helix(2)/Nod-like DNA-binding domain. Although the HhH(2)/NDD domain is not required or sufficient for chromosome binding in embryos, several well-characterized nod mutations have been mapped in this domain. To characterize the role of the HhH(2)/NDD domain in mediating Nod function, we created a series of UAS-driven transgene constructs capable of expressing either a wild-type Nod-GFP fusion protein or proteins in which the HhH(2)/NDD domain had been altered by site-directed mutagenesis. Although wild-type Nod-GFP localizes to the oocyte chromosomes and rescues the segregation defect in nod mutant oocytes, two of three proteins carrying mutants in the HhH(2)/NDD domain fail to either rescue the nod mutant phenotype or bind to oocyte chromosomes. However, these mutant proteins do bind to the polytene chromosomes in nurse-cell nuclei and enter the oocyte nucleus. Thus, even though the HhH(2)/NDD domain is not essential for chromosome binding in other cell types, it is required for chromosome binding in the oocyte. These HhH(2)/NDD mutants also block the localization of Nod to the posterior pole of stage 9–10A oocytes, a process that is thought to facilitate the interaction of Nod with the plus ends of microtubules (Cui et al. 2005). This observation suggests that the Nod HhH2/NDD domain may play other roles in addition to binding Nod to meiotic chromosomes. PMID:16143607

Retinoid Binding Properties of Nucleotide Binding Domain 1 of the Stargardt Disease-associated ATP Binding Cassette (ABC) Transporter, ABCA4*

PubMed Central

Biswas-Fiss, Esther E.; Affet, Stephanie; Ha, Malissa; Biswas, Subhasis B.

2012-01-01

The retina-specific ATP binding cassette transporter, ABCA4 protein, is associated with a broad range of inherited macular degenerations, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. In order to understand its role in retinal transport in rod out segment discs, we have investigated the interactions of the soluble domains of ABCA4 with both 11-cis- and all-trans-retinal. Using fluorescence anisotropy-based binding analysis and recombinant polypeptides derived from the amino acid sequences of the four soluble domains of ABCA4, we demonstrated that the nucleotide binding domain 1 (NBD1) specifically bound 11-cis-retinal. Its affinity for all-trans-retinal was markedly reduced. Stargardt disease-associated mutations in this domain resulted in attenuation of 11-cis-retinal binding. Significant differences in 11-cis-retinal binding affinities were observed between NBD1 and other cytoplasmic and lumenal domains of ABCA4. The results suggest a possible role of ABCA4 and, in particular, the NBD1 domain in 11-cis-retinal binding. These results also correlate well with a recent report on the in vivo role of ABCA4 in 11-cis-retinal transport. PMID:23144455

Functional relationship between CABIT, SAM and 14-3-3 binding domains of GAREM1 that play a role in its subcellular localization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishino, Tasuku; Matsunaga, Ryota; Konishi, Hiroaki, E-mail: hkonishi@pu-hiroshima.ac.jp

2015-08-21

GAREM1 (Grb2-associated regulator of Erk/MAPK1) is an adaptor protein that is involved in the epidermal growth factor (EGF) pathway. The nuclear localization of GAREM1 depends on the nuclear localization sequence (NLS), which is located at the N-terminal CABIT (cysteine-containing, all in Themis) domain. Here, we identified 14-3-3ε as a GAREM-binding protein, and its binding site is closely located to the NLS. This 14-3-3 binding site was of the atypical type and independent of GAREM phosphorylation. Moreover, the binding of 14-3-3 had an effect on the nuclear localization of GAREM1. Unexpectedly, we observed that the CABIT domain had intramolecular association withmore » the C-terminal SAM (sterile alpha motif) domain. This association might be inhibited by binding of 14-3-3 at the CABIT domain. Our results demonstrate that the mechanism underlying the nuclear localization of GAREM1 depends on its NLS in the CABIT domain, which is controlled by the binding of 14-3-3 and the C-terminal SAM domain. We suggest that the interplay between 14-3-3, SAM domain and CABIT domain might be responsible for the distribution of GAREM1 in mammalian cells. - Highlights: • 14-3-3ε regulated the nuclear localization of GAREM1 as its binding partner. • The atypical 14-3-3 binding site of GAREM1 is located near the NLS in CABIT domain. • The CABIT domain had intramolecular association with the SAM domain in GAREM1. • Subcellular localization of GAREM1 is affected with its CABIT-SAM interaction.« less

Divergent functional connectivity during attentional processing in Lewy body dementia and Alzheimer's disease.

PubMed

Kobeleva, Xenia; Firbank, Michael; Peraza, Luis; Gallagher, Peter; Thomas, Alan; Burn, David J; O'Brien, John; Taylor, John-Paul

2017-07-01

Attention and executive dysfunction are features of Lewy body dementia (LBD) but their neuroanatomical basis is poorly understood. To investigate underlying dysfunctional attention-executive network (EXEC) interactions, we examined functional connectivity (FC) in 30 patients with LBD, 20 patients with Alzheimer's disease (AD), and 21 healthy controls during an event-related functional magnetic resonance imaging (fMRI) experiment. Participants performed a modified Attention Network Test (ANT), where they were instructed to press a button in response to the majority direction of arrows, which were either all pointing in the same direction or with one pointing in the opposite direction. Network activations during both target conditions and a baseline condition (no target) were derived by (ICA) Independent Component Analysis, and interactions between these networks were examined using the beta series correlations approach. Our study revealed that FC of ventral and dorsal attention networks DAN was reduced in LBD during all conditions, although most prominently during incongruent trials. These alterations in connectivity might be driven by a failure of engagement of ventral attention networks, and consequent over-reliance on the DAN. In contrast, when comparing AD patients with the other groups, we found hyperconnectivity between the posterior part of the default mode network (DMN) and the DAN in all conditions, particularly during incongruent trials. This might be attributable to either a compensatory effect to overcome DMN dysfunction, or be arising as a result of a disturbed transition of the DMN from rest to task. Our results demonstrate that dementia syndromes can be characterized both by hyper- and hypoconnectivity of distinct brain networks, depending on the interplay between task demand and available cognitive resources. However these are dependent upon the underlying pathology, which needs to be taken into account when developing specific cognitive therapies for LBD as compared to Alzheimer's. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Distinct Ubiquitin Binding Modes Exhibited by SH3 Domains: Molecular Determinants and Functional Implications

PubMed Central

Ortega Roldan, Jose L.; Casares, Salvador; Ringkjøbing Jensen, Malene; Cárdenes, Nayra; Bravo, Jerónimo; Blackledge, Martin; Azuaga, Ana I.; van Nuland, Nico A. J.

2013-01-01

SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C) of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination. PMID:24039852

The PpaA/AerR regulators of photosynthesis gene expression from anoxygenic phototrophic proteobacteria contain heme-binding SCHIC domains.

PubMed

Moskvin, Oleg V; Gilles-Gonzalez, Marie-Alda; Gomelsky, Mark

2010-10-01

The SCHIC domain of the B12-binding domain family present in the Rhodobacter sphaeroides AppA protein binds heme and senses oxygen. Here we show that the predicted SCHIC domain PpaA/AerR regulators also bind heme and respond to oxygen in vitro, despite their low sequence identity with AppA.

Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition.

PubMed

Jun, S; Wallen, R V; Goriely, A; Kalionis, B; Desplan, C

1998-11-10

Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix-turn-helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes.

Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition

PubMed Central

Jun, Susie; Wallen, Robert V.; Goriely, Anne; Kalionis, Bill; Desplan, Claude

1998-01-01

Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix–turn–helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes. PMID:9811867

Expanding RNA binding specificity and affinity of engineered PUF domains.

PubMed

Zhao, Yang-Yang; Mao, Miao-Wei; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-05-18

Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way.

Expanding RNA binding specificity and affinity of engineered PUF domains

PubMed Central

Zhao, Yang-Yang; Zhang, Wen-Jing; Wang, Jue; Li, Hai-Tao; Yang, Yi; Wang, Zefeng; Wu, Jia-Wei

2018-01-01

Abstract Specific manipulation of RNA is necessary for the research in biotechnology and medicine. The RNA-binding domains of Pumilio/fem-3 mRNA binding factors (PUF domains) are programmable RNA binding scaffolds used to engineer artificial proteins that specifically modulate RNAs. However, the native PUF domains generally recognize 8-nt RNAs, limiting their applications. Here, we modify the PUF domain of human Pumilio1 to engineer PUFs that recognize RNA targets of different length. The engineered PUFs bind to their RNA targets specifically and PUFs with more repeats have higher binding affinity than the canonical eight-repeat domains; however, the binding affinity reaches the peak at those with 9 and 10 repeats. Structural analysis on PUF with nine repeats reveals a higher degree of curvature, and the RNA binding unexpectedly and dramatically opens the curved structure. Investigation of the residues positioned in between two RNA bases demonstrates that tyrosine and arginine have favored stacking interactions. Further tests on the availability of the engineered PUFs in vitro and in splicing function assays indicate that our engineered PUFs bind RNA targets with high affinity in a programmable way. PMID:29490074

Role of Altered Sialylation of the I-Like Domain of β1 Integrin in the Binding of Fibronectin to β1 Integrin: Thermodynamics and Conformational Analyses

PubMed Central

Pan, Di; Song, Yuhua

2010-01-01

Abstract N-glycosylation of the I-like domain of β1 integrin plays an essential role in integrin structure and function, and the altered sialylation of β1 integrin regulates β1 integrin binding to fibronectin. However, the structural basis underlying the effect of altered sialylation of the β1 I-like domain on β1 integrin binding to fibronectin remains largely unknown. In this study, we used a combination of molecular dynamics simulations and binding free energy analyses to investigate changes in binding thermodynamics and in conformation of the glycosylated β1 I-like domain-FN-III9-10 complex caused by altered sialylation of the β1 I-like domain. Binding free energy analyses showed that desialylation of β1 I-like domain increased β1 integrin binding to fibronectin, consistent with experimental results. Interaction analyses showed that altered sialylation of the β1 I-like domain resulted in significant changes in the interaction of the N-glycans of the I-like domain with both the I-like domain and fibronectin, and these changes could directly affect the allosteric regulation of the interaction between the I-like domain and fibronectin. Altered sialylation of the β1 I-like domain caused significant conformational changes in key functional sites of both the β1 I-like domain and fibronectin. In addition, altered sialylation of the β1 I-like domain resulted in changes in the degree of correlated motions between residues in the I-like domain and residues in fibronectin, and in the degree of motion changes in fibronectin, which could affect β1 integrin binding to fibronectin. We believe results from this study provide thermodynamic and structural evidence for a role of altered sialylation of β1 integrin in regulating β1 integrin binding to fibronectin and it's induced cellular activities. PMID:20655849

Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site.

PubMed

Kadamur, Ganesh; Ross, Elliott M

2016-05-20

Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Intrinsic Pleckstrin Homology (PH) Domain Motion in Phospholipase C-β Exposes a Gβγ Protein Binding Site*

PubMed Central

Kadamur, Ganesh

2016-01-01

Mammalian phospholipase C-β (PLC-β) isoforms are stimulated by heterotrimeric G protein subunits and members of the Rho GTPase family of small G proteins. Although recent structural studies showed how Gαq and Rac1 bind PLC-β, there is a lack of consensus regarding the Gβγ binding site in PLC-β. Using FRET between cerulean fluorescent protein-labeled Gβγ and the Alexa Fluor 594-labeled PLC-β pleckstrin homology (PH) domain, we demonstrate that the PH domain is the minimal Gβγ binding region in PLC-β3. We show that the isolated PH domain can compete with full-length PLC-β3 for binding Gβγ but not Gαq, Using sequence conservation, structural analyses, and mutagenesis, we identify a hydrophobic face of the PLC-β PH domain as the Gβγ binding interface. This PH domain surface is not solvent-exposed in crystal structures of PLC-β, necessitating conformational rearrangement to allow Gβγ binding. Blocking PH domain motion in PLC-β by cross-linking it to the EF hand domain inhibits stimulation by Gβγ without altering basal activity or Gαq response. The fraction of PLC-β cross-linked is proportional to the fractional loss of Gβγ response. Cross-linked PLC-β does not bind Gβγ in a FRET-based Gβγ-PLC-β binding assay. We propose that unliganded PLC-β exists in equilibrium between a closed conformation observed in crystal structures and an open conformation where the PH domain moves away from the EF hands. Therefore, intrinsic movement of the PH domain in PLC-β modulates Gβγ access to its binding site. PMID:27002154

Quantitation of the calcium and membrane binding properties of the C2 domains of dysferlin.

PubMed

Abdullah, Nazish; Padmanarayana, Murugesh; Marty, Naomi J; Johnson, Colin P

2014-01-21

Dysferlin is a large membrane protein involved in calcium-triggered resealing of the sarcolemma after injury. Although it is generally accepted that dysferlin is Ca(2+) sensitive, the Ca(2+) binding properties of dysferlin have not been characterized. In this study, we report an analysis of the Ca(2+) and membrane binding properties of all seven C2 domains of dysferlin as well as a multi-C2 domain construct. Isothermal titration calorimetry measurements indicate that all seven dysferlin C2 domains interact with Ca(2+) with a wide range of binding affinities. The C2A and C2C domains were determined to be the most sensitive, with Kd values in the tens of micromolar, whereas the C2D domain was least sensitive, with a near millimolar Kd value. Mutagenesis of C2A demonstrates the requirement for negatively charged residues in the loop regions for divalent ion binding. Furthermore, dysferlin displayed significantly lower binding affinity for the divalent cations magnesium and strontium. Measurement of a multidomain construct indicates that the solution binding affinity does not change when C2 domains are linked. Finally, sedimentation assays suggest all seven C2 domains bind lipid membranes, and that Ca(2+) enhances but is not required for interaction. This report reveals for the first time, to our knowledge, that all dysferlin domains bind Ca(2+) albeit with varying affinity and stoichiometry. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Structure of the Response Regulator PhoP from Mycobacterium tuberculosis Reveals a Dimer Through the Receiver Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

S Menon; S Wang

The PhoP protein from Mycobacterium tuberculosis is a response regulator of the OmpR/PhoB subfamily, whose structure consists of an N-terminal receiver domain and a C-terminal DNA-binding domain. How the DNA-binding activities are regulated by phosphorylation of the receiver domain remains unclear due to a lack of structural information on the full-length proteins. Here we report the crystal structure of the full-length PhoP of M. tuberculosis. Unlike other known structures of full-length proteins of the same subfamily, PhoP forms a dimer through its receiver domain with the dimer interface involving {alpha}4-{beta}5-{alpha}5, a common interface for activated receiver domain dimers. However, themore » switch residues, Thr99 and Tyr118, are in a conformation resembling those of nonactivated receiver domains. The Tyr118 side chain is involved in the dimer interface interactions. The receiver domain is tethered to the DNA-binding domain through a flexible linker and does not impose structural constraints on the DNA-binding domain. This structure suggests that phosphorylation likely facilitates/stabilizes receiver domain dimerization, bringing the DNA-binding domains to close proximity, thereby increasing their binding affinity for direct repeat DNA sequences.« less

Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

PubMed Central

Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

2011-01-01

The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

Coding Sequence Mutations Identified in MYH7, TNNT2, SCN5A, CSRP3, LBD3, and TCAP from 313 Patients with Familial or Idiopathic Dilated Cardiomyopathy

PubMed Central

Hershberger, Ray E.; Parks, Sharie B.; Kushner, Jessica D.; Li, Duanxiang; Ludwigsen, Susan; Jakobs, Petra; Nauman, Deirdre; Burgess, Donna; Partain, Julie; Litt, Michael

2008-01-01

Abstract Background: More than 20 genes have been reported to cause idiopathic and familial dilated cardiomyopathy (IDC/FDC), but the frequency of genetic causation remains poorly understood. Methods and Results: Blood samples were collected and DNA prepared from 313 patients, 183 with FDC and 130 with IDC. Genomic DNA underwent bidirectional sequencing of six genes, and mutation carriers were followed up by evaluation of additional family members. We identified in 36 probands, 31 unique protein‐altering variants (11.5% overall) that were not identified in 253 control subjects (506 chromosomes). These included 13 probands (4.2%) with 12 β‐myosin heavy chain (MYH7) mutations, nine probands (2.9%) with six different cardiac troponin T (TNNT2) mutations, eight probands (2.6%) carrying seven different cardiac sodium channel (SCN5A) mutations, three probands (1.0%) with three titin‐cap or telethonin (TCAP) mutations, three probands (1.0%) with two LIM domain binding 3 (LDB3) mutations, and one proband (0.3%) with a muscle LIM protein (CSRP3) mutation. Four nucleotide changes did not segregate with phentoype and/or did not alter a conserved amino acid and were therefore considered unlikely to be disease‐causing. Mutations in 11 probands were assessed as likely disease‐causing, and in 21 probands were considered possibly disease‐causing. These 32 probands included 14 of the 130 with IDC (10.8%) and 18 of the 183 with FDC (9.8%) Conclusions: Mutations of these six genes each account for a small fraction of the genetic cause of FDC/IDC. The frequency of possible or likely disease‐causing mutations in these genes is similar for IDC and FDC. PMID:19412328

Laser beam delivery at ELI-NP

DOE PAGES

Ursescu, Daniel; Cheriaux, G.; Audebert, P.; ...

2017-01-01

The Laser Beam Delivery (LBD) system technical design report covers the interface between the High Power Laser System (HPLS) and the experiments, together with the pulse quality management. Here, the laser transport part of the LBD has a number of subsystems as follows: the beam transport lines for the six main outputs of HPLS, the additional short and long pulses and the synchronization system including the timing of the laser pulses with the Gamma Beam System (GBS) and the experiments on femtosecond timescale. Pulse quality management, discussed further here, consist in the generation and delivery of multiple HPLS pulses, coherentmore » combining of the HPLS arms, laser pulse diagnostics on target, laser beam dumps, shutters and output energy adaption.« less

The chitin-binding domain of a GH-18 chitinase from Vibrio harveyi is crucial for chitin-chitinase interactions.

PubMed

Suginta, Wipa; Sirimontree, Paknisa; Sritho, Natchanok; Ohnuma, Takayuki; Fukamizo, Tamo

2016-12-01

Vibrio harveyi chitinase A (VhChiA) is a GH-18 glycosyl hydrolase with a structure containing three distinct domains: i) the N-terminal chitin-binding domain; ii) the (α/β) 8 TIM barrel catalytic domain; and iii) the α+β insertion domain. In this study, we cloned the gene fragment encoding the chitin-binding domain of VhChiA, termed ChBD Vh ChiA . The recombinant ChBD Vh ChiA was heterologously expressed in E. coli BL21 strain Tuner(DE3)pLacI host cells, and purified to homogeneity. CD measurements suggested that ChBD Vh ChiA contained β-sheets as major structural components and fluorescence spectroscopy showed that the protein domain was folded correctly, and suitable for functional characterization. Chitin binding assays showed that ChBD Vh ChiA bound to both α- and β-chitins, with the greatest affinity for β-colloidal chitin, but barely bound to polymeric chitosan. These results identified the tandem N-acetamido functionality on chitin chains as the specific sites of enzyme-substrate interactions. The binding affinity of the isolated domain was significantly lower than that of intact VhChiA, suggesting that the catalytic domain works synergistically with the chitin-binding domain to guide the polymeric substrate into the substrate binding cleft. These data confirm the physiological role of the chitin-binding domain of the marine bacterial GH-18 chitinase A in chitin-chitinase interactions. Copyright © 2016 Elsevier B.V. All rights reserved.

Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

PubMed Central

Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

2010-01-01

The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

Structural basis of redox-dependent substrate binding of protein disulfide isomerase

PubMed Central

Yagi-Utsumi, Maho; Satoh, Tadashi; Kato, Koichi

2015-01-01

Protein disulfide isomerase (PDI) is a multidomain enzyme, operating as an essential folding catalyst, in which the b′ and a′ domains provide substrate binding sites and undergo an open–closed domain rearrangement depending on the redox states of the a′ domain. Despite the long research history of this enzyme, three-dimensional structural data remain unavailable for its ligand-binding mode. Here we characterize PDI substrate recognition using α-synuclein (αSN) as the model ligand. Our nuclear magnetic resonance (NMR) data revealed that the substrate-binding domains of PDI captured the αSN segment Val37–Val40 only in the oxidized form. Furthermore, we determined the crystal structure of an oxidized form of the b′–a′ domains in complex with an undecapeptide corresponding to this segment. The peptide-binding mode observed in the crystal structure with NMR validation, was characterized by hydrophobic interactions on the b′ domain in an open conformation. Comparison with the previously reported crystal structure indicates that the a′ domain partially masks the binding surface of the b′ domain, causing steric hindrance against the peptide in the reduced form of the b′–a′ domains that exhibits a closed conformation. These findings provide a structural basis for the mechanism underlying the redox-dependent substrate binding of PDI. PMID:26350503

PDZ Binding Domains, Structural Disorder and Phosphorylation: A Menage-a-trois Tailing Dcp2 mRNA Decapping Enzymes.

PubMed

Gunawardana, Dilantha

2016-01-01

Diverse cellular activities are mediated through the interaction of protein domains and their binding partners. One such protein domain widely distributed in the higher metazoan world is the PDZ domain, which facilitates abundant protein-protein interactions. The PDZ domain-PDZ binding domain interaction has been implicated in several pathologies including Alzheimer's disease, Parkinson's disease and Down syndrome. PDZ domains bind to C-terminal peptides/proteins which have either of the following combinations: S/T-X-hydrophobic-COOH for type I, hydrophobic-Xhydrophobic- COOH for type II, and D/E-X-hydrophobic-COOH for type III, although hydrophobicity in the termini form the key characteristic of the PDZ-binding domains. We identified and characterized a Dcp2 type mRNA decapping enzyme from Arabidopsis thaliana, a protein containing a putative PDZ-binding domain using mutagenesis and protein biochemistry. Now we are using bioinformatics to study the Cterminal end of mRNA decapping enzymes from complex metazoans with the aim of (1) identifying putative PDZ-binding domains (2) Correlating structural disorder with PDZ binding domains and (3) Demonstrating the presence of phosphorylation sites in C-terminal extremities of Dcp2 type mRNA decapping enzymes. It is proposed here that the trinity of PDZbinding domains, structural disorder and phosphorylation-susceptible sites are a feature of the Dcp2 family of decapping enzymes and perhaps is a wider trick in protein evolution where scaffolding/tethering is a requirement for localization and function. It is critical though laboratory-based supporting evidence is sought to back-up this bioinformatics exploration into tail regions of mRNA decapping enzymes.

Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

Structure of the ACF7 EF-Hand-GAR Module and Delineation of Microtubule Binding Determinants.

PubMed

Lane, Thomas R; Fuchs, Elaine; Slep, Kevin C

2017-07-05

Spectraplakins are large molecules that cross-link F-actin and microtubules (MTs). Mutations in spectraplakins yield defective cell polarization, aberrant focal adhesion dynamics, and dystonia. We present the 2.8 Å crystal structure of the hACF7 EF1-EF2-GAR MT-binding module and delineate the GAR residues critical for MT binding. The EF1-EF2 and GAR domains are autonomous domains connected by a flexible linker. The EF1-EF2 domain is an EFβ-scaffold with two bound Ca 2+ ions that straddle an N-terminal α helix. The GAR domain has a unique α/β sandwich fold that coordinates Zn 2+ . While the EF1-EF2 domain is not sufficient for MT binding, the GAR domain is and likely enhances EF1-EF2-MT engagement. Residues in a conserved basic patch, distal to the GAR domain's Zn 2+ -binding site, mediate MT binding. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor α Antagonist in MCF-7 Breast Cancer Cells

PubMed Central

Chisamore, Michael J.; Cunningham, Michael E.; Flores, Osvaldo; Wilkinson, Hilary A.; Chen, J. Don

2009-01-01

Background The orphan nuclear receptor estrogen-related receptor α (ERRα) is a member of the nuclear receptor superfamily. It was identified through a search for genes encoding proteins related to estrogen receptor α (ERα). An endogenous ligand has not been found. Novel ERRα antagonists that are highly specific for binding to the ligand binding domain (LBD) of ERRα have been recently reported. Research suggests that ERRα may be a novel drug target to treat breast cancer and/or metabolic disorders and this has led to an effort to characterize the mechanisms of action of N-[(2Z)-3-(4,5-dihydro-1,3-thiazol-2-yl)-1,3-thiazolidin-2-yl idene]-5H dibenzo[a,d][7]annulen-5-amine, a novel ERRα specific antagonist. Methodology/Principal Findings We demonstrate this ERRα ligand inhibits ERRα transcriptional activity in MCF-7 cells by luciferase assay but does not affect mRNA levels measured by real-time RT-PCR. Also, ERα (ESR1) mRNA levels were not affected upon treatment with the ERRα antagonist, but other ERRα (ESRRA) target genes such as pS2 (TFF1), osteopontin (SPP1), and aromatase (CYP19A1) mRNA levels decreased. In vitro, the ERRα antagonist prevents the constitutive interaction between ERRα and nuclear receptor coactivators. Furthermore, we use Western blots to demonstrate ERRα protein degradation via the ubiquitin proteasome pathway is increased by the ERRα-subtype specific antagonist. We demonstrate by chromatin immunoprecipitation (ChIP) that the interaction between ACADM, ESRRA, and TFF1 endogenous gene promoters and ERRα protein is decreased when cells are treated with the ligand. Knocking-down ERRα (shRNA) led to similar genomic effects seen when MCF-7 cells were treated with our ERRα antagonist. Conclusions/Significance We report the mechanism of action of a novel ERRα specific antagonist that inhibits transcriptional activity of ERRα, disrupts the constitutive interaction between ERRα and nuclear coactivators, and induces proteasome-dependent ERRα protein degradation. Additionally, we confirmed that knocking-down ERRα lead to similar genomic effects demonstrated in vitro when treated with the ERRα specific antagonist. PMID:19462000

Biophysical basis of the binding of WWOX tumor suppressor to WBP1 and WBP2 adaptors.

PubMed

McDonald, Caleb B; Buffa, Laura; Bar-Mag, Tomer; Salah, Zaidoun; Bhat, Vikas; Mikles, David C; Deegan, Brian J; Seldeen, Kenneth L; Malhotra, Arun; Sudol, Marius; Aqeilan, Rami I; Nawaz, Zafar; Farooq, Amjad

2012-09-07

The WW-containing oxidoreductase (WWOX) tumor suppressor participates in a diverse array of cellular activities by virtue of its ability to recognize WW-binding protein 1 (WBP1) and WW-binding protein 2 (WBP2) signaling adaptors among a wide variety of other ligands. Herein, using a multitude of biophysical techniques, we provide evidence that while the WW1 domain of WWOX binds to PPXY motifs within WBP1 and WBP2 in a physiologically relevant manner, the WW2 domain exhibits no affinity toward any of these PPXY motifs. Importantly, our data suggest that while R25/W44 residues located within the binding pocket of a triple-stranded β-fold of WW1 domain are critical for the recognition of PPXY ligands, they are replaced by the chemically distinct E66/Y85 duo at structurally equivalent positions within the WW2 domain, thereby accounting for its failure to bind PPXY ligands. Predictably, not only does the introduction of E66R/Y85W double substitution within the WW2 domain result in gain of function but the resulting engineered domain, hereinafter referred to as WW2_RW, also appears to be a much stronger binding partner of WBP1 and WBP2 than the wild-type WW1 domain. We also show that while the WW1 domain is structurally disordered and folds upon ligand binding, the WW2 domain not only adopts a fully structured conformation but also aids stabilization and ligand binding to WW1 domain. This salient observation implies that the WW2 domain likely serves as a chaperone to augment the physiological function of WW1 domain within WWOX. Collectively, our study lays the groundwork for understanding the molecular basis of a key protein-protein interaction pertinent to human health and disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

An Autoinhibitory Role for the Pleckstrin Homology Domain of Interleukin-2-Inducible Tyrosine Kinase and Its Interplay with Canonical Phospholipid Recognition.

PubMed

Devkota, Sujan; Joseph, Raji E; Boyken, Scott E; Fulton, D Bruce; Andreotti, Amy H

2017-06-13

Pleckstrin homology (PH) domains are well-known as phospholipid binding modules, yet evidence that PH domain function extends beyond lipid recognition is mounting. In this work, we characterize a protein binding function for the PH domain of interleukin-2-inducible tyrosine kinase (ITK), an immune cell specific signaling protein that belongs to the TEC family of nonreceptor tyrosine kinases. Its N-terminal PH domain is a well-characterized lipid binding module that localizes ITK to the membrane via phosphatidylinositol 3,4,5-trisphosphate (PIP 3 ) binding. Using a combination of nuclear magnetic resonance spectroscopy and mutagenesis, we have mapped an autoregulatory protein interaction site on the ITK PH domain that makes direct contact with the catalytic kinase domain of ITK, inhibiting the phospho-transfer reaction. Moreover, we have elucidated an important interplay between lipid binding by the ITK PH domain and the stability of the autoinhibitory complex formed by full length ITK. The ITK activation loop in the kinase domain becomes accessible to phosphorylation to the exogenous kinase LCK upon binding of the ITK PH domain to PIP 3 . By clarifying the allosteric role of the ITK PH domain in controlling ITK function, we have expanded the functional repertoire of the PH domain generally and opened the door to alternative strategies to target this specific kinase in the context of immune cell signaling.

Identification of functional domains of the IR2 protein of equine herpesvirus 1 required for inhibition of viral gene expression and replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan

2011-09-01

The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less

Solution structure of the Big domain from Streptococcus pneumoniae reveals a novel Ca2+-binding module

PubMed Central

Wang, Tao; Zhang, Jiahai; Zhang, Xuecheng; Xu, Chao; Tu, Xiaoming

2013-01-01

Streptococcus pneumoniae is a pathogen causing acute respiratory infection, otitis media and some other severe diseases in human. In this study, the solution structure of a bacterial immunoglobulin-like (Big) domain from a putative S. pneumoniae surface protein SP0498 was determined by NMR spectroscopy. SP0498 Big domain adopts an eight-β-strand barrel-like fold, which is different in some aspects from the two-sheet sandwich-like fold of the canonical Ig-like domains. Intriguingly, we identified that the SP0498 Big domain was a Ca2+ binding domain. The structure of the Big domain is different from those of the well known Ca2+ binding domains, therefore revealing a novel Ca2+-binding module. Furthermore, we identified the critical residues responsible for the binding to Ca2+. We are the first to report the interactions between the Big domain and Ca2+ in terms of structure, suggesting an important role of the Big domain in many essential calcium-dependent cellular processes such as pathogenesis. PMID:23326635

Crystal structure of the solute-binding protein BxlE from Streptomyces thermoviolaceus OPC-520 complexed with xylobiose.

PubMed

Tomoo, Koji; Miki, Yasuhiro; Morioka, Hideaki; Seike, Kiho; Ishida, Toshimasa; Ikenishi, Sadao; Miyamoto, Katsushiro; Hasegawa, Tomokazu; Yamano, Akihito; Hamada, Kensaku; Tsujibo, Hiroshi

2017-06-01

BxlE from Streptomyces thermoviolaceus OPC-520 is a xylo-oligosaccharide (mainly xylobiose)-binding protein that serves as the initial receptor for the bacterial ABC-type xylo-oligosaccharide transport system. To determine the ligand-binding mechanism of BxlE, X-ray structures of ligand-free (open form) and ligand (xylobiose)-bound (closed form) BxlE were determined at 1.85 Å resolution. BxlE consists of two globular domains that are linked by two β-strands, with the cleft at the interface of the two domains creating the ligand-binding pocket. In the ligand-free open form, this pocket consists of a U-shaped and negatively charged groove located between the two domains. In the xylobiose-bound closed form of BxlE, both the N and C domains move to fold the ligand without conformational changes in either domain. Xylobiose is buried in the groove and wrapped by the N-domain mainly via hydrogen bond interactions and by the C-domain primarily via non-polar interactions with Trp side chains. In addition to the concave shape matching the binding of xylobiose, an inter-domain salt bridge between Asp-47 and Lys-294 limits the space in the ligand-binding site. This domain-stabilized mechanism of ligand binding to BxlE is a unique feature that is not observed with other solute-binding proteins. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Exploring the molecular basis of RNA recognition by the dimeric RNA-binding protein via molecular simulation methods.

PubMed

Chang, Shan; Zhang, Da-Wei; Xu, Lei; Wan, Hua; Hou, Ting-Jun; Kong, Ren

2016-11-01

RNA-binding protein with multiple splicing (RBPMS) is critical for axon guidance, smooth muscle plasticity, and regulation of cancer cell proliferation and migration. Recently, different states of the RNA-recognition motif (RRM) of RBPMS, one in its free form and another in complex with CAC-containing RNA, were determined by X-ray crystallography. In this article, the free RRM domain, its wild type complex and 2 mutant complex systems are studied by molecular dynamics (MD) simulations. Through comparison of free RRM domain and complex systems, it's found that the RNA binding facilitates stabilizing the RNA-binding interface of RRM domain, especially the C-terminal loop. Although both R38Q and T103A/K104A mutations reduce the binding affinity of RRM domain and RNA, the underlining mechanisms are different. Principal component analysis (PCA) and Molecular mechanics Poisson-Boltzmann surface area (MM/PBSA) methods were used to explore the dynamical and recognition mechanisms of RRM domain and RNA. R38Q mutation is positioned on the homodimerization interface and mainly induces the large fluctuations of RRM domains. This mutation does not directly act on the RNA-binding interface, but some interfacial hydrogen bonds are weakened. In contrast, T103A/K104A mutations are located on the RNA-binding interface of RRM domain. These mutations obviously break most of high occupancy hydrogen bonds in the RNA-binding interface. Meanwhile, the key interfacial residues lose their favorable energy contributions upon RNA binding. The ranking of calculated binding energies in 3 complex systems is well consistent with that of experimental binding affinities. These results will be helpful in understanding the RNA recognition mechanisms of RRM domain.

Exploring the molecular basis of RNA recognition by the dimeric RNA-binding protein via molecular simulation methods

PubMed Central

Chang, Shan; Zhang, Da-Wei; Xu, Lei; Wan, Hua; Hou, Ting-Jun; Kong, Ren

2016-01-01

ABSTRACT RNA-binding protein with multiple splicing (RBPMS) is critical for axon guidance, smooth muscle plasticity, and regulation of cancer cell proliferation and migration. Recently, different states of the RNA-recognition motif (RRM) of RBPMS, one in its free form and another in complex with CAC-containing RNA, were determined by X-ray crystallography. In this article, the free RRM domain, its wild type complex and 2 mutant complex systems are studied by molecular dynamics (MD) simulations. Through comparison of free RRM domain and complex systems, it's found that the RNA binding facilitates stabilizing the RNA-binding interface of RRM domain, especially the C-terminal loop. Although both R38Q and T103A/K104A mutations reduce the binding affinity of RRM domain and RNA, the underlining mechanisms are different. Principal component analysis (PCA) and Molecular mechanics Poisson-Boltzmann surface area (MM/PBSA) methods were used to explore the dynamical and recognition mechanisms of RRM domain and RNA. R38Q mutation is positioned on the homodimerization interface and mainly induces the large fluctuations of RRM domains. This mutation does not directly act on the RNA-binding interface, but some interfacial hydrogen bonds are weakened. In contrast, T103A/K104A mutations are located on the RNA-binding interface of RRM domain. These mutations obviously break most of high occupancy hydrogen bonds in the RNA-binding interface. Meanwhile, the key interfacial residues lose their favorable energy contributions upon RNA binding. The ranking of calculated binding energies in 3 complex systems is well consistent with that of experimental binding affinities. These results will be helpful in understanding the RNA recognition mechanisms of RRM domain. PMID:27592836

Interaction between the PH and START domains of ceramide transfer protein competes with phosphatidylinositol 4-phosphate binding by the PH domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prashek, Jennifer; Bouyain, Samuel; Fu, Mingui

De novo synthesis of the sphingolipid sphingomyelin requires non-vesicular transport of ceramide from the endoplasmic reticulum to the Golgi by the multidomain protein ceramide transfer protein (CERT). CERT's N-terminal pleckstrin homology (PH) domain targets it to the Golgi by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P) in the Golgi membrane, whereas its C-terminal StAR-related lipid transfer domain (START) carries out ceramide transfer. Hyperphosphorylation of a serine-rich motif immediately after the PH domain decreases both PtdIns(4)P binding and ceramide transfer by CERT. This down-regulation requires both the PH and START domains, suggesting a possible inhibitory interaction between the two domains. In this studymore » we show that isolated PH and START domains interact with each other. The crystal structure of a PH–START complex revealed that the START domain binds to the PH domain at the same site for PtdIns(4)P-binding, suggesting that the START domain competes with PtdIns(4)P for association with the PH domain. We further report that mutations disrupting the PH–START interaction increase both PtdIns(4)P-binding affinity and ceramide transfer activity of a CERT-serine–rich phosphorylation mimic. We also found that these mutations increase the Golgi localization of CERT inside the cell, consistent with enhanced PtdIns(4)P binding of the mutant. Collectively, our structural, biochemical, and cellular investigations provide important structural insight into the regulation of CERT function and localization.« less

Alteration of the C-terminal ligand specificity of the erbin PDZ domain by allosteric mutational effects.

PubMed

Murciano-Calles, Javier; McLaughlin, Megan E; Erijman, Ariel; Hooda, Yogesh; Chakravorty, Nishant; Martinez, Jose C; Shifman, Julia M; Sidhu, Sachdev S

2014-10-23

Modulation of protein binding specificity is important for basic biology and for applied science. Here we explore how binding specificity is conveyed in PDZ (postsynaptic density protein-95/discs large/zonula occludens-1) domains, small interaction modules that recognize various proteins by binding to an extended C terminus. Our goal was to engineer variants of the Erbin PDZ domain with altered specificity for the most C-terminal position (position 0) where a Val is strongly preferred by the wild-type domain. We constructed a library of PDZ domains by randomizing residues in direct contact with position 0 and in a loop that is close to but does not contact position 0. We used phage display to select for PDZ variants that bind to 19 peptide ligands differing only at position 0. To verify that each obtained PDZ domain exhibited the correct binding specificity, we selected peptide ligands for each domain. Despite intensive efforts, we were only able to evolve Erbin PDZ domain variants with selectivity for the aliphatic C-terminal side chains Val, Ile and Leu. Interestingly, many PDZ domains with these three distinct specificities contained identical amino acids at positions that directly contact position 0 but differed in the loop that does not contact position 0. Computational modeling of the selected PDZ domains shows how slight conformational changes in the loop region propagate to the binding site and result in different binding specificities. Our results demonstrate that second-sphere residues could be crucial in determining protein binding specificity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Structural analyses of von Willebrand factor C domains of collagen 2A and CCN3 reveal an alternative mode of binding to bone morphogenetic protein-2.

PubMed

Xu, Emma-Ruoqi; Blythe, Emily E; Fischer, Gerhard; Hyvönen, Marko

2017-07-28

Bone morphogenetic proteins (BMPs) are secreted growth factors that promote differentiation processes in embryogenesis and tissue development. Regulation of BMP signaling involves binding to a variety of extracellular proteins, among which are many von Willebrand factor C (vWC) domain-containing proteins. Although the crystal structure of the complex of crossveinless-2 (CV-2) vWC1 and BMP-2 previously revealed one mode of the vWC/BMP-binding mechanism, other vWC domains may bind to BMP differently. Here, using X-ray crystallography, we present for the first time structures of the vWC domains of two proteins thought to interact with BMP-2: collagen IIA and matricellular protein CCN3. We found that these two vWC domains share a similar N-terminal fold that differs greatly from that in CV-2 vWC, which comprises its BMP-2-binding site. We analyzed the ability of these vWC domains to directly bind to BMP-2 and detected an interaction only between the collagen IIa vWC and BMP-2. Guided by the collagen IIa vWC domain crystal structure and conservation of surface residues among orthologous domains, we mapped the BMP-binding epitope on the subdomain 1 of the vWC domain. This binding site is different from that previously observed in the complex between CV-2 vWC and BMP-2, revealing an alternative mode of interaction between vWC domains and BMPs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

NASA Technical Reports Server (NTRS)

Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

2000-01-01

Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

Post-stroke acquired amusia: A comparison between right- and left-brain hemispheric damages.

PubMed

Jafari, Zahra; Esmaili, Mahdiye; Delbari, Ahmad; Mehrpour, Masoud; Mohajerani, Majid H

2017-01-01

Although extensive research has been published about the emotional consequences of stroke, most studies have focused on emotional words, speech prosody, voices, or facial expressions. The emotional processing of musical excerpts following stroke has been relatively unexplored. The present study was conducted to investigate the effects of chronic stroke on the recognition of basic emotions in music. Seventy persons, including 25 normal controls (NC), 25 persons with right brain damage (RBD) from stroke, and 20 persons with left brain damage (LBD) from stroke between the ages of 31-71 years were studied. The Musical Emotional Bursts (MEB) test, which consists of a set of short musical pieces expressing basic emotional states (happiness, sadness, and fear) and neutrality, was used to test musical emotional perception. Both stroke groups were significantly poorer than normal controls for the MEB total score and its subtests (p < 0.001). The RBD group was significantly less able than the LBD group to recognize sadness (p = 0.047) and neutrality (p = 0.015). Negative correlations were found between age and MEB scores for all groups, particularly the NC and RBD groups. Our findings indicated that stroke affecting the auditory cerebrum can cause acquired amusia with greater severity in RBD than LBD. These results supported the "valence hypothesis" of right hemisphere dominance in processing negative emotions.

Ecology of the aging human brain.

PubMed

Sonnen, Joshua A; Santa Cruz, Karen; Hemmy, Laura S; Woltjer, Randall; Leverenz, James B; Montine, Kathleen S; Jack, Clifford R; Kaye, Jeffrey; Lim, Kelvin; Larson, Eric B; White, Lon; Montine, Thomas J

2011-08-01

Alzheimer disease, cerebral vascular brain injury, and isocortical Lewy body disease (LBD) are the major contributors to dementia in community- and population-based studies. To estimate the prevalence of clinically silent forms of these diseases in cognitively normal (CN) adults. Autopsy study. Community- and population based. A total of 1672 brain autopsies from the Adult Changes in Thought study, Honolulu-Asia Aging Study, Nun Study, and Oregon Brain Aging Study, of which 424 met the criteria for CN. Of these, 336 cases had a comprehensive neuropathologic examination of neuritic plaque density, Braak stage for neurofibrillary tangles, LB distribution, and number of cerebral microinfarcts. Forty-seven percent of CN cases had moderate or frequent neuritic plaque density; of these, 6% also had Braak stage V or VI for neurofibrillary tangles. Fifteen percent of CN cases had medullary LBD; 8% also had nigral and 4% isocortical LBD. The presence of any cerebral microinfarcts was identified in 33% and of high-level cerebral microinfarcts in 10% of CN individuals. Overall, the burden of lesions in each individual and their comorbidity varied widely within each study but were similar across studies. These data show an individually varying complex convergence of subclinical diseases in the brain of older CN adults. Appreciating this ecology should help guide future biomarker and neuroimaging studies and clinical trials that focus on community- and population-based cohorts.

α-Synuclein pathology in the cranial and spinal nerves in Lewy body disease.

PubMed

Nakamura, Keiko; Mori, Fumiaki; Tanji, Kunikazu; Miki, Yasuo; Toyoshima, Yasuko; Kakita, Akiyoshi; Takahashi, Hitoshi; Yamada, Masahito; Wakabayashi, Koichi

2016-06-01

Accumulation of phosphorylated α-synuclein in neurons and glial cells is a histological hallmark of Lewy body disease (LBD) and multiple system atrophy (MSA). Recently, filamentous aggregations of phosphorylated α-synuclein have been reported in the cytoplasm of Schwann cells, but not in axons, in the peripheral nervous system in MSA, mainly in the cranial and spinal nerve roots. Here we conducted an immunohistochemical investigation of the cranial and spinal nerves and dorsal root ganglia of patients with LBD. Lewy axons were found in the oculomotor, trigeminal and glossopharyngeal-vagus nerves, but not in the hypoglossal nerve. The glossopharyngeal-vagus nerves were most frequently affected, with involvement in all of 20 subjects. In the spinal nerve roots, Lewy axons were found in all of the cases examined. Lewy axons in the anterior nerves were more frequent and numerous in the thoracic and sacral segments than in the cervical and lumbar segments. On the other hand, axonal lesions in the posterior spinal nerve roots appeared to increase along a cervical-to-sacral gradient. Although Schwann cell cytoplasmic inclusions were found in the spinal nerves, they were only minimal. In the dorsal root ganglia, axonal lesions were seldom evident. These findings indicate that α-synuclein pathology in the peripheral nerves is axonal-predominant in LBD, whereas it is restricted to glial cells in MSA. © 2015 Japanese Society of Neuropathology.

Musical tasks targeting preserved and impaired functions in two dementias.

PubMed

Halpern, Andrea R; Golden, Hannah L; Magdalinou, Nadia; Witoonpanich, Pirada; Warren, Jason D

2015-03-01

Studies of musical abilities in dementia have for the most part been rather general assessments of abilities, for instance, assessing retention of music learned premorbidly. Here, we studied patients with dementias with contrasting cognitive profiles to explore specific aspects of music cognition under challenge. Patients suffered from Alzheimer's disease (AD), in which a primary impairment is in forming new declarative memories, or Lewy body disease (PD/LBD), a type of parkinsonism in which executive impairments are prominent. In the AD patients, we examined musical imagery. Behavioral and neural evidence confirms involvement of perceptual networks in imagery, and these are relatively spared in early stages of the illness. Thus, we expected patients to have relatively intact imagery in a mental pitch comparison task. For the LBD patients, we tested whether executive dysfunction would extend to music. We probed inhibitory skills by asking for a speeded pitch or timbre judgment when the irrelevant dimension was held constant or also changed. Preliminary results show that AD patients score similarly to controls in the imagery tasks, but PD/LBD patients are impaired relative to controls in suppressing some irrelevant musical dimensions, particularly when the required judgment varies from trial to trial. © 2014 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals Inc. on behalf of The New York Academy of Sciences.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Structural and functional analysis of the YAP-binding domain of human TEAD2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Wei; Yu, Jianzhong; Tomchick, Diana R.

2010-06-15

The Hippo pathway controls organ size and suppresses tumorigenesis in metazoans by blocking cell proliferation and promoting apoptosis. The TEAD1-4 proteins (which contain a DNA-binding domain but lack an activation domain) interact with YAP (which lacks a DNA-binding domain but contains an activation domain) to form functional heterodimeric transcription factors that activate proliferative and prosurvival gene expression programs. The Hippo pathway inhibits the YAP-TEAD hybrid transcription factors by phosphorylating and promoting cytoplasmic retention of YAP. Here we report the crystal structure of the YAP-binding domain (YBD) of human TEAD2. TEAD2 YBD adopts an immunoglobulin-like {beta}-sandwich fold with two extra helix-turn-helixmore » inserts. NMR studies reveal that the TEAD-binding domain of YAP is natively unfolded and that TEAD binding causes localized conformational changes in YAP. In vitro binding and in vivo functional assays define an extensive conserved surface of TEAD2 YBD as the YAP-binding site. Therefore, our studies suggest that a short segment of YAP adopts an extended conformation and forms extensive contacts with a rigid surface of TEAD. Targeting a surface-exposed pocket of TEAD might be an effective strategy to disrupt the YAP-TEAD interaction and to reduce the oncogenic potential of YAP.« less

Plant chimeric Ca2+/Calmodulin-dependent protein kinase. Role of the neural visinin-like domain in regulating autophosphorylation and calmodulin affinity

NASA Technical Reports Server (NTRS)

Sathyanarayanan, P. V.; Cremo, C. R.; Poovaiah, B. W.

2000-01-01

Chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) is characterized by a serine-threonine kinase domain, an autoinhibitory domain, a calmodulin-binding domain and a neural visinin-like domain with three EF-hands. The neural visinin-like Ca(2+)-binding domain at the C-terminal end of the CaM-binding domain makes CCaMK unique among all the known calmodulin-dependent kinases. Biological functions of the plant visinin-like proteins or visinin-like domains in plant proteins are not well known. Using EF-hand deletions in the visinin-like domain, we found that the visinin-like domain regulated Ca(2+)-stimulated autophosphorylation of CCaMK. To investigate the effects of Ca(2+)-stimulated autophosphorylation on the interaction with calmodulin, the equilibrium binding constants of CCaMK were measured by fluorescence emission anisotropy using dansylated calmodulin. Binding was 8-fold tighter after Ca(2+)-stimulated autophosphorylation. This shift in affinity did not occur in CCaMK deletion mutants lacking Ca(2+)-stimulated autophosphorylation. A variable calmodulin affinity regulated by Ca(2+)-stimulated autophosphorylation mediated through the visinin-like domain is a new regulatory mechanism for CCaMK activation and calmodulin-dependent protein kinases. Our experiments demonstrate the existence of two functional molecular switches in a protein kinase regulating the kinase activity, namely a visinin-like domain acting as a Ca(2+)-triggered switch and a CaM-binding domain acting as an autophosphorylation-triggered molecular switch.

Deleted in malignant brain tumors-1 protein (DMBT1): a pattern recognition receptor with multiple binding sites.

PubMed

Ligtenberg, Antoon J M; Karlsson, Niclas G; Veerman, Enno C I

2010-01-01

Deleted in Malignant Brain Tumors-1 protein (DMBT1), salivary agglutinin (DMBT1(SAG)), and lung glycoprotein-340 (DMBT1(GP340)) are three names for glycoproteins encoded by the same DMBT1 gene. All these proteins belong to the scavenger receptor cysteine-rich (SRCR) superfamily of proteins: a superfamily of secreted or membrane-bound proteins with SRCR domains that are highly conserved down to sponges, the most ancient metazoa. In addition to SRCR domains, all DMBT1s contain two CUB domains and one zona pellucida domain. The SRCR domains play a role in the function of DMBT1s, which is the binding of a broad range of pathogens including cariogenic streptococci, Helicobacter pylori and HIV. Mucosal defense proteins like IgA, surfactant proteins and lactoferrin also bind to DMBT1s through their SRCR domains. The binding motif on the SRCR domains comprises an 11-mer peptide in which a few amino acids are essential for binding (GRVEVLYRGSW). Adjacent to each individual SRCR domain are glycosylation domains, where the attached carbohydrate chains play a role in the binding of influenza A virus and Helicobacter pylori. The composition of the carbohydrate chains is not only donor specific, but also varies between different organs. These data demonstrate a role for DMBT1s as pattern recognition molecules containing various peptide and carbohydrate binding motifs.

The Vibrio cholerae Colonization Factor GbpA Possesses a Modular Structure that Governs Binding to Different Host Surfaces

PubMed Central

Wong, Edmond; Vaaje-Kolstad, Gustav; Ghosh, Avishek; Hurtado-Guerrero, Ramon; Konarev, Peter V.; Ibrahim, Adel F. M.; Svergun, Dmitri I.; Eijsink, Vincent G. H.; Chatterjee, Nabendu S.; van Aalten, Daan M. F.

2012-01-01

Vibrio cholerae is a bacterial pathogen that colonizes the chitinous exoskeleton of zooplankton as well as the human gastrointestinal tract. Colonization of these different niches involves an N-acetylglucosamine binding protein (GbpA) that has been reported to mediate bacterial attachment to both marine chitin and mammalian intestinal mucin through an unknown molecular mechanism. We report structural studies that reveal that GbpA possesses an unusual, elongated, four-domain structure, with domains 1 and 4 showing structural homology to chitin binding domains. A glycan screen revealed that GbpA binds to GlcNAc oligosaccharides. Structure-guided GbpA truncation mutants show that domains 1 and 4 of GbpA interact with chitin in vitro, whereas in vivo complementation studies reveal that domain 1 is also crucial for mucin binding and intestinal colonization. Bacterial binding studies show that domains 2 and 3 bind to the V. cholerae surface. Finally, mouse virulence assays show that only the first three domains of GbpA are required for colonization. These results explain how GbpA provides structural/functional modular interactions between V. cholerae, intestinal epithelium and chitinous exoskeletons. PMID:22253590

Recombinant spider silk genetically functionalized with affinity domains.

PubMed

Jansson, Ronnie; Thatikonda, Naresh; Lindberg, Diana; Rising, Anna; Johansson, Jan; Nygren, Per-Åke; Hedhammar, My

2014-05-12

Functionalization of biocompatible materials for presentation of active protein domains is an area of growing interest. Herein, we describe a strategy for functionalization of recombinant spider silk via gene fusion to affinity domains of broad biotechnological use. Four affinity domains of different origin and structure; the IgG-binding domains Z and C2, the albumin-binding domain ABD, and the biotin-binding domain M4, were all successfully produced as soluble silk fusion proteins under nondenaturing purification conditions. Silk films and fibers produced from the fusion proteins were demonstrated to be chemically and thermally stable. Still, the bioactive domains are concluded to be folded and accessible, since their respective targets could be selectively captured from complex samples, including rabbit serum and human plasma. Interestingly, materials produced from mixtures of two different silk fusion proteins displayed combined binding properties, suggesting that tailor-made materials with desired stoichiometry and surface distributions of several binding domains can be produced. Further, use of the IgG binding ability as a general mean for presentation of desired biomolecules could be demonstrated for a human vascular endothelial growth factor (hVEGF) model system, via a first capture of anti-VEGF IgG to silk containing the Z-domain, followed by incubation with hVEGF. Taken together, this study demonstrates the potential of recombinant silk, genetically functionalized with affinity domains, for construction of biomaterials capable of presentation of almost any desired biomolecule.

Chimeric Plant Calcium/Calmodulin-Dependent Protein Kinase Gene with a Neural Visinin-Like Calcium-Binding Domain

NASA Technical Reports Server (NTRS)

Patil, Shameekumar; Takezawa, D.; Poovaiah, B. W.

1995-01-01

Calcium, a universal second messenger, regulates diverse cellular processes in eukaryotes. Ca-2(+) and Ca-2(+)/calmodulin-regulated protein phosphorylation play a pivotal role in amplifying and diversifying the action of Ca-2(+)- mediated signals. A chimeric Ca-2(+)/calmodulin-dependent protein kinase (CCaMK) gene with a visinin-like Ca-2(+)- binding domain was cloned and characterized from lily. The cDNA clone contains an open reading frame coding for a protein of 520 amino acids. The predicted structure of CCaMK contains a catalytic domain followed by two regulatory domains, a calmodulin-binding domain and a visinin-like Ca-2(+)-binding domain. The amino-terminal region of CCaMK contains all 11 conserved subdomains characteristic of serine/threonine protein kinases. The calmodulin-binding region of CCaMK has high homology (79%) to alpha subunit of mammalian Ca-2(+)/calmodulin-dependent protein kinase. The calmodulin-binding region is fused to a neural visinin-like domain that contains three Ca-2(+)-binding EF-hand motifs and a biotin-binding site. The Escherichia coli-expressed protein (approx. 56 kDa) binds calmodulin in a Ca-2(+)-dependent manner. Furthermore, Ca-45-binding assays revealed that CCaMK directly binds Ca-2(+). The CCaMK gene is preferentially expressed in developing anthers. Southern blot analysis revealed that CCaMK is encoded by a single gene. The structural features of the gene suggest that it has multiple regulatory controls and could play a unique role in Ca-2(+) signaling in plants.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

Cholinesterase inhibitors in Alzheimer's disease and Lewy body spectrum disorders: the emerging pharmacogenetic story

PubMed Central

2009-01-01

This review provides an update on the current state of pharmacogenetic research in the treatment of Alzheimer's disease (AD) and Lewy body disease (LBD) as it pertains to the use of cholinesterase inhibitors (ChEI). AD and LBD are first reviewed from clinical and pathophysiological perspectives. This is followed by a discussion of ChEIs used in the symptomatic treatment of these conditions, focusing on their unique and overlapping pharmacokinetic and pharmacodynamic profiles, which can be used to identify candidate genes for pharmacogenetics studies. The literature published to date is then reviewed and limitations are discussed. This is followed by a discussion of potential endophenotypes which may help to refine future pharmacogenetic studies of response and adverse effects to ChEIs. PMID:20038497

Intramolecular interactions regulate SAP97 binding to GKAP

PubMed Central

Wu, Hongju; Reissner, Carsten; Kuhlendahl, Sven; Coblentz, Blake; Reuver, Susanne; Kindler, Stefan; Gundelfinger, Eckart D.; Garner, Craig C.

2000-01-01

Membrane-associated guanylate kinase homologs (MAGUKs) are multidomain proteins found to be central organizers of cellular junctions. In this study, we examined the molecular mechanisms that regulate the interaction of the MAGUK SAP97 with its GUK domain binding partner GKAP (GUK-associated protein). The GKAP–GUK interaction is regulated by a series of intramolecular interactions. Specifically, the association of the Src homology 3 (SH3) domain and sequences situated between the SH3 and GUK domains with the GUK domain was found to interfere with GKAP binding. In contrast, N-terminal sequences that precede the first PDZ domain in SAP97, facilitated GKAP binding via its association with the SH3 domain. Utilizing crystal structure data available for PDZ, SH3 and GUK domains, molecular models of SAP97 were generated. These models revealed that SAP97 can exist in a compact U-shaped conformation in which the N-terminal domain folds back and interacts with the SH3 and GUK domains. These models support the biochemical data and provide new insights into how intramolecular interactions may regulate the association of SAP97 with its binding partners. PMID:11060025

Kinase Associated-1 Domains Drive MARK/PAR1 Kinases to Membrane Targets by Binding Acidic Phospholipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moravcevic, Katarina; Mendrola, Jeannine M.; Schmitz, Karl R.

Phospholipid-binding modules such as PH, C1, and C2 domains play crucial roles in location-dependent regulation of many protein kinases. Here, we identify the KA1 domain (kinase associated-1 domain), found at the C terminus of yeast septin-associated kinases (Kcc4p, Gin4p, and Hsl1p) and human MARK/PAR1 kinases, as a membrane association domain that binds acidic phospholipids. Membrane localization of isolated KA1 domains depends on phosphatidylserine. Using X-ray crystallography, we identified a structurally conserved binding site for anionic phospholipids in KA1 domains from Kcc4p and MARK1. Mutating this site impairs membrane association of both KA1 domains and intact proteins and reveals the importancemore » of phosphatidylserine for bud neck localization of yeast Kcc4p. Our data suggest that KA1 domains contribute to coincidence detection, allowing kinases to bind other regulators (such as septins) only at the membrane surface. These findings have important implications for understanding MARK/PAR1 kinases, which are implicated in Alzheimer's disease, cancer, and autism.« less

Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

PubMed Central

Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

2013-01-01

Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

PubMed

Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

2008-11-21

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

Bio-nanocapsules displaying various immunoglobulins as an active targeting-based drug delivery system.

PubMed

Tatematsu, Kenji; Iijima, Masumi; Yoshimoto, Nobuo; Nakai, Tadashi; Okajima, Toshihide; Kuroda, Shun'ichi

2016-04-15

The bio-nanocapsule (BNC) is an approximately 30-nm particle comprising the hepatitis B virus (HBV) envelope L protein and a lipid bilayer. The L protein harbors the HBV-derived infection machinery; therefore, BNC can encapsulate payloads such as drugs, nucleic acids, and proteins and deliver them into human hepatocytes specifically in vitro and in vivo. To diversify the possible functions of BNC, we generated ZZ-BNC by replacing the domain indispensable for the human hepatotrophic property of BNC (N-terminal region of L protein) with the tandem form of the IgG Fc-binding Z domain of Staphylococcus aureus protein A. Thus, the ZZ-BNC is an active targeting-based drug delivery system (DDS) nanocarrier that depends on the specificity of the IgGs displayed. However, the Z domain limits the animal species and subtypes of IgGs that can be displayed on ZZ-BNC. In this study, we introduced into BNC an Ig κ light chain-binding B1 domain of Finegoldia magna protein L (protein-L B1 domain) and an Ig Fc-binding C2 domain of Streptococcus species protein G (protein-G C2 domain) to produce LG-BNC. The LL-BNC was constructed in a similar way using a tandem form of the protein-L B1 domain. Both LG-BNC and LL-BNC could display rat IgGs, mouse IgG1, human IgG3, and human IgM, all of which not binding to ZZ-BNC, and accumulate in target cells in an antibody specificity-dependent manner. Thus, these BNCs could display a broad spectrum of Igs, significantly improving the prospects for BNCs as active targeting-based DDS nanocarriers. We previously reported that ZZ-BNC, bio-nanocapsule deploying the IgG-binding Z domain of protein A, could display cell-specific antibody in an oriented immobilization manner, and act as an active targeting-based DDS nanocarrier. Since the Z domain can only bind to limited types of Igs, we generated BNCs deploying other Ig-binding domains: LL-BNC harboring the tandem form of Ig-binding domain of protein L, and LG-BNC harboring the Ig binding domains of protein L and protein G sequentially. Both BNCs could display a broader spectrum of Igs than does the ZZ-BNC. When these BNCs displayed anti-CD11c IgG or anti-EGFR IgG, both of which cannot bind to Z domain, they could bind to and then enter their respective target cells. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Ubiquitin Interacts with the Tollip C2 and CUE Domains and Inhibits Binding of Tollip to Phosphoinositides*

PubMed Central

Mitra, Sharmistha; Traughber, C. Alicia; Brannon, Mary K.; Gomez, Stephanie; Capelluto, Daniel G. S.

2013-01-01

A large number of cellular signaling processes are directed through internalization, via endocytosis, of polyubiquitinated cargo proteins. Tollip is an adaptor protein that facilitates endosomal cargo sorting for lysosomal degradation. Tollip preferentially binds phosphatidylinositol 3-phosphate (PtdIns(3)P) via its C2 domain, an association that may be required for endosomal membrane targeting. Here, we show that Tollip binds ubiquitin through its C2 and CUE domains and that its association with the C2 domain inhibits PtdIns(3)P binding. NMR analysis demonstrates that the C2 and CUE domains bind to overlapping sites on ubiquitin, suggesting that two ubiquitin molecules associate with Tollip simultaneously. Hydrodynamic studies reveal that ubiquitin forms heterodimers with the CUE domain, indicating that the association disrupts the dimeric state of the CUE domain. We propose that, in the absence of polyubiquitinated cargo, the dual binding of ubiquitin partitions Tollip into membrane-bound and membrane-free states, a function that contributes to the engagement of Tollip in both membrane trafficking and cytosolic pathways. PMID:23880770

The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

PubMed

Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

2007-01-01

The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

Shortening of the Lactobacillus paracasei subsp. paracasei BGNJ1-64 AggLb Protein Switches Its Activity from Auto-aggregation to Biofilm Formation.

PubMed

Miljkovic, Marija; Bertani, Iris; Fira, Djordje; Jovcic, Branko; Novovic, Katarina; Venturi, Vittorio; Kojic, Milan

2016-01-01

AggLb is the largest (318.6 kDa) aggregation-promoting protein of Lactobacillus paracasei subsp. paracasei BGNJ1-64 responsible for forming large cell aggregates, which causes auto-aggregation, collagen binding and pathogen exclusion in vitro. It contains an N-terminus leader peptide, followed by six successive collagen binding domains, 20 successive repeats (CnaB-like domains) and an LPXTG sorting signal at the C-terminus for cell wall anchoring. Experimental information about the roles of the domains of AggLb is currently unknown. To define the domain that confers cell aggregation and the key domains for interactions of specific affinity between AggLb and components of the extracellular matrix, we constructed a series of variants of the aggLb gene and expressed them in Lactococcus lactis subsp. lactis BGKP1-20 using a lactococcal promoter. All of the variants contained a leader peptide, an inter collagen binding-CnaB domain region (used to raise an anti-AggLb antibody), an anchor domain and a different number of collagen binding and CnaB-like domains. The role of the collagen binding repeats of the N-terminus in auto-aggregation and binding to collagen and fibronectin was confirmed. Deletion of the collagen binding repeats II, III, and IV resulted in a loss of the strong auto-aggregation, collagen and fibronectin binding abilities whereas the biofilm formation capability was increased. The strong auto-aggregation, collagen and fibronectin binding abilities of AggLb were negatively correlated to biofilm formation.

Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

2010-11-05

Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Biophysical Basis of the Binding of WWOX Tumor Suppressor to WBP1 and WBP2 Adaptors

PubMed Central

McDonald, Caleb B.; Buffa, Laura; Bar-Mag, Tomer; Salah, Zaidoun; Bhat, Vikas; Mikles, David C.; Deegan, Brian J.; Seldeen, Kenneth L.; Malhotra, Arun; Sudol, Marius; Aqeilan, Rami I.; Nawaz, Zafar; Farooq, Amjad

2012-01-01

The WWOX tumor suppressor participates in a diverse array of cellular activities by virtue of its ability to recognize WBP1 and WBP2 signaling adaptors among a wide variety of other ligands. Herein, using a multitude of biophysical techniques, we provide evidence that while the WW1 domain of WWOX binds to PPXY motifs within WBP1 and WBP2 in a physiologically-relevant manner, the WW2 domain exhibits no affinity toward any of these PPXY motifs. Importantly, our data suggest that while R25/W44 residues located within the binding pocket of triple-stranded β-fold of WW1 domain are critical for the recognition of PPXY ligands, they are replaced by the chemically-distinct E66/Y85 duo at structurally-equivalent positions within the WW2 domain, thereby accounting for its failure to bind PPXY ligands. Predictably, introduction of E66R/Y85W double-substitution within the WW2 domain not only results in gain-of-function but the resulting engineered domain, hereinafter referred to as WW2_RW, also appears to be a much stronger binding partner of WBP1 and WBP2 than the wild type WW1 domain. We also show that while the WW1 domain is structurally disordered and folds upon ligand binding, the WW2 domain not only adopts a fully structured conformation but also aids stabilization and ligand binding to WW1 domain. This salient observation implies that the WW2 domain likely serves as a chaperone to augment the physiological function of WW1 domain within WWOX. Collectively, our study lays the groundwork for understanding the molecular basis of a key protein-protein interaction pertinent to human health and disease. PMID:22634283

Molecular origin of the binding of WWOX tumor suppressor to ErbB4 receptor tyrosine kinase.

PubMed

Schuchardt, Brett J; Bhat, Vikas; Mikles, David C; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

2013-12-23

The ability of WWOX tumor suppressor to physically associate with the intracellular domain (ICD) of ErbB4 receptor tyrosine kinase is believed to play a central role in downregulating the transcriptional function of the latter. Herein, using various biophysical methods, we show that while the WW1 domain of WWOX binds to PPXY motifs located within the ICD of ErbB4 in a physiologically relevant manner, the WW2 domain does not. Importantly, while the WW1 domain absolutely requires the integrity of the PPXY consensus sequence, nonconsensus residues within and flanking this motif do not appear to be critical for binding. This strongly suggests that the WW1 domain of WWOX is rather promiscuous toward its cellular partners. We also provide evidence that the lack of binding of the WW2 domain of WWOX to PPXY motifs is due to the replacement of a signature tryptophan, lining the hydrophobic ligand binding groove, with tyrosine (Y85). Consistent with this notion, the Y85W substitution within the WW2 domain exquisitely restores its binding to PPXY motifs in a manner akin to the binding of the WW1 domain of WWOX. Of particular significance is the observation that the WW2 domain augments the binding of the WW1 domain to ErbB4, implying that the former serves as a chaperone within the context of the WW1-WW2 tandem module of WWOX in agreement with our findings reported previously. Altogether, our study sheds new light on the molecular basis of an important WW-ligand interaction involved in mediating a plethora of cellular processes.

Molecular Origin of the Binding of WWOX Tumor Suppressor to ErbB4 Receptor Tyrosine Kinase

PubMed Central

Schuchardt, Brett J.; Bhat, Vikas; Mikles, David C.; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

2014-01-01

The ability of WWOX tumor suppressor to physically associate with the intracellular domain (ICD) of ErbB4 receptor tyrosine kinase is believed to play a central role in down-regulating the transcriptional function of the latter. Herein, using various biophysical methods, we show that while the WW1 domain of WWOX binds to PPXY motifs located within the ICD of ErbB4 in a physiologically-relevant manner, the WW2 domain does not. Importantly, while the WW1 domain absolutely requires the integrity of the PPXY consensus sequence, non-consensus residues within and flanking this motif do not appear to be critical for binding. This strongly suggests that the WW1 domain of WWOX is rather promiscuous toward its cellular partners. We also provide evidence that the lack of binding of WW2 domain of WWOX to PPXY motifs is due to the replacement of a signature tryptophan, lining the hydrophobic ligand binding groove, with tyrosine (Y85). Consistent with this notion, the Y85W substitution within the WW2 domain exquisitely restores its binding to PPXY motifs in a manner akin to the binding of WW1 domain of WWOX. Of particular significance is the observation that WW2 domain augments the binding of WW1 domain to ErbB4, implying that the former serves as a chaperone within the context of the WW1–WW2 tandem module of WWOX in agreement with our findings reported previously. Taken together, our study sheds new light on the molecular basis of an important WW-ligand interaction involved in mediating a plethora of cellular processes. PMID:24308844

Guanidine hydrochloride denaturation of human serum albumin originates by local unfolding of some stable loops in domain III.

PubMed

Ahmad, Basir; Ahmed, Md Zulfazal; Haq, Soghra Khatun; Khan, Rizwan Hasan

2005-06-15

The effect of guanidine hydrochloride (GnHCl) on the global stability of human serum albumin (HSA) has been studied by fluorescence and circular dichroism spectroscopic measurements. The differential stability of native conformation of three HSA domains were explored by using domain-specific ligands, hemin (domain I), chloroform (domain II), bilirubin (at domain I/domain II interface) and diazepam (domain III). GnHCl induced unfolding transition curves as monitored by probes for secondary and tertiary structures were cooperative but noncoincidental. A strong ANS binding to the protein was observed around 1.8 M GnHCl, suggesting existence of intermediate states in the unfolding pathway of HSA. A gradual decrease (in the GnHCl concentration range 0.0-1.8 M) in the binding of diazepam indicates that domain III is the most labile to GnHCl denaturation. A significant increase in the binding of bilirubin up to 1.4 M GnHCl and decrease thereafter leading to complete abolishment of bilirubin binding at around 2.0 M GnHCl suggest favorable rearrangement and separation of domains I and II at 1.4 and 2.0 M GnHCl concentration, respectively. Above 1.6 M GnHCl, decrease of the binding of hemin, a ligand for domain I, chloroform, which binds in domain II and lone tryptophanyl fluorescence (Trp-214 located in domain II) indicate that at higher concentration of GnHCl domains I and II start unfolding simultaneously but the stability of domain I (7.4 Kcal/mol) is much more than domain II (4.3 Kcal/mol). A pictorial model for the unfolding of HSA domains, consistent with all these results, has been formulated, suggesting that domain III is the most labile followed by domain II while domain I is the most stable. A molten globule like state of domain III around 1.8 M GnHCl has also been identified and characterized.

Molecular Basis for Failure of “Atypical” C1 Domain of Vav1 to Bind Diacylglycerol/Phorbol Ester*

PubMed Central

Geczy, Tamas; Peach, Megan L.; El Kazzouli, Saïd; Sigano, Dina M.; Kang, Ji-Hye; Valle, Christopher J.; Selezneva, Julia; Woo, Wonhee; Kedei, Noemi; Lewin, Nancy E.; Garfield, Susan H.; Lim, Langston; Mannan, Poonam; Marquez, Victor E.; Blumberg, Peter M.

2012-01-01

C1 domains, the recognition motif of the second messenger diacylglycerol and of the phorbol esters, are classified as typical (ligand-responsive) or atypical (not ligand-responsive). The C1 domain of Vav1, a guanine nucleotide exchange factor, plays a critical role in regulation of Vav activity through stabilization of the Dbl homology domain, which is responsible for exchange activity of Vav. Although the C1 domain of Vav1 is classified as atypical, it retains a binding pocket geometry homologous to that of the typical C1 domains of PKCs. This study clarifies the basis for its failure to bind ligands. Substituting Vav1-specific residues into the C1b domain of PKCδ, we identified five crucial residues (Glu9, Glu10, Thr11, Thr24, and Tyr26) along the rim of the binding cleft that weaken binding potency in a cumulative fashion. Reciprocally, replacing these incompatible residues in the Vav1 C1 domain with the corresponding residues from PKCδ C1b (δC1b) conferred high potency for phorbol ester binding. Computer modeling predicts that these unique residues in Vav1 increase the hydrophilicity of the rim of the binding pocket, impairing membrane association and thereby preventing formation of the ternary C1-ligand-membrane binding complex. The initial design of diacylglycerol-lactones to exploit these Vav1 unique residues showed enhanced selectivity for C1 domains incorporating these residues, suggesting a strategy for the development of ligands targeting Vav1. PMID:22351766

Three-dimensional structure of NADPH–cytochrome P450 reductase: Prototype for FMN- and FAD-containing enzymes

PubMed Central

Wang, Ming; Roberts, David L.; Paschke, Rosemary; Shea, Thomas M.; Masters, Bettie Sue Siler; Kim, Jung-Ja P.

1997-01-01

Microsomal NADPH–cytochrome P450 reductase (CPR) is one of only two mammalian enzymes known to contain both FAD and FMN, the other being nitric-oxide synthase. CPR is a membrane-bound protein and catalyzes electron transfer from NADPH to all known microsomal cytochromes P450. The structure of rat liver CPR, expressed in Escherichia coli and solubilized by limited trypsinolysis, has been determined by x-ray crystallography at 2.6 Å resolution. The molecule is composed of four structural domains: (from the N- to C- termini) the FMN-binding domain, the connecting domain, and the FAD- and NADPH-binding domains. The FMN-binding domain is similar to the structure of flavodoxin, whereas the two C-terminal dinucleotide-binding domains are similar to those of ferredoxin–NADP+ reductase (FNR). The connecting domain, situated between the FMN-binding and FNR-like domains, is responsible for the relative orientation of the other domains, ensuring the proper alignment of the two flavins necessary for efficient electron transfer. The two flavin isoalloxazine rings are juxtaposed, with the closest distance between them being about 4 Å. The bowl-shaped surface near the FMN-binding site is likely the docking site of cytochrome c and the physiological redox partners, including cytochromes P450 and b5 and heme oxygenase. PMID:9237990

Genome-wide association meta-analysis of neuropathologic features of Alzheimer's disease and related dementias.

PubMed

Beecham, Gary W; Hamilton, Kara; Naj, Adam C; Martin, Eden R; Huentelman, Matt; Myers, Amanda J; Corneveaux, Jason J; Hardy, John; Vonsattel, Jean-Paul; Younkin, Steven G; Bennett, David A; De Jager, Philip L; Larson, Eric B; Crane, Paul K; Kamboh, M Ilyas; Kofler, Julia K; Mash, Deborah C; Duque, Linda; Gilbert, John R; Gwirtsman, Harry; Buxbaum, Joseph D; Kramer, Patricia; Dickson, Dennis W; Farrer, Lindsay A; Frosch, Matthew P; Ghetti, Bernardino; Haines, Jonathan L; Hyman, Bradley T; Kukull, Walter A; Mayeux, Richard P; Pericak-Vance, Margaret A; Schneider, Julie A; Trojanowski, John Q; Reiman, Eric M; Schellenberg, Gerard D; Montine, Thomas J

2014-09-01

Alzheimer's disease (AD) and related dementias are a major public health challenge and present a therapeutic imperative for which we need additional insight into molecular pathogenesis. We performed a genome-wide association study and analysis of known genetic risk loci for AD dementia using neuropathologic data from 4,914 brain autopsies. Neuropathologic data were used to define clinico-pathologic AD dementia or controls, assess core neuropathologic features of AD (neuritic plaques, NPs; neurofibrillary tangles, NFTs), and evaluate commonly co-morbid neuropathologic changes: cerebral amyloid angiopathy (CAA), Lewy body disease (LBD), hippocampal sclerosis of the elderly (HS), and vascular brain injury (VBI). Genome-wide significance was observed for clinico-pathologic AD dementia, NPs, NFTs, CAA, and LBD with a number of variants in and around the apolipoprotein E gene (APOE). GalNAc transferase 7 (GALNT7), ATP-Binding Cassette, Sub-Family G (WHITE), Member 1 (ABCG1), and an intergenic region on chromosome 9 were associated with NP score; and Potassium Large Conductance Calcium-Activated Channel, Subfamily M, Beta Member 2 (KCNMB2) was strongly associated with HS. Twelve of the 21 non-APOE genetic risk loci for clinically-defined AD dementia were confirmed in our clinico-pathologic sample: CR1, BIN1, CLU, MS4A6A, PICALM, ABCA7, CD33, PTK2B, SORL1, MEF2C, ZCWPW1, and CASS4 with 9 of these 12 loci showing larger odds ratio in the clinico-pathologic sample. Correlation of effect sizes for risk of AD dementia with effect size for NFTs or NPs showed positive correlation, while those for risk of VBI showed a moderate negative correlation. The other co-morbid neuropathologic features showed only nominal association with the known AD loci. Our results discovered new genetic associations with specific neuropathologic features and aligned known genetic risk for AD dementia with specific neuropathologic changes in the largest brain autopsy study of AD and related dementias.

Bacterial SPOR domains are recruited to septal peptidoglycan by binding to glycan strands that lack stem peptides

PubMed Central

Yahashiri, Atsushi; Jorgenson, Matthew A.; Weiss, David S.

2015-01-01

Bacterial SPOR domains bind peptidoglycan (PG) and are thought to target proteins to the cell division site by binding to “denuded” glycan strands that lack stem peptides, but uncertainties remain, in part because septal-specific binding has yet to be studied in a purified system. Here we show that fusions of GFP to SPOR domains from the Escherichia coli cell-division proteins DamX, DedD, FtsN, and RlpA all localize to septal regions of purified PG sacculi obtained from E. coli and Bacillus subtilis. Treatment of sacculi with an amidase that removes stem peptides enhanced SPOR domain binding, whereas treatment with a lytic transglycosylase that removes denuded glycans reduced SPOR domain binding. These findings demonstrate unequivocally that SPOR domains localize by binding to septal PG, that the physiologically relevant binding site is indeed a denuded glycan, and that denuded glycans are enriched in septal PG rather than distributed uniformly around the sacculus. Accumulation of denuded glycans in the septal PG of both E. coli and B. subtilis, organisms separated by 1 billion years of evolution, suggests that sequential removal of stem peptides followed by degradation of the glycan backbone is an ancient feature of PG turnover during bacterial cell division. Linking SPOR domain localization to the abundance of a structure (denuded glycans) present only transiently during biogenesis of septal PG provides a mechanism for coordinating the function of SPOR domain proteins with the progress of cell division. PMID:26305949

Copper binding affinity of the C2B domain of synaptotagmin-1 and its potential role in the nonclassical secretion of Acidic Fibroblast Growth Factor

PubMed Central

Jayanthi, Srinivas; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy; Furr, Mercede; Daily, Anna; Thurman, Ryan; Rutherford, Lindsay; Chandrashekar, Reena; Adams, Paul; Prudovsky, Igor; Suresh Kumar, Thallapuranam Krishnaswamy

2014-01-01

Fibroblast growth factor 1 (FGF1) is a heparin-binding proangiogenic protein. FGF1 lacks the conventional N-terminal signal peptide required for secretion through the endoplasmic reticulum (ER) -Golgi secretory pathway. FGF1 is released through a Cu2+ - mediated nonclassical secretion pathway. The secretion of FGF1 involves the formation of a Cu2+- mediated multiprotein release complex (MRC) including FGF1, S100A13 (a calcium-binding protein) and p40 synaptotagmin (Syt1). It is believed that binding of Cu2+ to the C2B domain is important for the release of FGF1 in to the extracellular medium. In this study, using a variety of biophysical studies, Cu2+ and lipid interactions of the C2B domain of Syt1were characterized. Isothermal titration calorimetry (ITC) experiments reveal that C2B domain binds to Cu2+ in a biphasic manner involving an initial endothermic and a subsequent exothermic phase. Fluorescence energy transfer experiments using Tb3+ show that there are two Cu2+- binding pockets on the C2B domain, and one of these is also a Ca2+- binding site. Lipid-binding studies using ITC demonstrate that the C2B domain preferentially binds to small unilamellar vesicles of phosphatidyl serine (PS). Results of the differential scanning calorimetry and limited trypsin digestion experiments suggest that C2B domain is marginally destabilized upon binding to PS vesicles. These results, for the first time, suggest that the main role of the C2B domain of Syt1 is to serve as an anchor for the FGF1 MRC on the membrane bilayer. In addition, binding of the C2B domain to the lipid bilayer is shown to significantly decrease the binding affinity of the protein to Cu2+. The study provides valuable insights on the sequence of structural events that occur in the nonclassical secretion of FGF1. PMID:25224745

Structure of the E2 DNA-binding domain from human papillomavirus serotype 31 at 2.4 A.

PubMed

Bussiere, D E; Kong, X; Egan, D A; Walter, K; Holzman, T F; Lindh, F; Robins, T; Giranda, V L

1998-11-01

The papillomaviruses are a family of small double-stranded DNA viruses which exclusively infect epithelial cells and stimulate the proliferation of those cells. A key protein within the papillomavirus life-cycle is known as the E2 (Early 2) protein and is responsible for regulating viral transcription from all viral promoters as well as for replication of the papillomavirus genome in tandem with another protein known as E1. The E2 protein itself consists of three functional domains: an N-terminal trans-activation domain, a proline-rich linker, and a C-terminal DNA-binding domain. The first crystal structure of the human papillomavirus, serotype 31 (HPV-31), E2 DNA-binding domain has been determined at 2.4 A resolution. The HPV DNA-binding domain monomer consists of two beta-alpha-beta repeats of approximately equal length and is arranged as to have an anti-parallel beta-sheet flanked by the two alpha-helices. The monomers form the functional in vivo dimer by association of the beta-sheets of each monomer so as to form an eight-stranded anti-parallel beta-barrel at the center of the dimer, with the alpha-helices lining the outside of the barrel. The overall structure of HVP-31 E2 DNA-binding domain is similar to both the bovine papillomavirus E2-binding domain and the Epstein-Barr nuclear antigen-1 DNA-binding domain.

Analysis of a two-domain binding site for the urokinase-type plasminogen activator-plasminogen activator inhibitor-1 complex in low-density-lipoprotein-receptor-related protein.

PubMed

Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C

2001-07-01

The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.

In vivo binding properties of SH2 domains from GTPase-activating protein and phosphatidylinositol 3-kinase.

PubMed Central

Cooper, J A; Kashishian, A

1993-01-01

We have used a transient expression system and mutant platelet-derived growth factor (PDGF) receptors to study the binding specificities of the Src homology 2 (SH2) regions of the Ras GTPase-activator protein (GAP) and the p85 alpha subunit of phosphatidylinositol 3-kinase (PI3 kinase). A number of fusion proteins, each tagged with an epitope allowing recognition by a monoclonal antibody, were expressed at levels comparable to those of endogenous GAP. Fusion proteins containing the central SH2-SH3-SH2 region of GAP or the C-terminal region of p85 alpha, which includes two SH2 domains, bound to PDGF receptors in response to PDGF stimulation. Both fusion proteins showed the same requirements for tyrosine phosphorylation sites in the PDGF receptor as the full-length proteins from which they were derived, i.e., binding of the GAP fusion protein was reduced by mutation of Tyr-771, and binding of the p85 fusion protein was reduced by mutation of Tyr-740, Tyr-751, or both residues. Fusion proteins containing single SH2 domains from either GAP or p85 alpha did not bind detectably to PDGF receptors in this system, suggesting that two SH2 domains in a single polypeptide cooperate to raise the affinity of binding. The sequence specificities of individual SH2 domains were deduced from the binding properties of fusion proteins containing one SH2 domain from GAP and another from p85. The results suggest that the C-terminal GAP SH2 domain specifies binding to Tyr-771, the C-terminal p85 alpha SH2 domain binds to either Tyr-740 or Tyr-751, and each protein's N-terminal SH2 domain binds to unidentified phosphorylation sites.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8382774

Big domains are novel Ca²+-binding modules: evidences from big domains of Leptospira immunoglobulin-like (Lig) proteins.

PubMed

Raman, Rajeev; Rajanikanth, V; Palaniappan, Raghavan U M; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P; Sharma, Yogendra; Chang, Yung-Fu

2010-12-29

Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca²+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca²+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9(th) (Lig A9) and 10(th) repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca²+ with dissociation constants of 2-4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. We demonstrate that the Lig are Ca²+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca²+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca²+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca²+ binding.

Big Domains Are Novel Ca2+-Binding Modules: Evidences from Big Domains of Leptospira Immunoglobulin-Like (Lig) Proteins

PubMed Central

Palaniappan, Raghavan U. M.; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P.; Sharma, Yogendra; Chang, Yung-Fu

2010-01-01

Background Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca2+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca2+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. Principal Findings We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9th (Lig A9) and 10th repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca2+ with dissociation constants of 2–4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. Conclusions We demonstrate that the Lig are Ca2+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca2+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca2+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca2+ binding. PMID:21206924

Quantifying domain-ligand affinities and specificities by high-throughput holdup assay

PubMed Central

Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles

2015-01-01

Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890

The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

PubMed

Alam, Tanfis I; Rao, Venigalla B

2008-03-07

Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

A histone-mimicking interdomain linker in a multidomain protein modulates multivalent histone binding

PubMed Central

Kostrhon, Sebastian; Kontaxis, Georg; Kaufmann, Tanja; Schirghuber, Erika; Kubicek, Stefan; Konrat, Robert

2017-01-01

N-terminal histone tails are subject to many posttranslational modifications that are recognized by and interact with designated reader domains in histone-binding proteins. BROMO domain adjacent to zinc finger 2B (BAZ2B) is a multidomain histone-binding protein that contains two histone reader modules, a plant homeodomain (PHD) and a bromodomain (BRD), linked by a largely disordered linker. Although previous studies have reported specificity of the PHD domain for the unmodified N terminus of histone H3 and of the BRD domain for H3 acetylated at Lys14 (H3K14ac), the exact mode of H3 binding by BAZ2B and its regulation are underexplored. Here, using isothermal titration calorimetry and NMR spectroscopy, we report that acidic residues in the BAZ2B PHD domain are essential for H3 binding and that BAZ2B PHD–BRD establishes a polyvalent interaction with H3K14ac. Furthermore, we provide evidence that the disordered interdomain linker modulates the histone-binding affinity by interacting with the PHD domain. In particular, lysine-rich stretches in the linker, which resemble the positively charged N terminus of histone H3, reduce the binding affinity of the PHD finger toward the histone substrate. Phosphorylation, acetylation, or poly(ADP-ribosyl)ation of the linker residues may therefore act as a cellular mechanism to transiently tune BAZ2B histone-binding affinity. Our findings further support the concept of interdomain linkers serving a dual role in substrate binding by appropriately positioning the adjacent domains and by electrostatically modulating substrate binding. Moreover, inhibition of histone binding by a histone-mimicking interdomain linker represents another example of regulation of protein–protein interactions by intramolecular mimicry. PMID:28864776

DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

PubMed Central

Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

2012-01-01

Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

The SPOR Domain, a Widely Conserved Peptidoglycan Binding Domain That Targets Proteins to the Site of Cell Division.

PubMed

Yahashiri, Atsushi; Jorgenson, Matthew A; Weiss, David S

2017-07-15

Sporulation-related repeat (SPOR) domains are small peptidoglycan (PG) binding domains found in thousands of bacterial proteins. The name "SPOR domain" stems from the fact that several early examples came from proteins involved in sporulation, but SPOR domain proteins are quite diverse and contribute to a variety of processes that involve remodeling of the PG sacculus, especially with respect to cell division. SPOR domains target proteins to the division site by binding to regions of PG devoid of stem peptides ("denuded" glycans), which in turn are enriched in septal PG by the intense, localized activity of cell wall amidases involved in daughter cell separation. This targeting mechanism sets SPOR domain proteins apart from most other septal ring proteins, which localize via protein-protein interactions. In addition to SPOR domains, bacteria contain several other PG-binding domains that can exploit features of the cell wall to target proteins to specific subcellular sites. Copyright © 2017 American Society for Microbiology.

Characterization of the molecular basis of group II intron RNA recognition by CRS1-CRM domains.

PubMed

Keren, Ido; Klipcan, Liron; Bezawork-Geleta, Ayenachew; Kolton, Max; Shaya, Felix; Ostersetzer-Biran, Oren

2008-08-22

CRM (chloroplast RNA splicing and ribosome maturation) is a recently recognized RNA-binding domain of ancient origin that has been retained in eukaryotic genomes only within the plant lineage. Whereas in bacteria CRM domains exist as single domain proteins involved in ribosome maturation, in plants they are found in a family of proteins that contain between one and four repeats. Several members of this family with multiple CRM domains have been shown to be required for the splicing of specific plastidic group II introns. Detailed biochemical analysis of one of these factors in maize, CRS1, demonstrated its high affinity and specific binding to the single group II intron whose splicing it facilitates, the plastid-encoded atpF intron RNA. Through its association with two intronic regions, CRS1 guides the folding of atpF intron RNA into its predicted "catalytically active" form. To understand how multiple CRM domains cooperate to achieve high affinity sequence-specific binding to RNA, we analyzed the RNA binding affinity and specificity associated with each individual CRM domain in CRS1; whereas CRM3 bound tightly to the RNA, CRM1 associated specifically with a unique region found within atpF intron domain I. CRM2, which demonstrated only low binding affinity, also seems to form specific interactions with regions localized to domains I, III, and IV. We further show that CRM domains share structural similarities and RNA binding characteristics with the well known RNA recognition motif domain.

Evaluation of Selected Binding Domains for the Analysis of Ubiquitinated Proteomes

NASA Astrophysics Data System (ADS)

Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

2013-08-01

Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono- and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ~200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle.

The Ubiquitin-associated Domain of Cellular Inhibitor of Apoptosis Proteins Facilitates Ubiquitylation*

PubMed Central

Budhidarmo, Rhesa; Day, Catherine L.

2014-01-01

The cellular inhibitor of apoptosis (cIAP) proteins are essential RING E3 ubiquitin ligases that regulate apoptosis and inflammatory responses. cIAPs contain a ubiquitin-associated (UBA) domain that binds ubiquitin and is implicated in the regulation of cell survival and proteasomal degradation. Here we show that mutation of the MGF and LL motifs in the UBA domain of cIAP1 caused unfolding and increased cIAP1 multimonoubiquitylation. By developing a UBA mutant that disrupted ubiquitin binding but not the structure of the UBA domain, we found that the UBA domain enhances cIAP1 and cIAP2 ubiquitylation. We demonstrate that the UBA domain binds to the UbcH5b∼Ub conjugate, and this promotes RING domain-dependent monoubiquitylation. This study establishes ubiquitin-binding modules, such as the UBA domain, as important regulatory modules that can fine tune the activity of E3 ligases. PMID:25065467

Exceptionally tight membrane-binding may explain the key role of the synaptotagmin-7 C 2 A domain in asynchronous neurotransmitter release

DOE Office of Scientific and Technical Information (OSTI.GOV)

Voleti, Rashmi; Tomchick, Diana R.; Südhof, Thomas C.

Synaptotagmins (Syts) act as Ca2+ sensors in neurotransmitter release by virtue of Ca2+-binding to their two C2 domains, but their mechanisms of action remain unclear. Puzzlingly, Ca2+-binding to the C2B domain appears to dominate Syt1 function in synchronous release, whereas Ca2+-binding to the C2A domain mediates Syt7 function in asynchronous release. Here we show that crystal structures of the Syt7 C2A domain and C2AB region, and analyses of intrinsic Ca2+-binding to the Syt7 C2 domains using isothermal titration calorimetry, did not reveal major differences that could explain functional differentiation between Syt7 and Syt1. However, using liposome titrations under Ca2+ saturatingmore » conditions, we show that the Syt7 C2A domain has a very high membrane affinity and dominates phospholipid binding to Syt7 in the presence or absence of L-α-phosphatidylinositol 4,5-diphosphate (PIP2). For Syt1, the two Ca2+-saturated C2 domains have similar affinities for membranes lacking PIP2, but the C2B domain dominates binding to PIP2-containing membranes. Mutagenesis revealed that the dramatic differences in membrane affinity between the Syt1 and Syt7 C2A domains arise in part from apparently conservative residue substitutions, showing how striking biochemical and functional differences can result from the cumulative effects of subtle residue substitutions. Viewed together, our results suggest that membrane affinity may be a key determinant of the functions of Syt C2 domains in neurotransmitter release.« less

RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain and is required for ubiquitination.

PubMed

Choudhury, Nila Roy; Heikel, Gregory; Trubitsyna, Maryia; Kubik, Peter; Nowak, Jakub Stanislaw; Webb, Shaun; Granneman, Sander; Spanos, Christos; Rappsilber, Juri; Castello, Alfredo; Michlewski, Gracjan

2017-11-08

TRIM25 is a novel RNA-binding protein and a member of the Tripartite Motif (TRIM) family of E3 ubiquitin ligases, which plays a pivotal role in the innate immune response. However, there is scarce knowledge about its RNA-related roles in cell biology. Furthermore, its RNA-binding domain has not been characterized. Here, we reveal that the RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain, which we postulate to be a novel RNA-binding domain. Using CLIP-seq and SILAC-based co-immunoprecipitation assays, we uncover TRIM25's endogenous RNA targets and protein binding partners. We demonstrate that TRIM25 controls the levels of Zinc Finger Antiviral Protein (ZAP). Finally, we show that the RNA-binding activity of TRIM25 is important for its ubiquitin ligase activity towards itself (autoubiquitination) and its physiologically relevant target ZAP. Our results suggest that many other proteins with the PRY/SPRY domain could have yet uncharacterized RNA-binding potential. Together, our data reveal new insights into the molecular roles and characteristics of RNA-binding E3 ubiquitin ligases and demonstrate that RNA could be an essential factor in their enzymatic activity.

Measles virus fusion machinery activated by sialic acid binding globular domain.

PubMed

Talekar, Aparna; Moscona, Anne; Porotto, Matteo

2013-12-01

Paramyxoviruses, including the human pathogen measles virus (MV) and the avian Newcastle disease virus (NDV), enter host cells through fusion of the viral envelope with the target cell membrane. This fusion is driven by the concerted action of two viral envelope glycoproteins: the receptor binding protein and the fusion protein (F). The MV receptor binding protein (hemagglutinin [H]) attaches to proteinaceous receptors on host cells, while the receptor binding protein of NDV (hemagglutinin-neuraminidase [HN]) interacts with sialic acid-containing receptors. The receptor-bound HN/H triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. The mechanism of fusion activation has been proposed to be different for sialic acid-binding viruses and proteinaceous receptor-binding viruses. We report that a chimeric protein containing the NDV HN receptor binding region and the MV H stalk domain can activate MV F to fuse, suggesting that the signal to the stalk of a protein-binding receptor binding molecule can be transmitted from a sialic acid binding domain. By engineering the NDV HN globular domain to interact with a proteinaceous receptor, the fusion activation signal was preserved. Our findings are consistent with a unified mechanism of fusion activation, at least for the Paramyxovirinae subfamily, in which the receptor binding domains of the receptor binding proteins are interchangeable and the stalk determines the specificity of F activation.

Molecular Evolution of the Oxygen-Binding Hemerythrin Domain

PubMed Central

Alvarez-Carreño, Claudia; Becerra, Arturo; Lazcano, Antonio

2016-01-01

Background The evolution of oxygenic photosynthesis during Precambrian times entailed the diversification of strategies minimizing reactive oxygen species-associated damage. Four families of oxygen-carrier proteins (hemoglobin, hemerythrin and the two non-homologous families of arthropodan and molluscan hemocyanins) are known to have evolved independently the capacity to bind oxygen reversibly, providing cells with strategies to cope with the evolutionary pressure of oxygen accumulation. Oxygen-binding hemerythrin was first studied in marine invertebrates but further research has made it clear that it is present in the three domains of life, strongly suggesting that its origin predated the emergence of eukaryotes. Results Oxygen-binding hemerythrins are a monophyletic sub-group of the hemerythrin/HHE (histidine, histidine, glutamic acid) cation-binding domain. Oxygen-binding hemerythrin homologs were unambiguously identified in 367/2236 bacterial, 21/150 archaeal and 4/135 eukaryotic genomes. Overall, oxygen-binding hemerythrin homologues were found in the same proportion as single-domain and as long protein sequences. The associated functions of protein domains in long hemerythrin sequences can be classified in three major groups: signal transduction, phosphorelay response regulation, and protein binding. This suggests that in many organisms the reversible oxygen-binding capacity was incorporated in signaling pathways. A maximum-likelihood tree of oxygen-binding hemerythrin homologues revealed a complex evolutionary history in which lateral gene transfer, duplications and gene losses appear to have played an important role. Conclusions Hemerythrin is an ancient protein domain with a complex evolutionary history. The distinctive iron-binding coordination site of oxygen-binding hemerythrins evolved first in prokaryotes, very likely prior to the divergence of Firmicutes and Proteobacteria, and spread into many bacterial, archaeal and eukaryotic species. The later evolution of the oxygen-binding hemerythrin domain in both prokaryotes and eukaryotes led to a wide variety of functions, ranging from protection against oxidative damage in anaerobic and microaerophilic organisms, to oxygen supplying to particular enzymes and pathways in aerobic and facultative species. PMID:27336621

Characterizing protein domain associations by Small-molecule ligand binding

PubMed Central

Li, Qingliang; Cheng, Tiejun; Wang, Yanli; Bryant, Stephen H.

2012-01-01

Background Protein domains are evolutionarily conserved building blocks for protein structure and function, which are conventionally identified based on protein sequence or structure similarity. Small molecule binding domains are of great importance for the recognition of small molecules in biological systems and drug development. Many small molecules, including drugs, have been increasingly identified to bind to multiple targets, leading to promiscuous interactions with protein domains. Thus, a large scale characterization of the protein domains and their associations with respect to small-molecule binding is of particular interest to system biology research, drug target identification, as well as drug repurposing. Methods We compiled a collection of 13,822 physical interactions of small molecules and protein domains derived from the Protein Data Bank (PDB) structures. Based on the chemical similarity of these small molecules, we characterized pairwise associations of the protein domains and further investigated their global associations from a network point of view. Results We found that protein domains, despite lack of similarity in sequence and structure, were comprehensively associated through binding the same or similar small-molecule ligands. Moreover, we identified modules in the domain network that consisted of closely related protein domains by sharing similar biochemical mechanisms, being involved in relevant biological pathways, or being regulated by the same cognate cofactors. Conclusions A novel protein domain relationship was identified in the context of small-molecule binding, which is complementary to those identified by traditional sequence-based or structure-based approaches. The protein domain network constructed in the present study provides a novel perspective for chemogenomic study and network pharmacology, as well as target identification for drug repurposing. PMID:23745168

Allostery Mediates Ligand Binding to WWOX Tumor Suppressor via a Conformational Switch

PubMed Central

Schuchardt, Brett J.; Mikles, David C.; Bhat, Vikas; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

2014-01-01

While being devoid of the ability to recognize ligands itself, the WW2 domain is believed to aid ligand binding to WW1 domain in the context of WW1-WW2 tandem module of WWOX tumor suppressor. In an effort to test the generality of this hypothesis, we have undertaken here a detailed biophysical analysis of the binding of WW domains of WWOX alone and in the context of WW1-WW2 tandem module to an array of putative PPXY ligands. Our data show that while the WW1 domain of WWOX binds to all ligands in a physiologically-relevant manner, the WW2 domain does not. Moreover, ligand binding to WW1 domain in the context of WW1-WW2 tandem module is two-to-three-fold stronger than when treated alone. We also provide evidence that the WW domains within the WW1-WW2 tandem module physically associate so as to adopt a fixed spatial orientation relative to each other. Of particular note is the observation that the physical association of WW2 domain with WW1 blocks access to ligand. Consequently, ligand binding to WW1 domain not only results in the displacement of WW2 lid but also disrupts the physical association of WW domains in the liganded conformation. Taken together, our study underscores a key role of allosteric communication in the ability of WW2 orphan domain to chaperone physiological action of WW1 domain within the context of the WW1-WW2 tandem module of WWOX. PMID:25703206

A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

PubMed

Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

1993-11-11

Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

Molecular and functional characterization of clathrin- and AP-2-binding determinants within a disordered domain of auxilin.

PubMed

Scheele, Urte; Alves, Jurgen; Frank, Ronald; Duwel, Michael; Kalthoff, Christoph; Ungewickell, Ernst

2003-07-11

Uncoating of clathrin-coated vesicles requires the J-domain protein auxilin for targeting hsc70 to the clathrin coats and for stimulating the hsc70 ATPase activity. This results in the release of hsc70-complexed clathrin triskelia and concomitant dissociation of the coat. To understand the complex role of auxilin in uncoating and clathrin assembly in more detail, we analyzed the molecular organization of its clathrin-binding domain (amino acids 547-813). CD spectroscopy of auxilin fragments revealed that the clathrin-binding domain is almost completely disordered in solution. By systematic mapping using synthetic peptides and by site-directed mutagenesis, we identified short peptide sequences involved in clathrin heavy chain and AP-2 binding and evaluated their significance for the function of auxilin. Some of the binding determinants, including those containing sequences 674DPF and 636WDW, showed dual specificity for both clathrin and AP-2. In contrast, the two DLL motifs within the clathrin-binding domain were exclusively involved in clathrin binding. Surprisingly, they interacted not only with the N-terminal domain of the heavy chain, but also with the distal domain. Moreover, both DLL peptides proved to be essential for clathrin assembly and uncoating. In addition, we found that the motif 726NWQ is required for efficient clathrin assembly activity. Auxilin shares a number of protein-protein interaction motifs with other endocytic proteins, including AP180. We demonstrate that AP180 and auxilin compete for binding to the alpha-ear domain of AP-2. Like AP180, auxilin also directly interacts with the ear domain of beta-adaptin. On the basis of our data, we propose a refined model for the uncoating mechanism of clathrin-coated vesicles.

A novel signal transduction protein: Combination of solute binding and tandem PAS-like sensor domains in one polypeptide chain: Periplasmic Ligand Binding Protein Dret_0059

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Wilton, R.; Cuff, M. E.

We report the structural and biochemical characterization of a novel periplasmic ligand-binding protein, Dret_0059, from Desulfohalobium retbaense DSM 5692, an organism isolated from the Salt Lake Retba in Senegal. The structure of the protein consists of a unique combination of a periplasmic solute binding protein (SBP) domain at the N-terminal and a tandem PAS-like sensor domain at the C-terminal region. SBP domains are found ubiquitously and their best known function is in solute transport across membranes. PAS-like sensor domains are commonly found in signal transduction proteins. These domains are widely observed as parts of many protein architectures and complexes butmore » have not been observed previously within the same polypeptide chain. In the structure of Dret_0059, a ketoleucine moiety is bound to the SBP, whereas a cytosine molecule is bound in the distal PAS-like domain of the tandem PAS-like domain. Differential scanning flourimetry support the binding of ligands observed in the crystal structure. There is significant interaction between the SBP and tandem PAS-like domains, and it is possible that the binding of one ligand could have an effect on the binding of the other. We uncovered three other proteins with this structural architecture in the non-redundant sequence data base, and predict that they too bind the same substrates. The genomic context of this protein did not offer any clues for its function. We did not find any biological process in which the two observed ligands are coupled. The protein Dret_0059 could be involved in either signal transduction or solute transport.« less

The RNA recognition motif domains of RBM5 are required for RNA binding and cancer cell proliferation inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Lei; Zhang, Qing; Yang, Yu

Highlights: • RNA recognition motif domains of RBM5 are essential for cell proliferation inhibition. • RNA recognition motif domains of RBM5 are essential for apoptosis induction. • RNA recognition motif domains of RBM5 are essential for RNA binding. • RNA recognition motif domains of RBM5 are essential for caspase-2 alternative splicing. - Abstract: RBM5 is a known putative tumor suppressor gene that has been shown to function in cell growth inhibition by modulating apoptosis. RBM5 also plays a critical role in alternative splicing as an RNA binding protein. However, it is still unclear which domains of RBM5 are required formore » RNA binding and related functional activities. We hypothesized the two putative RNA recognition motif (RRM) domains of RBM5 spanning from amino acids 98–178 and 231–315 are essential for RBM5-mediated cell growth inhibition, apoptosis regulation, and RNA binding. To investigate this hypothesis, we evaluated the activities of the wide-type and mutant RBM5 gene transfer in low-RBM5 expressing A549 cells. We found that, unlike wild-type RBM5 (RBM5-wt), a RBM5 mutant lacking the two RRM domains (RBM5-ΔRRM), is unable to bind RNA, has compromised caspase-2 alternative splicing activity, lacks cell proliferation inhibition and apoptosis induction function in A549 cells. These data provide direct evidence that the two RRM domains of RBM5 are required for RNA binding and the RNA binding activity of RBM5 contributes to its function on apoptosis induction and cell growth inhibition.« less

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

Stereochemical determinants of C-terminal specificity in PDZ peptide-binding domains: a novel contribution of the carboxylate-binding loop.

PubMed

Amacher, Jeanine F; Cushing, Patrick R; Bahl, Christopher D; Beck, Tobias; Madden, Dean R

2013-02-15

PDZ (PSD-95/Dlg/ZO-1) binding domains often serve as cellular traffic engineers, controlling the localization and activity of a wide variety of binding partners. As a result, they play important roles in both physiological and pathological processes. However, PDZ binding specificities overlap, allowing multiple PDZ proteins to mediate distinct effects on shared binding partners. For example, several PDZ domains bind the cystic fibrosis (CF) transmembrane conductance regulator (CFTR), an epithelial ion channel mutated in CF. Among these binding partners, the CFTR-associated ligand (CAL) facilitates post-maturational degradation of the channel and is thus a potential therapeutic target. Using iterative optimization, we previously developed a selective CAL inhibitor peptide (iCAL36). Here, we investigate the stereochemical basis of iCAL36 specificity. The crystal structure of iCAL36 in complex with the CAL PDZ domain reveals stereochemical interactions distributed along the peptide-binding cleft, despite the apparent degeneracy of the CAL binding motif. A critical selectivity determinant that distinguishes CAL from other CFTR-binding PDZ domains is the accommodation of an isoleucine residue at the C-terminal position (P(0)), a characteristic shared with the Tax-interacting protein-1. Comparison of the structures of these two PDZ domains in complex with ligands containing P(0) Leu or Ile residues reveals two distinct modes of accommodation for β-branched C-terminal side chains. Access to each mode is controlled by distinct residues in the carboxylate-binding loop. These studies provide new insights into the primary sequence determinants of binding motifs, which in turn control the scope and evolution of PDZ interactomes.

Cooperative Allosteric Ligand Binding in Calmodulin

NASA Astrophysics Data System (ADS)

Nandigrami, Prithviraj

Conformational dynamics is often essential for a protein's function. For example, proteins are able to communicate the effect of binding at one site to a distal region of the molecule through changes in its conformational dynamics. This so called allosteric coupling fine tunes the sensitivity of ligand binding to changes in concentration. A conformational change between a "closed" (apo) and an "open" (holo) conformation upon ligation often produces this coupling between binding sites. Enhanced sensitivity between the unbound and bound ensembles leads to a sharper binding curve. There are two basic conceptual frameworks that guide our visualization about ligand binding mechanisms. First, a ligand can stabilize the unstable "open" state from a dynamic ensemble of conformations within the unbound basin. This binding mechanism is called conformational selection. Second, a ligand can weakly bind to the low-affinity "closed" state followed by a conformational transition to the "open" state. In this dissertation, I focus on molecular dynamics simulations to understand microscopic origins of ligand binding cooperativity. A minimal model of allosteric binding transitions must include ligand binding/unbinding events, while capturing the transition mechanism between two distinct meta-stable free energy basins. Due in part to computational timescales limitations, work in this dissertation describes large-scale conformational transitions through a simplified, coarse-grained model based on the energy basins defined by the open and closed conformations of the protein Calmodulin (CaM). CaM is a ubiquitous calcium-binding protein consisting of two structurally similar globular domains connected by a flexible linker. The two domains of CaM, N-terminal domain (nCaM) and C-terminal domain (cCaM) consists of two helix-loop-helix motifs (the EF-hands) connected by a flexible linker. Each domain of CaM consists of two binding loops and binds 2 calcium ions each. The intact domain binds up to 4 calcium ions. The simulations use a coupled molecular dynamics/monte carlo scheme where the protein dynamics is simulated explicitly, while ligand binding/unbinding are treated implicitly. In the model, ligand binding/unbinding events coupled with a conformational change of the protein within the grand canonical ensemble. Here, ligand concentration is controlled through the chemical potential (micro). This allows us to use a simple thermodynamic model to analyze the simulated data and quantify binding cooperativity. Simulated binding titration curves are calculated through equilibrium simulations at different values of micro. First, I study domain opening transitions of isolated nCaM and cCaM in the absence of calcium. This work is motivated by results from a recent analytic variational model that predicts distinct domain opening transition mechanism for the domains of CaM. This is a surprising result because the domains have the same folded state topology. In the simulations, I find the two domains of CaM have distinct transition mechanism over a broad range of temperature, in harmony with the analytic predictions. In particular, the simulated transition mechanism of nCaM follows a two-state behavior, while domain opening in cCaM involves global unfolding and refolding of the tertiary structure. The unfolded intermediate also appears in the landscape of nCaM, but at a higher temperature than it appears in cCaM's energy landscape. This is consistent with nCaM's higher thermal stability. Under approximate physiological conditions, majority of the sampled transitions in cCaM involves unfolding and refolding during conformational change. Kinetically, the transient unfolding and refolding in cCaM significantly slows the domain opening and closing rates in cCaM. Second, I investigate the structural origins of binding affinity and allosteric cooperativity of binding 2 calcium-ions to each domain of CaM. In my work, I predict the order of binding strength of CaM's loops. I analyze simulated binding curves within the framework of the classic Monod-Wyman-Changeux (MWC) model of allostery to extract the binding free energies to the closed and open ensembles. The simulations predict that cCaM binds calcium with higher affinity and greater cooperativity than nCaM. Where it is possible to compare, these predictions are in good agreement with experimental results. The analysis of the simulations offers a rationale for why the two domains differ in cooperativity: the higher cooperativity of cCaM is due to larger difference in affinity of its binding loops. Third, I extend the work to investigate structural origins of binding cooperativity of 4 calcium-ions to intact CaM. I characterize the microscopic cooperativities of each ligation state and provide a kinetic description of the binding mechanism. Due to the heterogeneous nature of CaM's loops, as predicted in our simulations of isolated domains, I focus on investigating the influence of this heterogeneity on the kinetic flux of binding pathways as a function of concentration. The formalism developed for Network Models of protein folding kinetics, is used to evaluate the directed flux of all possible pathways between unligated and fully loaded CaM. (Abstract shortened by ProQuest.).

Mapping small molecule binding data to structural domains

PubMed Central

2012-01-01

Background Large-scale bioactivity/SAR Open Data has recently become available, and this has allowed new analyses and approaches to be developed to help address the productivity and translational gaps of current drug discovery. One of the current limitations of these data is the relative sparsity of reported interactions per protein target, and complexities in establishing clear relationships between bioactivity and targets using bioinformatics tools. We detail in this paper the indexing of targets by the structural domains that bind (or are likely to bind) the ligand within a full-length protein. Specifically, we present a simple heuristic to map small molecule binding to Pfam domains. This profiling can be applied to all proteins within a genome to give some indications of the potential pharmacological modulation and regulation of all proteins. Results In this implementation of our heuristic, ligand binding to protein targets from the ChEMBL database was mapped to structural domains as defined by profiles contained within the Pfam-A database. Our mapping suggests that the majority of assay targets within the current version of the ChEMBL database bind ligands through a small number of highly prevalent domains, and conversely the majority of Pfam domains sampled by our data play no currently established role in ligand binding. Validation studies, carried out firstly against Uniprot entries with expert binding-site annotation and secondly against entries in the wwPDB repository of crystallographic protein structures, demonstrate that our simple heuristic maps ligand binding to the correct domain in about 90 percent of all assessed cases. Using the mappings obtained with our heuristic, we have assembled ligand sets associated with each Pfam domain. Conclusions Small molecule binding has been mapped to Pfam-A domains of protein targets in the ChEMBL bioactivity database. The result of this mapping is an enriched annotation of small molecule bioactivity data and a grouping of activity classes following the Pfam-A specifications of protein domains. This is valuable for data-focused approaches in drug discovery, for example when extrapolating potential targets of a small molecule with known activity against one or few targets, or in the assessment of a potential target for drug discovery or screening studies. PMID:23282026

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Han; Shin, Ok-Ho; Machius, Mischa

The neuronal protein synaptotagmin 1 functions as a Ca{sup 2+} sensor in exocytosis via two Ca{sup 2+}-binding C{sub 2} domains. The very similar synaptotagmin 4, which includes all the predicted Ca{sup 2+}-binding residues in the C{sub 2}B domain but not in the C{sub 2}A domain, is also thought to function as a neuronal Ca{sup 2+} sensor. Here we show that, unexpectedly, both C{sub 2} domains of fly synaptotagmin 4 exhibit Ca{sup 2+}-dependent phospholipid binding, whereas neither C{sub 2} domain of rat synaptotagmin 4 binds Ca{sup 2+} or phospholipids efficiently. Crystallography reveals that changes in the orientations of critical Ca{sup 2+}more » ligands, and perhaps their flexibility, render the rat synaptotagmin 4 C{sub 2}B domain unable to form full Ca{sup 2+}-binding sites. These results indicate that synaptotagmin 4 is a Ca{sup 2+} sensor in the fly but not in the rat, that the Ca{sup 2+}-binding properties of C{sub 2} domains cannot be reliably predicted from sequence analyses, and that proteins clearly identified as orthologs may nevertheless have markedly different functional properties.« less

A high-resolution structure of the DNA-binding domain of AhrC, the arginine repressor/activator protein from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Baumberg, Simon; Stockley, Peter G.

2007-11-01

The structure of the winged helix–turn–helix DNA-binding domain of AhrC has been determined at 1.0 Å resolution. The largely hydrophobic β-wing shows high B factors and may mediate the dimer interface in operator complexes. In Bacillus subtilis the concentration of l-arginine is controlled by the transcriptional regulator AhrC, which interacts with 18 bp DNA operator sites called ARG boxes in the promoters of arginine biosynthetic and catabolic operons. AhrC is a 100 kDa homohexamer, with each subunit having two domains. The C-terminal domains form the core, mediating intersubunit interactions and binding of the co-repressor l-arginine, whilst the N-terminal domains containmore » a winged helix–turn–helix DNA-binding motif and are arranged around the periphery. The N-terminal domain of AhrC has been expressed, purified and characterized and it has been shown that the fragment still binds DNA operators as a recombinant monomer. The DNA-binding domain has also been crystallized and the crystal structure refined to 1.0 Å resolution is presented.« less

SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family

PubMed Central

2010-01-01

Background Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. Findings De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Conclusions Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein. PMID:20979600

SECRET domain of variola virus CrmB protein can be a member of poxviral type II chemokine-binding proteins family.

PubMed

Antonets, Denis V; Nepomnyashchikh, Tatyana S; Shchelkunov, Sergei N

2010-10-27

Variola virus (VARV) the causative agent of smallpox, eradicated in 1980, have wide spectrum of immunomodulatory proteins to evade host immunity. Recently additional biological activity was discovered for VARV CrmB protein, known to bind and inhibit tumour necrosis factor (TNF) through its N-terminal domain homologous to cellular TNF receptors. Besides binding TNF, this protein was also shown to bind with high affinity several chemokines which recruit B- and T-lymphocytes and dendritic cells to sites of viral entry and replication. Ability to bind chemokines was shown to be associated with unique C-terminal domain of CrmB protein. This domain named SECRET (Smallpox virus-Encoded Chemokine Receptor) is unrelated to the host proteins and lacks significant homology with other known viral chemokine-binding proteins or any other known protein. De novo modelling of VARV-CrmB SECRET domain spatial structure revealed its apparent structural homology with cowpox virus CC-chemokine binding protein (vCCI) and vaccinia virus A41 protein, despite low sequence identity between these three proteins. Potential ligand-binding surface of modelled VARV-CrmB SECRET domain was also predicted to bear prominent electronegative charge which is characteristic to known orthopoxviral chemokine-binding proteins. Our results suggest that SECRET should be included into the family of poxviral type II chemokine-binding proteins and that it might have been evolved from the vCCI-like predecessor protein.

Calcium binding to calmodulin mutants monitored by domain-specific intrinsic phenylalanine and tyrosine fluorescence.

PubMed Central

VanScyoc, Wendy S; Sorensen, Brenda R; Rusinova, Elena; Laws, William R; Ross, J B Alexander; Shea, Madeline A

2002-01-01

Cooperative calcium binding to the two homologous domains of calmodulin (CaM) induces conformational changes that regulate its association with and activation of numerous cellular target proteins. Calcium binding to the pair of high-affinity sites (III and IV in the C-domain) can be monitored by observing calcium-dependent changes in intrinsic tyrosine fluorescence intensity (lambda(ex)/lambda(em) of 277/320 nm). However, calcium binding to the low-affinity sites (I and II in the N-domain) is more difficult to measure with optical spectroscopy because that domain of CaM does not contain tryptophan or tyrosine. We recently demonstrated that calcium-dependent changes in intrinsic phenylalanine fluorescence (lambda(ex)/lambda(em) of 250/280 nm) of an N-domain fragment of CaM reflect occupancy of sites I and II (VanScyoc, W. S., and M. A. Shea, 2001, Protein Sci. 10:1758-1768). Using steady-state and time-resolved fluorescence methods, we now show that these excitation and emission wavelength pairs for phenylalanine and tyrosine fluorescence can be used to monitor equilibrium calcium titrations of the individual domains in full-length CaM. Calcium-dependent changes in phenylalanine fluorescence specifically indicate ion occupancy of sites I and II in the N-domain because phenylalanine residues in the C-domain are nonemissive. Tyrosine emission from the C-domain does not interfere with phenylalanine fluorescence signals from the N-domain. This is the first demonstration that intrinsic fluorescence may be used to monitor calcium binding to each domain of CaM. In this way, we also evaluated how mutations of two residues (Arg74 and Arg90) located between sites II and III can alter the calcium-binding properties of each of the domains. The mutation R74A caused an increase in the calcium affinity of sites I and II in the N-domain. The mutation R90A caused an increase in calcium affinity of sites III and IV in the C-domain whereas R90G caused an increase in calcium affinity of sites in both domains. This approach holds promise for exploring the linked energetics of calcium binding and target recognition. PMID:12414709

Signatures of Pleiotropy, Economy and Convergent Evolution in a Domain-Resolved Map of Human–Virus Protein–Protein Interaction Networks

PubMed Central

Garamszegi, Sara; Franzosa, Eric A.; Xia, Yu

2013-01-01

A central challenge in host-pathogen systems biology is the elucidation of general, systems-level principles that distinguish host-pathogen interactions from within-host interactions. Current analyses of host-pathogen and within-host protein-protein interaction networks are largely limited by their resolution, treating proteins as nodes and interactions as edges. Here, we construct a domain-resolved map of human-virus and within-human protein-protein interaction networks by annotating protein interactions with high-coverage, high-accuracy, domain-centric interaction mechanisms: (1) domain-domain interactions, in which a domain in one protein binds to a domain in a second protein, and (2) domain-motif interactions, in which a domain in one protein binds to a short, linear peptide motif in a second protein. Analysis of these domain-resolved networks reveals, for the first time, significant mechanistic differences between virus-human and within-human interactions at the resolution of single domains. While human proteins tend to compete with each other for domain binding sites by means of sequence similarity, viral proteins tend to compete with human proteins for domain binding sites in the absence of sequence similarity. Independent of their previously established preference for targeting human protein hubs, viral proteins also preferentially target human proteins containing linear motif-binding domains. Compared to human proteins, viral proteins participate in more domain-motif interactions, target more unique linear motif-binding domains per residue, and contain more unique linear motifs per residue. Together, these results suggest that viruses surmount genome size constraints by convergently evolving multiple short linear motifs in order to effectively mimic, hijack, and manipulate complex host processes for their survival. Our domain-resolved analyses reveal unique signatures of pleiotropy, economy, and convergent evolution in viral-host interactions that are otherwise hidden in the traditional binary network, highlighting the power and necessity of high-resolution approaches in host-pathogen systems biology. PMID:24339775

Signatures of pleiotropy, economy and convergent evolution in a domain-resolved map of human-virus protein-protein interaction networks.

PubMed

Garamszegi, Sara; Franzosa, Eric A; Xia, Yu

2013-01-01

A central challenge in host-pathogen systems biology is the elucidation of general, systems-level principles that distinguish host-pathogen interactions from within-host interactions. Current analyses of host-pathogen and within-host protein-protein interaction networks are largely limited by their resolution, treating proteins as nodes and interactions as edges. Here, we construct a domain-resolved map of human-virus and within-human protein-protein interaction networks by annotating protein interactions with high-coverage, high-accuracy, domain-centric interaction mechanisms: (1) domain-domain interactions, in which a domain in one protein binds to a domain in a second protein, and (2) domain-motif interactions, in which a domain in one protein binds to a short, linear peptide motif in a second protein. Analysis of these domain-resolved networks reveals, for the first time, significant mechanistic differences between virus-human and within-human interactions at the resolution of single domains. While human proteins tend to compete with each other for domain binding sites by means of sequence similarity, viral proteins tend to compete with human proteins for domain binding sites in the absence of sequence similarity. Independent of their previously established preference for targeting human protein hubs, viral proteins also preferentially target human proteins containing linear motif-binding domains. Compared to human proteins, viral proteins participate in more domain-motif interactions, target more unique linear motif-binding domains per residue, and contain more unique linear motifs per residue. Together, these results suggest that viruses surmount genome size constraints by convergently evolving multiple short linear motifs in order to effectively mimic, hijack, and manipulate complex host processes for their survival. Our domain-resolved analyses reveal unique signatures of pleiotropy, economy, and convergent evolution in viral-host interactions that are otherwise hidden in the traditional binary network, highlighting the power and necessity of high-resolution approaches in host-pathogen systems biology.

Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.

PubMed

Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N

2014-06-01

The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.

Allostery mediates ligand binding to WWOX tumor suppressor via a conformational switch.

PubMed

Schuchardt, Brett J; Mikles, David C; Bhat, Vikas; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

2015-04-01

While being devoid of the ability to recognize ligands itself, the WW2 domain is believed to aid ligand binding to the WW1 domain in the context of a WW1-WW2 tandem module of WW domain-containing oxidoreductase (WWOX) tumor suppressor. In an effort to test the generality of this hypothesis, we have undertaken here a detailed biophysical analysis of the binding of WW domains of WWOX alone and in the context of the WW1-WW2 tandem module to an array of putative proline-proline-x-tyrosine (PPXY) ligands. Our data show that while the WW1 domain of WWOX binds to all ligands in a physiologically relevant manner, the WW2 domain does not. Moreover, ligand binding to the WW1 domain in the context of the WW1-WW2 tandem module is two-to-three-fold stronger than when treated alone. We also provide evidence that the WW domains within the WW1-WW2 tandem module physically associate so as to adopt a fixed spatial orientation relative to each other. Of particular note is the observation that the physical association of the WW2 domain with WW1 blocks access to ligands. Consequently, ligand binding to the WW1 domain not only results in the displacement of the WW2 lid but also disrupts the physical association of WW domains in the liganded conformation. Taken together, our study underscores a key role of allosteric communication in the ability of the WW2 orphan domain to chaperone physiological action of the WW1 domain within the context of the WW1-WW2 tandem module of WWOX. Copyright © 2015 John Wiley & Sons, Ltd.

Distinct peptide binding specificities of Src homology 3 (SH3) protein domains can be determined by modulation of local energetics across the binding interface.

PubMed

Gorelik, Maryna; Davidson, Alan R

2012-03-16

The yeast Nbp2p SH3 and Bem1p SH3b domains bind certain target peptides with similar high affinities, yet display vastly different affinities for other targets. To investigate this unusual behavior, we have solved the structure of the Nbp2p SH3-Ste20 peptide complex and compared it with the previously determined structure of the Bem1p SH3b bound to the same peptide. Although the Ste20 peptide interacts with both domains in a structurally similar manner, extensive in vitro studies with domain and peptide mutants revealed large variations in interaction strength across the binding interface of the two complexes. Whereas the Nbp2p SH3 made stronger contacts with the peptide core RXXPXXP motif, the Bem1p SH3b domain made stronger contacts with residues flanking the core motif. Remarkably, this modulation of local binding energetics can explain the distinct and highly nuanced binding specificities of these two domains.

The regulation of integrin function by divalent cations

PubMed Central

Zhang, Kun; Chen, JianFeng

2012-01-01

Integrins are a family of α/β heterodimeric adhesion metalloprotein receptors and their functions are highly dependent on and regulated by different divalent cations. Recently advanced studies have revolutionized our perception of integrin metal ion-binding sites and their specific functions. Ligand binding to integrins is bridged by a divalent cation bound at the MIDAS motif on top of either α I domain in I domain-containing integrins or β I domain in α I domain-less integrins. The MIDAS motif in β I domain is flanked by ADMIDAS and SyMBS, the other two crucial metal ion binding sites playing pivotal roles in the regulation of integrin affinity and bidirectional signaling across the plasma membrane. The β-propeller domain of α subunit contains three or four β-hairpin loop-like Ca2+-binding motifs that have essential roles in integrin biogenesis. The function of another Ca2+-binding motif located at the genu of α subunit remains elusive. Here, we provide an overview of the integrin metal ion-binding sites and discuss their roles in the regulation of integrin functions. PMID:22647937

Comprehension of Idioms in Turkish Aphasic Participants.

PubMed

Aydin, Burcu; Barin, Muzaffer; Yagiz, Oktay

2017-12-01

Brain damaged participants offer an opportunity to evaluate the cognitive and linguistic processes and make assumptions about how the brain works. Cognitive linguists have been investigating the underlying mechanisms of idiom comprehension to unravel the ongoing debate on hemispheric specialization in figurative language comprehension. The aim of this study is to evaluate and compare the comprehension of idiomatic expressions in left brain damaged (LBD) aphasic, right brain damaged (RBD) and healthy control participants. Idiom comprehension in eleven LBD aphasic participants, ten RBD participants and eleven healthy control participants were assessed with three tasks: String to Picture Matching Task, Literal Sentence Comprehension Task and Oral Idiom Definition Task. The results of the tasks showed that in overall idiom comprehension category, the left brain-damaged aphasic participants interpret idioms more literally compared to right brain-damaged participants. What is more, there is a significant difference in opaque idiom comprehension implying that left brain-damaged aphasic participants perform worse compared to right brain-damaged participants. On the other hand, there is no statistically significant difference in scores of transparent idiom comprehension between the left brain-damaged aphasic and right brain-damaged participants. This result also contribute to the idea that while figurative processing system is damaged in LBD aphasics, the literal comprehension mechanism is spared to some extent. The results of this study support the view that idiom comprehension sites are mainly left lateralized. Furthermore, the results of this study are in consistence with the Giora's Graded Salience Hypothesis.

AKAP13 Rho-GEF and PKD-Binding Domain Deficient Mice Develop Normally but Have an Abnormal Response to β-Adrenergic-Induced Cardiac Hypertrophy

PubMed Central

Spindler, Matthew J.; Burmeister, Brian T.; Huang, Yu; Hsiao, Edward C.; Salomonis, Nathan; Scott, Mark J.; Srivastava, Deepak; Carnegie, Graeme K.; Conklin, Bruce R.

2013-01-01

Background A-kinase anchoring proteins (AKAPs) are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA) and D (PKD) and an active Rho-guanine nucleotide exchange factor (Rho-GEF) domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown. Methodology/Principal Findings To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction. Conclusions These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy. PMID:23658642

Experimentally biased model structure of the Hsc70/auxilin complex: Substrate transfer and interdomain structural change

PubMed Central

Gruschus, James M.; Greene, Lois E.; Eisenberg, Evan; Ferretti, James A.

2004-01-01

A model structure of the Hsc70/auxilin complex has been constructed to gain insight into interprotein substrate transfer and ATP hydrolysis induced conformational changes in the multidomain Hsc70 structure. The Hsc70/auxilin system, which is a member of the Hsp70/Hsp40 chaperone system family, uncoats clathrin-coated vesicles in an ATP hydrolysis-driven process. Incorporating previous results from NMR and mutant binding studies, the auxilin J-domain was docked into the Hsc70 ATPase domain lower cleft using rigid backbone/flexible side chain molecular dynamics, and the Hsc70 substrate binding domain was docked by a similar procedure. For comparison, J-domain and substrate binding domain docking sites were obtained by the rigid-body docking programs DOT and ZDOCK, filtered and ranked by the program ClusPro, and relaxed using the same rigid backbone/flexible side chain dynamics. The substrate binding domain sites were assessed in terms of conserved surface complementarity and feasibility in the context of substrate transfer, both for auxilin and another Hsp40 protein, Hsc20. This assessment favors placement of the substrate binding domain near D152 on the ATPase domain surface adjacent to the J-domain invariant HPD segment, with the Hsc70 interdomain linker in the lower cleft. Examining Hsc70 interdomain energetics, we propose that long-range electrostatic interactions, perhaps due to a difference in the pKa values of bound ATP and ADP, could play a major role in the structural change induced by ATP hydrolysis. Interdomain electrostatic interactions also appear to play a role in stimulation of ATPase activity due to J-domain binding and substrate binding by Hsc70. PMID:15273304

Structural and Functional Characterization of the Kindlin-1 Pleckstrin Homology Domain*

PubMed Central

Yates, Luke A.; Lumb, Craig N.; Brahme, Nina N.; Zalyte, Ruta; Bird, Louise E.; De Colibus, Luigi; Owens, Raymond J.; Calderwood, David A.; Sansom, Mark S. P.; Gilbert, Robert J. C.

2012-01-01

Inside-out activation of integrins is mediated via the binding of talin and kindlin to integrin β-subunit cytoplasmic tails. The kindlin FERM domain is interrupted by a pleckstrin homology (PH) domain within its F2 subdomain. Here, we present data confirming the importance of the kindlin-1 PH domain for integrin activation and its x-ray crystal structure at a resolution of 2.1 Å revealing a C-terminal second α-helix integral to the domain but found only in the kindlin protein family. An isoform-specific salt bridge occludes the canonical phosphoinositide binding site, but molecular dynamics simulations display transient switching to an alternative open conformer. Molecular docking reveals that the opening of the pocket would enable potential ligands to bind within it. Although lipid overlay assays suggested the PH domain binds inositol monophosphates, surface plasmon resonance demonstrated weak affinities for inositol 3,4,5-triphosphate (Ins(3,4,5)P3; KD ∼100 μm) and no monophosphate binding. Removing the salt bridge by site-directed mutagenesis increases the PH domain affinity for Ins(3,4,5)P3 as measured by surface plasmon resonance and enables it to bind PtdIns(3,5)P2 on a dot-blot. Structural comparison with other PH domains suggests that the phosphate binding pocket in the kindlin-1 PH domain is more occluded than in kindlins-2 and -3 due to its salt bridge. In addition, the apparent affinity for Ins(3,4,5)P3 is affected by the presence of PO4 ions in the buffer. We suggest the physiological ligand of the kindlin-1 PH domain is most likely not an inositol phosphate but another phosphorylated species. PMID:23132860

Molecular dynamics and binding selectivity of nucleotides and polynucleotide substrates with EIF2C2/Ago2 PAZ domain.

PubMed

Kandeel, Mahmoud; Kitade, Yukio

2018-02-01

RNA interference (RNAi) constitutes a major target in drug discovery. Recently, we reported that the Argonaute protein 2 (Ago2) PAZ domain selectively binds with all ribonucleotides except adenine and poorly recognizes deoxyribonucleotides. The binding properties of the PAZ domain with polynucleotides and the molecular mechanisms of substrates' selectivity remains unclear. In this study, the binding potencies of polynucleotides and the associated conformational and dynamic changes in PAZ domain are investigated. Coinciding with nucleotides' binding profile with the PAZ domain, polyuridylate (PolyU) and polycytidylate (PolyC) were potent binders. However, K dPolyU and K dPolyC were 15.8 and 9.3μM, respectively. In contrast, polyadenylate (PolyA) binding was not detectable. Molecular dynamics (MD) simulation revealed the highest change in root mean square deviation (RMSD) with ApoPAZ or PAZ domain bound with experimentally approved, low affinity substrates, whereas stronger binding substrates such as UMP or PolyU showed minimal RMSD changes. The loop between α3 and β5 in the β-hairpin subdomain showed the most responsive change in RMSD, being highly movable in the ApoPAZ and PAZ-AMP complex. Favorable substrate recognition was associate with moderate change in secondary structure content. In conclusion, the PAZ domain retains differential substrate selectivity associated with corresponding dynamic and structural changes upon binding. Copyright © 2017 Elsevier B.V. All rights reserved.

An ice-binding and tandem beta-sandwich domain-containing protein in Shewanella frigidimarina is a potential new type of ice adhesin.

PubMed

Vance, Tyler D R; Graham, Laurie A; Davies, Peter L

2018-04-01

Out of the dozen different ice-binding protein (IBP) structures known, the DUF3494 domain is the most widespread, having been passed many times between prokaryotic and eukaryotic microorganisms by horizontal gene transfer. This ~25-kDa β-solenoid domain with an adjacent parallel α-helix is most commonly associated with an N-terminal secretory signal peptide. However, examples of the DUF3494 domain preceded by tandem Bacterial Immunoglobulin-like (BIg) domains are sometimes found, though uncharacterized. Here, we present one such protein (SfIBP_1) from the Antarctic bacterium Shewanella frigidimarina. We have confirmed and characterized the ice-binding activity of its ice-binding domain using thermal hysteresis measurements, fluorescent ice plane affinity analysis, and ice recrystallization inhibition assays. X-ray crystallography was used to solve the structure of the SfIBP_1 ice-binding domain, to further characterize its ice-binding surface and unique method of stabilizing or 'capping' the ends of the solenoid structure. The latter is formed from the interaction of two loops mediated by a combination of tandem prolines and electrostatic interactions. Furthermore, given their domain architecture and membrane association, we propose that these BIg-containing DUF3494 IBPs serve as ice-binding adhesion proteins that are capable of adsorbing their host bacterium onto ice. Submitted new structure to the Protein Data Bank (PDB: 6BG8). © 2018 Federation of European Biochemical Societies.

Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

2004-04-16

2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

PDZ binding to the BAR domain of PICK1 is elucidated by coarse-grained molecular dynamics.

PubMed

He, Yi; Liwo, Adam; Weinstein, Harel; Scheraga, Harold A

2011-01-07

A key regulator of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor traffic, PICK1 is known to interact with over 40 other proteins, including receptors, transporters and ionic channels, and to be active mostly as a homodimer. The current lack of a complete PICK1 structure determined at atomic resolution hinders the elucidation of its functional mechanisms. Here, we identify interactions between the component PDZ and BAR domains of PICK1 by calculating possible binding sites for the PDZ domain of PICK1 (PICK1-PDZ) to the homology-modeled, crescent-shaped dimer of the PICK1-BAR domain using multiplexed replica-exchange molecular dynamics (MREMD) and canonical molecular dynamics simulations with the coarse-grained UNRES force field. The MREMD results show that the preferred binding site for the single PDZ domain is the concave cavity of the BAR dimer. A second possible binding site is near the N-terminus of the BAR domain that is linked directly to the PDZ domain. Subsequent short canonical molecular dynamics simulations used to determine how the PICK1-PDZ domain moves to the preferred binding site on the BAR domain of PICK1 revealed that initial hydrophobic interactions drive the progress of the simulated binding. Thus, the concave face of the BAR dimer accommodates the PDZ domain first by weak hydrophobic interactions and then the PDZ domain slides to the center of the concave face, where more favorable hydrophobic interactions take over. Copyright © 2010 Elsevier Ltd. All rights reserved.

Insulator function and topological domain border strength scale with architectural protein occupancy

PubMed Central

2014-01-01

Background Chromosome conformation capture studies suggest that eukaryotic genomes are organized into structures called topologically associating domains. The borders of these domains are highly enriched for architectural proteins with characterized roles in insulator function. However, a majority of architectural protein binding sites localize within topological domains, suggesting sites associated with domain borders represent a functionally different subclass of these regulatory elements. How topologically associating domains are established and what differentiates border-associated from non-border architectural protein binding sites remain unanswered questions. Results By mapping the genome-wide target sites for several Drosophila architectural proteins, including previously uncharacterized profiles for TFIIIC and SMC-containing condensin complexes, we uncover an extensive pattern of colocalization in which architectural proteins establish dense clusters at the borders of topological domains. Reporter-based enhancer-blocking insulator activity as well as endogenous domain border strength scale with the occupancy level of architectural protein binding sites, suggesting co-binding by architectural proteins underlies the functional potential of these loci. Analyses in mouse and human stem cells suggest that clustering of architectural proteins is a general feature of genome organization, and conserved architectural protein binding sites may underlie the tissue-invariant nature of topologically associating domains observed in mammals. Conclusions We identify a spectrum of architectural protein occupancy that scales with the topological structure of chromosomes and the regulatory potential of these elements. Whereas high occupancy architectural protein binding sites associate with robust partitioning of topologically associating domains and robust insulator function, low occupancy sites appear reserved for gene-specific regulation within topological domains. PMID:24981874

Conformational Control of the Binding of the Transactivation Domain of the MLL Protein and c-Myb to the KIX Domain of CREB

PubMed Central

Korkmaz, Elif Nihal; Nussinov, Ruth; Haliloğlu, Türkan

2012-01-01

The KIX domain of CBP is a transcriptional coactivator. Concomitant binding to the activation domain of proto-oncogene protein c-Myb and the transactivation domain of the trithorax group protein mixed lineage leukemia (MLL) transcription factor lead to the biologically active ternary MLL∶KIX∶c-Myb complex which plays a role in Pol II-mediated transcription. The binding of the activation domain of MLL to KIX enhances c-Myb binding. Here we carried out molecular dynamics (MD) simulations for the MLL∶KIX∶c-Myb ternary complex, its binary components and KIX with the goal of providing a mechanistic explanation for the experimental observations. The dynamic behavior revealed that the MLL binding site is allosterically coupled to the c-Myb binding site. MLL binding redistributes the conformational ensemble of KIX, leading to higher populations of states which favor c-Myb binding. The key element in the allosteric communication pathways is the KIX loop, which acts as a control mechanism to enhance subsequent binding events. We tested this conclusion by in silico mutations of loop residues in the KIX∶MLL complex and by comparing wild type and mutant dynamics through MD simulations. The loop assumed MLL binding conformation similar to that observed in the KIX∶c-Myb state which disfavors the allosteric network. The coupling with c-Myb binding site faded, abolishing the positive cooperativity observed in the presence of MLL. Our major conclusion is that by eliciting a loop-mediated allosteric switch between the different states following the binding events, transcriptional activation can be regulated. The KIX system presents an example how nature makes use of conformational control in higher level regulation of transcriptional activity and thus cellular events. PMID:22438798

Phosphorylation-regulated Binding of RNA Polymerase II to Fibrous Polymers of Low Complexity Domains

PubMed Central

Xiang, Siheng; Wu, Leeju; Theodoropoulos, Pano; Mirzaei, Hamid; Han, Tina; Xie, Shanhai; Corden, Jeffry L.; McKnight, Steven L.

2014-01-01

SUMMARY The low complexity (LC) domains of the products of the fused in sarcoma (FUS), Ewings sarcoma (EWS) and TAF15 genes are translocated onto a variety of different DNA-binding domains and thereby assist in driving the formation of cancerous cells. In the context of the translocated fusion proteins, these LC sequences function as transcriptional activation domains. Here we show that polymeric fibers formed from these LC domains directly bind the C-terminal domain (CTD) of RNA polymerase II in a manner reversible by phosphorylation of the iterated, heptad repeats of the CTD. Mutational analysis indicates that the degree of binding between the CTD and the LC domain polymers correlates with the strength of transcriptional activation. These studies offer a simple means of conceptualizing how RNA polymerase II is recruited to active genes in its unphosphorylated state, and released for elongation following phosphorylation of the CTD. PMID:24267890

Recombinant hepatitis B surface antigen and anionic phospholipids share a binding region in the fifth domain of β2-glycoprotein I (apolipoprotein H)

PubMed Central

Mehdi, Haider; Naqvi, Asma; Kamboh, M. lIyas

2008-01-01

Human β2-glycoprotein I (β2GPI) binds to recombinant hepatitis B surface antigen (rHBsAg), but the location of the binding domain on β2GPI is unknown. It has been suggested that the lipid rather than the protein moiety of rHBsAg binds to β2GPI. Since β2 GPI binds to anionic phospholipids (PL) through its lipid binding region in the fifth domain of β2GPI, we predicted that this lipid binding region may also be involved in binding rHBsAg. In this study, we examined rHBsAg binding to two naturally occurring mutants of β2GPI, Cys306Gly and Trp316Ser, or evolutionarily conserved hydrophobic amino acid sequence, Leu313-Ala314-Phe315 in the fifth domain of β2GPI. The two naturally occurring mutations and two mutagenized amino acids, Leu313Gly or Phe315Ser, disrupted the binding of recombinant β2GPI (rβ2GPI) to both rHBsAg and cardiolipin (CL), an anionic PL. These results suggest that rHBsAg and CL share the same region in the fifth domain of β2GPI. Credence to this conclusion was further provided by competitive ELISA, where CL-bound rβ2GPI was incubated with increasing amounts of rHBsAg. As expected, pre-incubation of rβ2GPI with CL precluded binding to rHBsAg, indicating that CL and rHBsAg bind to the same region on β2GPI. Our data provide evidence that the lipid (PL) rather than the protein moiety of rHBsAg binds to β2GPI and that this binding region is located in the fifth domain of β2GPI, which also binds to anionic PL. PMID:18230366

Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases.

PubMed

Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

2016-04-12

While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding.

Evaluation of selected binding domains for the analysis of ubiquitinated proteomes

PubMed Central

Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

2013-01-01

Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising, but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ∼200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle. PMID:23649778

Structural basis for the inhibition of insulin-like growth factors by insulin-like growth factor-binding proteins

PubMed Central

Sitar, Tomasz; Popowicz, Grzegorz M.; Siwanowicz, Igor; Huber, Robert; Holak, Tad A.

2006-01-01

Insulin-like growth factor-binding proteins (IGFBPs) control bioavailability, activity, and distribution of insulin-like growth factor (IGF)1 and -2 through high-affinity IGFBP/IGF complexes. IGF-binding sites are found on N- and C-terminal fragments of IGFBPs, the two conserved domains of IGFBPs. The relative contributions of these domains to IGFBP/IGF complexation has been difficult to analyze, in part, because of the lack of appropriate three-dimensional structures. To analyze the effects of N- and C-terminal domain interactions, we determined several x-ray structures: first, of a ternary complex of N- and C-terminal domain fragments of IGFBP4 and IGF1 and second, of a “hybrid” ternary complex using the C-terminal domain fragment of IGFBP1 instead of IGFBP4. We also solved the binary complex of the N-terminal domains of IGFBP4 and IGF1, again to analyze C- and N-terminal domain interactions by comparison with the ternary complexes. The structures reveal the mechanisms of IGF signaling regulation via IGFBP binding. This finding supports research into the design of IGFBP variants as therapeutic IGF inhibitors for diseases of IGF disregulation. In IGFBP4, residues 1–38 form a rigid disulphide bond ladder-like structure, and the first five N-terminal residues bind to IGF and partially mask IGF residues responsible for the type 1 IGF receptor binding. A high-affinity IGF1-binding site is located in a globular structure between residues 39 and 82. Although the C-terminal domains do not form stable binary complexes with either IGF1 or the N-terminal domain of IGFBP4, in the ternary complex, the C-terminal domain contacts both and contributes to blocking of the IGF1 receptor-binding region of IGF1. PMID:16924115

Calcium Regulates Molecular Interactions of Otoferlin with Soluble NSF Attachment Protein Receptor (SNARE) Proteins Required for Hair Cell Exocytosis*

PubMed Central

Ramakrishnan, Neeliyath A.; Drescher, Marian J.; Morley, Barbara J.; Kelley, Philip M.; Drescher, Dennis G.

2014-01-01

Mutations in otoferlin, a C2 domain-containing ferlin family protein, cause non-syndromic hearing loss in humans (DFNB9 deafness). Furthermore, transmitter secretion of cochlear inner hair cells is compromised in mice lacking otoferlin. In the present study, we show that the C2F domain of otoferlin directly binds calcium (KD = 267 μm) with diminished binding in a pachanga (D1767G) C2F mouse mutation. Calcium was found to differentially regulate binding of otoferlin C2 domains to target SNARE (t-SNARE) proteins and phospholipids. C2D–F domains interact with the syntaxin-1 t-SNARE motif with maximum binding within the range of 20–50 μm Ca2+. At 20 μm Ca2+, the dissociation rate was substantially lower, indicating increased binding (KD = ∼10−9) compared with 0 μm Ca2+ (KD = ∼10−8), suggesting a calcium-mediated stabilization of the C2 domain·t-SNARE complex. C2A and C2B interactions with t-SNAREs were insensitive to calcium. The C2F domain directly binds the t-SNARE SNAP-25 maximally at 100 μm and with reduction at 0 μm Ca2+, a pattern repeated for C2F domain interactions with phosphatidylinositol 4,5-bisphosphate. In contrast, C2F did not bind the vesicle SNARE protein synaptobrevin-1 (VAMP-1). Moreover, an antibody targeting otoferlin immunoprecipitated syntaxin-1 and SNAP-25 but not synaptobrevin-1. As opposed to an increase in binding with increased calcium, interactions between otoferlin C2F domain and intramolecular C2 domains occurred in the absence of calcium, consistent with intra-C2 domain interactions forming a “closed” tertiary structure at low calcium that “opens” as calcium increases. These results suggest a direct role for otoferlin in exocytosis and modulation of calcium-dependent membrane fusion. PMID:24478316

Conformational changes in the expression domain of the Escherichia coli thiM riboswitch

PubMed Central

Rentmeister, Andrea; Mayer, Günter; Kuhn, Nicole; Famulok, Michael

2007-01-01

The thiM riboswitch contains an aptamer domain that adaptively binds the coenzyme thiamine pyrophosphate (TPP). The binding of TPP to the aptamer domain induces structural rearrangements that are relayed to a second domain, the so-called expression domain, thereby interfering with gene expression. The recently solved crystal structures of the aptamer domains of the thiM riboswitches in complex with TPP revealed how TPP stabilizes secondary and tertiary structures in the RNA ligand complex. To understand the global modes of reorganization between the two domains upon metabolite binding the structure of the entire riboswitch in presence and absence of TPP needs to be determined. Here we report the secondary structure of the entire thiM riboswitch from Escherichia coli in its TPP-free form and its transition into the TPP-bound variant, thereby depicting domains of the riboswitch that serve as communication links between the aptamer and the expression domain. Furthermore, structural probing provides an explanation for the lack of genetic control exerted by a riboswitch variant with mutations in the expression domain that still binds TPP. PMID:17517779

RP-1551s, a family of azaphilones produced by Penicillium sp., inhibit the binding of PDGF to the extracellular domain of its receptor.

PubMed

Toki, S; Tanaka, T; Uosaki, Y; Yoshida, M; Suzuki, Y; Kita, K; Mihara, A; Ando, K; Lokker, N A; Giese, N A; Matsuda, Y

1999-03-01

Nine azaphilones designated RP-1551-1, -2, -3, -4, -5, -6, -7, -M1, and -M2 were isolated from the culture broth of Penicillium sp. SPC-21609 as inhibitors of PDGF binding to its receptor. RP-1551s inhibit the binding of PDGF AA to the extracellular domain of PDGF alpha-receptor with IC50 values ranging from 0.1 to 2 microM without affecting PDGF BB binding to the extracellular domain of PDGF beta-receptor. PDGF binding was not restored after the PDGF alpha-receptor extracellular domain was washed in an attempt to remove the RP-1551-1 bound to the receptor. This result suggests that RP-1551-1 may irreversibly interact with the PDGF alpha-receptor. Since many azaphilone compounds possess high reactivity with an amino group, RP-1551-1 may prevent PDGF AA binding by reacting with amino groups on the alpha-receptor extracellular domain.

Structure-Templated Predictions of Novel Protein Interactions from Sequence Information

PubMed Central

Betel, Doron; Breitkreuz, Kevin E; Isserlin, Ruth; Dewar-Darch, Danielle; Tyers, Mike; Hogue, Christopher W. V

2007-01-01

The multitude of functions performed in the cell are largely controlled by a set of carefully orchestrated protein interactions often facilitated by specific binding of conserved domains in the interacting proteins. Interacting domains commonly exhibit distinct binding specificity to short and conserved recognition peptides called binding profiles. Although many conserved domains are known in nature, only a few have well-characterized binding profiles. Here, we describe a novel predictive method known as domain–motif interactions from structural topology (D-MIST) for elucidating the binding profiles of interacting domains. A set of domains and their corresponding binding profiles were derived from extant protein structures and protein interaction data and then used to predict novel protein interactions in yeast. A number of the predicted interactions were verified experimentally, including new interactions of the mitotic exit network, RNA polymerases, nucleotide metabolism enzymes, and the chaperone complex. These results demonstrate that new protein interactions can be predicted exclusively from sequence information. PMID:17892321

Three-dimensional (3D) structure prediction and function analysis of the chitin-binding domain 3 protein HD73_3189 from Bacillus thuringiensis HD73.

PubMed

Zhan, Yiling; Guo, Shuyuan

2015-01-01

Bacillus thuringiensis (Bt) is capable of producing a chitin-binding protein believed to be functionally important to bacteria during the stationary phase of its growth cycle. In this paper, the chitin-binding domain 3 protein HD73_3189 from B. thuringiensis has been analyzed by computer technology. Primary and secondary structural analyses demonstrated that HD73_3189 is negatively charged and contains several α-helices, aperiodical coils and β-strands. Domain and motif analyses revealed that HD73_3189 contains a signal peptide, an N-terminal chitin binding 3 domains, two copies of a fibronectin-like domain 3 and a C-terminal carbohydrate binding domain classified as CBM_5_12. Moreover, analysis predicted the protein's associated localization site to be the cell wall. Ligand site prediction determined that amino acid residues GLU-312, TRP-334, ILE-341 and VAL-382 exposed on the surface of the target protein exhibit polar interactions with the substrate.

Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Q Zhai; M Landesman; H Robinson

2011-12-31

Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Q.; Robinson, H.; Landesman, M. B.

2011-01-01

Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

Functional Analysis of a Bacterial Antifreeze Protein Indicates a Cooperative Effect between Its Two Ice-Binding Domains.

PubMed

Wang, Chen; Oliver, Erin E; Christner, Brent C; Luo, Bing-Hao

2016-07-19

Antifreeze proteins make up a class of ice-binding proteins (IBPs) that are possessed and expressed by certain cold-adapted organisms to enhance their freezing tolerance. Here we report the biophysical and functional characterization of an IBP discovered in a bacterium recovered from a deep glacial ice core drilled at Vostok Station, Antarctica (IBPv). Our study showed that the recombinant protein rIBPv exhibited a thermal hysteresis of 2 °C at concentrations of >50 μM, effectively inhibited ice recrystallization, and enhanced bacterial viability during freeze-thaw cycling. Circular dichroism scans indicated that rIBPv mainly consists of β strands, and its denaturing temperature was 53.5 °C. Multiple-sequence alignment of homologous IBPs predicted that IBPv contains two ice-binding domains, a feature unique among known IBPs. To examine functional differences between the IBPv domains, each domain was cloned, expressed, and purified. The second domain (domain B) expressed greater ice binding activity. Data from thermal hysteresis and gel filtration assays supported the idea that the two domains cooperate to achieve a higher ice binding effect by forming heterodimers. However, physical linkage of the domains was not required for this effect.

Structure of the SANT domain from the Xenopus chromatin remodeling factor ISWI

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horton, John R.; Elgar, Stuart J.; Khan, Seema I.

2008-09-17

The SANT (Swi3, Ada2, N-Cor, and TFIIIB) module was first described as a putative DNA-binding domain with strong similarity to the helix-turn-helix DNA binding domain of Myb-related proteins. The X-ray structure of the C-terminal one third portion of the ATPase ISWI of Drosophila melangoaster, containing both SANT and SLIDE (SANT-Like ISWI Domain), confirmed the overall helix-turn-helix structural architecture of SANT as well as SLIDE. However, the DNA-contacting residues in Myb are not conserved in SANT and the structurally corresponding residues in the ISWI SANT domain are acidic, and therefore incompatible with DNA interaction. Recent studies suggested that SANT domains mightmore » be a histone-tail-binding module, including the DNA binding SANT domain of c-Myb. Here they present the X-ray structure of Xenopus laevis ISWI SANT domain, derived from limited proteolysis of a C-terminal fragment of ISWI protein.« less

The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site.

PubMed

Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph

2009-08-07

SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.

Non-Native Metal Ion Reveals the Role of Electrostatics in Synaptotagmin 1-Membrane Interactions.

PubMed

Katti, Sachin; Nyenhuis, Sarah B; Her, Bin; Srivastava, Atul K; Taylor, Alexander B; Hart, P John; Cafiso, David S; Igumenova, Tatyana I

2017-06-27

C2 domains are independently folded modules that often target their host proteins to anionic membranes in a Ca 2+ -dependent manner. In these cases, membrane association is triggered by Ca 2+ binding to the negatively charged loop region of the C2 domain. Here, we used a non-native metal ion, Cd 2+ , in lieu of Ca 2+ to gain insight into the contributions made by long-range Coulombic interactions and direct metal ion-lipid bridging to membrane binding. Using X-ray crystallography, NMR, Förster resonance energy transfer, and vesicle cosedimentation assays, we demonstrate that, although Cd 2+ binds to the loop region of C2A/B domains of synaptotagmin 1 with high affinity, long-range Coulombic interactions are too weak to support membrane binding of individual domains. We attribute this behavior to two factors: the stoichiometry of Cd 2+ binding to the loop regions of the C2A and C2B domains and the impaired ability of Cd 2+ to directly coordinate the lipids. In contrast, electron paramagnetic resonance experiments revealed that Cd 2+ does support membrane binding of the C2 domains in full-length synaptotagmin 1, where the high local lipid concentrations that result from membrane tethering can partially compensate for lack of a full complement of divalent metal ions and specific lipid coordination in Cd 2+ -complexed C2A/B domains. Our data suggest that long-range Coulombic interactions alone can drive the initial association of C2A/B with anionic membranes and that Ca 2+ further augments membrane binding by the formation of metal ion-lipid coordination bonds and additional Ca 2+ ion binding to the C2 domain loop regions.

The C-terminal heavy-chain domain of botulinum neurotoxin a is not the only site that binds neurons, as the N-terminal heavy-chain domain also plays a very active role in toxin-cell binding and interactions.

PubMed

Ayyar, B Vijayalakshmi; Aoki, K Roger; Atassi, M Zouhair

2015-04-01

Botulinum neurotoxins (BoNTs) possess unique specificity for nerve terminals. They bind to the presynaptic membrane and then translocate intracellularly, where the light-chain endopeptidase cleaves the SNARE complex proteins, subverting the synaptic exocytosis responsible for acetylcholine release to the synaptic cleft. This inhibits acetylcholine binding to its receptor, causing paralysis. Binding, an obligate event for cell intoxication, is believed to occur through the heavy-chain C-terminal (HC) domain. It is followed by toxin translocation and entry into the cell cytoplasm, which is thought to be mediated by the heavy-chain N-terminal (HN) domain. Submolecular mapping analysis by using synthetic peptides spanning BoNT serotype A (BoNT/A) and mouse brain synaptosomes (SNPs) and protective antibodies against toxin from mice and cervical dystonia patients undergoing BoNT/A treatment revealed that not only regions of the HC domain but also regions of the HN domain are involved in the toxin binding process. Based on these findings, we expressed a peptide corresponding to the BoNT/A region comprising HN domain residues 729 to 845 (HN729-845). HN729-845 bound directly to mouse brain SNPs and substantially inhibited BoNT/A binding to SNPs. The binding involved gangliosides GT1b and GD1a and a few membrane lipids. The peptide bound to human or mouse neuroblastoma cells within 1 min. Peptide HN729-845 protected mice completely against a lethal BoNT/A dose (1.05 times the 100% lethal dose). This protective activity was obtained at a dose comparable to that of the peptide from positions 967 to 1296 in the HC domain. These findings strongly indicate that HN729-845 and, by extension, the HN domain are fully programmed and equipped to bind to neuronal cells and in the free state can even inhibit the binding of the toxin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

SH3 domain-mediated binding of the Drk protein to Dos is an important step in signaling of Drosophila receptor tyrosine kinases.

PubMed

Feller, Stephan M; Wecklein, Heike; Lewitzky, Marc; Kibler, Eike; Raabe, Thomas

2002-08-01

Activation of the Sevenless (Sev) receptor tyrosine kinase (RTK) in the developing Drosophila eye is required for the specification of the R7 photoreceptor cell fate. Daughter of Sevenless (Dos), a putative multi-site adaptor protein, is a substrate of the Sev kinase and is known to associate with the tyrosine phosphatase Corkscrew (Csw). Binding of Csw to Dos depends on the Csw Src homology 2 (SH2) domains and is an essential step for signaling by the Sev RTK. Dos, however, lacks a recognizable phosphotyrosine interaction domain and it was previously unclear how it is recruited to the Sev receptor. Here it is shown that the SH2/SH3 domain adaptor protein Drk can provide this link. Drk binds with its SH2 domain to the autophosphorylated Sev receptor while the C-terminal SH3 domain is able to associate with Dos. The Drk SH3 domain binding motifs on Dos were mapped to two sites which do not conform the known Drk SH3 domain binding motif (PxxPxR) but instead have the consensus PxxxRxxKP. Mutational analysis in vitro and in vivo provided evidence that both Drk binding sites fulfil an important function in the context of Sev and Drosophila epidermal growth factor receptor mediated signaling processes.

The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

PubMed Central

Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

2017-01-01

Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

A multiprotein binding interface in an intrinsically disordered region of the tumor suppressor protein interferon regulatory factor-1.

PubMed

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R; Vojtesek, Borivoj; Ball, Kathryn L

2011-04-22

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106-140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs.

Superbinder SH2 domains act as antagonists of cell signaling.

PubMed

Kaneko, Tomonori; Huang, Haiming; Cao, Xuan; Li, Xing; Li, Chengjun; Voss, Courtney; Sidhu, Sachdev S; Li, Shawn S C

2012-09-25

Protein-ligand interactions mediated by modular domains, which often play important roles in regulating cellular functions, are generally of moderate affinities. We examined the Src homology 2 (SH2) domain, a modular domain that recognizes phosphorylated tyrosine (pTyr) residues, to investigate how the binding affinity of a modular domain for its ligand influences the structure and cellular function of the protein. We used the phage display method to perform directed evolution of the pTyr-binding residues in the SH2 domain of the tyrosine kinase Fyn and identified three amino acid substitutions that critically affected binding. We generated three SH2 domain triple-point mutants that were "superbinders" with much higher affinities for pTyr-containing peptides than the natural domain. Crystallographic analysis of one of these superbinders revealed that the superbinder SH2 domain recognized the pTyr moiety in a bipartite binding mode: A hydrophobic surface encompassed the phenyl ring, and a positively charged site engaged the phosphate. When expressed in mammalian cells, the superbinder SH2 domains blocked epidermal growth factor receptor signaling and inhibited anchorage-independent cell proliferation, suggesting that pTyr superbinders might be explored for therapeutic applications and useful as biological research tools. Although the SH2 domain fold can support much higher affinity for its ligand than is observed in nature, our results suggest that natural SH2 domains are not optimized for ligand binding but for specificity and flexibility, which are likely properties important for their function in signaling and regulatory processes.

Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less

Aurora A regulates the activity of HURP by controlling the accessibility of its microtubule-binding domain.

PubMed

Wong, Jim; Lerrigo, Robert; Jang, Chang-Young; Fang, Guowei

2008-05-01

HURP is a spindle-associated protein that mediates Ran-GTP-dependent assembly of the bipolar spindle and promotes chromosome congression and interkinetochore tension during mitosis. We report here a biochemical mechanism of HURP regulation by Aurora A, a key mitotic kinase that controls the assembly and function of the spindle. We found that HURP binds to microtubules through its N-terminal domain that hyperstabilizes spindle microtubules. Ectopic expression of this domain generates defects in spindle morphology and function that reduce the level of tension across sister kinetochores and activate the spindle checkpoint. Interestingly, the microtubule binding activity of this N-terminal domain is regulated by the C-terminal region of HURP: in its hypophosphorylated state, C-terminal HURP associates with the microtubule-binding domain, abrogating its affinity for microtubules. However, when the C-terminal domain is phosphorylated by Aurora A, it no longer binds to N-terminal HURP, thereby releasing the inhibition on its microtubule binding and stabilizing activity. In fact, ectopic expression of this C-terminal domain depletes endogenous HURP from the mitotic spindle in HeLa cells in trans, suggesting the physiological importance for this mode of regulation. We concluded that phosphorylation of HURP by Aurora A provides a regulatory mechanism for the control of spindle assembly and function.

Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

PubMed

Pessler, Frank; Hernandez, Nouria

2003-08-01

POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eberhard, Jeremy; Onder, Zeynep; Moroianu, Junona, E-mail: moroianu@bc.edu

We previously discovered that nuclear import of high risk HPV16 E7 is mediated by a cNLS located within the zinc-binding domain via a pathway that is independent of karyopherins/importins (Angeline et al., 2003; Knapp et al., 2009). In this study we continued our characterization of the cNLS and nuclear import pathway of HPV16 E7. We find that an intact zinc-binding domain is essential for the cNLS function in mediating nuclear import of HPV16 E7. Mutagenesis of cysteine residues to alanine in each of the two CysXXCys motifs involved in zinc-binding changes the nuclear localization of the EGFP-16E7 and 2xEGFP-16E7 mutants.more » We further discover that a patch of hydrophobic residues, {sub 65}LRLCV{sub 69}, within the zinc-binding domain of HPV16 E7 mediates its nuclear import via hydrophobic interactions with the FG domain of the central channel nucleoporin Nup62. - Highlights: • An intact zinc-binding domain is essential for the nuclear localization of HPV16 E7. • Identification of a hydrophobic patch that is critical for the nuclear import of HPV16 E7. • HPV16 E7 interacts via its zinc-binding domain with the FG domain of Nup62.« less

Fast and reliable prediction of domain-peptide binding affinity using coarse-grained structure models.

PubMed

Tian, Feifei; Tan, Rui; Guo, Tailin; Zhou, Peng; Yang, Li

2013-07-01

Domain-peptide recognition and interaction are fundamentally important for eukaryotic signaling and regulatory networks. It is thus essential to quantitatively infer the binding stability and specificity of such interaction based upon large-scale but low-accurate complex structure models which could be readily obtained from sophisticated molecular modeling procedure. In the present study, a new method is described for the fast and reliable prediction of domain-peptide binding affinity with coarse-grained structure models. This method is designed to tolerate strong random noises involved in domain-peptide complex structures and uses statistical modeling approach to eliminate systematic bias associated with a group of investigated samples. As a paradigm, this method was employed to model and predict the binding behavior of various peptides to four evolutionarily unrelated peptide-recognition domains (PRDs), i.e. human amph SH3, human nherf PDZ, yeast syh GYF and yeast bmh 14-3-3, and moreover, we explored the molecular mechanism and biological implication underlying the binding of cognate and noncognate peptide ligands to their domain receptors. It is expected that the newly proposed method could be further used to perform genome-wide inference of domain-peptide binding at three-dimensional structure level. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

PubMed

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

Modeling Conformational Transitions and Energetics of Ligand Binding with the Glutamate Receptor Ligand Binding Domain

NASA Astrophysics Data System (ADS)

Kurnikova, Maria

2009-03-01

Understanding of protein motion and energetics of conformational transitions is crucial to understanding protein function. The glutamate receptor ligand binding domain (GluR2 S1S2) is a two lobe protein, which binds ligand at the interface of two lobes and undergoes conformational transition. The cleft closure conformational transition of S1S2 has been implicated in gating of the ion channel formed by the transmembrane domain of the receptor. In this study we present a composite multi-faceted theoretical analysis of the detailed mechanism of this conformational transition based on rigid cluster decomposition of the protein structure [1] and identifying hydrogen bonds that are responsible for stabilizing the closed conformation [2]. Free energy of the protein reorganization upon ligand binding was calculated using combined Thermodynamic Integration (TI) and Umbrella Sampling (US) simulations [3]. Ligand -- protein interactions in the binding cleft were analyzed using Molecular Dynamics, continuum electrostatics and QM/MM models [4]. All model calculations compare well with corresponding experimental measurements. [4pt] [1] Protein Flexibility using Constraints from Molecular Dynamics Simulations T. Mamonova, B. Hespenheide, R. Straub, M. F. Thorpe, M. G. Kurnikova , Phys. Biol., 2, S137 (2005)[0pt] [2] Theoretical Study of the Glutamate Receptor Ligand Binding Domain Flexibility and Conformational Reorganization T. Mamonova, K. Speranskiy, and M. Kurnikova , Prot.: Struct., Func., Bioinf., 73,656 (2008)[0pt] [3] Energetics of the cleft closing transition and glutamate binding in the Glutamate Receptor ligand Binding Domain T. Mamonova, M. Yonkunas, and M. Kurnikova Biochemistry 47, 11077 (2008)[0pt] [4] On the Binding Determinants of the Glutamate Agonist with the Glutamate Receptor Ligand Binding Domain K. Speranskiy and M. Kurnikova Biochemistry 44, 11208 (2005)

The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

PubMed

Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

2013-07-01

AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

PubMed Central

Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

2013-01-01

AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

A novel signal transduction protein: Combination of solute binding and tandem PAS-like sensor domains in one polypeptide chain.

PubMed

Wu, R; Wilton, R; Cuff, M E; Endres, M; Babnigg, G; Edirisinghe, J N; Henry, C S; Joachimiak, A; Schiffer, M; Pokkuluri, P R

2017-04-01

We report the structural and biochemical characterization of a novel periplasmic ligand-binding protein, Dret_0059, from Desulfohalobium retbaense DSM 5692, an organism isolated from Lake Retba, in Senegal. The structure of the protein consists of a unique combination of a periplasmic solute binding protein (SBP) domain at the N-terminal and a tandem PAS-like sensor domain at the C-terminal region. SBP domains are found ubiquitously, and their best known function is in solute transport across membranes. PAS-like sensor domains are commonly found in signal transduction proteins. These domains are widely observed as parts of many protein architectures and complexes but have not been observed previously within the same polypeptide chain. In the structure of Dret_0059, a ketoleucine moiety is bound to the SBP, whereas a cytosine molecule is bound in the distal PAS-like domain of the tandem PAS-like domain. Differential scanning flourimetry support the binding of ligands observed in the crystal structure. There is significant interaction between the SBP and tandem PAS-like domains, and it is possible that the binding of one ligand could have an effect on the binding of the other. We uncovered three other proteins with this structural architecture in the non-redundant sequence data base, and predict that they too bind the same substrates. The genomic context of this protein did not offer any clues for its function. We did not find any biological process in which the two observed ligands are coupled. The protein Dret_0059 could be involved in either signal transduction or solute transport. © 2017 The Protein Society.

MODELING THE BINDING OF THE METABOLITES OF SOME POLYCYCLIC AROMTIC HYDROCARBONS TO THE LIGAND BINDING DOMAIN OF THE ESTROGEN RECEPTOR

EPA Science Inventory

Modeling the binding of the metabolites of some Polycyclic Aromatic Hydrocarbons to the ligand binding domain of the estrogen receptor
James Rabinowitz, Stephen Little, Katrina Brown, National Health and Environmental Effects Research Laboratory, Research Triangle Park, NC; Un...

Molecular basis of the specific subcellular localization of the C2-like domain of 5-lipoxygenase.

PubMed

Kulkarni, Shilpa; Das, Sudipto; Funk, Colin D; Murray, Diana; Cho, Wonhwa

2002-04-12

The activation of 5-lipoxygenase (5-LO) involves its calcium-dependent translocation to the nuclear envelope, where it catalyzes the two-step transformation of arachidonic acid into leukotriene A(4), leading to the synthesis of various leukotrienes. To understand the mechanism by which 5-LO is specifically targeted to the nuclear envelope, we studied the membrane binding properties of the amino-terminal domain of 5-LO, which has been proposed to have a C2 domain-like structure. The model building, electrostatic potential calculation, and in vitro membrane binding studies of the isolated C2-like domain of 5-LO and selected mutants show that this Ca(2+)-dependent domain selectively binds zwitterionic phosphatidylcholine, which is conferred by tryptophan residues (Trp(13), Trp(75), and Trp(102)) located in the putative Ca(2+)-binding loops. The spatiotemporal dynamics of the enhanced green fluorescence protein-tagged C2-like domain of 5-LO and mutants in living cells also show that the phosphatidylcholine selectivity of the C2-like domain accounts for the specific targeting of 5-LO to the nuclear envelope. Together, these results show that the C2-like domain of 5-LO is a genuine Ca(2+)-dependent membrane-targeting domain and that the subcellular localization of the domain is governed in large part by its membrane binding properties.

Novel Mechanism of Hemin Capture by Hbp2, the Hemoglobin-binding Hemophore from Listeria monocytogenes*

PubMed Central

Malmirchegini, G. Reza; Sjodt, Megan; Shnitkind, Sergey; Sawaya, Michael R.; Rosinski, Justin; Newton, Salete M.; Klebba, Phillip E.; Clubb, Robert T.

2014-01-01

Iron is an essential nutrient that is required for the growth of the bacterial pathogen Listeria monocytogenes. In cell cultures, this microbe secretes hemin/hemoglobin-binding protein 2 (Hbp2; Lmo2185) protein, which has been proposed to function as a hemophore that scavenges heme from the environment. Based on its primary sequence, Hbp2 contains three NEAr transporter (NEAT) domains of unknown function. Here we show that each of these domains mediates high affinity binding to ferric heme (hemin) and that its N- and C-terminal domains interact with hemoglobin (Hb). The results of hemin transfer experiments are consistent with Hbp2 functioning as an Hb-binding hemophore that delivers hemin to other Hbp2 proteins that are attached to the cell wall. Surprisingly, our work reveals that the central NEAT domain in Hbp2 binds hemin even though its primary sequence lacks a highly conserved YXXXY motif that is used by all other previously characterized NEAT domains to coordinate iron in the hemin molecule. To elucidate the mechanism of hemin binding by Hbp2, we determined crystal structures of its central NEAT domain (Hbp2N2; residues 183–303) in its free and hemin-bound states. The structures reveal an unprecedented mechanism of hemin binding in which Hbp2N2 undergoes a major conformational rearrangement that facilitates metal coordination by a non-canonical tyrosine residue. These studies highlight previously unrecognized plasticity in the hemin binding mechanism of NEAT domains and provide insight into how L. monocytogenes captures heme iron. PMID:25315777

Enhancement of DNaseI Salt Tolerance by Mimicking the Domain Structure of DNase from an Extremely Halotolerant Bacterium Thioalkalivibrio sp. K90mix

PubMed Central

Alzbutas, Gediminas; Kaniusaite, Milda; Lagunavicius, Arunas

2016-01-01

In our previous work we showed that DNaseI-like protein from an extremely halotolerant bacterium Thioalkalivibrio sp. K90mix retained its activity at salt concentrations as high as 4 M NaCl and the key factor allowing this was the C-terminal DNA-binding domain, which comprised two HhH (helix-hairpin-helix) motifs. The further investigations revealed that this domain originated from proteins related to bacterial competence ComEA/ComE proteins. It is likely that in the course of evolution the DNA-binding domain from these proteins was fused to a metallo-β-lactamase superfamily domain. Very likely such domain organization having proteins subsequently “donated” the DNA-binding domain to bacterial DNases. In this study we have mimicked this evolutionary step by fusing bovine DNaseI and DNA-binding domains. We have created two fusions: one harboring the DNA-binding domain of DNaseI-like protein from Thioalkalivibrio sp. K90mix and the second one harboring the DNA-binding domain of bacterial competence protein ComEA from Bacillus subtilis. Both domains enhanced salt tolerance of DNaseI, albeit to different extent. Molecular modeling revealed the essential differences between their interaction with DNA shedding some light on the differences in salt tolerance. In this study we have enhanced salt tolerance of bovine DNaseI; thus, we successfully mimicked the Nature’s evolutionary engineering that created the extremely halotolerant bacterial DNase. We have demonstrated that the newly engineered DNaseI variants can be successfully used in applications where activity of the wild type bovine DNaseI is impeded by buffers used. PMID:26939122

N- versus C-domain selectivity of catalytic inactivation of human angiotensin converting enzyme by lisinopril-coupled transition metal chelates.

PubMed

Hocharoen, Lalintip; Joyner, Jeff C; Cowan, J A

2013-12-27

The N- and C-terminal domains of human somatic angiotensin I converting enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates was tested for both reversible binding and irreversible catalytic inactivation of each domain of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and catalytic factors (double-filter effect).

Specific phosphopeptide binding regulates a conformational change in the PI 3-kinase SH2 domain associated with enzyme activation.

PubMed Central

Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A

1993-01-01

SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612

Knowledge-Guided Docking of WW Domain Proteins and Flexible Ligands

NASA Astrophysics Data System (ADS)

Lu, Haiyun; Li, Hao; Banu Bte Sm Rashid, Shamima; Leow, Wee Kheng; Liou, Yih-Cherng

Studies of interactions between protein domains and ligands are important in many aspects such as cellular signaling. We present a knowledge-guided approach for docking protein domains and flexible ligands. The approach is applied to the WW domain, a small protein module mediating signaling complexes which have been implicated in diseases such as muscular dystrophy and Liddle’s syndrome. The first stage of the approach employs a substring search for two binding grooves of WW domains and possible binding motifs of peptide ligands based on known features. The second stage aligns the ligand’s peptide backbone to the two binding grooves using a quasi-Newton constrained optimization algorithm. The backbone-aligned ligands produced serve as good starting points to the third stage which uses any flexible docking algorithm to perform the docking. The experimental results demonstrate that the backbone alignment method in the second stage performs better than conventional rigid superposition given two binding constraints. It is also shown that using the backbone-aligned ligands as initial configurations improves the flexible docking in the third stage. The presented approach can also be applied to other protein domains that involve binding of flexible ligand to two or more binding sites.

The structure of transcription termination factor Nrd1 reveals an original mode for GUAA recognition

PubMed Central

Franco-Echevarría, Elsa; González-Polo, Noelia; Zorrilla, Silvia; Martínez-Lumbreras, Santiago; Santiveri, Clara M.; Campos-Olivas, Ramón; Sánchez, Mar; Calvo, Olga

2017-01-01

Abstract Transcription termination of non-coding RNAs is regulated in yeast by a complex of three RNA binding proteins: Nrd1, Nab3 and Sen1. Nrd1 is central in this process by interacting with Rbp1 of RNA polymerase II, Trf4 of TRAMP and GUAA/G terminator sequences. We lack structural data for the last of these binding events. We determined the structures of Nrd1 RNA binding domain and its complexes with three GUAA-containing RNAs, characterized RNA binding energetics and tested rationally designed mutants in vivo. The Nrd1 structure shows an RRM domain fused with a second α/β domain that we name split domain (SD), because it is formed by two non-consecutive segments at each side of the RRM. The GUAA interacts with both domains and with a pocket of water molecules, trapped between the two stacking adenines and the SD. Comprehensive binding studies demonstrate for the first time that Nrd1 has a slight preference for GUAA over GUAG and genetic and functional studies suggest that Nrd1 RNA binding domain might play further roles in non-coding RNAs transcription termination. PMID:28973465

BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

DTIC Science & Technology

2006-12-01

has fine mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task was to...construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two domains in AR

Solution Structure of the cGMP Binding GAF Domain from Phosphodiesterase 5: Insights into Nucleotide Specificity, Dimerization, and cGMP-Dependent Conformational Change

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heikaus, Clemens C.; Stout, Joseph R.; Sekharan, Monica R.

2008-08-15

Phosphodiesterase 5 (PDE5) controls intracellular levels of cGMP through its regulation of cGMP hydrolysis. Hydrolytic activity of the C-terminal catalytic domain is increased by cGMP binding to the N-terminal GAF A domain. We present the NMR solution structure of the cGMP-bound PDE5A GAF A domain. The cGMP orientation in the buried binding pocket was defined through 37 intermolecular NOEs.

Identification of the WW domain-interaction sites in the unstructured N-terminal domain of EBV LMP 2A.

PubMed

Seo, Min-Duk; Park, Sung Jean; Kim, Hyun-Jung; Lee, Bong Jin

2007-01-09

Epstein-Barr virus latency is maintained by the latent membrane protein (LMP) 2A, which mimics the B-cell receptor (BCR) and perturbs BCR signaling. The cytoplasmic N-terminal domain of LMP2A is composed of 119 amino acids. The N-terminal domain of LMP2A (LMP2A NTD) contains two PY motifs (PPPPY) that interact with the WW domains of Nedd4 family ubiquitin-protein ligases. Based on our analysis of NMR data, we found that the LMP2A NTD adopts an overall random-coil structure in its native state. However, the region between residues 60 and 90 was relatively ordered, and seemed to form the hydrophobic core of the LMP2A NTD. This region resides between two PY motifs and is important for WW domain binding. Mapping of the residues involved in the interaction between the LMP2A NTD and WW domains was achieved by chemical shift perturbation, by the addition of WW2 and WW3 peptides. Interestingly, the binding of the WW domains mainly occurred in the hydrophobic core of the LMP2A NTD. In addition, we detected a difference in the binding modes of the two PY motifs against the two WW peptides. The binding of the WW3 peptide caused the resonances of five residues (Tyr(60), Glu(61), Asp(62), Trp(65), and Gly(66)) just behind the N-terminal PY motif of the LMP2A NTD to disappear. A similar result was obtained with WW2 binding. However, near the C-terminal PY motif, the chemical shift perturbation caused by WW2 binding was different from that due to WW3 binding, indicating that the residues near the PY motifs are involved in selective binding of WW domains. The present work represents the first structural study of the LMP2A NTD and provides fundamental structural information about its interaction with ubiquitin-protein ligase.

Structure-based design of ligands for protein basic domains: Application to the HIV-1 Tat protein

NASA Astrophysics Data System (ADS)

Filikov, Anton V.; James, Thomas L.

1998-05-01

A methodology has been developed for designing ligands to bind a flexible basic protein domain where the structure of the domain is essentially known. It is based on an empirical binding free energy function developed for highly charged complexes and on Monte Carlo simulations in internal coordinates with both the ligand and the receptor being flexible. HIV-1 encodes a transactivating regulatory protein called Tat. Binding of the basic domain of Tat to TAR RNA is required for efficient transcription of the viral genome. The structure of a biologically active peptide containing the Tat basic RNA-binding domain is available from NMR studies. The goal of the current project is to design a ligand which will bind to that basic domain and potentially inhibit the TAR-Tat interaction. The basic domain contains six arginine and two lysine residues. Our strategy was to design a ligand for arginine first and then a superligand for the basic domain by joining arginine ligands with a linker. Several possible arginine ligands were obtained by searching the Available Chemicals Directory with DOCK 3.5 software. Phytic acid, which can potentially bind multiple arginines, was chosen as a building block for the superligand. Calorimetric binding studies of several compounds to methylguanidine and Arg-/Lys-containing peptides were performed. The data were used to develop an empirical binding free energy function for prediction of affinity of the ligands for the Tat basic domain. Modeling of the conformations of the complexes with both the superligand and the basic domain being flexible has been carried out via Biased Probability Monte Carlo (BPMC) simulations in internal coordinates (ICM 2.6 suite of programs). The simulations used parameters to ensure correct folding, i.e., consistent with the experimental NMR structure of a 25-residue Tat peptide, from a random starting conformation. Superligands for the basic domain were designed by joining together two molecules of phytic acid with peptidic and peptidomimetic linkers. The linkers were refined by varying the length and side chains of the linking residues, carrying out BPMC simulations, and evaluation of the binding free energy for the best energy conformation. The dissociation constant of the best ligand designed is estimated to be in the low- to mid-nanomolar range.

Characterization of domain-peptide interaction interface: a case study on the amphiphysin-1 SH3 domain.

PubMed

Hou, Tingjun; Zhang, Wei; Case, David A; Wang, Wei

2008-02-29

Many important protein-protein interactions are mediated by peptide recognition modular domains, such as the Src homology 3 (SH3), SH2, PDZ, and WW domains. Characterizing the interaction interface of domain-peptide complexes and predicting binding specificity for modular domains are critical for deciphering protein-protein interaction networks. Here, we propose the use of an energetic decomposition analysis to characterize domain-peptide interactions and the molecular interaction energy components (MIECs), including van der Waals, electrostatic, and desolvation energy between residue pairs on the binding interface. We show a proof-of-concept study on the amphiphysin-1 SH3 domain interacting with its peptide ligands. The structures of the human amphiphysin-1 SH3 domain complexed with 884 peptides were first modeled using virtual mutagenesis and optimized by molecular mechanics (MM) minimization. Next, the MIECs between domain and peptide residues were computed using the MM/generalized Born decomposition analysis. We conducted two types of statistical analyses on the MIECs to demonstrate their usefulness for predicting binding affinities of peptides and for classifying peptides into binder and non-binder categories. First, combining partial least squares analysis and genetic algorithm, we fitted linear regression models between the MIECs and the peptide binding affinities on the training data set. These models were then used to predict binding affinities for peptides in the test data set; the predicted values have a correlation coefficient of 0.81 and an unsigned mean error of 0.39 compared with the experimentally measured ones. The partial least squares-genetic algorithm analysis on the MIECs revealed the critical interactions for the binding specificity of the amphiphysin-1 SH3 domain. Next, a support vector machine (SVM) was employed to build classification models based on the MIECs of peptides in the training set. A rigorous training-validation procedure was used to assess the performances of different kernel functions in SVM and different combinations of the MIECs. The best SVM classifier gave satisfactory predictions for the test set, indicated by average prediction accuracy rates of 78% and 91% for the binding and non-binding peptides, respectively. We also showed that the performance of our approach on both binding affinity prediction and binder/non-binder classification was superior to the performances of the conventional MM/Poisson-Boltzmann solvent-accessible surface area and MM/generalized Born solvent-accessible surface area calculations. Our study demonstrates that the analysis of the MIECs between peptides and the SH3 domain can successfully characterize the binding interface, and it provides a framework to derive integrated prediction models for different domain-peptide systems.

Mechanistic insights into phosphoprotein-binding FHA domains.

PubMed

Liang, Xiangyang; Van Doren, Steven R

2008-08-01

[Structure: see text]. FHA domains are protein modules that switch signals in diverse biological pathways by monitoring the phosphorylation of threonine residues of target proteins. As part of the effort to gain insight into cellular avoidance of cancer, FHA domains involved in the cellular response to DNA damage have been especially well-characterized. The complete protein where the FHA domain resides and the interaction partners determine the nature of the signaling. Thus, a key biochemical question is how do FHA domains pick out their partners from among thousands of alternatives in the cell? This Account discusses the structure, affinity, and specificity of FHA domains and the formation of their functional structure. Although FHA domains share sequence identity at only five loop residues, they all fold into a beta-sandwich of two beta-sheets. The conserved arginine and serine of the recognition loops recognize the phosphorylation of the threonine targeted. Side chains emanating from loops that join beta-strand 4 with 5, 6 with 7, or 10 with 11 make specific contacts with amino acids of the ligand that tailor sequence preferences. Many FHA domains choose a partner in extended conformation, somewhat according to the residue three after the phosphothreonine in sequence (pT + 3 position). One group of FHA domains chooses a short carboxylate-containing side chain at pT + 3. Another group chooses a long, branched aliphatic side chain. A third group prefers other hydrophobic or uncharged polar side chains at pT + 3. However, another FHA domain instead chooses on the basis of pT - 2, pT - 3, and pT + 1 positions. An FHA domain from a marker of human cancer instead chooses a much longer protein fragment that adds a beta-strand to its beta-sheet and that presents hydrophobic residues from a novel helix to the usual recognition surface. This novel recognition site and more remote sites for the binding of other types of protein partners were predicted for the entire family of FHA domains by a bioinformatics approach. The phosphopeptide-dependent dynamics of an FHA domain, SH2 domain, and PTB domain suggest a common theme: rigid, preformed binding surfaces support van der Waals contacts that provide favorable binding enthalpy. Despite the lack of pronounced conformational changes in FHA domains linked to binding events, more subtle adjustments may be possible. In the one FHA domain tested, phosphothreonine peptide binding is accompanied by increased flexibility just outside the binding site and increased rigidity across the beta-sandwich. The folding of the same FHA domain progresses through near-native intermediates that stabilize the recognition loops in the center of the phosphoprotein-binding surface; this may promote rigidity in the interface and affinity for targets phosphorylated on threonine.

Identification and functional characterization of an Src homology domain 3 domain-binding site on Cbl.

PubMed

Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland

2006-12-01

Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.

Cloning and characterization of a novel human STAR domain containing cDNA KHDRBS2.

PubMed

Wang, Liu; Xu, Jian; Zeng, Li; Ye, Xin; Wu, Qihan; Dai, Jianfeng; Ji, Chaoneng; Gu, Shaohua; Zhao, Chunhua; Xie, Yi; Mao, Yumin

2002-12-01

KHDRBS2, KH domain containing, RNA binding, signal transduction associated 2, is an RNA-binding protein that is tyrosine phosphorylated by Src during mitosis. It contains a KH domain,which is embedded in a larger conserved domain called the STAR domain. This protein has a 99% sequence identity with rat SLM-1 (the Sam68-like mammalian protein 1) and 98% sequence identity with mouse SLM-1 in its STAR domain. KHDRBS2 has the characteristic Sam68 SH2 and SH3 domain binding sites. RT-PCR analysis showed its transcript is ubiquitously expressed. The characterization of KHDRBS2 indicates it may link tyrosine kinase signaling cascades with some aspect of RNA metabolism.

A physical model describing the interaction of nuclear transport receptors with FG nucleoporin domain assemblies.

PubMed

Zahn, Raphael; Osmanović, Dino; Ehret, Severin; Araya Callis, Carolina; Frey, Steffen; Stewart, Murray; You, Changjiang; Görlich, Dirk; Hoogenboom, Bart W; Richter, Ralf P

2016-04-08

The permeability barrier of nuclear pore complexes (NPCs) controls bulk nucleocytoplasmic exchange. It consists of nucleoporin domains rich in phenylalanine-glycine motifs (FG domains). As a bottom-up nanoscale model for the permeability barrier, we have used planar films produced with three different end-grafted FG domains, and quantitatively analyzed the binding of two different nuclear transport receptors (NTRs), NTF2 and Importin β, together with the concomitant film thickness changes. NTR binding caused only moderate changes in film thickness; the binding isotherms showed negative cooperativity and could all be mapped onto a single master curve. This universal NTR binding behavior - a key element for the transport selectivity of the NPC - was quantitatively reproduced by a physical model that treats FG domains as regular, flexible polymers, and NTRs as spherical colloids with a homogeneous surface, ignoring the detailed arrangement of interaction sites along FG domains and on the NTR surface.

Characterization of substrate binding of the WW domains in human WWP2 protein.

PubMed

Jiang, Jiahong; Wang, Nan; Jiang, Yafei; Tan, Hongwei; Zheng, Jimin; Chen, Guangju; Jia, Zongchao

2015-07-08

WW domains harbor substrates containing proline-rich motifs, but the substrate specificity and binding mechanism remain elusive for those WW domains less amenable for structural studies, such as human WWP2 (hWWP2). Herein we have employed multiple techniques to investigate the second WW domain (WW2) in hWWP2. Our results show that hWWP2 is a specialized E3 for PPxY motif-containing substrates only and does not recognize other amino acids and phospho-residues. The strongest binding affinity of WW2, and the incompatibility between each WW domain, imply a novel relationship, and our SPR experiment reveals a dynamic binding mode in Class-I WW domains for the first time. The results from alanine-scanning mutagenesis and modeling further point to functionally conserved residues in WW2. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

The Src SH2 domain interacts dynamically with the focal adhesion kinase binding site as demonstrated by paramagnetic NMR spectroscopy.

PubMed

Lindfors, Hanna E; Drijfhout, Jan Wouter; Ubbink, Marcellus

2012-06-01

The interaction between the tyrosine kinases Src and focal adhesion kinase (FAK) is a key step in signaling processes from focal adhesions. The phosphorylated tyrosine residue 397 in FAK is able to bind the Src SH2 domain. To establish the extent of the FAK binding motif, the binding affinity of the SH2 domain for phosphorylated and unphosphorylated FAK-derived peptides of increasing length was determined and compared with that of the internal Src SH2 binding site. It is shown that the FAK peptides have higher affinity than the internal binding site and that seven negative residues adjacent to the core SH2 binding motif increase the binding constant 30-fold. A rigid spin-label incorporated in the FAK peptides was used to establish on the basis of paramagnetic relaxation enhancement whether the peptide-protein complex is well defined. A large spread of the paramagnetic effects on the surface of the SH2 domain suggests that the peptide-protein complex exhibits dynamics, despite the high affinity of the peptide. The strong electrostatic interaction between the positive side of the SH2 domain and the negative peptide results in a high affinity but may also favor a dynamic interaction. Copyright © 2012 Wiley Periodicals, Inc.

A Smad action turnover switch operated by WW domain readers of a phosphoserine code

PubMed Central

Aragón, Eric; Goerner, Nina; Zaromytidou, Alexia-Ileana; Xi, Qiaoran; Escobedo, Albert; Massagué, Joan; Macias, Maria J.

2011-01-01

When directed to the nucleus by TGF-β or BMP signals, Smad proteins undergo cyclin-dependent kinase 8/9 (CDK8/9) and glycogen synthase kinase-3 (GSK3) phosphorylations that mediate the binding of YAP and Pin1 for transcriptional action, and of ubiquitin ligases Smurf1 and Nedd4L for Smad destruction. Here we demonstrate that there is an order of events—Smad activation first and destruction later—and that it is controlled by a switch in the recognition of Smad phosphoserines by WW domains in their binding partners. In the BMP pathway, Smad1 phosphorylation by CDK8/9 creates binding sites for the WW domains of YAP, and subsequent phosphorylation by GSK3 switches off YAP binding and adds binding sites for Smurf1 WW domains. Similarly, in the TGF-β pathway, Smad3 phosphorylation by CDK8/9 creates binding sites for Pin1 and GSK3, then adds sites to enhance Nedd4L binding. Thus, a Smad phosphoserine code and a set of WW domain code readers provide an efficient solution to the problem of coupling TGF-β signal delivery to turnover of the Smad signal transducers. PMID:21685363

Time-resolved multimodal analysis of Src Homology 2 (SH2) domain binding in signaling by receptor tyrosine kinases

PubMed Central

Jadwin, Joshua A; Oh, Dongmyung; Curran, Timothy G; Ogiue-Ikeda, Mari; Jia, Lin; White, Forest M; Machida, Kazuya; Yu, Ji; Mayer, Bruce J

2016-01-01

While the affinities and specificities of SH2 domain-phosphotyrosine interactions have been well characterized, spatio-temporal changes in phosphosite availability in response to signals, and their impact on recruitment of SH2-containing proteins in vivo, are not well understood. To address this issue, we used three complementary experimental approaches to monitor phosphorylation and SH2 binding in human A431 cells stimulated with epidermal growth factor (EGF): 1) phospho-specific mass spectrometry; 2) far-Western blotting; and 3) live cell single-molecule imaging of SH2 membrane recruitment. Far-Western and MS analyses identified both well-established and previously undocumented EGF-dependent tyrosine phosphorylation and binding events, as well as dynamic changes in binding patterns over time. In comparing SH2 binding site phosphorylation with SH2 domain membrane recruitment in living cells, we found in vivo binding to be much slower. Delayed SH2 domain recruitment correlated with clustering of SH2 domain binding sites on the membrane, consistent with membrane retention via SH2 rebinding. DOI: http://dx.doi.org/10.7554/eLife.11835.001 PMID:27071344

Combining biophysical methods to analyze the disulfide bond in SH2 domain of C-terminal Src kinase.

PubMed

Liu, Dongsheng; Cowburn, David

2016-01-01

The Src Homology 2 (SH2) domain is a structurally conserved protein domain that typically binds to a phosphorylated tyrosine in a peptide motif from the target protein. The SH2 domain of C-terminal Src kinase (Csk) contains a single disulfide bond, which is unusual for most SH2 domains. Although the global motion of SH2 domain regulates Csk function, little is known about the relationship between the disulfide bond and binding of the ligand. In this study, we combined X-ray crystallography, solution NMR, and other biophysical methods to reveal the interaction network in Csk. Denaturation studies have shown that disulfide bond contributes significantly to the stability of SH2 domain, and crystal structures of the oxidized and C122S mutant showed minor conformational changes. We further investigated the binding of SH2 domain to a phosphorylated peptide from Csk-binding protein upon reduction and oxidation using both NMR and fluorescence approaches. This work employed NMR, X-ray cryptography, and other biophysical methods to study a disulfide bond in Csk SH2 domain. In addition, this work provides in-depth understanding of the structural dynamics of Csk SH2 domain.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

PubMed

Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-31

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

PubMed Central

Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-01

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

Takifugu rubripes cation independent mannose 6-phosphate receptor: Cloning, expression and functional characterization of the IGF-II binding domain.

PubMed

A, Ajith Kumar; Nadimpalli, Siva Kumar

2018-07-01

Mannose 6-phosphate/IGF-II receptor mediated lysosomal clearance of insulin-like growth factor-II is significantly associated with the evolution of placental mammals. The protein is also referred to as the IGF-II receptor. Earlier studies suggested relatively low binding affinity between the receptor and ligand in prototherian and metatherian mammals. In the present study, we cloned the IGF-II binding domain of the early vertebrate fugu fish and expressed it in bacteria. A 72000Da truncated receptor containing the IGF-II binding domain was obtained. Analysis of this protein (covering domains 11-13 of the CIMPR) for its affinity to fish and human IGF-II by ligand blot assays and ELISA showed that the expressed receptor can specifically bind to both fish and human IGF-II. Additionally, a peptide-specific antibody raised against the region of the IGF-II binding domain also was able to recognize the IGF-II binding regions of mammalian and non-mammalian cation independent MPR protein. These interactions were further characterized by Surface Plasma resonance support that the receptor binds to fish IGF-II, with a dissociation constant of 548nM. Preliminary analysis suggests that the binding mechanism as well as the affinity of the fish and human receptor for IGF-II may have varied according to different evolutionary pressures. Copyright © 2018. Published by Elsevier B.V.

Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

PubMed

Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

2005-11-01

The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

Actin-related proteins regulate the RSC chromatin remodeler by weakening intramolecular interactions of the Sth1 ATPase.

PubMed

Turegun, Bengi; Baker, Richard W; Leschziner, Andres E; Dominguez, Roberto

2018-01-01

The catalytic subunits of SWI/SNF-family and INO80-family chromatin remodelers bind actin and actin-related proteins (Arps) through an N-terminal helicase/SANT-associated (HSA) domain. Between the HSA and ATPase domains lies a conserved post-HSA (pHSA) domain. The HSA domain of Sth1, the catalytic subunit of the yeast SWI/SNF-family remodeler RSC, recruits the Rtt102-Arp7/9 heterotrimer. Rtt102-Arp7/9 regulates RSC function, but the mechanism is unclear. We show that the pHSA domain interacts directly with another conserved region of the catalytic subunit, protrusion-1. Rtt102-Arp7/9 binding to the HSA domain weakens this interaction and promotes the formation of stable, monodisperse complexes with DNA and nucleosomes. A crystal structure of Rtt102-Arp7/9 shows that ATP binds to Arp7 but not Arp9. However, Arp7 does not hydrolyze ATP. Together, the results suggest that Rtt102 and ATP stabilize a conformation of Arp7/9 that potentiates binding to the HSA domain, which releases intramolecular interactions within Sth1 and controls DNA and nucleosome binding.

Two zinc-binding domains in the transporter AdcA from Streptococcus pyogenes facilitate high-affinity binding and fast transport of zinc.

PubMed

Cao, Kun; Li, Nan; Wang, Hongcui; Cao, Xin; He, Jiaojiao; Zhang, Bing; He, Qing-Yu; Zhang, Gong; Sun, Xuesong

2018-04-20

Zinc is an essential metal in bacteria. One important bacterial zinc transporter is AdcA, and most bacteria possess AdcA homologs that are single-domain small proteins due to better efficiency of protein biogenesis. However, a double-domain AdcA with two zinc-binding sites is significantly overrepresented in Streptococcus species, many of which are major human pathogens. Using molecular simulation and experimental validations of AdcA from Streptococcus pyogenes , we found here that the two AdcA domains sequentially stabilize the structure upon zinc binding, indicating an organization required for both increased zinc affinity and transfer speed. This structural organization appears to endow Streptococcus species with distinct advantages in zinc-depleted environments, which would not be achieved by each single AdcA domain alone. This enhanced zinc transport mechanism sheds light on the significance of the evolution of the AdcA domain fusion, provides new insights into double-domain transporter proteins with two binding sites for the same ion, and indicates a potential target of antimicrobial drugs against pathogenic Streptococcus species. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

The Role of Bacterial Enhancer Binding Proteins as Specialized Activators of σ54-Dependent Transcription

PubMed Central

2012-01-01

Summary: Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active forms and utilize ATP hydrolysis to remodel the conformation of RNA polymerase containing the alternative sigma factor σ54. We present a comprehensive and detailed summary of recent advances in our understanding of how these specialized molecular machines function. The review is structured by introducing each of the three domains in turn: the central catalytic domain, the N-terminal regulatory domain, and the C-terminal DNA binding domain. The role of the central catalytic domain is presented with particular reference to (i) oligomerization, (ii) ATP hydrolysis, and (iii) the key GAFTGA motif that contacts σ54 for remodeling. Each of these functions forms a potential target of the signal-sensing N-terminal regulatory domain, which can act either positively or negatively to control the activation of σ54-dependent transcription. Finally, we focus on the DNA binding function of the C-terminal domain and the enhancer sites to which it binds. Particular attention is paid to the importance of σ54 to the bacterial cell and its unique role in regulating transcription. PMID:22933558

The structure of the nucleoprotein binding domain of lyssavirus phosphoprotein reveals a structural relationship between the N-RNA binding domains of Rhabdoviridae and Paramyxoviridae.

PubMed

Delmas, Olivier; Assenberg, Rene; Grimes, Jonathan M; Bourhy, Hervé

2010-01-01

The phosphoprotein P of non-segmented negative-sense RNA viruses is an essential component of the replication and transcription complex and acts as a co-factor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. We have obtained the structure of the C-terminal domain of P of Mokola virus (MOKV), a lyssavirus that belongs to the Rhabdoviridae family and mapped at the amino acid level the crucial positions involved in interaction with N and in the formation of the viral replication complex. Comparison of the N-RNA binding domains of P solved to date suggests that the N-RNA binding domains are structurally conserved among paramyxoviruses and rhabdoviruses in spite of low sequence conservation. We also review the numerous other functions of this domain and more generally of the phosphoprotein.

Structural Basis of J Cochaperone Binding and Regulation of Hsp70

PubMed Central

Jiang, Jianwen; Maes, E. Guy; Taylor, Alex B; Wang, Liping; Hinck, Andrew P; Lafer, Eileen M; Sousa, Rui

2007-01-01

The many protein processing reactions of the ATP-hydrolyzing Hsp70s are regulated by J cochaperones, which contain J domains that stimulate Hsp70 ATPase activity and accessory domains that present protein substrates to Hsp70s. We report the structure of a J domain complexed with a J responsive portion of a mammalian Hsp70. The J domain activates ATPase activity by directing the linker that connects the Hsp70 nucleotide binding domain (NBD) and substrate binding domain (SBD) towards a hydrophobic patch on the NBD surface. Binding of the J domain to Hsp70 displaces the SBD from the NBD, which may allow the SBD flexibility to capture diverse substrates. Unlike prokaryotic Hsp70, the SBD and NBD of the mammalian chaperone interact in the ADP state. Thus, while both nucleotides and J cochaperones modulate Hsp70 NBD:linker and NBD:SBD interactions, the intrinsic persistence of those interactions differs in different Hsp70s and this may optimize their activities for different cellular roles. PMID:17996706

The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

Tyrosine Phosphorylation of the Lyn Src Homology 2 (SH2) Domain Modulates Its Binding Affinity and Specificity*

PubMed Central

Jin, Lily L.; Wybenga-Groot, Leanne E.; Tong, Jiefei; Taylor, Paul; Minden, Mark D.; Trudel, Suzanne; McGlade, C. Jane; Moran, Michael F.

2015-01-01

Src homology 2 (SH2) domains are modular protein structures that bind phosphotyrosine (pY)-containing polypeptides and regulate cellular functions through protein-protein interactions. Proteomics analysis showed that the SH2 domains of Src family kinases are themselves tyrosine phosphorylated in blood system cancers, including acute myeloid leukemia, chronic lymphocytic leukemia, and multiple myeloma. Using the Src family kinase Lyn SH2 domain as a model, we found that phosphorylation at the conserved SH2 domain residue Y194 impacts the affinity and specificity of SH2 domain binding to pY-containing peptides and proteins. Analysis of the Lyn SH2 domain crystal structure supports a model wherein phosphorylation of Y194 on the EF loop modulates the binding pocket that engages amino acid side chains at the pY+2/+3 position. These data indicate another level of regulation wherein SH2-mediated protein-protein interactions are modulated by SH2 kinases and phosphatases. PMID:25587033

Structural Determination of Functional Domains in Early B-cell Factor (EBF) Family of Transcription Factors Reveals Similarities to Rel DNA-binding Proteins and a Novel Dimerization Motif*

PubMed Central

Siponen, Marina I.; Wisniewska, Magdalena; Lehtiö, Lari; Johansson, Ida; Svensson, Linda; Raszewski, Grzegorz; Nilsson, Lennart; Sigvardsson, Mikael; Berglund, Helena

2010-01-01

The early B-cell factor (EBF) transcription factors are central regulators of development in several organs and tissues. This protein family shows low sequence similarity to other protein families, which is why structural information for the functional domains of these proteins is crucial to understand their biochemical features. We have used a modular approach to determine the crystal structures of the structured domains in the EBF family. The DNA binding domain reveals a striking resemblance to the DNA binding domains of the Rel homology superfamily of transcription factors but contains a unique zinc binding structure, termed zinc knuckle. Further the EBF proteins contain an IPT/TIG domain and an atypical helix-loop-helix domain with a novel type of dimerization motif. The data presented here provide insights into unique structural features of the EBF proteins and open possibilities for detailed molecular investigations of this important transcription factor family. PMID:20592035

Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding Domain I in mismatch recognition.

PubMed Central

Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric

2007-01-01

In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869

Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition.

PubMed

Lee, Susan D; Surtees, Jennifer A; Alani, Eric

2007-02-09

In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.

The regulation mechanisms of AhR by molecular chaperone complex.

PubMed

Kudo, Ikuru; Hosaka, Miki; Haga, Asami; Tsuji, Noriko; Nagata, Yuhtaroh; Okada, Hirotaka; Fukuda, Kana; Kakizaki, Yuka; Okamoto, Tomoya; Grave, Ewa; Itoh, Hideaki

2018-03-01

The AhR, so called the dioxin receptor, is a member of the nuclear receptor superfamily. The ligand-free AhR forms a cytosolic protein complex with the molecular chaperone HSP90, co-chaperone p23, and XAP2 in the cytoplasm. Following ligand binding like 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD), the AhR translocates into the nucleus. Although it has been reported that HSP90 regulates the translocation of the AhR to the nucleus, the precise activation mechanisms of the AhR have not yet been fully understood. AhR consists of the N-terminal bHLH domain containing NLS and NES, the middle PAS domain and the C-terminal transactivation domain. The PAS domain is familiar as a ligand and HSP90 binding domain. In this study, we focused on the bHLH domain that was thought to be a HSP90 binding domain. We investigated the binding properties of bHLH to HSP90. We analyzed the direct interaction of bHLH with HSP90, p23 and XAP2 using purified proteins. We found that not only the PAS domain but also the bHLH domain bound to HSP90. The bHLH domain forms complex with HSP90, p23 and XAP2. We also determined the bHLH binding domain was HSP90 N-domain. The bHLH domain makes a complex with HSP90, p23 and XAP2 via the HSP90 N-domain. Although the NLS is closed in the absence of a ligand, the structure of AhR will be changed in the presence of a ligand, which leads to NLS open, result in the nuclear translocation of AhR.

Keep your fingers off my DNA: protein-protein interactions mediated by C2H2 zinc finger domains.

PubMed

Brayer, Kathryn J; Segal, David J

2008-01-01

Cys2-His2 (C2H2) zinc finger domains (ZFs) were originally identified as DNA-binding domains, and uncharacterized domains are typically assumed to function in DNA binding. However, a growing body of evidence suggests an important and widespread role for these domains in protein binding. There are even examples of zinc fingers that support both DNA and protein interactions, which can be found in well-known DNA-binding proteins such as Sp1, Zif268, and Ying Yang 1 (YY1). C2H2 protein-protein interactions (PPIs) are proving to be more abundant than previously appreciated, more plastic than their DNA-binding counterparts, and more variable and complex in their interactions surfaces. Here we review the current knowledge of over 100 C2H2 zinc finger-mediated PPIs, focusing on what is known about the binding surface, contributions of individual fingers to the interaction, and function. An accurate understanding of zinc finger biology will likely require greater insights into the potential protein interaction capabilities of C2H2 ZFs.

Scaffold hopping from (5-hydroxymethyl) isophthalates to multisubstituted pyrimidines diminishes binding affinity to the C1 domain of protein kinase C.

PubMed

Provenzani, Riccardo; Tarvainen, Ilari; Brandoli, Giulia; Lempinen, Antti; Artes, Sanna; Turku, Ainoleena; Jäntti, Maria Helena; Talman, Virpi; Yli-Kauhaluoma, Jari; Tuominen, Raimo K; Boije Af Gennäs, Gustav

2018-01-01

Protein kinase C (PKC) isoforms play a pivotal role in the regulation of numerous cellular functions, making them extensively studied and highly attractive drug targets. Utilizing the crystal structure of the PKCδ C1B domain, we have developed hydrophobic isophthalic acid derivatives that modify PKC functions by binding to the C1 domain of the enzyme. In the present study, we aimed to improve the drug-like properties of the isophthalic acid derivatives by increasing their solubility and enhancing the binding affinity. Here we describe the design and synthesis of a series of multisubstituted pyrimidines as analogs of C1 domain-targeted isophthalates and characterize their binding affinities to the PKCα isoform. In contrast to our computational predictions, the scaffold hopping from phenyl to pyrimidine core diminished the binding affinity. Although the novel pyrimidines did not establish improved binding affinity for PKCα compared to our previous isophthalic acid derivatives, the present results provide useful structure-activity relationship data for further development of ligands targeted to the C1 domain of PKC.

Phosphoinositide-binding proteins in autophagy.

PubMed

Lystad, Alf Håkon; Simonsen, Anne

2016-08-01

Phosphoinositides represent a very small fraction of membrane phospholipids, having fast turnover rates and unique subcellular distributions, which make them perfect for initiating local temporal effects. Seven different phosphoinositide species are generated through reversible phosphorylation of the inositol ring of phosphatidylinositol (PtdIns). The negative charge generated by the phosphates provides specificity for interaction with various protein domains that commonly contain a cluster of basic residues. Examples of domains that bind phosphoinositides include PH domains, WD40 repeats, PX domains, and FYVE domains. Such domains often display specificity toward a certain species or subset of phosphoinositides. Here we will review the current literature of different phosphoinositide-binding proteins involved in autophagy. © 2016 Federation of European Biochemical Societies.

Mechanism of mRNA-STAR domain interaction: Molecular dynamics simulations of Mammalian Quaking STAR protein.

PubMed

Sharma, Monika; Anirudh, C R

2017-10-03

STAR proteins are evolutionary conserved mRNA-binding proteins that post-transcriptionally regulate gene expression at all stages of RNA metabolism. These proteins possess conserved STAR domain that recognizes identical RNA regulatory elements as YUAAY. Recently reported crystal structures show that STAR domain is composed of N-terminal QUA1, K-homology domain (KH) and C-terminal QUA2, and mRNA binding is mediated by KH-QUA2 domain. Here, we present simulation studies done to investigate binding of mRNA to STAR protein, mammalian Quaking protein (QKI). We carried out conventional MD simulations of STAR domain in presence and absence of mRNA, and studied the impact of mRNA on the stability, dynamics and underlying allosteric mechanism of STAR domain. Our unbiased simulations results show that presence of mRNA stabilizes the overall STAR domain by reducing the structural deviations, correlating the 'within-domain' motions, and maintaining the native contacts information. Absence of mRNA not only influenced the essential modes of motion of STAR domain, but also affected the connectivity of networks within STAR domain. We further explored the dissociation of mRNA from STAR domain using umbrella sampling simulations, and the results suggest that mRNA binding to STAR domain occurs in multi-step: first conformational selection of mRNA backbone conformations, followed by induced fit mechanism as nucleobases interact with STAR domain.

Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

PubMed

Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

2017-08-01

Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

Atypical binding of the Swa2p UBA domain to ubiquitin.

PubMed

Matta-Camacho, Edna; Kozlov, Guennadi; Trempe, Jean-François; Gehring, Kalle

2009-02-20

Swa2p is an auxilin-like yeast protein that is involved in vesicular transport and required for uncoating of clathrin-coated vesicles. Swa2p contains a ubiquitin-associated (UBA) domain, which is present in a variety of proteins involved in ubiquitin (Ub)-mediated processes. We have determined a structural model of the Swa2p UBA domain in complex with Ub using NMR spectroscopy and molecular docking. Ub recognition occurs predominantly through an atypical interaction in which UBA helix alpha1 and the N-terminal part of helix alpha2 bind to Ub. Mutation of Ala148, a key residue in helix alpha1, to polar residues greatly reduced the affinity of the UBA domain for Ub and revealed a second low-affinity Ub-binding site located on the surface formed by helices alpha1 and alpha3. Surface plasmon resonance showed that the Swa2p UBA domain binds K48- and K63-linked di-Ub in a non-linkage-specific manner. These results reveal convergent evolution of a Ub-binding site on helix alpha1 of UBA domains involved in membrane protein trafficking.

Mapping the ER Interactome: The P Domains of Calnexin and Calreticulin as Plurivalent Adapters for Foldases and Chaperones.

PubMed

Kozlov, Guennadi; Muñoz-Escobar, Juliana; Castro, Karla; Gehring, Kalle

2017-09-05

The lectin chaperones calreticulin (CRT) and calnexin (CNX) contribute to the folding of glycoproteins in the ER by recruiting foldases such as the protein disulfide isomerase ERp57 and the peptidyl prolyl cis-trans isomerase CypB. Recently, CRT was shown to interact with the chaperone ERp29. Here, we show that ERp29 directly binds to the P domain of CNX. Crystal structures of the D domain of ERp29 in complex with the P domains from CRT and calmegin, a tissue-specific CNX homolog, reveal a commonality in the mechanism of binding whereby the tip of the P domain functions as a plurivalent adapter to bind a variety of folding factors. We show that mutation of a single residue, D348 in CNX, abrogates binding to ERp29 as well as ERp57 and CypB. The structural diversity of the accessory factors suggests that these chaperones became specialized for glycoprotein folding through convergent evolution of their P-domain binding sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

A novel RNA binding surface of the TAM domain of TIP5/BAZ2A mediates epigenetic regulation of rRNA genes.

PubMed

Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael

2015-05-26

The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Role of Flexibility and Conformational Selection in the Binding Promiscuity of PDZ Domains

PubMed Central

Münz, Márton; Hein, Jotun; Biggin, Philip C.

2012-01-01

In molecular recognition, it is often the case that ligand binding is coupled to conformational change in one or both of the binding partners. Two hypotheses describe the limiting cases involved; the first is the induced fit and the second is the conformational selection model. The conformational selection model requires that the protein adopts conformations that are similar to the ligand-bound conformation in the absence of ligand, whilst the induced-fit model predicts that the ligand-bound conformation of the protein is only accessible when the ligand is actually bound. The flexibility of the apo protein clearly plays a major role in these interpretations. For many proteins involved in signaling pathways there is the added complication that they are often promiscuous in that they are capable of binding to different ligand partners. The relationship between protein flexibility and promiscuity is an area of active research and is perhaps best exemplified by the PDZ domain family of proteins. In this study we use molecular dynamics simulations to examine the relationship between flexibility and promiscuity in five PDZ domains: the human Dvl2 (Dishevelled-2) PDZ domain, the human Erbin PDZ domain, the PDZ1 domain of InaD (inactivation no after-potential D protein) from fruit fly, the PDZ7 domain of GRIP1 (glutamate receptor interacting protein 1) from rat and the PDZ2 domain of PTP-BL (protein tyrosine phosphatase) from mouse. We show that despite their high structural similarity, the PDZ binding sites have significantly different dynamics. Importantly, the degree of binding pocket flexibility was found to be closely related to the various characteristics of peptide binding specificity and promiscuity of the five PDZ domains. Our findings suggest that the intrinsic motions of the apo structures play a key role in distinguishing functional properties of different PDZ domains and allow us to make predictions that can be experimentally tested. PMID:23133356

Conformational dynamics and ligand binding in the multi-domain protein PDC109.

PubMed

Kim, Hyun Jin; Choi, Moo Young; Kim, Hyung J; Llinás, Miguel

2010-02-18

PDC109 is a modular multi-domain protein with two fibronectin type II (Fn2) repeats joined by a linker. It plays a major role in bull sperm binding to the oviductal epithelium through its interactions with phosphorylcholines (PhCs), a head group of sperm cell membrane lipids. The crystal structure of the PDC109-PhC complex shows that each PhC binds to the corresponding Fn2 domain, while the two domains are on the same face of the protein. Long timescale explicit solvent molecular dynamics (MD) simulations of PDC109, in the presence and absence of PhC, suggest that PhC binding strongly correlates with the relative orientation of choline-phospholipid binding sites of the two Fn2 domains; unless the two domains tightly bind PhCs, they tend to change their relative orientation by deforming the flexible linker. The effective PDC109-PhC association constant of 28 M(-1), estimated from their potential of mean force is consistent with the experimental result. Principal component analysis of the long timescale MD simulations was compared to the significantly less expensive normal mode analysis of minimized structures. The comparison indicates that difference between relative domain motions of PDC109 with bound and unbound PhC is captured by the first principal component in the principal component analysis as well as the three lowest normal modes in the normal mode analysis. The present study illustrates the use of detailed MD simulations to clarify the energetics of specific ligand-domain interactions revealed by a static crystallographic model, as well as their influence on relative domain motions in a multi-domain protein.

Carbohydrate-binding module 74 is a novel starch-binding domain associated with large and multidomain α-amylase enzymes.

PubMed

Valk, Vincent; Lammerts van Bueren, Alicia; van der Kaaij, Rachel M; Dijkhuizen, Lubbert

2016-06-01

Microbacterium aurum B8.A is a bacterium that originates from a potato starch-processing plant and employs a GH13 α-amylase (MaAmyA) enzyme that forms pores in potato starch granules. MaAmyA is a large and multi-modular protein that contains a novel domain at its C terminus (Domain 2). Deletion of Domain 2 from MaAmyA did not affect its ability to degrade starch granules but resulted in a strong reduction in granular pore size. Here, we separately expressed and purified this Domain 2 in Escherichia coli and determined its likely function in starch pore formation. Domain 2 independently binds amylose, amylopectin, and granular starch but does not have any detectable catalytic (hydrolytic or oxidizing) activity on α-glucan substrates. Therefore, we propose that this novel starch-binding domain is a new carbohydrate-binding module (CBM), the first representative of family CBM74 that assists MaAmyA in efficient pore formation in starch granules. Protein sequence-based BLAST searches revealed that CBM74 occurs widespread, but in bacteria only, and is often associated with large and multi-domain α-amylases containing family CBM25 or CBM26 domains. CBM74 may specifically function in binding to granular starches to enhance the capability of α-amylase enzymes to degrade resistant starches (RSs). Interestingly, the majority of family CBM74 representatives are found in α-amylases originating from human gut-associated Bifidobacteria, where they may assist in resistant starch degradation. The CBM74 domain thus may have a strong impact on the efficiency of RS digestion in the mammalian gastrointestinal tract. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Two amino acid residues confer different binding affinities of Abelson family kinase SRC homology 2 domains for phosphorylated cortactin.

PubMed

Gifford, Stacey M; Liu, Weizhi; Mader, Christopher C; Halo, Tiffany L; Machida, Kazuya; Boggon, Titus J; Koleske, Anthony J

2014-07-11

The closely related Abl family kinases, Arg and Abl, play important non-redundant roles in the regulation of cell morphogenesis and motility. Despite similar N-terminal sequences, Arg and Abl interact with different substrates and binding partners with varying affinities. This selectivity may be due to slight differences in amino acid sequence leading to differential interactions with target proteins. We report that the Arg Src homology (SH) 2 domain binds two specific phosphotyrosines on cortactin, a known Abl/Arg substrate, with over 10-fold higher affinity than the Abl SH2 domain. We show that this significant affinity difference is due to the substitution of arginine 161 and serine 187 in Abl to leucine 207 and threonine 233 in Arg, respectively. We constructed Abl SH2 domains with R161L and S187T mutations alone and in combination and find that these substitutions are sufficient to convert the low affinity Abl SH2 domain to a higher affinity "Arg-like" SH2 domain in binding to a phospho-cortactin peptide. We crystallized the Arg SH2 domain for structural comparison to existing crystal structures of the Abl SH2 domain. We show that these two residues are important determinants of Arg and Abl SH2 domain binding specificity. Finally, we expressed Arg containing an "Abl-like" low affinity mutant Arg SH2 domain (L207R/T233S) and find that this mutant, although properly localized to the cell periphery, does not support wild type levels of cell edge protrusion. Together, these observations indicate that these two amino acid positions confer different binding affinities and cellular functions on the distinct Abl family kinases. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification and specificity studies of small-molecule ligands for SH3 protein domains.

PubMed

Inglis, Steven R; Stojkoski, Cvetan; Branson, Kim M; Cawthray, Jacquie F; Fritz, Daniel; Wiadrowski, Emma; Pyke, Simon M; Booker, Grant W

2004-10-21

The Src Homology 3 (SH3) domains are small protein-protein interaction domains that bind proline-rich sequences and mediate a wide range of cell-signaling and other important biological processes. Since deregulated signaling pathways form the basis of many human diseases, the SH3 domains have been attractive targets for novel therapeutics. High-affinity ligands for SH3 domains have been designed; however, these have all been peptide-based and no examples of entirely nonpeptide SH3 ligands have previously been reported. Using the mouse Tec Kinase SH3 domain as a model system for structure-based ligand design, we have identified several simple heterocyclic compounds that selectively bind to the Tec SH3 domain. Using a combination of nuclear magnetic resonance chemical shift perturbation, structure-activity relationships, and site-directed mutagenesis, the binding of these compounds at the proline-rich peptide-binding site has been characterized. The most potent of these, 2-aminoquinoline, bound with Kd = 125 microM and was able to compete for binding with a proline-rich peptide. Synthesis of 6-substituted-2-aminoquinolines resulted in ligands with up to 6-fold improved affinity over 2-aminoquinoline and enhanced specificity for the Tec SH3 domain. Therefore, 2-aminoquinolines may potentially be useful for the development of high affinity small molecule ligands for SH3 domains.

A structural portrait of the PDZ domain family.

PubMed

Ernst, Andreas; Appleton, Brent A; Ivarsson, Ylva; Zhang, Yingnan; Gfeller, David; Wiesmann, Christian; Sidhu, Sachdev S

2014-10-23

PDZ (PSD-95/Discs-large/ZO1) domains are interaction modules that typically bind to specific C-terminal sequences of partner proteins and assemble signaling complexes in multicellular organisms. We have analyzed the existing database of PDZ domain structures in the context of a specificity tree based on binding specificities defined by peptide-phage binding selections. We have identified 16 structures of PDZ domains in complex with high-affinity ligands and have elucidated four additional structures to assemble a structural database that covers most of the branches of the PDZ specificity tree. A detailed comparison of the structures reveals features that are responsible for the diverse specificities across the PDZ domain family. Specificity differences can be explained by differences in PDZ residues that are in contact with the peptide ligands, but these contacts involve both side-chain and main-chain interactions. Most PDZ domains bind peptides in a canonical conformation in which the ligand main chain adopts an extended β-strand conformation by interacting in an antiparallel fashion with a PDZ β-strand. However, a subset of PDZ domains bind peptides with a bent main-chain conformation and the specificities of these non-canonical domains could not be explained based on canonical structures. Our analysis provides a structural portrait of the PDZ domain family, which serves as a guide in understanding the structural basis for the diverse specificities across the family. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

Prediction of small molecule binding property of protein domains with Bayesian classifiers based on Markov chains.

PubMed

Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland

2009-12-01

Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.

A Multiprotein Binding Interface in an Intrinsically Disordered Region of the Tumor Suppressor Protein Interferon Regulatory Factor-1*

PubMed Central

Narayan, Vikram; Halada, Petr; Hernychová, Lenka; Chong, Yuh Ping; Žáková, Jitka; Hupp, Ted R.; Vojtesek, Borivoj; Ball, Kathryn L.

2011-01-01

The interferon-regulated transcription factor and tumor suppressor protein IRF-1 is predicted to be largely disordered outside of the DNA-binding domain. One of the advantages of intrinsically disordered protein domains is thought to be their ability to take part in multiple, specific but low affinity protein interactions; however, relatively few IRF-1-interacting proteins have been described. The recent identification of a functional binding interface for the E3-ubiquitin ligase CHIP within the major disordered domain of IRF-1 led us to ask whether this region might be employed more widely by regulators of IRF-1 function. Here we describe the use of peptide aptamer-based affinity chromatography coupled with mass spectrometry to define a multiprotein binding interface on IRF-1 (Mf2 domain; amino acids 106–140) and to identify Mf2-binding proteins from A375 cells. Based on their function as known transcriptional regulators, a selection of the Mf2 domain-binding proteins (NPM1, TRIM28, and YB-1) have been validated using in vitro and cell-based assays. Interestingly, although NPM1, TRIM28, and YB-1 all bind to the Mf2 domain, they have differing amino acid specificities, demonstrating the degree of combinatorial diversity and specificity available through linear interaction motifs. PMID:21245151

Distinct Mechanisms of Recognizing Endosomal Sorting Complex Required for Transport III (ESCRT-III) Protein IST1 by Different Microtubule Interacting and Trafficking (MIT) Domains*

PubMed Central

Guo, Emily Z.; Xu, Zhaohui

2015-01-01

The endosomal sorting complex required for transport (ESCRT) machinery is responsible for membrane remodeling in a number of biological processes including multivesicular body biogenesis, cytokinesis, and enveloped virus budding. In mammalian cells, efficient abscission during cytokinesis requires proper function of the ESCRT-III protein IST1, which binds to the microtubule interacting and trafficking (MIT) domains of VPS4, LIP5, and Spartin via its C-terminal MIT-interacting motif (MIM). Here, we studied the molecular interactions between IST1 and the three MIT domain-containing proteins to understand the structural basis that governs pairwise MIT-MIM interaction. Crystal structures of the three molecular complexes revealed that IST1 binds to the MIT domains of VPS4, LIP5, and Spartin using two different mechanisms (MIM1 mode versus MIM3 mode). Structural comparison revealed that structural features in both MIT and MIM contribute to determine the specific binding mechanism. Within the IST1 MIM sequence, two phenylalanine residues were shown to be important in discriminating MIM1 versus MIM3 binding. These observations enabled us to deduce a preliminary binding code, which we applied to provide CHMP2A, a protein that normally only binds the MIT domain in the MIM1 mode, the additional ability to bind the MIT domain of Spartin in the MIM3 mode. PMID:25657007

When core competence is not enough: functional interplay of the DEAD-box helicase core with ancillary domains and auxiliary factors in RNA binding and unwinding.

PubMed

Rudolph, Markus G; Klostermeier, Dagmar

2015-08-01

DEAD-box helicases catalyze RNA duplex unwinding in an ATP-dependent reaction. Members of the DEAD-box helicase family consist of a common helicase core formed by two RecA-like domains. According to the current mechanistic model for DEAD-box mediated RNA unwinding, binding of RNA and ATP triggers a conformational change of the helicase core, and leads to formation of a compact, closed state. In the closed conformation, the two parts of the active site for ATP hydrolysis and of the RNA binding site, residing on the two RecA domains, become aligned. Closing of the helicase core is coupled to a deformation of the RNA backbone and destabilization of the RNA duplex, allowing for dissociation of one of the strands. The second strand remains bound to the helicase core until ATP hydrolysis and product release lead to re-opening of the core. The concomitant disruption of the RNA binding site causes dissociation of the second strand. The activity of the helicase core can be modulated by interaction partners, and by flanking N- and C-terminal domains. A number of C-terminal flanking regions have been implicated in RNA binding: RNA recognition motifs (RRM) typically mediate sequence-specific RNA binding, whereas positively charged, unstructured regions provide binding sites for structured RNA, without sequence-specificity. Interaction partners modulate RNA binding to the core, or bind to RNA regions emanating from the core. The functional interplay of the helicase core and ancillary domains or interaction partners in RNA binding and unwinding is not entirely understood. This review summarizes our current knowledge on RNA binding to the DEAD-box helicase core and the roles of ancillary domains and interaction partners in RNA binding and unwinding by DEAD-box proteins.

Word list and story recall elicit different patterns of memory deficit in patients with Alzheimer's disease, frontotemporal dementia, subcortical ischemic vascular disease, and Lewy body dementia.

PubMed

Perri, Roberta; Fadda, Lucia; Caltagirone, Carlo; Carlesimo, Giovanni Augusto

2013-01-01

Different roles have been attributed to mesio-temporal areas and frontal lobes in declarative memory functioning, and qualitative differences have been observed in the amnesic symptoms due to pathological damage of these two portions of the central nervous system. The aim of the present study was to look for memory profiles related to pathological involvement in the temporal and frontal structures in patients with different dementia syndromes on word-list and prose memory tasks. 20 patients with Alzheimer's disease (AD), 20 with frontal variant of FTD (fvFTD), 20 with subcortical ischemic vascular dementia (SIVD), and 20 with Lewy body dementia (LBD) and 34 healthy subjects (NCs) were submitted to word-list and prose memory tasks. All groups performed similarly on both the immediate and delayed recall of the word-list. Conversely, AD patients performed worse than all the other dementia groups on the immediate prose recall. On delayed prose recall, AD patients performed worse than fvFTD and SIVD patients but similar to LBD patients. Differential scores between word-list and prose tests were minimal in the AD group and very pronounced in fvFTD and SIVD groups. The combined use of the prose and word-list tasks evidenced a "mesio-temporal" memory profile in AD patients as opposed to a "frontal" one in fvFTD and SIVD patients and a mixed profile in the LBD patients. In particular, a differential score between the two tests can be useful in differentiating AD patients from patients with other forms of dementia.

Equity in Whom Gets Studied: A Systematic Review Examining Geographical Region, Gender, Commodity, and Employment Context in Research of Low Back Disorders in Farmers.

PubMed

Trask, Catherine; Khan, Muhammad Idress; Adebayo, Olugbenga; Boden, Catherine; Bath, Brenna

2015-01-01

Farmers are at high risk of having low back disorders (LBDs). Agriculture employs half the global workforce, but it is unclear whether all farming populations are represented equitably in the LBD literature. This systematic review quantifies the number and quality of research studies by geographical region, agricultural commodity, and farmer characteristics. MEDLINE, Web of Science, CINAHL, Scopus, and Embase databases were searched using conceptual groups of search terms: "farming" and "LBD." Screening and extraction were performed by two researchers in parallel, then reconciled through discussion. Extracted study characteristics included location of study; commodity produced; worker sex, ethnicity, and migration status; type of employment; and study quality. These were compared with agricultural employment statistics from the International Labour Organization and World Bank. From 125 articles, roughly half (67) did not specify the employment context of the participants in terms of migration status or subsistence versus commercial farming. Although in many regions worldwide women make up the bulk of the workforce, only a minority of low back disorder studies focus on women. Despite the predominance of the agricultural workforce in developing nations, 91% of included studies were conducted in developed nations. There was no significant difference in study quality by geographic region. The nature of the world's agricultural workforce is poorly represented by the literature when it comes to LBD research. If developing nations, female sex, and migrant work are related to increased vulnerability, then these groups need more representation to achieve equitable occupational health study.

Does Using a Chair Backrest or Reducing Seated Hip Flexion Influence Trunk Muscle Activity and Discomfort? A Systematic Review.

PubMed

Curran, Máire; O'Sullivan, Leonard; O'Sullivan, Peter; Dankaerts, Wim; O'Sullivan, Kieran

2015-11-01

This paper systematically reviews the effect of chair backrests and reducing seated hip flexion on low back discomfort (LBD) and trunk muscle activation. Prolonged sitting commonly exacerbates low back pain (LBP). Several modifications to seated posture and chair design have been recommended, including using chairs with backrests and chairs that reduce hip flexion. Electronic databases were searched by two independent assessors. Part 1 of this review includes 26 studies comparing the effect of sitting with at least two different hip angles. In Part 2, seven studies that compared the effect of sitting with and without a backrest were eligible. Study quality was assessed using the PEDro scale. Significant confounding variables and a relatively small number of randomized controlled trials (RCTs) involving people with LBP complicates analysis of the results. There was moderate evidence that chair backrests reduce paraspinal muscle activation, and limited evidence that chair backrests reduce LBD. There was no evidence that chairs involving less hip flexion reduce LBP or LBD, or consistently alter trunk muscle activation. However, participants in several studies subjectively preferred the modified chairs involving less hip flexion. The limited evidence to support the use of chairs involving less seated hip flexion, or the effect of a backrest, is consistent with the limited evidence that other isolated chair design features can reduce LBP. LBP management is likely to require consideration of several factors in addition to sitting position. Larger RCTs involving people with LBP are required. © 2015, Human Factors and Ergonomics Society.

MMSE and MoCA in Parkinson’s disease and dementia with Lewy bodies: a multicenter 1-year follow-up study

PubMed Central

Weis, L.; Bostantjopoulou, S.; Stefanova, E.; Falup-Pecurariu, C.; Kramberger, M. G.; Geurtsen, G. J.; Antonini, A.; Weintraub, D.; Aarsland, D.

2016-01-01

The Mini-Mental State Examination (MMSE) and the Montreal Cognitive Assessment (MoCA) are the most commonly used scales to test cognitive impairment in Lewy body disease (LBD), but there is no consensus on which is best suited to assess cognition in clinical practice and most sensitive to cognitive decline. Retrospective cohort study of 265 LBD patients [Parkinson’s disease (PD) without dementia (PDnD, N = 197), PD with dementia (PDD, N = 40), and dementia with Lewy bodies (DLB, N = 28)] from an international consortium who completed both the MMSE and MoCA at baseline and 1-year follow-up (N = 153). Percentage of relative standard deviation (RSD%) at baseline was the measure of inter-individual variance, and estimation of change (Cohen’s d) over time was calculated. RSD% for the MoCA (21 %) was greater than for the MMSE (13 %) (p = 0.03) in the whole group. This difference was significant only in PDnD (11 vs. 5 %, p < 0.01), but not in PDD (30 vs. 19 %, p = 0.37) or DLB (15 vs. 14 %, p = 0.78). In contrast, the 1-year estimation of change did not differ between the two tests in any of the groups (Cohen’s effect <0.20 in each group). MMSE and MoCA are equal in measuring the rate of cognitive changes over time in LBD. However, in PDnD, the MoCA is a better measure of cognitive status as it lacks both ceiling and floor effects. PMID:26852137

Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

PubMed

Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

2001-04-15

We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

N- vs. C-Domain Selectivity of Catalytic Inactivation of Human Angiotensin Converting Enzyme by Lisinopril-Coupled Transition Metal Chelates

PubMed Central

Hocharoen, Lalintip; Joyner, Jeff C.; Cowan, J. A.

2014-01-01

The N- and C-terminal domains of human somatic Angiotensin I Converting Enzyme (sACE-1) demonstrate distinct physiological functions, with resulting interest in the development of domain-selective inhibitors for specific therapeutic applications. Herein, the activity of lisinopril-coupled transition metal chelates were tested for both reversible binding and irreversible catalytic inactivation of sACE-1. C/N domain binding selectivity ratios ranged from 1 to 350, while rates of irreversible catalytic inactivation of the N- and C-domains were found to be significantly greater for the N-domain, suggesting a more optimal orientation of the M-chelate-lisinopril complexes within the active site of the N-domain of sACE-1. Finally, the combined effect of binding selectivity and inactivation selectivity was assessed for each catalyst (double-filter selectivity factors), and several catalysts were found to cause domain-selective catalytic inactivation. The results of this study demonstrate the ability to optimize the target selectivity of catalytic metallopeptides through both binding and orientation factors (double-filter effect). PMID:24228790

IQGAP Proteins Reveal an Atypical Phosphoinositide (aPI) Binding Domain with a Pseudo C2 Domain Fold*

PubMed Central

Dixon, Miles J.; Gray, Alexander; Schenning, Martijn; Agacan, Mark; Tempel, Wolfram; Tong, Yufeng; Nedyalkova, Lyudmila; Park, Hee-Won; Leslie, Nicholas R.; van Aalten, Daan M. F.; Downes, C. Peter; Batty, Ian H.

2012-01-01

Class I phosphoinositide (PI) 3-kinases act through effector proteins whose 3-PI selectivity is mediated by a limited repertoire of structurally defined, lipid recognition domains. We describe here the lipid preferences and crystal structure of a new class of PI binding modules exemplified by select IQGAPs (IQ motif containing GTPase-activating proteins) known to coordinate cellular signaling events and cytoskeletal dynamics. This module is defined by a C-terminal 105–107 amino acid region of which IQGAP1 and -2, but not IQGAP3, binds preferentially to phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3). The binding affinity for PtdInsP3, together with other, secondary target-recognition characteristics, are comparable with those of the pleckstrin homology domain of cytohesin-3 (general receptor for phosphoinositides 1), an established PtdInsP3 effector protein. Importantly, the IQGAP1 C-terminal domain and the cytohesin-3 pleckstrin homology domain, each tagged with enhanced green fluorescent protein, were both re-localized from the cytosol to the cell periphery following the activation of PI 3-kinase in Swiss 3T3 fibroblasts, consistent with their common, selective recognition of endogenous 3-PI(s). The crystal structure of the C-terminal IQGAP2 PI binding module reveals unexpected topological similarity to an integral fold of C2 domains, including a putative basic binding pocket. We propose that this module integrates select IQGAP proteins with PI 3-kinase signaling and constitutes a novel, atypical phosphoinositide binding domain that may represent the first of a larger group, each perhaps structurally unique but collectively dissimilar from the known PI recognition modules. PMID:22493426

IQGAP Proteins Reveal an Atypical Phosphoinositide (aPI) Binding Domain with a Pseudo C2 Domain Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dixon, Miles J.; Gray, Alexander; Schenning, Martijn

2012-10-16

Class I phosphoinositide (PI) 3-kinases act through effector proteins whose 3-PI selectivity is mediated by a limited repertoire of structurally defined, lipid recognition domains. We describe here the lipid preferences and crystal structure of a new class of PI binding modules exemplified by select IQGAPs (IQ motif containing GTPase-activating proteins) known to coordinate cellular signaling events and cytoskeletal dynamics. This module is defined by a C-terminal 105-107 amino acid region of which IQGAP1 and -2, but not IQGAP3, binds preferentially to phosphatidylinositol 3,4,5-trisphosphate (PtdInsP3). The binding affinity for PtdInsP3, together with other, secondary target-recognition characteristics, are comparable with those ofmore » the pleckstrin homology domain of cytohesin-3 (general receptor for phosphoinositides 1), an established PtdInsP3 effector protein. Importantly, the IQGAP1 C-terminal domain and the cytohesin-3 pleckstrin homology domain, each tagged with enhanced green fluorescent protein, were both re-localized from the cytosol to the cell periphery following the activation of PI 3-kinase in Swiss 3T3 fibroblasts, consistent with their common, selective recognition of endogenous 3-PI(s). The crystal structure of the C-terminal IQGAP2 PI binding module reveals unexpected topological similarity to an integral fold of C2 domains, including a putative basic binding pocket. We propose that this module integrates select IQGAP proteins with PI 3-kinase signaling and constitutes a novel, atypical phosphoinositide binding domain that may represent the first of a larger group, each perhaps structurally unique but collectively dissimilar from the known PI recognition modules.« less

Selective Targeting of SH2 Domain-Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies.

PubMed

Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie; Sha, Fern; Pojer, Florence; Koide, Akiko; Seeliger, Markus; Koide, Shohei; Hantschel, Oliver

2017-05-05

The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroup (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody-SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Novel alternative splicings of BPAG1 (bullous pemphigoid antigen 1) including the domain structure closely related to MACF (microtubule actin cross-linking factor).

PubMed

Okumura, Masayo; Yamakawa, Hisashi; Ohara, Osamu; Owaribe, Katsushi

2002-02-22

BPAG1 (bullous pemphigoid antigen 1) was originally identified as a 230-kDa hemidesmosomal protein and belongs to the plakin family, because it consists of a plakin domain, a coiled-coil rod domain and a COOH-terminal intermediate filament binding domain. To date, alternatively spliced products of BPAG1, BPAG1e, and BPAG1n are known. BPAG1e is expressed in epithelial tissues and localized to hemidesmosomes, on the other hand, BPAG1n is expressed in neural tissues and muscles and has an actin binding domain at the NH(2)-terminal of BPAG1e. BPAG1 is also known as a gene responsible for Dystonia musculorum (dt) neurodegeneration syndrome of the mouse. Another plakin family protein MACF (microtubule actin cross-linking factor) has also an actin binding domain and the plakin domain at the NH(2)-terminal. However, in contrast to its high homology with BPAG1 at the NH(2)-terminal, the COOH-terminal structure of MACF, including a microtubule binding domain, resembles dystrophin rather than plakins. Here, we investigated RNAs and proteins expressed from the BPAG1 locus and suggest novel alternative splicing variants, which include one consisting of the COOH-terminal domain structure homologous to MACF. The results indicate that BPAG1 has three kinds of cytoskeletal binding domains and seems to play an important role in linking the different types of cytoskeletons.

An examination of dynamics crosstalk between SH2 and SH3 domains by hydrogen/deuterium exchange and mass spectrometry

PubMed Central

Hochrein, James M.; Lerner, Edwina C.; Schiavone, Anthony P.; Smithgall, Thomas E.; Engen, John R.

2006-01-01

The ability of proteins to regulate their own enzymatic activity can be facilitated by changes in structure or protein dynamics in response to external regulators. Because many proteins contain SH2 and SH3 domains, transmission of information between the domains is a potential method of allosteric regulation. To determine if ligand binding to one modular domain may alter structural dynamics in an adjacent domain, allowing potential transmission of information through the protein, we used hydrogen exchange and mass spectrometry to measure changes in protein dynamics in the SH3 and SH2 domains of hematopoietic cell kinase (Hck). Ligand binding to either domain had little or no effect on hydrogen exchange in the adjacent domain, suggesting that changes in protein structure or dynamics are not a means of SH2/SH3 crosstalk. Furthermore, ligands of varying affinity covalently attached to SH3/SH2 altered dynamics only in the domain to which they bind. Such results demonstrate that ligand binding may not structurally alter adjacent SH3/SH2 domains and implies that other aspects of protein architecture contribute to the multiple levels of regulation in proteins containing SH3 and SH2 domains. PMID:16322569

Teaching strategies to promote concept learning by design challenges

NASA Astrophysics Data System (ADS)

Van Breukelen, Dave; Van Meel, Adrianus; De Vries, Marc

2017-07-01

Background: This study is the second study of a design-based research, organised around four studies, that aims to improve student learning, teaching skills and teacher training concerning the design-based learning approach called Learning by Design (LBD).

Affinity and specificity of interactions between Nedd4 isoforms and the epithelial Na+ channel.

PubMed

Henry, Pauline C; Kanelis, Voula; O'Brien, M Christine; Kim, Brian; Gautschi, Ivan; Forman-Kay, Julie; Schild, Laurent; Rotin, Daniela

2003-05-30

The epithelial Na+ channel (alphabetagammaENaC) regulates salt and fluid homeostasis and blood pressure. Each ENaC subunit contains a PY motif (PPXY) that binds to the WW domains of Nedd4, a Hect family ubiquitin ligase containing 3-4 WW domains and usually a C2 domain. It has been proposed that Nedd4-2, but not Nedd4-1, isoforms can bind to and suppress ENaC activity. Here we challenge this notion and show that, instead, the presence of a unique WW domain (WW3*) in either Nedd4-2 or Nedd4-1 determines high affinity interactions and the ability to suppress ENaC. WW3* from either Nedd4-2 or Nedd4-1 binds ENaC-PY motifs equally well (e.g. Kd approximately 10 microm for alpha- or betaENaC, 3-6-fold higher affinity than WW4), as determined by intrinsic tryptophan fluorescence. Moreover, dNedd4-1, which naturally contains a WW3* instead of WW2, is able to suppress ENaC function equally well as Nedd4-2. Homology models of the WW3*.betaENaC-PY complex revealed that a Pro and Ala conserved in all WW3*, but not other Nedd4-WW domains, help form the binding pocket for PY motif prolines. Extensive contacts are formed between the betaENaC-PY motif and the Pro in WW3*, and the small Ala creates a large pocket to accommodate the peptide. Indeed, mutating the conserved Pro and Ala in WW3* reduces binding affinity 2-3-fold. Additionally, we demonstrate that mutations in PY motif residues that form contacts with the WW domain based on our previously solved structure either abolish or severely reduce binding affinity to the WW domain and that the extent of binding correlates with the level of ENaC suppression. Independently, we show that a peptide encompassing the PY motif of sgk1, previously proposed to bind to Nedd4-2 and alter its ability to regulate ENaC, does not bind (or binds poorly) the WW domains of Nedd4-2. Collectively, these results suggest that high affinity of WW domain-PY-motif interactions rather than affiliation with Nedd4-1/Nedd-2 is critical for ENaC suppression by Nedd4 proteins.

Membrane interaction of the N-terminal domain of chemokine receptor CXCR1.

PubMed

Haldar, Sourav; Raghuraman, H; Namani, Trishool; Rajarathnam, Krishna; Chattopadhyay, Amitabha

2010-06-01

The N-terminal domain of chemokine receptors constitutes one of the two critical ligand binding sites, and plays important roles by mediating binding affinity, receptor selectivity, and regulating function. In this work, we monitored the organization and dynamics of a 34-mer peptide of the CXC chemokine receptor 1 (CXCR1) N-terminal domain and its interaction with membranes by utilizing a combination of fluorescence-based approaches and surface pressure measurements. Our results show that the CXCR1 N-domain 34-mer peptide binds vesicles of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and upon binding, the tryptophan residues of the peptide experience motional restriction and exhibit red edge excitation shift (REES) of 19nm. These results are further supported by increase in fluorescence anisotropy and mean fluorescence lifetime upon membrane binding. These results constitute one of the first reports demonstrating membrane interaction of the N-terminal domain of CXCR1 and gain relevance in the context of the emerging role of cellular membranes in chemokine signaling.

Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import

PubMed Central

Buchanan, Susan K; Lukacik, Petra; Grizot, Sylvestre; Ghirlando, Rodolfo; Ali, Maruf M U; Barnard, Travis J; Jakes, Karen S; Kienker, Paul K; Esser, Lothar

2007-01-01

Colicin Ia is a 69 kDa protein that kills susceptible Escherichia coli cells by binding to a specific receptor in the outer membrane, colicin I receptor (70 kDa), and subsequently translocating its channel forming domain across the periplasmic space, where it inserts into the inner membrane and forms a voltage-dependent ion channel. We determined crystal structures of colicin I receptor alone and in complex with the receptor binding domain of colicin Ia. The receptor undergoes large and unusual conformational changes upon colicin binding, opening at the cell surface and positioning the receptor binding domain of colicin Ia directly above it. We modelled the interaction with full-length colicin Ia to show that the channel forming domain is initially positioned 150 Å above the cell surface. Functional data using full-length colicin Ia show that colicin I receptor is necessary for cell surface binding, and suggest that the receptor participates in translocation of colicin Ia across the outer membrane. PMID:17464289

In-Solution SH2 Domain Binding Assay Based on Proximity Ligation.

PubMed

Machida, Kazuya

2017-01-01

Protein-protein interactions mediated by SH2 domains confer specificity in tyrosine kinase pathways. Traditional assays for assessing interactions between an SH2 domain and its interacting protein such as far-Western and pull-down are inherently low throughput. We developed SH2-PLA, an in-solution SH2 domain binding assay, that takes advantage of the speed and sensitivity of proximity ligation and real-time PCR. SH2-PLA allows for rapid assessment of SH2 domain binding to a target protein using only a few microliters of cell lysate, thereby making it an attractive new tool to study tyrosine kinase signaling.

Drosophila Pumilio Protein Contains Multiple Autonomous Repression Domains That Regulate mRNAs Independently of Nanos and Brain Tumor

PubMed Central

Weidmann, Chase A.

2012-01-01

Drosophila melanogaster Pumilio is an RNA-binding protein that potently represses specific mRNAs. In developing embryos, Pumilio regulates a key morphogen, Hunchback, in collaboration with the cofactor Nanos. To investigate repression by Pumilio and Nanos, we created cell-based assays and found that Pumilio inhibits translation and enhances mRNA decay independent of Nanos. Nanos robustly stimulates repression through interactions with the Pumilio RNA-binding domain. We programmed Pumilio to recognize a new binding site, which garners repression of new target mRNAs. We show that cofactors Brain Tumor and eIF4E Homologous Protein are not obligatory for Pumilio and Nanos activity. The conserved RNA-binding domain of Pumilio was thought to be sufficient for its function. Instead, we demonstrate that three unique domains in the N terminus of Pumilio possess the major repressive activity and can function autonomously. The N termini of insect and vertebrate Pumilio and Fem-3 binding factors (PUFs) are related, and we show that corresponding regions of human PUM1 and PUM2 have repressive activity. Other PUF proteins lack these repression domains. Our findings suggest that PUF proteins have evolved new regulatory functions through protein sequences appended to their conserved PUF repeat RNA-binding domains. PMID:22064486

Drosophila Pumilio protein contains multiple autonomous repression domains that regulate mRNAs independently of Nanos and brain tumor.

PubMed

Weidmann, Chase A; Goldstrohm, Aaron C

2012-01-01

Drosophila melanogaster Pumilio is an RNA-binding protein that potently represses specific mRNAs. In developing embryos, Pumilio regulates a key morphogen, Hunchback, in collaboration with the cofactor Nanos. To investigate repression by Pumilio and Nanos, we created cell-based assays and found that Pumilio inhibits translation and enhances mRNA decay independent of Nanos. Nanos robustly stimulates repression through interactions with the Pumilio RNA-binding domain. We programmed Pumilio to recognize a new binding site, which garners repression of new target mRNAs. We show that cofactors Brain Tumor and eIF4E Homologous Protein are not obligatory for Pumilio and Nanos activity. The conserved RNA-binding domain of Pumilio was thought to be sufficient for its function. Instead, we demonstrate that three unique domains in the N terminus of Pumilio possess the major repressive activity and can function autonomously. The N termini of insect and vertebrate Pumilio and Fem-3 binding factors (PUFs) are related, and we show that corresponding regions of human PUM1 and PUM2 have repressive activity. Other PUF proteins lack these repression domains. Our findings suggest that PUF proteins have evolved new regulatory functions through protein sequences appended to their conserved PUF repeat RNA-binding domains.

Occupancy of a C2-C2 type 'zinc-finger' protein domain by copper. Direct observation by electrospray ionization mass spectrometry.

PubMed

Hutchens, T W; Allen, M H; Li, C M; Yip, T T

1992-09-07

The metal ion specificity of most 'zinc-finger' metal binding domains is unknown. The human estrogen receptor protein contains two different C2-C2 type 'zinc-finger' sequences within its DNA-binding domain (ERDBD). Copper inhibits the function of this protein by mechanisms which remain unclear. We have used electrospray ionization mass spectrometry to evaluate directly the 71-residue ERDBD (K180-M250) in the absence and presence of Cu(II) ions. The ERDBD showed a high affinity for Cu and was completely occupied with 4 Cu bound; each Cu ion was evidently bound to only two ligand residues (net loss of only 2 Da per bound Cu). The Cu binding stoichiometry was confirmed by atomic absorption. These results (i) provide the first direct physical evidence for the ability of the estrogen receptor DNA-binding domain to bind Cu and (ii) document a twofold difference in the Zn- and Cu-binding capacity. Differences in the ERDBD domain structure with bound Zn and Cu are predicted. Given the relative intracellular contents of Zn and Cu, our findings demonstrate the need to investigate further the Cu occupancy of this and other zinc-finger domains both in vitro and in vivo.

Domain wise docking analyses of the modular chitin binding protein CBP50 from Bacillus thuringiensis serovar konkukian S4.

PubMed

Sehar, Ujala; Mehmood, Muhammad Aamer; Hussain, Khadim; Nawaz, Salman; Nadeem, Shahid; Siddique, Muhammad Hussnain; Nadeem, Habibullah; Gull, Munazza; Ahmad, Niaz; Sohail, Iqra; Gill, Saba Shahid; Majeed, Summera

2013-01-01

This paper presents an in silico characterization of the chitin binding protein CBP50 from B. thuringiensis serovar konkukian S4 through homology modeling and molecular docking. The CBP50 has shown a modular structure containing an N-terminal CBM33 domain, two consecutive fibronectin-III (Fn-III) like domains and a C-terminal CBM5 domain. The protein presented a unique modular structure which could not be modeled using ordinary procedures. So, domain wise modeling using MODELLER and docking analyses using Autodock Vina were performed. The best conformation for each domain was selected using standard procedure. It was revealed that four amino acid residues Glu-71, Ser-74, Glu-76 and Gln-90 from N-terminal domain are involved in protein-substrate interaction. Similarly, amino acid residues Trp-20, Asn-21, Ser-23 and Val-30 of Fn-III like domains and Glu-15, Ala-17, Ser-18 and Leu-35 of C-terminal domain were involved in substrate binding. Site-directed mutagenesis of these proposed amino acid residues in future will elucidate the key amino acids involved in chitin binding activity of CBP50 protein.

A G-quadruplex-binding macrodomain within the "SARS-unique domain" is essential for the activity of the SARS-coronavirus replication-transcription complex.

PubMed

Kusov, Yuri; Tan, Jinzhi; Alvarez, Enrique; Enjuanes, Luis; Hilgenfeld, Rolf

2015-10-01

The multi-domain non-structural protein 3 of SARS-coronavirus is a component of the viral replication/transcription complex (RTC). Among other domains, it contains three sequentially arranged macrodomains: the X domain and subdomains SUD-N as well as SUD-M within the "SARS-unique domain". The X domain was proposed to be an ADP-ribose-1"-phosphatase or a poly(ADP-ribose)-binding protein, whereas SUD-NM binds oligo(G)-nucleotides capable of forming G-quadruplexes. Here, we describe the application of a reverse genetic approach to assess the importance of these macrodomains for the activity of the SARS-CoV RTC. To this end, Renilla luciferase-encoding SARS-CoV replicons with selectively deleted macrodomains were constructed and their ability to modulate the RTC activity was examined. While the SUD-N and the X domains were found to be dispensable, the SUD-M domain was crucial for viral genome replication/transcription. Moreover, alanine replacement of charged amino-acid residues of the SUD-M domain, which are likely involved in G-quadruplex-binding, caused abrogation of RTC activity. Copyright © 2015 Elsevier Inc. All rights reserved.

The Tyrosine Sulfate Domain of Fibromodulin Binds Collagen and Enhances Fibril Formation.

PubMed

Tillgren, Viveka; Mörgelin, Matthias; Önnerfjord, Patrik; Kalamajski, Sebastian; Aspberg, Anders

2016-11-04

Small leucine-rich proteoglycans interact with other extracellular matrix proteins and are important regulators of matrix assembly. Fibromodulin has a key role in connective tissues, binding collagen through two identified binding sites in its leucine-rich repeat domain and regulating collagen fibril formation in vitro and in vivo Some nine tyrosine residues in the fibromodulin N-terminal domain are O-sulfated, a posttranslational modification often involved in protein interactions. The N-terminal domain mimics heparin, binding proteins with clustered basic amino acid residues. Because heparin affects collagen fibril formation, we investigated whether tyrosine sulfate is involved in fibromodulin interactions with collagen. Using full-length fibromodulin and its N-terminal tyrosine-sulfated domain purified from tissue, as well as recombinant fibromodulin fragments, we found that the N-terminal domain binds collagen. The tyrosine-sulfated domain and the leucine-rich repeat domain both bound to three specific sites along the collagen type I molecule, at the N terminus and at 100 and 220 nm from the N terminus. The N-terminal domain shortened the collagen fibril formation lag phase and tyrosine sulfation was required for this effect. The isolated leucine-rich repeat domain inhibited the fibril formation rate, and full-length fibromodulin showed a combination of these effects. The fibrils formed in the presence of fibromodulin or its fragments showed more organized structure. Fibromodulin and its tyrosine sulfate domain remained bound on the formed fiber. Taken together, this suggests a novel, regulatory function for tyrosine sulfation in collagen interaction and control of fibril formation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Evolution of the nuclear receptor gene superfamily.

PubMed Central

Laudet, V; Hänni, C; Coll, J; Catzeflis, F; Stéhelin, D

1992-01-01

Nuclear receptor genes represent a large family of genes encoding receptors for various hydrophobic ligands such as steroids, vitamin D, retinoic acid and thyroid hormones. This family also contains genes encoding putative receptors for unknown ligands. Nuclear receptor gene products are composed of several domains important for transcriptional activation, DNA binding (C domain), hormone binding and dimerization (E domain). It is not known whether these genes have evolved through gene duplication from a common ancestor or if their different domains came from different independent sources. To test these possibilities we have constructed and compared the phylogenetic trees derived from two different domains of 30 nuclear receptor genes. The tree built from the DNA binding C domain clearly shows a common progeny of all nuclear receptors, which can be grouped into three subfamilies: (i) thyroid hormone and retinoic acid receptors, (ii) orphan receptors and (iii) steroid hormone receptors. The tree constructed from the central part of the E domain which is implicated in transcriptional regulation and dimerization shows the same distribution in three subfamilies but two groups of receptors are in a different position from that in the C domain tree: (i) the Drosophila knirps family genes have acquired very different E domains during evolution, and (ii) the vitamin D and ecdysone receptors, as well as the FTZ-F1 and the NGF1B genes, seem to have DNA binding and hormone binding domains belonging to different classes. These data suggest a complex evolutionary history for nuclear receptor genes in which gene duplication events and swapping between domains of different origins took place. PMID:1312460

Selective Targeting of SH2 Domain–Phosphotyrosine Interactions of Src Family Tyrosine Kinases with Monobodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kükenshöner, Tim; Schmit, Nadine Eliane; Bouda, Emilie

The binding of Src-homology 2 (SH2) domains to phosphotyrosine (pY) sites is critical for the autoinhibition and substrate recognition of the eight Src family kinases (SFKs). The high sequence conservation of the 120 human SH2 domains poses a significant challenge to selectively perturb the interactions of even the SFK SH2 family against the rest of the SH2 domains. We have developed synthetic binding proteins, termed monobodies, for six of the SFK SH2 domains with nanomolar affinity. Most of these monobodies competed with pY ligand binding and showed strong selectivity for either the SrcA (Yes, Src, Fyn, Fgr) or SrcB subgroupmore » (Lck, Lyn, Blk, Hck). Interactome analysis of intracellularly expressed monobodies revealed that they bind SFKs but no other SH2-containing proteins. Three crystal structures of monobody–SH2 complexes unveiled different and only partly overlapping binding modes, which rationalized the observed selectivity and enabled structure-based mutagenesis to modulate inhibition mode and selectivity. In line with the critical roles of SFK SH2 domains in kinase autoinhibition and T-cell receptor signaling, monobodies binding the Src and Hck SH2 domains selectively activated respective recombinant kinases, whereas an Lck SH2-binding monobody inhibited proximal signaling events downstream of the T-cell receptor complex. Our results show that SFK SH2 domains can be targeted with unprecedented potency and selectivity using monobodies. They are excellent tools for dissecting SFK functions in normal development and signaling and to interfere with aberrant SFK signaling networks in cancer cells.« less

Thermodynamic Linkage Between Calmodulin Domains Binding Calcium and Contiguous Sites in the C-Terminal Tail of CaV1.2

PubMed Central

Evans, T. Idil Apak; Hell, Johannes; Shea, Madeline A.

2011-01-01

Calmodulin (CaM) binding to the intracellular C-terminal tail (CTT) of the cardiac L-type Ca2+ channel (CaV1.2) regulates Ca2+ entry by recognizing sites that contribute to negative feedback mechanisms for channel closing. CaM associates with CaV1.2 under low resting [Ca2+], but is poised to change conformation and position when intracellular [Ca2+] rises. CaM binding Ca2+, and the domains of CaM binding the CTT are linked thermodynamic functions. To better understand regulation, we determined the energetics of CaM domains binding to peptides representing pre-IQ sites A1588, and C1614 and the IQ motif studied as overlapping peptides IQ1644 and IQ′1650 as well as their effect on calcium binding. (Ca2+)4-CaM bound to all four peptides very favorably (Kd ≤ 2 nM). Linkage analysis showed that IQ1644–1670 bound with a Kd ~1 pM. In the pre-IQ region, (Ca2+)2-N-domain bound preferentially to A1588, while (Ca2+)2-C-domain preferred C1614. When bound to C1614, calcium binding in the N-domain affected the tertiary conformation of the C-domain. Based on the thermodynamics, we propose a structural mechanism for calcium-dependent conformational change in which the linker between CTT sites A and C buckles to form an A-C hairpin that is bridged by calcium-saturated CaM. PMID:21757287

Sources and loads of nutrients in the South Platte River, Colorado and Nebraska, 1994-95

USGS Publications Warehouse

Litke, D.W.

1996-01-01

The South Platte River Basin was one of 20 river basins selected in 1991 for investigation as part of the U.S. Geological Survey's National Water- Quality Assessment (NAWQA) Program. Nationwide, nutrients have been identified as one of the primary nationwide water-quality concerns and are of particular interest in the South Platte River Basin where nutrient concentrations are large compared to concentrations in other NAWQA river basins. This report presents estimates of the magnitude of nutrient-source inputs to the South Platte River Basin, describes nutrient concen- trations and loads in the South Platte River during different seasons, and presents comparisons of nutrient inputs to instream nutrient loads. Annual nutrient inputs to the basin were estimated to be 306,000 tons of nitrogen and 41,000 tons of phosphorus. The principal nutrient sources were wastewater-treatment plants, fertilizer and manure applications, and atmospheric deposition. To characterize nutrient concentrations and loads in the South Platte River during different seasons, five nutrient synoptic samplings were conducted during 1994 and 1995. Upstream from Denver, Colorado, during April 1994 and January 1995, total nitrogen concentrations were less than 2 milligrams per liter (mg/L), and total phosphorus concentrations were less than 0.2 mg/L. The water in the river at this point was derived mostly from forested land in the mountains west of Denver. Total nutrient concentrations increased through the Denver metropolitan area, and concentration peaks occurred just downstream from each of Denver's largest wastewater-treatment plants with maximum concentrations of 13.6 mg/L total nitrogen and 2.4 mg/L total phosphorus. Nutrient concen- concentrations generally decreased downstream from Denver. Upstream from Denver during April 1994 and January 1995, total nitrogen loads were less than 1,000 pounds per day (lb/d), and total phosphorus loads were less than 125 lb/d. Total nutrient loads increased through the Denver metropolitan area, and load peaks occurred just downstream from each of Denver's largest wastewater-treatment plants, with a maximum load of 14,000 lb/d total nitrogen and 2,300 lb/d total phosphorus. In April 1994, nutrient loads generally decreased from Henderson, Colorado, to North Platte, Nebraska. In January 1995, however, nutrient loads increased from Henderson to Kersey, Colorado (maximum loads of 31,000 lb/d total nitrogen and 3,000 lb/d total phosphorus), and then decreased from Kersey to North Platte. Seasonal nutrient loads primarily were dependent on streamflow. Total nitrogen loads were largest in June 1994 and January 1995 when streamflows also were largest. During June, streamflow was large, but nitrogen concentrations were small, which indicated that snowmelt runoff diluted the available supply of nitrogen. Total phosphorus loads were largest in June, when streamflow and phosphorus concentrations were large, which indicated an additional source of phosphorus during snowmelt runoff. Streamflow along the South Platte River was smallest in April and August 1994, and nutrient loads also were smallest during these months. The downstream pattern for nutrient loads did not vary much by season. Loads were large at Henderson, decreased between Henderson and Kersey, and usually were largest at Kersey. The magnitude of the decrease in loads between Henderson and Kersey varied between synoptics and was dependent on the amount of water removed by irrigation ditches. Nutrient loads leaving the basin were very small compared to the estimated total nutrient inputs to the basin. Streamflow balances indicated that the South Platte River is a gaining river throughout much of its length; streamflow-balance residuals were as large as 15 cubic feet per second per mile. Nutrient-load balances indicated that increases in river nitrate loads were, in some places, due to nitrification and, elsewhere, were due to the influx of nitrate-enriched ground water to

Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12.

PubMed

Zúñiga-Navarrete, Fernando; Gómez, Isabel; Peña, Guadalupe; Amaro, Itzel; Ortíz, Ernesto; Becerril, Baltazar; Ibarra, Jorge E; Bravo, Alejandra; Soberón, Mario

2015-04-01

Bacillus thuringiensis Cry toxins exert their toxic effect by specific recognition of larval midgut proteins leading to oligomerization of the toxin, membrane insertion and pore formation. The exposed domain II loop regions of Cry toxins have been shown to be involved in receptor binding. Insect cadherins have shown to be functionally involved in toxin binding facilitating toxin oligomerization. Here, we isolated a VHH (VHHA5) antibody by phage display that binds Cry3Aa loop 1 and competed with the binding of Cry3Aa to Tenebrio molitor brush border membranes. VHHA5 also competed with the binding of Cry3Aa to a cadherin fragment (CR12) that was previously shown to be involved in binding and toxicity of Cry3Aa, indicating that Cry3Aa binds CR12 through domain II loop 1. Moreover, we show that a loop 1 mutant, previously characterized to have increased toxicity to T. molitor, displayed a correlative enhanced binding affinity to T. molitor CR12 and to VHHA5. These results show that Cry3Aa domain II loop 1 is a binding site of CR12 T. molitor cadherin. Copyright © 2015 Elsevier Ltd. All rights reserved.

Evaluation of Novel Design Strategies for Developing Zinc Finger Nucleases Tools for Treating Human Diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bach, Christian; Sherman, William; Pallis, Jani

Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less

Evaluation of Novel Design Strategies for Developing Zinc Finger Nucleases Tools for Treating Human Diseases

DOE PAGES

Bach, Christian; Sherman, William; Pallis, Jani; ...

2014-01-01

Zinc finger nucleases (ZFNs) are associated with cell death and apoptosis by binding at countless undesired locations. This cytotoxicity is associated with the binding ability of engineered zinc finger domains to bind dissimilar DNA sequences with high affinity. In general, binding preferences of transcription factors are associated with significant degenerated diversity and complexity which convolutes the design and engineering of precise DNA binding domains. Evolutionary success of natural zinc finger proteins, however, evinces that nature created specific evolutionary traits and strategies, such as modularity and rank-specific recognition to cope with binding complexity that are critical for creating clinical viable toolsmore » to precisely modify the human genome. Our findings indicate preservation of general modularity and significant alteration of the rank-specific binding preferences of the three-finger binding domain of transcription factor SP1 when exchanging amino acids in the 2nd finger.« less

H3K9me2/3 Binding of the MBT Domain Protein LIN-61 Is Essential for Caenorhabditis elegans Vulva Development

PubMed Central

Koester-Eiserfunke, Nora; Fischle, Wolfgang

2011-01-01

MBT domain proteins are involved in developmental processes and tumorigenesis. In vitro binding and mutagenesis studies have shown that individual MBT domains within clustered MBT repeat regions bind mono- and dimethylated histone lysine residues with little to no sequence specificity but discriminate against the tri- and unmethylated states. However, the exact function of promiscuous histone methyl-lysine binding in the biology of MBT domain proteins has not been elucidated. Here, we show that the Caenorhabditis elegans four MBT domain protein LIN-61, in contrast to other MBT repeat factors, specifically interacts with histone H3 when methylated on lysine 9, displaying a strong preference for di- and trimethylated states (H3K9me2/3). Although the fourth MBT repeat is implicated in this interaction, H3K9me2/3 binding minimally requires MBT repeats two to four. Further, mutagenesis of residues conserved with other methyl-lysine binding MBT regions in the fourth MBT repeat does not abolish interaction, implicating a distinct binding mode. In vivo, H3K9me2/3 interaction of LIN-61 is required for C. elegans vulva development within the synMuvB pathway. Mutant LIN-61 proteins deficient in H3K9me2/3 binding fail to rescue lin-61 synMuvB function. Also, previously identified point mutant synMuvB alleles are deficient in H3K9me2/3 interaction although these target residues that are outside of the fourth MBT repeat. Interestingly, lin-61 genetically interacts with two other synMuvB genes, hpl-2, an HP1 homologous H3K9me2/3 binding factor, and met-2, a SETDB1 homologous H3K9 methyl transferase (H3K9MT), in determining C. elegans vulva development and fertility. Besides identifying the first sequence specific and di-/trimethylation binding MBT domain protein, our studies imply complex multi-domain regulation of ligand interaction of MBT domains. Our results also introduce a mechanistic link between LIN-61 function and biology, and they establish interplay of the H3K9me2/3 binding proteins, LIN-61 and HPL-2, as well as the H3K9MT MET-2 in distinct developmental pathways. PMID:21437264

Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain.

PubMed Central

Stevenson, S C; Rollence, M; White, B; Weaver, L; McClelland, A

1995-01-01

The adenovirus fiber protein is responsible for attachment of the virion to cell surface receptors. The identity of the cellular receptor which mediates binding is unknown, although there is evidence suggesting that two distinct adenovirus receptors interact with the group C (adenovirus type 5 [Ad5]) and the group B (Ad3) adenoviruses. In order to define the determinants of adenovirus receptor specificity, we have carried out a series of competition binding experiments using recombinant native fiber polypeptides from Ad5 and Ad3 and chimeric fiber proteins in which the head domains of Ad5 and Ad3 were exchanged. Specific binding of fiber to HeLa cell receptors was assessed with radiolabeled protein synthesized in vitro, and by competition analysis with baculovirus-expressed fiber protein. Fiber produced in vitro was found as both monomer and trimer, but only the assembled trimers had receptor binding activity. Competition data support the conclusion that Ad5 and Ad3 interact with different cellular receptors. The Ad5 receptor distribution on several cell lines was assessed with a fiber binding flow cytometric assay. HeLa cells were found to express high levels of receptor, while CHO and human diploid fibroblasts did not. A chimeric fiber containing the Ad5 fiber head domain blocked the binding of Ad5 fiber but not Ad3 fiber. Similarly, a chimeric fiber containing the Ad3 fiber head blocked the binding of labeled Ad3 fiber but not Ad5 fiber. In addition, the isolated Ad3 fiber head domain competed effectively with labeled Ad3 fiber for binding to HeLa cell receptors. These results demonstrate that the determinants of receptor binding are located in the head domain of the fiber and that the isolated head domain is capable of trimerization and binding to cellular receptors. Our results also show that it is possible to change the receptor specificity of the fiber protein by manipulation of sequences contained in the head domain. Modification or replacement of the fiber head domain with novel ligands may permit adenovirus vectors with new receptor specificities which could be useful for targeted gene delivery in vivo to be engineered. PMID:7707507