Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015

NASA Astrophysics Data System (ADS)

Deng, Nanjie; Flynn, William F.; Xia, Junchao; Vijayan, R. S. K.; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M.

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Nucleotide-dependent conformational states of actin

PubMed Central

Pfaendtner, Jim; Branduardi, Davide; Parrinello, Michele; Pollard, Thomas D.; Voth, Gregory A.

2009-01-01

The influence of the state of the bound nucleotide (ATP, ADP-Pi, or ADP) on the conformational free-energy landscape of actin is investigated. Nucleotide-dependent folding of the DNase-I binding (DB) loop in monomeric actin and the actin trimer is carried out using all-atom molecular dynamics (MD) calculations accelerated with a multiscale implementation of the metadynamics algorithm. Additionally, an investigation of the opening and closing of the actin nucleotide binding cleft is performed. Nucleotide-dependent free-energy profiles for all of these conformational changes are calculated within the framework of metadynamics. We find that in ADP-bound monomer, the folded and unfolded states of the DB loop have similar relative free-energy. This result helps explain the experimental difficulty in obtaining an ordered crystal structure for this region of monomeric actin. However, we find that in the ADP-bound actin trimer, the folded DB loop is stable and in a free-energy minimum. It is also demonstrated that the nucleotide binding cleft favors a closed conformation for the bound nucleotide in the ATP and ADP-Pi states, whereas the ADP state favors an open confirmation, both in the monomer and trimer. These results suggest a mechanism of allosteric interactions between the nucleotide binding cleft and the DB loop. This behavior is confirmed by an additional simulation that shows the folding free-energy as a function of the nucleotide cleft width, which demonstrates that the barrier for folding changes significantly depending on the value of the cleft width. PMID:19620726

Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations

PubMed Central

Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M.

2011-01-01

The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on λ -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

Virtual screening using molecular simulations.

PubMed

Yang, Tianyi; Wu, Johnny C; Yan, Chunli; Wang, Yuanfeng; Luo, Ray; Gonzales, Michael B; Dalby, Kevin N; Ren, Pengyu

2011-06-01

Effective virtual screening relies on our ability to make accurate prediction of protein-ligand binding, which remains a great challenge. In this work, utilizing the molecular-mechanics Poisson-Boltzmann (or Generalized Born) surface area approach, we have evaluated the binding affinity of a set of 156 ligands to seven families of proteins, trypsin β, thrombin α, cyclin-dependent kinase (CDK), cAMP-dependent kinase (PKA), urokinase-type plasminogen activator, β-glucosidase A, and coagulation factor Xa. The effect of protein dielectric constant in the implicit-solvent model on the binding free energy calculation is shown to be important. The statistical correlations between the binding energy calculated from the implicit-solvent approach and experimental free energy are in the range of 0.56-0.79 across all the families. This performance is better than that of typical docking programs especially given that the latter is directly trained using known binding data whereas the molecular mechanics is based on general physical parameters. Estimation of entropic contribution remains the barrier to accurate free energy calculation. We show that the traditional rigid rotor harmonic oscillator approximation is unable to improve the binding free energy prediction. Inclusion of conformational restriction seems to be promising but requires further investigation. On the other hand, our preliminary study suggests that implicit-solvent based alchemical perturbation, which offers explicit sampling of configuration entropy, can be a viable approach to significantly improve the prediction of binding free energy. Overall, the molecular mechanics approach has the potential for medium to high-throughput computational drug discovery. Copyright © 2011 Wiley-Liss, Inc.

Target Z dependence of Xe L x-ray emission in heavy ion-atom collision near the Bohr velocity: influence of level matching

NASA Astrophysics Data System (ADS)

Ren, Jieru; Zhao, Yongtao; Zhou, Xianming; Cheng, Rui; Lei, Yu; Sun, Yuanbo; Wang, Xing; Xu, Ge; Wang, Yuyu; Liu, Shidong; Yu, Yang; Li, Yongfeng; Zhang, Xiaoan; Xu, Zhongfeng; Xiao, Guoqing

2013-09-01

X-ray yields for the projectile L-shell have been measured for collisions between Xe20+ and thick solid targets throughout the periodic table with incident energies near the Bohr velocity. The yields show a very pronounced cyclic dependence on the target atomic number. This result indicates that Xe L x-ray emission intensity is greatly enhanced either in near-symmetric collisions or if the binding energy of the Xe M-shell matches the L- or N-shell binding energy of the target.

pH-selective mutagenesis of protein-protein interfaces: in silico design of therapeutic antibodies with prolonged half-life.

PubMed

Spassov, Velin Z; Yan, Lisa

2013-04-01

Understanding the effects of mutation on pH-dependent protein binding affinity is important in protein design, especially in the area of protein therapeutics. We propose a novel method for fast in silico mutagenesis of protein-protein complexes to calculate the effect of mutation as a function of pH. The free energy differences between the wild type and mutants are evaluated from a molecular mechanics model, combined with calculations of the equilibria of proton binding. The predicted pH-dependent energy profiles demonstrate excellent agreement with experimentally measured pH-dependency of the effect of mutations on the dissociation constants for the complex of turkey ovomucoid third domain (OMTKY3) and proteinase B. The virtual scanning mutagenesis identifies all hotspots responsible for pH-dependent binding of immunoglobulin G (IgG) to neonatal Fc receptor (FcRn) and the results support the current understanding of the salvage mechanism of the antibody by FcRn based on pH-selective binding. The method can be used to select mutations that change the pH-dependent binding profiles of proteins and guide the time consuming and expensive protein engineering experiments. As an application of this method, we propose a computational strategy to search for mutations that can alter the pH-dependent binding behavior of IgG to FcRn with the aim of improving the half-life of therapeutic antibodies in the target organism. Copyright © 2013 Wiley Periodicals, Inc.

Onset of η-meson binding in the He isotopes

NASA Astrophysics Data System (ADS)

Barnea, N.; Friedman, E.; Gal, A.

2017-12-01

The onset of binding η (548) mesons in nuclei is studied in the He isotopes by doing precise ηNNN and ηNNNN few-body stochastic variational method calculations for two semi-realistic NN potentials and two energy dependent ηN potentials derived from coupled-channel models of the N* (1535) nucleon resonance. The energy dependence of the ηN subthreshold input is treated self consistently. It is found that a minimal value of the real part of the ηN scattering length aηN close to 1 fm is required to bind η mesons in 3He, yielding then a few MeV η binding in 4He. The onset of η-meson binding in 4He requires that Re aηN exceeds 0.7 fm approximately. These results compare well with results of recent ηNNN and ηNNNN pionless effective field theory calculations. Related optical-model calculations are also discussed.

Free-energy relationships in ion channels activated by voltage and ligand

PubMed Central

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Electronic and optical properties of exciton, trions and biexciton in II-VI parabolic quantum dot

NASA Astrophysics Data System (ADS)

Sujanah, P.; John Peter, A.; Woo Lee, Chang

2015-08-01

Binding energies of exciton, trions and biexciton and their interband optical transition energies are studied in a CdTe/ZnTe quantum dot nanostructure taking into consideration the geometrical confinement effect. The radial spread of the wavefunctions, binding energies, optical transition energies, oscillator strength, radiative life time and the absorption coefficients of exciton, positively and negatively charged excitons and biexciton are carried out. It is found that the ratio of the radiative life time of exciton with the trions and biexciton enhances with the reduction of geometrical confinement. The results show that (i) the binding energies of exciton, positive and negative trions and the biexciton have strong influence on the reduction of geometrical confinement effect, (ii) the binding energy is found to decrease from the binding energies of exciton to positive trion through biexciton and negative trion binding energies, (iii) the oscillator strength of trions is found to be lesser than exciton and the biexciton and (iv) the electronic and optical properties of exciton, trions and the biexciton are considerably dependent on the spatial confinement, incident photon energy and the radiative life time. The obtained results are in good agreement with the other existing literature.

Curvature Dependent Reactivity of Fullerenes and Nanotubes

NASA Technical Reports Server (NTRS)

Park, Seongjun; Cho, Kyeongjae; Srivastava, Deepak

2000-01-01

Dependence of pyramidalization angle, examples of nanotube surfaces, internal and external reactivity, and binding energies are some of the topics discussed in this conference presentation preprint. Final conclusions include the relationship between the pyramidal angle of the surface and its associated external reaction energy.

Hydrogenic impurity bound polaron in an anisotropic quantum dot

NASA Astrophysics Data System (ADS)

Chen, Shi-Hua

2018-01-01

The effect of the electron-phonon interaction on an electron bound to a hydrogenic impurity in a three-dimensional (3D) anisotropic quantum dot (QD) is studied theoretically. We use the Landau-Pekar variational approach to calculate the binding energy of ground state (GS) and first-excited state (ES) with considering electron-phonon interaction. The expressions of the GS and ES energies under investigation depict a rich variety of dependent relationship with the variational parameters in three different limiting cases. Numerical calculations were performed for ZnSe QDs with different confinement lengths in the xy-plane and the z-direction, respectively. It is illustrated that binding energies of impurity polarons corresponding to each level are larger in small QDs. Furthermore, the contribution to binding energy from phonon is about 15% of the total binding energy.

How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

PubMed

Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

2015-06-09

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

Simulation of Reversible Protein–Protein Binding and Calculation of Binding Free Energies Using Perturbed Distance Restraints

PubMed Central

2017-01-01

Virtually all biological processes depend on the interaction between proteins at some point. The correct prediction of biomolecular binding free-energies has many interesting applications in both basic and applied pharmaceutical research. While recent advances in the field of molecular dynamics (MD) simulations have proven the feasibility of the calculation of protein–protein binding free energies, the large conformational freedom of proteins and complex free energy landscapes of binding processes make such calculations a difficult task. Moreover, convergence and reversibility of resulting free-energy values remain poorly described. In this work, an easy-to-use, yet robust approach for the calculation of standard-state protein–protein binding free energies using perturbed distance restraints is described. In the binding process the conformations of the proteins were restrained, as suggested earlier. Two approaches to avoid end-state problems upon release of the conformational restraints were compared. The method was evaluated by practical application to a small model complex of ubiquitin and the very flexible ubiquitin-binding domain of human DNA polymerase ι (UBM2). All computed free energy differences were closely monitored for convergence, and the calculated binding free energies had a mean unsigned deviation of only 1.4 or 2.5 kJ·mol–1 from experimental values. Statistical error estimates were in the order of thermal noise. We conclude that the presented method has promising potential for broad applicability to quantitatively describe protein–protein and various other kinds of complex formation. PMID:28898077

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

PubMed

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Quantum mechanics/molecular mechanics modeling of photoelectron spectra: the carbon 1s core-electron binding energies of ethanol-water solutions.

PubMed

Löytynoja, T; Niskanen, J; Jänkälä, K; Vahtras, O; Rinkevicius, Z; Ågren, H

2014-11-20

Using ethanol-water solutions as illustration, we demonstrate the capability of the hybrid quantum mechanics/molecular mechanics (QM/MM) paradigm to simulate core photoelectron spectroscopy: the binding energies and the chemical shifts. An integrated approach with QM/MM binding energy calculations coupled to preceding molecular dynamics sampling is adopted to generate binding energies averaged over the solute-solvent configurations available at a particular temperature and pressure and thus allowing for a statistical assessment with confidence levels for the final binding energies. The results are analyzed in terms of the contributions in the molecular mechanics model-electrostatic, polarization, and van der Waals-with atom or bond granulation of the corresponding MM charge and polarizability force-fields. The role of extramolecular charge transfer screening of the core-hole and explicit hydrogen bonding is studied by extending the QM core to cover the first solvation shell. The results are compared to those obtained from pure electrostatic and polarizable continuum models. Particularly, the dependence of the carbon 1s binding energies with respect to the ethanol concentration is studied. Our results indicate that QM/MM can be used as an all-encompassing model to study photoelectron binding energies and chemical shifts in solvent environments.

Exciton size and binding energy limitations in one-dimensional organic materials.

PubMed

Kraner, S; Scholz, R; Plasser, F; Koerner, C; Leo, K

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent density functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.

Binding energy of the donor impurities in GaAs-Ga 1- x Al x As quantum well wires with Morse potential in the presence of electric and magnetic fields

NASA Astrophysics Data System (ADS)

Aciksoz, Esra; Bayrak, Orhan; Soylu, Asim

2016-10-01

The behavior of a donor in the GaAs-Ga1-x Al x As quantum well wire represented by the Morse potential is examined within the framework of the effective-mass approximation. The donor binding energies are numerically calculated for with and without the electric and magnetic fields in order to show their influence on the binding energies. Moreover, how the donor binding energies change for the constant potential parameters (D e, r e, and a) as well as with the different values of the electric and magnetic field strengths is determined. It is found that the donor binding energy is highly dependent on the external electric and magnetic fields as well as parameters of the Morse potential. Project supported by the Turkish Science Research Council (TÜBİTAK) and the Financial Supports from Akdeniz and Nigde Universities.

Polarizability and binding energy of a shallow donor in spherical quantum dot-quantum well (QD-QW)

NASA Astrophysics Data System (ADS)

Rahmani, K.; Chrafih, Y.; M’Zred, S.; Janati, S.; Zorkani, I.; Jorio, A.; Mmadi, A.

2018-03-01

The polarizability and the binding energy is estimated for a shallow donor confined to move in inhomogeneous quantum dots (CdS/HgS/CdS). In this work, the Hass variational method within the effective mass approximation in used in the case of an infinitely deep well. The polarizability and the binding energy depend on the inner and the outer radius of the QDQW, also it depends strongly on the donor position. It’s found that the stark effect is more important when the impurity is located at the center of the (QDQW) and becomes less important when the donor moves toward the extremities of the spherical layer. When the electric field increases, the binding energy and the polarizability decreases. Its effects is more pronounced when the impurity is placed on the center of the spherical layer and decrease when the donor move toward extremities of this spherical layer. We have demonstrated the existence of a critical value {≤ft( {{{{R_1}} \\over {{R_2}}}} \\right)cri} which can be used to distinguish the tree dimension confinement from the spherical surface confinement and it’s may be important for the nanofabrication techniques.

First-principles study of the binding energy between nanostructures and its scaling with system size

NASA Astrophysics Data System (ADS)

Tao, Jianmin; Jiao, Yang; Mo, Yuxiang; Yang, Zeng-Hui; Zhu, Jian-Xin; Hyldgaard, Per; Perdew, John P.

2018-04-01

The equilibrium van der Waals binding energy is an important factor in the design of materials and devices. However, it presents great computational challenges for materials built up from nanostructures. Here we investigate the binding-energy scaling behavior from first-principles calculations. We show that the equilibrium binding energy per atom between identical nanostructures can scale up or down with nanostructure size, but can be parametrized for large N with an analytical formula (in meV/atom), Eb/N =a +b /N +c /N2+d /N3 , where N is the number of atoms in a nanostructure and a , b , c , and d are fitting parameters, depending on the properties of a nanostructure. The formula is consistent with a finite large-size limit of binding energy per atom. We find that there are two competing factors in the determination of the binding energy: Nonadditivities of van der Waals coefficients and center-to-center distance between nanostructures. To decode the detail, the nonadditivity of the static multipole polarizability is investigated from an accurate spherical-shell model. We find that the higher-order multipole polarizability displays ultrastrong intrinsic nonadditivity, no matter if the dipole polarizability is additive or not.

Glycine Hinges with Opposing Actions at the Acetylcholine Receptor-Channel Transmitter Binding SiteS⃞

PubMed Central

Purohit, Prasad

2011-01-01

The extent to which agonists activate synaptic receptor-channels depends on both the intrinsic tendency of the unliganded receptor to open and the amount of agonist binding energy realized in the channel-opening process. We examined mutations of the nicotinic acetylcholine receptor transmitter binding site (α subunit loop B) with regard to both of these parameters. αGly147 is an “activation” hinge where backbone flexibility maintains high values for intrinsic gating, the affinity of the resting conformation for agonists and net ligand binding energy. αGly153 is a “deactivation” hinge that maintains low values for these parameters. αTrp149 (between these two glycines) serves mainly to provide ligand binding energy for gating. We propose that a concerted motion of the two glycine hinges (plus other structural elements at the binding site) positions αTrp149 so that it provides physiologically optimal binding and gating function at the nerve-muscle synapse. PMID:21115636

Exciton size and binding energy limitations in one-dimensional organic materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraner, S., E-mail: stefan.kraner@iapp.de; Koerner, C.; Leo, K.

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent densitymore » functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.« less

The effect of magnetic field on the impurity binding energy of shallow donor impurities in a Ga1−xInxNyAs1−y/GaAs quantum well

PubMed Central

2012-01-01

Using a variational approach, we have investigated the effects of the magnetic field, the impurity position, and the nitrogen and indium concentrations on impurity binding energy in a Ga1−xInxNyAs1−y/GaAs quantum well. Our calculations have revealed the dependence of impurity binding on the applied magnetic field, the impurity position, and the nitrogen and indium concentrations. PMID:23095253

Robust tunable excitonic features in monolayer transition metal dichalcogenide quantum dots

NASA Astrophysics Data System (ADS)

Fouladi-Oskouei, J.; Shojaei, S.; Liu, Z.

2018-04-01

The effects of quantum confinement on excitons in parabolic quantum dots of monolayer transition metal dichalcogenides (TMDC QDs) are investigated within a massive Dirac fermion model. A giant spin-valley coupling of the TMDC QDs is obtained, larger than that of monolayer TMDC sheets and consistent with recent experimental measurements. The exciton transition energy and the binding energy are calculated, and it is found that the strong quantum confinement results in extremely high exciton binding energies. The enormously large exciton binding energy in TMDC QDs (({{E}{{B2D}}}∼ 500 meV)<{{E}{{BQD}}}~≲ 1800 meV for different kinds of TMDC QDs) ensures that the many body interactions play a significant role in the investigation of the optical properties of these novel nanostructures. The estimated oscillator strength and radiative lifetime of excitons are strongly size-dependent and indicate a giant oscillator strength enhancement and ultrafast radiative annihilation of excitons, varying from a few tens of femtoseconds to a few picoseconds. We found that the spin-dependent band gap, spin-valley coupling, binding energy and excitonic effects can be tuned by quantum confinements, leading to tunable quantum dots in monolayer TMDCs. This finding offers new functionality in engineering the interaction of a 2D material with light and creates promise for the quantum manipulation of spin and valley degrees of freedom in TMDC nanostructures, enabling versatile novel 2D quantum photonic and optoelectronic nanodevices.

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Dominant Alcohol-Protein Interaction via Hydration-Enabled Enthalpy-Driven Binding Mechanism

PubMed Central

Chong, Yuan; Kleinhammes, Alfred; Tang, Pei; Xu, Yan; Wu, Yue

2015-01-01

Water plays an important role in weak associations of small drug molecules with proteins. Intense focus has been on binding-induced structural changes in the water network surrounding protein binding sites, especially their contributions to binding thermodynamics. However, water is also tightly coupled to protein conformations and dynamics, and so far little is known about the influence of water-protein interactions on ligand binding. Alcohols are a type of low-affinity drugs, and it remains unclear how water affects alcohol-protein interactions. Here, we present alcohol adsorption isotherms under controlled protein hydration using in-situ NMR detection. As functions of hydration level, Gibbs free energy, enthalpy, and entropy of binding were determined from the temperature dependence of isotherms. Two types of alcohol binding were found. The dominant type is low-affinity nonspecific binding, which is strongly dependent on temperature and the level of hydration. At low hydration levels, this nonspecific binding only occurs above a threshold of alcohol vapor pressure. An increased hydration level reduces this threshold, with it finally disappearing at a hydration level of h~0.2 (g water/g protein), gradually shifting alcohol binding from an entropy-driven to an enthalpy-driven process. Water at charged and polar groups on the protein surface was found to be particularly important in enabling this binding. Although further increase in hydration has smaller effects on the changes of binding enthalpy and entropy, it results in significant negative change in Gibbs free energy due to unmatched enthalpy-entropy compensation. These results show the crucial role of water-protein interplay in alcohol binding. PMID:25856773

Understanding the physical basis of the salt dependence of the electrostatic binding free energy of mutated charged ligand-nucleic acid complexes.

PubMed

Harris, Robert C; Bredenberg, Johan H; Silalahi, Alexander R J; Boschitsch, Alexander H; Fenley, Marcia O

2011-06-01

The predictions of the derivative of the electrostatic binding free energy of a biomolecular complex, ΔG(el), with respect to the logarithm of the 1:1 salt concentration, d(ΔG(el))/d(ln[NaCl]), SK, by the Poisson-Boltzmann equation, PBE, are very similar to those of the simpler Debye-Hückel equation, DHE, because the terms in the PBE's predictions of SK that depend on the details of the dielectric interface are small compared to the contributions from long-range electrostatic interactions. These facts allow one to obtain predictions of SK using a simplified charge model along with the DHE that are highly correlated with both the PBE and experimental binding data. The DHE-based model developed here, which was derived from the generalized Born model, explains the lack of correlation between SK and ΔG(el) in the presence of a dielectric discontinuity, which conflicts with the popular use of this supposed correlation to parse experimental binding free energies into electrostatic and nonelectrostatic components. Moreover, the DHE model also provides a clear justification for the correlations between SK and various empirical quantities, like the number of ion pairs, the ligand charge on the interface, the Coulomb binding free energy, and the product of the charges on the complex's components, but these correlations are weak, questioning their usefulness. Copyright © 2011 Elsevier B.V. All rights reserved.

Concentration-dependent Cu(II) binding to prion protein

NASA Astrophysics Data System (ADS)

Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry

2008-03-01

The prion protein plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The normal function of the prion protein is unknown, but it has been linked to its ability to bind copper ions. Experimental evidence suggests that copper can be bound in three distinct modes depending on its concentration, but only one of those binding modes has been fully characterized experimentally. Using a newly developed hybrid DFT/DFT method [1], which combines Kohn-Sham DFT with orbital-free DFT, we have examined all the binding modes and obtained their detailed binding geometries and copper ion binding energies. Our results also provide explanation for experiments, which have found that when the copper concentration increases the copper binding mode changes, surprisingly, from a stronger to a weaker one. Overall, our results indicate that prion protein can function as a copper buffer. 1. Hodak, Lu, Bernholc, JCP, in press.

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

PubMed

Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

2015-08-01

Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

Magnetic quantization in monolayer bismuthene

NASA Astrophysics Data System (ADS)

Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

Binding energy and photoionization cross-section of hydrogen-like donor impurity in strongly oblate ellipsoidal quantum dot

NASA Astrophysics Data System (ADS)

Hayrapetyan, D. B.; Ohanyan, G. L.; Baghdasaryan, D. A.; Sarkisyan, H. A.; Baskoutas, S.; Kazaryan, E. M.

2018-01-01

Hydrogen-like donor impurity states in strongly oblate ellipsoidal quantum dot have been studied. The hydrogen-like donor impurity states are investigated within the framework of variational method. The trial wave function constructed on the base of wave functions of the system without impurity. The dependence of the energy and binding energy for the ground and first excited states on the geometrical parameters of the ellipsoidal quantum dot and on the impurity position have been calculated. The behavior of the oscillator strength for different angles of incident light and geometrical parameters have been revealed. Photoionization cross-section of the electron transitions from the impurity ground state to the size-quantized ground and first excited states have been studied. The effects of impurity position and the geometrical parameters of the ellipsoidal quantum dot on the photoionization cross section dependence on the photon energy have been considered.

New Parameters for Higher Accuracy in the Computation of Binding Free Energy Differences upon Alanine Scanning Mutagenesis on Protein-Protein Interfaces.

PubMed

Simões, Inês C M; Costa, Inês P D; Coimbra, João T S; Ramos, Maria J; Fernandes, Pedro A

2017-01-23

Knowing how proteins make stable complexes enables the development of inhibitors to preclude protein-protein (P:P) binding. The identification of the specific interfacial residues that mostly contribute to protein binding, denominated as hot spots, is thus critical. Here, we refine an in silico alanine scanning mutagenesis protocol, based on a residue-dependent dielectric constant version of the Molecular Mechanics/Poisson-Boltzmann Surface Area method. We have used a large data set of structurally diverse P:P complexes to redefine the residue-dependent dielectric constants used in the determination of binding free energies. The accuracy of the method was validated through comparison with experimental data, considering the per-residue P:P binding free energy (ΔΔG binding ) differences upon alanine mutation. Different protocols were tested, i.e., a geometry optimization protocol and three molecular dynamics (MD) protocols: (1) one using explicit water molecules, (2) another with an implicit solvation model, and (3) a third where we have carried out an accelerated MD with explicit water molecules. Using a set of protein dielectric constants (within the range from 1 to 20) we showed that the dielectric constants of 7 for nonpolar and polar residues and 11 for charged residues (and histidine) provide optimal ΔΔG binding predictions. An overall mean unsigned error (MUE) of 1.4 kcal mol -1 relative to the experiment was achieved in 210 mutations only with geometry optimization, which was further reduced with MD simulations (MUE of 1.1 kcal mol -1 for the MD employing explicit solvent). This recalibrated method allows for a better computational identification of hot spots, avoiding expensive and time-consuming experiments or thermodynamic integration/ free energy perturbation/ uBAR calculations, and will hopefully help new drug discovery campaigns in their quest of searching spots of interest for binding small drug-like molecules at P:P interfaces.

Accurate, robust and reliable calculations of Poisson-Boltzmann binding energies

PubMed Central

Nguyen, Duc D.; Wang, Bao

2017-01-01

Poisson-Boltzmann (PB) model is one of the most popular implicit solvent models in biophysical modeling and computation. The ability of providing accurate and reliable PB estimation of electrostatic solvation free energy, ΔGel, and binding free energy, ΔΔGel, is important to computational biophysics and biochemistry. In this work, we investigate the grid dependence of our PB solver (MIBPB) with SESs for estimating both electrostatic solvation free energies and electrostatic binding free energies. It is found that the relative absolute error of ΔGel obtained at the grid spacing of 1.0 Å compared to ΔGel at 0.2 Å averaged over 153 molecules is less than 0.2%. Our results indicate that the use of grid spacing 0.6 Å ensures accuracy and reliability in ΔΔGel calculation. In fact, the grid spacing of 1.1 Å appears to deliver adequate accuracy for high throughput screening. PMID:28211071

Crown oxygen-doping graphene with embedded main-group metal atoms

NASA Astrophysics Data System (ADS)

Wu, Liyuan; Wang, Qian; Yang, Chuanghua; Quhe, Ruge; Guan, Pengfei; Lu, Pengfei

2018-02-01

Different main-group metal atoms embedded in crown oxygen-doping graphene (metal@OG) systems are studied by the density functional theory. The binding energies and electronic structures are calculated by using first-principles calculations. The binding energy of metal@OG system mainly depends on the electronegativity of the metal atom. The lower the value of the electronegativity, the larger the binding energy, indicating the more stable the system. The electronic structure of metal@OG arouses the emergence of bandgap and shift of Dirac point. It is shown that interaction between metal atom and crown oxygen-doping graphene leads to the graphene's stable n-doping, and the metal@OG systems are stable semiconducting materials, which can be used in technological applications.

Computational Calorimetry: High-Precision Calculation of Host–Guest Binding Thermodynamics

PubMed Central

2015-01-01

We present a strategy for carrying out high-precision calculations of binding free energy and binding enthalpy values from molecular dynamics simulations with explicit solvent. The approach is used to calculate the thermodynamic profiles for binding of nine small molecule guests to either the cucurbit[7]uril (CB7) or β-cyclodextrin (βCD) host. For these systems, calculations using commodity hardware can yield binding free energy and binding enthalpy values with a precision of ∼0.5 kcal/mol (95% CI) in a matter of days. Crucially, the self-consistency of the approach is established by calculating the binding enthalpy directly, via end point potential energy calculations, and indirectly, via the temperature dependence of the binding free energy, i.e., by the van’t Hoff equation. Excellent agreement between the direct and van’t Hoff methods is demonstrated for both host–guest systems and an ion-pair model system for which particularly well-converged results are attainable. Additionally, we find that hydrogen mass repartitioning allows marked acceleration of the calculations with no discernible cost in precision or accuracy. Finally, we provide guidance for accurately assessing numerical uncertainty of the results in settings where complex correlations in the time series can pose challenges to statistical analysis. The routine nature and high precision of these binding calculations opens the possibility of including measured binding thermodynamics as target data in force field optimization so that simulations may be used to reliably interpret experimental data and guide molecular design. PMID:26523125

On the use of nonfluorescent dye labeled ligands in FRET-based receptor binding studies.

PubMed

Tahtaoui, Chouaib; Guillier, Fabrice; Klotz, Philippe; Galzi, Jean-Luc; Hibert, Marcel; Ilien, Brigitte

2005-12-01

The efficiency of fluorescence resonance energy transfer (FRET) is dependent upon donor-acceptor proximity and spectral overlap, whether the acceptor partner is fluorescent or not. We report here on the design, synthesis, and characterization of two novel pirenzepine derivatives that were coupled to patent blue VF and pinacyanol dyes. These nonfluorescent compounds, when added to cells stably expressing enhanced green fluorescent protein (EGFP)-fused muscarinic M1 receptors, promote EGFP fluorescence extinction in a time-, concentration-, and atropine-dependent manner. They display nanomolar affinity for the muscarinic receptor, determined using either FRET or classical radioligand binding conditions. We provide evidence that these compounds behave as potent acceptors of energy from excited EGFP with quenching efficiencies comparable to those of analogous fluorescent bodipy or rhodamine red pirenzepine derivatives. The advantages they offer over fluorescent ligands are illustrated and discussed in terms of reliability, sensitivity, and wider applicability of FRET-based receptor binding assays.

High-resolution photoluminescence spectroscopy of Sn-doped ZnO single crystals

DOE PAGES

Kumar, E. Senthil; Mohammadbeigi, F.; Boatner, Lynn A.; ...

2016-01-01

Here, Group IV donors in ZnO are poorly understood, despite evidence that they are effective n-dopants. We present high-resolution photoluminescence spectroscopy studies of unintentionally doped and Sn doped ZnO single crystals grown by the chemical vapor transport method. Doped samples showed greatly increased emission from the I10 bound exciton transition which was recently proven to be related to the incorporation of Sn impurities based on radio-isotope studies. PL linewidths are exceptionally sharp for these samples, enabling clear identification of several donor species. Temperature dependent PL measurements of the I10 line emission energy and intensity dependence reveal a behavior similar tomore » other shallow donors in ZnO. Ionized donor bound exciton and two electron satellite transitions of the I10 transition are unambiguously identified and yield a donor binding energy of 71 meV. In contrast to recent reports of Ge-related donors in ZnO, the spectroscopic binding energy for the Sn-related donor bound exciton follows a linear relationship with donor binding energy (Haynes rule), confirming the shallow nature of this defect center, which we attribute to a SnZn double donor compensated by an unknown single acceptor.« less

Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

PubMed Central

Raman, E. Prabhu; MacKerell, Alexander D.

2015-01-01

The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

Impact of Many-Body Effects on Landau Levels in Graphene

NASA Astrophysics Data System (ADS)

Sonntag, J.; Reichardt, S.; Wirtz, L.; Beschoten, B.; Katsnelson, M. I.; Libisch, F.; Stampfer, C.

2018-05-01

We present magneto-Raman spectroscopy measurements on suspended graphene to investigate the charge carrier density-dependent electron-electron interaction in the presence of Landau levels. Utilizing gate-tunable magnetophonon resonances, we extract the charge carrier density dependence of the Landau level transition energies and the associated effective Fermi velocity vF. In contrast to the logarithmic divergence of vF at zero magnetic field, we find a piecewise linear scaling of vF as a function of the charge carrier density, due to a magnetic-field-induced suppression of the long-range Coulomb interaction. We quantitatively confirm our experimental findings by performing tight-binding calculations on the level of the Hartree-Fock approximation, which also allow us to estimate an excitonic binding energy of ≈6 meV contained in the experimentally extracted Landau level transitions energies.

Self-energy effect and Coulomb potential modulation of the exciton in monolayer MoS2 on polar substrate

NASA Astrophysics Data System (ADS)

Wang, Zi-Wu; Xiao, Yao; Li, Run-Ze; Li, Wei-Ping; Li, Zhi-Qing

2017-11-01

We theoretically investigate the correction of exciton binding energy in monolayer MoS2 resulting from the exciton couples with surface optical (SO) phonons induced by polar substrate. The total correction of binding energy can be divided into the self-energy effect and modification of Coulomb potential using the unitary transformation method. We find that both the self-energy and Coulomb potential vary from tens of meV to several hundreds of meV depending on the cut-off wave vector of SO phonon modes, polarizability of substrate materials and internal distance between the monolayer MoS2 and polar substrate. An effective Coulomb potential is obtained by combining the modified term into the Coulomb potential. This potentially could be widely used in various two-dimensional materials. Our theoretical results not only propose the ways to externally control the exciton binding energy in experiment, but also enrich the understanding of the exciton properties in the dielectric environment.

Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method

PubMed Central

2011-01-01

Background The reliable and robust estimation of ligand binding affinity continues to be a challenge in drug design. Many current methods rely on molecular mechanics (MM) calculations which do not fully explain complex molecular interactions. Full quantum mechanical (QM) computation of the electronic state of protein-ligand complexes has recently become possible by the latest advances in the development of linear-scaling QM methods such as the ab initio fragment molecular orbital (FMO) method. This approximate molecular orbital method is sufficiently fast that it can be incorporated into the development cycle during structure-based drug design for the reliable estimation of ligand binding affinity. Additionally, the FMO method can be combined with approximations for entropy and solvation to make it applicable for binding affinity prediction for a broad range of target and chemotypes. Results We applied this method to examine the binding affinity for a series of published cyclin-dependent kinase 2 (CDK2) inhibitors. We calculated the binding affinity for 28 CDK2 inhibitors using the ab initio FMO method based on a number of X-ray crystal structures. The sum of the pair interaction energies (PIE) was calculated and used to explain the gas-phase enthalpic contribution to binding. The correlation of the ligand potencies to the protein-ligand interaction energies gained from FMO was examined and was seen to give a good correlation which outperformed three MM force field based scoring functions used to appoximate the free energy of binding. Although the FMO calculation allows for the enthalpic component of binding interactions to be understood at the quantum level, as it is an in vacuo single point calculation, the entropic component and solvation terms are neglected. For this reason a more accurate and predictive estimate for binding free energy was desired. Therefore, additional terms used to describe the protein-ligand interactions were then calculated to improve the correlation of the FMO derived values to experimental free energies of binding. These terms were used to account for the polar and non-polar solvation of the molecule estimated by the Poisson-Boltzmann equation and the solvent accessible surface area (SASA), respectively, as well as a correction term for ligand entropy. A quantitative structure-activity relationship (QSAR) model obtained by Partial Least Squares projection to latent structures (PLS) analysis of the ligand potencies and the calculated terms showed a strong correlation (r2 = 0.939, q2 = 0.896) for the 14 molecule test set which had a Pearson rank order correlation of 0.97. A training set of a further 14 molecules was well predicted (r2 = 0.842), and could be used to obtain meaningful estimations of the binding free energy. Conclusions Our results show that binding energies calculated with the FMO method correlate well with published data. Analysis of the terms used to derive the FMO energies adds greater understanding to the binding interactions than can be gained by MM methods. Combining this information with additional terms and creating a scaled model to describe the data results in more accurate predictions of ligand potencies than the absolute values obtained by FMO alone. PMID:21219630

Calculations of antiproton-nucleus quasi-bound states using the Paris N bar N potential

NASA Astrophysics Data System (ADS)

Hrtánková, Jaroslava; Mareš, Jiří

2018-01-01

An optical potential constructed using the p bar N scattering amplitudes derived from the 2009 version of the Paris N bar N potential is applied in calculations of p bar quasi-bound states in selected nuclei across the periodic table. A proper self-consistent procedure for treating energy dependence of the amplitudes in a nucleus appears crucial for evaluating p bar binding energies and widths. Particular attention is paid to the role of P-wave amplitudes. While the P-wave potential nearly does not affect calculated p bar binding energies, it reduces considerably the corresponding widths. The Paris S-wave potential supplemented by a phenomenological P-wave term yields in dynamical calculations p bar binding energies Bpbar ≈ 200 MeV and widths Γpbar ∼ 200- 230 MeV, which is very close to the values obtained within the RMF model consistent with p bar -atom data.

Cooper-pair size and binding energy for unconventional superconducting systems

NASA Astrophysics Data System (ADS)

Dinóla Neto, F.; Neto, Minos A.; Salmon, Octavio D. Rodriguez

2018-06-01

The main proposal of this paper is to analyze the size of the Cooper pairs composed by unbalanced mass fermions from different electronic bands along the BCS-BEC crossover and study the binding energy of the pairs. We are considering an interaction between fermions with different masses leading to an inter-band pairing. In addiction to the attractive interaction we have an hybridization term to couple both bands, which in general acts unfavorable for the pairing between the electrons. We get first order phase transitions as the hybridization breaks the Cooper pairs for the s-wave symmetry of the gap amplitude. The results show the dependence of the Cooper-pair size as a function of the hybridization for T = 0 . We also propose the structure of the binding energy of the inter-band system as a function of the two-bands quasi-particle energies.

NMR Mapping of Protein Conformational Landscapes using Coordinated Behavior of Chemical Shifts upon Ligand Binding

PubMed Central

Cembran, Alessandro; Kim, Jonggul; Gao, Jiali; Veglia, Gianluigi

2014-01-01

Proteins exist as an ensemble of conformers that are distributed on free energy landscapes resembling folding funnels. While the most stable conformers populate low energy basins, protein function is often carried out through low-populated conformational states that occupy high energy basins. Ligand binding shifts the populations of these states, changing the distribution of these conformers. Understanding how the equilibrium among the states is altered upon ligand binding, interaction with other binding partners, and/or mutations and post-translational modifications is of critical importance for explaining allosteric signaling in proteins. Here, we propose a statistical analysis of the chemical shifts (CONCISE, COordiNated ChemIcal Shifts bEhavior) for the interpretation of protein conformational equilibria following linear trajectories of NMR chemical shifts. CONCISE enables one to quantitatively measure the population shifts associated with ligand titrations and estimate the degree of collectiveness of the protein residues’ response to ligand binding, giving a concise view of the structural transitions. The combination of CONCISE with thermocalorimetric and kinetic data allows one to depict a protein’s approximate conformational energy landscape. We tested this method with the catalytic subunit of cAMP-dependent protein kinase A, a ubiquitous enzyme that undergoes conformational transitions upon both nucleotide and pseudo-substrate binding. When complemented with chemical shift covariance analysis (CHESCA), this new method offers both collective response and residue-specific correlations for ligand binding to proteins. PMID:24604024

Origin of the size-dependence of the equilibrium van der Waals binding between nanostructures

NASA Astrophysics Data System (ADS)

Tao, Jianmin; Perdew, John P.; Tang, Hong; Shahi, Chandra

2018-02-01

Nanostructures can be bound together at equilibrium by the van der Waals (vdW) effect, a small but ubiquitous many-body attraction that presents challenges to density functional theory. How does the binding energy depend upon the size or number of atoms in one of a pair of identical nanostructures? To answer this question, we treat each nanostructure as a whole object, not as a collection of atoms. Our calculations start from an accurate static dipole polarizability for each considered nanostructure, and an accurate equilibrium center-to-center distance for the pair (the latter from experiment or from the vdW-DF-cx functional). We consider the competition in each term -C2k/d2k (k = 3, 4, 5) of the long-range vdW series for the interaction energy, between the size dependence of the vdW coefficient C2k and that of the 2kth power of the center-to-center distance d. The damping of these vdW terms can be negligible, but in any case, it does not affect the size dependence for a given term in the absence of non-vdW binding. To our surprise, the vdW energy can be size-independent for quasi-spherical nanoclusters bound to one another by vdW interaction, even with strong nonadditivity of the vdW coefficient, as demonstrated for fullerenes. We also show that, for low-dimensional systems, the vdW interaction yields the strongest size-dependence, in stark contrast to that of fullerenes. We illustrate this with parallel planar polycyclic aromatic hydrocarbons. The size dependences of other morphologies or bonding types lie between, as shown by sodium clusters.

How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent

NASA Astrophysics Data System (ADS)

Dudev, Todor; Grauffel, Cédric; Lim, Carmay

2017-02-01

Adenosine triphosphate (ATP), the major energy currency of the cell, exists in solution mostly as ATP-Mg. Recent experiments suggest that Mg2+ interacts with the highly charged ATP triphosphate group and Li+ can co-bind with the native Mg2+ to form ATP-Mg-Li and modulate the neuronal purine receptor response. However, it is unclear how the negatively charged ATP triphosphate group binds Mg2+ and Li+ (i.e. which phosphate group(s) bind Mg2+/Li+) and how the ATP solution conformation depends on the type of metal cation and the metal-binding mode. Here, we reveal the preferred ATP-binding mode of Mg2+/Li+ alone and combined: Mg2+ prefers to bind ATP tridentately to each of the three phosphate groups, but Li+ prefers to bind bidentately to the terminal two phosphates. We show that the solution ATP conformation depends on the cation and its binding site/mode, but it does not change significantly when Li+ binds to Mg2+-loaded ATP. Hence, ATP-Mg-Li, like Mg2+-ATP, can fit in the ATP-binding site of the host enzyme/receptor, activating specific signaling pathways.

Photoionization cross section and binding energy of single dopant in hollow cylindrical core/shell quantum dot

NASA Astrophysics Data System (ADS)

Feddi, E.; El-Yadri, M.; Dujardin, F.; Restrepo, R. L.; Duque, C. A.

2017-02-01

In this study, we have investigated the confined donor impurity in a hollow cylindrical-shell quantum dot. The charges are assumed to be completely confined to the interior of the shell with rigid walls. Within the framework of the effective-mass approximation and by using a simple variational approach, we have computed the donor binding energy as a function of the shell sizes in order to study the behavior of the electron-impurity attraction for a very small thickness. Our results show that the binding energy of a donor impurity placed at the center of cylindrical core/shell dots depends strongly on the shell size. The binding energy increases when the shell-wideness becomes smaller and shows the same behavior as in a simple cylindrical quantum dot. A special case has been studied, which corresponds to the ratio between the inner and outer radii near to one (a/b → 1) for which our model gives a non-significant behavior of the impurity binding energy. This fact implies the existence of a critical value (a/b) for which the binding energy of the donor impurity tends to the limit value of 4 effective Rydbergs as in a 2D quantum well. We also analyse the photoionization cross section considering only the in-plane incident radiation polarization. We determine its behavior as a function of photon energy, shell size, and donor position. The measurement of photoionization in such systems would be of great interest to understand the optical properties of carriers in quantum dots.

The role of multivalency in the association kinetics of patchy particle complexes.

PubMed

Newton, Arthur C; Groenewold, Jan; Kegel, Willem K; Bolhuis, Peter G

2017-06-21

Association and dissociation of particles are elementary steps in many natural and technological relevant processes. For many such processes, the presence of multiple binding sites is essential. For instance, protein complexes and regular structures such as virus shells are formed from elementary building blocks with multiple binding sites. Here we address a fundamental question concerning the role of multivalency of binding sites in the association kinetics of such complexes. Using single replica transition interface sampling simulations, we investigate the influence of the multivalency on the binding kinetics and the association mechanism of patchy particles that form polyhedral clusters. When the individual bond strength is fixed, the kinetics naturally is very dependent on the multivalency, with dissociation rate constants exponentially decreasing with the number of bonds. In contrast, we find that when the total bond energy per particle is kept constant, association and dissociation rate constants turn out rather independent of multivalency, although of course still very dependent on the total energy. The association and dissociation mechanisms, however, depend on the presence and nature of the intermediate states. For instance, pathways that visit intermediate states are less prevalent for particles with five binding sites compared to the case of particles with only three bonds. The presence of intermediate states can lead to kinetic trapping and malformed aggregates. We discuss implications for natural forming complexes such as virus shells and for the design of artificial colloidal patchy particles.

The role of multivalency in the association kinetics of patchy particle complexes

NASA Astrophysics Data System (ADS)

Newton, Arthur C.; Groenewold, Jan; Kegel, Willem K.; Bolhuis, Peter G.

2017-06-01

Association and dissociation of particles are elementary steps in many natural and technological relevant processes. For many such processes, the presence of multiple binding sites is essential. For instance, protein complexes and regular structures such as virus shells are formed from elementary building blocks with multiple binding sites. Here we address a fundamental question concerning the role of multivalency of binding sites in the association kinetics of such complexes. Using single replica transition interface sampling simulations, we investigate the influence of the multivalency on the binding kinetics and the association mechanism of patchy particles that form polyhedral clusters. When the individual bond strength is fixed, the kinetics naturally is very dependent on the multivalency, with dissociation rate constants exponentially decreasing with the number of bonds. In contrast, we find that when the total bond energy per particle is kept constant, association and dissociation rate constants turn out rather independent of multivalency, although of course still very dependent on the total energy. The association and dissociation mechanisms, however, depend on the presence and nature of the intermediate states. For instance, pathways that visit intermediate states are less prevalent for particles with five binding sites compared to the case of particles with only three bonds. The presence of intermediate states can lead to kinetic trapping and malformed aggregates. We discuss implications for natural forming complexes such as virus shells and for the design of artificial colloidal patchy particles.

Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-11-01

We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

Calculating the sensitivity and robustness of binding free energy calculations to force field parameters

PubMed Central

Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.

2013-01-01

Binding free energy calculations offer a thermodynamically rigorous method to compute protein-ligand binding, and they depend on empirical force fields with hundreds of parameters. We examined the sensitivity of computed binding free energies to the ligand’s electrostatic and van der Waals parameters. Dielectric screening and cancellation of effects between ligand-protein and ligand-solvent interactions reduce the parameter sensitivity of binding affinity by 65%, compared with interaction strengths computed in the gas-phase. However, multiple changes to parameters combine additively on average, which can lead to large changes in overall affinity from many small changes to parameters. Using these results, we estimate that random, uncorrelated errors in force field nonbonded parameters must be smaller than 0.02 e per charge, 0.06 Å per radius, and 0.01 kcal/mol per well depth in order to obtain 68% (one standard deviation) confidence that a computed affinity for a moderately-sized lead compound will fall within 1 kcal/mol of the true affinity, if these are the only sources of error considered. PMID:24015114

Determination of layer-dependent exciton binding energies in few-layer black phosphorus

PubMed Central

Zhang, Guowei; Chaves, Andrey; Huang, Shenyang; Wang, Fanjie; Xing, Qiaoxia; Low, Tony; Yan, Hugen

2018-01-01

The attraction between electrons and holes in semiconductors forms excitons, which largely determine the optical properties of the hosting material, and hence the device performance, especially for low-dimensional systems. Mono- and few-layer black phosphorus (BP) are emerging two-dimensional (2D) semiconductors. Despite its fundamental importance and technological interest, experimental investigation of exciton physics has been rather limited. We report the first systematic measurement of exciton binding energies in ultrahigh-quality few-layer BP by infrared absorption spectroscopy, with layer (L) thickness ranging from 2 to 6 layers. Our experiments allow us to determine the exciton binding energy, decreasing from 213 meV (2L) to 106 meV (6L). The scaling behavior with layer numbers can be well described by an analytical model, which takes into account the nonlocal screening effect. Extrapolation to free-standing monolayer yields a large binding energy of ~800 meV. Our study provides insights into 2D excitons and their crossover from 2D to 3D, and demonstrates that few-layer BP is a promising high-quality optoelectronic material for potential infrared applications. PMID:29556530

Probing inter- and intrachain Zhang-Rice excitons in Li 2 CuO 2 and determining their binding energy

DOE PAGES

Monney, Claude; Bisogni, Valentina; Zhou, Ke-Jin; ...

2016-10-10

Cuprate materials, such as those hosting high-temperature superconductivity, represent a famous class of materials where the correlations between the strongly entangled charges and spins produce complex phase diagrams. Several years ago, the Zhang-Rice singlet was proposed as a natural quasiparticle in hole-doped cuprates. The occurrence and binding energy of this quasiparticle, consisting of a pair of bound holes with antiparallel spins on the same CuO 4 plaquette, depends on the local electronic interactions, which are fundamental quantities for understanding the physics of the cuprates. Here, we employ state-of-the-art resonant inelastic x-ray scattering (RIXS) to probe the correlated physics of themore » CuO 4 plaquettes in the quasi-one-dimensional chain cuprate Li 2CuO 2. By tuning the incoming photon energy to the O K edge, we populate bound states related to the Zhang-Rice quasiparticles in the RIXS process. Both intra- and interchain Zhang-Rice singlets are observed and their occurrence is shown to depend on the nearest-neighbor spin-spin correlations, which are readily probed in this experiment. Finally, we also extract the binding energy of the Zhang-Rice singlet and identify the Zhang-Rice triplet excitation in the RIXS spectra.« less

Molecular basis of endosomal-membrane association for the dengue virus envelope protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rogers, David M.; Kent, Michael S.; Rempe, Susan B.

Dengue virus is coated by an icosahedral shell of 90 envelope protein dimers that convert to trimers at low pH and promote fusion of its membrane with the membrane of the host endosome. We provide the first estimates for the free energy barrier and minimum for two key steps in this process: host membrane bending and protein–membrane binding. Both are studied using complementary membrane elastic, continuum electrostatics and all-atom molecular dynamics simulations. The predicted host membrane bending required to form an initial fusion stalk presents a 22–30 kcal/mol free energy barrier according to a constrained membrane elastic model. Combined continuummore » and molecular dynamics results predict a 15 kcal/mol free energy decrease on binding of each trimer of dengue envelope protein to a membrane with 30% anionic phosphatidylglycerol lipid. The bending cost depends on the preferred curvature of the lipids composing the host membrane leaflets, while the free energy gained for protein binding depends on the surface charge density of the host membrane. The fusion loop of the envelope protein inserts exactly at the level of the interface between the membrane's hydrophobic and head-group regions. As a result, the methods used in this work provide a means for further characterization of the structures and free energies of protein-assisted membrane fusion.« less

Molecular basis of endosomal-membrane association for the dengue virus envelope protein

DOE PAGES

Rogers, David M.; Kent, Michael S.; Rempe, Susan B.

2015-01-02

Dengue virus is coated by an icosahedral shell of 90 envelope protein dimers that convert to trimers at low pH and promote fusion of its membrane with the membrane of the host endosome. We provide the first estimates for the free energy barrier and minimum for two key steps in this process: host membrane bending and protein–membrane binding. Both are studied using complementary membrane elastic, continuum electrostatics and all-atom molecular dynamics simulations. The predicted host membrane bending required to form an initial fusion stalk presents a 22–30 kcal/mol free energy barrier according to a constrained membrane elastic model. Combined continuummore » and molecular dynamics results predict a 15 kcal/mol free energy decrease on binding of each trimer of dengue envelope protein to a membrane with 30% anionic phosphatidylglycerol lipid. The bending cost depends on the preferred curvature of the lipids composing the host membrane leaflets, while the free energy gained for protein binding depends on the surface charge density of the host membrane. The fusion loop of the envelope protein inserts exactly at the level of the interface between the membrane's hydrophobic and head-group regions. As a result, the methods used in this work provide a means for further characterization of the structures and free energies of protein-assisted membrane fusion.« less

Using DNA mechanics to predict in vitro nucleosome positions and formation energies

PubMed Central

Morozov, Alexandre V.; Fortney, Karissa; Gaykalova, Daria A.; Studitsky, Vasily M.; Widom, Jonathan; Siggia, Eric D.

2009-01-01

In eukaryotic genomes, nucleosomes function to compact DNA and to regulate access to it both by simple physical occlusion and by providing the substrate for numerous covalent epigenetic tags. While competition with other DNA-binding factors and action of chromatin remodeling enzymes significantly affect nucleosome formation in vivo, nucleosome positions in vitro are determined by steric exclusion and sequence alone. We have developed a biophysical model, DNABEND, for the sequence dependence of DNA bending energies, and validated it against a collection of in vitro free energies of nucleosome formation and a set of in vitro nucleosome positions mapped at high resolution. We have also made a first ab initio prediction of nucleosomal DNA geometries, and checked its accuracy against the nucleosome crystal structure. We have used DNABEND to design both strong and weak histone- binding sequences, and measured the corresponding free energies of nucleosome formation. We find that DNABEND can successfully predict in vitro nucleosome positions and free energies, providing a physical explanation for the intrinsic sequence dependence of histone–DNA interactions. PMID:19509309

Estimating Atomic Contributions to Hydration and Binding Using Free Energy Perturbation.

PubMed

Irwin, Benedict W J; Huggins, David J

2018-06-12

We present a general method called atom-wise free energy perturbation (AFEP), which extends a conventional molecular dynamics free energy perturbation (FEP) simulation to give the contribution to a free energy change from each atom. AFEP is derived from an expansion of the Zwanzig equation used in the exponential averaging method by defining that the system total energy can be partitioned into contributions from each atom. A partitioning method is assumed and used to group terms in the expansion to correspond to individual atoms. AFEP is applied to six example free energy changes to demonstrate the method. Firstly, the hydration free energies of methane, methanol, methylamine, methanethiol, and caffeine in water. AFEP highlights the atoms in the molecules that interact favorably or unfavorably with water. Finally AFEP is applied to the binding free energy of human immunodeficiency virus type 1 protease to lopinavir, and AFEP reveals the contribution of each atom to the binding free energy, indicating candidate areas of the molecule to improve to produce a more strongly binding inhibitor. FEP gives a single value for the free energy change and is already a very useful method. AFEP gives a free energy change for each "part" of the system being simulated, where part can mean individual atoms, chemical groups, amino acids, or larger partitions depending on what the user is trying to measure. This method should have various applications in molecular dynamics studies of physical, chemical, or biochemical phenomena, specifically in the field of computational drug discovery.

Fluorescence stopped-flow study of the interaction of tubulin with the antimitotic drug MDL 27048.

PubMed

Silence, K; D'Hoore, A; Engelborghs, Y; Peyrot, V; Briand, C

1992-11-17

The kinetics of the binding of MDL 27048 to tubulin have been studied by fluorescence stopped flow. The binding is accompanied by a fluorescence increase. The time course can be described by a sum of two exponentials, assumed to be due to the presence of two major tubulin isoforms. The observed rate constants depend in a nonlinear way on the concentration of MDL in pseudo-first-order conditions. This concentration dependence can be described by the presence of a fast equilibrium of low affinity, followed by an isomerization of the initial complex. The dissociation kinetics have been studied by displacement experiments, in which MTC was used as a competitive ligand. The reaction enthalpy change for the first binding equilibrium and the activation energies for the forward and reverse steps of the isomerization were determined from the temperature dependence. This was possible for the two tubulin isotype populations. The kinetics of the binding of MDL to tubulin are slowed down in the presence of 3',4',5'-trimethoxyacetophenone, a fast binding analog of the colchicine A-ring, but are not influenced by the binding of tropolone methyl ether, indicating that the binding site of MDL has the A-subsite in common with colchicine, but not the C-subsite.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Tu, Xingchen; Wang, Hao

The electronic efficiency and binding energy of contacts formed between graphene electrodes and poly-aromatic hydrocarbon (PAH) anchoring groups have been investigated by the non-equilibrium Green’s function formalism combined with density functional theory. Our calculations show that PAH molecules always bind in the interior and at the edge of graphene in the AB stacking manner, and that the binding energy increases following the increase of the number of carbon and hydrogen atoms constituting the PAH molecule. When we move to analyzing the electronic transport properties of molecular junctions with a six-carbon alkyne chain as the central molecule, the electronic efficiency ofmore » the graphene-PAH contacts is found to depend on the energy gap between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of the corresponding PAH anchoring group, rather than its size. To be specific, the smaller is the HOMO-LUMO gap of the PAH anchoring group, the higher is the electronic efficiency of the graphene-PAH contact. Although the HOMO-LUMO gap of a PAH molecule depends on its specific configuration, PAH molecules with similar atomic structures show a decreasing trend for their HOMO-LUMO gap as the number of fused benzene rings increases. Therefore, graphene-conjugated molecule-graphene junctions with high-binding and high-conducting graphene-PAH contacts can be realized by choosing appropriate PAH anchor groups with a large area and a small HOMO-LUMO gap.« less

Exciton binding energy in a pyramidal quantum dot

NASA Astrophysics Data System (ADS)

Anitha, A.; Arulmozhi, M.

2018-05-01

The effects of spatially dependent effective mass, non-parabolicity of the conduction band and dielectric screening function on exciton binding energy in a pyramid-shaped quantum dot of GaAs have been investigated by variational method as a function of base width of the pyramid. We have assumed that the pyramid has a square base with area a× a and height of the pyramid H=a/2. The trial wave function of the exciton has been chosen according to the even mirror boundary condition, i.e. the wave function of the exciton at the boundary could be non-zero. The results show that (i) the non-parabolicity of the conduction band affects the light hole (lh) and heavy hole (hh) excitons to be more bound than that with parabolicity of the conduction band, (ii) the dielectric screening function (DSF) affects the lh and hh excitons to be more bound than that without the DSF and (iii) the spatially dependent effective mass (SDEM) affects the lh and hh excitons to be less bound than that without the SDEM. The combined effects of DSF and SDEM on exciton binding energy have also been calculated. The results are compared with those available in the literature.

Interfacial disorder drives charge separation in molecular semiconductors

NASA Astrophysics Data System (ADS)

Willard, Adam

One of the fundamental microscopic processes in photocurrent generation is the dissociation of neutral photo-excitations (i.e., Frenkel excitons) into free charge carriers (i.e., electrons and holes). This process requires the physical separation of oppositely charged electrons and holes, which are held to together by an attractive electrostatic binding energy. In traditional inorganic-based photovoltaic (PV) materials, this binding energy is generally small and easily overcome, however, in organic-based PVs (OPVs) the exciton binding energy can significantly exceed thermal energies. The inability of bound charges to overcome this large binding energy has been implicated as a primary source of efficiency loss in OPVs. Here I present results from our recent efforts to explore the role of static molecular disorder in mediating this process. Using a simple lattice model of exciton dynamics we demonstrate that random spatial variations in the energetic landscape can mitigate the attractive Coulomb interaction between electrons and holes. We show that this effect manifests as a reduction in the free energy barrier for exciton dissociation that grows more pronounced with increasing disorder. By considering the competition between this thermodynamic effect and the disorder-induced slowing of dissociation kinetics we demonstrate that exciton dissociation yields are expected to depend non-monotonically on the degree of static disorder.

Origin of the size-dependence of the equilibrium van der Waals binding between nanostructures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Jianmin

Nanostructures can be bound together at equilibrium by the van der Waals (vdW) effect, a small but ubiquitous many-body attraction that presents challenges to density functional theory. How does the binding energy depend upon the size or number of atoms in one of a pair of identical nanostructures? To answer this question, we treat each nanostructure properly as a whole object, not as a collection of atoms. Our calculations start from an accurate static dipole polarizability for each considered nanostructure, and an accurate equilibrium center-to-center distance for the pair (the latter from experiment, or from the vdW-DF-cx functional). We consider the competition in each termmore » $$-C_{2k}/d^{2k}$$ ($k=3, 4, 5$) of the long-range vdW series for the interaction energy, between the size dependence of the vdW coefficient $$C_{2k}$$ and that of the $2k$-th power of the center-to-center distance $d$. The damping of these vdW terms can be negligible, but in any case it does not affect the size dependence for a given term in the absence of non-vdW binding. To our surprise, the vdW energy can be size-independent for quasi-spherical nanoclusters bound to one another by vdW interaction, even with strong nonadditivity of the vdW coefficient, as demonstrated for fullerenes. We also show that, for low-dimensional systems, the vdW interaction yields the strongest size-dependence, in stark contrast to that of fullerenes. We illustrate this with parallel planar polycyclic aromatic hydrocarbons. Other cases are between, as shown by sodium clusters.« less

Origin of the size-dependence of the equilibrium van der Waals binding between nanostructures

DOE PAGES

Tao, Jianmin

2018-02-21

Nanostructures can be bound together at equilibrium by the van der Waals (vdW) effect, a small but ubiquitous many-body attraction that presents challenges to density functional theory. How does the binding energy depend upon the size or number of atoms in one of a pair of identical nanostructures? To answer this question, we treat each nanostructure properly as a whole object, not as a collection of atoms. Our calculations start from an accurate static dipole polarizability for each considered nanostructure, and an accurate equilibrium center-to-center distance for the pair (the latter from experiment, or from the vdW-DF-cx functional). We consider the competition in each termmore » $$-C_{2k}/d^{2k}$$ ($k=3, 4, 5$) of the long-range vdW series for the interaction energy, between the size dependence of the vdW coefficient $$C_{2k}$$ and that of the $2k$-th power of the center-to-center distance $d$. The damping of these vdW terms can be negligible, but in any case it does not affect the size dependence for a given term in the absence of non-vdW binding. To our surprise, the vdW energy can be size-independent for quasi-spherical nanoclusters bound to one another by vdW interaction, even with strong nonadditivity of the vdW coefficient, as demonstrated for fullerenes. We also show that, for low-dimensional systems, the vdW interaction yields the strongest size-dependence, in stark contrast to that of fullerenes. We illustrate this with parallel planar polycyclic aromatic hydrocarbons. Other cases are between, as shown by sodium clusters.« less

Biochemical activity of a fluorescent dye rhodamine 6G: Molecular modeling, electrochemical, spectroscopic and thermodynamic studies.

PubMed

Al Masum, Abdulla; Chakraborty, Maharudra; Ghosh, Soumen; Laha, Dipranjan; Karmakar, Parimal; Islam, Md Maidul; Mukhopadhyay, Subrata

2016-11-01

Interaction of CT DNA with Rhodamine 6G (R6G) has been studied using molecular docking, electrochemical, spectroscopic and thermodynamic methods. From the study, it was illustrated that Rhodamine 6G binds to the minor groove of CT DNA. The binding was cooperative in nature. Circular voltametric study showed significant change in peak current and peak potential due to complexation. All the studies showed that the binding constant was in the order of 10 6 M -1 . Circular dichroic spectra showed significant conformational change on binding and DNA unwind during binding. Thermodynamic study showed that binding was favored by negative enthalpy and positive entropy change. From thermodynamic study it was also observed that several positive and negative free energies played significant role during binding and the unfavorable conformational free energy change was overcame by highly negative hydrophobic and salt dependent free energy changes. The experimental results were further validated using molecular docking study and the effect of structure on binding has been studied theoretically. From docking study it was found that the hydrophobic interaction and hydrogen bonds played a significant role during binding. The dye was absorbed by cell and this phenomenon was studied using fluorescent microscope. Cell survivability test showed that the dye active against Human Breast Cancer cells MDA-MB 468. ROS study showed that the activity is due to the production of reactive oxygen. Copyright © 2016 Elsevier B.V. All rights reserved.

On the Mg(2+) binding site of the ε subunit from bacterial F-type ATP synthases.

PubMed

Krah, Alexander; Takada, Shoji

2015-10-01

F-type ATP synthases, central energy conversion machines of the cell synthesize adenosine triphosphate (ATP) using an electrochemical gradient across the membrane and, reversely, can also hydrolyze ATP to pump ions across the membrane, depending on cellular conditions such as ATP concentration. To prevent wasteful ATP hydrolysis, mammalian and bacterial ATP synthases possess different regulatory mechanisms. In bacteria, a low ATP concentration induces a conformational change in the ε subunit from the down- to up-states, which inhibits ATP hydrolysis. Moreover, the conformational change of the ε subunit depends on Mg(2+) concentration in some bacteria such as Bacillus subtilis, but not in others. This diversity makes the ε subunit a potential target for antibiotics. Here, performing molecular dynamics simulations, we identify the Mg(2+) binding site in the ε subunit from B. subtilis as E59 and E86. The free energy analysis shows that the first-sphere bi-dentate coordination of the Mg(2+) ion by the two glutamates is the most stable state. In comparison, we also clarify the reason for the absence of Mg(2+) dependency in the ε subunit from thermophilic Bacillus PS3, despite the high homology to that from B. subtilis. Sequence alignment suggests that this Mg(2+) binding motif is present in the ε subunits of some pathogenic bacteria. In addition we discuss strategies to stabilize an isolated ε subunit carrying the Mg(2+) binding motif by site directed mutagenesis, which also can be used to crystallize Mg(2+) dependent ε subunits in future. Copyright © 2015 Elsevier B.V. All rights reserved.

Simultaneous fluorescence light-up and selective multicolor nucleobase recognition based on sequence-dependent strong binding of berberine to DNA abasic site.

PubMed

Wu, Fei; Shao, Yong; Ma, Kun; Cui, Qinghua; Liu, Guiying; Xu, Shujuan

2012-04-28

Label-free DNA nucleobase recognition by fluorescent small molecules has received much attention due to its simplicity in mutation identification and drug screening. However, sequence-dependent fluorescence light-up nucleobase recognition and multicolor emission with individual emission energy for individual nucleobases have been seldom realized. Herein, an abasic site (AP site) in a DNA duplex was employed as a binding field for berberine, one of isoquinoline alkaloids. Unlike weak binding of berberine to the fully matched DNAs without the AP site, strong binding of berberine to the AP site occurs and the berberine's fluorescence light-up behaviors are highly dependent on the target nucleobases opposite the AP site in which the targets thymine and cytosine produce dual emission bands, while the targets guanine and adenine only give a single emission band. Furthermore, more intense emissions are observed for the target pyrimidines than purines. The flanking bases of the AP site also produce some modifications of the berberine's emission behavior. The binding selectivity of berberine at the AP site is also confirmed by measurements of fluorescence resonance energy transfer, excited-state lifetime, DNA melting and fluorescence quenching by ferrocyanide and sodium chloride. It is expected that the target pyrimidines cause berberine to be stacked well within DNA base pairs near the AP site, which results in a strong resonance coupling of the electronic transitions to the particular vibration mode to produce the dual emissions. The fluorescent signal-on and emission energy-modulated sensing for nucleobases based on this fluorophore is substantially advantageous over the previously used fluorophores. We expect that this approach will be developed as a practical device for differentiating pyrimidines from purines by positioning an AP site toward a target that is available for readout by this alkaloid probe. This journal is © The Royal Society of Chemistry 2012

Deep insights into the mode of ATP-binding mechanism in Zebrafish cyclin-dependent protein kinase-like 1 (zCDKL1): A molecular dynamics approach.

PubMed

Rout, Ajaya Kumar; Dehury, Budheswar; Maharana, Jitendra; Nayak, Chirasmita; Baisvar, Vishwamitra Singh; Behera, Bijay Kumar; Das, Basanta Kumar

2018-05-01

In eukaryotes, the serine/threonine kinases (STKs) belonging to cyclin-dependent protein kinases (CDKs) play significant role in control of cell division and curb transcription in response to several extra and intra-cellular signals indispensable for enzymatic activity. The zebrafish cyclin-dependent protein kinase-like 1 protein (zCDKL1) shares a high degree of sequence and structural similarity with mammalian orthologs and express in brain, ovary, testis, and low levels in other tissues. Regardless of its importance in the developmental process, the structure, function and mode of ATP recognition have not been investigated yet due to lack of experimental data. Henceforth, to gain atomistic insights in to the structural dynamics and mode of ATP binding, a series of computational techniques involving theoretical modeling, docking, molecular dynamics (MD) simulations and MM/PBSA binding free energies were employed. The modeled bi-lobed zCDKL1 shares a high degree of secondary structure topology with human orthologs where ATP prefers to lie in the central cavity of the bi-lobed catalytic domain enclosed by strong hydrogen bonding, electrostatic and hydrophobic contacts. Long range MD simulation portrayed that catalytic domain of zCDKL1 to be highly rigid in nature as compared to the complex (zCDKL1-ATP) form. Comparative analysis with its orthologs revealed that conserved amino acids i.e., Ile10, Gly11, Glu12, Val18, Arg31, Phe80, Glu 130, Cys143 and Asp144 were crucial for ATP binding mechanism, which needs further investigation for legitimacy. MM/PBSA method revealed that van der Waals, electrostatic and polar solvation energy mostly contributes towards negative free energy. The implications of ATP binding mechanism inferred through these structural bioinformatics approaches will help in understanding the catalytic mechanisms of important STKs in eukaryotic system. Copyright © 2018. Published by Elsevier Inc.

Sirt1 carboxyl-domain is an ATP-repressible domain that is transferrable to other proteins

PubMed Central

Kang, Hyeog; Oka, Shinichi; Lee, Duck-Yeon; Park, Junhong; Aponte, Angel M.; Jung, Young-Sang; Bitterman, Jacob; Zhai, Peiyong; He, Yi; Kooshapur, Hamed; Ghirlando, Rodolfo; Tjandra, Nico; Lee, Sean B.; Kim, Myung K.; Sadoshima, Junichi; Chung, Jay H.

2017-01-01

Sirt1 is an NAD+-dependent protein deacetylase that regulates many physiological functions, including stress resistance, adipogenesis, cell senescence and energy production. Sirt1 can be activated by energy deprivation, but the mechanism is poorly understood. Here, we report that Sirt1 is negatively regulated by ATP, which binds to the C-terminal domain (CTD) of Sirt1. ATP suppresses Sirt1 activity by impairing the CTD's ability to bind to the deacetylase domain as well as its ability to function as the substrate recruitment site. ATP, but not NAD+, causes a conformational shift to a less compact structure. Mutations that prevent ATP binding increase Sirt1's ability to promote stress resistance and inhibit adipogenesis under high-ATP conditions. Interestingly, the CTD can be attached to other proteins, thereby converting them into energy-regulated proteins. These discoveries provide insight into how extreme energy deprivation can impact Sirt1 activity and underscore the complex nature of Sirt1 structure and regulation. PMID:28504272

Bose polaron problem: Effect of mass imbalance on binding energy

NASA Astrophysics Data System (ADS)

Ardila, L. A. Peña; Giorgini, S.

2016-12-01

By means of quantum Monte Carlo methods we calculate the binding energy of an impurity immersed in a Bose-Einstein condensate at T =0 . The focus is on the attractive branch of the Bose polaron and on the role played by the mass imbalance between the impurity and the surrounding particles. For an impurity resonantly coupled to the bath, we investigate the dependence of the binding energy on the mass ratio and on the interaction strength within the medium. In particular, we determine the equation of state in the case of a static (infinite mass) impurity, where three-body correlations are irrelevant and the result is expected to be a universal function of the gas parameter. For the mass ratio corresponding to 40K impurities in a gas of 87Rb atoms, we provide an explicit comparison with the experimental findings of a recent study carried out at JILA.

The effect of desolvation on the binding of inhibitors to HIV-1 protease and cyclin-dependent kinases: Causes of resistance.

PubMed

Fong, Clifford W

2016-08-01

Studies of the cyclin-dependent kinase inhibitors and HIV-1 protease inhibitors have confirmed that ligand-protein binding is dependent on desolvation effects. It has been found that a four parameter linear model incorporating desolvation energy, lipophilicity, dipole moment and molecular volume of the ligands is a good model to describe the binding between ligands and kinases or proteases. The resistance shown by MDR proteases to the anti-viral drugs is multi-faceted involving varying changes in desolvation, lipophilicity and dipole moment interaction compared to the non-resistant protease. Desolvation has been shown to be the dominant factor influencing the effect of inhibitors against the cyclin-dependent kinases, but lipophilicity and dipole moment are also significant factors. The model can differentiate between the inhibitory activity of CDK2/cycE, CDK1/cycB and CDK4/cycD enzymes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Rearrangements under confinement lead to increased binding energy of Synaptotagmin-1 with anionic membranes in Mg2+ and Ca2.

PubMed

Gruget, Clémence; Coleman, Jeff; Bello, Oscar; Krishnakumar, Shyam S; Perez, Eric; Rothman, James E; Pincet, Frederic; Donaldson, Stephen H

2018-05-01

Synaptotagmin-1 (Syt1) is the primary calcium sensor (Ca 2+ ) that mediates neurotransmitter release at the synapse. The tandem C2 domains (C2A and C2B) of Syt1 exhibit functionally critical, Ca 2+ -dependent interactions with the plasma membrane. With the surface forces apparatus, we directly measure the binding energy of membrane-anchored Syt1 to an anionic membrane and find that Syt1 binds with ~6 k B T in EGTA, ~10 k B T in Mg 2+ and ~18 k B T in Ca 2+ . Molecular rearrangements measured during confinement are more prevalent in Ca 2+ and Mg 2+ and suggest that Syt1 initially binds through C2B, then reorients the C2 domains into the preferred binding configuration. These results provide energetic and mechanistic details of the Syt1 Ca 2+ -activation process in synaptic transmission. © 2018 Federation of European Biochemical Societies.

Investigation of flavonoids bearing different substituents on ring C and their cu2+ complex binding with bovine serum albumin: structure-affinity relationship aspects.

PubMed

Shi, Shuyun; Zhang, Yuping; Chen, Xiaoqin; Peng, Mijun

2011-10-12

The effects of 1:1 flavonoid-Cu(2+) complexes of four flavonoids with different C-ring substituents, quercetin (QU), luteolin (LU), taxifolin (TA), and (+)-catechin (CA), on bovine serum albumin (BSA) were investigated and compared with corresponding free flavonoids by spectroscopic analysis in an attempt to characterize the chemical association taking place. The results indicated that all of the quenching mechanisms were based on static quenching combined with nonradiative energy transfer. Cu(2+) chelation changed the binding constants for BSA depending on the structures of flavonoids and the detected concentrations. The reduced hydroxyl groups, increased steric hindrance, and hydrophilicity of Cu(2+) chelation may be the main reasons for the reduced binding constants, whereas the formation of stable flavonoid-Cu(2+) complexes and synergistic action could increase the binding constants. The changed trends of critical energy transfer distance (R(0)) for Cu(2+) chelation were contrary to those of binding constants.

A molecular dynamics investigation of CDK8/CycC and ligand binding: conformational flexibility and implication in drug discovery

NASA Astrophysics Data System (ADS)

Cholko, Timothy; Chen, Wei; Tang, Zhiye; Chang, Chia-en A.

2018-05-01

Abnormal activity of cyclin-dependent kinase 8 (CDK8) along with its partner protein cyclin C (CycC) is a common feature of many diseases including colorectal cancer. Using molecular dynamics (MD) simulations, this study determined the dynamics of the CDK8-CycC system and we obtained detailed breakdowns of binding energy contributions for four type-I and five type-II CDK8 inhibitors. We revealed system motions and conformational changes that will affect ligand binding, confirmed the essentialness of CycC for inclusion in future computational studies, and provide guidance in development of CDK8 binders. We employed unbiased all-atom MD simulations for 500 ns on twelve CDK8-CycC systems, including apoproteins and protein-ligand complexes, then performed principal component analysis (PCA) and measured the RMSF of key regions to identify protein dynamics. Binding pocket volume analysis identified conformational changes that accompany ligand binding. Next, H-bond analysis, residue-wise interaction calculations, and MM/PBSA were performed to characterize protein-ligand interactions and find the binding energy. We discovered that CycC is vital for maintaining a proper conformation of CDK8 to facilitate ligand binding and that the system exhibits motion that should be carefully considered in future computational work. Surprisingly, we found that motion of the activation loop did not affect ligand binding. Type-I and type-II ligand binding is driven by van der Waals interactions, but electrostatic energy and entropic penalties affect type-II binding as well. Binding of both ligand types affects protein flexibility. Based on this we provide suggestions for development of tighter-binding CDK8 inhibitors and offer insight that can aid future computational studies.

The Dual Role of Disorder on the Dissociation of Interfacial Charge Transfer Excitons

NASA Astrophysics Data System (ADS)

Shi, Liang; Lee, Chee-Kong; Willard, Adam

In organic-based photovoltaics (OPV), dissociation of neutral photo-excitations (i.e., Frenkel excitons) into free charge carriers requires the excitons to overcome binding energy that can significantly exceed thermal energies. The inability of bound charges to overcome this large binding energy has been implicated as a primary source of efficiency loss in OPVs. Despite the potential impact on the performance of organic solar cells much remains to be understood about the microscopic mechanism of exciton dissociation in OPV materials. Here we explore the role of static molecular disorder in mediating this charge dissociation process. Using a simple lattice model of exciton dynamics we demonstrate that random spatial variations in the energetic landscape can mitigate the effects of the exciton binding energy by lowering the free energy barrier. By considering the competition between this thermodynamic effect and the disorder-induced slowing of dissociation kinetics we demonstrate that exciton dissociation yields are expected to depend non-monotonically on the degree of static disorder. We conclude that a certain amount of molecular-scale disorder is desirable in order to optimize the performance of organic photovoltaic materials.

Molecular dynamics simulations of energy dissipation and non-thermal diffusion on amorphous solid water.

PubMed

Fredon, A; Cuppen, H M

2018-02-21

Molecules in space are synthesized via a large variety of gas-phase reactions, and reactions on dust-grain surfaces, where the surface acts as a catalyst. Especially, saturated, hydrogen-rich molecules are formed through surface chemistry where the interstellar grains act as a meeting place and absorbing energy. Here we present the results of thousands of molecular dynamics simulations to quantify the outcome of an energy dissipation process. Admolecules on top of an amorphous solid water surface have been given translational energy between 0.5 and 5 eV. Three different surface species are considered, CO 2 , H 2 O and CH 4 , spanning a range in binding energies, number of internal degrees of freedom and molecular weight. The results are compared against a previous study using a crystalline water ice surface. Possible outcomes of a dissipation process are adsorption - possibly after long-range diffusion-, desorption and desorption of a surface molecule. The three admolecules were found to bind at different locations on the surface, particularly in terms of height. Water preferably binds on top of the surface, whereas methane fills the nanopores on the surface. This has direct consequences for desorption, travelled distance, and kick-out probabilities. The admolecules are found to frequently travel several tens of angstroms before stabilizing on a binding site, allowing follow-up reactions en route. We present kick-out probabilities and we have been able to quantify the desorption probability which depends on the binding energy of the species, the translational excitation, and a factor that accounts for difference in binding site height. We provide expressions that can be incorporated in astrochemical models to predict grain surface formation and return into the gas phase of these products.

Medium-heavy nuclei from nucleon-nucleon interactions in lattice QCD

NASA Astrophysics Data System (ADS)

Inoue, Takashi; Aoki, Sinya; Charron, Bruno; Doi, Takumi; Hatsuda, Tetsuo; Ikeda, Yoichi; Ishii, Noriyoshi; Murano, Keiko; Nemura, Hidekatsu; Sasaki, Kenji; HAL QCD Collaboration

2015-01-01

On the basis of the Brueckner-Hartree-Fock method with the nucleon-nucleon forces obtained from lattice QCD simulations, the properties of the medium-heavy doubly magic nuclei such as 16O and 40Ca are investigated. We found that those nuclei are bound for the pseudoscalar meson mass MPS≃470 MeV. The mass number dependence of the binding energies, single-particle spectra, and density distributions are qualitatively consistent with those expected from empirical data at the physical point, although these hypothetical nuclei at heavy quark mass have smaller binding energies than the real nuclei.

Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands

NASA Astrophysics Data System (ADS)

Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree

2018-05-01

In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

Length-dependent modulation of cytoskeletal remodeling and mechanical energetics in airway smooth muscle.

PubMed

Kim, Hak Rim; Liu, Katrina; Roberts, Thomas J; Hai, Chi-Ming

2011-06-01

Actin cytoskeletal remodeling is an important mechanism of airway smooth muscle (ASM) contraction. We tested the hypothesis that mechanical strain modulates the cholinergic receptor-mediated cytoskeletal recruitment of actin-binding and integrin-binding proteins in intact airway smooth muscle, thereby regulating the mechanical energetics of airway smooth muscle. We found that the carbachol-stimulated cytoskeletal recruitment of actin-related protein-3 (Arp3), metavinculin, and talin were up-regulated at short muscle lengths and down-regulated at long muscle lengths, suggesting that the actin cytoskeleton--integrin complex becomes enriched in cross-linked and branched actin filaments in shortened ASM. The mechanical energy output/input ratio during sinusoidal length oscillation was dependent on muscle length, oscillatory amplitude, and cholinergic activation. The enhancing effect of cholinergic stimulation on mechanical energy output/input ratio at short and long muscle lengths may be explained by the length-dependent modulation of cytoskeletal recruitment and crossbridge cycling, respectively. We postulate that ASM functions as a hybrid biomaterial, capable of switching between operating as a cytoskeleton-based mechanical energy store at short muscle lengths to operating as an actomyosin-powered mechanical energy generator at long muscle lengths. This postulate predicts that targeting the signaling molecules involved in cytoskeletal recruitment may provide a novel approach to dilating collapsed airways in obstructive airway disease.

Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

PubMed Central

Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

2012-01-01

In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

Electronic and Structural Parameters of Phosphorus-Oxygen Bonds in Inorganic Phosphate Crystals

NASA Astrophysics Data System (ADS)

Atuchin, V. V.; Kesler, V. G.; Pervukhina, N. V.

Wide set of experimental results on binding energy of photoelectrons emitted from P 2p, P 2s, and O 1s core levels has been observed for inorganic phosphate crystals and the parameters were compared using energy differences Δ(O 1s - P 2p) and Δ (O 1s - P 2s) as most robust characteristics. Linear dependence of the binding energy difference on mean chemical bond length L(P-O) between phosphorus and oxygen atoms has been found. The functions are of the forms: Δ (O 1s - P 2p) (eV) = 375.54 + 0.146 · L(P-O) (pm) and Δ (O 1s - P 2s) (eV) = 320.77 + 0.129 · L(P-O) (pm). The dependencies are general for inorganic phosphates and may be used in quantitative component analysis of X-ray photoemission spectra of complex oxide compounds including functional groups with different coordination of P and O atoms.

Role of codeposited impurities during growth. II. Dependence of morphology on binding and barrier energies

NASA Astrophysics Data System (ADS)

Sathiyanarayanan, Rajesh; Hamouda, Ajmi Bh.; Pimpinelli, A.; Einstein, T. L.

2011-01-01

In an accompanying article we showed that surface morphologies obtained through codeposition of a small quantity (2%) of impurities with Cu during growth (step-flow mode, θ = 40 ML) significantly depends on the lateral nearest-neighbor binding energy (ENN) to Cu adatom and the diffusion barrier (Ed) of the impurity atom on Cu(0 0 1). Based on these two energy parameters, ENN and Ed, we classify impurity atoms into four sets. We study island nucleation and growth in the presence of codeposited impurities from different sets in the submonolayer (θ⩽ 0.7 ML) regime. Similar to growth in the step-flow mode, we find different nucleation and growth behavior for impurities from different sets. We characterize these differences through variations of the number of islands (Ni) and the average island size with coverage (θ). Further, we compute the critical nucleus size (i) for all of these cases from the distribution of capture-zone areas using the generalized Wigner distribution.

Fast, metadynamics-based method for prediction of the stereochemistry-dependent relative free energies of ligand-receptor interactions.

PubMed

Plazinska, Anita; Plazinski, Wojciech; Jozwiak, Krzysztof

2014-04-30

The computational approach applicable for the molecular dynamics (MD)-based techniques is proposed to predict the ligand-protein binding affinities dependent on the ligand stereochemistry. All possible stereoconfigurations are expressed in terms of one set of force-field parameters [stereoconfiguration-independent potential (SIP)], which allows for calculating all relative free energies by only single simulation. SIP can be used for studying diverse, stereoconfiguration-dependent phenomena by means of various computational techniques of enhanced sampling. The method has been successfully tested on the β2-adrenergic receptor (β2-AR) binding the four fenoterol stereoisomers by both metadynamics simulations and replica-exchange MD. Both the methods gave very similar results, fully confirming the presence of stereoselective effects in the fenoterol-β2-AR interactions. However, the metadynamics-based approach offered much better efficiency of sampling which allows for significant reduction of the unphysical region in SIP. Copyright © 2014 Wiley Periodicals, Inc.

New measurements of the sticking coefficient and binding energy of molecules on non-porous amorphous solid water in the submonolayer regime

NASA Astrophysics Data System (ADS)

He, Jiao; Acharyya, Kinsuk; Emtiaz, S. M.; Vidali, Gianfranco

2016-06-01

Sticking and adsorption of molecules on dust grains are two important processes in gas-grain interactions. We accurately measured both the sticking coefficient and the binding energy of several key molecules on the surface of amorphous solid water as a function of coverage.A time-resolved scattering technique was used to measure sticking coefficient of H2, D2, N2, O2, CO, CH4, and CO2 on non-porous amorphous solid water (np-ASW) in the low coverage limit over a wide range of surface temperatures. We found that the time-resolved scattering technique is advantageous over the conventional King-Wells method that underestimates the sticking coefficient. Based on the measured values we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy.We measured the binding energy of N2, CO, O2, CH4, and CO2 on np-ASW, and of N2 and CO on porous amorphous solid water (p-ASW). We were able to measure binding energies down to a fraction of 1% of a layer, thus making these measurements more appropriate for astrochemistry than the existing values. We found that CO2 forms clusters on np-ASW surface even at very low coverage; this may help in explaining the segregation of CO2 in ices. The binding energies of N2, CO, O2, and CH4 on np-ASW decrease with coverage in the submonolayer regime. Their values in the low coverage limit are much higher than what is commonly used in gas-grain models. An empirical formula was used to describe the coverage dependence of the binding energies. We used the newly determined binding energy distributions in a simulation of gas-grain chemistry for cold dense clouds and hot core models. We found that owing to the higher value of desorption energy in the sub-monlayer regime a fraction of all these ices stays much longer and to higher temperature on the grain surface compared to the case using single value energies as currently done in astrochemical models.This work was supported in part by a grant to GV from NSF --- Astronomy & Astrophysics Division (#1311958)

The electronic and optical properties of quantum nano-structures

NASA Astrophysics Data System (ADS)

Ham, Heon

In semiconducting quantum nano-structures, the excitonic effects play an important role when we fabricate opto-electronic devices, such as lasers, diodes, detectors, etc. To gain a better understanding of the excitonic effects in quantum nano-structures, we investigated the exciton binding energy, oscillator strength, and linewidth in quantum nano-structures using both the infinite and finite well models. We investigated also the hydrogenic impurity binding energy and the photoionization cross section of the hydrogenic impurity in a spherical quantum dot. In our work, the variational approach is used in all calculations, because the Hamiltonian of the system is not separable, due to the different symmetries of the Coulomb and confining potentials. In the infinite well model of the semiconducting quantum nanostructures, the binding energy of the exciton increases with decreasing width of the potential barriers due to the increase in the effective strength of the Coulomb interaction between the electron and hole. In the finite well model, the exciton binding energy reaches a peak value, and the binding energy decreases with further decrease in the width of the potential barriers. The exciton linewidth in the infinite well model increases with decreasing wire radius, because the scattering rate of the exciton increases with decreasing wire radius. In the finite well model, the exciton linewidth in a cylindrical quantum wire reaches a peak value and the exciton linewidth decreases with further decrease in the wire radius, because the exciton is not well confined at very smaller wire radii. The binding energy of the hydrogenic impurity in a spherical quantum dot has also calculated using both the infinite and the finite well models. The binding energy of the hydrogenic impurity was calculated for on center and off center impurities in the spherical quantum dots. With decreasing radii of the dots, the binding energy of the hydrogenic impurity increases in the infinite well model. The binding energy of the hydrogenic impurity in the finite well model reaches a peak value and decreases with further decrease in the dot radii for both on center and off center impurities. We have calculated the photoionization cross section as a function of the radius and the frequency using both the infinite and finite well models. The photoionizaton cross section has a peak value at a frequency where the photon energy equals the difference between the final and initial state energies of the impurity. The behavior of the cross section with dot radius depends upon the location of the impurity and the polarization of the electromagnetic field.

Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

PubMed

Kachhap, Sangita; Singh, Balvinder

2015-01-01

In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

Analytical excited state forces for the time-dependent density-functional tight-binding method.

PubMed

Heringer, D; Niehaus, T A; Wanko, M; Frauenheim, Th

2007-12-01

An analytical formulation for the geometrical derivatives of excitation energies within the time-dependent density-functional tight-binding (TD-DFTB) method is presented. The derivation is based on the auxiliary functional approach proposed in [Furche and Ahlrichs, J Chem Phys 2002, 117, 7433]. To validate the quality of the potential energy surfaces provided by the method, adiabatic excitation energies, excited state geometries, and harmonic vibrational frequencies were calculated for a test set of molecules in excited states of different symmetry and multiplicity. According to the results, the TD-DFTB scheme surpasses the performance of configuration interaction singles and the random phase approximation but has a lower quality than ab initio time-dependent density-functional theory. As a consequence of the special form of the approximations made in TD-DFTB, the scaling exponent of the method can be reduced to three, similar to the ground state. The low scaling prefactor and the satisfactory accuracy of the method makes TD-DFTB especially suitable for molecular dynamics simulations of dozens of atoms as well as for the computation of luminescence spectra of systems containing hundreds of atoms. (c) 2007 Wiley Periodicals, Inc.

Excitons, trions, and biexcitons in transition-metal dichalcogenides: Magnetic-field dependence

NASA Astrophysics Data System (ADS)

Van der Donck, M.; Zarenia, M.; Peeters, F. M.

2018-05-01

The influence of a perpendicular magnetic field on the binding energy and structural properties of excitons, trions, and biexcitons in monolayers of semiconducting transition metal dichalcogenides (TMDs) is investigated. The stochastic variational method (SVM) with a correlated Gaussian basis is used to calculate the different properties of these few-particle systems. In addition, we present a simplified variational approach which supports the SVM results for excitons as a function of magnetic field. The exciton diamagnetic shift is compared with recent experimental results, and we extend this concept to trions and biexcitons. The effect of a local potential fluctuation, which we model by a circular potential well, on the binding energy of trions and biexcitons is investigated and found to significantly increase the binding of those excitonic complexes.

Magnetic properties and core electron binding energies of liquid water

NASA Astrophysics Data System (ADS)

Galamba, N.; Cabral, Benedito J. C.

2018-01-01

The magnetic properties and the core and inner valence electron binding energies of liquid water are investigated. The adopted methodology relies on the combination of molecular dynamics and electronic structure calculations. Born-Oppenheimer molecular dynamics with the Becke and Lee-Yang-Parr functionals for exchange and correlation, respectively, and includes an empirical correction (BLYP-D3) functional and classical molecular dynamics with the TIP4P/2005-F model were carried out. The Keal-Tozer functional was applied for predicting magnetic shielding and spin-spin coupling constants. Core and inner valence electron binding energies in liquid water were calculated with symmetry adapted cluster-configuration interaction. The relationship between the magnetic shielding constant σ(17O), the role played by the oxygen atom as a proton acceptor and donor, and the tetrahedral organisation of liquid water are investigated. The results indicate that the deshielding of the oxygen atom in water is very dependent on the order parameter (q) describing the tetrahedral organisation of the hydrogen bond network. The strong sensitivity of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between σ(17O) and the energy gap between the 1a1[O1s] (core) and the 2a1 (inner valence) orbitals of water. Although several studies discussed the eventual connection between magnetic properties and core electron binding energies, such a correlation could not be clearly established. Here, we demonstrate that for liquid water this correlation exists although involving the gap between electron binding energies of core and inner valence orbitals.

Binding of transcriptional activators to sigma 54 in the presence of the transition state analog ADP–aluminum fluoride: insights into activator mechanochemical action

PubMed Central

Chaney, Matthew; Grande, Ricardo; Wigneshweraraj, Siva R.; Cannon, Wendy; Casaz, Paul; Gallegos, Maria-Trinidad; Schumacher, Jorg; Jones, Susan; Elderkin, Sarah; Dago, Angel Ernesto; Morett, Enrique; Buck, Martin

2001-01-01

Conformational changes in sigma 54 (ς54) and ς54-holoenzyme depend on nucleotide hydrolysis by an activator. We now show that ς54 and its holoenzyme bind to the central ATP-hydrolyzing domains of the transcriptional activators PspF and NifA in the presence of ADP–aluminum fluoride, an analog of ATP in the transition state for hydrolysis. Direct binding of ς54 Region I to activator in the presence of ADP–aluminum fluoride was shown and inferred from in vivo suppression genetics. Energy transduction appears to occur through activator contacts to ς54 Region I. ADP–aluminum fluoride-dependent interactions and consideration of other AAA+ proteins provide insight into activator mechanochemical action. PMID:11544185

Effect of van der Waals interactions on the structural and binding properties of GaSe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarkisov, Sergey Y., E-mail: sarkisov@mail.tsu.ru; Kosobutsky, Alexey V., E-mail: kosobutsky@kemsu.ru; Kemerovo State University, Krasnaya 6, 650043 Kemerovo

The influence of van der Waals interactions on the lattice parameters, band structure, elastic moduli and binding energy of layered GaSe compound has been studied using projector-augmented wave method within density functional theory. We employed the conventional local/semilocal exchange-correlation functionals and recently developed van der Waals functionals which are able to describe dispersion forces. It is found that application of van der Waals density functionals allows to substantially increase the accuracy of calculations of the lattice constants a and c and interlayer distance in GaSe at ambient conditions and under hydrostatic pressure. The pressure dependences of the a-parameter, Ga–Ga, Ga–Semore » bond lengths and Ga–Ga–Se bond angle are characterized by a relatively low curvature, while c(p) has a distinct downward bowing due to nonlinear shrinking of the interlayer spacing. From the calculated binding energy curves we deduce the interlayer binding energy of GaSe, which is found to be in the range 0.172–0.197 eV/layer (14.2–16.2 meV/Å{sup 2}). - Highlights: • Effects of van der Waals interactions are analyzed using advanced density functionals. • Calculations with vdW-corrected functionals closely agree with experiment. • Interlayer binding energy of GaSe is estimated to be 14.2–16.2 meV/Å{sup 2}.« less

Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

DOE PAGES

Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...

2011-01-01

We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less

Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

Theoretical Insights into Methane C–H Bond Activation on Alkaline Metal Oxides

DOE PAGES

Aljama, Hassan; Nørskov, Jens K.; Abild-Pedersen, Frank

2017-07-17

Here, we investigate the role of alkaline metal oxides (AMO) (MgO, CaO, and SrO) in activating the C–H bond in methane. We also use Density Functional Theory (DFT) and microkinetic modeling to study the catalytic elementary steps in breaking the C–H bond in methane and creating the methyl radical, a precursor prior to creating C2 products. We also study the effects of surface geometry on the catalytic activity of AMO by examining terrace and step sites. We observe that the process of activating methane depends strongly on the structure of the AMO. When the AMO surface is doped with anmore » alkali metal, the transition state (TS) structure has a methyl radical-like behavior, where the methyl radical interacts weakly with the AMO surface. In this case, the TS energy scales with the hydrogen binding energy. On pure AMO, the TS interacts with AMO surface oxygen as well as the metal atom on the surface, and consequently the TS energy scales with the binding energy of hydrogen and methyl. We study the activity of AMO using a mean-field microkinetic model. The results indicate that terrace sites have similar catalytic activity, with the exception of MgO(100). Step sites bind hydrogen more strongly, making them more active, and this confirms previously reported experimental results. We map the catalytic activity of AMO using a volcano plot with two descriptors: the methyl and the hydrogen binding energies, with the latter being a more significant descriptor. The microkinetic model results suggest that C–H bond dissociation is not always the rate-limiting step. At weak hydrogen binding, the reaction is limited by C–H bond activation. At strong hydrogen binding, the reaction is limited due to poisoning of the active site. We found an increase in activity of AMO as the basicity increased. Finally, the developed microkinetic model allows screening for improved catalysts using simple calculations of the hydrogen binding energy.« less

Regulation of Polycystin-1 Function by Calmodulin Binding

PubMed Central

Doerr, Nicholas; Wang, Yidi; Kipp, Kevin R.; Liu, Guangyi; Benza, Jesse J.; Pletnev, Vladimir; Pavlov, Tengis S.; Staruschenko, Alexander; Mohieldin, Ashraf M.; Takahashi, Maki; Nauli, Surya M.; Weimbs, Thomas

2016-01-01

Autosomal Dominant Polycystic Kidney Disease (ADPKD) is a common genetic disease that leads to progressive renal cyst growth and loss of renal function, and is caused by mutations in the genes encoding polycystin-1 (PC1) and polycystin-2 (PC2), respectively. The PC1/PC2 complex localizes to primary cilia and can act as a flow-dependent calcium channel in addition to numerous other signaling functions. The exact functions of the polycystins, their regulation and the purpose of the PC1/PC2 channel are still poorly understood. PC1 is an integral membrane protein with a large extracytoplasmic N-terminal domain and a short, ~200 amino acid C-terminal cytoplasmic tail. Most proteins that interact with PC1 have been found to bind via the cytoplasmic tail. Here we report that the PC1 tail has homology to the regulatory domain of myosin heavy chain including a conserved calmodulin-binding motif. This motif binds to CaM in a calcium-dependent manner. Disruption of the CaM-binding motif in PC1 does not affect PC2 binding, cilia targeting, or signaling via heterotrimeric G-proteins or STAT3. However, disruption of CaM binding inhibits the PC1/PC2 calcium channel activity and the flow-dependent calcium response in kidney epithelial cells. Furthermore, expression of CaM-binding mutant PC1 disrupts cellular energy metabolism. These results suggest that critical functions of PC1 are regulated by its ability to sense cytosolic calcium levels via binding to CaM. PMID:27560828

Bonding in the first-row diatomic molecules within the local spin-density approximation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Painter, G.S.; Averill, F.W.

1982-08-15

The Hohenberg-Kohn-Sham density-functional equations in the local spin-density approximation (LSDA) have been solved with essentially no loss of accuracy for dimers of the first row of the Periodic Table with the use of a fully-self-consistent spin-polarized Gaussian-orbital approach. Spectroscopic constants (binding energies, equilibrium separations, and ground-state vibrational frequencies) have been derived from the calculated potential-energy curves. Intercomparison of results obtained using the exchange-correlation functionals of Slater (scaled exchange or X..cap alpha..), Gunnarsson and Lundqvist (GL), and Vosko, Wilk, and Nusair (VWN) permits assessment of the relative merits of each and serves to identify general shortcomings in the LSDA. Basic trendsmore » are similar for each functional, but the treatment of the spin dependence of the exchange-correlation energy in the GL and VWN functionals yields a variation of the binding energy across the series which is more systematic than that in the X..cap alpha.. approximation. Agreement between the present results and those of Dunlap, Connolly, and Sabin in the X..cap alpha.., approximation confirms the accuracy of the variational charge-density-fit procedure used in the latter work. The refinements in correlation treatment within the VWN functional are reflected in improvements in binding energies which are only slight for most dimers in the series. This behavior is attributed to the error remaining in the exchange channel within the LSDA and demonstrates the necessity for self-interaction corrections for more accurate binding-energy determinations. Within the current LSDA, absolute accuracies of the VWN functional for the first-row dimers are within 2.3 eV for binding energies, 0.07 a.u. for bond lengths, and approx.200 cm/sup -1/ for vibrational frequencies.« less

4He binding energy calculation including full tensor-force effects

NASA Astrophysics Data System (ADS)

Fonseca, A. C.

1989-09-01

The four-body equations of Alt, Grassberger, and Sandhas are solved in the version where the (2)+(2) subamplitudes are treated exactly by convolution, using one-term separable Yamaguchy nucleon-nucleon potentials in the 1S0 and 3S1-3D1 channels. The resulting jp=1/2+ and (3/2+ three-body subamplitudes are represented in a separable form using the energy-dependent pole expansion. Converged bound-state results are calculated for the first time using the full interaction, and are compared with those obtained from a simplified treatment of the tensor force. The Tjon line that correlates three-nucleon and four-nucleon binding energies is shown using different nucleon-nucleon potentials. In all calculations the Coulomb force has been neglected.

Momentum distributions of isotopes produced by fragmentation of relativistic C-12 and O-16 projectiles

NASA Technical Reports Server (NTRS)

Greiner, D. E.; Lindstrom, P. J.; Heckman, H. H.; Cork, B.; Bieser, F. S.

1975-01-01

The fragment momentum distributions in the projectile rest frame are, typically, Gaussian shaped, narrow, consistent with isotropy, depend on fragment and projectile, and have no significant correlation with target mass or beam energy. The nuclear temperature is inferred from the momentum distributions of the fragments and is approximately equal to the projectile nuclear binding energy, indicative of small energy transfer between target and fragment.

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

NASA Astrophysics Data System (ADS)

Hong, Sung-Young; Xu, Pan; Camillone, Nina R.; White, Michael G.; Camillone, Nicholas

2016-07-01

We report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate-adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probability increases roughly two orders magnitude, and (ii) the adsorbate-substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate-substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, ηel, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of ηel largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Sung -Young; Xu, Pan; Camillone, Nina R.

Here, we report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probabilitymore » increases roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η el, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η el largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Sung-Young; Camillone, Nina R.; Camillone, Nicholas, E-mail: nicholas@bnl.gov

We report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probability increasesmore » roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η{sub el}, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η{sub el} largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE PAGES

Hong, Sung -Young; Xu, Pan; Camillone, Nina R.; ...

2016-07-01

Here, we report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probabilitymore » increases roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η el, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η el largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

Interaction energies for the purine inhibitor roscovitine with cyclin-dependent kinase 2: correlated ab initio quantum-chemical, DFT and empirical calculations.

PubMed

Dobes, Petr; Otyepka, Michal; Strnad, Miroslav; Hobza, Pavel

2006-05-24

The interaction between roscovitine and cyclin-dependent kinase 2 (cdk2) was investigated by performing correlated ab initio quantum-chemical calculations. The whole protein was fragmented into smaller systems consisting of one or a few amino acids, and the interaction energies of these fragments with roscovitine were determined by using the MP2 method with the extended aug-cc-pVDZ basis set. For selected complexes, the complete basis set limit MP2 interaction energies, as well as the coupled-cluster corrections with inclusion of single, double and noninteractive triples contributions [CCSD(T)], were also evaluated. The energies of interaction between roscovitine and small fragments and between roscovitine and substantial sections of protein (722 atoms) were also computed by using density-functional tight-binding methods covering dispersion energy (DFTB-D) and the Cornell empirical potential. Total stabilisation energy originates predominantly from dispersion energy and methods that do not account for the dispersion energy cannot, therefore, be recommended for the study of protein-inhibitor interactions. The Cornell empirical potential describes reasonably well the interaction between roscovitine and protein; therefore, this method can be applied in future thermodynamic calculations. A limited number of amino acid residues contribute significantly to the binding of roscovitine and cdk2, whereas a rather large number of amino acids make a negligible contribution.

Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

PubMed

Hong, Seung Hwan; Choi, Han-Yong

2013-09-11

We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

Two-Photon Absorption and Two-Photon-Induced Gain in Perovskite Quantum Dots.

PubMed

Nagamine, Gabriel; Rocha, Jaqueline O; Bonato, Luiz G; Nogueira, Ana F; Zaharieva, Zhanet; Watt, Andrew A R; de Brito Cruz, Carlos H; Padilha, Lazaro A

2018-06-21

Perovskite quantum dots (PQDs) emerged as a promising class of material for applications in lighting devices, including light emitting diodes and lasers. In this work, we explore nonlinear absorption properties of PQDs showing the spectral signatures and the size dependence of their two-photon absorption (2PA) cross-section, which can reach values higher than 10 6 GM. The large 2PA cross section allows for low threshold two-photon induced amplified spontaneous emission (ASE), which can be as low as 1.6 mJ/cm 2 . We also show that the ASE properties are strongly dependent on the nanomaterial size, and that the ASE threshold, in terms of the average number of excitons, decreases for smaller PQDs. Investigating the PQDs biexciton binding energy, we observe strong correlation between the increasing on the biexciton binding energy and the decreasing on the ASE threshold, suggesting that ASE in PQDs is a biexciton-assisted process.

Variational method for calculating the binding energy of the base state of an impurity D- centered on a quantum dot of GaAs-Ga1-xAlxAs

NASA Astrophysics Data System (ADS)

Durán-Flórez, F.; Caicedo, L. C.; Gonzalez, J. E.

2018-04-01

In quantum mechanics it is very difficult to obtain exact solutions, therefore, it is necessary to resort to tools and methods that facilitate the calculations of the solutions of these systems, one of these methods is the variational method that consists in proposing a wave function that depend on several parameters that are adjusted to get close to the exact solution. Authors in the past have performed calculations applying this method using exponential and Gaussian orbital functions with linear and quadratic correlation factors. In this paper, a Gaussian function with a linear correlation factor is proposed, for the calculation of the binding energy of an impurity D ‑ centered on a quantum dot of radius r, the Gaussian function is dependent on the radius of the quantum dot.

Basis sets for the calculation of core-electron binding energies

NASA Astrophysics Data System (ADS)

Hanson-Heine, Magnus W. D.; George, Michael W.; Besley, Nicholas A.

2018-05-01

Core-electron binding energies (CEBEs) computed within a Δ self-consistent field approach require large basis sets to achieve convergence with respect to the basis set limit. It is shown that supplementing a basis set with basis functions from the corresponding basis set for the element with the next highest nuclear charge (Z + 1) provides basis sets that give CEBEs close to the basis set limit. This simple procedure provides relatively small basis sets that are well suited for calculations where the description of a core-ionised state is important, such as time-dependent density functional theory calculations of X-ray emission spectroscopy.

Equilibrium structure and atomic vibrations of Nin clusters

NASA Astrophysics Data System (ADS)

Borisova, Svetlana D.; Rusina, Galina G.

2017-12-01

The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

Free energy of a heavy quark-antiquark pair in a thermal medium from AdS/CFT

NASA Astrophysics Data System (ADS)

Ewerz, Carlo; Kaczmarek, Olaf; Samberg, Andreas

2018-03-01

We study the free energy of a heavy quark-antiquark pair in a thermal medium using the AdS/CFT correspondence. We point out that a commonly used prescription for calculating this quantity leads to a temperature dependence in conflict with general properties of the free energy. The problem originates from a particular way of subtracting divergences. We argue that the commonly used prescription gives rise to the binding energy rather than the free energy. We consider a different subtraction procedure and show that the resulting free energy is well-behaved and in qualitative agreement with results from lattice QCD. The free energy and the binding energy of the quark pair are computed for N=4 supersymmetric Yang-Mills theory and several non-conformal theories. We also calculate the entropy and the internal energy of the pair in these theories. Using the consistent subtraction, we further study the free energy, entropy, and internal energy of a single heavy quark in the thermal medium for various theories. Also here the results are found to be in qualitative agreement with lattice QCD results.

Single-molecule FRET reveals the energy landscape of the full-length SAM-I riboswitch.

PubMed

Manz, Christoph; Kobitski, Andrei Yu; Samanta, Ayan; Keller, Bettina G; Jäschke, Andres; Nienhaus, G Ulrich

2017-11-01

S-adenosyl-L-methionine (SAM) ligand binding induces major structural changes in SAM-I riboswitches, through which gene expression is regulated via transcription termination. Little is known about the conformations and motions governing the function of the full-length Bacillus subtilis yitJ SAM-I riboswitch. Therefore, we have explored its conformational energy landscape as a function of Mg 2+ and SAM ligand concentrations using single-molecule Förster resonance energy transfer (smFRET) microscopy and hidden Markov modeling analysis. We resolved four conformational states both in the presence and the absence of SAM and determined their Mg 2+ -dependent fractional populations and conformational dynamics, including state lifetimes, interconversion rate coefficients and equilibration timescales. Riboswitches with terminator and antiterminator folds coexist, and SAM binding only gradually shifts the populations toward terminator states. We observed a pronounced acceleration of conformational transitions upon SAM binding, which may be crucial for off-switching during the brief decision window before expression of the downstream gene.

Metal cation dependence of interactions with amino acids: bond dissociation energies of Rb(+) and Cs(+) to the acidic amino acids and their amide derivatives.

PubMed

Armentrout, P B; Yang, Bo; Rodgers, M T

2014-04-24

Metal cation-amino acid interactions are key components controlling the secondary structure and biological function of proteins, enzymes, and macromolecular complexes comprising these species. Determination of pairwise interactions of alkali metal cations with amino acids provides a thermodynamic vocabulary that begins to quantify these fundamental processes. In the present work, we expand a systematic study of such interactions by examining rubidium and cesium cations binding with the acidic amino acids (AA), aspartic acid (Asp) and glutamic acid (Glu), and their amide derivatives, asparagine (Asn) and glutamine (Gln). These eight complexes are formed using electrospray ionization and their bond dissociation energies (BDEs) are determined experimentally using threshold collision-induced dissociation with xenon in a guided ion beam tandem mass spectrometer. Analyses of the energy-dependent cross sections include consideration of unimolecular decay rates, internal energy of the reactant ions, and multiple ion-neutral collisions. Quantum chemical calculations are conducted at the B3LYP, MP2(full), and M06 levels of theory using def2-TZVPPD basis sets, with results showing reasonable agreement with experiment. At 0 and 298 K, most levels of theory predict that the ground-state conformers for M(+)(Asp) and M(+)(Asn) involve tridentate binding of the metal cation to the backbone carbonyl, amino, and side-chain carbonyl groups, although tridentate binding to the carboxylic acid group and side-chain carbonyl is competitive for M(+)(Asn). For the two longer side-chain amino acids, Glu and Gln, multiple structures are competitive. A comparison of these results to those for the smaller alkali cations, Na(+) and K(+), provides insight into the trends in binding energies associated with the molecular polarizability and dipole moment of the side chain. For all four metal cations, the BDEs are inversely correlated with the size of the metal cation and follow the order Asp < Glu < Asn < Gln.

Energetics and kinetics of cooperative cofilin-actin filament interactions.

PubMed

Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

2006-08-11

We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

Density-based Energy Decomposition Analysis for Intermolecular Interactions with Variationally Determined Intermediate State Energies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Q.; Ayers, P.W.; Zhang, Y.

2009-10-28

The first purely density-based energy decomposition analysis (EDA) for intermolecular binding is developed within the density functional theory. The most important feature of this scheme is to variationally determine the frozen density energy, based on a constrained search formalism and implemented with the Wu-Yang algorithm [Q. Wu and W. Yang, J. Chem. Phys. 118, 2498 (2003) ]. This variational process dispenses with the Heitler-London antisymmetrization of wave functions used in most previous methods and calculates the electrostatic and Pauli repulsion energies together without any distortion of the frozen density, an important fact that enables a clean separation of these twomore » terms from the relaxation (i.e., polarization and charge transfer) terms. The new EDA also employs the constrained density functional theory approach [Q. Wu and T. Van Voorhis, Phys. Rev. A 72, 24502 (2005)] to separate out charge transfer effects. Because the charge transfer energy is based on the density flow in real space, it has a small basis set dependence. Applications of this decomposition to hydrogen bonding in the water dimer and the formamide dimer show that the frozen density energy dominates the binding in these systems, consistent with the noncovalent nature of the interactions. A more detailed examination reveals how the interplay of electrostatics and the Pauli repulsion determines the distance and angular dependence of these hydrogen bonds.« less

Nature of the high-binding-energy dip in the low-temperature photoemission spectra of Bi2Sr2CaCu2O8+δ

NASA Astrophysics Data System (ADS)

Dessau, D. S.; Shen, Z.-X.; Wells, B. O.; King, D. M.; Spicer, W. E.; Arko, A. J.; Lombardo, L. W.; Mitzi, D. B.; Kapitulnik, A.

1992-03-01

At the transition to superconductivity, an anomalous high-binding-energy (~=-90 meV) dip appears in the low-temperature photoemission spectra taken along the Γ-M¯ high-symmetry direction of Bi2Sr2CaCu2O8+δ. This paper details experiments which further characterize the energy and k-space dependence of this dip structure. The dip occurs over a wide portion of the Γ-M¯ zone diagonal (110), yet shows minimal energy dispersion. In the spectra taken along the Γ-X zone edge (100), the dip is very weak or not present. We show that these results imply that the dip is not an artifact dependent on the experiment or special features of the band structure and therefore is an intrinsic feature of the superconducting state of Bi2Sr2CaCu2O8+δ. The behavior of the normal-state bands along Γ-M¯ in relation to the local-density-approximation prediction of a Bi-O-based electron ``pocket'' is also discussed, with our data explained most naturally if the Bi-O band remains above the Fermi level for all k.

Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

PubMed

Rohs, Remo; Sklenar, Heinz

2004-04-01

The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dhaka, R. S.; Barman, S. R.

Ne 1s core-level photoelectron spectra from Ne nanobubbles implanted in aluminum exhibit two peaks whose binding energies and relative intensities change with implantation energy, isochronal annealing, and sputtering. These changes in the core-level spectra are manifestations of the nanometer size of the bubbles since the screening of the photohole by the Al conduction electrons depends on the bubble size. Existence of a bimodal depth and size distribution of Ne nanobubbles is demonstrated in this work: smaller bubbles of about 4 A in radius are formed close to the Al(111) surface while the larger sized bubbles of 20 A in radiusmore » exist deeper below in the beneath subsurface region. A general relation between the radius of the rare-gas bubbles and their core-level binding energies is established.« less

Structure, bonding nature, and binding energy of alkanethiolate on As-rich GaAs (001) surface: a density functional theory study.

PubMed

Voznyy, Oleksandr; Dubowski, Jan J

2006-11-30

Chemisorption of alkanethiols on As-rich GaAs (001) surface under a low coverage condition was studied using first principles density functional calculations in a periodic supercell approach. The thiolate adsorption site, tilt angle and its direction are dictated by the high directionality of As dangling bond and sulfur 3p orbital participating in bonding and steric repulsion of the first three CH2 units from the surface. Small charge transfer between thiolate and surface, strong dependence of total energy on tilt angle, and a relatively short length of 2.28 A of the S-As bond indicate the highly covalent nature of the bonding. Calculated binding energy of 2.1 eV is consistent with the available experimental data.

Quantifying the topography of the intrinsic energy landscape of flexible biomolecular recognition

PubMed Central

Chu, Xiakun; Gan, Linfeng; Wang, Erkang; Wang, Jin

2013-01-01

Biomolecular functions are determined by their interactions with other molecules. Biomolecular recognition is often flexible and associated with large conformational changes involving both binding and folding. However, the global and physical understanding for the process is still challenging. Here, we quantified the intrinsic energy landscapes of flexible biomolecular recognition in terms of binding–folding dynamics for 15 homodimers by exploring the underlying density of states, using a structure-based model both with and without considering energetic roughness. By quantifying three individual effective intrinsic energy landscapes (one for interfacial binding, two for monomeric folding), the association mechanisms for flexible recognition of 15 homodimers can be classified into two-state cooperative “coupled binding–folding” and three-state noncooperative “folding prior to binding” scenarios. We found that the association mechanism of flexible biomolecular recognition relies on the interplay between the underlying effective intrinsic binding and folding energy landscapes. By quantifying the whole global intrinsic binding–folding energy landscapes, we found strong correlations between the landscape topography measure Λ (dimensionless ratio of energy gap versus roughness modulated by the configurational entropy) and the ratio of the thermodynamic stable temperature versus trapping temperature, as well as between Λ and binding kinetics. Therefore, the global energy landscape topography determines the binding–folding thermodynamics and kinetics, crucial for the feasibility and efficiency of realizing biomolecular function. We also found “U-shape” temperature-dependent kinetic behavior and a dynamical cross-over temperature for dividing exponential and nonexponential kinetics for two-state homodimers. Our study provides a unique way to bridge the gap between theory and experiments. PMID:23754431

Role of the pH in state-dependent blockade of hERG currents

NASA Astrophysics Data System (ADS)

Wang, Yibo; Guo, Jiqing; Perissinotti, Laura L.; Lees-Miller, James; Teng, Guoqi; Durdagi, Serdar; Duff, Henry J.; Noskov, Sergei Yu.

2016-10-01

Mutations that reduce inactivation of the voltage-gated Kv11.1 potassium channel (hERG) reduce binding for a number of blockers. State specific block of the inactivated state of hERG block may increase risks of drug-induced Torsade de pointes. In this study, molecular simulations of dofetilide binding to the previously developed and experimentally validated models of the hERG channel in open and open-inactivated states were combined with voltage-clamp experiments to unravel the mechanism(s) of state-dependent blockade. The computations of the free energy profiles associated with the drug block to its binding pocket in the intra-cavitary site display startling differences in the open and open-inactivated states of the channel. It was also found that drug ionization may play a crucial role in preferential targeting to the open-inactivated state of the pore domain. pH-dependent hERG blockade by dofetilie was studied with patch-clamp recordings. The results show that low pH increases the extent and speed of drug-induced block. Both experimental and computational findings indicate that binding to the open-inactivated state is of key importance to our understanding of the dofetilide’s mode of action.

Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

2016-05-14

We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less

Theory for rates, equilibrium constants, and Brønsted slopes in F1-ATPase single molecule imaging experiments

PubMed Central

Volkán-Kacsó, Sándor; Marcus, Rudolph A.

2015-01-01

A theoretical model of elastically coupled reactions is proposed for single molecule imaging and rotor manipulation experiments on F1-ATPase. Stalling experiments are considered in which rates of individual ligand binding, ligand release, and chemical reaction steps have an exponential dependence on rotor angle. These data are treated in terms of the effect of thermodynamic driving forces on reaction rates, and lead to equations relating rate constants and free energies to the stalling angle. These relations, in turn, are modeled using a formalism originally developed to treat electron and other transfer reactions. During stalling the free energy profile of the enzymatic steps is altered by a work term due to elastic structural twisting. Using biochemical and single molecule data, the dependence of the rate constant and equilibrium constant on the stall angle, as well as the Børnsted slope are predicted and compared with experiment. Reasonable agreement is found with stalling experiments for ATP and GTP binding. The model can be applied to other torque-generating steps of reversible ligand binding, such as ADP and Pi release, when sufficient data become available. PMID:26483483

Comparison of calculation and experiment implicates significant electrostatic contributions to the binding stability of barnase and barstar.

PubMed

Dong, Feng; Vijayakumar, M; Zhou, Huan-Xiang

2003-07-01

The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (epsilon (p)) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with epsilon (p) = 4; and c), "SE + epsilon (p) = 20." The "vdW + epsilon (p) = 4" and "SE + epsilon (p) = 20" protocols predicted an overall electrostatic stabilization whereas the "SE + epsilon (p) = 4" protocol predicted an overall electrostatic destabilization. The "vdW + epsilon (p) = 4" protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the "SE + epsilon (p) = 4" protocol predicted significantly larger coupling energies of charge pairs whereas the "SE + epsilon (p) = 20" protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol.

Energy Dissipation and Nonthermal Diffusion on Interstellar Ice Grains

NASA Astrophysics Data System (ADS)

Fredon, A.; Lamberts, T.; Cuppen, H. M.

2017-11-01

Interstellar dust grains are known to facilitate chemical reactions by acting as a meeting place and adsorbing energy. This process strongly depends on the ability of the reactive species to effectively diffuse over the surface. The cold temperatures around 10 K strongly hamper this for species other than H and H2. However, complex organic molecules have been observed in the gas phase at these cold conditions, indicating that their formation, as well as their return to the gas phase, should be effective. Here, we show how the energy released following surface reactions can be employed to solve both problems by inducing desorption or diffusion. To this purpose, we have performed thousands of Molecular Dynamics simulations to quantify the outcome of an energy dissipation process. Admolecules on top of a crystalline water surface have been given translational energy between 0.5 and 5 eV. Three different surface species are considered (CO2, H2O, and CH4), spanning a range in binding energies, number of internal degrees of freedom, and molecular weights. The admolecules are found to be able to travel up to several hundreds of angstroms before coming to a stand still, allowing for follow-up reactions en route. The probability of travel beyond any particular radius, as determined by our simulations, shows the same r dependence for all three admolecule species. Furthermore, we have been able to quantify the desorption probability, which depends on the binding energy of the species and the translational excitation. We provide expressions that can be incorporated in astrochemical models to predict grain surface formation and return into the gas phase of these products.

Temperature-Dependent Energy Gap Shift and Thermally Activated Transition in Multilayer CdTe/ZnTe Quantum Dots.

PubMed

Man, Minh Tan; Lee, Hong Seok

2015-10-01

We investigated the influence of growth conditions on carrier dynamics in multilayer CdTe/ZnTe quantum dots (QDs) by monitoring the temperature dependence of the photoluminescence emission energy. The results were analyzed using the empirical Varshni and O'Donnell relations for temperature variation of the energy gap shift. Best fit values showed that the thermally activated transition between two different states occurs due to band low-temperature quenching with values separated by 5.0-6.5 meV. The addition of stack periods in multilayer CdTe/ZnTe QDs plays an important role in the energy gap shift, where the exciton binding energy is enhanced, and, conversely, the exciton-phonon coupling strength is suppressed with an average energy of 19.3-19.8 meV.

Interaction of two walkers: wave-mediated energy and force.

PubMed

Borghesi, Christian; Moukhtar, Julien; Labousse, Matthieu; Eddi, Antonin; Fort, Emmanuel; Couder, Yves

2014-12-01

A bouncing droplet, self-propelled by its interaction with the waves it generates, forms a classical wave-particle association called a "walker." Previous works have demonstrated that the dynamics of a single walker is driven by its global surface wave field that retains information on its past trajectory. Here we investigate the energy stored in this wave field for two coupled walkers and how it conveys an interaction between them. For this purpose, we characterize experimentally the "promenade modes" where two walkers are bound and propagate together. Their possible binding distances take discrete values, and the velocity of the pair depends on their mutual binding. The mean parallel motion can be either rectilinear or oscillating. The experimental results are recovered analytically with a simple theoretical framework. A relation between the kinetic energy of the droplets and the total energy of the standing waves is established.

Free energies of binding from large-scale first-principles quantum mechanical calculations: application to ligand hydration energies.

PubMed

Fox, Stephen J; Pittock, Chris; Tautermann, Christofer S; Fox, Thomas; Christ, Clara; Malcolm, N O J; Essex, Jonathan W; Skylaris, Chris-Kriton

2013-08-15

Schemes of increasing sophistication for obtaining free energies of binding have been developed over the years, where configurational sampling is used to include the all-important entropic contributions to the free energies. However, the quality of the results will also depend on the accuracy with which the intermolecular interactions are computed at each molecular configuration. In this context, the energy change associated with the rearrangement of electrons (electronic polarization and charge transfer) upon binding is a very important effect. Classical molecular mechanics force fields do not take this effect into account explicitly, and polarizable force fields and semiempirical quantum or hybrid quantum-classical (QM/MM) calculations are increasingly employed (at higher computational cost) to compute intermolecular interactions in free-energy schemes. In this work, we investigate the use of large-scale quantum mechanical calculations from first-principles as a way of fully taking into account electronic effects in free-energy calculations. We employ a one-step free-energy perturbation (FEP) scheme from a molecular mechanical (MM) potential to a quantum mechanical (QM) potential as a correction to thermodynamic integration calculations within the MM potential. We use this approach to calculate relative free energies of hydration of small aromatic molecules. Our quantum calculations are performed on multiple configurations from classical molecular dynamics simulations. The quantum energy of each configuration is obtained from density functional theory calculations with a near-complete psinc basis set on over 600 atoms using the ONETEP program.

Thermodynamic stability of carbonic anhydrase: measurements of binding affinity and stoichiometry using ThermoFluor.

PubMed

Matulis, Daumantas; Kranz, James K; Salemme, F Raymond; Todd, Matthew J

2005-04-05

ThermoFluor (a miniaturized high-throughput protein stability assay) was used to analyze the linkage between protein thermal stability and ligand binding. Equilibrium binding ligands increase protein thermal stability by an amount proportional to the concentration and affinity of the ligand. Binding constants (K(b)) were measured by examining the systematic effect of ligand concentration on protein stability. The precise ligand effects depend on the thermodynamics of protein stability: in particular, the unfolding enthalpy. An extension of current theoretical treatments was developed for tight binding inhibitors, where ligand effect on T(m) can also reveal binding stoichiometry. A thermodynamic analysis of carbonic anhydrase by differential scanning calorimetry (DSC) enabled a dissection of the Gibbs free energy of stability into enthalpic and entropic components. Under certain conditions, thermal stability increased by over 30 degrees C; the heat capacity of protein unfolding was estimated from the dependence of calorimetric enthalpy on T(m). The binding affinity of six sulfonamide inhibitors to two isozymes (human type 1 and bovine type 2) was analyzed by both ThermoFluor and isothermal titration calorimetry (ITC), resulting in a good correlation in the rank ordering of ligand affinity. This combined investigation by ThermoFluor, ITC, and DSC provides a detailed picture of the linkage between ligand binding and protein stability. The systematic effect of ligands on stability is shown to be a general tool to measure affinity.

Structural Reorganization and the Cooperative Binding of Single-stranded Telomere DNA in Sterkiella nova*

PubMed Central

Buczek, Pawel; Horvath, Martin P.

2009-01-01

In Sterkiella nova, α and β telomere proteins bind cooperatively with single-stranded DNA to form a ternary α·β·DNA complex. Association of telomere protein subunits is DNA-dependent, and α-β association enhances DNA affinity. To further understand the molecular basis for binding cooperativity, we characterized several possible stepwise assembly pathways using isothermal titration calorimetry. In one path, α and DNA first form a stable α·DNA complex followed by addition of β in a second step. Binding energy accumulates with nearly equal free energy of association for each of these steps. Heat capacity is nonetheless dramatically different with ΔCp = −305 ± 3 cal mol−1 K−1 for α binding with DNA and ΔCp = −2010 ± 20 cal mol−1 K−1 for addition of β to complete the α·β·DNA complex. By examining alternate routes including titration of single-stranded DNA with a preformed α·β complex, a significant portion of binding energy and heat capacity could be assigned to structural reorganization involving protein-protein interactions and repositioning of the DNA. Structural reorganization probably affords a mechanism to regulate high affinity binding of telomere single-stranded DNA with important implications for telomere biology. Regulation of telomere complex dissociation is thought to involve post-translational modifications in the lysine-rich C-terminal portion of β. We observed no difference in binding energetics or crystal structure when comparing complexes prepared with full-length β or a C-terminally truncated form, supporting interesting parallels between the intrinsically disordered regions of histones and this portion of β. PMID:17082188

How strong is the edge effect in the adsorption of anticancer drugs on a graphene cluster?

PubMed

Rungnim, Chompoonut; Chanajaree, Rungroj; Rungrotmongkol, Thanyada; Hannongbua, Supot; Kungwan, Nawee; Wolschann, Peter; Karpfen, Alfred; Parasuk, Vudhichai

2016-04-01

The adsorption of nucleobase-analog anticancer drugs (fluorouracil, thioguanine, and mercaptopurine) on a graphene flake (C54H18) was investigated by shifting the site at which adsorption occurs from one end of the sheet to the other end. The counterpoise-corrected M06-2X/cc-pVDZ binding energies revealed that the binding stability decreases in the sequence thioguanine > mercaptopurine > fluorouracil. We found that adsorption near the middle of the sheet is more favorable than adsorption near the edge due to the edge effect. This edge effect is stronger for the adsorption of thioguanine or mercaptopurine than for fluorouracil adsorption. However, the edge effect reduces the binding energy of the drug to the flake by only a small amount, <5 kcal/mol, depending on the adsorption site and the alignment of the drug at this site.

Energy-resolved collision-induced dissociation studies of 1,10-phenanthroline complexes of the late first-row divalent transition metal cations: determination of the third sequential binding energies.

PubMed

Nose, Holliness; Chen, Yu; Rodgers, M T

2013-05-23

The third sequential binding energies of the late first-row divalent transition metal cations to 1,10-phenanthroline (Phen) are determined by energy-resolved collision-induced dissociation (CID) techniques using a guided ion beam tandem mass spectrometer. Five late first-row transition metal cations in their +2 oxidation states are examined including: Fe(2+), Co(2+), Ni(2+), Cu(2+), and Zn(2+). The kinetic energy dependent CID cross sections for loss of an intact Phen ligand from the M(2+)(Phen)3 complexes are modeled to obtain 0 and 298 K bond dissociation energies (BDEs) after accounting for the effects of the internal energy of the complexes, multiple ion-neutral collisions, and unimolecular decay rates. Electronic structure theory calculations at the B3LYP, BHandHLYP, and M06 levels of theory are employed to determine the structures and theoretical estimates for the first, second, and third sequential BDEs of the M(2+)(Phen)x complexes. B3LYP was found to deliver results that are most consistent with the measured values. Periodic trends in the binding of these complexes are examined and compared to the analogous complexes to the late first-row monovalent transition metal cations, Co(+), Ni(+), Cu(+), and Zn(+), previously investigated.

A thermodynamic approach to link self-organization, preferential flow and rainfall-runoff behaviour

NASA Astrophysics Data System (ADS)

Zehe, E.; Ehret, U.; Blume, T.; Kleidon, A.; Scherer, U.; Westhoff, M.

2013-11-01

This study investigates whether a thermodynamically optimal hillslope structure can, if existent, serve as a first guess for uncalibrated predictions of rainfall-runoff. To this end we propose a thermodynamic framework to link rainfall-runoff processes and dynamics of potential energy, kinetic energy and capillary binding energy in catchments and hillslopes. The starting point is that hydraulic equilibrium in soil corresponds to local thermodynamic equilibrium (LTE), characterized by a local maximum entropy/minimum of free energy of soil water. Deviations from LTE occur either due to evaporative losses, which increase absolute values of negative capillary binding energy of soil water and reduce its potential energy, or due to infiltration of rainfall, which increases potential energy of soil water and reduces the strength of capillary binding energy. The amplitude and relaxation time of these deviations depend on climate, vegetation, soil hydraulic functions, topography and density of macropores. Based on this framework we analysed the free energy balance of hillslopes within numerical experiments that perturbed model structures with respect to the surface density of macropores. These model structures have been previously shown to allow successful long-term simulations of the water balances of the Weiherbach and the Malalcahuello catchments, which are located in distinctly different pedological and climatic settings. Our findings offer a new perspective on different functions of preferential flow paths depending on the pedological setting. Free energy dynamics of soil water in the cohesive soils of the Weiherbach is dominated by dynamics of capillary binding energy. Macropores act as dissipative wetting structures by enlarging water flows against steep gradients in soil water potential after long dry spells. This implies accelerated depletion of these gradients and faster relaxation back towards LTE. We found two local optima in macropore density that maximize reduction rates of free energy of soil water during rainfall-driven conditions. These two optima exist because reduction rates of free energy are, in this case, a second-order polynomial of the wetting rate, which implicitly depends on macroporosity. An uncalibrated long-term simulation of the water balance of the Weiherbach catchment based on the first optimum macroporosity performed almost as well as the best fit when macroporosity was calibrated to match rainfall-runoff. In the Malalcahuello catchment we did not find an apparent optimum density of macropores, because free energy dynamics of soil water during rainfall-driven conditions is dominated by increases of potential energy. Macropores act as dissipative drainage structures by enhancing export of potential energy. No optimum macropore density exists in this case because potential energy change rates scale linearly with the wetting rate. We found, however, a distinguished macroporosity that assures steady-state conditions of the potential energy balance of the soil, in the sense that average storage of potential energy is compensated by average potential energy export. This distinguished macroporosity was close to the value that yielded the best fit of rainfall-runoff behaviour during a calibration exercise and allowed a robust estimate of the annual runoff coefficient. Our findings are promising for predictions in ungauged catchments (PUB) as the optimal/distinguished model structures can serve as a first guess for uncalibrated predictions of rainfall-runoff. They also offer an alternative for classifying catchments according to their similarity of the free energy balance components.

Binding behaviors of greenly synthesized silver nanoparticles - Lysozyme interaction: Spectroscopic approach

NASA Astrophysics Data System (ADS)

Roy, Swarup

2018-02-01

Interaction of greenly synthesized silver nanoparticles (SNP) and lysozyme (Lys) has been studied using spectroscopy. From UV-Vis study it is observed that a moderate association constant (Kapp) of 5.36 × 104 L/mol giving an indication of interaction. Fluorescence emission and time resolved study, confirm static mode of quenching phenomena and the binding constant (Kb) was 25.12, 3.98 and 1.99 × 103 L/mol at 298, 305 and 312 K respectively and the number of binding sites (n) was found to be ∼1. Using temperature dependent fluorimetric data, thermodynamic parameters calculated (Enthalpy change, ΔH = -143.95 kJ/mol, Entropy change, ΔS = -400.32 J/mol/K, Gibbs free energy change, ΔG = -24.66 kJ/mol at 298 K) and resulting insight indicative of weak force (van der Walls interaction & H-bonding) as key feature for the Lys-SNP interaction. By following Förster's non-radiative energy transfer (FRET) theory, average binding distance (r = 3.05 nm) was calculated and observed that nonradiative type energy transfer between SNP and Lys. What is more, circular dichroism (CD) spectra indicates presence of SNP does not display substantial alteration in the secondary structure of Lys. Hence, this results may be very useful for the well thought of essential aspects of binding between the Lys and SNP.

Metal-Ion Effects on the Polarization of Metal-Bound Water and Infrared Vibrational Modes of the Coordinated Metal Center of Mycobacterium tuberculosis Pyrazinamidase via Quantum Mechanical Calculations

PubMed Central

2014-01-01

Mycobacterium tuberculosis pyrazinamidase (PZAse) is a key enzyme to activate the pro-drug pyrazinamide (PZA). PZAse is a metalloenzyme that coordinates in vitro different divalent metal cofactors in the metal coordination site (MCS). Several metals including Co2+, Mn2+, and Zn2+ are able to reactivate the metal-depleted PZAse in vitro. We use quantum mechanical calculations to investigate the Zn2+, Fe2+, and Mn2+ metal cofactor effects on the local MCS structure, metal–ligand or metal–residue binding energy, and charge distribution. Results suggest that the major metal-dependent changes occur in the metal–ligand binding energy and charge distribution. Zn2+ shows the highest binding energy to the ligands (residues). In addition, Zn2+ and Mn2+ within the PZAse MCS highly polarize the O–H bond of coordinated water molecules in comparison with Fe2+. This suggests that the coordination of Zn2+ or Mn2+ to the PZAse protein facilitates the deprotonation of coordinated water to generate a nucleophile for catalysis as in carboxypeptidase A. Because metal ion binding is relevant to enzymatic reaction, identification of the metal binding event is important. The infrared vibrational mode shift of the C=Nε (His) bond from the M. tuberculosis MCS is the best IR probe to metal complexation. PMID:25055049

Designing molecular complexes using free-energy derivatives from liquid-state integral equation theory

NASA Astrophysics Data System (ADS)

Mrugalla, Florian; Kast, Stefan M.

2016-09-01

Complex formation between molecules in solution is the key process by which molecular interactions are translated into functional systems. These processes are governed by the binding or free energy of association which depends on both direct molecular interactions and the solvation contribution. A design goal frequently addressed in pharmaceutical sciences is the optimization of chemical properties of the complex partners in the sense of minimizing their binding free energy with respect to a change in chemical structure. Here, we demonstrate that liquid-state theory in the form of the solute-solute equation of the reference interaction site model provides all necessary information for such a task with high efficiency. In particular, computing derivatives of the potential of mean force (PMF), which defines the free-energy surface of complex formation, with respect to potential parameters can be viewed as a means to define a direction in chemical space toward better binders. We illustrate the methodology in the benchmark case of alkali ion binding to the crown ether 18-crown-6 in aqueous solution. In order to examine the validity of the underlying solute-solute theory, we first compare PMFs computed by different approaches, including explicit free-energy molecular dynamics simulations as a reference. Predictions of an optimally binding ion radius based on free-energy derivatives are then shown to yield consistent results for different ion parameter sets and to compare well with earlier, orders-of-magnitude more costly explicit simulation results. This proof-of-principle study, therefore, demonstrates the potential of liquid-state theory for molecular design problems.

Designing molecular complexes using free-energy derivatives from liquid-state integral equation theory.

PubMed

Mrugalla, Florian; Kast, Stefan M

2016-09-01

Complex formation between molecules in solution is the key process by which molecular interactions are translated into functional systems. These processes are governed by the binding or free energy of association which depends on both direct molecular interactions and the solvation contribution. A design goal frequently addressed in pharmaceutical sciences is the optimization of chemical properties of the complex partners in the sense of minimizing their binding free energy with respect to a change in chemical structure. Here, we demonstrate that liquid-state theory in the form of the solute-solute equation of the reference interaction site model provides all necessary information for such a task with high efficiency. In particular, computing derivatives of the potential of mean force (PMF), which defines the free-energy surface of complex formation, with respect to potential parameters can be viewed as a means to define a direction in chemical space toward better binders. We illustrate the methodology in the benchmark case of alkali ion binding to the crown ether 18-crown-6 in aqueous solution. In order to examine the validity of the underlying solute-solute theory, we first compare PMFs computed by different approaches, including explicit free-energy molecular dynamics simulations as a reference. Predictions of an optimally binding ion radius based on free-energy derivatives are then shown to yield consistent results for different ion parameter sets and to compare well with earlier, orders-of-magnitude more costly explicit simulation results. This proof-of-principle study, therefore, demonstrates the potential of liquid-state theory for molecular design problems.

Stereoselective binding of agonists to the β2-adrenergic receptor: insights into molecular details and thermodynamics from molecular dynamics simulations.

PubMed

Plazinska, Anita; Plazinski, Wojciech

2017-05-02

The β 2 -adrenergic receptor (β 2 -AR) is one of the most studied G-protein-coupled receptors. When interacting with ligand molecules, it exhibits a binding characteristic that is strongly dependent on ligand stereoconfiguration. In particular, many experimental and theoretical studies confirmed that stereoisomers of an important β 2 -AR agonist, fenoterol, are associated with diverse mechanisms of binding and activation of β 2 -AR. The objective of the present study was to explore the stereoselective binding of fenoterol to β 2 -AR through the application of an advanced computational methodology based on enhanced-sampling molecular dynamics simulations and potentials of interactions tailored to investigate the stereorecognition effects. The results remain in very good, quantitative agreement with the experimental data (measured in the context of ligand-receptor affinities and their dependence on the temperature), which provides an additional validation for the applied computational protocols. Additionally, our results contribute to the understanding of stereoselective agonist binding by β 2 -AR. Although the significant role of the N293 6.55 residue is confirmed, we additionally show that stereorecognition does not depend solely on the N293-ligand interactions; the stereoselective effects rely on the co-operation of several residues located on both the 6th and 7th transmembrane domains and on extracellular loops. The magnitude and character of the contributions of these residues may be very diverse and result in either enhancing or reducing the stereoselective effects. The same is true when considering the enthalpic and entropic contributions to the binding free energies, which also are dependent on the ligand stereoconfiguration.

Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

PubMed Central

Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

2013-01-01

The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges −5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol−1) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non-periodic PB calculations for a given system, its dependence on the box size being analytical. The latter scheme also provides insight into the physical origin of the finite-size effects. These two schemes also encompass a correction for discrete solvent effects that persists even in the limit of infinite box sizes. Application of either scheme essentially eliminates the size dependence of the corrected charging free energies (maximal deviation of 1.5 kJ mol−1). Because it is simple to apply, the analytical correction scheme offers a general solution to the problem of finite-size effects in free-energy calculations involving charged solutes, as encountered in calculations concerning, e.g., protein-ligand binding, biomolecular association, residue mutation, pKa and redox potential estimation, substrate transformation, solvation, and solvent-solvent partitioning. PMID:24320250

Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: an accurate correction scheme for electrostatic finite-size effects.

PubMed

Rocklin, Gabriel J; Mobley, David L; Dill, Ken A; Hünenberger, Philippe H

2013-11-14

The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges -5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol(-1)) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non-periodic PB calculations for a given system, its dependence on the box size being analytical. The latter scheme also provides insight into the physical origin of the finite-size effects. These two schemes also encompass a correction for discrete solvent effects that persists even in the limit of infinite box sizes. Application of either scheme essentially eliminates the size dependence of the corrected charging free energies (maximal deviation of 1.5 kJ mol(-1)). Because it is simple to apply, the analytical correction scheme offers a general solution to the problem of finite-size effects in free-energy calculations involving charged solutes, as encountered in calculations concerning, e.g., protein-ligand binding, biomolecular association, residue mutation, pKa and redox potential estimation, substrate transformation, solvation, and solvent-solvent partitioning.

Calculating the binding free energies of charged species based on explicit-solvent simulations employing lattice-sum methods: An accurate correction scheme for electrostatic finite-size effects

NASA Astrophysics Data System (ADS)

Rocklin, Gabriel J.; Mobley, David L.; Dill, Ken A.; Hünenberger, Philippe H.

2013-11-01

The calculation of a protein-ligand binding free energy based on molecular dynamics (MD) simulations generally relies on a thermodynamic cycle in which the ligand is alchemically inserted into the system, both in the solvated protein and free in solution. The corresponding ligand-insertion free energies are typically calculated in nanoscale computational boxes simulated under periodic boundary conditions and considering electrostatic interactions defined by a periodic lattice-sum. This is distinct from the ideal bulk situation of a system of macroscopic size simulated under non-periodic boundary conditions with Coulombic electrostatic interactions. This discrepancy results in finite-size effects, which affect primarily the charging component of the insertion free energy, are dependent on the box size, and can be large when the ligand bears a net charge, especially if the protein is charged as well. This article investigates finite-size effects on calculated charging free energies using as a test case the binding of the ligand 2-amino-5-methylthiazole (net charge +1 e) to a mutant form of yeast cytochrome c peroxidase in water. Considering different charge isoforms of the protein (net charges -5, 0, +3, or +9 e), either in the absence or the presence of neutralizing counter-ions, and sizes of the cubic computational box (edges ranging from 7.42 to 11.02 nm), the potentially large magnitude of finite-size effects on the raw charging free energies (up to 17.1 kJ mol-1) is demonstrated. Two correction schemes are then proposed to eliminate these effects, a numerical and an analytical one. Both schemes are based on a continuum-electrostatics analysis and require performing Poisson-Boltzmann (PB) calculations on the protein-ligand system. While the numerical scheme requires PB calculations under both non-periodic and periodic boundary conditions, the latter at the box size considered in the MD simulations, the analytical scheme only requires three non-periodic PB calculations for a given system, its dependence on the box size being analytical. The latter scheme also provides insight into the physical origin of the finite-size effects. These two schemes also encompass a correction for discrete solvent effects that persists even in the limit of infinite box sizes. Application of either scheme essentially eliminates the size dependence of the corrected charging free energies (maximal deviation of 1.5 kJ mol-1). Because it is simple to apply, the analytical correction scheme offers a general solution to the problem of finite-size effects in free-energy calculations involving charged solutes, as encountered in calculations concerning, e.g., protein-ligand binding, biomolecular association, residue mutation, pKa and redox potential estimation, substrate transformation, solvation, and solvent-solvent partitioning.

Electric field induced optical gain of a hydrogenic impurity in a Cd{sub 0.8}Zn{sub 0.2}Se/ZnSe parabolic quantum dot

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jasmine, P. Christina Lily; Peter, A. John, E-mail: a.john.peter@gmail.com

The dependence of electric field on the electronic and optical properties is investigated in a Cd{sub 0.8}Zn{sub 0.2}Se/ZnSe quantum dot. The hydrogenic binding energy, in the presence of electric field, is calculated with the spatial confinement effect. The electric field dependent optical gain with the photon energy is found using compact density matrix method. The results show that the electric field has a great influence on the optical properties of II-VI semiconductor quantum dot.

Development of many-body polarizable force fields for Li-battery components: 1. Ether, alkane, and carbonate-based solvents.

PubMed

Borodin, Oleg; Smith, Grant D

2006-03-30

Classical many-body polarizable force fields were developed for n-alkanes, perflouroalkanes, polyethers, ketones, and linear and cyclic carbonates on the basis of quantum chemistry dimer energies of model compounds and empirical thermodynamic liquid-state properties. The dependence of the electron correlation contribution to the dimer binding energy on basis-set size and level of theory was investigated as a function of molecular separation for a number of alkane, ether, and ketone dimers. Molecular dynamics (MD) simulations of the force fields accurately predicted structural, dynamic, and transport properties of liquids and unentangled polymer melts. On average, gas-phase dimer binding energies predicted with the force field were between those from MP2/aug-cc-pvDz and MP2/aug-cc-pvTz quantum chemistry calculations.

Chirality dependent interaction of ammonia with carbon nanotubes

NASA Astrophysics Data System (ADS)

Talukdar, Keka; Shantappa, Anil

2018-04-01

For the specific structure and extraordinary properties, carbon nanotubes (CNTs) have many applications in diversified fields. The interaction of CNTs with ammonia is a very interesting matter to study as it is related to the application of CNTs as ammonia sensor. Here the interaction of single walled zigzag, armchair and chiral carbon nanotubes is studied in respect of the change in energies before and after binding with ammonia by molecular dynamics simulation. Their deformation after simulation is modeled. The change of thermal conductivity of the CNTs is also found by simulation. The potential energy before and after absorption of ammonia gives useful information of the system. Thermal conductivities of the ammonia bound CNTs are changed considerably. It is observed that the potential energy and thermal conductivity both are changing for the interaction with ammonia and hence they are sensitive to ammonia binding.

Gas-Phase Interaction of Anions with Polyisobutylenes: Collision-Induced Dissociation Study and Quantum Chemical Modeling.

PubMed

Nagy, Lajos; Kuki, Ákos; Deák, György; Purgel, Mihály; Vékony, Ádám; Zsuga, Miklós; Kéki, Sándor

2016-09-01

The gas-phase interaction of anions including fluoride, chloride, bromide, iodide, ethyl sulfate, chlorate, and nitrate with polyisobutylene (PIB) derivatives was studied using collision-induced dissociation (CID). The gas-phase adducts of anions with PIBs ([PIB + anion](-)) were generated from the electrosprayed solution of PIBs in the presence of the corresponding anions. The so-formed adducts subjected to CID showed a loss of anion at different characteristic collision energies, thus allowing the study of the strength of interaction between the anions and nonpolar PIBs having different end-groups. The values of characteristic collision energies (the energy needed to obtain 50% fragmentation) obtained by CID experiments correlated linearly with the binding enthalpies between the anion and PIB, as determined by density functional theory calculations. In the case of halide ions, the critical energies for dissociation, that is, the binding enthalpies for [PIB + anion](-) adducts, increased in the order of I(-) < Br(-) < Cl(-) < F(-). Furthermore, it was found that the binding enthalpies for the adducts formed with halide ions decreased approximately with the square radius of the halide ion, suggesting that the strength of interaction is mainly determined by the "surface" charge density of the halide ion. In addition, the characteristic collision energy versus the number of isobutylene units revealed a linear dependence.

Cation-π Interactions: Computational Analyses of the Aromatic Box Motif and the Fluorination Strategy for Experimental Evaluation

PubMed Central

Davis, Matthew R.; Dougherty, Dennis A.

2015-01-01

Cation-π interactions are common in biological systems, and many structural studies have revealed the aromatic box as a common motif. With the aim of understanding the nature of the aromatic box, several computational methods were evaluated for their ability to reproduce experimental cation-π binding energies. We find the DFT method M06 with the 6-31G(d,p) basis set performs best of several methods tested. The binding of benzene to a number of different cations (sodium, potassium, ammonium, tetramethylammonium, and guanidinium) was studied. In addition, the binding of the organic cations NH4+ and NMe4+ to ab initio generated aromatic boxes as well as examples of aromatic boxes from protein crystal structures were investigated. These data, along with a study of the distance dependence of the cation-π interaction, indicate that multiple aromatic residues can meaningfully contribute to cation binding, even with displacements of more than an angstrom from the optimal cation-π interaction. Progressive fluorination of benzene and indole was studied as well, and binding energies obtained were used to reaffirm the validity of the “fluorination strategy” to study cation-π interactions in vivo. PMID:26467787

Cation-π interactions: computational analyses of the aromatic box motif and the fluorination strategy for experimental evaluation.

PubMed

Davis, Matthew R; Dougherty, Dennis A

2015-11-21

Cation-π interactions are common in biological systems, and many structural studies have revealed the aromatic box as a common motif. With the aim of understanding the nature of the aromatic box, several computational methods were evaluated for their ability to reproduce experimental cation-π binding energies. We find the DFT method M06 with the 6-31G(d,p) basis set performs best of several methods tested. The binding of benzene to a number of different cations (sodium, potassium, ammonium, tetramethylammonium, and guanidinium) was studied. In addition, the binding of the organic cations NH4(+) and NMe4(+) to ab initio generated aromatic boxes as well as examples of aromatic boxes from protein crystal structures were investigated. These data, along with a study of the distance dependence of the cation-π interaction, indicate that multiple aromatic residues can meaningfully contribute to cation binding, even with displacements of more than an angstrom from the optimal cation-π interaction. Progressive fluorination of benzene and indole was studied as well, and binding energies obtained were used to reaffirm the validity of the "fluorination strategy" to study cation-π interactions in vivo.

Partial Ionic Character beyond the Pauling Paradigm: Metal Nanoparticles

DOE PAGES

Duanmu, Kaining; Truhlar, Donald G.

2014-11-12

A canonical perspective on the chemical bond is the Pauling paradigm: a bond in a molecule containing only identical atoms has no ionic character. However, we show that homonuclear silver clusters have very uneven charge distributions (for example, the C 2v structure of Ag 4 has a larger dipole moment than formaldehyde or acetone), and we show how to predict the charge distribution from coordination numbers and Hirshfeld charges. The new charge model is validated against Kohn–Sham calculations of dipole moments with four approximations for the exchange–correlation functional. We report Kohn–Sham studies of the binding energies of CO on silvermore » monomer and silver clusters containing 2–18 atoms. We also find that an accurate charge model is essential for understanding the site dependence of binding. In particular we find that atoms with more positive charges tend to have higher binding energies, which can be used for guidance in catalyst modeling and design. Furthermore, the nonuniform charge distribution of silver clusters predisposes the site preference of binding of carbon monoxide, and we conclude that nonuniform charge distributions are an important property for understanding binding of metal nanoparticles in general.« less

Growth of AlGaN under the conditions of significant gallium evaporation: Phase separation and enhanced lateral growth

NASA Astrophysics Data System (ADS)

Mayboroda, I. O.; Knizhnik, A. A.; Grishchenko, Yu. V.; Ezubchenko, I. S.; Zanaveskin, Maxim L.; Kondratev, O. A.; Presniakov, M. Yu.; Potapkin, B. V.; Ilyin, V. A.

2017-09-01

The growth kinetics of AlGaN in NH3 MBE under significant Ga desorption was studied. It was found that the addition of gallium stimulates 2D growth and provides better morphology of films compared to pure AlN. The effect was experimentally observed at up to 98% desorption of the impinging gallium. We found that under the conditions of significant thermal desorption, larger amounts of gallium were retained at lateral boundaries of 3D surface features than at flat terraces because of the higher binding energy of Ga atoms at specific surface defects. The selective accumulation of gallium resulted in an increase in the lateral growth component through the formation of the Ga-enriched AlGaN phase at boundaries of 3D surface features. We studied the temperature dependence of AlGaN growth rate and developed a kinetic model analytically describing this dependence. As the model was in good agreement with the experimental data, we used it to estimate the increase in the binding energy of Ga atoms at surface defects compared to terrace surface sites using data on the Ga content in different AlGaN phases. We also applied first-principles calculations to the thermodynamic analysis of stable configurations on the AlN surface and then used these surface configurations to compare the binding energy of Ga atoms at terraces and steps. Both first-principles calculations and analytical estimations of the experimental results gave similar values of difference in binding energies; this value is 0.3 eV. Finally, it was studied experimentally whether gallium can act as a surfactant in AlN growth by NH3 MBE at elevated temperatures. Gallium application has allowed us to grow a 300 nm thick AlN film with a RMS surface roughness of 2.2 Å over an area of 10 × 10 μm and a reduced density of screw dislocations.

Universal dependence of hydrogen oxidation and evolution reaction activity of platinum-group metals on pH and hydrogen binding energy

PubMed Central

Zheng, Jie; Sheng, Wenchao; Zhuang, Zhongbin; Xu, Bingjun; Yan, Yushan

2016-01-01

Understanding how pH affects the activity of hydrogen oxidation reaction (HOR) and hydrogen evolution reaction (HER) is key to developing active, stable, and affordable HOR/HER catalysts for hydroxide exchange membrane fuel cells and electrolyzers. A common linear correlation between hydrogen binding energy (HBE) and pH is observed for four supported platinum-group metal catalysts (Pt/C, Ir/C, Pd/C, and Rh/C) over a broad pH range (0 to 13), suggesting that the pH dependence of HBE is metal-independent. A universal correlation between exchange current density and HBE is also observed on the four metals, indicating that they may share the same elementary steps and rate-determining steps and that the HBE is the dominant descriptor for HOR/HER activities. The onset potential of CO stripping on the four metals decreases with pH, indicating a stronger OH adsorption, which provides evidence against the promoting effect of adsorbed OH on HOR/HER. PMID:27034988

Universal dependence of hydrogen oxidation and evolution reaction activity of platinum-group metals on pH and hydrogen binding energy.

PubMed

Zheng, Jie; Sheng, Wenchao; Zhuang, Zhongbin; Xu, Bingjun; Yan, Yushan

2016-03-01

Understanding how pH affects the activity of hydrogen oxidation reaction (HOR) and hydrogen evolution reaction (HER) is key to developing active, stable, and affordable HOR/HER catalysts for hydroxide exchange membrane fuel cells and electrolyzers. A common linear correlation between hydrogen binding energy (HBE) and pH is observed for four supported platinum-group metal catalysts (Pt/C, Ir/C, Pd/C, and Rh/C) over a broad pH range (0 to 13), suggesting that the pH dependence of HBE is metal-independent. A universal correlation between exchange current density and HBE is also observed on the four metals, indicating that they may share the same elementary steps and rate-determining steps and that the HBE is the dominant descriptor for HOR/HER activities. The onset potential of CO stripping on the four metals decreases with pH, indicating a stronger OH adsorption, which provides evidence against the promoting effect of adsorbed OH on HOR/HER.

Heat shock protein (Hsp) 70 is an activator of the Hsp104 motor.

PubMed

Lee, Jungsoon; Kim, Ji-Hyun; Biter, Amadeo B; Sielaff, Bernhard; Lee, Sukyeong; Tsai, Francis T F

2013-05-21

Heat shock protein (Hsp) 104 is a ring-forming, protein-remodeling machine that harnesses the energy of ATP binding and hydrolysis to drive protein disaggregation. Although Hsp104 is an active ATPase, the recovery of functional protein requires the species-specific cooperation of the Hsp70 system. However, like Hsp104, Hsp70 is an active ATPase, which recognizes aggregated and aggregation-prone proteins, making it difficult to differentiate the mechanistic roles of Hsp104 and Hsp70 during protein disaggregation. Mapping the Hsp70-binding sites in yeast Hsp104 using peptide array technology and photo-cross-linking revealed a striking conservation of the primary Hsp70-binding motifs on the Hsp104 middle-domain across species, despite lack of sequence identity. Remarkably, inserting a Strep-Tactin binding motif at the spatially conserved Hsp70-binding site elicits the Hsp104 protein disaggregating activity that now depends on Strep-Tactin but no longer requires Hsp70/40. Consistent with a Strep-Tactin-dependent activation step, we found that full-length Hsp70 on its own could activate the Hsp104 hexamer by promoting intersubunit coordination, suggesting that Hsp70 is an activator of the Hsp104 motor.

Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

PubMed Central

Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

2009-01-01

The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

Ultrafast Dynamics of 1,3-Cyclohexadiene in Highly Excited States

DOE PAGES

Bühler, Christine C.; Minitti, Michael P.; Deb, Sanghamitra; ...

2011-01-01

The ultrafast dynamics of 1,3-cyclohexadiene has been investigated via structurally sensitive Rydberg electron binding energies and shown to differ upon excitation to the 1B state and the 3p Rydberg state. Excitation of the molecule with 4.63 eV photons into the ultrashort-lived 1B state yields the well-known ring opening to 1,3,5-hexatriene, while a 5.99 eV photon lifts the molecule directly into the 3p-Rydberg state. Excitation to 3p does not induce ring opening. In both experiments, time-dependent shifts of the Rydberg electron binding energy reflect the structural dynamics of the molecular core. Structural distortions associated with 3p-excitation cause a dynamical shift in the -more » and -binding energies by 10 and 26 meV/ps, respectively, whereas after excitation into 1B, more severe structural transformations along the ring-opening coordinate produce shifts at a rate of 40 to 60 meV/ps. The experiment validates photoionization-photoelectron spectroscopy via Rydberg states as a powerful technique to observe structural dynamics of polyatomic molecules.« less

Probing excitonic states in suspended two-dimensional semiconductors by photocurrent spectroscopy

NASA Astrophysics Data System (ADS)

Klots, A. R.; Newaz, A. K. M.; Wang, Bin; Prasai, D.; Krzyzanowska, H.; Lin, Junhao; Caudel, D.; Ghimire, N. J.; Yan, J.; Ivanov, B. L.; Velizhanin, K. A.; Burger, A.; Mandrus, D. G.; Tolk, N. H.; Pantelides, S. T.; Bolotin, K. I.

2014-10-01

The optical response of semiconducting monolayer transition-metal dichalcogenides (TMDCs) is dominated by strongly bound excitons that are stable even at room temperature. However, substrate-related effects such as screening and disorder in currently available specimens mask many anticipated physical phenomena and limit device applications of TMDCs. Here, we demonstrate that that these undesirable effects are strongly suppressed in suspended devices. Extremely robust (photogain > 1,000) and fast (response time < 1 ms) photoresponse allow us to study, for the first time, the formation, binding energies, and dissociation mechanisms of excitons in TMDCs through photocurrent spectroscopy. By analyzing the spectral positions of peaks in the photocurrent and by comparing them with first-principles calculations, we obtain binding energies, band gaps and spin-orbit splitting in monolayer TMDCs. For monolayer MoS2, in particular, we obtain an extremely large binding energy for band-edge excitons, Ebind >= 570 meV. Along with band-edge excitons, we observe excitons associated with a van Hove singularity of rather unique nature. The analysis of the source-drain voltage dependence of photocurrent spectra reveals exciton dissociation and photoconversion mechanisms in TMDCs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nusrat, H; Pang, G; Au, P

Purpose: The doping of plastic scintillators with high-Z elements changes the radiation interaction cross section of the medium and therefore changes the intrinsic response of the detector. The selection of doped plastic scintillators available commercially is limited. This research aims to develop a novel methodology for the mechanical doping of plastic scintillating materials. The ultimate goal of this project is to use doped scintillators of varying intrinsic behavior to unfold the LET (energy) spectrum of any radiation beam. Methods: Commercially available BC408 plastic scintillator was obtained and crushed into uniform powder (using ball mill). Two separate materials were tested formore » light output signal: uncrushed scintillator and scintillating powder bound by glue. Commercially available U301 UV-hardening glue was used. Scintillation response was measured by creating a thin housing of black acrylic that allowed light from each scintillator to be guided to an optical fiber via a taper. The optical fiber was connected to a PMT; signal was measured using an electrometer. Tests were conducted to determine if crushing+bonding distorted linearity and energy dependence of detector response. Linearity was tested for by irradiating (uncrushed and crushed+glued) for varying durations ensuring signal scaled accordingly; this was done using 300kV x-rays and 6MeV electrons. The effect on energy dependence was examined by obtaining a signal ratio (100kV vs. 300kV; 6MeV vs. 18MeV) for both uncrushed and crushed+glued scintillating material. Results: Crushing and binding with U301 glue did not have an effect on linearity. Energy dependence was changed by 20.3%; crushing+bonding decreased the sensitivity at low energy radiation. Conclusion: This work indicates that crushing and binding of plastic scintillating material does not change the linearity of its response to radiation but does have an effect on the energy dependence. Future work involves addition of high-Z dopants (W, Mo, Pb) and characterization of the detector response.« less

Investigating the Role of Phosphorylation in the Binding of Silaffin Peptide R5 to Silica with Molecular Dynamics Simulations.

PubMed

Sprenger, K G; Prakash, Arushi; Drobny, Gary; Pfaendtner, Jim

2018-01-23

Biomimetic silica formation, a process that is largely driven by proteins, has garnered considerable interest in recent years due to its role in the development of new biotechnologies. However, much remains unknown of the molecular-scale mechanisms underlying the binding of proteins to biomineral surfaces such as silica, or even of the key residue-level interactions between such proteins and surfaces. In this study, we employ molecular dynamics (MD) simulations to study the binding of R5-a 19-residue segment of a native silaffin peptide used for in vitro silica formation-to a silica surface. The metadynamics enhanced sampling method is used to converge the binding behavior of R5 on silica at both neutral (pH 7.5) and acidic (pH 5) conditions. The results show fundamental differences in the mechanism of binding between the two cases, providing unique insight into the pH-dependent ability of R5 and native silaffin to precipitate silica. We also study the effect of phosphorylation of serine residues in R5 on both the binding free energy to silica and the interfacial conformation of the peptide. Results indicate that phosphorylation drastically decreases the binding free energy and changes the structure of silica-adsorbed R5 through the introduction of charge and steric repulsion. New mechanistic insights from this work could inform rational design of new biomaterials and biotechnologies.

Large-Scale Conformational Dynamics Control H5N1 Influenza Polymerase PB2 Binding to Importin α.

PubMed

Delaforge, Elise; Milles, Sigrid; Bouvignies, Guillaume; Bouvier, Denis; Boivin, Stephane; Salvi, Nicola; Maurin, Damien; Martel, Anne; Round, Adam; Lemke, Edward A; Jensen, Malene Ringkjøbing; Hart, Darren J; Blackledge, Martin

2015-12-09

Influenza A RNA polymerase complex is formed from three components, PA, PB1, and PB2. PB2 is independently imported into the nucleus prior to polymerase reconstitution. All crystallographic structures of the PB2 C-terminus (residues 536-759) reveal two globular domains, 627 and NLS, that form a tightly packed heterodimer. The molecular basis of the affinity of 627-NLS for importins remained unclear from these structures, apparently requiring large-scale conformational changes prior to importin binding. Using a combination of solution-state NMR, small-angle neutron scattering, small-angle X-ray scattering (SAXS), and Förster resonance energy transfer (FRET), we show that 627-NLS populates a temperature-dependent dynamic equilibrium between closed and open states. The closed state is stabilized by a tripartite salt bridge involving the 627-NLS interface and the linker, that becomes flexible in the open state, with 627 and NLS dislocating into a highly dynamic ensemble. Activation enthalpies and entropies associated with the rupture of this interface were derived from simultaneous analysis of temperature-dependent chemical exchange saturation transfer measurements, revealing a strong temperature dependence of both open-state population and exchange rate. Single-molecule FRET and SAXS demonstrate that only the open-form is capable of binding to importin α and that, upon binding, the 627 domain samples a dynamic conformational equilibrium in the vicinity of the C-terminus of importin α. This intrinsic large-scale conformational flexibility therefore enables 627-NLS to bind importin through conformational selection from a temperature-dependent equilibrium comprising both functional forms of the protein.

Investigating the binding behaviour of two avidin-based testosterone binders using molecular recognition force spectroscopy.

PubMed

Rangl, Martina; Leitner, Michael; Riihimäki, Tiina; Lehtonen, Soili; Hytönen, Vesa P; Gruber, Hermann J; Kulomaa, Markku; Hinterdorfer, Peter; Ebner, Andreas

2014-02-01

Molecular recognition force spectroscopy, a biosensing atomic force microscopy technique allows to characterise the dissociation of ligand-receptor complexes at the molecular level. Here, we used molecular recognition force spectroscopy to study the binding capability of recently developed testosterone binders. The two avidin-based proteins called sbAvd-1 and sbAvd-2 are expected to bind both testosterone and biotin but differ in their binding behaviour towards these ligands. To explore the ligand binding and dissociation energy landscape of these proteins, we tethered biotin or testosterone to the atomic force microscopy probe while the testosterone-binding protein was immobilized on the surface. Repeated formation and rupture of the ligand-receptor complex at different pulling velocities allowed determination of the loading rate dependence of the complex-rupturing force. In this way, we obtained the molecular dissociation rate (k(off)) and energy landscape distances (x(β)) of the four possible complexes: sbAvd-1-biotin, sbAvd-1-testosterone, sbAvd-2-biotin and sbAvd-2-testosterone. It was found that the kinetic off-rates for both proteins and both ligands are similar. In contrast, the x(β) values, as well as the probability of complex formations, varied considerably. In addition, competitive binding experiments with biotin and testosterone in solution differ significantly for the two testosterone-binding proteins, implying a decreased cross-reactivity of sbAvd-2. Unravelling the binding behaviour of the investigated testosterone-binding proteins is expected to improve their usability for possible sensing applications. Copyright © 2014 John Wiley & Sons, Ltd.

Influence of the size and charge of gold nanoclusters on complexation with siRNA: a molecular dynamics simulation study.

PubMed

Mudedla, Sathish Kumar; Azhagiya Singam, Ettayapuram Ramaprasad; Balamurugan, Kanagasabai; Subramanian, Venkatesan

2015-11-11

The complexation of small interfering RNA (siRNA) with positively charged gold nanoclusters has been studied in the present investigation with the help of classical molecular dynamics and steered molecular dynamics simulations accompanied by free energy calculations. The results show that gold nanoclusters form a stable complex with siRNA. The wrapping of siRNA around the gold nanocluster depends on the size and charge on the surface of the gold cluster. The binding pattern of the gold nanocluster with siRNA is also influenced by the presence of another cluster. The interaction between the positively charged amines in the gold nanocluster and the negatively charged phosphate group in the siRNA is responsible for the formation of complexes. The binding free energy value increases with the size of the gold cluster and the number of positive charges present on the surface of the gold nanocluster. The results reveal that the binding energy of small gold nanoclusters increases in the presence of another gold nanocluster while the binding of large gold nanoclusters decreases due to the introduction of another gold nanocluster. Overall, the findings have clearly demonstrated the effect of size and charge of gold nanoclusters on their interaction pattern with siRNA.

Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Interplay between binding affinity and kinetics in protein-protein interactions.

PubMed

Cao, Huaiqing; Huang, Yongqi; Liu, Zhirong

2016-07-01

To clarify the interplay between the binding affinity and kinetics of protein-protein interactions, and the possible role of intrinsically disordered proteins in such interactions, molecular simulations were carried out on 20 protein complexes. With bias potential and reweighting techniques, the free energy profiles were obtained under physiological affinities, which showed that the bound-state valley is deep with a barrier height of 12 - 33 RT. From the dependence of the affinity on interface interactions, the entropic contribution to the binding affinity is approximated to be proportional to the interface area. The extracted dissociation rates based on the Arrhenius law correlate reasonably well with the experimental values (Pearson correlation coefficient R = 0.79). For each protein complex, a linear free energy relationship between binding affinity and the dissociation rate was confirmed, but the distribution of the slopes for intrinsically disordered proteins showed no essential difference with that observed for ordered proteins. A comparison with protein folding was also performed. Proteins 2016; 84:920-933. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Blockade of Neuronal α7-nAChR by α-Conotoxin ImI Explained by Computational Scanning and Energy Calculations

PubMed Central

Yu, Rilei; Craik, David J.; Kaas, Quentin

2011-01-01

α-Conotoxins potently inhibit isoforms of nicotinic acetylcholine receptors (nAChRs), which are essential for neuronal and neuromuscular transmission. They are also used as neurochemical tools to study nAChR physiology and are being evaluated as drug leads to treat various neuronal disorders. A number of experimental studies have been performed to investigate the structure-activity relationships of conotoxin/nAChR complexes. However, the structural determinants of their binding interactions are still ambiguous in the absence of experimental structures of conotoxin-receptor complexes. In this study, the binding modes of α-conotoxin ImI to the α7-nAChR, currently the best-studied system experimentally, were investigated using comparative modeling and molecular dynamics simulations. The structures of more than 30 single point mutants of either the conotoxin or the receptor were modeled and analyzed. The models were used to explain qualitatively the change of affinities measured experimentally, including some nAChR positions located outside the binding site. Mutational energies were calculated using different methods that combine a conformational refinement procedure (minimization with a distance dependent dielectric constant or explicit water, or molecular dynamics using five restraint strategies) and a binding energy function (MM-GB/SA or MM-PB/SA). The protocol using explicit water energy minimization and MM-GB/SA gave the best correlations with experimental binding affinities, with an R2 value of 0.74. The van der Waals and non-polar desolvation components were found to be the main driving force for binding of the conotoxin to the nAChR. The electrostatic component was responsible for the selectivity of the various ImI mutants. Overall, this study provides novel insights into the binding mechanism of α-conotoxins to nAChRs and the methodological developments reported here open avenues for computational scanning studies of a rapidly expanding range of wild-type and chemically modified α-conotoxins. PMID:21390272

Do Halogen–Hydrogen Bond Donor Interactions Dominate the Favorable Contribution of Halogens to Ligand–Protein Binding?

PubMed Central

2017-01-01

Halogens are present in a significant number of drugs, contributing favorably to ligand–protein binding. Currently, the contribution of halogens, most notably chlorine and bromine, is largely attributed to halogen bonds involving favorable interactions with hydrogen bond acceptors. However, we show that halogens acting as hydrogen bond acceptors potentially make a more favorable contribution to ligand binding than halogen bonds based on quantum mechanical calculations. In addition, bioinformatics analysis of ligand–protein crystal structures shows the presence of significant numbers of such interactions. It is shown that interactions between halogens and hydrogen bond donors (HBDs) are dominated by perpendicular C–X···HBD orientations. Notably, the orientation dependence of the halogen–HBD (X–HBD) interactions is minimal over greater than 100° with favorable interaction energies ranging from −2 to −14 kcal/mol. This contrasts halogen bonds in that X–HBD interactions are substantially more favorable, being comparable to canonical hydrogen bonds, with a smaller orientation dependence, such that they make significant, favorable contributions to ligand–protein binding and, therefore, should be actively considered during rational ligand design. PMID:28657759

Comparison of Calculation and Experiment Implicates Significant Electrostatic Contributions to the Binding Stability of Barnase and Barstar

PubMed Central

Dong, Feng; Vijayakumar, M.; Zhou, Huan-Xiang

2003-01-01

The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (ɛp) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with ɛp = 4; and c), “SE + ɛp = 20.” The “vdW + ɛp = 4” and “SE + ɛp = 20” protocols predicted an overall electrostatic stabilization whereas the “SE + ɛp = 4” protocol predicted an overall electrostatic destabilization. The “vdW + ɛp = 4” protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the “SE + ɛp = 4” protocol predicted significantly larger coupling energies of charge pairs whereas the “SE + ɛp = 20” protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol. PMID:12829463

Translation Initiation Factor eIF4B Interacts with a Picornavirus Internal Ribosome Entry Site in both 48S and 80S Initiation Complexes Independently of Initiator AUG Location

PubMed Central

Ochs, Kerstin; Rust, René C.; Niepmann, Michael

1999-01-01

Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840

Multiple ligand simultaneous docking: orchestrated dancing of ligands in binding sites of protein.

PubMed

Li, Huameng; Li, Chenglong

2010-07-30

Present docking methodologies simulate only one single ligand at a time during docking process. In reality, the molecular recognition process always involves multiple molecular species. Typical protein-ligand interactions are, for example, substrate and cofactor in catalytic cycle; metal ion coordination together with ligand(s); and ligand binding with water molecules. To simulate the real molecular binding processes, we propose a novel multiple ligand simultaneous docking (MLSD) strategy, which can deal with all the above processes, vastly improving docking sampling and binding free energy scoring. The work also compares two search strategies: Lamarckian genetic algorithm and particle swarm optimization, which have respective advantages depending on the specific systems. The methodology proves robust through systematic testing against several diverse model systems: E. coli purine nucleoside phosphorylase (PNP) complex with two substrates, SHP2NSH2 complex with two peptides and Bcl-xL complex with ABT-737 fragments. In all cases, the final correct docking poses and relative binding free energies were obtained. In PNP case, the simulations also capture the binding intermediates and reveal the binding dynamics during the recognition processes, which are consistent with the proposed enzymatic mechanism. In the other two cases, conventional single-ligand docking fails due to energetic and dynamic coupling among ligands, whereas MLSD results in the correct binding modes. These three cases also represent potential applications in the areas of exploring enzymatic mechanism, interpreting noisy X-ray crystallographic maps, and aiding fragment-based drug design, respectively. 2010 Wiley Periodicals, Inc.

Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

PubMed

Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

2016-11-04

The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Monney, Claude; Bisogni, Valentina; Zhou, Ke-Jin

Cuprate materials, such as those hosting high-temperature superconductivity, represent a famous class of materials where the correlations between the strongly entangled charges and spins produce complex phase diagrams. Several years ago, the Zhang-Rice singlet was proposed as a natural quasiparticle in hole-doped cuprates. The occurrence and binding energy of this quasiparticle, consisting of a pair of bound holes with antiparallel spins on the same CuO 4 plaquette, depends on the local electronic interactions, which are fundamental quantities for understanding the physics of the cuprates. Here, we employ state-of-the-art resonant inelastic x-ray scattering (RIXS) to probe the correlated physics of themore » CuO 4 plaquettes in the quasi-one-dimensional chain cuprate Li 2CuO 2. By tuning the incoming photon energy to the O K edge, we populate bound states related to the Zhang-Rice quasiparticles in the RIXS process. Both intra- and interchain Zhang-Rice singlets are observed and their occurrence is shown to depend on the nearest-neighbor spin-spin correlations, which are readily probed in this experiment. Finally, we also extract the binding energy of the Zhang-Rice singlet and identify the Zhang-Rice triplet excitation in the RIXS spectra.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Core-level binding energy shifts in Pt Ru nanoparticles: A puzzle resolved

NASA Astrophysics Data System (ADS)

Lewera, Adam; Zhou, Wei Ping; Hunger, Ralf; Jaegermann, Wolfram; Wieckowski, Andrzej; Yockel, Scott; Bagus, Paul S.

2007-10-01

Synchrotron measurements of Pt and Ru core-level binding energies, BE's, in Pt-Ru nanoparticles, as a function of Pt content, quantify earlier indications that the Pt 4f BE shift is much larger than the Ru 3d BE shift. A complementary theoretical analysis relates the BE shifts to changes in the metal-metal distances as the composition of the nanoparticle changes. We establish that the large Pt and small Ru BE shifts arise from the different response of these metals to changes in the bond distances, an unexpected result. Our results give evidence that the magnitudes of the BE shifts depend on whether the d band is open, as for Ru, or essentially filled, as for Pt.

Enhanced Ligand Sampling for Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Free energy calculations are used to study how strongly potential drug molecules interact with their target receptors. The accuracy of these calculations depends on the accuracy of the molecular dynamics (MD) force field as well as proper sampling of the major conformations of each molecule. However, proper sampling of ligand conformations can be difficult when there are large barriers separating the major ligand conformations. An example of this is for ligands with an asymmetrically substituted phenyl ring, where the presence of protein loops hinders the proper sampling of the different ring conformations. These ring conformations become more difficult to sample when the size of the functional groups attached to the ring increases. The Adaptive Integration Method (AIM) has been developed, which adaptively changes the alchemical coupling parameter λ during the MD simulation so that conformations sampled at one λ can aid sampling at the other λ values. The Accelerated Adaptive Integration Method (AcclAIM) builds on AIM by lowering potential barriers for specific degrees of freedom at intermediate λ values. However, these methods may not work when there are very large barriers separating the major ligand conformations. In this work, we describe a modification to AIM that improves sampling of the different ring conformations, even when there is a very large barrier between them. This method combines AIM with conformational Monte Carlo sampling, giving improved convergence of ring populations and the resulting free energy. This method, called AIM/MC, is applied to study the relative binding free energy for a pair of ligands that bind to thrombin and a different pair of ligands that bind to aspartyl protease β-APP cleaving enzyme 1 (BACE1). These protein–ligand binding free energy calculations illustrate the improvements in conformational sampling and the convergence of the free energy compared to both AIM and AcclAIM. PMID:25906170

Binding Modes of Ligands Using Enhanced Sampling (BLUES): Rapid Decorrelation of Ligand Binding Modes via Nonequilibrium Candidate Monte Carlo.

PubMed

Gill, Samuel C; Lim, Nathan M; Grinaway, Patrick B; Rustenburg, Ariën S; Fass, Josh; Ross, Gregory A; Chodera, John D; Mobley, David L

2018-05-31

Accurately predicting protein-ligand binding affinities and binding modes is a major goal in computational chemistry, but even the prediction of ligand binding modes in proteins poses major challenges. Here, we focus on solving the binding mode prediction problem for rigid fragments. That is, we focus on computing the dominant placement, conformation, and orientations of a relatively rigid, fragment-like ligand in a receptor, and the populations of the multiple binding modes which may be relevant. This problem is important in its own right, but is even more timely given the recent success of alchemical free energy calculations. Alchemical calculations are increasingly used to predict binding free energies of ligands to receptors. However, the accuracy of these calculations is dependent on proper sampling of the relevant ligand binding modes. Unfortunately, ligand binding modes may often be uncertain, hard to predict, and/or slow to interconvert on simulation time scales, so proper sampling with current techniques can require prohibitively long simulations. We need new methods which dramatically improve sampling of ligand binding modes. Here, we develop and apply a nonequilibrium candidate Monte Carlo (NCMC) method to improve sampling of ligand binding modes. In this technique, the ligand is rotated and subsequently allowed to relax in its new position through alchemical perturbation before accepting or rejecting the rotation and relaxation as a nonequilibrium Monte Carlo move. When applied to a T4 lysozyme model binding system, this NCMC method shows over 2 orders of magnitude improvement in binding mode sampling efficiency compared to a brute force molecular dynamics simulation. This is a first step toward applying this methodology to pharmaceutically relevant binding of fragments and, eventually, drug-like molecules. We are making this approach available via our new Binding modes of ligands using enhanced sampling (BLUES) package which is freely available on GitHub.

Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

PubMed Central

Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

2017-01-01

Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

Dynamics, magnetic properties, and electron binding energies of H2O2 in water.

PubMed

C Cabral, Benedito J

2017-06-21

Results for the magnetic properties and electron binding energies of H 2 O 2 in liquid water are presented. The adopted methodology relies on the combination of Born-Oppenheimer molecular dynamics and electronic structure calculations. The Keal-Tozer functional was applied for predicting magnetic shieldings and H 2 O 2 intramolecular spin-spin coupling constants. Electron binding energies were calculated with electron propagator theory. In water, H 2 O 2 is a better proton donor than proton acceptor, and the present results indicate that this feature is important for understanding magnetic properties in solution. In comparison with the gas-phase, H 2 O 2 atoms are deshielded in water. For oxygen atoms, the deshielding is mainly determined by structural/conformational changes. Hydrogen-bond interactions explain the deshielding of protons in water. The predicted chemical shift for the H 2 O 2 protons in water (δ∼11.8 ppm) is in good agreement with experimental information (δ=11.2 ppm). The two lowest electron binding energies of H 2 O 2 in water (10.7±0.5 and 11.2±0.5 eV) are in reasonable agreement with experiment. In keeping with data from photoelectron spectroscopy, an ∼1.6 eV red-shift of the two first ionisation energies relative to the gas-phase is observed in water. The strong dependence of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between the σ( 17 O) magnetic shielding constant and the energy gap between the [2a] lowest valence and [1a] core orbitals of H 2 O 2 .

Nondestructive depth profile of the chemical state of ultrathin Al2O3/Si interface

NASA Astrophysics Data System (ADS)

Lee, Jong Cheol; Oh, S.-J.

2004-05-01

We investigated a depth profile of the chemical states of an Al2O3/Si interface using nondestructive photon energy-dependent high-resolution x-ray photoelectron spectroscopy (HRXPS). The Si 2p binding energy, attributed to the oxide interfacial layer (OIL), was found to shift from 102.1 eV to 102.9 eV as the OIL region closer to Al2O3 layer was sampled, while the Al 2p binding energy remains the same. This fact strongly suggests that the chemical state of the interfacial layer is not Al silicate as previously believed. We instead propose from the HRXPS of Al 2p and Si 2p depth-profile studies that the chemical states of the Al2O3/Si interface mainly consist of SiO2 and Si2O3.

Energy economy in the actomyosin interaction: lessons from simple models.

PubMed

Lehman, Steven L

2010-01-01

The energy economy of the actomyosin interaction in skeletal muscle is both scientifically fascinating and practically important. This chapter demonstrates how simple cross-bridge models have guided research regarding the energy economy of skeletal muscle. Parameter variation on a very simple two-state strain-dependent model shows that early events in the actomyosin interaction strongly influence energy efficiency, and late events determine maximum shortening velocity. Addition of a weakly-bound state preceding force production allows weak coupling of cross-bridge mechanics and ATP turnover, so that a simple three-state model can simulate the velocity-dependence of ATP turnover. Consideration of the limitations of this model leads to a review of recent evidence regarding the relationship between ligand binding states, conformational states, and macromolecular structures of myosin cross-bridges. Investigation of the fine structure of the actomyosin interaction during the working stroke continues to inform fundamental research regarding the energy economy of striated muscle.

Calculations of binding affinity between C8-substituted GTP analogs and the bacterial cell-division protein FtsZ

PubMed Central

Hritz, Jozef; Läppchen, Tilman

2010-01-01

The FtsZ protein is a self-polymerizing GTPase that plays a central role in bacterial cell division. Several C8-substituted GTP analogs are known to inhibit the polymerization of FtsZ by competing for the same binding site as its endogenous activating ligand GTP. Free energy calculations of the relative binding affinities to FtsZ for a set of five C8-substituted GTP analogs were performed. The calculated values agree well with the available experimental data, and the main contribution to the free energy differences is determined to be the conformational restriction of the ligands. The dihedral angle distributions around the glycosidic bond of these compounds in water are known to vary considerably depending on the physicochemical properties of the substituent at C8. However, within the FtsZ protein, this substitution has a negligible influence on the dihedral angle distributions, which fall within the narrow range of −140° to −90° for all investigated compounds. The corresponding ensemble average of the coupling constants 3J(C4,H1′) is calculated to be 2.95 ± 0.1 Hz. The contribution of the conformational selection of the GTP analogs upon binding was quantified from the corresponding populations. The obtained restraining free energy values follow the same trend as the relative binding affinities to FtsZ, indicating their dominant contribution. PMID:20559630

Nanobiological studies on drug design using molecular mechanic method.

PubMed

Ghaheh, Hooria Seyedhosseini; Mousavi, Maryam; Araghi, Mahmood; Rasoolzadeh, Reza; Hosseini, Zahra

2015-01-01

Influenza H1N1 is very important worldwide and point mutations that occur in the virus gene are a threat for the World Health Organization (WHO) and druggists, since they could make this virus resistant to the existing antibiotics. Influenza epidemics cause severe respiratory illness in 30 to 50 million people and kill 250,000 to 500,000 people worldwide every year. Nowadays, drug design is not done through trial and error because of its cost and waste of time; therefore bioinformatics studies is essential for designing drugs. This paper, infolds a study on binding site of Neuraminidase (NA) enzyme, (that is very important in drug design) in 310K temperature and different dielectrics, for the best drug design. Information of NA enzyme was extracted from Protein Data Bank (PDB) and National Center for Biotechnology Information (NCBI) websites. The new sequences of N1 were downloaded from the NCBI influenza virus sequence database. Drug binding sites were assimilated and homologized modeling using Argus lab 4.0, HyperChem 6.0 and Chem. D3 softwares. Their stability was assessed in different dielectrics and temperatures. Measurements of potential energy (Kcal/mol) of binding sites of NA in different dielectrics and 310K temperature revealed that at time step size = 0 pSec drug binding sites have maximum energy level and at time step size = 100 pSec have maximum stability and minimum energy. Drug binding sites are more dependent on dielectric constants rather than on temperature and the optimum dielectric constant is 39/78.

Bound states in string nets

NASA Astrophysics Data System (ADS)

Schulz, Marc Daniel; Dusuel, Sébastien; Vidal, Julien

2016-11-01

We discuss the emergence of bound states in the low-energy spectrum of the string-net Hamiltonian in the presence of a string tension. In the ladder geometry, we show that a single bound state arises either for a finite tension or in the zero-tension limit depending on the theory considered. In the latter case, we perturbatively compute the binding energy as a function of the total quantum dimension. We also address this issue in the honeycomb lattice where the number of bound states in the topological phase depends on the total quantum dimension. Finally, the internal structure of these bound states is analyzed in the zero-tension limit.

Identification of the Catalytic Ubiquinone-binding Site of Vibrio cholerae Sodium-dependent NADH Dehydrogenase

PubMed Central

Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar

2017-01-01

The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088

Crystal Structures of An F420-Dependent Glucose-6-Phosphate Dehydrogenase Fgd1 Involved in the Activation of the Anti-Tb Drug Candidate Pa-824 Reveal the Basis of Coenzyme And Substrate Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bashiri, G.; Squire, C.J.; Moreland, N.J.

2009-05-11

The modified flavin coenzyme F{sub 420} is found in a restricted number of microorganisms. It is widely distributed in mycobacteria, however, where it is important in energy metabolism, and in Mycobacterium tuberculosis (Mtb) is implicated in redox processes related to non-replicating persistence. In Mtb, the F{sub 420}-dependent glucose-6-phosphate dehydrogenase FGD1 provides reduced F{sub 420} for the in vivo activation of the nitroimidazopyran prodrug PA-824, currently being developed for anti-tuberculosis therapy against both replicating and persistent bacteria. The structure of M. tuberculosis FGD1 has been determined by x-ray crystallography both in its apo state and in complex with F{sub 420} andmore » citrate at resolutions of 1.90 and 1.95{angstrom}, respectively. The structure reveals a highly specific F{sub 420} binding mode, which is shared with several other F{sub 420}-dependent enzymes. Citrate occupies the substrate binding pocket adjacent to F{sub 420} and is shown to be a competitive inhibitor (IC{sub 50} 43 {micro}m). Modeling of the binding of the glucose 6-phosphate (G6P) substrate identifies a positively charged phosphate binding pocket and shows that G6P, like citrate, packs against the isoalloxazine moiety of F{sub 420} and helps promote a butterfly bend conformation that facilitates F{sub 420} reduction and catalysis.« less

Positive temperature variation of the bandgap energy in the single-crystalline chalcopyrite semiconductor AgInS{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozaki, Shunji, E-mail: ozaki@el.gunma-u.ac.jp; Horikoshi, Yoshimichi

2014-02-07

Optical absorption spectra have been measured on the single-crystalline chalcopyrite semiconductor AgInS{sub 2} using polarized light at T = 10–300 K. The bandgap energy E{sub g} of AgInS{sub 2} shows unusual temperature dependence at low temperatures. The resultant temperature coefficient ∂E{sub g}/∂T is found to be positive at T < 130 K and negative above 130 K. This result has been successfully explained by considering the effects of thermal expansion and electron–phonon interaction. The free-exciton emission of photoluminescence spectra also indicates positive temperature dependence of the peak energies at low temperatures. The exciton binding energy of AgInS{sub 2} is determined to be 26.4 meV.

Time-Resolved Stark Spectroscopy in CdSe Nanoplatelets: Exciton Binding Energy, Polarizability, and Field-Dependent Radiative Rates.

PubMed

Scott, Riccardo; Achtstein, Alexander W; Prudnikau, Anatol V; Antanovich, Artsiom; Siebbeles, Laurens D A; Artemyev, Mikhail; Woggon, Ulrike

2016-10-12

We present a study of the application potential of CdSe nanoplatelets (NPLs), a model system for colloidal 2D materials, as field-controlled emitters. We demonstrate that their emission can be changed by 28% upon application of electrical fields up to 175 kV/cm, a very high modulation depth for field-controlled nanoemitters. From our experimental results we estimate the exciton binding energy in 5.5 monolayer CdSe nanoplatelets to be E B = 170 meV; hence CdSe NPLs exhibit highly robust excitons which are stable even at room temperature. This opens up the possibility to tune the emission and recombination dynamics efficiently by external fields. Our analysis further allows a quantitative discrimination of spectral changes of the emission energy and changes in PL intensity related to broadening of the emission line width as well as changes in the intrinsic radiative rates which are directly connected to the measured changes in the PL decay dynamics. With the developed field-dependent population model treating all occurring field-dependent effects in a global analysis, we are able to quantify, e.g., the ground state exciton transition dipole moment (3.0 × 10 -29 Cm) and its polarizability, which determine the radiative rate, as well as the (static) exciton polarizability (8.6 × 10 -8 eV cm 2 /kV 2 ), all in good agreement with theory. Our results show that an efficient field control over the exciton recombination dynamics, emission line width, and emission energy in these nanoparticles is feasible and opens up application potential as field-controlled emitters.

Temperature and doping dependence of the high-energy kink in cuprates.

PubMed

Zemljic, M M; Prelovsek, P; Tohyama, T

2008-01-25

It is shown that spectral functions within the extended t-J model, evaluated using the finite-temperature diagonalization of small clusters, exhibit the high-energy kink in single-particle dispersion consistent with recent angle-resolved photoemission results on hole-doped cuprates. The kink and waterfall-like features persist up to large doping and to temperatures beyond J; hence, the origin can be generally attributed to strong correlations and incoherent hole propagation at large binding energies. In contrast, our analysis predicts that electron-doped cuprates do not exhibit these phenomena in photoemission.

The substrate binding interface of alkylpurine DNA glycosylase AlkD.

PubMed

Mullins, Elwood A; Rubinson, Emily H; Eichman, Brandt F

2014-01-01

Tandem helical repeats have emerged as an important DNA binding architecture. DNA glycosylase AlkD, which excises N3- and N7-alkylated nucleobases, uses repeating helical motifs to bind duplex DNA and to selectively pause at non-Watson-Crick base pairs. Remodeling of the DNA backbone promotes nucleotide flipping of the lesion and the complementary base into the solvent and toward the protein surface, respectively. The important features of this new DNA binding architecture that allow AlkD to distinguish between damaged and normal DNA without contacting the lesion are poorly understood. Here, we show through extensive mutational analysis that DNA binding and N3-methyladenine (3mA) and N7-methylguanine (7mG) excision are dependent upon each residue lining the DNA binding interface. Disrupting electrostatic or hydrophobic interactions with the DNA backbone substantially reduced binding affinity and catalytic activity. These results demonstrate that residues seemingly only involved in general DNA binding are important for catalytic activity and imply that base excision is driven by binding energy provided by the entire substrate interface of this novel DNA binding architecture. Copyright © 2013 Elsevier B.V. All rights reserved.

Characteristics of low-and high-fat beef patties: effect of high hydrostatic pressure.

PubMed

Carballo, J; Fernandez, P; Carrascosa, A V; Solas, M T; Colmenero, F J

1997-01-01

The purpose of this study was to analyze the consequences of applying high pressures (100 and 300 MPa for 5 or 20 min) on characteristics such as water- and fat-binding properties, texture, color, microstructure, and microbiology of low-fat (9.2%) and high-fat (20.3%) beef patties. In nonpressurized patties, the low-fat product exhibited significantly poorer (P < 0.05) binding properties and higher (P < 0.05) Kramer shear force and Kramer energy than did high-fat patties. Although high pressure did not clearly influence the binding properties of low- and high-fat beef patties, it did produce a rise in the Kramer shear force and energy which were more pronounced at 300 MPa. High pressures altered patty color, the extent of alteration depending on fat content, pressure, and pressurizing time. Pressurizing high- and low-fat beef patties at 300 MPa not only produced a lethal effect (P < 0.05) on microorganisms, but caused sublethal damage as well.

Modeling Ionization Events iduced by Protein Protein Binding

NASA Astrophysics Data System (ADS)

Mitra, Rooplekha; Shyam, Radhey; Alexov, Emil

2009-11-01

The association of two or more biological macromolecules dramatically change the environment of the amino acids situated at binding interface and could change ionization states of titratable groups. The change of ionization due to the binding results in proton uptake/release and causes pH-dependence of the binding free energy. We apply computational method, as implemented in Multi Conformation Continuum Electrostatics (MCCE) algorithm, to study protonation evens on a large set of protein-protein complexes. Our results indicate that proton uptake/release is a common phenomena in protein binding since in vast majority of the cases (70%) the binding caused at least 0.5 units proton change. The proton uptake/release was further investigated with respect to interfacial area and charges of the monomers and it was found that macroscopic characteristics are not important determinants. Instead, charge complementarity across the interface and the number of unpaired ionizable groups at the interface are the primary source of proton uptake/release.

Lactate Dehydrogenase Undergoes a Substantial Structural Change to Bind its Substrate

PubMed Central

Qiu, Linlin; Gulotta, Miriam; Callender, Robert

2007-01-01

Employing temperature-jump relaxation spectroscopy, we investigate the kinetics and thermodynamics of the formation of a very early ternary binding intermediate formed when lactate dehydrogenase (LDH) binds a substrate mimic on its way to forming the productive LDH/NADH·substrate Michaelis complex. Temperature-jump scans show two distinct submillisecond processes are involved in the formation of this ternary binding intermediate, called the encounter complex here. The on-rate of the formation of the encounter complex from LDH/NADH with oxamate (a substrate mimic) is determined as a function of temperature and in the presence of small concentrations of a protein destabilizer (urea) and protein stabilizer (TMAO). It shows a strong temperature dependence with inverse Arrhenius behavior and a temperature-dependent enthalpy (heat capacity of 610 ± 84 cal/Mol K), is slowed in the presence of TMAO and speeded up in the presence of urea. These results suggest that LDH/NADH occupies a range of conformations, some competent to bind substrate (open structure; a minority population) and others noncompetent (closed), in fast equilibrium with each other in accord with a select fit model of binding. From the thermodynamic results, the two species differ in the rearrangement of low energy hydrogen bonds as would arise from changes in internal hydrogen bonding and/or increases in the solvation of the protein structure. The binding-competent species can bind ligand at or very near diffusion-limited speeds, suggesting that the binding pocket is substantially exposed to solvent in these species. This would be in contrast to the putative closed structure where the binding pocket resides deep within the protein interior. PMID:17483169

Theoretical studies of alkyl radicals in the NaY and HY zeolites.

PubMed

Ghandi, Khashayar; Zahariev, Federico E; Wang, Yan Alexander

2005-08-18

Interplay of quantum mechanical calculations and experimental data on hyperfine coupling constants of ethyl radical in zeolites at several temperatures was engaged to study the geometries and binding energies and to predict the temperature dependence of hyperfine splitting of a series of alkyl radicals in zeolites for the first time. The main focus is on the hyperfine interaction of alkyl radicals in the NaY and HY zeolites. The hyperfine splitting for neutral free radicals and free radical cations is predicted for different zeolite environments. This information can be used to establish the nature of the muoniated alkyl radicals in the NaY and HY zeolites via muSR experiments. The muon hyperfine coupling constants of the ethane radical cation in these zeolites are very large with relatively little dependence on temperature. It was found that the intramolecular dynamics of alkyl free radicals are only weakly affected by their strong binding to zeolites. In contrast, the substrate binding has a significant effect on their intermolecular dynamics.

The force-dependent mechanism of DnaK-mediated mechanical folding

PubMed Central

Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2018-01-01

It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

The properties of small Ag clusters bound to DNA bases.

PubMed

Soto-Verdugo, Víctor; Metiu, Horia; Gwinn, Elisabeth

2010-05-21

We study the binding of neutral silver clusters, Ag(n) (n=1-6), to the DNA bases adenine (A), cytosine (C), guanine (G), and thymine (T) and the absorption spectra of the silver cluster-base complexes. Using density functional theory (DFT), we find that the clusters prefer to bind to the doubly bonded ring nitrogens and that binding to T is generally much weaker than to C, G, and A. Ag(3) and Ag(4) make the stronger bonds. Bader charge analysis indicates a mild electron transfer from the base to the clusters for all bases, except T. The donor bases (C, G, and A) bind to the sites on the cluster where the lowest unoccupied molecular orbital has a pronounced protrusion. The site where cluster binds to the base is controlled by the shape of the higher occupied states of the base. Time-dependent DFT calculations show that different base-cluster isomers may have very different absorption spectra. In particular, we find new excitations in base-cluster molecules, at energies well below those of the isolated components, and with strengths that depend strongly on the orientations of planar clusters with respect to the base planes. Our results suggest that geometric constraints on binding, imposed by designed DNA structures, may be a feasible route to engineering the selection of specific cluster-base assemblies.

In vitro and in silico assessment of the structure-dependent binding of bisphenol analogues to glucocorticoid receptor.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Yu, Hansong; Li, Tiezhu

2017-03-01

Widespread use of bisphenol A (BPA) and other bisphenol analogues has attracted increasing attention for their potential adverse effects. As environmental endocrine-disrupting compounds (EDCs), bisphenols (BPs) may activate a variety of nuclear receptors, including glucocorticoid receptor (GR). In this work, the binding of 11 BPs to GR was investigated by fluorescence polarization (FP) assay in combination with molecular dynamics simulations. The human glucocorticoid receptor was prepared as a soluble recombinant protein. A fluorescein-labeled dexamethasone derivative (Dex-fl) was employed as tracer. Competitive displacement of Dex-fl from GR by BPs showed that the binding affinities of bisphenol analogues were largely dependent on their characteristic functional groups. In order to further understand the relationship between BPs structures and their GR-mediated activities, molecular docking was utilized to explore the binding modes at the atomic level. The results confirmed that structural variations of bisphenol analogues contributed to different interactions of BPs with GR, potentially causing distinct toxic effects. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.8266), which might be helpful for the design of environmentally benign materials with reduced toxicities. In addition, the established FP assay based on GR exhibited the potential to offer an alternative to traditional methods for the detection of bisphenols.

Differential Cationization of Fatty Acids with Monovalent Cations Studied by ESI-MS/MS and Computational Approach.

PubMed

Sudarshana Reddy, B; Pavankumar, P; Sridhar, L; Saha, Soumen; Narahari Sastry, G; Prabhakar, S

2018-04-24

The intercellular and intracellular transport of charged species (Na + /K + ) entail interaction of the ions with neutral organic molecules and formation of adduct ions. The rate of transport of the ions across the cell membrane(s) may depend on the stability of the adduct ions, which in turn rely on structural aspects of the organic molecules that interact with the ions. Positive ion ESI mass spectra were recorded for the solutions containing fatty acids (FAs) and monovalent cations (X=Li + , Na + , K + , Rb + and Cs + ). Product ion spectra of the [FA+X] + ions were recorded at different collision energies. Theoretical studies were exploited under both gas phase and solvent phase to investigate the structural effects of the fatty acids during cationization. Stability of [FA+X] + adduct ions were further estimated by means of AIM topological analyses and interaction energy (IE) values. Positive ion ESI-MS analyses of the solution of FAs and X + ions showed preferential binding of the K + ions to FAs. The K + ion binding increased with the increase in number of double bonds of FAs, while decreased with increase in the number of carbons of FAs. Dissociation curves of [FA+X] + ions indicated the relative stability order of the [FA+X] + ions and it was in line with the observed trends in ESI-MS. The solvent phase computational studies divulged the mode of binding and the binding efficiencies of different FAs with monovalent cations. Among the studied monovalent cations, the cationization of FAs follow the order K + >Na + >Li + >Rb + >Cs + . The docosahexaenoic acid showed high efficiency in binding with K + ion. The K + ion binding efficiency of FAs depends on the number of double bonds in unsaturated FAs and the carbon chain length in saturated FAs. The cationization trends of FAs obtained from the ESI-MS, ESI-MS/MS analyses were in good agreement with solvent phase computational studies. This article is protected by copyright. All rights reserved.

Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.

PubMed

Gapsys, Vytautas; de Groot, Bert L

2017-12-12

Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .

Effective homogeneity of the exchange-correlation and non-interacting kinetic energy functionals under density scaling.

PubMed

Borgoo, Alex; Teale, Andrew M; Tozer, David J

2012-01-21

Correlated electron densities, experimental ionisation potentials, and experimental electron affinities are used to investigate the homogeneity of the exchange-correlation and non-interacting kinetic energy functionals of Kohn-Sham density functional theory under density scaling. Results are presented for atoms and small molecules, paying attention to the influence of the integer discontinuity and the choice of the electron affinity. For the exchange-correlation functional, effective homogeneities are highly system-dependent on either side of the integer discontinuity. By contrast, the average homogeneity-associated with the potential that averages over the discontinuity-is generally close to 4/3 when the discontinuity is computed using positive affinities for systems that do bind an excess electron and negative affinities for those that do not. The proximity to 4/3 becomes increasingly pronounced with increasing atomic number. Evaluating the discontinuity using a zero affinity in systems that do not bind an excess electron instead leads to effective homogeneities on the electron abundant side that are close to 4/3. For the non-interacting kinetic energy functional, the effective homogeneities are less system-dependent and the effect of the integer discontinuity is less pronounced. Average values are uniformly below 5/3. The study provides information that may aid the development of improved exchange-correlation and non-interacting kinetic energy functionals. © 2012 American Institute of Physics

N‐Heterocyclic Carbene Self‐assembled Monolayers on Copper and Gold: Dramatic Effect of Wingtip Groups on Binding, Orientation and Assembly

PubMed Central

Larrea, Christian R.; Narouz, Mina R.; Mosey, Nicholas J.; Horton, J. Hugh; Crudden, Cathleen M.

2017-01-01

Abstract Self‐assembled monolayers of N‐heterocyclic carbenes (NHCs) on copper are reported. The monolayer structure is highly dependent on the N,N‐substituents on the NHC. On both Cu(111) and Au(111), bulky isopropyl substituents force the NHC to bind perpendicular to the metal surface while methyl‐ or ethyl‐substituted NHCs lie flat. Temperature‐programmed desorption studies show that the NHC binds to Cu(111) with a desorption energy of E des=152±10 kJ mol−1. NHCs that bind upright desorb cleanly, while flat‐lying NHCs decompose leaving adsorbed organic residues. Scanning tunneling microscopy of methylated NHCs reveals arrays of covalently linked dimers which transform into adsorbed (NHC)2Cu species by extraction of a copper atom from the surface after annealing. PMID:28960768

The measured and calculated affinity of methyl and methoxy substituted benzoquinones for the QA site of bacterial reaction centers

PubMed Central

Zheng, Zhong; Dutton, P. Leslie; Gunner, M. R.

2010-01-01

Quinones play important roles in mitochondrial and photosynthetic energy conversion acting as intramembrane, mobile electron and proton carriers between catalytic sites in various electron transfer proteins. They display different affinity, selectivity, functionality and exchange dynamics in different binding sites. The computational analysis of quinone binding sheds light on the requirements for quinone affinity and specificity. The affinities of ten oxidized, neutral benzoquinones (BQs) were measured for the high affinity QA site in the detergent solubilized Rhodobacter sphaeroides bacterial photosynthetic reaction center. Multi-Conformation Continuum Electrostatics (MCCE) was then used to calculate their relative binding free energies by Grand Canonical Monte Carlo sampling with a rigid protein backbone, flexible ligand and side chain positions and protonation states. Van der Waals and torsion energies, Poisson-Boltzmann continuum electrostatics and accessible surface area dependent ligand-solvent interactions are considered. An initial, single cycle of GROMACS backbone optimization improves the match with experiment as do coupled ligand and side chain motions. The calculations match experiment with an RMSD of 2.29 and a slope of 1.28. The affinities are dominated by favorable protein-ligand van der Waals rather than electrostatic interactions. Each quinone appears in a closely clustered set of positions. Methyl and methoxy groups move into the same positions as found for the native quinone. Difficulties putting methyls into methoxy sites are observed. Calculations using an SAS dependent implicit van der Waals interaction smoothed out small clashes, providing a better match to experiment with a RMSD of 0.77 and a slope of 0.97. PMID:20607696

Probing excitonic states in suspended two-dimensional semiconductors by photocurrent spectroscopy

DOE PAGES

Klots, A. R.; Newaz, A. K. M.; Wang, Bin; ...

2014-10-16

The optical response of semiconducting monolayer transition-metal dichalcogenides (TMDCs) is dominated by strongly bound excitons that are stable even at room temperature. However, substrate-related effects such as screening and disorder in currently available specimens mask many anticipated physical phenomena and limit device applications of TMDCs. Here, we demonstrate that that these undesirable effects are strongly suppressed in suspended devices. Extremely robust (photogain > 1,000) and fast (response time < 1 ms) photoresponse allow us to study, for the first time, the formation, binding energies, and dissociation mechanisms of excitons in TMDCs through photocurrent spectroscopy. By analyzing the spectral positions ofmore » peaks in the photocurrent and by comparing them with first-principles calculations, we obtain binding energies, band gaps and spin-orbit splitting in monolayer TMDCs. For monolayer MoS2, in particular, we obtain an extremely large binding energy for band-edge excitons, Ebind ≥ 570 meV. Along with band-edge excitons, we observe excitons associated with a van Hove singularity of rather unique nature. In conclusion, the analysis of the source-drain voltage dependence of photocurrent spectra reveals exciton dissociation and photoconversion mechanisms in TMDCs.« less

A computational study to identify the key residues of peroxisome proliferator-activated receptor gamma in the interactions with its antagonists.

PubMed

Sharifi, Tayebeh; Ghayeb, Yousef

2018-05-01

Peroxisome proliferator-activated receptors (PPARs) compose a family of nuclear receptors, PPARα, PPARβ, and PPARγ, which mediate the effects of lipidic ligands at the transcriptional level. Among these, the PPARγ has been known to regulate adipocyte differentiation, fatty acid storage and glucose metabolism, and is a target of antidiabetic drugs. In this work, the interactions between PPARγ and its six known antagonists were investigated using computational methods such as molecular docking, molecular dynamics (MD) simulations, and the hybrid quantum mechanics/molecular mechanics (QM/MM). The binding energies evaluated by molecular docking varied between -22.59 and -35.15 kJ mol - 1 . In addition, MD simulations were performed to investigate the binding modes and PPARγ conformational changes upon binding of antagonists. Analysis of the root-mean-square fluctuations (RMSF) of backbone atoms shows that H3 of PPARγ has a higher mobility in the absence of antagonists and moderate conformational changes were observed. The interaction energies between antagonists and each PPARγ residue involved in the interactions were studied by QM/MM calculations. These calculations reveal that antagonists with different structures show different interaction energies with the same residue of PPARγ. Therefore, it can be concluded that the key residues vary depending on the structure of the ligand, which binds to PPARγ.

Accurate ensemble molecular dynamics binding free energy ranking of multidrug-resistant HIV-1 proteases.

PubMed

Sadiq, S Kashif; Wright, David W; Kenway, Owain A; Coveney, Peter V

2010-05-24

Accurate calculation of important thermodynamic properties, such as macromolecular binding free energies, is one of the principal goals of molecular dynamics simulations. However, single long simulation frequently produces incorrectly converged quantitative results due to inadequate sampling of conformational space in a feasible wall-clock time. Multiple short (ensemble) simulations have been shown to explore conformational space more effectively than single long simulations, but the two methods have not yet been thermodynamically compared. Here we show that, for end-state binding free energy determination methods, ensemble simulations exhibit significantly enhanced thermodynamic sampling over single long simulations and result in accurate and converged relative binding free energies that are reproducible to within 0.5 kcal/mol. Completely correct ranking is obtained for six HIV-1 protease variants bound to lopinavir with a correlation coefficient of 0.89 and a mean relative deviation from experiment of 0.9 kcal/mol. Multidrug resistance to lopinavir is enthalpically driven and increases through a decrease in the protein-ligand van der Waals interaction, principally due to the V82A/I84V mutation, and an increase in net electrostatic repulsion due to water-mediated disruption of protein-ligand interactions in the catalytic region. Furthermore, we correctly rank, to within 1 kcal/mol of experiment, the substantially increased chemical potency of lopinavir binding to the wild-type protease compared to saquinavir and show that lopinavir takes advantage of a decreased net electrostatic repulsion to confer enhanced binding. Our approach is dependent on the combined use of petascale computing resources and on an automated simulation workflow to attain the required level of sampling and turn around time to obtain the results, which can be as little as three days. This level of performance promotes integration of such methodology with clinical decision support systems for the optimization of patient-specific therapy.

Isoelectronic bound-exciton photoluminescence in strained beryllium-doped Si0.92Ge0.08 epilayers and Si0.92Ge0.08/Si superlattices at ambient and elevated hydrostatic pressure

NASA Astrophysics Data System (ADS)

Kim, Sangsig; Chang, Ganlin; Herman, Irving P.; Bevk, Joze; Moore, Karen L.; Hall, Dennis G.

1997-03-01

Photoluminescence (PL) from a beryllium-doped Si0.92Ge0.08 epilayer and three different beryllium-doped Si0.92Ge0.08/Si superlattices (SL's) commensurately grown on Si(100) substrates is examined at 9 K at ambient pressure and, for the epilayer and one SL, as a function of hydrostatic pressure. In each structure, excitons bind to the isoelectronic Be pairs in the strained Si0.92Ge0.08 layers. The zero-phonon PL peaks of the epilayer and the in situ doped 50-Å Si0.92Ge0.08/100-Å Si SL shift linearly with pressure toward lower energy at the rate of 0.68+/-0.03 and 0.97+/-0.03 meV/kbar, respectively, which are near the 0.77-meV/kbar value for Si:Be. The PL energies at ambient and elevated pressure are analyzed by accounting for strain, quantum confinement, and exciton binding. A modified Hopfield-Thomas-Lynch model is used to model exciton binding to the Be pairs. This model, in which potential wells bind electrons to a site (that then trap holes), predicts a distribution of electron binding energies when an inhomogeneous distribution of potential-well depths is used. This accounts for the large PL linewidth and the decrease of linewidth with increasing pressure, among other observations. In SL's, the exciton binding energy is shown to depend on the width of the wells as well as the spatial distribution of Be dopants in the superlattice. Also, at and above 58 kbar a very unusual peak is observed in one of the SL's, which is associated with a free-exciton peak in Si, that shifts very fast with pressure (-6.02+/-0.03 meV/kbar).

Combined 3D-QSAR, molecular docking, molecular dynamics simulation, and binding free energy calculation studies on the 5-hydroxy-2H-pyridazin-3-one derivatives as HCV NS5B polymerase inhibitors.

PubMed

Yu, Haijing; Fang, Yu; Lu, Xia; Liu, Yongjuan; Zhang, Huabei

2014-01-01

The NS5B RNA-dependent RNA polymerase (RdRP) is a promising therapeutic target for developing novel anti-hepatitis C virus (HCV) drugs. In this work, a combined molecular modeling study was performed on a series of 193 5-hydroxy-2H-pyridazin-3-one derivatives as inhibitors of HCV NS5B Polymerase. The best 3D-QSAR models, including CoMFA and CoMSIA, are based on receptor (or docking). Furthermore, a 40-ns molecular dynamics (MD) simulation and binding free energy calculations using docked structures of NS5B with ten compounds, which have diverse structures and pIC50 values, were employed to determine the detailed binding process and to compare the binding modes of the inhibitors with different activities. On one side, the stability and rationality of molecular docking and 3D-QSAR results were validated by MD simulation. The binding free energies calculated by the MM-PBSA method gave a good correlation with the experimental biological activity. On the other side, by analyzing some differences between the molecular docking and the MD simulation results, we can find that the MD simulation could also remedy the defects of molecular docking. The analyses of the combined molecular modeling results have identified that Tyr448, Ser556, and Asp318 are the key amino acid residues in the NS5B binding pocket. The results from this study can provide some insights into the development of novel potent NS5B inhibitors. © 2013 John Wiley & Sons A/S.

Role of water molecules in structure and energetics of Pseudomonas aeruginosa lectin I interacting with disaccharides.

PubMed

Nurisso, Alessandra; Blanchard, Bertrand; Audfray, Aymeric; Rydner, Lina; Oscarson, Stefan; Varrot, Annabelle; Imberty, Anne

2010-06-25

Calcium-dependent lectin I from Pseudomonas aeruginosa (PA-IL) binds specifically to oligosaccharides presenting an alpha-galactose residue at their nonreducing end, such as the disaccharides alphaGal1-2betaGalOMe, alphaGal1-3betaGalOMe, and alphaGal1-4betaGalOMe. This provides a unique model for studying the effect of the glycosidic linkage of the ligands on structure and thermodynamics of the complexes by means of experimental and theoretical tools. The structural features of PA-IL in complex with the three disaccharides were established by docking and molecular dynamics simulations and compared with those observed in available crystal structures, including PA-IL.alphaGal1-2betaGalOMe complex, which was solved at 2.4 A resolution and reported herein. The role of a structural bridge water molecule in the binding site of PA-IL was also elucidated through molecular dynamics simulations and free energy calculations. This water molecule establishes three very stable hydrogen bonds with O6 of nonreducing galactose, oxygen from Pro-51 main chain, and nitrogen from Gln-53 main chain of the lectin binding site. Binding free energies for PA-IL in complex with the three disaccharides were investigated, and the results were compared with the experimental data determined by titration microcalorimetry. When the bridge water molecule was included in the free energy calculations, the simulations predicted the correct binding affinity trends with the 1-2-linked disaccharide presenting three times stronger affinity ligand than the other two. These results highlight the role of the water molecule in the binding site of PA-IL and indicate that it should be taken into account when designing glycoderivatives active against P. aeruginosa adhesion.

Improved estimation of ligand macromolecule binding affinities by linear response approach using a combination of multi-mode MD simulation and QM/MM methods

NASA Astrophysics Data System (ADS)

Khandelwal, Akash; Balaz, Stefan

2007-01-01

Structure-based predictions of binding affinities of ligands binding to proteins by coordination bonds with transition metals, covalent bonds, and bonds involving charge re-distributions are hindered by the absence of proper force fields. This shortcoming affects all methods which use force-field-based molecular simulation data on complex formation for affinity predictions. One of the most frequently used methods in this category is the Linear Response (LR) approach of Åquist, correlating binding affinities with van der Waals and electrostatic energies, as extended by Jorgensen's inclusion of solvent-accessible surface areas. All these terms represent the differences, upon binding, in the ensemble averages of pertinent quantities, obtained from molecular dynamics (MD) or Monte Carlo simulations of the complex and of single components. Here we report a modification of the LR approach by: (1) the replacement of the two energy terms through the single-point QM/MM energy of the time-averaged complex structure from an MD simulation; and (2) a rigorous consideration of multiple modes (mm) of binding. The first extension alleviates the force-field related problems, while the second extension deals with the ligands exhibiting large-scale motions in the course of an MD simulation. The second modification results in the correlation equation that is nonlinear in optimized coefficients, but does not lead to an increase in the number of optimized coefficients. The application of the resulting mm QM/MM LR approach to the inhibition of zinc-dependent gelatinase B (matrix metalloproteinase 9) by 28 hydroxamate ligands indicates a significant improvement of descriptive and predictive abilities.

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Structural and Thermal Disorder of Solution-Processed CH3NH3PbBr3 Hybrid Perovskite Thin Films.

PubMed

Wolf, Christoph; Kim, Joo-Sung; Lee, Tae-Woo

2017-03-29

We extracted the electronic disorder energy of the organic-inorganic lead-halide hybrid perovskite CH 3 NH 3 PbBr 3 from temperature-dependent absorption data. We showed that the disorder at room temperature is ∼30 meV and is due to strong electron-phonon coupling with the longitudinal-optical mode of energy 16 meV. This mode can be attributed to longitudinal-optical phonons of the inorganic PbBr 6 frame; this conclusion highlights the polaronic nature of electronic excitations in CH 3 NH 3 PbBr 3 . We showed that structural disorder is of the same impact as thermal disorder. A temperature-dependence of the exciton binding energy was observed close to the orthorhombic-to-tetragonal phase-transition temperature.

Position-specific incorporation of fluorescent non-natural amino acids into maltose-binding protein for detection of ligand binding by FRET and fluorescence quenching.

PubMed

Iijima, Issei; Hohsaka, Takahiro

2009-04-17

Position-specific incorporation of fluorescent groups is a useful method for analysis of the functions and structures of proteins. We have developed a method for the incorporation of visible-wavelength-fluorescent non-natural amino acids into proteins in a cell-free translation system. Using this technique, we introduced one or two BODIPY-linked amino acids into maltose-binding protein (MBP) to obtain MBP derivatives showing ligand-dependent changes in fluorescence intensity or intensity ratio. BODIPY-FL-aminophenylalanine was incorporated in place of 15 tyrosines, as well as the N-terminal Lys1, and the C-terminal Lys370 of MBP. Fluorescence measurements revealed that MBP containing a BODIPY-FL moiety in place of Tyr210 showed a 13-fold increase in fluorescence upon binding of maltose. Tryptophan-to-phenylalanine substitutions suggest that the increase in fluorescence was the result of a decrease in the quenching of BODIPY-FL by tryptophan located around the binding site. MBP containing a BODIPY-558 moiety also showed a maltose-dependent increase in fluorescence. BODIPY-FL was then additionally incorporated in place of Lys1 of the BODIPY-558-containing MBP as a response to the amber codon. Fluorescence measurements with excitation of BODIPY-FL showed a large change in fluorescence intensity ratio (0.13 to 1.25) upon binding of maltose; this change can be attributed to fluorescence resonance energy transfer (FRET) and maltose-dependent quenching of BODIPY-558. These results demonstrate the usefulness of the position-specific incorporation of fluorescent amino acids in the fluorescence-based detection of protein functions.

Modeling Shear Induced Von Willebrand Factor Binding to Collagen

NASA Astrophysics Data System (ADS)

Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong

2017-11-01

Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).

Few residues within an extensive binding interface drive receptor interaction and determine the specificity of arrestin proteins.

PubMed

Vishnivetskiy, Sergey A; Gimenez, Luis E; Francis, Derek J; Hanson, Susan M; Hubbell, Wayne L; Klug, Candice S; Gurevich, Vsevolod V

2011-07-08

Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements.

Few Residues within an Extensive Binding Interface Drive Receptor Interaction and Determine the Specificity of Arrestin Proteins*

PubMed Central

Vishnivetskiy, Sergey A.; Gimenez, Luis E.; Francis, Derek J.; Hanson, Susan M.; Hubbell, Wayne L.; Klug, Candice S.; Gurevich, Vsevolod V.

2011-01-01

Arrestins bind active phosphorylated forms of G protein-coupled receptors, terminating G protein activation, orchestrating receptor trafficking, and redirecting signaling to alternative pathways. Visual arrestin-1 preferentially binds rhodopsin, whereas the two non-visual arrestins interact with hundreds of G protein-coupled receptor subtypes. Here we show that an extensive surface on the concave side of both arrestin-2 domains is involved in receptor binding. We also identified a small number of residues on the receptor binding surface of the N- and C-domains that largely determine the receptor specificity of arrestins. We show that alanine substitution of these residues blocks the binding of arrestin-1 to rhodopsin in vitro and of arrestin-2 and -3 to β2-adrenergic, M2 muscarinic cholinergic, and D2 dopamine receptors in intact cells, suggesting that these elements critically contribute to the energy of the interaction. Thus, in contrast to arrestin-1, where direct phosphate binding is crucial, the interaction of non-visual arrestins with their cognate receptors depends to a lesser extent on phosphate binding and more on the binding to non-phosphorylated receptor elements. PMID:21471193

Quantum-Mechanics Methodologies in Drug Discovery: Applications of Docking and Scoring in Lead Optimization.

PubMed

Crespo, Alejandro; Rodriguez-Granillo, Agustina; Lim, Victoria T

2017-01-01

The development and application of quantum mechanics (QM) methodologies in computer- aided drug design have flourished in the last 10 years. Despite the natural advantage of QM methods to predict binding affinities with a higher level of theory than those methods based on molecular mechanics (MM), there are only a few examples where diverse sets of protein-ligand targets have been evaluated simultaneously. In this work, we review recent advances in QM docking and scoring for those cases in which a systematic analysis has been performed. In addition, we introduce and validate a simplified QM/MM expression to compute protein-ligand binding energies. Overall, QMbased scoring functions are generally better to predict ligand affinities than those based on classical mechanics. However, the agreement between experimental activities and calculated binding energies is highly dependent on the specific chemical series considered. The advantage of more accurate QM methods is evident in cases where charge transfer and polarization effects are important, for example when metals are involved in the binding process or when dispersion forces play a significant role as in the case of hydrophobic or stacking interactions. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Computational investigation of the binding mode of bis(hydroxylphenyl)arenes in 17β-HSD1: molecular dynamics simulations, MM-PBSA free energy calculations, and molecular electrostatic potential maps

NASA Astrophysics Data System (ADS)

Negri, Matthias; Recanatini, Maurizio; Hartmann, Rolf W.

2011-09-01

17β-Hydroxysteroid dehydrogenase type 1 (17β-HSD1) catalyzes the last step of the estrogen biosynthesis, namely the reduction of estrone to the biologically potent estradiol. As such it is a potentially attractive drug target for the treatment of estrogen-dependent diseases like breast cancer and endometriosis. 17β-HSD1 belongs to the bisubstrate enzymes and exists as an ensemble of conformations. These principally differ in the region of the βFαG'-loop, suggesting a prominent role in substrate and inhibitor binding. Although several classes of potent non-steroidal 17β-HSD1 inhibitors currently exist, their binding mode is still unclear. We aimed to elucidate the binding mode of bis(hydroxyphenyl)arenes, a highly potent class of 17β-HSD1 inhibitors, and to rank these compounds correctly with respect to their inhibitory potency, two essential aspects in drug design. Ensemble docking experiments resulted in a steroidal binding mode for the closed enzyme conformations and in an alternative mode for the opened and occluded conformers with the inhibitors placed below the NADPH interacting with it synergically via π-π stacking and H-bond formation. Both binding modes were investigated by MD simulations and MM-PBSA binding free energy estimations using as representative member for this class compound 1 (50 nM). Notably, only the alternative binding mode proved stable and was energetically more favorable, while when simulated in the steroidal binding mode compound 1 was displaced from the active site. In parallel, ab initio studies of small NADPH-inhibitor complexes were performed, which supported the importance of the synergistic interaction between inhibitors and cofactor.

Driving spin transition at interface: Role of adsorption configurations

NASA Astrophysics Data System (ADS)

Zhang, Yachao

2018-01-01

A clear insight into the electrical manipulation of molecular spins at interface is crucial to the design of molecule-based spintronic devices. Here we report on the electrically driven spin transition in manganocene physisorbed on a metallic surface in two different adsorption configurations predicted by ab initio techniques, including a Hubbard-U correction at the manganese site and accounting for the long-range van der Waals interactions. We show that the application of an electric field at the interface induces a high-spin to low-spin transition in the flat-lying manganocene, while it could hardly alter the high-spin ground state of the standing-up molecule. This phenomenon cannot be explained by either the molecule-metal charge transfer or the local electron correlation effects. We demonstrate a linear dependence of the intra-molecular spin-state splitting on the energy difference between crystal-field splitting and on-site Coulomb repulsion. After considering the molecule-surface binding energy shifts upon spin transition, we reproduce the obtained spin-state energetics. We find that the configuration-dependent responses of the spin-transition originate from the binding energy shifts instead of the variation of the local ligand field. Through these analyses, we obtain an intuitive understanding of the effects of molecule-surface contact on spin-crossover under electrical bias.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Binding selectivity of dibenzo-18-crown-6 for alkali metal cations in aqueous solution: A density functional theory study using a continuum solvation model.

PubMed

Choi, Chang Min; Heo, Jiyoung; Kim, Nam Joon

2012-08-08

Dibenzo-18-crown-6 (DB18C6) exhibits the binding selectivity for alkali metal cations in solution phase. In this study, we investigate the main forces that determine the binding selectivity of DB18C6 for the metal cations in aqueous solution using the density functional theory (DFT) and the conductor-like polarizable continuum model (CPCM). The bond dissociation free energies (BDFE) of DB18C6 complexes with alkali metal cations (M+-DB18C6, M = Li, Na, K, Rb, and Cs) in aqueous solution are calculated at the B3LYP/6-311++G(d,p)//B3LYP/6-31 + G(d) level using the CPCM. It is found that the theoretical BDFE is the largest for K+-DB18C6 and decreases as the size of the metal cation gets larger or smaller than that of K+, which agrees well with previous experimental results. The solvation energy of M+-DB18C6 in aqueous solution plays a key role in determining the binding selectivity of DB18C6. In particular, the non-electrostatic dispersion interaction between the solute and solvent, which depends strongly on the complex structure, is largely responsible for the different solvation energies of M+-DB18C6. This study shows that the implicit solvation model like the CPCM works reasonably well in predicting the binding selectivity of DB18C6 in aqueous solution.

Modelling free and oxide-supported nanoalloy catalysts: comparison of bulk-immiscible Pd-Ir and Au-Rh systems and influence of a TiO2 support.

PubMed

Demiroglu, Ilker; Fan, Tian-E; Li, Z Y; Yuan, Jun; Liu, Tun-Dong; Piccolo, Laurent; Johnston, Roy L

2018-05-24

The relative stabilities of different chemical arrangements of Pd-Ir and Au-Rh nanoalloys (and their pure metal equivalents) are studied, for a range of compositions, for fcc truncated octahedral 38- and 79-atom nanoparticles (NPs). For the 38-atom NPs, comparisons are made of pure and alloy NPs supported on a TiO2(110) slab. The relative energies of different chemical arrangements are found to be similar for Pd-Ir and Au-Rh nanoalloys, and depend on the cohesive and surface energies of the component metals. For supported nanoalloys on TiO2, the interaction with the surface is greater for Ir (Rh) than Pd (Au): most of the pure NPs and nanoalloys preferentially bind to the TiO2 surface in an edge-on configuration. When Au-Rh nanoalloys are bound to the surface through Au, the surface binding strength is lower than for the pure Au NP, while the Pd-surface interaction is found to be greater for Pd-Ir nanoalloys than for the pure Pd NP. However, alloying leads to very little difference in Ir-surface and Rh-surface binding strength. Comparing the relative stabilities of the TiO2-supported NPs, the results for Pd-Ir and Au-Rh nanoalloys are the same: supported Janus NPs, whose Ir (Rh) atoms bind to the TiO2 surface, bind most strongly to the surface, becoming closer in energy to the core-shell configurations (Ir@Pd and Rh@Au) which are favoured for the free particles.

A computational approach for predicting off-target toxicity of antiviral ribonucleoside analogues to mitochondrial RNA polymerase.

PubMed

Freedman, Holly; Winter, Philip; Tuszynski, Jack; Tyrrell, D Lorne; Houghton, Michael

2018-06-22

In the development of antiviral drugs that target viral RNA-dependent RNA polymerases, off-target toxicity caused by the inhibition of the human mitochondrial RNA polymerase (POLRMT) is a major liability. Therefore, it is essential that all new ribonucleoside analogue drugs be accurately screened for POLRMT inhibition. A computational tool that can accurately predict NTP binding to POLRMT could assist in evaluating any potential toxicity and in designing possible salvaging strategies. Using the available crystal structure of POLRMT bound to an RNA transcript, here we created a model of POLRMT with an NTP molecule bound in the active site. Furthermore, we implemented a computational screening procedure that determines the relative binding free energy of an NTP analogue to POLRMT by free energy perturbation (FEP), i.e. a simulation in which the natural NTP molecule is slowly transformed into the analogue and back. In each direction, the transformation was performed over 40 ns of simulation on our IBM Blue Gene Q supercomputer. This procedure was validated across a panel of drugs for which experimental dissociation constants were available, showing that NTP relative binding free energies could be predicted to within 0.97 kcal/mol of the experimental values on average. These results demonstrate for the first time that free-energy simulation can be a useful tool for predicting binding affinities of NTP analogues to a polymerase. We expect that our model, together with similar models of viral polymerases, will be very useful in the screening and future design of NTP inhibitors of viral polymerases that have no mitochondrial toxicity. © 2018 Freedman et al.

Zeaxanthin Binds to Light-Harvesting Complex Stress-Related Protein to Enhance Nonphotochemical Quenching in Physcomitrella patens[W

PubMed Central

Pinnola, Alberta; Dall’Osto, Luca; Gerotto, Caterina; Morosinotto, Tomas; Bassi, Roberto; Alboresi, Alessandro

2013-01-01

Nonphotochemical quenching (NPQ) dissipates excess energy to protect the photosynthetic apparatus from excess light. The moss Physcomitrella patens exhibits strong NPQ by both algal-type light-harvesting complex stress-related (LHCSR)–dependent and plant-type S subunit of Photosystem II (PSBS)-dependent mechanisms. In this work, we studied the dependence of NPQ reactions on zeaxanthin, which is synthesized under light stress by violaxanthin deepoxidase (VDE) from preexisting violaxanthin. We produced vde knockout (KO) plants and showed they underwent a dramatic reduction in thermal dissipation ability and enhanced photoinhibition in excess light conditions. Multiple mutants (vde lhcsr KO and vde psbs KO) showed that zeaxanthin had a major influence on LHCSR-dependent NPQ, in contrast with previous reports in Chlamydomonas reinhardtii. The PSBS-dependent component of quenching was less dependent on zeaxanthin, despite the near-complete violaxanthin to zeaxanthin exchange in LHC proteins. Consistent with this, we provide biochemical evidence that native LHCSR protein binds zeaxanthin upon excess light stress. These findings suggest that zeaxanthin played an important role in the adaptation of modern plants to the enhanced levels of oxygen and excess light intensity of land environments. PMID:24014548

Zeaxanthin binds to light-harvesting complex stress-related protein to enhance nonphotochemical quenching in Physcomitrella patens.

PubMed

Pinnola, Alberta; Dall'Osto, Luca; Gerotto, Caterina; Morosinotto, Tomas; Bassi, Roberto; Alboresi, Alessandro

2013-09-01

Nonphotochemical quenching (NPQ) dissipates excess energy to protect the photosynthetic apparatus from excess light. The moss Physcomitrella patens exhibits strong NPQ by both algal-type light-harvesting complex stress-related (LHCSR)-dependent and plant-type S subunit of Photosystem II (PSBS)-dependent mechanisms. In this work, we studied the dependence of NPQ reactions on zeaxanthin, which is synthesized under light stress by violaxanthin deepoxidase (VDE) from preexisting violaxanthin. We produced vde knockout (KO) plants and showed they underwent a dramatic reduction in thermal dissipation ability and enhanced photoinhibition in excess light conditions. Multiple mutants (vde lhcsr KO and vde psbs KO) showed that zeaxanthin had a major influence on LHCSR-dependent NPQ, in contrast with previous reports in Chlamydomonas reinhardtii. The PSBS-dependent component of quenching was less dependent on zeaxanthin, despite the near-complete violaxanthin to zeaxanthin exchange in LHC proteins. Consistent with this, we provide biochemical evidence that native LHCSR protein binds zeaxanthin upon excess light stress. These findings suggest that zeaxanthin played an important role in the adaptation of modern plants to the enhanced levels of oxygen and excess light intensity of land environments.

Universal noise and Efimov physics

NASA Astrophysics Data System (ADS)

Nicholson, Amy N.

2016-03-01

Probability distributions for correlation functions of particles interacting via random-valued fields are discussed as a novel tool for determining the spectrum of a theory. In particular, this method is used to determine the energies of universal N-body clusters tied to Efimov trimers, for even N, by investigating the distribution of a correlation function of two particles at unitarity. Using numerical evidence that this distribution is log-normal, an analytical prediction for the N-dependence of the N-body binding energies is made.

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

Trap densities and transport properties of pentacene metal-oxide-semiconductor transistors. I. Analytical modeling of time-dependent characteristics

NASA Astrophysics Data System (ADS)

Basile, A. F.; Cramer, T.; Kyndiah, A.; Biscarini, F.; Fraboni, B.

2014-06-01

Metal-oxide-semiconductor (MOS) transistors fabricated with pentacene thin films were characterized by temperature-dependent current-voltage (I-V) characteristics, time-dependent current measurements, and admittance spectroscopy. The channel mobility shows almost linear variation with temperature, suggesting that only shallow traps are present in the semiconductor and at the oxide/semiconductor interface. The admittance spectra feature a broad peak, which can be modeled as the sum of a continuous distribution of relaxation times. The activation energy of this peak is comparable to the polaron binding energy in pentacene. The absence of trap signals in the admittance spectra confirmed that both the semiconductor and the oxide/semiconductor interface have negligible density of deep traps, likely owing to the passivation of SiO2 before pentacene growth. Nevertheless, current instabilities were observed in time-dependent current measurements following the application of gate-voltage pulses. The corresponding activation energy matches the energy of a hole trap in SiO2. We show that hole trapping in the oxide can explain both the temperature and the time dependences of the current instabilities observed in pentacene MOS transistors. The combination of these experimental techniques allows us to derive a comprehensive model for charge transport in hybrid architectures where trapping processes occur at various time and length scales.

Phosphorene quantum dot-fullerene nanocomposites for solar energy conversion: An unexplored inorganic-organic nanohybrid with novel photovoltaic properties

NASA Astrophysics Data System (ADS)

Rajbanshi, Biplab; Kar, Moumita; Sarkar, Pallavi; Sarkar, Pranab

2017-10-01

Using the self-consistent charge density-functional based tight-binding (SCC-DFTB) method, coupled with time-dependent density functional theory (TDDFT) calculations, for the first time we explore the possibility of use of phosphorene quantum dots in solar energy harvesting devices. The phosphorene quantum dots-fullerene (PQDs-PCBA) nanocomposites show type-II band alignment indicating spatial separation of charge carriers. The TDDFT calculations also show that the PQD-fullerene nanocomposites seem to be exciting material for future generation solar energy harvester, with extremely fast charge transfer and very poor recombination rate.

Thermodynamics of Aryl-Dihydroxyphenyl-Thiadiazole Binding to Human Hsp90

PubMed Central

Kazlauskas, Egidijus; Petrikaitė, Vilma; Michailovienė, Vilma; Revuckienė, Jurgita; Matulienė, Jurgita; Grinius, Leonas; Matulis, Daumantas

2012-01-01

The design of specific inhibitors against the Hsp90 chaperone and other enzyme relies on the detailed and correct understanding of both the thermodynamics of inhibitor binding and the structural features of the protein-inhibitor complex. Here we present a detailed thermodynamic study of binding of aryl-dihydroxyphenyl-thiadiazole inhibitor series to recombinant human Hsp90 alpha isozyme. The inhibitors are highly potent, with the intrinsic Kd approximately equal to 1 nM as determined by isothermal titration calorimetry (ITC) and thermal shift assay (TSA). Dissection of protonation contributions yielded the intrinsic thermodynamic parameters of binding, such as enthalpy, entropy, Gibbs free energy, and the heat capacity. The differences in binding thermodynamic parameters between the series of inhibitors revealed contributions of the functional groups, thus providing insight into molecular reasons for improved or diminished binding efficiency. The inhibitor binding to Hsp90 alpha primarily depended on a large favorable enthalpic contribution combined with the smaller favorable entropic contribution, thus suggesting that their binding was both enthalpically and entropically optimized. The enthalpy-entropy compensation phenomenon was highly evident when comparing the inhibitor binding enthalpies and entropies. This study illustrates how detailed thermodynamic analysis helps to understand energetic reasons for the binding efficiency and develop more potent inhibitors that could be applied for therapeutic use as Hsp90 inhibitors. PMID:22655030

Discrete persistent-chain model for protein binding on DNA.

PubMed

Lam, Pui-Man; Zhen, Yi

2011-04-01

We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society

Positron trapping at defects in copper oxide superconductors

NASA Astrophysics Data System (ADS)

McMullen, T.; Jena, P.; Khanna, S. N.; Li, Yi; Jensen, Kjeld O.

1991-05-01

Positron states and lifetimes at defects in the copper oxide superconductors La2-xSrxCuO4, YBa2Cu3O7-x, and Bi2Sr2CaCu2O8+x are calculated with use of the superposed-atom model. In the Bi2Sr2CaCu2O8+x compound, we find that the smaller metal-ion vacancies appear to only bind positrons weakly, while missing oxygens do not trap positrons. In contrast, metal-ion vacancies in La2-xSrxCuO4 and YBa2Cu3O7-x bind positrons by ~1 eV, and oxygen-related defects appear to be the weak-binding sites in these materials. The sites that bind positrons only weakly, by energies ~kBT, are of particular interest in view of the complex temperature dependences of the annihilation characteristics that are observed in these materials.

Thermodynamics of Alkanethiol Self-Assembled Monolayer Assembly on Pd Surfaces.

PubMed

Kumar, Gaurav; Van Cleve, Timothy; Park, Jiyun; van Duin, Adri; Medlin, J Will; Janik, Michael J

2018-06-05

We investigate the structure and binding energy of alkanethiolate self-assembled monolayers (SAMs) on Pd (111), Pd (100), and Pd (110) facets at different coverages. Dispersion-corrected density functional theory calculations are used to correlate the binding energy of alkanethiolates with alkyl chain length and coverage. The equilibrium coverage of thiolate layers strongly prefers 1/3 monolayer (ML) on the Pd (111) surface. The coverage of thiolates varies with chemical potential on Pd (100) and Pd (110), increasing from 1/3 to 1/2 ML on (100) and from 1/4 to 1/2 ML on (110) as the thiol chemical potential is increased. Higher coverages are driven by attractive dispersion interactions between the extended alkyl chains, such that transitions to higher coverages occur at lower thiol chemical potentials for longer chain thiolates. Stronger adsorption to the Pd (100) surface causes the equilibrium Wulff construction of Pd particles to take on a cubic shape upon saturation with thiols. The binding of H, O, and CO adsorbates is weakened as the thiolate coverage is increased, with saturation coverages causing unfavorable binding of O and CO on Pd (100) and weakened binding on other facets. Temperature-dependent CO diffuse reflectance infrared Fourier transform spectroscopy experiments are used to corroborate the weakened binding of CO in the presence of thiolate SAMs of varying surface density. Preliminary results of multiscale modeling efforts on the Pd-thiol system using a reactive force field, ReaxFF, are also discussed.

Multiple Functions of Aromatic-Carbohydrate Interactions in a Processive Cellulase Examined with Molecular Simulation*

PubMed Central

Payne, Christina M.; Bomble, Yannick J.; Taylor, Courtney B.; McCabe, Clare; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

2011-01-01

Proteins employ aromatic residues for carbohydrate binding in a wide range of biological functions. Glycoside hydrolases, which are ubiquitous in nature, typically exhibit tunnels, clefts, or pockets lined with aromatic residues for processing carbohydrates. Mutation of these aromatic residues often results in significant activity differences on insoluble and soluble substrates. However, the thermodynamic basis and molecular level role of these aromatic residues remain unknown. Here, we calculate the relative ligand binding free energy by mutating tryptophans in the Trichoderma reesei family 6 cellulase (Cel6A) to alanine. Removal of aromatic residues near the catalytic site has little impact on the ligand binding free energy, suggesting that aromatic residues immediately upstream of the active site are not directly involved in binding, but play a role in the glucopyranose ring distortion necessary for catalysis. Removal of aromatic residues at the entrance and exit of the Cel6A tunnel, however, dramatically impacts the binding affinity, suggesting that these residues play a role in chain acquisition and product stabilization, respectively. The roles suggested from differences in binding affinity are confirmed by molecular dynamics and normal mode analysis. Surprisingly, our results illustrate that aromatic-carbohydrate interactions vary dramatically depending on the position in the enzyme tunnel. As aromatic-carbohydrate interactions are present in all carbohydrate-active enzymes, these results have implications for understanding protein structure-function relationships in carbohydrate metabolism and recognition, carbon turnover in nature, and protein engineering strategies for biomass utilization. Generally, these results suggest that nature employs aromatic-carbohydrate interactions with a wide range of binding affinities for diverse functions. PMID:21965672

Electrostatics, structure prediction, and the energy landscapes for protein folding and binding.

PubMed

Tsai, Min-Yeh; Zheng, Weihua; Balamurugan, D; Schafer, Nicholas P; Kim, Bobby L; Cheung, Margaret S; Wolynes, Peter G

2016-01-01

While being long in range and therefore weakly specific, electrostatic interactions are able to modulate the stability and folding landscapes of some proteins. The relevance of electrostatic forces for steering the docking of proteins to each other is widely acknowledged, however, the role of electrostatics in establishing specifically funneled landscapes and their relevance for protein structure prediction are still not clear. By introducing Debye-Hückel potentials that mimic long-range electrostatic forces into the Associative memory, Water mediated, Structure, and Energy Model (AWSEM), a transferable protein model capable of predicting tertiary structures, we assess the effects of electrostatics on the landscapes of thirteen monomeric proteins and four dimers. For the monomers, we find that adding electrostatic interactions does not improve structure prediction. Simulations of ribosomal protein S6 show, however, that folding stability depends monotonically on electrostatic strength. The trend in predicted melting temperatures of the S6 variants agrees with experimental observations. Electrostatic effects can play a range of roles in binding. The binding of the protein complex KIX-pKID is largely assisted by electrostatic interactions, which provide direct charge-charge stabilization of the native state and contribute to the funneling of the binding landscape. In contrast, for several other proteins, including the DNA-binding protein FIS, electrostatics causes frustration in the DNA-binding region, which favors its binding with DNA but not with its protein partner. This study highlights the importance of long-range electrostatics in functional responses to problems where proteins interact with their charged partners, such as DNA, RNA, as well as membranes. © 2015 The Protein Society.

Allosteric Signaling Is Bidirectional in an Outer-Membrane Transport Protein.

PubMed

Sikora, Arthur; Joseph, Benesh; Matson, Morgan; Staley, Jacob R; Cafiso, David S

2016-11-01

In BtuB, the Escherichia coli TonB-dependent transporter for vitamin B 12 , substrate binding to the extracellular surface unfolds a conserved energy coupling motif termed the Ton box into the periplasm. This transmembrane signaling event facilitates an interaction between BtuB and the inner-membrane protein TonB. In this study, continuous-wave and pulse electron paramagnetic resonance in a native outer-membrane preparation demonstrate that signaling also occurs from the periplasmic to the extracellular surface in BtuB. The binding of a TonB fragment to the periplasmic interface alters the configuration of the second extracellular loop and partially dissociates a spin-labeled substrate analog. Moreover, mutants in the periplasmic Ton box that are transport-defective alter the binding site for vitamin B 12 in BtuB. This work demonstrates that the Ton box and the extracellular substrate binding site are allosterically coupled in BtuB, and that TonB binding may initiate a partial round of transport. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

External electric field effect on the binding energy of a hydrogenic donor impurity in InGaAsP/InP concentric double quantum rings

NASA Astrophysics Data System (ADS)

Hu, Min; Wang, Hailong; Gong, Qian; Wang, Shumin

2018-04-01

Within the framework of effective-mass envelope-function theory, the ground state binding energy of a hydrogenic donor impurity is calculated in the InGaAsP/InP concentric double quantum rings (CDQRs) using the plane wave method. The effects of geometry, impurity position, external electric field and alloy composition on binding energy are considered. It is shown that the peak value of the binding energy appears in two rings with large gap as the donor impurity moves along the radial direction. The binding energy reaches the peak value at the center of ring height when the donor impurity moves along the axial direction. The binding energy shows nonlinear variation with the increase of ring height. With the external electric field applied along the z-axis, the binding energy of the donor impurity located at zi ≥ 0 decreases while that located at zi < 0 increases. In addition, the binding energy decreases with increasing Ga composition, but increases with the increasing As composition.

Effects of hydrostatic pressure on the donor impurity in a cylindrical quantum dot with Morse confining potential

NASA Astrophysics Data System (ADS)

Hayrapetyan, David B.; Kotanjyan, Tigran V.; Tevosyan, Hovhannes Kh.; Kazaryan, Eduard M.

2016-12-01

The effects of hydrostatic pressure and size quantization on the binding energies of a hydrogen-like donor impurity in cylindrical GaAs quantum dot (QD) with Morse confining potential are studied using the variational method and effective-mass approximation. In the cylindrical QD, the effect of hydrostatic pressure on the binding energy of electron has been investigated and it has been found that the application of the hydrostatic pressure leads to the blue shift. The dependence of the absorption edge on geometrical parameters of cylindrical QD is obtained. Selection rules are revealed for transitions between levels with different quantum numbers. It is shown that for the radial quantum number, transitions are allowed between the levels with the same quantum numbers, and any transitions between different levels are allowed for the principal quantum number.

Lamb shift and the gravitational binding energy for binary black holes

NASA Astrophysics Data System (ADS)

Porto, Rafael A.

2017-07-01

We show that the correction to the gravitational binding energy for binary black holes due to the tail effect resembles the Lamb shift in the Hydrogen atom. In both cases a conservative effect arises from interactions with radiation modes, and moreover an explicit cancelation between near and far zone divergences is at work. In addition, regularization scheme-dependence may introduce "ambiguity parameters." This is remediated—within an effective field theory approach—by the implementation of the zero-bin subtraction. We illustrate the procedure explicitly for the Lamb shift, by performing an ambiguity-free derivation within the framework of nonrelativistic electrodynamics. We also derive the renormalization group equations from which we reproduce Bethe logarithm (at order αe5log αe), and likewise the contribution to the gravitational potential from the tail effect (proportional to v8log v ).

Dynamical fate of wide binaries in the solar neighborhood

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weinberg, M.D.; Shapiro, S.L.; Wasserman, I.

1987-01-01

An analytical model is presented for the evolution of wide binaries in the Galaxy. The study is pertinent to the postulated solar companion, Nemesis, which may disturb the Oort cloud and cause catastrophic comet showers to strike the earth every 26 Myr. Distant gravitational encounters are modeled by Fokker-Planck coefficients for advection and diffusion of the orbital binding energy. It is shown that encounters with passing stars cause a diffusive evolution of the binding energy and semimajor axis. Encounters with subclumps in giant molecular clouds disrupt orbits to a degree dependent on the cumulative number of stellar encounters. The timemore » scales of the vents and the limitations of scaling laws used are discussed. Results are provided from calculations of galactic distribution of wide binaries and the evolution of wide binary orbits. 38 references.« less

Electronic structure evolution of fullerene on CH 3NH 3PbI 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Liu, Xiaoliang

2015-03-19

The thickness dependence of fullerene on CH 3NH 3PbI 3 perovskitefilm surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy(XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskitefilm to fullerene molecules. Further deposition of fullerene forms C 60 solid, accompaniedmore » by the reduction of the electron transfer. As a result, the strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Electronic structure evolution of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Kauppi, John

2015-03-16

The thickness dependence of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3} perovskite film surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy (XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. Further deposition of fullerene forms C{submore » 60} solid, accompanied by the reduction of the electron transfer. The strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Exciton–exciton annihilation and biexciton stimulated emission in graphene nanoribbons

PubMed Central

Soavi, Giancarlo; Dal Conte, Stefano; Manzoni, Cristian; Viola, Daniele; Narita, Akimitsu; Hu, Yunbin; Feng, Xinliang; Hohenester, Ulrich; Molinari, Elisa; Prezzi, Deborah; Müllen, Klaus; Cerullo, Giulio

2016-01-01

Graphene nanoribbons display extraordinary optical properties due to one-dimensional quantum-confinement, such as width-dependent bandgap and strong electron–hole interactions, responsible for the formation of excitons with extremely high binding energies. Here we use femtosecond transient absorption spectroscopy to explore the ultrafast optical properties of ultranarrow, structurally well-defined graphene nanoribbons as a function of the excitation fluence, and the impact of enhanced Coulomb interaction on their excited states dynamics. We show that in the high-excitation regime biexcitons are formed by nonlinear exciton–exciton annihilation, and that they radiatively recombine via stimulated emission. We obtain a biexciton binding energy of ≈250 meV, in very good agreement with theoretical results from quantum Monte Carlo simulations. These observations pave the way for the application of graphene nanoribbons in photonics and optoelectronics. PMID:26984281

Interaction of amino acids with the Au(111) surface: adsorption free energies from molecular dynamics simulations.

PubMed

Hoefling, Martin; Iori, Francesco; Corni, Stefano; Gottschalk, Kay-Eberhard

2010-06-01

Interactions of proteins with inorganic surfaces are of high importance in biological events and in modern biotechnological applications. Therefore, peptides have been engineered to recognize inorganic surfaces with high specificity. However, the underlying interactions are still not well understood. Here, we investigated the adsorption of amino acids as protein building blocks onto a Au(111) surface. In particular, using molecular dynamics simulations, we calculated the potential of mean force between all the 20 amino acids and the gold surface. We found a strong dependence of the binding affinities on the chemical character of the amino acids. Additionally, the interaction free energy is correlated with the propensity of amino acids to form beta-sheets, hinting at design principles for gold binding peptides and induction of beta-sheet formation near surfaces.

Magnetic field dependence of electronic properties of MoS2 quantum dots with different edges

NASA Astrophysics Data System (ADS)

Chen, Qiao; Li, L. L.; Peeters, F. M.

2018-02-01

Using the tight-binding approach, we investigate the energy spectrum of square, triangular, and hexagonal MoS2 quantum dots (QDs) in the presence of a perpendicular magnetic field. Novel edge states emerge in MoS2 QDs, which are distributed over the whole edge which we call ring states. The ring states are robust in the presence of spin-orbit coupling (SOC). The corresponding energy levels of the ring states oscillate as a function of the perpendicular magnetic field which are related to Aharonov-Bohm oscillations. Oscillations in the magnetic field dependence of the energy levels and the peaks in the magneto-optical spectrum emerge (disappear) as the ring states are formed (collapsed). The period and the amplitude of the oscillation decrease with the size of the MoS2 QDs.

Theoretical study of the influence of the electric field on the electronic properties of armchair boron nitride nanoribbon

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-11-01

We have investigated the electronic properties of A-BNNRs in the external electric field using third nearest neighbor tight binding approximation including edge effects. We found that the dependence of on-site energy to the external electric field for edge atoms and center part atoms is different. By comparing the band structure in the different fields, several differences are clearly seen such as modification of energy dispersions, creation of additional band edge states and band gap reduction. By increasing the electric field the band gap reduces linearly until reaches zero and BNNRs with larger width are more sensitive than small ones. All changes in the band structure are directly reflected in the DOS spectrum. The numbers and the energies of the DOS peaks are dependent on the electric field strength.

Partially ionized hydrogen plasma in strong magnetic fields.

PubMed

Potekhin, A Y; Chabrier, G; Shibanov, Y A

1999-08-01

We study the thermodynamic properties of a partially ionized hydrogen plasma in strong magnetic fields, B approximately 10(12)-10(13) G, typical of neutron stars. The properties of the plasma depend significantly on the quantum-mechanical sizes and binding energies of the atoms, which are strongly modified by thermal motion across the field. We use new fitting formulas for the atomic binding energies and sizes, based on accurate numerical calculations and valid for any state of motion of the atom. In particular, we take into account decentered atomic states, neglected in previous studies of thermodynamics of magnetized plasmas. We also employ analytic fits for the thermodynamic functions of nonideal fully ionized electron-ion Coulomb plasmas. This enables us to construct an analytic model of the free energy. An ionization equilibrium equation is derived, taking into account the strong magnetic field effects and the nonideality effects. This equation is solved by an iteration technique. Ionization degrees, occupancies, and the equation of state are calculated.

Observation of the spin-polarized surface state in a noncentrosymmetric superconductor BiPd

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neupane, Madhab; Alidoust, Nasser; Hosen, M. Mofazzel

Recently, noncentrosymmetric superconductor BiPd has attracted considerable research interest due to the possibility of hosting topological superconductivity. Here in this paper we report a systematic high-resolution angle-resolved photoemission spectroscopy (ARPES) and spin-resolved ARPES study of the normal state electronic and spin properties of BiPd. Our experimental results show the presence of a surface state at higher-binding energy with the location of Dirac point at around 700 meV below the Fermi level. The detailed photon energy, temperature-dependent and spin-resolved ARPES measurements complemented by our first-principles calculations demonstrate the existence of the spin-polarized surface states at high-binding energy. The absence of suchmore » spin-polarized surface states near the Fermi level negates the possibility of a topological superconducting behaviour on the surface. Our direct experimental observation of spin-polarized surface states in BiPd provides critical information that will guide the future search for topological superconductivity in noncentrosymmetric materials.« less

Observation of the spin-polarized surface state in a noncentrosymmetric superconductor BiPd

DOE PAGES

Neupane, Madhab; Alidoust, Nasser; Hosen, M. Mofazzel; ...

2016-11-07

Recently, noncentrosymmetric superconductor BiPd has attracted considerable research interest due to the possibility of hosting topological superconductivity. Here in this paper we report a systematic high-resolution angle-resolved photoemission spectroscopy (ARPES) and spin-resolved ARPES study of the normal state electronic and spin properties of BiPd. Our experimental results show the presence of a surface state at higher-binding energy with the location of Dirac point at around 700 meV below the Fermi level. The detailed photon energy, temperature-dependent and spin-resolved ARPES measurements complemented by our first-principles calculations demonstrate the existence of the spin-polarized surface states at high-binding energy. The absence of suchmore » spin-polarized surface states near the Fermi level negates the possibility of a topological superconducting behaviour on the surface. Our direct experimental observation of spin-polarized surface states in BiPd provides critical information that will guide the future search for topological superconductivity in noncentrosymmetric materials.« less

Hydrogen atom addition to the surface of graphene nanoflakes: A density functional theory study

NASA Astrophysics Data System (ADS)

Tachikawa, Hiroto

2017-02-01

Polycyclic aromatic hydrocarbons (PAHs) provide a 2-dimensional (2D) reaction surface in 3-dimensional (3D) interstellar space and have been utilized as a model of graphene surfaces. In the present study, the reaction of PAHs with atomic hydrogen was investigated by means of density functional theory (DFT) to systematically elucidate the binding nature of atomic hydrogen to graphene nanoflakes. PAHs with n = 4-37 were chosen, where n indicates the number of benzene rings. Activation energies of hydrogen addition to the graphene surface were calculated to be 5.2-7.0 kcal/mol at the CAM-B3LYP/6-311G(d,p) level, which is almost constant for all PAHs. The binding energies of hydrogen atom were slightly dependent on the size (n): 14.8-28.5 kcal/mol. The absorption spectra showed that a long tail is generated at the low-energy region after hydrogen addition to the graphene surface. The electronic states of hydrogenated graphenes were discussed on the basis of theoretical results.

Theory of nanobubble formation and induced force in nanochannels

NASA Astrophysics Data System (ADS)

Arai, Noriyoshi; Koishi, Takahiro; Ebisuzaki, Toshikazu

2017-10-01

This paper presents a fundamental theory of nanobubble formation and induced force in confined nanochannels. It is shown that nanobubble formation between hydrophobic plates can be predicted from their surface tension and geometry, with estimated values for the surface free energy and the force acting on the plates in good agreement with the results of molecular dynamics simulation and experimentation. When a bubble is formed between two plates, vertical attractive force and horizontal retract force due to the shifted plates are applied to the plates. The net force exerted on the plates is not dependent on the distance between them. The short-range force between hydrophobic surfaces due to hydrophobic interaction appears to correspond to the force estimated by our theory. We compared between experimental and theoretical values for the binding energy of a molecular motor system to validate our theory. The tendency that the binding energy increases as the size of the protein increases is consistent with the theory.

Simultaneous effects of temperature and pressure on the donor binding energy in a V-groove quantum wire

NASA Astrophysics Data System (ADS)

Khordad, R.

2010-03-01

The influence of temperature and pressure, simultaneously, on the binding energy of a hydrogenic donor impurity in a ridge GaAs/Ga 1- xAl xAs quantum wire is studied using a variational procedure within the effective mass approximation. The subband energy and the binding energy of the donor impurity in its ground state as a function of the wire bend width and impurity location at different temperatures and pressures are calculated. The results show that, when the temperature increases, the donor binding energy decreases for a constant applied pressure for all wire bend widths. Also, the binding energy increases by increasing the pressure for a constant temperature for all wire bend widths. In addition, when the temperature and pressure are applied simultaneously the binding energy decreases as the quantum wire bend width increases. On the whole, it is deduced that the temperature and pressure have important effects on the donor binding energy in a V-groove quantum wire.

Energetic stabilities of thiolated pyrimidines on gold nanoparticles investigated by Raman spectroscopy and density functional theory calculations.

PubMed

Ganbold, Erdene-Ochir; Yoon, Jinha; Cho, Kwang-Hwi; Joo, Sang-Woo

2015-01-01

The adsorption structures of 2-thiocytosine (2TC) on gold surfaces were examined by means of vibrational Raman spectroscopy and quantum mechanical density functional theory calculations. The 1H-thione-amino form was calculated to be most stable among the six examined tautomers. The three plausible binding geometries of sulfur, pyrimidine nitrogen, and amino group binding modes were calculated to estimate the binding energies of the 1H-thione-amino form with six gold cluster atoms. Thiouracils including 2-thiouracil (2TU), 4-thiouracil (4TU), and 6-methyl-2-thiouracil (6M2TU) were also studied to compare their relative binding energies on gold atoms. The intracellular localization of a DNA base analog of 2TC on gold nanoparticles (AuNPs) in HeLa cells was identified by means of surface-enhanced Raman scattering. AuNPs were modified with 2TC by self-assembly. Our dark-field microscopy and z-depth-dependent confocal Raman spectroscopy indicated that 2TC-assembled AuNPs could be found inside cancer cells. On the other hand, we did not observe noticeably strong Raman peaks in the cases of thiouracils including 2TU, 4TU, and 6M2TU. This may be due to the additional amino group of 2TC, which can lead to a stronger binding of adsorbates on AuNPs. Copyright © 2015. Published by Elsevier B.V.

Mechanical Unfolding Studies on Single-Domain SUMO and Multi-Domain Periplasmic Binding Proteins

NASA Astrophysics Data System (ADS)

Kotamarthi, Hema Chandra; Ainavarapu, Sri Rama Koti

Protein mechanics is a key component of many cellular and sub-cellular processes. The current review focuses on recent studies from our laboratory that probe the effect of sequence on the mechanical stability of structurally similar proteins and the unfolding mechanisms of multi-domain periplasmic binding proteins. Ubiquitin and small ubiquitin-related modifiers (SUMOs) are structurally similar and possess different mechanical stabilities, ubiquitin being stronger than SUMOs as revealed from their unfolding forces. These differences are plausibly due to the variation in number of inter-residue contacts. The unfolding potential widths determined from the pulling speed-dependent studies revealed that SUMOs are mechanically more flexible than ubiquitin. This flexibility of SUMOs plays a role in ligand binding and our single-molecule studies on SUMO interaction with SUMO binding motifs (SBMs) have shown that ligand binding decreases the SUMO flexibility and increases its mechanical stability. Studies on multi-domain periplasmic binding proteins have revealed that the unfolding energy landscape of these proteins is complex and they follow kinetic partitioning between two-state and multiple three-state pathways.

Analytical models of calcium binding in a calcium channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Jinn-Liang; Eisenberg, Bob

2014-08-21

The anomalous mole fraction effect of L-type calcium channels is analyzed using a Fermi like distribution with the experimental data of Almers and McCleskey [J. Physiol. 353, 585 (1984)] and the atomic resolution model of Lipkind and Fozzard [Biochemistry 40, 6786 (2001)] of the selectivity filter of the channel. Much of the analysis is algebraic, independent of differential equations. The Fermi distribution is derived from the configuration entropy of ions and water molecules with different sizes, different valences, and interstitial voids between particles. It allows us to calculate potentials and distances (between the binding ion and the oxygen ions ofmore » the glutamate side chains) directly from the experimental data using algebraic formulas. The spatial resolution of these results is comparable with those of molecular models, but of course the accuracy is no better than that implied by the experimental data. The glutamate side chains in our model are flexible enough to accommodate different types of binding ions in different bath conditions. The binding curves of Na{sup +} and Ca{sup 2+} for [CaCl{sub 2}] ranging from 10{sup −8} to 10{sup −2} M with a fixed 32 mM background [NaCl] are shown to agree with published Monte Carlo simulations. The Poisson-Fermi differential equation—that includes both steric and correlation effects—is then used to obtain the spatial profiles of energy, concentration, and dielectric coefficient from the solvent region to the filter. The energy profiles of ions are shown to depend sensitively on the steric energy that is not taken into account in the classical rate theory. We improve the rate theory by introducing a steric energy that lumps the effects of excluded volumes of all ions and water molecules and empty spaces between particles created by Lennard-Jones type and electrostatic forces. We show that the energy landscape varies significantly with bath concentrations. The energy landscape is not constant.« less

Study of interactions between metal ions and protein model compounds by energy decomposition analyses and the AMOEBA force field

NASA Astrophysics Data System (ADS)

Jing, Zhifeng; Qi, Rui; Liu, Chengwen; Ren, Pengyu

2017-10-01

The interactions between metal ions and proteins are ubiquitous in biology. The selective binding of metal ions has a variety of regulatory functions. Therefore, there is a need to understand the mechanism of protein-ion binding. The interactions involving metal ions are complicated in nature, where short-range charge-penetration, charge transfer, polarization, and many-body effects all contribute significantly, and a quantitative description of all these interactions is lacking. In addition, it is unclear how well current polarizable force fields can capture these energy terms and whether these polarization models are good enough to describe the many-body effects. In this work, two energy decomposition methods, absolutely localized molecular orbitals and symmetry-adapted perturbation theory, were utilized to study the interactions between Mg2+/Ca2+ and model compounds for amino acids. Comparison of individual interaction components revealed that while there are significant charge-penetration and charge-transfer effects in Ca complexes, these effects can be captured by the van der Waals (vdW) term in the AMOEBA force field. The electrostatic interaction in Mg complexes is well described by AMOEBA since the charge penetration is small, but the distance-dependent polarization energy is problematic. Many-body effects were shown to be important for protein-ion binding. In the absence of many-body effects, highly charged binding pockets will be over-stabilized, and the pockets will always favor Mg and thus lose selectivity. Therefore, many-body effects must be incorporated in the force field in order to predict the structure and energetics of metalloproteins. Also, the many-body effects of charge transfer in Ca complexes were found to be non-negligible. The absorption of charge-transfer energy into the additive vdW term was a main source of error for the AMOEBA many-body interaction energies.

Cooperative DNA Recognition Modulated by an Interplay between Protein-Protein Interactions and DNA-Mediated Allostery

PubMed Central

Merino, Felipe; Bouvier, Benjamin; Cojocaru, Vlad

2015-01-01

Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions. PMID:26067358

Cooperative DNA Recognition Modulated by an Interplay between Protein-Protein Interactions and DNA-Mediated Allostery.

PubMed

Merino, Felipe; Bouvier, Benjamin; Cojocaru, Vlad

2015-06-01

Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions.

Prediction of Protein-Protein Interaction Sites Using Electrostatic Desolvation Profiles

PubMed Central

Fiorucci, Sébastien; Zacharias, Martin

2010-01-01

Abstract Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. PMID:20441756

Ligand Selectivity Mechanism and Conformational Changes in Guanine Riboswitch by Molecular Dynamics Simulations and Free Energy Calculations.

PubMed

Hu, Guodong; Ma, Aijing; Wang, Jihua

2017-04-24

Riboswitches regulate gene expression through direct and specific interactions with small metabolite molecules. Binding of a ligand to its RNA target is high selectivity and affinity and induces conformational changes of the RNA's secondary and tertiary structure. The structural difference of two purine riboswitches aptamers is caused by only one single mutation, where cytosine 74 in the guanine riboswitch is corresponding to a uracil 74 in adenine riboswitch. Here we employed molecular dynamics (MD) simulation, molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) and thermodynamic integration computational methodologies to evaluate the energetic and conformational changes of ligands binding to purine riboswitches. The snapshots used in MM-PBSA calculation were extracted from ten 50 ns MD simulation trajectories for each complex. These free energy results are in consistent with the experimental data and rationalize the selectivity of the riboswitches for different ligands. In particular, it is found that the loss in binding free energy upon mutation is mainly electrostatic in guanine (GUA) and riboswitch complex. Furthermore, new hydrogen bonds are found in mutated complexes. To reveal the conformational properties of guanine riboswitch, we performed a total of 6 μs MD simulations in both the presence and the absence of the ligand GUA. The MD simulations suggest that the conformation of guanine riboswitch depends on the distance of two groups in the binding pocket of ligand. The conformation is in a close conformation when U51-A52 is close to C74-U75.

Ultrafast Structural Dynamics in Combustion Relevant Model Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, Peter M.

2014-03-31

The research project explored the time resolved structural dynamics of important model reaction system using an array of novel methods that were developed specifically for this purpose. They include time resolved electron diffraction, time resolved relativistic electron diffraction, and time resolved Rydberg fingerprint spectroscopy. Toward the end of the funding period, we also developed time-resolved x-ray diffraction, which uses ultrafast x-ray pulses at LCLS. Those experiments are just now blossoming, as the funding period expired. In the following, the time resolved Rydberg Fingerprint Spectroscopy is discussed in some detail, as it has been a very productive method. The binding energymore » of an electron in a Rydberg state, that is, the energy difference between the Rydberg level and the ground state of the molecular ion, has been found to be a uniquely powerful tool to characterize the molecular structure. To rationalize the structure sensitivity we invoke a picture from electron diffraction: when it passes the molecular ion core, the Rydberg electron experiences a phase shift compared to an electron in a hydrogen atom. This phase shift requires an adjustment of the binding energy of the electron, which is measurable. As in electron diffraction, the phase shift depends on the molecular, geometrical structure, so that a measurement of the electron binding energy can be interpreted as a measurement of the molecule’s structure. Building on this insight, we have developed a structurally sensitive spectroscopy: the molecule is first elevated to the Rydberg state, and the binding energy is then measured using photoelectron spectroscopy. The molecule’s structure is read out as the binding energy spectrum. Since the photoionization can be done with ultrafast laser pulses, the technique is inherently capable of a time resolution in the femtosecond regime. For the purpose of identifying the structures of molecules during chemical reactions, and for the analysis of molecular species in the hot environments of combustion processes, there are several features that make the Rydberg ionization spectroscopy uniquely useful. First, the Rydberg electron’s orbit is quite large and covers the entire molecule for most molecular structures of combustion interest. Secondly, the ionization does not change vibrational quantum numbers, so that even complicated and large molecules can be observed with fairly well resolved spectra. In fact, the spectroscopy is blind to vibrational excitation of the molecule. This has the interesting consequence for the study of chemical dynamics, where the molecules are invariably very energetic, that the molecular structures are observed unobstructed by the vibrational congestion that dominates other spectroscopies. This implies also that, as a tool to probe the time-dependent structural dynamics of chemically interesting molecules, Rydberg spectroscopy may well be better suited than electron or x-ray diffraction. With recent progress in calculating Rydberg binding energy spectra, we are approaching the point where the method can be evolved into a structure determination method. To implement the Rydberg ionization spectroscopy we use a molecular beam based, time-resolved pump-probe multi-photon ionization/photoelectron scheme in which a first laser pulse excites the molecule to a Rydberg state, and a probe pulse ionizes the molecule. A time-of-flight detector measures the kinetic energy spectrum of the photoelectrons. The photoelectron spectrum directly provides the binding energy of the electron, and thereby reveals the molecule’s time-dependent structural fingerprint. Only the duration of the laser pulses limits the time resolution. With a new laser system, we have now reached time resolutions better than 100 fs, although very deep UV wavelengths (down to 190 nm) have slightly longer instrument functions. The structural dynamics of molecules in Rydberg-excited states is obtained by delaying the probe ionization photon from the pump photon; the structural dynamics of molecules in their ground state or excited valence states is measured by inducing the dynamics using a near UV laser pulse, and employing a multi-photon ionization scheme via the Rydberg states as a probe process. Thus, the technique is capable of measuring the reaction dynamics in any electronic state of neutral molecules.« less

NMR Studies of Protein Hydration and Protein-Ligand Interactions

NASA Astrophysics Data System (ADS)

Chong, Yuan

Water on the surface of a protein is called hydration water. Hydration water is known to play a crucial role in a variety of biological processes including protein folding, enzymatic activation, and drug binding. Although the significance of hydration water has been recognized, the underlying mechanism remains far from being understood. This dissertation employs a unique in-situ nuclear magnetic resonance (NMR) technique to study the mechanism of protein hydration and the role of hydration in alcohol-protein interactions. Water isotherms in proteins are measured at different temperatures via the in-situ NMR technique. Water is found to interact differently with hydrophilic and hydrophobic groups on the protein. Water adsorption on hydrophilic groups is hardly affected by the temperature, while water adsorption on hydrophobic groups strongly depends on the temperature around 10 C, below which the adsorption is substantially reduced. This effect is induced by the dramatic decrease in the protein flexibility below 10 C. Furthermore, nanosecond to microsecond protein dynamics and the free energy, enthalpy, and entropy of protein hydration are studied as a function of hydration level and temperature. A crossover at 10 C in protein dynamics and thermodynamics is revealed. The effect of water at hydrophilic groups on protein dynamics and thermodynamics shows little temperature dependence, whereas water at hydrophobic groups has stronger effect above 10 C. In addition, I investigate the role of water in alcohol binding to the protein using the in-situ NMR detection. The isotherms of alcohols are first measured on dry proteins, then on proteins with a series of controlled hydration levels. The free energy, enthalpy, and entropy of alcohol binding are also determined. Two distinct types of alcohol binding are identified. On the one hand, alcohols can directly bind to a few specific sites on the protein. This type of binding is independent of temperature and can be facilitated by hydration. On the other hand, alcohols can bind to many nonspecific sites on the protein. In dry proteins, this type of binding only occurs above a threshold of alcohol vapor pressure. Such a threshold is gradually reduced by increasing the hydration level and can be removed above a critical hydration level. Hydration also shifts the nonspecific alcohol binding from an entropy-driven to an enthalpy-driven process. This dissertation reveals the mechanism of protein hydration and the detailed roles of hydration in ligand binding, with important implications for the understanding of protein functions.

Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

PubMed

Kowalczyk, Tim; Le, Khoa; Irle, Stephan

2016-01-12

We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

A coarse-grained biophysical model of sequence evolution and the population size dependence of the speciation rate

PubMed Central

Khatri, Bhavin S.; Goldstein, Richard A.

2015-01-01

Speciation is fundamental to understanding the huge diversity of life on Earth. Although still controversial, empirical evidence suggests that the rate of speciation is larger for smaller populations. Here, we explore a biophysical model of speciation by developing a simple coarse-grained theory of transcription factor-DNA binding and how their co-evolution in two geographically isolated lineages leads to incompatibilities. To develop a tractable analytical theory, we derive a Smoluchowski equation for the dynamics of binding energy evolution that accounts for the fact that natural selection acts on phenotypes, but variation arises from mutations in sequences; the Smoluchowski equation includes selection due to both gradients in fitness and gradients in sequence entropy, which is the logarithm of the number of sequences that correspond to a particular binding energy. This simple consideration predicts that smaller populations develop incompatibilities more quickly in the weak mutation regime; this trend arises as sequence entropy poises smaller populations closer to incompatible regions of phenotype space. These results suggest a generic coarse-grained approach to evolutionary stochastic dynamics, allowing realistic modelling at the phenotypic level. PMID:25936759

Unraveling the inhibition mechanism of cyanidin-3-sophoroside on polyphenol oxidase and its effect on enzymatic browning of apples.

PubMed

Hemachandran, Hridya; Anantharaman, Amrita; Mohan, Sankari; Mohan, Gopalakrishnan; Kumar, D Thirumal; Dey, Diksha; Kumar, Drishty; Dey, Priyanka; Choudhury, Amrita; George Priya Doss, C; Ramamoorthy, Siva

2017-07-15

The hunt for anti-browning agents in the food and agricultural industries aims to minimize nutritional loss and prolong post harvest storage. In the present study, the effect of cyanidin-3-sophoroside (CS) from Garcinia mangostana rind, on polyphenol oxidase (PPO) activity was investigated. The non-competitive inhibition mode of CS was determined by Lineweaver Burk plot. CS forms a ground-state complex by quenching the intrinsic fluorescence of PPO. The static quenching was temperature-dependent with an activation energy of 4.654±0.1091kJmol -1 to withstand the disruption of amino acid residues of the enzyme binding site. The enzyme conformational change was validated by 3D fluorescence and CD spectrum. Docking (binding energy -8.124kcal/mol) and simulation studies confirmed the binding pattern and stability. CS decreased PPO activity and browning index of fresh cut apples and prolonged the shelf life. Thus, CS appears to be a promising anti-browning agent to control enzymatic browning. Copyright © 2017 Elsevier Ltd. All rights reserved.

Comparing alchemical and physical pathway methods for computing the absolute binding free energy of charged ligands.

PubMed

Deng, Nanjie; Cui, Di; Zhang, Bin W; Xia, Junchao; Cruz, Jeffrey; Levy, Ronald

2018-06-13

Accurately predicting absolute binding free energies of protein-ligand complexes is important as a fundamental problem in both computational biophysics and pharmaceutical discovery. Calculating binding free energies for charged ligands is generally considered to be challenging because of the strong electrostatic interactions between the ligand and its environment in aqueous solution. In this work, we compare the performance of the potential of mean force (PMF) method and the double decoupling method (DDM) for computing absolute binding free energies for charged ligands. We first clarify an unresolved issue concerning the explicit use of the binding site volume to define the complexed state in DDM together with the use of harmonic restraints. We also provide an alternative derivation for the formula for absolute binding free energy using the PMF approach. We use these formulas to compute the binding free energy of charged ligands at an allosteric site of HIV-1 integrase, which has emerged in recent years as a promising target for developing antiviral therapy. As compared with the experimental results, the absolute binding free energies obtained by using the PMF approach show unsigned errors of 1.5-3.4 kcal mol-1, which are somewhat better than the results from DDM (unsigned errors of 1.6-4.3 kcal mol-1) using the same amount of CPU time. According to the DDM decomposition of the binding free energy, the ligand binding appears to be dominated by nonpolar interactions despite the presence of very large and favorable intermolecular ligand-receptor electrostatic interactions, which are almost completely cancelled out by the equally large free energy cost of desolvation of the charged moiety of the ligands in solution. We discuss the relative strengths of computing absolute binding free energies using the alchemical and physical pathway methods.

Free energy profiles of cocaine esterase-cocaine binding process by molecular dynamics and potential of mean force simulations.

PubMed

Zhang, Yuxin; Huang, Xiaoqin; Han, Keli; Zheng, Fang; Zhan, Chang-Guo

2016-11-25

The combined molecular dynamics (MD) and potential of mean force (PMF) simulations have been performed to determine the free energy profile of the CocE)-(+)-cocaine binding process in comparison with that of the corresponding CocE-(-)-cocaine binding process. According to the MD simulations, the equilibrium CocE-(+)-cocaine binding mode is similar to the CocE-(-)-cocaine binding mode. However, based on the simulated free energy profiles, a significant free energy barrier (∼5 kcal/mol) exists in the CocE-(+)-cocaine binding process whereas no obvious free energy barrier exists in the CocE-(-)-cocaine binding process, although the free energy barrier of ∼5 kcal/mol is not high enough to really slow down the CocE-(+)-cocaine binding process. In addition, the obtained free energy profiles also demonstrate that (+)-cocaine and (-)-cocaine have very close binding free energies with CocE, with a negligible difference (∼0.2 kcal/mol), which is qualitatively consistent with the nearly same experimental K M values of the CocE enzyme for (+)-cocaine and (-)-cocaine. The consistency between the computational results and available experimental data suggests that the mechanistic insights obtained from this study are reasonable. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Adsorption of surfactant ions and binding of their counterions at an air/water interface.

PubMed

Tagashira, Hiroaki; Takata, Youichi; Hyono, Atsushi; Ohshima, Hiroyuki

2009-01-01

An expression for the surface tension of an aqueous mixed solution of surfactants and electrolyte ions in the presence of the common ions was derived from the Helmholtz free energy of an air/water surface. By applying the equation to experimental data for the surface tension, the adsorption constant of surfactant ions onto the air/water interface, the binding constant of counterions on the surfactants, and the surface potential and surface charge density of the interface were estimated. The adsorption constant and binding constant were dependent on the species of surfactant ion and counterion, respectively. Taking account of the dependence of surface potential and surface charge density on the concentration of electrolyte, it was suggested that the addition of electrolyte to the aqueous surfactant solution brings about the decrease in the surface potential, the increase in the surface density of surfactant ions, and consequently, the decrease in the surface tension. Furthermore, it was found that the configurational entropy plays a predominant role for the surface tension, compared to the electrical work.

Effect of urea on protein-ligand association.

PubMed

Stepanian, Lora; Son, Ikbae; Chalikian, Tigran V

2017-12-01

We combine experimental and theoretical approaches to investigate the influence of a cosolvent on a ligand-protein association event. We apply fluorescence measurements to determining the affinity of the inhibitor tri-N-acetylglucosamine [(GlcNAc) 3 ] for lysozyme at urea concentrations ranging from 0 to 8M. Notwithstanding that, at room temperature and neutral pH, lysozyme retains its native conformation up to the solubility limit of urea, the affinity of (GlcNAc) 3 for the protein steadily decreases as the concentration of urea increases. We analyze the urea dependence of the binding free energy within the framework of a simplified statistical thermodynamics-based model that accounts for the excluded volume effect and direct solute-solvent interactions. The analysis reveals that the detrimental action of urea on the inhibitor-lysozyme binding originates from competition between the free energy contributions of the excluded volume effect and direct solute-solvent interactions. The free energy contribution of direct urea-solute interactions narrowly overcomes the excluded volume contribution thereby resulting in urea weakening the protein-ligand association. More broadly, the successful application of the simple model employed in this work points to the possibility of its use in quantifying the stabilizing/destabilizing action of individual cosolvents on biochemical folding and binding reactions. Copyright © 2016 Elsevier B.V. All rights reserved.

Comprehensive and Automated Linear Interaction Energy Based Binding-Affinity Prediction for Multifarious Cytochrome P450 Aromatase Inhibitors

PubMed Central

2017-01-01

Cytochrome P450 aromatase (CYP19A1) plays a key role in the development of estrogen dependent breast cancer, and aromatase inhibitors have been at the front line of treatment for the past three decades. The development of potent, selective and safer inhibitors is ongoing with in silico screening methods playing a more prominent role in the search for promising lead compounds in bioactivity-relevant chemical space. Here we present a set of comprehensive binding affinity prediction models for CYP19A1 using our automated Linear Interaction Energy (LIE) based workflow on a set of 132 putative and structurally diverse aromatase inhibitors obtained from a typical industrial screening study. We extended the workflow with machine learning methods to automatically cluster training and test compounds in order to maximize the number of explained compounds in one or more predictive LIE models. The method uses protein–ligand interaction profiles obtained from Molecular Dynamics (MD) trajectories to help model search and define the applicability domain of the resolved models. Our method was successful in accounting for 86% of the data set in 3 robust models that show high correlation between calculated and observed values for ligand-binding free energies (RMSE < 2.5 kJ mol–1), with good cross-validation statistics. PMID:28776988

Spectroscopic and molecular modeling approaches to investigate the interaction of bisphenol A, bisphenol F and their diglycidyl ethers with PPARα.

PubMed

Zhang, Jie; Zhang, Tiehua; Guan, Tianzhu; Ruan, Ping; Ren, Dayong; Dai, Weichang; Yu, Hansong; Li, Tiezhu

2017-08-01

A fluorescence polarization (FP) assay for the simultaneous determination of bisphenol A (BPA), bisphenol F (BPF), bisphenol A diglycidyl ether (BADGE) and bisphenol F diglycidyl ether (BFDGE) was developed. The method was based on the competition between bisphenols (BPs) and fluorescein-labeled dexamethasone derivative (Dex-fl) for mouse peroxisome proliferator-activated receptor α ligand binding domain (mPPARα-LBD). A recombinant soluble protein derivative mPPARα-LBD* was prepared, then in vitro binding of 4 BPs to mPPARα-LBD* was investigated. Fluorescence polarization assay showed that these compounds exhibited different binding potencies with mPPARα-LBD*. Additionally, molecular dynamics simulations were performed to further understand the mechanism of BPs binding affinity for mPPARα-LBD*. Docking results elucidated that the driving forces for the binding of BPs to mPPARα-LBD* were predominantly dependent on hydrophobic and hydrogen-bonding interactions. Comparison of the calculated binding energies vs. experimental binding affinities yielded a good correlation (R 2  = 0.7258). The proposed method has potential for multi-residue detection of BPA, BPF, BADGE, and BFDGE. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.

PubMed

Rosenberg, Robert E

2018-05-10

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.

Variation in One Residue Associated with the Metal Ion-Dependent Adhesion Site Regulates αIIbβ3 Integrin Ligand Binding Affinity

PubMed Central

Wu, Xue; Xiu, Zhilong; Li, Guohui; Luo, Bing-Hao

2013-01-01

The Asp of the RGD motif of the ligand coordinates with the β I domain metal ion dependent adhesion site (MIDAS) divalent cation, emphasizing the importance of the MIDAS in ligand binding. There appears to be two distinct groups of integrins that differ in their ligand binding affinity and adhesion ability. These differences may be due to a specific residue associated with the MIDAS, particularly the β3 residue Ala252 and corresponding Ala in the β1 integrin compared to the analogous Asp residue in the β2 and β7 integrins. Interestingly, mutations in the adjacent to MIDAS (ADMIDAS) of integrins α4β7 and αLβ2 increased the binding and adhesion abilities compared to the wild-type, while the same mutations in the α2β1, α5β1, αVβ3, and αIIbβ3 integrins demonstrated decreased ligand binding and adhesion. We introduced a mutation in the αIIbβ3 to convert this MIDAS associated Ala252 to Asp. By combination of this mutant with mutations of one or two ADMIDAS residues, we studied the effects of this residue on ligand binding and adhesion. Then, we performed molecular dynamics simulations on the wild-type and mutant αIIbβ3 integrin β I domains, and investigated the dynamics of metal ion binding sites in different integrin-RGD complexes. We found that the tendency of calculated binding free energies was in excellent agreement with the experimental results, suggesting that the variation in this MIDAS associated residue accounts for the differences in ligand binding and adhesion among different integrins, and it accounts for the conflicting results of ADMIDAS mutations within different integrins. This study sheds more light on the role of the MIDAS associated residue pertaining to ligand binding and adhesion and suggests that this residue may play a pivotal role in integrin-mediated cell rolling and firm adhesion. PMID:24116162

Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase

PubMed Central

Patra, Niladri; Ioannidis, Efthymios I.

2016-01-01

Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21–22 kcal/mol, in good agreement with experiment (18–19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are accessible, for example in other transferases. PMID:27564542

Theoretical studies on the selective mechanisms of GSK3β and CDK2 by molecular dynamics simulations and free energy calculations.

PubMed

Zhao, Sufang; Zhu, Jingyu; Xu, Lei; Jin, Jian

2017-06-01

Glycogen synthase kinase 3 (GSK3) is a serine/threonine protein kinase which is widely involved in cell signaling and controls a broad number of cellular functions. GSK3 contains α and β isoforms, and GSK3β has received more attention and becomes an attractive drug target for the treatment of several diseases. The binding pocket of cyclin-dependent kinase 2 (CDK2) shares high sequence identity to that of GSK3β, and therefore, the design of highly selective inhibitors toward GSK3β remains a big challenge. In this study, a computational strategy, which combines molecular docking, molecular dynamics simulations, free energy calculations, and umbrella sampling simulations, was employed to explore the binding mechanisms of two selective inhibitors to GSK3β and CDK2. The simulation results highlighted the key residues critical for GSK3β selectivity. It was observed that although GSK3β and CDK2 share the conserved ATP-binding pockets, some different residues have significant contributions to protein selectivity. This study provides valuable information for understanding the GSK3β-selective binding mechanisms and the rational design of selective GSK3β inhibitors. © 2016 John Wiley & Sons A/S.

Insight into Temperature Dependence of GTPase Activity in Human Guanylate Binding Protein-1

PubMed Central

Rahman, Safikur; Deep, Shashank; Sau, Apurba Kumar

2012-01-01

Interferon-γ induced human guanylate binding protein-1(hGBP1) belongs to a family of dynamin related large GTPases. Unlike all other GTPases, hGBP1 hydrolyzes GTP to a mixture of GDP and GMP with GMP being the major product at 37°C but GDP became significant when the hydrolysis reaction was carried out at 15°C. The hydrolysis reaction in hGBP1 is believed to involve with a number of catalytic steps. To investigate the effect of temperature in the product formation and on the different catalytic complexes of hGBP1, we carried out temperature dependent GTPase assays, mutational analysis, chemical and thermal denaturation studies. The Arrhenius plot for both GDP and GMP interestingly showed nonlinear behaviour, suggesting that the product formation from the GTP-bound enzyme complex is associated with at least more than one step. The negative activation energy for GDP formation and GTPase assay with external GDP together indicate that GDP formation occurs through the reversible dissociation of GDP-bound enzyme dimer to monomer, which further reversibly dissociates to give the product. Denaturation studies of different catalytic complexes show that unlike other complexes the free energy of GDP-bound hGBP1 decreases significantly at lower temperature. GDP formation is found to be dependent on the free energy of the GDP-bound enzyme complex. The decrease in the free energy of this complex at low temperature compared to at high is the reason for higher GDP formation at low temperature. Thermal denaturation studies also suggest that the difference in the free energy of the GTP-bound enzyme dimer compared to its monomer plays a crucial role in the product formation; higher stability favours GMP but lower favours GDP. Thus, this study provides the first thermodynamic insight into the effect of temperature in the product formation of hGBP1. PMID:22859948

Lattice vibrational contribution to equation of state for tetrahedral compounds

NASA Astrophysics Data System (ADS)

Kagaya, H.-Matsuo; Kotoku, H.; Soma, T.

1989-02-01

The lattice vibrational contributions to the Helmholtz free energy and the thermal pressure of tetrahedral compounds such as GaP, InP, ZnS, ZnSe, ZnTe and CdTe are investigated from the electronic theory of solids in the dynamical treatment based on our presented binding force. The temperature dependence of Helmholtz free energy and thermal pressure from lattice vibrational term are quantitatively obtained, and vibrational contributions to free energy are small compared with the static crystal energy. The influence of the thermal pressure is important to the equation of state in high temperatures, and the reformulation of the volume scale for the pressure-volume relation is given by considering the thermal pressure.

Influence of polarization and self-polarization charges on impurity binding energy in spherical quantum dot with parabolic confinement

NASA Astrophysics Data System (ADS)

Sarkar, Supratik; Sarkar, Samrat; Bose, Chayanika

2018-07-01

We present a general formulation of the ground state binding energy of a shallow hydrogenic impurity in spherical quantum dot with parabolic confinement, considering the effects of polarization and self energy. The variational approach within the effective mass approximation is employed here. The binding energy of an on-center impurity is computed for a GaAs/AlxGa1-xAs quantum dot as a function of the dot size with the dot barrier as parameter. The influence of polarization and self energy are also treated separately. Results indicate that the binding energy increases due to the presence of polarization charge, while decreases due to the self energy of the carrier. An overall enhancement in impurity binding energy, especially for small dots is noted.

Symmetry Energy and Its Components in Finite Nuclei

NASA Astrophysics Data System (ADS)

Antonov, A. N.; Gaidarov, M. K.; Kadrev, D. N.; Sarriguren, P.; Moya de Guerra, E.

2018-05-01

We derive the volume and surface components of the nuclear symmetry energy (NSE) and their ratio within the coherent density fluctuation model. The estimations use the results of the model for the NSE in finite nuclei based on the Brueckner and Skyrme energy-density functionals for nuclear matter. The obtained values of the volume and surface contributions to the NSE and their ratio for the Ni, Sn, and Pb isotopic chains are compared with estimations of other approaches which have used available experimental data on binding energies, neutron-skin thicknesses, and excitation energies to isobaric analog states (IAS). Apart from the density dependence investigated in our previous works, we study also the temperature dependence of the symmetry energy in finite nuclei in the framework of the local density approximation combining it with the self-consistent Skyrme-HFB method using the cylindrical transformed deformed harmonic-oscillator basis. The results for the thermal evolution of the NSE in the interval T = 0–4 MeV show that its values decrease with temperature. The investigations of the T-dependence of the neutron and proton root-mean-square radii and the corresponding neutron skin thickness point out that the effect of temperature leads mainly to a substantial increase of the neutron radii and skins, especially in nuclei which are more rich of neutrons.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. H.

1981-01-01

Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

Reversible geminate recombination of hydrogen-bonded water molecule pair

NASA Astrophysics Data System (ADS)

Markovitch, Omer; Agmon, Noam

2008-08-01

The (history independent) autocorrelation function for a hydrogen-bonded water molecule pair, calculated from classical molecular dynamics trajectories of liquid water, exhibits a t-3/2 asymptotic tail. Its whole time dependence agrees quantitatively with the solution for reversible diffusion-influenced geminate recombination derived by Agmon and Weiss [J. Chem. Phys. 91, 6937 (1989)]. Agreement with diffusion theory is independent of the precise definition of the bound state. Given the water self-diffusion constant, this theory enables us to determine the dissociation and bimolecular recombination rate parameters for a water dimer. (The theory is indispensable for obtaining the bimolecular rate coefficient.) Interestingly, the activation energies obtained from the temperature dependence of these rate coefficients are similar, rather than differing by the hydrogen-bond (HB) strength. This suggests that recombination requires displacing another water molecule, which meanwhile occupied the binding site. Because these activation energies are about twice the HB strength, cleavage of two HBs may be required to allow pair separation. The autocorrelation function without the HB angular restriction yields a recombination rate coefficient that is larger than that for rebinding to all four tetrahedral water sites (with angular restrictions), suggesting the additional participation of interstitial sites. Following dissociation, the probability of the pair to be unbound but within the reaction sphere rises more slowly than expected, possibly because binding to the interstitial sites delays pair separation. An extended diffusion model, which includes an additional binding site, can account for this behavior.

Effects of cross-bridge compliance on the force-velocity relationship and muscle power output

PubMed Central

Fenwick, Axel J.; Wood, Alexander M.

2017-01-01

Muscles produce force and power by utilizing chemical energy through ATP hydrolysis. During concentric contractions (shortening), muscles generate less force compared to isometric contractions, but consume greater amounts of energy as shortening velocity increases. Conversely, more force is generated and less energy is consumed during eccentric muscle contractions (lengthening). This relationship between force, energy use, and the velocity of contraction has important implications for understanding muscle efficiency, but the molecular mechanisms underlying this behavior remain poorly understood. Here we used spatially-explicit, multi-filament models of Ca2+-regulated force production within a half-sarcomere to simulate how force production, energy utilization, and the number of bound cross-bridges are affected by dynamic changes in sarcomere length. These computational simulations show that cross-bridge binding increased during slow-velocity concentric and eccentric contractions, compared to isometric contractions. Over the full ranges of velocities that we simulated, cross-bridge cycling and energy utilization (i.e. ATPase rates) increased during shortening, and decreased during lengthening. These findings are consistent with the Fenn effect, but arise from a complicated relationship between velocity-dependent cross-bridge recruitment and cross-bridge cycling kinetics. We also investigated how force production, power output, and energy utilization varied with cross-bridge and myofilament compliance, which is impossible to address under typical experimental conditions. These important simulations show that increasing cross-bridge compliance resulted in greater cross-bridge binding and ATPase activity, but less force was generated per cross-bridge and throughout the sarcomere. These data indicate that the efficiency of force production decreases in a velocity-dependent manner, and that this behavior is sensitive to cross-bridge compliance. In contrast, significant effects of myofilament compliance on force production were only observed during isometric contractions, suggesting that changes in myofilament compliance may not influence power output during non-isometric contractions as greatly as changes in cross-bridge compliance. These findings advance our understanding of how cross-bridge and myofilament properties underlie velocity-dependent changes in contractile efficiency during muscle movement. PMID:29284062

Effects of cross-bridge compliance on the force-velocity relationship and muscle power output.

PubMed

Fenwick, Axel J; Wood, Alexander M; Tanner, Bertrand C W

2017-01-01

Muscles produce force and power by utilizing chemical energy through ATP hydrolysis. During concentric contractions (shortening), muscles generate less force compared to isometric contractions, but consume greater amounts of energy as shortening velocity increases. Conversely, more force is generated and less energy is consumed during eccentric muscle contractions (lengthening). This relationship between force, energy use, and the velocity of contraction has important implications for understanding muscle efficiency, but the molecular mechanisms underlying this behavior remain poorly understood. Here we used spatially-explicit, multi-filament models of Ca2+-regulated force production within a half-sarcomere to simulate how force production, energy utilization, and the number of bound cross-bridges are affected by dynamic changes in sarcomere length. These computational simulations show that cross-bridge binding increased during slow-velocity concentric and eccentric contractions, compared to isometric contractions. Over the full ranges of velocities that we simulated, cross-bridge cycling and energy utilization (i.e. ATPase rates) increased during shortening, and decreased during lengthening. These findings are consistent with the Fenn effect, but arise from a complicated relationship between velocity-dependent cross-bridge recruitment and cross-bridge cycling kinetics. We also investigated how force production, power output, and energy utilization varied with cross-bridge and myofilament compliance, which is impossible to address under typical experimental conditions. These important simulations show that increasing cross-bridge compliance resulted in greater cross-bridge binding and ATPase activity, but less force was generated per cross-bridge and throughout the sarcomere. These data indicate that the efficiency of force production decreases in a velocity-dependent manner, and that this behavior is sensitive to cross-bridge compliance. In contrast, significant effects of myofilament compliance on force production were only observed during isometric contractions, suggesting that changes in myofilament compliance may not influence power output during non-isometric contractions as greatly as changes in cross-bridge compliance. These findings advance our understanding of how cross-bridge and myofilament properties underlie velocity-dependent changes in contractile efficiency during muscle movement.

Long tailed trions in monolayer MoS2: Temperature dependent asymmetry and resulting red-shift of trion photoluminescence spectra.

PubMed

Christopher, Jason W; Goldberg, Bennett B; Swan, Anna K

2017-10-25

Monolayer molybdenum disulfide (MoS 2 ) has emerged as a model system for studying many-body physics because the low dimensionality reduces screening leading to tightly bound states stable at room temperature. Further, the many-body states possess a pseudo-spin degree of freedom that corresponds with the two direct-gap valleys of the band structure, which can be optically manipulated. Here we focus on one bound state, the negatively charged trion. Unlike excitons, trions can radiatively decay with non-zero momentum by kicking out an electron, resulting in an asymmetric trion photoluminescence (PL) peak with a long low-energy tail and peak position that differs from the zero momentum trion energy. The asymmetry of the trion PL peak and resulting peak red-shift depends both on the trion size and a temperature-dependent contribution. Ignoring the trion asymmetry will result in over estimating the trion binding energy by nearly 20 meV at room temperature. We analyze the temperature-dependent PL to reveal the effective trion size, consistent with the literature, and the temperature dependence of the band gap and spin-orbit splitting of the valence band. This is the first time the temperature-dependence of the trion PL has been analyzed with such detail in any system.

Phosphorylation-dependent mineral-type specificity for apatite-binding peptide sequences.

PubMed

Addison, William N; Miller, Sharon J; Ramaswamy, Janani; Mansouri, Ahmad; Kohn, David H; McKee, Marc D

2010-12-01

Apatite-binding peptides discovered by phage display provide an alternative design method for creating functional biomaterials for bone and tooth tissue repair. A limitation of this approach is the absence of display peptide phosphorylation--a post-translational modification important to mineral-binding proteins. To refine the material specificity of a recently identified apatite-binding peptide, and to determine critical design parameters (net charge, charge distribution, amino acid sequence and composition) controlling peptide affinity for mineral, we investigated the effects of phosphorylation and sequence scrambling on peptide adsorption to four different apatites (bone-like mineral, and three types of apatite containing initially 0, 5.6 and 10.5% carbonate). Phosphorylation of the VTKHLNQISQSY peptide (VTK peptide) led to a 10-fold increase in peptide adsorption (compared to nonphosphorylated peptide) to bone-like mineral, and a 2-fold increase in adsorption to the carbonated apatite, but there was no effect of phosphorylation on peptide affinity to pure hydroxyapatite (without carbonate). Sequence scrambling of the nonphosphorylated VTK peptide enhanced its specificity for the bone-like mineral, but scrambled phosphorylated VTK peptide (pVTK) did not significantly alter mineral-binding suggesting that despite the importance of sequence order and/or charge distribution to mineral-binding, the enhanced binding after phosphorylation exceeds any further enhancement by altered sequence order. Osteoblast culture mineralization was dose-dependently inhibited by pVTK and to a significantly lesser extent by scrambled pVTK, while the nonphosphorylated and scrambled forms had no effect, indicating that inhibition of osteoblast mineralization is dependent on both peptide sequence and charge. Computational modeling of peptide-mineral interactions indicated a favorable change in binding energy upon phosphorylation that was unaffected by scrambling. In conclusion, phosphorylation of serine residues increases peptide specificity for bone-like mineral, whose adsorption is determined primarily by sequence composition and net charge as opposed to sequence order. However, sequence order in addition to net charge modulates the mineralization of osteoblast cultures. The ability of such peptides to inhibit mineralization has potential utility in the management of pathologic calcification. Copyright © 2010 Elsevier Ltd. All rights reserved.

Co-regulation of nuclear respiratory factor-1 by NFκB and CREB links LPS-induced inflammation to mitochondrial biogenesis

PubMed Central

Suliman, Hagir B.; Sweeney, Timothy E.; Withers, Crystal M.; Piantadosi, Claude A.

2010-01-01

The nuclear respiratory factor-1 (NRF1) gene is activated by lipopolysaccharide (LPS), which might reflect TLR4-mediated mitigation of cellular inflammatory damage via initiation of mitochondrial biogenesis. To test this hypothesis, we examined NRF1 promoter regulation by NFκB, and identified interspecies-conserved κB-responsive promoter and intronic elements in the NRF1 locus. In mice, activation of Nrf1 and its downstream target, Tfam, by Escherichia coli was contingent on NFκB, and in LPS-treated hepatocytes, NFκB served as an NRF1 enhancer element in conjunction with NFκB promoter binding. Unexpectedly, optimal NRF1 promoter activity after LPS also required binding by the energy-state-dependent transcription factor CREB. EMSA and ChIP assays confirmed p65 and CREB binding to the NRF1 promoter and p65 binding to intron 1. Functionality for both transcription factors was validated by gene-knockdown studies. LPS regulation of NRF1 led to mtDNA-encoded gene expression and expansion of mtDNA copy number. In cells expressing plasmid constructs containing the NRF-1 promoter and GFP, LPS-dependent reporter activity was abolished by cis-acting κB-element mutations, and nuclear accumulation of NFκB and CREB demonstrated dependence on mitochondrial H2O2. These findings indicate that TLR4-dependent NFκB and CREB activation co-regulate the NRF1 promoter with NFκB intronic enhancement and redox-regulated nuclear translocation, leading to downstream target-gene expression, and identify NRF-1 as an early-phase component of the host antibacterial defenses. PMID:20587593

JSEP Annual Report

DTIC Science & Technology

1993-03-01

Mitzi , and A. Kapitulnik, "Nature of the high-binding-energy dip in the low-temperature photoemission spectra of Bi2Sr2CaCu2O8+d," Phys. Rev. B 45...5095 (1992). 2. B. 0. Wells, Z.-X. Shen, D. S. Dessau, W. E. Spicer, D. B. Mitzi , L.Lombardo, A. Kapitulnik, A. J. Arko. "Evidence for k-dependent, in

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miliordos, Evangelos; Aprà, Edoardo; Xantheas, Sotiris S.

We establish a new estimate for the binding energy between two benzene molecules in the parallel-displaced (PD) conformation by systematically converging (i) the intra- and intermolecular geometry at the minimum, (ii) the expansion of the orbital basis set, and (iii) the level of electron correlation. The calculations were performed at the second-order Møller–Plesset perturbation (MP2) and the coupled cluster including singles, doubles, and a perturbative estimate of triples replacement [CCSD(T)] levels of electronic structure theory. At both levels of theory, by including results corrected for basis set superposition error (BSSE), we have estimated the complete basis set (CBS) limit bymore » employing the family of Dunning’s correlation-consistent polarized valence basis sets. The largest MP2 calculation was performed with the cc-pV6Z basis set (2772 basis functions), whereas the largest CCSD(T) calculation was with the cc-pV5Z basis set (1752 basis functions). The cluster geometries were optimized with basis sets up to quadruple-ζ quality, observing that both its intra- and intermolecular parts have practically converged with the triple-ζ quality sets. The use of converged geometries was found to play an important role for obtaining accurate estimates for the CBS limits. Our results demonstrate that the binding energies with the families of the plain (cc-pVnZ) and augmented (aug-cc-pVnZ) sets converge [within <0.01 kcal/mol for MP2 and <0.15 kcal/mol for CCSD(T)] to the same CBS limit. In addition, the average of the uncorrected and BSSE-corrected binding energies was found to converge to the same CBS limit much faster than either of the two constituents (uncorrected or BSSE-corrected binding energies). Due to the fact that the family of augmented basis sets (especially for the larger sets) causes serious linear dependency problems, the plain basis sets (for which no linear dependencies were found) are deemed as a more efficient and straightforward path for obtaining an accurate CBS limit. We considered extrapolations of the uncorrected (ΔE) and BSSE-corrected (ΔE cp) binding energies, their average value (ΔE ave), as well as the average of the latter over the plain and augmented sets (Δ~E ave) with the cardinal number of the basis set n. Our best estimate of the CCSD(T)/CBS limit for the π–π binding energy in the PD benzene dimer is D e = -2.65 ± 0.02 kcal/mol. The best CCSD(T)/cc-pV5Z calculated value is -2.62 kcal/mol, just 0.03 kcal/mol away from the CBS limit. For comparison, the MP2/CBS limit estimate is -5.00 ± 0.01 kcal/mol, demonstrating a 90% overbinding with respect to CCSD(T). Finally, the spin-component-scaled (SCS) MP2 variant was found to closely reproduce the CCSD(T) results for each basis set, while scaled opposite spin (SOS) MP2 yielded results that are too low when compared to CCSD(T).« less

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Computing Curvature Sensitivity of Biomolecules in Membranes by Simulated Buckling.

PubMed

Elías-Wolff, Federico; Lindén, Martin; Lyubartsev, Alexander P; Brandt, Erik G

2018-03-13

Membrane curvature sensing, where the binding free energies of membrane-associated molecules depend on the local membrane curvature, is a key factor to modulate and maintain the shape and organization of cell membranes. However, the microscopic mechanisms are not well understood, partly due to absence of efficient simulation methods. Here, we describe a method to compute the curvature dependence of the binding free energy of a membrane-associated probe molecule that interacts with a buckled membrane, which has been created by lateral compression of a flat bilayer patch. This buckling approach samples a wide range of curvatures in a single simulation, and anisotropic effects can be extracted from the orientation statistics. We develop an efficient and robust algorithm to extract the motion of the probe along the buckled membrane surface, and evaluate its numerical properties by extensive sampling of three coarse-grained model systems: local lipid density in a curved environment for single-component bilayers, curvature preferences of individual lipids in two-component membranes, and curvature sensing by a homotrimeric transmembrane protein. The method can be used to complement experimental data from curvature partition assays and provides additional insight into mesoscopic theories and molecular mechanisms for curvature sensing.

Insights into the spurious long-range nature of local rs-dependent non-local exchange-correlation kernels

DOE PAGES

Lu, Deyu

2016-08-05

A systematic route to go beyond the exact exchange plus random phase approximation (RPA) is to include a physical exchange-correlation kernel in the adiabatic-connection fluctuation-dissipation theorem. Previously, [D. Lu, J. Chem. Phys. 140, 18A520 (2014)], we found that non-local kernels with a screening length depending on the local Wigner-Seitz radius, r s(r), suffer an error associated with a spurious long-range repulsion in van der Waals bounded systems, which deteriorates the binding energy curve as compared to RPA. Here, we analyze the source of the error and propose to replace r s(r) by a global, average r s in the kernel.more » Exemplary studies with the Corradini, del Sole, Onida, and Palummo kernel show that while this change does not affect the already outstanding performance in crystalline solids, using an average r s significantly reduces the spurious long-range tail in the exchange-correlation kernel in van der Waals bounded systems. Finally, when this method is combined with further corrections using local dielectric response theory, the binding energy of the Kr dimer is improved three times as compared to RPA.« less

Probing Bioluminescence Resonance Energy Transfer in Quantum Rod-Luciferase Nanoconjugates.

PubMed

Alam, Rabeka; Karam, Liliana M; Doane, Tennyson L; Coopersmith, Kaitlin; Fontaine, Danielle M; Branchini, Bruce R; Maye, Mathew M

2016-02-23

We describe the necessary design criteria to create highly efficient energy transfer conjugates containing luciferase enzymes derived from Photinus pyralis (Ppy) and semiconductor quantum rods (QRs) with rod-in-rod (r/r) microstructure. By fine-tuning the synthetic conditions, CdSe/CdS r/r-QRs were prepared with two different emission colors and three different aspect ratios (l/w) each. These were hybridized with blue, green, and red emitting Ppy, leading to a number of new BRET nanoconjugates. Measurements of the emission BRET ratio (BR) indicate that the resulting energy transfer is highly dependent on QR energy accepting properties, which include absorption, quantum yield, and optical anisotropy, as well as its morphological and topological properties, such as aspect ratio and defect concentration. The highest BR was found using r/r-QRs with lower l/w that were conjugated with red Ppy, which may be activating one of the anisotropic CdSe core energy levels. The role QR surface defects play on Ppy binding, and energy transfer was studied by growth of gold nanoparticles at the defects, which indicated that each QR set has different sites. The Ppy binding at those sites is suggested by the observed BRET red-shift as a function of Ppy-to-QR loading (L), where the lowest L results in highest efficiency and furthest shift.

Enzymology below 200 K: The kinetics and thermodynamics of the photochemistry catalyzed by protochlorophyllide oxidoreductase

PubMed Central

Heyes, Derren J.; Ruban, Alexander V.; Wilks, Helen M.; Hunter, C. Neil

2002-01-01

The chlorophyll biosynthesis enzyme protochlorophyllide reductase (POR) catalyzes the light-dependent reduction of protochlorophyllide (Pchlide) into chlorophyllide in the presence of NADPH. As POR is light-dependent, catalysis can be initiated by illumination of the enzyme-substrate complex at low temperatures, making it an attractive model for studying aspects of biological proton and hydride transfers. The early stages in the photoreduction, involving Pchlide binding and an initial photochemical reaction, have been studied in vitro by using low-temperature fluorescence and absorbance measurements. Formation of the ternary POR-NADPH-Pchlide complex produces red shifts in the fluorescence and absorbance maxima of Pchlide, allowing the dissociation constant for Pchlide binding to be measured. We demonstrate that the product of an initial photochemical reaction, which can occur below 200 K, is a nonfluorescent intermediate with a broad absorbance band at 696 nm (A696) that is suggested to represent an ion radical complex. The temperature dependence of the rate of A696 formation has allowed the activation energy for the photochemical step to be calculated and has shown that POR catalysis can proceed at much lower temperatures than previously thought. Calculations of differences in free energy between various reaction intermediates have been calculated; these, together with the quantum efficiency for Pchlide conversion, suggest a quantitative model for the thermodynamics of the light-driven step of Pchlide reduction. PMID:12177453

Fundamental considerations in ski binding analysis.

PubMed

Mote, C D; Hull, M L

1976-01-01

1. The static adjustment of a ski binding by hand or by available machines is only an adjustment and is neither a static nor a dynamic evaluation of the binding design. Bindings of different design with identical static adjustments will perform differently in environments in which the forces are static or dynamic. 2. The concept of binding release force is a useful measure of binding adjustment, but it is inappropriate as a criterion for binding evaluation. First, it does not direct attention toward the injury causing mechanism, strain, or displacement in the leg. Second, it is only part of the evaluation in dynamic problems. 3. The binding release decision in present bindings is displacement controlled. The relative displacement of the boot and ski is the system variable. For any specified relative displacement the binding force can be any of an infinite number of possibilities determined by the loading path. 4. The response of the leg-ski system to external impulses applied to the ski is independent of the boot-ski relative motion as long as the boot recenters quickly in the binding. Response is dependent upon the external impulse plus system inertia, damping and stiffness. 5. When tested under half sinusoidal forces applied to a test ski, all bindings will demonstrate static and impulse loading regions. In the static region the force drives the binding to a relative release displacement. In the impulse region the initial velocity of the ski drives the binding to a release displacement. 6. The transition between the static and impulse loading regions is determined by the binding's capacity to store and dissipate energy along the principal loading path. Increased energy capacity necessitates larger external impulses to produce release. 7. In all bindings examined to date, the transmitted leg displacement or strain at release under static loading exceeds leg strain under dynamic or impact loading. Because static loading is responsible for many injuries, a skier should be able to release his bindings in every mode by simply pulling or twisting his foot outward. If that cannot be done without injury, the skier has identified for himself one type of fall that will result in injury. 8. And lastly, a little advice from Ben Franklin--"Carelessness does more harm than a want of knowledge."

Magnetic resonance studies of atomic hydrogen at zero field and low temperature: Recombination and binding on liquid helium

NASA Astrophysics Data System (ADS)

Jochemsen, R.; Morrow, M.; Berlinsky, A. J.; Hardy, W. N.

1982-07-01

Magnetic resonance studies at zero field are reported for atomic hydrogen gas confined in a closed glass bulb with helium-coated walls for T < 1 K in a dilution refrigerator. Low-energy r.f. discharge pulses have been used to produce H atoms at temperatures as low as T = 0.06 K. The atom density nH (10 9 < nH < 10 13) measured by the strength of the free induction decay signal, follows a second-order rate equation {dn H}/{dt} = -Kn H2. At the lowest temperatures recombination is dominated by the process H + H+ wall → H 2 + wall. From the temperature dependence of the rate constant K we have determined the binding energy of H on liquid 4He and 3He, and also the cross section for recombination on the surface.

Ab-initio study of structural, electronic, and transport properties of zigzag GaP nanotubes.

PubMed

Srivastava, Anurag; Jain, Sumit Kumar; Khare, Purnima Swarup

2014-03-01

Stability and electronic properties of zigzag (3 ≤ n ≤ 16) gallium phosphide nanotubes (GaP NTs) have been analyzed by employing a systematic ab-intio approach based on density functional theory using generalized gradient approximation with revised Perdew Burke Ernzerhoff type parameterization. Diameter dependence of bond length, buckling, binding energy, and band gap has been investigated and the analysis shows that the bond length and buckling decreases with increasing diameter of the tube, highest binding energy of (16, 0) confirms this as the most stable amongst all the NTs taken into consideration. The present GaP NTs shows direct band gap and it increases with diameter of the tubes. Using a two probe model for (4, 0) NT the I-V relationship shows an exponential increase in current on applying bias voltage beyond 1.73 volt.

Exciton–exciton annihilation and biexciton stimulated emission in graphene nanoribbons

DOE PAGES

Soavi, Giancarlo; Dal Conte, Stefano; Manzoni, Cristian; ...

2016-03-17

Graphene nanoribbons display extraordinary optical properties due to one-dimensional quantum-confinement, such as width-dependent bandgap and strong electron–hole interactions, responsible for the formation of excitons with extremely high binding energies. Here we use femtosecond transient absorption spectroscopy to explore the ultrafast optical properties of ultranarrow, structurally well-defined graphene nanoribbons as a function of the excitation fluence, and the impact of enhanced Coulomb interaction on their excited states dynamics. We show that in the high-excitation regime biexcitons are formed by nonlinear exciton–exciton annihilation, and that they radiatively recombine via stimulated emission. We obtain a biexciton binding energy of ≈250meV, in very goodmore » agreement with theoretical results from quantum Monte Carlo simulations. As a result, these observations pave the way for the application of graphene nanoribbons in photonics and optoelectronics.« less

Visualizing the orientational dependence of an intermolecular potential

NASA Astrophysics Data System (ADS)

Sweetman, Adam; Rashid, Mohammad A.; Jarvis, Samuel P.; Dunn, Janette L.; Rahe, Philipp; Moriarty, Philip

2016-02-01

Scanning probe microscopy can now be used to map the properties of single molecules with intramolecular precision by functionalization of the apex of the scanning probe tip with a single atom or molecule. Here we report on the mapping of the three-dimensional potential between fullerene (C60) molecules in different relative orientations, with sub-Angstrom resolution, using dynamic force microscopy (DFM). We introduce a visualization method which is capable of directly imaging the variation in equilibrium binding energy of different molecular orientations. We model the interaction using both a simple approach based around analytical Lennard-Jones potentials, and with dispersion-force-corrected density functional theory (DFT), and show that the positional variation in the binding energy between the molecules is dominated by the onset of repulsive interactions. Our modelling suggests that variations in the dispersion interaction are masked by repulsive interactions even at displacements significantly larger than the equilibrium intermolecular separation.

A simple model for solvation in mixed solvents. Applications to the stabilization and destabilization of macromolecular structures.

PubMed

Schellman, J A

1990-08-31

The properties of a simple model for solvation in mixed solvents are explored in this paper. The model is based on the supposition that solvent replacement is a simple one-for-one substitution reaction at macromolecular sites which are independent of one another. This leads to a new form for the binding polynomial in which all terms are associated with ligand interchange rather than ligand addition. The principal solvent acts as one of the ligands. Thermodynamic analysis then shows that thermodynamic binding (i.e., selective interaction) depends on the properties of K'-1, whereas stoichiometric binding (site occupation) depends on K'. K' is a 'practical' interchange equilibrium constant given by (f3/f1)K, where K is the true equilibrium constant for the interchange of components 3 and 1 on the site and f3 and f4 denote their respective activity coefficients on the mole fraction scale. Values of K' less than unity lead to negative selective interaction. It is selective interaction and not occupation number which determines the thermodynamic effects of solvation. When K' greater than 100 on the mole fraction scale or K' greater than 2 on the molality scale (in water), the differences between stoichiometric binding and selective interaction become less than 1%. The theory of this paper is therefore necessary only for very weak binding constants. When K'-1 is small, large concentrations of the added solvent component are required to produce a thermodynamic effect. Under these circumstances the isotherms for the selective interaction and for the excess (or transfer) free energy are strongly dependent on the behavior of the activity coefficients of both solvent components. Two classes of behavior are described depending on whether the components display positive or negative deviations from Raoult's law. Examples which are discussed are aqueous solutions of urea and guanidinium chloride for positive deviations and of sucrose and glucose for negative deviations. Examination of the few studies which have been reported in the literature shows that most of the qualitative features of the stabilization of proteins by sugars and their destabilization by urea and guanidinium chloride are faithfully represented with the model. This includes maxima in the free energy of stabilization and destabilization, decreased and zero selective interaction at high concentrations, etc. These phenomena had no prior explanation. Deficiencies in the model as a representation of solvation in aqueous solution are discussed in the appendix.

Semi-empirical anzatz for Helmholtz free energy calculation: Thermal properties of silver along shock Hugoniot

NASA Astrophysics Data System (ADS)

Joshi, R. H.; Thakore, B. Y.; Bhatt, N. K.; Vyas, P. R.; Jani, A. R.

2018-02-01

A density functional theory along with electronic contribution is used to compute quasiharmonic total energy for silver, whereas explicit phonon anharmonic contribution is added through perturbative term in temperature. Within the Mie-Grüneisen approach, we propose a consistent computational scheme for calculating various thermophysical properties of a substance, in which the required Grüneisen parameter γth is calculated from the knowledge of binding energy. The present study demonstrates that no separate relation for volume dependence for γth is needed, and complete thermodynamics under simultaneous high-temperature and high-pressure condition can be derived in a consistent manner. We have calculated static and dynamic equation of states and some important thermodynamic properties along the shock Hugoniot. A careful examination of temperature dependence of Grüneisen parameter reveals the importance of temperature-effect on various thermal properties.

Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

PubMed

Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

2017-04-01

Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

Epitope mapping of monoclonal antibody HPT-101: a study combining dynamic force spectroscopy, ELISA and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Stangner, Tim; Angioletti-Uberti, Stefano; Knappe, Daniel; Singer, David; Wagner, Carolin; Hoffmann, Ralf; Kremer, Friedrich

2015-12-01

By combining enzyme-linked immunosorbent assay (ELISA) and optical tweezers-assisted dynamic force spectroscopy (DFS), we identify for the first time the binding epitope of the phosphorylation-specific monoclonal antibody (mAb) HPT-101 to the Alzheimer's disease relevant peptide tau[pThr231/pSer235] on the level of single amino acids. In particular, seven tau isoforms are synthesized by replacing binding relevant amino acids by a neutral alanine (alanine scanning). From the binding between mAb HPT-101 and the alanine-scan derivatives, we extract specific binding parameters such as bond lifetime {τ }0, binding length {x}{ts}, free energy of activation {{Δ }}G (DFS) and affinity constant {K}{{a}} (ELISA, DFS). Based on these quantities, we propose criteria to identify essential, secondary and non-essential amino acids, being representative of the antibody binding epitope. The obtained results are found to be in full accord for both experimental techniques. In order to elucidate the microscopic origin of the change in binding parameters, we perform molecular dynamics (MD) simulations of the free epitope in solution for both its parent and modified form. By taking the end-to-end distance {d}{{E}-{{E}}} and the distance between the α-carbons {d}{{C}-{{C}}} of the phosphorylated residues as gauging parameters, we measure how the structure of the epitope depends on the type of substitution. In particular, whereas {d}{{C}-{{C}}} is sometimes conserved between the parent and modified form, {d}{{E}-{{E}}} strongly changes depending on the type of substitution, correlating well with the experimental data. These results are highly significant, offering a detailed microscopic picture of molecular recognition.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Young-Ho; Lazauskas, Rimantas; Park, Tae-Sun

M1 properties, comprising magnetic moments and radiative capture of thermal neutron observables, are studied in two- and three-nucleon systems. We use meson exchange current derived up to N{sup 3}LO using heavy baryon chiral perturbation theory a la Weinberg. Calculations have been performed for several qualitatively different realistic nuclear Hamiltonians, which permits us to analyze model dependence of our results. Our results are found to be strongly correlated with the effective range parameters such as binding energies and the scattering lengths. Taking into account such correlations, the results are in good agreement with the experimental data with small model dependence.

Binding free energy calculations between bovine β-lactoglobulin and four fatty acids using the MMGBSA method.

PubMed

Bello, Martiniano

2014-10-01

The bovine dairy protein β-lactoglobulin (βlg) is a promiscuous protein that has the ability to bind several hydrophobic ligands. In this study, based on known experimental data, the dynamic interaction mechanism between bovine βlg and four fatty acids was investigated by a protocol combining molecular dynamics (MD) simulations and molecular mechanics generalized Born surface area (MMGBSA) binding free energy calculations. Energetic analyses revealed binding free energy trends that corroborated known experimental findings; larger ligand size corresponded to greater binding affinity. Finally, binding free energy decomposition provided detailed information about the key residues stabilizing the complex. © 2014 Wiley Periodicals, Inc.

A Prediction Method of Binding Free Energy of Protein and Ligand

NASA Astrophysics Data System (ADS)

Yang, Kun; Wang, Xicheng

2010-05-01

Predicting the binding free energy is an important problem in bimolecular simulation. Such prediction would be great benefit in understanding protein functions, and may be useful for computational prediction of ligand binding strengths, e.g., in discovering pharmaceutical drugs. Free energy perturbation (FEP)/thermodynamics integration (TI) is a classical method to explicitly predict free energy. However, this method need plenty of time to collect datum, and that attempts to deal with some simple systems and small changes of molecular structures. Another one for estimating ligand binding affinities is linear interaction energy (LIE) method. This method employs averages of interaction potential energy terms from molecular dynamics simulations or other thermal conformational sampling techniques. Incorporation of systematic deviations from electrostatic linear response, derived from free energy perturbation studies, into the absolute binding free energy expression significantly enhances the accuracy of the approach. However, it also is time-consuming work. In this paper, a new prediction method based on steered molecular dynamics (SMD) with direction optimization is developed to compute binding free energy. Jarzynski's equality is used to derive the PMF or free-energy. The results for two numerical examples are presented, showing that the method has good accuracy and efficiency. The novel method can also simulate whole binding proceeding and give some important structural information about development of new drugs.

Moiré-pattern interlayer potentials in van der Waals materials in the random-phase approximation

NASA Astrophysics Data System (ADS)

Leconte, Nicolas; Jung, Jeil; Lebègue, Sébastien; Gould, Tim

2017-11-01

Stacking-dependent interlayer interactions are important for understanding the structural and electronic properties in incommensurable two-dimensional material assemblies where long-range moiré patterns arise due to small lattice constant mismatch or twist angles. Here we study the stacking-dependent interlayer coupling energies between graphene (G) and hexagonal boron nitride (BN) homo- and heterostructures using high-level random-phase approximation (RPA) ab initio calculations. Our results show that although total binding energies within LDA and RPA differ substantially by a factor of 200%-400%, the energy differences as a function of stacking configuration yield nearly constant values with variations smaller than 20%, meaning that LDA estimates are quite reliable. We produce phenomenological fits to these energy differences, which allows us to calculate various properties of interest including interlayer spacing, sliding energetics, pressure gradients, and elastic coefficients to high accuracy. The importance of long-range interactions (captured by RPA but not LDA) on various properties is also discussed. Parametrizations for all fits are provided.

Genistein Binding to Copper(II)-Solvent Dependence and Effects on Radical Scavenging.

PubMed

Yang, Jing; Xu, Yi; Liu, Hao-Yu; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H

2017-10-18

Genistein, but not daidzein, binds to copper(II) with a 1:2 stoichiometry in ethanol and with a 1:1 stoichiometry in methanol, indicating chelation by the 5-phenol and the 4-keto group of the isoflavonoid as demonstrated by the Jobs method and UV-visible absorption spectroscopy. In ethanol, the stability constants had the value 1.12 × 10 11 L²∙mol -2 for the 1:2 complex and in methanol 6.0 × 10⁵ L∙mol -1 for the 1:1 complex at 25 °C. Binding was not detected in water, as confirmed by an upper limit for the 1:1 stability constant of K = 5 mol -1 L as calculated from the difference in solvation free energy of copper(II) between methanol and the more polar water. Solvent molecules compete with genistein as demonstrated in methanol where binding stoichiometry changes from 1:2 to 1:1 compared to ethanol and methanol/chloroform (7/3, v / v ). Genistein binding to copper(II) increases the scavenging rate of the stable, neutral 2,2-diphenyl-1-picrylhydrazyl radical by more than a factor of four, while only small effects were seen for the short-lived but more oxidizing β -carotene radical cation using laser flash photolysis. The increased efficiency of coordinated genistein is concluded to depend on kinetic rather than on thermodynamic factors, as confirmed by the small change in reduction potential of -0.016 V detected by cyclic voltammetry upon binding of genistein to copper(II) in methanol/chloroform solutions.

Binding and Energetics of Electron Transfer between an Artificial Four-Helix Mn-Protein and Reaction Centers from Rhodobacter sphaeroides.

PubMed

Espiritu, Eduardo; Olson, Tien L; Williams, JoAnn C; Allen, James P

2017-12-12

The ability of an artificial four-helix bundle Mn-protein, P1, to bind and transfer an electron to photosynthetic reaction centers from the purple bacterium Rhodobacter sphaeroides was characterized using optical spectroscopy. Upon illumination of reaction centers, an electron is transferred from P, the bacteriochlorophyll dimer, to Q A , the primary electron acceptor. The P1 Mn-protein can bind to the reaction center and reduce the oxidized bacteriochlorophyll dimer, P + , with a dissociation constant of 1.2 μM at pH 9.4, comparable to the binding constant of c-type cytochromes. Amino acid substitutions of surface residues on the Mn-protein resulted in increases in the dissociation constant to 8.3 μM. The extent of reduction of P + by the P1 Mn-protein was dependent on the P/P + midpoint potential and the pH. Analysis of the free energy difference yielded a midpoint potential of approximately 635 mV at pH 9.4 for the Mn cofactor of the P1 Mn-protein, a value similar to those found for other Mn cofactors in proteins. The linear dependence of -56 mV/pH is consistent with one proton being released upon Mn oxidation, allowing the complex to maintain overall charge neutrality. These outcomes demonstrate the feasibility of designing four-helix bundles and other artificial metalloproteins to bind and transfer electrons to bacterial reaction centers and establish the usefulness of this system as a platform for designing sites to bind novel metal cofactors capable of performing complex oxidation-reduction reactions.

Zinc finger protein binding to DNA: an energy perspective using molecular dynamics simulation and free energy calculations on mutants of both zinc finger domains and their specific DNA bases.

PubMed

Hamed, Mazen Y; Arya, Gaurav

2016-05-01

Energy calculations based on MM-GBSA were employed to study various zinc finger protein (ZF) motifs binding to DNA. Mutants of both the DNA bound to their specific amino acids were studied. Calculated energies gave evidence for a relationship between binding energy and affinity of ZF motifs to their sites on DNA. ΔG values were -15.82(12), -3.66(12), and -12.14(11.6) kcal/mol for finger one, finger two, and finger three, respectively. The mutations in the DNA bases reduced the value of the negative energies of binding (maximum value for ΔΔG = 42Kcal/mol for F1 when GCG mutated to GGG, and ΔΔG = 22 kcal/mol for F2, the loss in total energy of binding originated in the loss in electrostatic energies upon mutation (r = .98). The mutations in key amino acids in the ZF motif in positions-1, 2, 3, and 6 showed reduced binding energies to DNA with correlation coefficients between total free energy and electrostatic was .99 and with Van der Waal was .93. Results agree with experimentally found selectivity which showed that Arginine in position-1 is specific to G, while Aspartic acid (D) in position 2 plays a complicated role in binding. There is a correlation between the MD calculated free energies of binding and those obtained experimentally for prepared ZF motifs bound to triplet bases in other reports (), our results may help in the design of ZF motifs based on the established recognition codes based on energies and contributing energies to the total energy.

Dissipative time-dependent quantum transport theory.

PubMed

Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

2013-04-28

A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

A study of planar anchor groups for graphene-based single-molecule electronics.

PubMed

Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

NASA Astrophysics Data System (ADS)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-02-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

Binding Energies of the Proton-Bound Amino Acid Dimers Gly·Gly, Ala·Ala, Gly·Ala, and Lys·Lys Measured by Blackbody Infrared Radiative Dissociation

PubMed Central

Price, William D.; Schnier, Paul D.

2005-01-01

Arrhenius activation energies in the zero-pressure limit for dissociation of gas-phase proton-bound homodimers of N,N-dimethylacetamide (N,N-DMA), glycine, alanine, and lysine and the heterodimer alanine·glycine were measured using blackbody infrared radiative dissociation (BIRD). In combination with master equation modeling of the kinetic data, binding energies of these dimers were determined. A value of 1.25 ± 0.05 eV is obtained for N,N-DMA and is in excellent agreement with that reported in the literature. The value obtained from the truncated Boltzmann model is significantly higher, indicating that the assumptions of this model do not apply to these ions. This is due to the competitive rates of photon emission and dissociation for these relatively large ions. The binding energies of the amino acid dimers are ~1.15 ± 0.05 eV and are indistinguishable despite the difference in their gas-phase basicity and structure. The threshold dissociation energies can be accurately modeled using a range of dissociation parameters and absorption/emission rates. However, the absolute values of the dissociation rates depend more strongly on the absorption/emission rates. For N,N-DMA and glycine, an accurate fit was obtained using frequencies and transition dipole moments calculated at the ab initio RHF/2-31G* and MP2/2-31G* level, respectively. In order to obtain a similar accuracy using values obtained from AM1 semiempirical calculations, it was necessary to multiply the transition dipole moments by a factor of 3. These results demonstrate that in combination with master equation modeling, BIRD can be used to obtain accurate threshold dissociation energies of relatively small ions of biological interest. PMID:17235378

Free energy force field (FEFF) 3D-QSAR analysis of a set of Plasmodium falciparum dihydrofolate reductase inhibitors

NASA Astrophysics Data System (ADS)

Santos-Filho, Osvaldo A.; Mishra, Rama K.; Hopfinger, A. J.

2001-09-01

Free energy force field (FEFF) 3D-QSAR analysis was used to construct ligand-receptor binding models for a set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines. The molecular target (`receptor') used was a 3D-homology model of a specific mutant type of Plasmodium falciparum (Pf) dihydrofolate reductase (DHFR). The dependent variable of the 3D-QSAR models is the IC50 inhibition constant for the specific mutant type of PfDHFR. The independent variables of the 3D-QSAR models (the descriptors) are scaled energy terms of a modified first-generation AMBER force field combined with a hydration shell aqueous solvation model and a collection of 2D-QSAR descriptors often used in QSAR studies. Multiple temperature molecular dynamics simulation (MDS) and the genetic function approximation (GFA) were employed using partial least square (PLS) and multidimensional linear regressions as the fitting functions to develop FEFF 3D-QSAR models for the binding process. The significant FEFF energy terms in the best 3D-QSAR models include energy contributions of the direct ligand-receptor interaction. Some changes in conformational energy terms of the ligand due to binding to the enzyme are also found to be important descriptors. The FEFF 3D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the PfDHFR to current antimalarials. The FEFF 3D-QSAR models are also compared to receptor-independent (RI) 4D-QSAR models developed in an earlier study and subsequently refined using recently developed generalized alignment rules.

Theoretical study of transition-metal ions bound to benzene

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

1992-01-01

Theoretical binding energies are reported for all first-row and selected second-row transition metal ions (M+) bound to benzene. The calculations employ basis sets of at least double-zeta plus polarization quality and account for electron correlation using the modified coupled-pair functional method. While the bending is predominantly electrostatic, the binding energies are significantly increased by electron correlation, because the donation from the metal d orbitals to the benzene pi* orbitals is not well described at the self-consistent-field level. The uncertainties in the computed binding energies are estimated to be about 5 kcal/mol. Although the calculated and experimental binding energies generally agree to within their combined uncertainties, it is likely that the true binding energies lie in the lower portion of the experimental range. This is supported by the very good agreement between the theoretical and recent experimental binding energies for AgC6H6(+).

Energy Scaling of Cold Atom-Atom-Ion Three-Body Recombination

NASA Astrophysics Data System (ADS)

Krükow, Artjom; Mohammadi, Amir; Härter, Arne; Denschlag, Johannes Hecker; Pérez-Ríos, Jesús; Greene, Chris H.

2016-05-01

We study three-body recombination of Ba++Rb +Rb in the mK regime where a single 138Ba+ ion in a Paul trap is immersed into a cloud of ultracold 87Rb atoms. We measure the energy dependence of the three-body rate coefficient k3 and compare the results to the theoretical prediction, k3∝Ecol-3 /4, where Ecol is the collision energy. We find agreement if we assume that the nonthermal ion energy distribution is determined by at least two different micromotion induced energy scales. Furthermore, using classical trajectory calculations we predict how the median binding energy of the formed molecules scales with the collision energy. Our studies give new insights into the kinetics of an ion immersed in an ultracold atom cloud and yield important prospects for atom-ion experiments targeting the s -wave regime.

Exploring the conformational changes of the ATP binding site of gyrase B from Escherichia coli complexed with different established inhibitors by using molecular dynamics simulation: protein-ligand interactions in the light of the alanine scanning and free energy decomposition methods.

PubMed

Saíz-Urra, Liane; Cabrera, Miguel Angel; Froeyen, Matheus

2011-02-01

Currently, bacterial diseases cause a death toll around 2 million people a year encouraging the search for new antimicrobial agents. DNA gyrase is a well-established antibacterial target consisting of two subunits, GyrA and GyrB, in a heterodimer A(2)B(2). GyrA is involved in DNA breakage and reunion and GyrB catalyzes the hydrolysis of ATP. The GyrB subunit from Escherichia coli has been investigated, namely the ATP binding pocket both considering the protein without ligands and bound with the inhibitors clorobiocin, novobiocin and 5'-adenylyl-β-γ-imidodiphosphate. The stability of the systems was studied by molecular dynamics simulation with the further analysis of the time dependent root-mean-square coordinate deviation (RMSD) from the initial structure, and temperature factors. Moreover, exploration of the conformational space of the systems during the MD simulation was carried out by a clustering data mining technique using the average-linkage algorithm. Recognizing the key residues in the binding site of the enzyme that are involved in the binding mode with the aforementioned inhibitors was investigated by using two techniques: free energy decomposition and computational alanine scanning. The results from these simulations highlight the important residues in the ATP binding site and can be useful in the design process of potential new inhibitors. Copyright © 2010 Elsevier Inc. All rights reserved.

Crystal Structure and Computational Characterization of the Lytic Polysaccharide Monooxygenase GH61D from the Basidiomycota Fungus Phanerochaete chrysosporium*

PubMed Central

Wu, Miao; Beckham, Gregg T.; Larsson, Anna M.; Ishida, Takuya; Kim, Seonah; Payne, Christina M.; Himmel, Michael E.; Crowley, Michael F.; Horn, Svein J.; Westereng, Bjørge; Igarashi, Kiyohiko; Samejima, Masahiro; Ståhlberg, Jerry; Eijsink, Vincent G. H.; Sandgren, Mats

2013-01-01

Carbohydrate structures are modified and degraded in the biosphere by a myriad of mostly hydrolytic enzymes. Recently, lytic polysaccharide mono-oxygenases (LPMOs) were discovered as a new class of enzymes for cleavage of recalcitrant polysaccharides that instead employ an oxidative mechanism. LPMOs employ copper as the catalytic metal and are dependent on oxygen and reducing agents for activity. LPMOs are found in many fungi and bacteria, but to date no basidiomycete LPMO has been structurally characterized. Here we present the three-dimensional crystal structure of the basidiomycete Phanerochaete chrysosporium GH61D LPMO, and, for the first time, measure the product distribution of LPMO action on a lignocellulosic substrate. The structure reveals a copper-bound active site common to LPMOs, a collection of aromatic and polar residues near the binding surface that may be responsible for regio-selectivity, and substantial differences in loop structures near the binding face compared with other LPMO structures. The activity assays indicate that this LPMO primarily produces aldonic acids. Last, molecular simulations reveal conformational changes, including the binding of several regions to the cellulose surface, leading to alignment of three tyrosine residues on the binding face of the enzyme with individual cellulose chains, similar to what has been observed for family 1 carbohydrate-binding modules. A calculated potential energy surface for surface translation indicates that P. chrysosporium GH61D exhibits energy wells whose spacing seems adapted to the spacing of cellobiose units along a cellulose chain. PMID:23525113

Uncoupling PIP2-calmodulin regulation of Kv7.2 channels by an assembly destabilizing epileptogenic mutation.

PubMed

Alberdi, Araitz; Gomis-Perez, Carolina; Bernardo-Seisdedos, Ganeko; Alaimo, Alessandro; Malo, Covadonga; Aldaregia, Juncal; Lopez-Robles, Carlos; Areso, Pilar; Butz, Elisabeth; Wahl-Schott, Christian; Villarroel, Alvaro

2015-11-01

We show that the combination of an intracellular bi-partite calmodulin (CaM)-binding site and a distant assembly region affect how an ion channel is regulated by a membrane lipid. Our data reveal that regulation by phosphatidylinositol(4,5)bisphosphate (PIP2) and stabilization of assembled Kv7.2 subunits by intracellular coiled-coil regions far from the membrane are coupled molecular processes. Live-cell fluorescence energy transfer measurements and direct binding studies indicate that remote coiled-coil formation creates conditions for different CaM interaction modes, each conferring different PIP2 dependency to Kv7.2 channels. Disruption of coiled-coil formation by epilepsy-causing mutation decreases apparent CaM-binding affinity and interrupts CaM influence on PIP2 sensitivity. © 2015. Published by The Company of Biologists Ltd.

Modulated photophysics of a cationic DNA-staining dye inside protein bovine serum albumin: Study of binding interaction and structural changes of protein

NASA Astrophysics Data System (ADS)

Samanta, Anuva; Jana, Sankar; Ray, Debarati; Guchhait, Nikhil

2014-03-01

The binding affinity of cationic DNA-staining dye, propidium iodide, with transport protein, bovine serum albumin, has been explored using UV-vis absorption, fluorescence, and circular dichroism spectroscopy. Steady state and time resolved fluorescence studies authenticate that fluorescence quenching of bovine serum albumin by propidium iodide is due to bovine serum albumin-propidium iodide complex formation. Thermodynamic parameters obtained from temperature dependent spectral studies cast light on binding interaction between the probe and protein. Site marker competitive binding has been encountered using phenylbutazone and flufenamic acid for site I and site II, respectively. Energy transfer efficiency and distance between bovine serum albumin and propidium iodide have been determined using Förster mechanism. Structural stabilization or destabilization of protein by propidium iodide has been investigated by urea denaturation study. The circular dichroism study as well as FT-IR measurement demonstrates some configurational changes of the protein in presence of the dye. Docking studies support the experimental data thereby reinforcing the binding site of the probe to the subdomain IIA of bovine serum albumin.

Correlating hydrogen oxidation and evolution activity on platinum at different pH with measured hydrogen binding energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, WC; Zhuang, ZB; Gao, MR

2015-01-08

The hydrogen oxidation/evolution reactions are two of the most fundamental reactions in distributed renewable electrochemical energy conversion and storage systems. The identification of the reaction descriptor is therefore of critical importance for the rational catalyst design and development. Here we report the correlation between hydrogen oxidation/evolution activity and experimentally measured hydrogen binding energy for polycrystalline platinum examined in several buffer solutions in a wide range of electrolyte pH from 0 to 13. The hydrogen oxidation/evolution activity obtained using the rotating disk electrode method is found to decrease with the pH, while the hydrogen binding energy, obtained from cyclic voltammograms, linearlymore » increases with the pH. Correlating the hydrogen oxidation/evolution activity to the hydrogen binding energy renders a monotonic decreasing hydrogen oxidation/evolution activity with the hydrogen binding energy, strongly supporting the hypothesis that hydrogen binding energy is the sole reaction descriptor for the hydrogen oxidation/evolution activity on monometallic platinum.« less

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

Modeling side-chains using molecular dynamics improve recognition of binding region in CAPRI targets.

PubMed

Camacho, Carlos J

2005-08-01

The CAPRI-II experiment added an extra level of complexity to the problem of predicting protein-protein interactions by including 5 targets for which participants had to build or complete the 3-dimensional (3D) structure of either the receptor or ligand based on the structure of a close homolog. In this article, we describe how modeling key side-chains using molecular dynamics (MD) in explicit solvent improved the recognition of the binding region of a free energy- based computational docking method. In particular, we show that MD is able to predict with relatively high accuracy the rotamer conformation of the anchor side-chains important for molecular recognition as suggested by Rajamani et al. (Proc Natl Acad Sci USA 2004;101:11287-11292). As expected, the conformations are some of the most common rotamers for the given residue, while latch side-chains that undergo induced fit upon binding are forced into less common conformations. Using these models as starting conformations in conjunction with the rigid-body docking server ClusPro and the flexible docking algorithm SmoothDock, we produced valuable predictions for 6 of the 9 targets in CAPRI-II, missing only the 3 targets that underwent significant structural rearrangements upon binding. We also show that our free energy- based scoring function, consisting of the sum of van der Waals, Coulombic electrostatic with a distance-dependent dielectric, and desolvation free energy successfully discriminates the nativelike conformation of our submitted predictions. The latter emphasizes the critical role that thermodynamics plays on our methodology, and validates the generality of the algorithm to predict protein interactions.

Prediction of protein-protein interaction sites using electrostatic desolvation profiles.

PubMed

Fiorucci, Sébastien; Zacharias, Martin

2010-05-19

Protein-protein complex formation involves removal of water from the interface region. Surface regions with a small free energy penalty for water removal or desolvation may correspond to preferred interaction sites. A method to calculate the electrostatic free energy of placing a neutral low-dielectric probe at various protein surface positions has been designed and applied to characterize putative interaction sites. Based on solutions of the finite-difference Poisson equation, this method also includes long-range electrostatic contributions and the protein solvent boundary shape in contrast to accessible-surface-area-based solvation energies. Calculations on a large set of proteins indicate that in many cases (>90%), the known binding site overlaps with one of the six regions of lowest electrostatic desolvation penalty (overlap with the lowest desolvation region for 48% of proteins). Since the onset of electrostatic desolvation occurs even before direct protein-protein contact formation, it may help guide proteins toward the binding region in the final stage of complex formation. It is interesting that the probe desolvation properties associated with residue types were found to depend to some degree on whether the residue was outside of or part of a binding site. The probe desolvation penalty was on average smaller if the residue was part of a binding site compared to other surface locations. Applications to several antigen-antibody complexes demonstrated that the approach might be useful not only to predict protein interaction sites in general but to map potential antigenic epitopes on protein surfaces. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Binding the Mammalian High Mobility Group Protein AT-hook 2 to AT-Rich Deoxyoligonucleotides: Enthalpy-Entropy Compensation

PubMed Central

Joynt, Suzanne; Morillo, Victor; Leng, Fenfei

2009-01-01

HMGA2 is a DNA minor-groove binding protein. We previously demonstrated that HMGA2 binds to AT-rich DNA with very high binding affinity where the binding of HMGA2 to poly(dA-dT)2 is enthalpy-driven and to poly(dA)poly(dT) is entropy-driven. This is a typical example of enthalpy-entropy compensation. To further study enthalpy-entropy compensation of HMGA2, we used isothermal-titration-calorimetry to examine the interactions of HMGA2 with two AT-rich DNA hairpins: 5′-CCAAAAAAAAAAAAAAAGCCCCCGCTTTTTTTTTTTTTTTGG-3′ (FL-AT-1) and 5′-CCATATATATATATATAGCCCCCGCTATATATATATATATGG-3′ (FL-AT-2). Surprisingly, we observed an atypical isothermal-titration-calorimetry-binding curve at low-salt aqueous solutions whereby the apparent binding-enthalpy decreased dramatically as the titration approached the end. This unusual behavior can be attributed to the DNA-annealing coupled to the ligand DNA-binding and is eliminated by increasing the salt concentration to ∼200 mM. At this condition, HMGA2 binding to FL-AT-1 is entropy-driven and to FL-AT-2 is enthalpy-driven. Interestingly, the DNA-binding free energies for HMGA2 binding to both hairpins are almost temperature independent; however, the enthalpy-entropy changes are dependent on temperature, which is another aspect of enthalpy-entropy compensation. The heat capacity change for HMGA2 binding to FL-AT-1 and FL-AT-2 are almost identical, indicating that the solvent displacement and charge-charge interaction in the coupled folding/binding processes for both binding reactions are similar. PMID:19450485

The structural and electronical factors that contribute affinity for the time-dependent inhibition of PGHS-1 by indomethacin, diclofenac and fenamates

NASA Astrophysics Data System (ADS)

Pouplana, R.; Pérez, C.; Sánchez, J.; Lozano, J. J.; Puig-Parellada, P.

1999-05-01

PGHS-1 and PGHS-2 are the targets of nonsteroidal anti- inflammatory drugs (NSAIDs). It appears that the high degree of selectivity for inhibition of PGHS-2 shown by certain compounds is the result of two mechanisms (time-dependent and time-independent inhibition), by which they interact with each isoform. The fenamic acids can be divided into competitive inhibitors of substrate binding and competitive inhibitors that cause time-dependent losses of cyclooxygenase activity. The cyclooxygenase activity was measured by oxygen consumption following preincubation of the enzyme and the inhibitor for increasing periods of time. The rate constants associated with binding inhibition kinetics and structure-activity relationships were calculated for a large number of fenamates, diclofenac and indomethacin. The KI* values are similar but the individual rate constants are markedly different: KI is two-fold lower, and k2 is six-fold slower for diclofenac than for indomethacin. All the active time-dependent compounds show MEPs with a negative conical surface, with their vertex on the minimum of the carboxyl group, which extends around the first aromatic ring to the central region. The conical surface keeps an open angle of 61° or larger, and a close contact surface with the residues Ala527, Ileu523, Val349, and Ser530, in the zones surrounding the bridging amino group and the chlorine atoms for meclofenamate and diclofenac, or in the region around the carbonyl group for indomethacin. The KI* and IC50 values indicate that the interactions that promote the slow binding kinetics must be examined in relation to the reaction energies of formation (ΔHr) of an ionic bond between the deprotonated carboxylic acid group of acid NSAIDs with the monocationic guanidinum group of Arg120, the free energies of solvation in aqueous solution, and the molecular volumes measured. Presumably indomethacin, diclofenac and meclofenamate cause the enzyme to undergo a subtle conformational change to a form that binds compounds even more tightly, with some slight structural changes confined to reorientations of the Arg277 and Gln358 side chains. These results show that the model has reliably chosen regions of biological significance consistent with both the X-ray crystallographic and kinetic results.

Binding Energy and Enzymatic Catalysis.

ERIC Educational Resources Information Center

Hansen, David E.; Raines, Ronald T.

1990-01-01

Discussed is the fundamental role that the favorable free energy of binding of the rate-determining transition state plays in catalysis. The principle that all of the catalytic factors discussed are realized by the use of this binding energy is reviewed. (CW)

Electronic state and photoionization cross section of a single dopant in GaN/InGaN core/shell quantum dot under magnetic field and hydrostatic pressure

NASA Astrophysics Data System (ADS)

Aouami, A. El; Feddi, E.; Talbi, A.; Dujardin, F.; Duque, C. A.

2018-06-01

In this study, we have investigated the simultaneous influence of magnetic field combined to the hydrostatic pressure and the geometrical confinement on the behavior of a single dopant confined in GaN/InGaN core/shell quantum dots. Within the scheme of the effective-mass approximation, the eigenvalues equation has solved by using the variational method with one-parameter trial wavefunctions. Variation of the ground state binding energy of the single dopant is determined according to the magnetic field and hydrostatic pressure for several dimensions of the heterostructure. The results show that the binding energy is strongly dependent on the core/shell sizes, the magnetic field, and the hydrostatic pressure. The analysis of the photoionization cross section, corresponding to optical transitions associated to the first donor energy level and the conduction band, shows clearly that the reduction of the dot dimensions and/or the simultaneous influences of applied magnetic field, combined to the hydrostatic pressure strength, cause a shift in resonance peaks towards the higher energies with important variations in the magnitude of the resonant peaks.

Determination of the absolute binding free energies of HIV-1 protease inhibitors using non-equilibrium molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ngo, Son Tung; Nguyen, Minh Tung; Nguyen, Minh Tho

2017-05-01

The absolute binding free energy of an inhibitor to HIV-1 Protease (PR) was determined throughout evaluation of the non-bonded interaction energy difference between the two bound and unbound states of the inhibitor and surrounding molecules by the fast pulling of ligand (FPL) process using non-equilibrium molecular dynamics (NEMD) simulations. The calculated free energy difference terms help clarifying the nature of the binding. Theoretical binding affinities are in good correlation with experimental data, with R = 0.89. The paradigm used is able to rank two inhibitors having the maximum difference of ∼1.5 kcal/mol in absolute binding free energies.

Implicit ligand theory for relative binding free energies

NASA Astrophysics Data System (ADS)

Nguyen, Trung Hai; Minh, David D. L.

2018-03-01

Implicit ligand theory enables noncovalent binding free energies to be calculated based on an exponential average of the binding potential of mean force (BPMF)—the binding free energy between a flexible ligand and rigid receptor—over a precomputed ensemble of receptor configurations. In the original formalism, receptor configurations were drawn from or reweighted to the apo ensemble. Here we show that BPMFs averaged over a holo ensemble yield binding free energies relative to the reference ligand that specifies the ensemble. When using receptor snapshots from an alchemical simulation with a single ligand, the new statistical estimator outperforms the original.

Quasiparticle energy bands and Fermi surfaces of monolayer NbSe2

NASA Astrophysics Data System (ADS)

Kim, Sejoong; Son, Young-Woo

2017-10-01

A quasiparticle band structure of a single layer 2 H -NbSe2 is reported by using first-principles G W calculation. We show that a self-energy correction increases the width of a partially occupied band and alters its Fermi surface shape when comparing those using conventional mean-field calculation methods. Owing to a broken inversion symmetry in the trigonal prismatic single layer structure, the spin-orbit interaction is included and its impact on the Fermi surface and quasiparticle energy bands are discussed. We also calculate the doping dependent static susceptibilities from the band structures obtained by the mean-field calculation as well as G W calculation with and without spin-orbit interactions. A complete tight-binding model is constructed within the three-band third nearest neighbor hoppings and is shown to reproduce our G W quasiparticle energy bands and Fermi surface very well. Considering variations of the Fermi surface shapes depending on self-energy corrections and spin-orbit interactions, we discuss the formations of charge density wave (CDW) with different dielectric environments and their implications on recent controversial experimental results on CDW transition temperatures.

Electrostatic forces govern the binding mechanism of intrinsically disordered histone chaperones

PubMed Central

Liu, Chuanbo; Wang, Tianshu; Bai, Yawen; Wang, Jin

2017-01-01

A unified picture to understand the protein recognition and function must include the native binding complex structure ensembles and the underlying binding mechanisms involved in specific biological processes. However, quantifications of both binding complex structures and dynamical mechanisms are still challenging for IDP. In this study, we have investigated the underlying molecular mechanism of the chaperone Chz1 and histone H2A.Z-H2B association by equilibrium and kinetic stopped-flow fluorescence spectroscopy. The dependence of free energy and kinetic rate constant on electrolyte mean activity coefficient and urea concentration are uncovered. Our results indicate a previous unseen binding kinetic intermediate. An initial conformation selection step of Chz1 is also revealed before the formation of this intermediate state. Based on these observations, a mixed mechanism of three steps including both conformation selection and induced fit is proposed. By combination of the ion- and denaturant-induced experiments, we demonstrate that electrostatic forces play a dominant role in the recognition of bipolar charged intrinsically disordered protein Chz1 to its preferred partner H2A.Z-H2B. Both the intra-chain and inter-chain electrostatic interactions have direct impacts on the native collapsed structure and binding mechanism. PMID:28552960

Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

NASA Astrophysics Data System (ADS)

David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

2010-09-01

Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

The cytotoxic effect of spiroflavanone derivatives, their binding ability to human serum albumin (HSA) and a DFT study on the mechanism of their synthesis

NASA Astrophysics Data System (ADS)

Budzisz, Elzbieta; Paneth, Piotr; Geromino, Inacrist; Muzioł, Tadeusz; Rozalski, Marek; Krajewska, Urszula; Pipiak, Paulina; Ponczek, Michał B.; Małecka, Magdalena; Kupcewicz, Bogumiła

2017-06-01

This paper examines the cytotoxic effect of nine compounds with spiropyrazoline structures, and determines the reaction mechanism between diazomethane and selected benzylideneflavanones, their lipophilicity, and their binding ability to human serum albumin. The cytotoxic effect was determined on two human leukaemia cell lines (HL-60 and NALM-6) and melanoma WM-115 cells, as well as on normal human umbilical vein endothelial cells (HUVEC). The highest cytotoxicity was exhibited by compound B7: it was found to have an IC50 of less than 10 μM for all three cancer cell lines, with five to 12-fold lower sensitivity against normal cells (HUVEC). All the compounds exhibit comparable affinity energy in human serum albumin binding (from -8.1 to -8.6 kcal mol-1) but vary in their binding sites depending on the substituent. X-ray crystallography of two derivatives confirmed their synthetic pathway, and their structures were carefully examined.

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Rational Design of a Transferrin-Binding Peptide Sequence Tailored to Targeted Nanoparticle Internalization.

PubMed

Santi, Melissa; Maccari, Giuseppe; Mereghetti, Paolo; Voliani, Valerio; Rocchiccioli, Silvia; Ucciferri, Nadia; Luin, Stefano; Signore, Giovanni

2017-02-15

The transferrin receptor (TfR) is a promising target in cancer therapy owing to its overexpression in most solid tumors and on the blood-brain barrier. Nanostructures chemically derivatized with transferrin are employed in TfR targeting but often lose their functionality upon injection in the bloodstream. As an alternative strategy, we rationally designed a peptide coating able to bind transferrin on suitable pockets not involved in binding to TfR or iron by using an iterative multiscale-modeling approach coupled with quantitative structure-activity and relationship (QSAR) analysis and evolutionary algorithms. We tested that selected sequences have low aspecific protein adsorption and high binding energy toward transferrin, and one of them is efficiently internalized in cells with a transferrin-dependent pathway. Furthermore, it promotes transferrin-mediated endocytosis of gold nanoparticles by modifying their protein corona and promoting oriented adsorption of transferrin. This strategy leads to highly effective nanostructures, potentially useful in diagnostic and therapeutic applications, which exploit (and do not suffer) the protein solvation for achieving a better targeting.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Effects of excitation frequency on high-order terahertz sideband generation in semiconductors

NASA Astrophysics Data System (ADS)

Xie, Xiao-Tao; Zhu, Bang-Fen; Liu, Ren-Bao

2013-10-01

We theoretically investigate the effects of the excitation frequency on the plateau of high-order terahertz sideband generation (HSG) in semiconductors driven by intense terahertz (THz) fields. We find that the plateau of the sideband spectrum strongly depends on the detuning between the near-infrared laser field and the band gap. We use the quantum trajectory theory (three-step model) to understand the HSG. In the three-step model, an electron-hole pair is first excited by a weak laser, then driven by the strong THz field, and finally recombined to emit a photon with energy gain. When the laser is tuned below the band gap (negative detuning), the electron-hole generation is a virtual process that requires quantum tunneling to occur. When the energy gained by the electron-hole pair from the THz field is less than 3.17 times the ponderomotive energy (Up), the electron and the hole can be driven to the same position and recombined without quantum tunneling, so that the HSG will have large probability amplitude. This leads to a plateau feature of the HSG spectrum with a high-frequency cutoff at about 3.17Up above the band gap. Such a plateau feature is similar to the case of high-order harmonics generation in atoms where electrons have to overcome the binding energy to escape the atomic core. A particularly interesting excitation condition in HSG is that the laser can be tuned above the band gap (positive detuning), corresponding to the unphysical ‘negative’ binding energy in atoms for high-order harmonic generation. Now the electron-hole pair is generated by real excitation, but the recombination process can be real or virtual depending on the energy gained from the THz field, which determines the plateau feature in HSG. Both the numerical calculation and the quantum trajectory analysis reveal that for positive detuning, the HSG plateau cutoff depends on the frequency of the excitation laser. In particular, when the laser is tuned more than 3.17Up above the band gap, the HSG spectrum presents no plateau feature but instead sharp peaks near the band edge and near the excitation frequency.

Orbital-dependent Electron-Hole Interaction in Graphene and Associated Multi-Layer Structures

PubMed Central

Deng, Tianqi; Su, Haibin

2015-01-01

We develop an orbital-dependent potential to describe electron-hole interaction in materials with structural 2D character, i.e. quasi-2D materials. The modulated orbital-dependent potentials are also constructed with non-local screening, multi-layer screening, and finite gap due to the coupling with substrates. We apply the excitonic Hamiltonian in coordinate-space with developed effective electron-hole interacting potentials to compute excitons’ binding strength at M (π band) and Γ (σ band) points in graphene and its associated multi-layer forms. The orbital-dependent potential provides a range-separated property for regulating both long- and short-range interactions. This accounts for the existence of the resonant π exciton in single- and bi-layer graphenes. The remarkable strong electron-hole interaction in σ orbitals plays a decisive role in the existence of σ exciton in graphene stack at room temperature. The interplay between gap-opening and screening from substrates shed a light on the weak dependence of σ exciton binding energy on the thickness of graphene stacks. Moreover, the analysis of non-hydrogenic exciton spectrum in quasi-2D systems clearly demonstrates the remarkable comparable contribution of orbital dependent potential with respect to non-local screening process. The understanding of orbital-dependent potential developed in this work is potentially applicable for a wide range of materials with low dimension. PMID:26610715

Effects of medium on nuclear properties in multifragmentation

NASA Astrophysics Data System (ADS)

De, J. N.; Samaddar, S. K.; Viñas, X.; Centelles, M.; Mishustin, I. N.; Greiner, W.

2012-08-01

In multifragmentation of hot nuclear matter, properties of fragments embedded in a soup of nucleonic gas and other fragments should be modified as compared with isolated nuclei. Such modifications are studied within a simple model where only nucleons and one kind of heavy nuclei are considered. The interaction between different species is described with a momentum-dependent two-body potential whose parameters are fitted to reproduce properties of cold isolated nuclei. The internal energy of heavy fragments is parametrized according to a liquid-drop model with density- and temperature-dependent parameters. Calculations are carried out for several subnuclear densities and moderate temperatures, for isospin-symmetric and asymmetric systems. We find that the fragments get stretched due to interactions with the medium and their binding energies decrease with increasing temperature and density of nuclear matter.

Comparison of gas-solid chromatography and MM2 force field molecular binding energies for greenhouse gases on a carbonaceous surface.

PubMed

Rybolt, Thomas R; Bivona, Kevin T; Thomas, Howard E; O'Dell, Casey M

2009-10-01

Gas-solid chromatography was used to determine B(2s) (gas-solid virial coefficient) values for eight molecular adsorbates interacting with a carbon powder (Carbopack B, Supelco). B(2s) values were determined by multiple size variant injections within the temperature range of 313-553 K. The molecular adsorbates included: carbon dioxide (CO(2)); tetrafluoromethane (CF(4)); hexafluoroethane (C(2)F(6)); 1,1-difluoroethane (C(2)H(4)F(2)); 1-chloro-1,1-difluoroethane (C(2)H(3)ClF(2)); dichlorodifluoromethane (CCl(2)F(2)); trichlorofluoromethane (CCl(3)F); and 1,1,1-trichloroethane (C(2)H(3)Cl(3)). Two of these molecules are of special interest because they are "super greenhouse gases". The global warming potential, GWP, for CF(4) is 6500 and for C(2)F(6) is 9200 relative to the reference value of 1 for CO(2). The GWP index considers both radiative blocking and molecular lifetime. For these and other industrial greenhouse gases, adsorptive trapping on a carbonaceous solid, which depends on molecule-surface binding energy, could avoid atmospheric release. The temperature variations of the gas-solid virial coefficients in conjunction with van't Hoff plots were used to find the experimental adsorption energy or binding energy values (E(*)) for each adsorbate. A molecular mechanics based, rough-surface model was used to calculate the molecule-surface binding energy (Ecal(*)) using augmented MM2 parameters. The surface model consisted of parallel graphene layers with two separated nanostructures each containing 17 benzene rings arranged in linear strips. The separation of the parallel nanostructures had been optimized in a prior study to appropriately represent molecule-surface interactions for Carbopack B. Linear regressions of E(*) versus Ecal(*) for the current data set of eight molecules and the same surface model gave E(*)=0.926 Ecal(*) and r(2)=0.956. A combined set of the current and prior Carbopack B adsorbates studied (linear alkanes, branched alkanes, cyclic alkanes, ethers, and halogenated hydrocarbons) gave a data set with 33 molecules and a regression of E(*)=0.991 Ecal(*) and r(2)=0.968. These results indicated a good correlation between the experimental and the MM2 computed molecule-surface binding energies.

An investigation on the effect of impurity position on the binding energy of quantum box under electric field with pressure and temperature

NASA Astrophysics Data System (ADS)

Yilmaz, S.; Kirak, M.

2018-05-01

In the present study, we have studied theoretically the influences of donor impurity position on the binding energy of a GaAs cubic quantum box structure. The binding energy is calculated as functions of the position of impurity, electric field, temperature and hydrostatic pressure. The variational method is employed to obtain the energy eigenvalues of the structure in the framework of the effective mass approximation. It has been found that the impurity positions with electric field, pressure and temperature have an important effect on the binding energy of structure considered. The results can be used to manufacture semiconductor device application by manipulating the binding energy with the impurity positions, electric field, pressure and temperature.

Anomalous center of mass shift: gravitational dipole moment.

NASA Astrophysics Data System (ADS)

Jeong, Eue Jin

1997-02-01

The anomalous, energy dependent shift of the center of mass of an idealized, perfectly rigid, uniformly rotating hemispherical shell which is caused by the relativistic mass increase effect is investigated in detail. It is shown that a classical object on impact which has the harmonic binding force between the adjacent constituent particles has the similar effect of the energy dependent, anomalous shift of the center of mass. From these observations, the general mode of the linear acceleration is suggested to be caused by the anomalous center of mass shift whether it's due to classical or relativistic origin. The effect of the energy dependent center of mass shift perpendicular to the plane of rotation of a rotating hemisphere appears as the non zero gravitational dipole moment in general relativity. Controlled experiment for the measurement of the gravitational dipole field and its possible links to the cylindrical type line formation of a worm hole in the extreme case are suggested. The jets from the black hole accretion disc and the observed anomalous red shift from far away galaxies are considered to be the consequences of the two different aspects of the dipole gravity.

Characterization of binding of N'-nitrosonornicotine to protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, M.F.

1986-01-01

The NADPH-dependent activation of the carcinogenic nitrosamine, N'-nitrosonornicotine (NNN) to a reactive intermediate which binds covalently to protein was assessed using male Sprague-Dawley rat liver and lung microsomes. The NADPH-dependent covalent binding of (/sup 14/C)NNN to liver and lung microsomes was linear with time up to 90 and 45 min, respectively and was also linear with protein concentrations up to 3.0 and 2.0 mg/ml, respectively. The apparent K/sub m/ and V/sub max/ of the NADPH-dependent binding to liver microsomes were determined from the initial velocities. Addition of the thiols glutathione, cystein, N-acetylcysteine or 2-mercapthoethanol significantly decreased the non-NADPH-dependent binding tomore » liver microsomal protein, but did not affect the NADPH-dependent binding. Glutathione was required in order to observe any NADPH-dependent binding to lung microsomal protein. In lung microsomes, SKF-525A significantly decreased the NADPH-dependent binding by 79%. Replacement of an air atmosphere with N/sub 2/ or CO:O/sub 2/ (8:2) significantly decreased the NADPH-dependent binding of (/sup 14/C)NNN to liver microsomal protein by 40% or 27% respectively. Extensive covalent binding of (/sup 14/C)NNN to liver and muscle microsomal protein occurred in the absence of an NADPH-generating system, in the presence of 50% methanol and also to bovine serum albumin, indicating a nonenzymatic reaction. These data indicate that cytochrome P-450 is at least in part responsible for the metabolic activation of the carcinogen NNN, but also suggest additional mechanisms of activation.« less

E1 and M1 γ-strength functions in 144Nd

DOE PAGES

Voinov, A. V.; Grimes, S. M.

2015-12-14

Both E1 and M1 γ-strength functions below the neutron separation energy were analyzed based on experimental data from 143Nd(n,γ) 144Nd and 143Nd(n,γα) 140Ce reactions. It is confirmed that the commonly adopted E1 model based on the temperature dependence of the width of the giant dipole resonance works well. The popular M1 strength function due to the spin-flip magnetic resonance located near the neutron binding energy is not capable of reproducing experimental data. As a result, the low-energy enhancement of the M1 strength or the energy-independent model of Weisskopf, both leading to the low-energy strength sizable to E1 one, fit experimentalmore » data best.« less

Quantum-well states in thin Ag films grown on the Ga/Si(111)-√{3 }×√{3 } surface

NASA Astrophysics Data System (ADS)

Starfelt, S.; Zhang, H. M.; Johansson, L. S. O.

2018-05-01

Silver thin films have been created by room temperature deposition on a Ga/Si(111)-√{3 }×√{3 } surface and their valence band structures and core levels have been measured by angle-resolved photoelectron spectroscopy (ARPES). Discrete quantum-well states (QWSs) quantized from the Ag s p valence band are observed already at 3 monolayers (ML). The characteristics of the QWSs have been examined in the phase accumulation model for thicknesses between 3 and 12 ML. The phase shift and QWSs binding energies dependence with Ag film thicknesses have all been consistently derived. In-plane energy dispersion follows a parabolic curve, and the effective mass of the QWSs shows an increasing trend with binding energies as well as with reduced film thicknesses. Furthermore, the ARPES measurements reveal umklapp mediated QWSs around the M ¯ points of the Si(111) 1 ×1 surface Brillouin zone. The study confirms that the Ga/Si(111)-√{3 }×√{3 } surface is a good substrate for growing uniform ultrathin Ag films in room temperature conditions.

Extracting ligands from receptors by reversed targeted molecular dynamics.

PubMed

Wolf, Romain M

2015-11-01

Short targeted MD trajectories are used to expel ligands from binding sites. The expulsion is governed by a linear increase of the target RMSD value, growing from zero to an arbitrary chosen final RMSD that forces the ligand to a selected distance outside of the receptor. The RMSD lag (i.e., the difference between the imposed and the actual RMSD) can be used to follow barriers encountered by the ligand during its way out of the receptor. The force constant used for the targeted MD can transform the RMSD lag into a strain energy. Integration of the (time-dependent) strain energy over time yields a value with the dimensions of "action" (i.e, energy multiplied by time) and can serve as a measure for the overall effort required to extract the ligand from its binding site. Possibilities to compare (numerically and graphically) the randomly detected exit pathways are discussed. As an example, the method is tested on the exit of bisphenol A from the human estrogen-related receptor [Formula: see text] and of GW0072 from the peroxysome proliferator activated receptor.

Enhanced conformational sampling to visualize a free-energy landscape of protein complex formation

PubMed Central

Iida, Shinji; Nakamura, Haruki; Higo, Junichi

2016-01-01

We introduce various, recently developed, generalized ensemble methods, which are useful to sample various molecular configurations emerging in the process of protein–protein or protein–ligand binding. The methods introduced here are those that have been or will be applied to biomolecular binding, where the biomolecules are treated as flexible molecules expressed by an all-atom model in an explicit solvent. Sampling produces an ensemble of conformations (snapshots) that are thermodynamically probable at room temperature. Then, projection of those conformations to an abstract low-dimensional space generates a free-energy landscape. As an example, we show a landscape of homo-dimer formation of an endothelin-1-like molecule computed using a generalized ensemble method. The lowest free-energy cluster at room temperature coincided precisely with the experimentally determined complex structure. Two minor clusters were also found in the landscape, which were largely different from the native complex form. Although those clusters were isolated at room temperature, with rising temperature a pathway emerged linking the lowest and second-lowest free-energy clusters, and a further temperature increment connected all the clusters. This exemplifies that the generalized ensemble method is a powerful tool for computing the free-energy landscape, by which one can discuss the thermodynamic stability of clusters and the temperature dependence of the cluster networks. PMID:27288028

Pairwise additivity of energy components in protein-ligand binding: The HIV II protease-Indinavir case

NASA Astrophysics Data System (ADS)

Ucisik, Melek N.; Dashti, Danial S.; Faver, John C.; Merz, Kenneth M.

2011-08-01

An energy expansion (binding energy decomposition into n-body interaction terms for n ≥ 2) to express the receptor-ligand binding energy for the fragmented HIV II protease-Indinavir system is described to address the role of cooperativity in ligand binding. The outcome of this energy expansion is compared to the total receptor-ligand binding energy at the Hartree-Fock, density functional theory, and semiempirical levels of theory. We find that the sum of the pairwise interaction energies approximates the total binding energy to ˜82% for HF and to >95% for both the M06-L density functional and PM6-DH2 semiempirical method. The contribution of the three-body interactions amounts to 18.7%, 3.8%, and 1.4% for HF, M06-L, and PM6-DH2, respectively. We find that the expansion can be safely truncated after n = 3. That is, the contribution of the interactions involving more than three parties to the total binding energy of Indinavir to the HIV II protease receptor is negligible. Overall, we find that the two-body terms represent a good approximation to the total binding energy of the system, which points to pairwise additivity in the present case. This basic principle of pairwise additivity is utilized in fragment-based drug design approaches and our results support its continued use. The present results can also aid in the validation of non-bonded terms contained within common force fields and in the correction of systematic errors in physics-based score functions.

Characterization of covalent binding of N'-nitrosonornicotine in rat liver microsomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, M.F.; Brock, W.J.; Marion, L.J.

1986-01-01

The metabolism of the carcinogenic nitrosamine, N'-nitrosonornicotine (NNN), to reactive intermediates which bind covalently was assessed using male Sprague-Dawley rat liver microsomes. The NADPH-dependent covalent binding of (/sup 14/C)NNN was linear with time up to 90 min and protein concentration up to 3.0 mg/ml. The apparent Km and Vmax of the binding were determined from the initial velocities and found to be 0.91 mM and 4.7 pmol/min/mg protein, respectively. Although NNN is not a hepatocarcinogen, this amount of NADPH-dependent covalent binding is 7-fold greater than that reported for dimethylnitrosamine, a potent hepatocarcinogen. Extensive covalent binding of (/sup 14/C)NNN to livermore » and muscle microsomal protein was also present in the absence of an NADPH-generating system and in the presence of 50% methanol, indicating a non-enzymatically mediated reaction. Addition of the nucleophiles glutathione, cysteine and N-acetylcysteine significantly decreased (p less than 0.01) the non-NADPH-dependent binding, but did not affect NADPH-dependent binding. In vitro addition of the cytochrome P-450 inhibitors metyrapone, piperonyl butoxide and SKF-525A significantly decreased (p less than 0.05) NADPH-dependent binding of (14C)NNN by 27-40%. NADH did not replace NADPH in supporting covalent binding. Replacement of an air atmosphere with nitrogen or CO:O2 (8:2) significantly decreased (p less than 0.05) NADPH-dependent binding of (/sup 14/C)NNN by 40 and 27%, respectively. Aroclor 1254 pre-treatment of the rats did not enhance the NADPH-dependent binding of (/sup 14/C)NNN. These data indicate that cytochrome P-450 is at least in part responsible for the metabolic activation of the carcinogen NNN but also suggest additional mechanisms of activation.« less

Visualizing the kinetic power stroke that drives proton-coupled Zn(II) transport

PubMed Central

Gupta, Sayan; Chai, Jin; Cheng, Jie; D'Mello, Rhijuta; Chance, Mark R.; Fu, Dax

2014-01-01

The proton gradient is a principal energy source for respiration-dependent active transport, but the structural mechanisms of proton-coupled transport processes are poorly understood. YiiP is a proton-coupled zinc transporter found in the cytoplasmic membrane of E. coli, and the transport-site of YiiP receives protons from water molecules that gain access to its hydrophobic environment and transduces the energy of an inward proton gradient to drive Zn(II) efflux1,2. This membrane protein is a well characterized member3-7 of the protein family of cation diffusion facilitators (CDFs) that occurs at all phylogenetic levels8-10. X-ray mediated hydroxyl radical labeling of YiiP and mass spectrometric analysis showed that Zn(II) binding triggered a highly localized, all-or-none change of water accessibility to the transport-site and an adjacent hydrophobic gate. Millisecond time-resolved dynamics revealed a concerted and reciprocal pattern of accessibility changes along a transmembrane helix, suggesting a rigid-body helical reorientation linked to Zn(II) binding that triggers the closing of the hydrophobic gate. The gated water access to the transport-site enables a stationary proton gradient to facilitate the conversion of zinc binding energy to the kinetic power stroke of a vectorial zinc transport. The kinetic details provide energetic insights into a proton-coupled active transport reaction. PMID:25043033

H2 Ortho-to-para Conversion on Grains: A Route to Fast Deuterium Fractionation in Dense Cloud Cores?

NASA Astrophysics Data System (ADS)

Bovino, S.; Grassi, T.; Schleicher, D. R. G.; Caselli, P.

2017-11-01

Deuterium fractionation, I.e., the enhancement of deuterated species with respect to non-deuterated ones, is considered to be a reliable chemical clock of star-forming regions. This process is strongly affected by the ortho-to-para H2 ratio. In this Letter we explore the effect of the ortho-para (o-p) H2 conversion on grains on the deuteration timescale in fully-depleted dense cores, including the most relevant uncertainties that affect this complex process. We show that (I) the o-p H2 conversion on grains is not strongly influenced by the uncertainties on the conversion time and the sticking coefficient, and (II) that the process is controlled by the temperature and the residence time of ortho-H2 on the surface, I.e., by the binding energy. We find that for binding energies between 330 and 550 K, depending on the temperature, the o-p H2 conversion on grains can shorten the deuterium fractionation timescale by orders of magnitude, opening a new route for explaining the large observed deuteration fraction D frac in dense molecular cloud cores. Our results suggest that the star formation timescale, when estimated through the timescale to reach the observed deuteration fractions, might be shorter than previously proposed. However, more accurate measurements of the binding energy are needed in order to better assess the overall role of this process.

Calculation of Host-Guest Binding Affinities Using a Quantum-Mechanical Energy Model.

PubMed

Muddana, Hari S; Gilson, Michael K

2012-06-12

The prediction of protein-ligand binding affinities is of central interest in computer-aided drug discovery, but it is still difficult to achieve a high degree of accuracy. Recent studies suggesting that available force fields may be a key source of error motivate the present study, which reports the first mining minima (M2) binding affinity calculations based on a quantum mechanical energy model, rather than an empirical force field. We apply a semi-empirical quantum-mechanical energy function, PM6-DH+, coupled with the COSMO solvation model, to 29 host-guest systems with a wide range of measured binding affinities. After correction for a systematic error, which appears to derive from the treatment of polar solvation, the computed absolute binding affinities agree well with experimental measurements, with a mean error 1.6 kcal/mol and a correlation coefficient of 0.91. These calculations also delineate the contributions of various energy components, including solute energy, configurational entropy, and solvation free energy, to the binding free energies of these host-guest complexes. Comparison with our previous calculations, which used empirical force fields, point to significant differences in both the energetic and entropic components of the binding free energy. The present study demonstrates successful combination of a quantum mechanical Hamiltonian with the M2 affinity method.

Multispectroscopic and calorimetric studies on the binding of the food colorant tartrazine with human hemoglobin.

PubMed

Basu, Anirban; Suresh Kumar, Gopinatha

2016-11-15

Interaction of the food colorant tartrazine with human hemoglobin was studied using multispectroscopic and microcalorimetric techniques to gain insights into the binding mechanism and thereby the toxicity aspects. Hemoglobin spectrum showed hypochromic changes in the presence of tartrazine. Quenching of the fluorescence of hemoglobin occurred and the quenching mechanism was through a static mode as revealed from temperature dependent and time-resolved fluorescence studies. According to the FRET theory the distance between β-Trp37 of hemoglobin and bound tartrazine was evaluated to be 3.44nm. Synchronous fluorescence studies showed that tartrazine binding led to alteration of the microenvironment around the tryptophans more in comparison to tyrosines. 3D fluorescence and FTIR data provided evidence for conformational changes in the protein on binding. Circular dichroism studies revealed that the binding led to significant loss in the helicity of hemoglobin. The esterase activity assay further complemented the circular dichroism data. Microcalorimetric study using isothermal titration calorimetry revealed the binding to be exothermic and driven largely by positive entropic contribution. Dissection of the Gibbs energy change proposed the protein-dye complexation to be dominated by non-polyelectrolytic forces. Negative heat capacity change also corroborated the involvement of hydrophobic forces in the binding process. Copyright © 2016 Elsevier B.V. All rights reserved.

Estimation of the Binding Free Energy of AC1NX476 to HIV-1 Protease Wild Type and Mutations Using Free Energy Perturbation Method.

PubMed

Ngo, Son Tung; Mai, Binh Khanh; Hiep, Dinh Minh; Li, Mai Suan

2015-10-01

The binding mechanism of AC1NX476 to HIV-1 protease wild type and mutations was studied by the docking and molecular dynamics simulations. The binding free energy was calculated using the double-annihilation binding free energy method. It is shown that the binding affinity of AC1NX476 to wild type is higher than not only ritonavir but also darunavir, making AC1NX476 become attractive candidate for HIV treatment. Our theoretical results are in excellent agreement with the experimental data as the correlation coefficient between calculated and experimentally measured binding free energies R = 0.993. Residues Asp25-A, Asp29-A, Asp30-A, Ile47-A, Gly48-A, and Val50-A from chain A, and Asp25-B from chain B play a crucial role in the ligand binding. The mutations were found to reduce the receptor-ligand interaction by widening the binding cavity, and the binding propensity is mainly driven by the van der Waals interaction. Our finding may be useful for designing potential drugs to combat with HIV. © 2015 John Wiley & Sons A/S.

Studying the Salt Dependence of the Binding of σ70 and σ32 to Core RNA Polymerase Using Luminescence Resonance Energy Transfer

PubMed Central

Glaser, Bryan T.; Bergendahl, Veit; Anthony, Larry C.; Olson, Brian; Burgess, Richard R.

2009-01-01

The study of protein-protein interactions is becoming increasingly important for understanding the regulation of many cellular processes. The ability to quantify the strength with which two binding partners interact is desirable but the accurate determination of equilibrium binding constants is a difficult process. The use of Luminescence Resonance Energy Transfer (LRET) provides a homogeneous binding assay that can be used for the detection of protein-protein interactions. Previously, we developed an LRET assay to screen for small molecule inhibitors of the interaction of σ70 with theβ' coiled-coil fragment (amino acids 100–309). Here we describe an LRET binding assay used to monitor the interaction of E. coli σ70 and σ32 with core RNA polymerase along with the controls to verify the system. This approach generates fluorescently labeled proteins through the random labeling of lysine residues which enables the use of the LRET assay for proteins for which the creation of single cysteine mutants is not feasible. With the LRET binding assay, we are able to show that the interaction of σ70 with core RNAP is much more sensitive to NaCl than to potassium glutamate (KGlu), whereas the σ32 interaction with core RNAP is insensitive to both salts even at concentrations >500 mM. We also find that the interaction of σ32 with core RNAP is stronger than σ70 with core RNAP, under all conditions tested. This work establishes a consistent set of conditions for the comparison of the binding affinities of the E.coli sigma factors with core RNA polymerase. The examination of the importance of salt conditions in the binding of these proteins could have implications in both in vitro assay conditions and in vivo function. PMID:19649256

Large scale affinity calculations of cyclodextrin host-guest complexes: Understanding the role of reorganization in the molecular recognition process

PubMed Central

Wickstrom, Lauren; He, Peng; Gallicchio, Emilio; Levy, Ronald M.

2013-01-01

Host-guest inclusion complexes are useful models for understanding the structural and energetic aspects of molecular recognition. Due to their small size relative to much larger protein-ligand complexes, converged results can be obtained rapidly for these systems thus offering the opportunity to more reliably study fundamental aspects of the thermodynamics of binding. In this work, we have performed a large scale binding affinity survey of 57 β-cyclodextrin (CD) host guest systems using the binding energy distribution analysis method (BEDAM) with implicit solvation (OPLS-AA/AGBNP2). Converged estimates of the standard binding free energies are obtained for these systems by employing techniques such as parallel Hamitionian replica exchange molecular dynamics, conformational reservoirs and multistate free energy estimators. Good agreement with experimental measurements is obtained in terms of both numerical accuracy and affinity rankings. Overall, average effective binding energies reproduce affinity rank ordering better than the calculated binding affinities, even though calculated binding free energies, which account for effects such as conformational strain and entropy loss upon binding, provide lower root mean square errors when compared to measurements. Interestingly, we find that binding free energies are superior rank order predictors for a large subset containing the most flexible guests. The results indicate that, while challenging, accurate modeling of reorganization effects can lead to ligand design models of superior predictive power for rank ordering relative to models based only on ligand-receptor interaction energies. PMID:25147485

Free energy decomposition of protein-protein interactions.

PubMed

Noskov, S Y; Lim, C

2001-08-01

A free energy decomposition scheme has been developed and tested on antibody-antigen and protease-inhibitor binding for which accurate experimental structures were available for both free and bound proteins. Using the x-ray coordinates of the free and bound proteins, the absolute binding free energy was computed assuming additivity of three well-defined, physical processes: desolvation of the x-ray structures, isomerization of the x-ray conformation to a nearby local minimum in the gas-phase, and subsequent noncovalent complex formation in the gas phase. This free energy scheme, together with the Generalized Born model for computing the electrostatic solvation free energy, yielded binding free energies in remarkable agreement with experimental data. Two assumptions commonly used in theoretical treatments; viz., the rigid-binding approximation (which assumes no conformational change upon complexation) and the neglect of vdW interactions, were found to yield large errors in the binding free energy. Protein-protein vdW and electrostatic interactions between complementary surfaces over a relatively large area (1400--1700 A(2)) were found to drive antibody-antigen and protease-inhibitor binding.

Extended Fenske-Hall LCAO MO calculations of core-level shifts in solid P compounds

NASA Astrophysics Data System (ADS)

Franke, R.; Chassé, T.; Reinhold, J.; Streubel, P.; Szargan, R.

1997-08-01

Extended Fenske-Hall LCAO-MO ΔSCF calculations on solids modelled as H-pseudoatom saturated clusters are reported. The computational results verify the experimentally obtained initial-state (effective atomic charges, Madelung potential) and relaxation-energy contributions to the XPS phosphorus core-level binding energy shifts measured in Na 3PO 3S, Na 3PO 4, Na 2PO 3F and NH 4PF 6 in reference to red phosphorus. It is shown that the different initial-state contributions observed in the studied phosphates are determined by local and nonlocal terms while the relaxation-energy contributions are mainly dependent on the nature of the nearest neighbors of the phosphorus atom.

Theory of nanotube faraday cage

NASA Astrophysics Data System (ADS)

Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

2003-03-01

Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shevchenko, N. V.; Mares, J.; Gal, A.

Coupled-channels three-body calculations of an I=1/2,J{sup {pi}}=0{sup -} KNN quasibound state in the KNN-{pi}{sigma}N system were performed and the dependence of the resulting three-body energy on the two-body KN-{pi}{sigma} interaction was investigated. Earlier results of binding energy B{sub K{sup -}}{sub pp}{approx}50-70 MeV and width {gamma}{sub K{sup -}}{sub pp}{approx}100 MeV are confirmed [N. V. Shevchenko et al., Phys. Rev. Lett. 98, 082301 (2007)]. It is shown that a suitably constructed energy-independent complex KN potential gives a considerably shallower and narrower three-body quasibound state than the full coupled-channels calculation. Comparison with other calculations is made.

Kinetics of phloretin binding to phosphatidylcholine vesicle membranes

PubMed Central

1980-01-01

The submillisecond kinetics for phloretin binding to unilamellar phosphatidylcholine (PC) vesicles was investigated using the temperature-jump technique. Spectrophotometric studies of the equilibrium binding performed at 328 nm demonstrated that phloretin binds to a single set of independent, equivalent sites on the vesicle with a dissociation constant of 8.0 microM and a lipid/site ratio of 4.0. The temperature of the phloretin-vesicle solution was jumped by 4 degrees C within 4 microseconds producing a monoexponential, concentration-dependent relaxation process with time constants in the 30--200-microseconds time range. An analysis of the concentration dependence of relaxation time constants at pH 7.30 and 24 degrees C yielded a binding rate constant of 2.7 X 10(8) M-1 s-1 and an unbinding constant of 2,900 s-1; approximately 66 percent of total binding sites are exposed at the outer vesicle surface. The value of the binding rate constant and three additional observations suggest that the binding kinetics are diffusion limited. The phloretin analogue, naringenin, which has a diffusion coefficient similar to phloretin yet a dissociation constant equal to 24 microM, bound to PC vesicle with the same rate constant as phloretin did. In addition, the phloretin-PC system was studied in buffers made one to six times more viscous than water by addition of sucrose or glycerol to the differ. The equilibrium affinity for phloretin binding to PC vesicles is independent of viscosity, yet the binding rate constant decreases with the expected dependence (kappa binding alpha 1/viscosity) for diffusion-limited processes. Thus, the binding rate constant is not altered by differences in binding affinity, yet depends upon the diffusion coefficient in buffer. Finally, studies of the pH dependence of the binding rate constant showed a dependence (kappa binding alpha [1 + 10pH-pK]) consistent with the diffusion-limited binding of a weak acid. PMID:7391812

Decrypting the structural, dynamic, and energetic basis of a monomeric kinesin interacting with a tubulin dimer in three ATPase states by all-atom molecular dynamics simulation.

PubMed

Chakraborty, Srirupa; Zheng, Wenjun

2015-01-27

We have employed molecular dynamics (MD) simulation to investigate, with atomic details, the structural dynamics and energetics of three major ATPase states (ADP, APO, and ATP state) of a human kinesin-1 monomer in complex with a tubulin dimer. Starting from a recently solved crystal structure of ATP-like kinesin-tubulin complex by the Knossow lab, we have used flexible fitting of cryo-electron-microscopy maps to construct new structural models of the kinesin-tubulin complex in APO and ATP state, and then conducted extensive MD simulations (total 400 ns for each state), followed by flexibility analysis, principal component analysis, hydrogen bond analysis, and binding free energy analysis. Our modeling and simulation have revealed key nucleotide-dependent changes in the structure and flexibility of the nucleotide-binding pocket (featuring a highly flexible and open switch I in APO state) and the tubulin-binding site, and allosterically coupled motions driving the APO to ATP transition. In addition, our binding free energy analysis has identified a set of key residues involved in kinesin-tubulin binding. On the basis of our simulation, we have attempted to address several outstanding issues in kinesin study, including the possible roles of β-sheet twist and neck linker docking in regulating nucleotide release and binding, the structural mechanism of ADP release, and possible extension and shortening of α4 helix during the ATPase cycle. This study has provided a comprehensive structural and dynamic picture of kinesin's major ATPase states, and offered promising targets for future mutational and functional studies to investigate the molecular mechanism of kinesin motors.

Effect of metal in M 3(btc) 2 and M 2(dobdc) MOFs for O 2/N 2 separations: A combined density functional theory and experimental study

DOE PAGES

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.; ...

2015-03-02

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Binding free energies for nicotine analogs inhibiting cytochrome P450 2A6 by a combined use of molecular dynamics simulations and QM/MM-PBSA calculations.

PubMed

Lu, Haiting; Huang, Xiaoqin; AbdulHameed, Mohamed Diwan M; Zhan, Chang-Guo

2014-04-01

Molecular dynamics (MD) simulations and hybrid quantum mechanical/molecular mechanical (QM/MM) calculations have been performed to explore the dynamic behaviors of cytochrome P450 2A6 (CYP2A6) binding with nicotine analogs (that are typical inhibitors) and to calculate their binding free energies in combination with Poisson-Boltzmann surface area (PBSA) calculations. The combined MD simulations and QM/MM-PBSA calculations reveal that the most important structural parameters affecting the CYP2A6-inhibitor binding affinity are two crucial internuclear distances, that is, the distance between the heme iron atom of CYP2A6 and the coordinating atom of the inhibitor, and the hydrogen-bonding distance between the N297 side chain of CYP2A6 and the pyridine nitrogen of the inhibitor. The combined MD simulations and QM/MM-PBSA calculations have led to dynamic CYP2A6-inhibitor binding structures that are consistent with the observed dynamic behaviors and structural features of CYP2A6-inhibitor binding, and led to the binding free energies that are in good agreement with the experimentally-derived binding free energies. The agreement between the calculated binding free energies and the experimentally-derived binding free energies suggests that the combined MD and QM/MM-PBSA approach may be used as a valuable tool to accurately predict the CYP2A6-inhibitor binding affinities in future computational design of new, potent and selective CYP2A6 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

Stoichiometry and kinetics of mercury uptake by photosynthetic bacteria.

PubMed

Kis, Mariann; Sipka, Gábor; Maróti, Péter

2017-05-01

Mercury adsorption on the cell surface and intracellular uptake by bacteria represent the key first step in the production and accumulation of highly toxic mercury in living organisms. In this work, the biophysical characteristics of mercury bioaccumulation are studied in intact cells of photosynthetic bacteria by use of analytical (dithizone) assay and physiological photosynthetic markers (pigment content, fluorescence induction, and membrane potential) to determine the amount of mercury ions bound to the cell surface and taken up by the cell. It is shown that the Hg(II) uptake mechanism (1) has two kinetically distinguishable components, (2) includes co-opted influx through heavy metal transporters since the slow component is inhibited by Ca 2+ channel blockers, (3) shows complex pH dependence demonstrating the competition of ligand binding of Hg(II) ions with H + ions (low pH) and high tendency of complex formation of Hg(II) with hydroxyl ions (high pH), and (4) is not a passive but an energy-dependent process as evidenced by light activation and inhibition by protonophore. Photosynthetic bacteria can accumulate Hg(II) in amounts much (about 10 5 ) greater than their own masses by well-defined strong and weak binding sites with equilibrium binding constants in the range of 1 (μM) -1 and 1 (mM) -1 , respectively. The strong binding sites are attributed to sulfhydryl groups as the uptake is blocked by use of sulfhydryl modifying agents and their number is much (two orders of magnitude) smaller than the number of weak binding sites. Biofilms developed by some bacteria (e.g., Rvx. gelatinosus) increase the mercury binding capacity further by a factor of about five. Photosynthetic bacteria in the light act as a sponge of Hg(II) and can be potentially used for biomonitoring and bioremediation of mercury-contaminated aqueous cultures.

Predicting binding poses and affinities for protein - ligand complexes in the 2015 D3R Grand Challenge using a physical model with a statistical parameter estimation

NASA Astrophysics Data System (ADS)

Grudinin, Sergei; Kadukova, Maria; Eisenbarth, Andreas; Marillet, Simon; Cazals, Frédéric

2016-09-01

The 2015 D3R Grand Challenge provided an opportunity to test our new model for the binding free energy of small molecules, as well as to assess our protocol to predict binding poses for protein-ligand complexes. Our pose predictions were ranked 3-9 for the HSP90 dataset, depending on the assessment metric. For the MAP4K dataset the ranks are very dispersed and equal to 2-35, depending on the assessment metric, which does not provide any insight into the accuracy of the method. The main success of our pose prediction protocol was the re-scoring stage using the recently developed Convex-PL potential. We make a thorough analysis of our docking predictions made with AutoDock Vina and discuss the effect of the choice of rigid receptor templates, the number of flexible residues in the binding pocket, the binding pocket size, and the benefits of re-scoring. However, the main challenge was to predict experimentally determined binding affinities for two blind test sets. Our affinity prediction model consisted of two terms, a pairwise-additive enthalpy, and a non pairwise-additive entropy. We trained the free parameters of the model with a regularized regression using affinity and structural data from the PDBBind database. Our model performed very well on the training set, however, failed on the two test sets. We explain the drawback and pitfalls of our model, in particular in terms of relative coverage of the test set by the training set and missed dynamical properties from crystal structures, and discuss different routes to improve it.

Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

PubMed Central

Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

2000-01-01

Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

Introducing various ligands into superhalogen anions reduces their electronic stabilities

NASA Astrophysics Data System (ADS)

Smuczyńska, Sylwia; Skurski, Piotr

2008-02-01

The vertical electron detachment energies (VDE) of six NaX2- anions (where X = F, Cl, Br) were calculated at the OVGF level with the 6-311++G(3df) basis sets. In all the cases studied the VDE exceeds the electron affinity of chlorine atom and thus those species were classified as superhalogen anions. The largest vertical binding energy was found for the NaF2- system (6.644 eV). The strong VDE dependence on the ligand type, ligand-central atom distance, and the character of the highest occupied molecular orbital (HOMO) was observed and discussed.

Spectroscopic ellipsometry in vacuum ultraviolet spectral area

NASA Astrophysics Data System (ADS)

Fuchs, Detlef

An ellipsometer is developed and built, which allows the direct spectroscopic evaluation of dielectric function of solid bodies in the energy area 5 to 35 eV. A linear polarized synchrotron radiation was used as light source. The Stokes parameters and the Mueller matrices were used for the mathematical modeling, which take into account the properties of the synchrotron light and the analyzer, which depend on the wavelength. The crystals of the semiconductor bindings GaAs, GaP, InP and ZnS were examined. Ellipsometric measurements and reflection spectra show a displacement of spectral structures towards lower photon energies after the storage.

Micro-Environmental Signature of The Interactions between Druggable Target Protein, Dipeptidyl Peptidase-IV, and Anti-Diabetic Drugs.

PubMed

Chakraborty, Chiranjib; Mallick, Bidyut; Sharma, Ashish Ranjan; Sharma, Garima; Jagga, Supriya; Doss, C George Priya; Nam, Ju-Suk; Lee, Sang-Soo

2017-01-01

Druggability of a target protein depends on the interacting micro-environment between the target protein and drugs. Therefore, a precise knowledge of the interacting micro-environment between the target protein and drugs is requisite for drug discovery process. To understand such micro-environment, we performed in silico interaction analysis between a human target protein, Dipeptidyl Peptidase-IV (DPP-4), and three anti-diabetic drugs (saxagliptin, linagliptin and vildagliptin). During the theoretical and bioinformatics analysis of micro-environmental properties, we performed drug-likeness study, protein active site predictions, docking analysis and residual interactions with the protein-drug interface. Micro-environmental landscape properties were evaluated through various parameters such as binding energy, intermolecular energy, electrostatic energy, van der Waals'+H-bond+desolvo energy (E VHD ) and ligand efficiency (LE) using different in silico methods. For this study, we have used several servers and software, such as Molsoft prediction server, CASTp server, AutoDock software and LIGPLOT server. Through micro-environmental study, highest log P value was observed for linagliptin (1.07). Lowest binding energy was also observed for linagliptin with DPP-4 in the binding plot. We also identified the number of H-bonds and residues involved in the hydrophobic interactions between the DPP-4 and the anti-diabetic drugs. During interaction, two H-bonds and nine residues, two H-bonds and eleven residues as well as four H-bonds and nine residues were found between the saxagliptin, linagliptin as well as vildagliptin cases and DPP-4, respectively. Our in silico data obtained for drug-target interactions and micro-environmental signature demonstrates linagliptin as the most stable interacting drug among the tested anti-diabetic medicines.

Effects of Co doping on the metamagnetic states of the ferromagnetic fcc Fe-Co alloy.

PubMed

Ortiz-Chi, Filiberto; Aguayo, Aarón; de Coss, Romeo

2013-01-16

The evolution of the metamagnetic states in the ferromagnetic face centered cubic (fcc) Fe(1-x)Co(x) alloy as a function of Co concentration has been studied by means of first-principles calculations. The ground state properties were obtained using the full-potential linear augmented plane wave method and the generalized gradient approximation for the exchange-correlation functional. The alloying was modeled using the virtual crystal approximation and the magnetic states were obtained from the calculations of the total energy as a function of the spin moment, using the fixed spin moment method. For ferromagnetic fcc Fe, the binding-energy curve shows metamagnetic behavior, with two minima corresponding to a small-volume, low-spin (LS) state and a large-volume, high-spin (HS) state, which are separated by a small energy (E(LS) ≲ E(HS)). The evolution of the magnetic moment, the exchange integral (J), and the binding-energy curve is analyzed in the whole range of Co concentrations (x). The magnetic moment corresponding to the HS state decreases monotonically from 2.6 μ(B)/atom in fcc Fe to 1.7 μ(B)/atom in fcc Co. In contrast, the exchange integral for the HS state shows a maximum at around x = 0.45. The thermal dependence of the lattice parameter is evaluated with a method based on statistical mechanics using the binding-energy curve as an effective potential. It is observed that the behavior of the lattice parameter with temperature is tuned by Co doping, from negative thermal expansion in fcc Fe to positive thermal expansion in fcc Co, through the modification of the energetics of the metamagnetic states.

Different binding mechanisms of neutral and anionic poly-/perfluorinated chemicals to human transthyretin revealed by In silico models.

PubMed

Yang, Xianhai; Lyakurwa, Felichesmi; Xie, Hongbin; Chen, Jingwen; Li, Xuehua; Qiao, Xianliang; Cai, Xiyun

2017-09-01

Chemical forms-dependent binding interactions between phenolic compounds and human transthyretin (hTTR) have been elaborated previously. However, it is not known whether the binding interactions between ionizable halogenated alphatic compounds and hTTR also have the same manner. In this study, poly-/perfluorinated chemicals (PFCs) were selected as model compounds and molecular dynamic simulation was performed to investigate the binding mechanisms between PFCs and hTTR. Results show the binding interactions between the halogenated aliphatic compounds and hTTR are related to the chemical forms. The ionized groups of PFCs can form electrostatic interactions with the -NH + 3 groups of Lys 15 residues in hTTR and form hydrogen bonds with the residues of hTTR. By analyzing the molecular orbital energies of PFCs, we also found that the anionic groups (nucleophile) in PFCs could form electron donor - acceptor interactions with the -NH + 3 groups (electrophile) in Lys 15. The aforementioned orientational interactions make the ionized groups of the PFCs point toward the entry port of the binding site. The roles of fluorine atoms in the binding interactions were also explored. The fluorine atoms can influence the binding interactions via inductive effects. Appropriate molecular descriptors were selected to characterize these interactions, and two quantitative structure-activity relationship models were developed. Copyright © 2017 Elsevier Ltd. All rights reserved.

The origins of the directionality of noncovalent intermolecular interactions.

PubMed

Wang, Changwei; Guan, Liangyu; Danovich, David; Shaik, Sason; Mo, Yirong

2016-01-05

The recent σ-hole concept emphasizes the contribution of electrostatic attraction to noncovalent bonds, and implies that the electrostatic force has an angular dependency. Here a set of clusters, which includes hydrogen bonding, halogen bonding, chalcogen bonding, and pnicogen bonding systems, is investigated to probe the magnitude of covalency and its contribution to the directionality in noncovalent bonding. The study is based on the block-localized wavefunction (BLW) method that decomposes the binding energy into the steric and the charge transfer (CT) (hyperconjugation) contributions. One unique feature of the BLW method is its capability to derive optimal geometries with only steric effect taken into account, while excluding the CT interaction. The results reveal that the overall steric energy exhibits angular dependency notably in halogen bonding, chalcogen bonding, and pnicogen bonding systems. Turning on the CT interactions further shortens the intermolecular distances. This bond shortening enhances the Pauli repulsion, which in turn offsets the electrostatic attraction, such that in the final sum, the contribution of the steric effect to bonding is diminished, leaving the CT to dominate the binding energy. In several other systems particularly hydrogen bonding systems, the steric effect nevertheless still plays the major role whereas the CT interaction is minor. However, in all cases, the CT exhibits strong directionality, suggesting that the linearity or near linearity of noncovalent bonds is largely governed by the charge-transfer interaction whose magnitude determines the covalency in noncovalent bonds. © 2015 Wiley Periodicals, Inc.

Reexamine structures and relative stability of medium-sized silicon clusters: Low-lying endohedral fullerene-like clusters Si 30-Si 38

NASA Astrophysics Data System (ADS)

Yoo, Soohaeng; Shao, Nan; Zeng, X. C.

2009-10-01

We report improved results of lowest-lying silicon clusters Si 30-Si 38. A large population of low-energy clusters are collected from previous searches by several research groups and the binding energies of these clusters are computed using density-functional theory (DFT) methods. Best candidates (isomers with high binding energies) are identified from the screening calculations. Additional constrained search is then performed for the best candidates using the basin-hopping method combined with DFT geometry optimization. The obtained low-lying clusters are classified according to binding energies computed using either the Perdew-Burke-Ernzerhof (PBE) functional or the Becke exchange and Lee-Yang-Parr correlation (BLYP) functional. We propose to rank low-lying clusters according to the mean PBE/BLYP binding energies in view that the PBE functional tends to give greater binding energies for more compact clusters whereas the BLYP functional tends to give greater binding energies for less compact clusters or clusters composed of small-sized magic-number clusters. Except for Si 30, the new search confirms again that medium-size silicon clusters Si 31-Si 38 constructed with proper fullerene cage motifs are most promising to be the lowest-energy structures.

Membrane-Mediated Cooperativity of Proteins

NASA Astrophysics Data System (ADS)

Weikl, Thomas R.

2018-04-01

Besides direct protein-protein interactions, indirect interactions mediated by membranes play an important role for the assembly and cooperative function of proteins in membrane shaping and adhesion. The intricate shapes of biological membranes are generated by proteins that locally induce membrane curvature. Indirect curvature-mediated interactions between these proteins arise because the proteins jointly affect the bending energy of the membranes. These curvature-mediated interactions are attractive for crescent-shaped proteins and are a driving force in the assembly of the proteins during membrane tubulation. Membrane adhesion results from the binding of receptor and ligand proteins that are anchored in the apposing membranes. The binding of these proteins strongly depends on nanoscale shape fluctuations of the membranes, leading to a fluctuation-mediated binding cooperativity. A length mismatch between receptor-ligand complexes in membrane adhesion zones causes repulsive curvature-mediated interactions that are a driving force for the length-based segregation of proteins during membrane adhesion.

Supervised machine learning techniques to predict binding affinity. A study for cyclin-dependent kinase 2.

PubMed

de Ávila, Maurício Boff; Xavier, Mariana Morrone; Pintro, Val Oliveira; de Azevedo, Walter Filgueira

2017-12-09

Here we report the development of a machine-learning model to predict binding affinity based on the crystallographic structures of protein-ligand complexes. We used an ensemble of crystallographic structures (resolution better than 1.5 Å resolution) for which half-maximal inhibitory concentration (IC 50 ) data is available. Polynomial scoring functions were built using as explanatory variables the energy terms present in the MolDock and PLANTS scoring functions. Prediction performance was tested and the supervised machine learning models showed improvement in the prediction power, when compared with PLANTS and MolDock scoring functions. In addition, the machine-learning model was applied to predict binding affinity of CDK2, which showed a better performance when compared with AutoDock4, AutoDock Vina, MolDock, and PLANTS scores. Copyright © 2017 Elsevier Inc. All rights reserved.

Coarse-graining, Electrostatics and pH effects in phospholipid systems

NASA Astrophysics Data System (ADS)

Travesset, Alex; Vangaveti, Sweta

2010-03-01

We introduce a minimal free energy describing the interaction of charged groups and counterions including both classical electrostatic and specific interactions. The predictions of the model are compared against the standard model for describing ions next to charged interfaces, consisting of Poisson-Boltzmann theory with additional constants describing ion binding, which are specific to the counterion and the interfacial charge (``chemical binding''). It is shown that the ``chemical'' model can be appropriately described by an underlying ``physical'' model over several decades in concentration, but the extracted binding constants are not uniquely defined, as they differ depending on the particular observable quantity being studied. It is also shown that electrostatic correlations for divalent (or higher valence) ions enhance the surface charge by increasing deprotonation, an effect not properly accounted within chemical models. The model is applied to the charged phospholipids phosphatidylserine, Phosphatidc acid and Phosphoinositides and implications for different biological processes are discussed.

Identification of DNA primase inhibitors via a combined fragment-based and virtual screening

NASA Astrophysics Data System (ADS)

Ilic, Stefan; Akabayov, Sabine R.; Arthanari, Haribabu; Wagner, Gerhard; Richardson, Charles C.; Akabayov, Barak

2016-11-01

The structural differences between bacterial and human primases render the former an excellent target for drug design. Here we describe a technique for selecting small molecule inhibitors of the activity of T7 DNA primase, an ideal model for bacterial primases due to their common structural and functional features. Using NMR screening, fragment molecules that bind T7 primase were identified and then exploited in virtual filtration to select larger molecules from the ZINC database. The molecules were docked to the primase active site using the available primase crystal structure and ranked based on their predicted binding energies to identify the best candidates for functional and structural investigations. Biochemical assays revealed that some of the molecules inhibit T7 primase-dependent DNA replication. The binding mechanism was delineated via NMR spectroscopy. Our approach, which combines fragment based and virtual screening, is rapid and cost effective and can be applied to other targets.

Structure of the Rigor Actin-Tropomyosin-Myosin Complex

PubMed Central

Behrmann, Elmar; Müller, Mirco; Penczek, Pawel A.; Mannherz, Hans Georg; Manstein, Dietmar J.; Raunser, Stefan

2014-01-01

The interaction of myosin with actin filaments is the central feature of muscle contraction and cargo movement along actin filaments of the cytoskeleton. Myosin converts the chemical energy stored in ATP into force and movement along actin filaments. Myosin binding to actin induces conformational changes that are coupled to the nucleotide-binding pocket and amplified by a specialized region of the motor domain for efficient force generation. Tropomyosin plays a key role in regulating the productive interaction between myosins and actin. Here, we report the 8 Å resolution structure of the actin-tropomyosin-myosin complex determined by cryo electron microscopy. The pseudo-atomic model of the complex obtained from fitting crystal structures into the map defines the large actin-myosin-tropomyosin interface and the molecular interactions between the proteins in detail and allows us to propose a structural model for tropomyosin dependent myosin binding to actin and actin-induced nucleotide release from myosin. PMID:22817895

Motor-substrate interactions in mycoplasma motility explains non-Arrhenius temperature dependence.

PubMed

Chen, Jing; Neu, John; Miyata, Makoto; Oster, George

2009-12-02

Mycoplasmas exhibit a novel, substrate-dependent gliding motility that is driven by approximately 400 "leg" proteins. The legs interact with the substrate and transmit the forces generated by an assembly of ATPase motors. The velocity of the cell increases linearly by nearly 10-fold over a narrow temperature range of 10-40 degrees C. This corresponds to an Arrhenius factor that decreases from approximately 45 k(B)T at 10 degrees C to approximately 10 k(B)T at 40 degrees C. On the other hand, load-velocity curves at different temperatures extrapolate to nearly the same stall force, suggesting a temperature-insensitive force-generation mechanism near stall. In this article, we propose a leg-substrate interaction mechanism that explains the intriguing temperature sensitivity of this motility. The large Arrhenius factor at low temperature comes about from the addition of many smaller energy barriers arising from many substrate-binding sites at the distal end of the leg protein. The Arrhenius dependence attenuates at high temperature due to two factors: 1), the reduced effective multiplicity of energy barriers intrinsic to the multiple-site binding mechanism; and 2), the temperature-sensitive weakly facilitated leg release that curtails the power stroke. The model suggests an explanation for the similar steep, sub-Arrhenius temperature-velocity curves observed in many molecular motors, such as kinesin and myosin, wherein the temperature behavior is dominated not by the catalytic biochemistry, but by the motor-substrate interaction.

Motor-Substrate Interactions in Mycoplasma Motility Explains Non-Arrhenius Temperature Dependence

PubMed Central

Chen, Jing; Neu, John; Miyata, Makoto; Oster, George

2009-01-01

Abstract Mycoplasmas exhibit a novel, substrate-dependent gliding motility that is driven by ∼400 “leg” proteins. The legs interact with the substrate and transmit the forces generated by an assembly of ATPase motors. The velocity of the cell increases linearly by nearly 10-fold over a narrow temperature range of 10–40°C. This corresponds to an Arrhenius factor that decreases from ∼45 kBT at 10°C to ∼10 kBT at 40°C. On the other hand, load-velocity curves at different temperatures extrapolate to nearly the same stall force, suggesting a temperature-insensitive force-generation mechanism near stall. In this article, we propose a leg-substrate interaction mechanism that explains the intriguing temperature sensitivity of this motility. The large Arrhenius factor at low temperature comes about from the addition of many smaller energy barriers arising from many substrate-binding sites at the distal end of the leg protein. The Arrhenius dependence attenuates at high temperature due to two factors: 1), the reduced effective multiplicity of energy barriers intrinsic to the multiple-site binding mechanism; and 2), the temperature-sensitive weakly facilitated leg release that curtails the power stroke. The model suggests an explanation for the similar steep, sub-Arrhenius temperature-velocity curves observed in many molecular motors, such as kinesin and myosin, wherein the temperature behavior is dominated not by the catalytic biochemistry, but by the motor-substrate interaction. PMID:19948122

Effective one body approach to the dynamics of two spinning black holes with next-to-leading order spin-orbit coupling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Damour, Thibault; Jaranowski, Piotr; Schaefer, Gerhard

2008-07-15

Using a recent, novel Hamiltonian formulation of the gravitational interaction of spinning binaries, we extend the effective one body (EOB) description of the dynamics of two spinning black holes to next-to-leading order (NLO) in the spin-orbit interaction. The spin-dependent EOB Hamiltonian is constructed from four main ingredients: (i) a transformation between the 'effective' Hamiltonian and the 'real' one; (ii) a generalized effective Hamilton-Jacobi equation involving higher powers of the momenta; (iii) a Kerr-type effective metric (with Pade-resummed coefficients) which depends on the choice of some basic 'effective spin vector' S{sub eff}, and which is deformed by comparable-mass effects; and (iv)more » an additional effective spin-orbit interaction term involving another spin vector {sigma}. As a first application of the new, NLO spin-dependent EOB Hamiltonian, we compute the binding energy of circular orbits (for parallel spins) as a function of the orbital frequency, and of the spin parameters. We also study the characteristics of the last stable circular orbit: binding energy, orbital frequency, and the corresponding dimensionless spin parameter a{sub LSO}{identical_to}cJ{sub LSO}/(G(H{sub LSO}/c{sup 2}){sup 2}). We find that the inclusion of NLO spin-orbit terms has a significant 'moderating' effect on the dynamical characteristics of the circular orbits for large and parallel spins.« less

Platinum Monolayer Shell on Non-Noble Metal Core Electrocatalysts for the Hydrogen Oxidation Reaction

NASA Astrophysics Data System (ADS)

Teeluck, Krishani Malini

According to the United States Environmental Protection Agency, as of 2015, transportation accounted for 32% of the carbon dioxide emissions in the United States (and all carbon dioxide emissions in the U.S. accounted for 82.2% of all greenhouse gases from human activity). A hydrogen fuel cell is a device that efficiently produces electrical energy directly from a chemical reaction, with zero carbon emissions, and therefore holds great promise in alleviating our dependence on harmful use of energy sources. Due to their clean emissions and high efficiencies, there has been focus on the hydrogen fuel cell for vehicle applications using proton exchange membrane and alkaline fuel cells. Although the proton exchange membrane fuel cell is currently being used in vehicles, their high cost limits their feasibility in the market. This has inspired the development of the alkaline fuel cell whose efficiency and simplicity suggest the possibility of manufacturing high power fuel cell vehicles at a low cost, since the electrocatalysts in the alkaline fuel cell can be made from non-noble metals. Although the hydrogen oxidation reaction is one of the fastest electrochemical reactions in acidic media, it is two orders of magnitude slower in alkaline media, which hinders the overall efficiency of the alkaline fuel cell. Pure platinum is currently the best catalyst for the hydrogen oxidation reaction, but platinum’s high cost and rarity yields economic issues, rendering the technology futile if it cannot be commercialized. Furthermore, platinum’s hydrogen binding energy is slightly stronger than the optimal hydrogen binding energy. As the hydrogen oxidation reaction happens only on the surface of the catalyst, there is no need for platinum content beyond the exterior. Since tungsten and nickel are cheap, as well as abundant, they are ideal elements to replace the core of the catalyst with, while leaving a platinum shell surrounding this core. The activity of the hydrogen oxidation reaction when using a platinum monolayer shell on a nickel tungsten core electrocatalyst is explored, and it was found that the novel catalyst created here exhibits kinetics that rival pure platinum, but at less than half the platinum content, suggesting that nickel and tungsten modify the electronic properties of platinum in a way that enhances its activity for the hydrogen oxidation reaction. Furthermore, the hydrogen binding energy of this novel electrocatalyst was found to be weaker than the optimal binding energy (rather than stronger, as seen in pure platinum), indicating the possibility of modifying the electronic properties of platinum for a more optimal hydrogen binding energy.

Molecular modeling and residue interaction network studies on the mechanism of binding and resistance of the HCV NS5B polymerase mutants to VX-222 and ANA598.

PubMed

Xue, Weiwei; Jiao, Pingzu; Liu, Huanxiang; Yao, Xiaojun

2014-04-01

Hepatitis C virus (HCV) NS5B protein is an RNA-dependent RNA polymerase (RdRp) with essential functions in viral genome replication and represents a promising therapeutic target to develop direct-acting antivirals (DAAs). Multiple nonnucleoside inhibitors (NNIs) binding sites have been identified within the polymerase. VX-222 and ANA598 are two NNIs targeting thumb II site and palm I site of HCV NS5B polymerase, respectively. These two molecules have been shown to be very effective in phase II clinical trials. However, the emergence of resistant HCV replicon variants (L419M, M423T, I482L mutants to VX-222 and M414T, M414L, G554D mutants to ANA598) has significantly decreased their efficacy. To elucidate the molecular mechanism about how these mutations influenced the drug binding mode and decreased drug efficacy, we studied the binding modes of VX-222 and ANA598 to wild-type and mutant polymerase by molecular modeling approach. Molecular dynamics (MD) simulations results combined with binding free energy calculations indicated that the mutations significantly altered the binding free energy and the interaction for the drugs to polymerase. The further per-residue binding free energy decomposition analysis revealed that the mutations decreased the interactions with several key residues, such as L419, M423, L474, S476, I482, L497, for VX-222 and L384, N411, M414, Y415, Q446, S556, G557 for ANA598. These were the major origins for the resistance to these two drugs. In addition, by analyzing the residue interaction network (RIN) of the complexes between the drugs with wild-type and the mutant polymerase, we found that the mutation residues in the networks involved in the drug resistance possessed a relatively lower size of topology centralities. The shift of betweenness and closeness values of binding site residues in the mutant polymerase is relevant to the mechanism of drug resistance of VX-222 and ANA598. These results can provide an atomic-level understanding about the mechanisms of drug resistance conferred by the studied mutations and will be helpful to design more potent inhibitors which could effectively overcome drug resistance of antivirus agents. Copyright © 2014 Elsevier B.V. All rights reserved.

Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

PubMed

Olson, Wilma K; Swigon, David; Coleman, Bernard D

2004-07-15

Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

Maximizing in vivo target clearance by design of pH-dependent target binding antibodies with altered affinity to FcRn.

PubMed

Yang, Danlin; Giragossian, Craig; Castellano, Steven; Lasaro, Marcio; Xiao, Haiguang; Saraf, Himanshu; Hess Kenny, Cynthia; Rybina, Irina; Huang, Zhong-Fu; Ahlberg, Jennifer; Bigwarfe, Tammy; Myzithras, Maria; Waltz, Erica; Roberts, Simon; Kroe-Barrett, Rachel; Singh, Sanjaya

2017-10-01

Antibodies with pH-dependent binding to both target antigens and neonatal Fc receptor (FcRn) provide an alternative tool to conventional neutralizing antibodies, particularly for therapies where reduction in antigen level is challenging due to high target burden. However, the requirements for optimal binding kinetic framework and extent of pH dependence for these antibodies to maximize target clearance from circulation are not well understood. We have identified a series of naturally-occurring high affinity antibodies with pH-dependent target binding properties. By in vivo studies in cynomolgus monkeys, we show that pH-dependent binding to the target alone is not sufficient for effective target removal from circulation, but requires Fc mutations that increase antibody binding to FcRn. Affinity-enhanced pH-dependent FcRn binding that is double-digit nM at pH 7.4 and single-digit nM at pH 6 achieved maximal target reduction when combined with similar target binding affinities in reverse pH directions. Sustained target clearance below the baseline level was achieved 3 weeks after single-dose administration at 1.5 mg/kg. Using the experimentally derived mechanistic model, we demonstrate the essential kinetic interplay between target turnover and antibody pH-dependent binding during the FcRn recycling, and identify the key components for achieving maximal target clearance. These results bridge the demand for improved patient dosing convenience with the "know-how" of therapeutic modality by design.

Is titin a 'winding filament'? A new twist on muscle contraction.

PubMed

Nishikawa, Kiisa C; Monroy, Jenna A; Uyeno, Theodore E; Yeo, Sang Hoon; Pai, Dinesh K; Lindstedt, Stan L

2012-03-07

Recent studies have demonstrated a role for the elastic protein titin in active muscle, but the mechanisms by which titin plays this role remain to be elucidated. In active muscle, Ca(2+)-binding has been shown to increase titin stiffness, but the observed increase is too small to explain the increased stiffness of parallel elastic elements upon muscle activation. We propose a 'winding filament' mechanism for titin's role in active muscle. First, we hypothesize that Ca(2+)-dependent binding of titin's N2A region to thin filaments increases titin stiffness by preventing low-force straightening of proximal immunoglobulin domains that occurs during passive stretch. This mechanism explains the difference in length dependence of force between skeletal myofibrils and cardiac myocytes. Second, we hypothesize that cross-bridges serve not only as motors that pull thin filaments towards the M-line, but also as rotors that wind titin on the thin filaments, storing elastic potential energy in PEVK during force development and active stretch. Energy stored during force development can be recovered during active shortening. The winding filament hypothesis accounts for force enhancement during stretch and force depression during shortening, and provides testable predictions that will encourage new directions for research on mechanisms of muscle contraction.

Is titin a ‘winding filament’? A new twist on muscle contraction

PubMed Central

Nishikawa, Kiisa C.; Monroy, Jenna A.; Uyeno, Theodore E.; Yeo, Sang Hoon; Pai, Dinesh K.; Lindstedt, Stan L.

2012-01-01

Recent studies have demonstrated a role for the elastic protein titin in active muscle, but the mechanisms by which titin plays this role remain to be elucidated. In active muscle, Ca2+-binding has been shown to increase titin stiffness, but the observed increase is too small to explain the increased stiffness of parallel elastic elements upon muscle activation. We propose a ‘winding filament’ mechanism for titin's role in active muscle. First, we hypothesize that Ca2+-dependent binding of titin's N2A region to thin filaments increases titin stiffness by preventing low-force straightening of proximal immunoglobulin domains that occurs during passive stretch. This mechanism explains the difference in length dependence of force between skeletal myofibrils and cardiac myocytes. Second, we hypothesize that cross-bridges serve not only as motors that pull thin filaments towards the M-line, but also as rotors that wind titin on the thin filaments, storing elastic potential energy in PEVK during force development and active stretch. Energy stored during force development can be recovered during active shortening. The winding filament hypothesis accounts for force enhancement during stretch and force depression during shortening, and provides testable predictions that will encourage new directions for research on mechanisms of muscle contraction. PMID:21900329

Binding free energy analysis of protein-protein docking model structures by evERdock.

PubMed

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-14

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

Binding free energy analysis of protein-protein docking model structures by evERdock

NASA Astrophysics Data System (ADS)

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-01

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE PAGES

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

2017-04-06

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

On binding energy of trions in bulk materials

NASA Astrophysics Data System (ADS)

Filikhin, Igor; Kezerashvili, Roman Ya.; Vlahovic, Branislav

2018-03-01

We study the negatively T- and positively T+ charged trions in bulk materials in the effective mass approximation within the framework of a potential model. The binding energies of trions in various semiconductors are calculated by employing Faddeev equation in configuration space. Results of calculations of the binding energies for T- are consistent with previous computational studies and are in reasonable agreement with experimental measurements, while the T+ is unbound for all considered cases. The mechanism of formation of the binding energy of trions is analyzed by comparing contributions of a mass-polarization term related to kinetic energy operators and a term related to the Coulomb repulsion of identical particles.

Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

PubMed Central

Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

2017-01-01

We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

Non-additivity of functional group contributions in protein-ligand binding: a comprehensive study by crystallography and isothermal titration calorimetry.

PubMed

Baum, Bernhard; Muley, Laveena; Smolinski, Michael; Heine, Andreas; Hangauer, David; Klebe, Gerhard

2010-04-09

Additivity of functional group contributions to protein-ligand binding is a very popular concept in medicinal chemistry as the basis of rational design and optimized lead structures. Most of the currently applied scoring functions for docking build on such additivity models. Even though the limitation of this concept is well known, case studies examining in detail why additivity fails at the molecular level are still very scarce. The present study shows, by use of crystal structure analysis and isothermal titration calorimetry for a congeneric series of thrombin inhibitors, that extensive cooperative effects between hydrophobic contacts and hydrogen bond formation are intimately coupled via dynamic properties of the formed complexes. The formation of optimal lipophilic contacts with the surface of the thrombin S3 pocket and the full desolvation of this pocket can conflict with the formation of an optimal hydrogen bond between ligand and protein. The mutual contributions of the competing interactions depend on the size of the ligand hydrophobic substituent and influence the residual mobility of ligand portions at the binding site. Analysis of the individual crystal structures and factorizing the free energy into enthalpy and entropy demonstrates that binding affinity of the ligands results from a mixture of enthalpic contributions from hydrogen bonding and hydrophobic contacts, and entropic considerations involving an increasing loss of residual mobility of the bound ligands. This complex picture of mutually competing and partially compensating enthalpic and entropic effects determines the non-additivity of free energy contributions to ligand binding at the molecular level. (c) 2010 Elsevier Ltd. All rights reserved.

Exploring the free-energy landscape of carbohydrate-protein complexes: development and validation of scoring functions considering the binding-site topology

NASA Astrophysics Data System (ADS)

Eid, Sameh; Saleh, Noureldin; Zalewski, Adam; Vedani, Angelo

2014-12-01

Carbohydrates play a key role in a variety of physiological and pathological processes and, hence, represent a rich source for the development of novel therapeutic agents. Being able to predict binding mode and binding affinity is an essential, yet lacking, aspect of the structure-based design of carbohydrate-based ligands. We assembled a diverse data set comprising 273 carbohydrate-protein crystal structures with known binding affinity and evaluated the prediction accuracy of a large collection of well-established scoring and free-energy functions, as well as combinations thereof. Unfortunately, the tested functions were not capable of reproducing binding affinities in the studied complexes. To simplify the complex free-energy surface of carbohydrate-protein systems, we classified the studied proteins according to the topology and solvent exposure of the carbohydrate-binding site into five distinct categories. A free-energy model based on the proposed classification scheme reproduced binding affinities in the carbohydrate data set with an r 2 of 0.71 and root-mean-squared-error of 1.25 kcal/mol ( N = 236). The improvement in model performance underlines the significance of the differences in the local micro-environments of carbohydrate-binding sites and demonstrates the usefulness of calibrating free-energy functions individually according to binding-site topology and solvent exposure.

Energetics of small molecule and water complexation in hydrophobic calixarene cavities.

PubMed

Notestein, Justin M; Katz, Alexander; Iglesia, Enrique

2006-04-25

Calixarenes grafted on silica are energetically uniform hosts that bind aromatic guests with 1:1 stoichiometry, as shown by binding energies that depend upon the calixarene upper rim composition but not on their grafted surface density (0.02-0.23 nm(-2)). These materials are unique in maintaining a hydrophilic silica surface, as probed by H2O physisorption measurements, while possessing a high density of hydrophobic binding sites that are orthogonal to the silica surface below them. The covalently enforced cone-shaped cavities and complete accessibility of these rigidly grafted calixarenes allow the first unambiguous measurements of the thermodynamics of guest interaction with the same calixarene cavities in aqueous solution and vapor phase. Similar to adsorption into nonpolar protein cavities, adsorption into these hydrophobic cavities from aqueous solution is enthalpy-driven, which is in contrast to entropy-driven adsorption into water-soluble hydrophobic hosts such as beta cyclodextrin. The adsorption thermodynamics of several substituted aromatics from vapor and liquid are compared by (i) describing guest chemical potentials relative to pure guest, which removes differences among guests because of aqueous solvation and van der Waals contacts in the pure condensed phase, and (ii) passivating residual guest binding sites on exposed silica, titrated by water during adsorption from aqueous solution, using inorganic salts before vapor adsorption. Adsorption isotherms depend only upon the saturation vapor pressure of each guest, indicating that guest binding from aqueous or vapor media is controlled by van der Waals contacts with hydrophobic calixarene cavities acting as covalently assembled condensation nuclei, without apparent contributions from CH-pi or other directional interactions. These data also provide the first direct quantification of free energies for interactions of water with the calixarene cavity interior. The calixarene-water interface is stabilized by approximately 20 kJ/mol relative to the water-vapor interface, indicating that water significantly competes with the aromatic guests for adsorption at these ostensibly hydrophobic cavities. This result is useful for understanding models of water interactions with other concave hydrophobic surfaces, including those commonly observed within proteins.

Two nucleotide binding sites modulate ( sup 3 H) glyburide binding to rat cortex membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, D.E.; Gopalakrishnan, M.; Triggle, D.J.

1991-03-11

The effects of nucleotides on the binding of the ATP-dependent K{sup +}-channel antagonist ({sup 3}H)glyburide (GLB) to rat cortex membranes were examined. Nucleotide triphosphates (NTPs) and nucleotide diphosphate (NDPs) inhibited the binding of GLB. This effect was dependent on the presence of dithiothreitol (DTT). Inhibition of binding by NTPs, with the exception of ATP{gamma}S, was dependent on the presence of Mg{sup 2+}. GLB binding showed a biphasic response to ADP: up to 3 mM, ADP inhibited binding, and above this concentration GLB binding increased rapidly, and was restored to normal levels by 10 mM ADP. In the presence of Mg{supmore » 2+}, ADP did not stimulate binding. Saturation analysis in the presence of Mg{sup 2+} and increasing concentrations of ADP showed that ADP results primarily in a change of the B{sub max} for GLB binding. The differential effects of NTPS and NDPs indicate that two nucleotide binding sites regulate GLB binding.« less

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

Funnel metadynamics as accurate binding free-energy method

PubMed Central

Limongelli, Vittorio; Bonomi, Massimiliano; Parrinello, Michele

2013-01-01

A detailed description of the events ruling ligand/protein interaction and an accurate estimation of the drug affinity to its target is of great help in speeding drug discovery strategies. We have developed a metadynamics-based approach, named funnel metadynamics, that allows the ligand to enhance the sampling of the target binding sites and its solvated states. This method leads to an efficient characterization of the binding free-energy surface and an accurate calculation of the absolute protein–ligand binding free energy. We illustrate our protocol in two systems, benzamidine/trypsin and SC-558/cyclooxygenase 2. In both cases, the X-ray conformation has been found as the lowest free-energy pose, and the computed protein–ligand binding free energy in good agreement with experiments. Furthermore, funnel metadynamics unveils important information about the binding process, such as the presence of alternative binding modes and the role of waters. The results achieved at an affordable computational cost make funnel metadynamics a valuable method for drug discovery and for dealing with a variety of problems in chemistry, physics, and material science. PMID:23553839

Effects of pH on the association between the inhibitor cystatin and the proteinase chymopapain.

PubMed

Reyes-Espinosa, Francisco; Arroyo-Reyna, Alfonso; Garcia-Gutierrez, Ponciano; Serratos, Iris N; Zubillaga, Rafael A

2014-01-01

Cysteine proteinases are involved in many aspects of physiological regulation. In humans, some cathepsins have shown another function in addition to their role as lysosomal proteases in intracellular protein degradation; they have been implicated in the pathogenesis of several heart and blood vessel diseases and in cancer development. In this work, we present a fluorometric and computational study of the binding of one representative plant cysteine proteinase, chymopapain, to one of the most studied inhibitors of these proteinases: chicken cystatin. The binding equilibrium constant, Kb, was determined in the pH range between 3.5 and 10.0, revealing a maximum in the affinity at pH 9.0. We constructed an atomic model for the chymopapain-cystatin dimer by docking the individual 3D protein structures; subsequently, the model was refined using a 100 ns NPT molecular dynamics simulation in explicit water. Upon scrutiny of this model, we identified 14 ionizing residues at the interface of the complex using a cutoff distance of 5.0 Å. Using the pKa values predicted with PROPKA and a modified proton-linkage model, we performed a regression analysis on our data to obtain the composite pKavalues for three isoacidic residues. We also calculated the electrostatic component of the binding energy (ΔGb,elec) at different pH values using an implicit solvent model and APBS software. The pH profile of this calculated energy compares well with the experimentally obtained binding energy, ΔGb. We propose that the residues that form an interchain ionic pair, Lys139A from chymopapain and Glu19B from cystatin, as well as Tyr61A and Tyr67A from chymopapain are the main residues responsible for the observed pH dependence in the chymopapain- cystatin affinity.

Common-envelope ejection in massive binary stars. Implications for the progenitors of GW150914 and GW151226

NASA Astrophysics Data System (ADS)

Kruckow, M. U.; Tauris, T. M.; Langer, N.; Szécsi, D.; Marchant, P.; Podsiadlowski, Ph.

2016-11-01

Context. The recently detected gravitational wave signals (GW150914 and GW151226) of the merger event of a pair of relatively massive stellar-mass black holes (BHs) calls for an investigation of the formation of such progenitor systems in general. Aims: We analyse the common-envelope (CE) stage of the traditional formation channel in binaries where the first-formed compact object undergoes an in-spiral inside the envelope of its evolved companion star and ejects the envelope in this process. Methods: We calculated envelope binding energies of donor stars with initial masses between 4 and 115M⊙ for metallicities of Z = ZMilky Way ≃ Z⊙/ 2 and Z = Z⊙/ 50, and derived minimum masses of in-spiralling objects needed to eject these envelopes. Results: In addition to producing double white dwarf and double neutron star binaries, CE evolution may also produce massive BH-BH systems with individual BH component masses of up to 50 - 60M⊙, in particular for donor stars evolved to giants beyond the Hertzsprung gap. However, the physics of envelope ejection of massive stars remains uncertain. We discuss the applicability of the energy-budget formalism, the location of the bifurcation point, the recombination energy, and the accretion energy during in-spiral as possible energy sources, and also comment on the effect of inflated helium cores. Conclusions: Massive stars in a wide range of metallicities and with initial masses of up to at least 115M⊙ may shed their envelopes and survive CE evolution, depending on their initial orbital parameters, similarly to the situation for intermediate- and low-mass stars with degenerate cores. In addition to being dependent on stellar radius, the envelope binding energies and λ-values also depend on the applied convective core-overshooting parameter, whereas these structure parameters are basically independent of metallicity for stars with initial masses below 60M⊙. Metal-rich stars ≳60M⊙ become luminous blue variables and do not evolve to reach the red giant stage. We conclude that based on stellar structure calculations, and in the view of the usual simple energy budget analysis, events like GW150914 and GW151226 might be produced by the CE channel. Calculations of post-CE orbital separations, however, and thus the estimated LIGO detection rates, remain highly uncertain.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

PubMed

Wang, Jinling; de Montellano, Paul R Ortiz

2003-05-30

Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

Enzyme activation through the utilization of intrinsic dianion binding energy.

PubMed

Amyes, T L; Malabanan, M M; Zhai, X; Reyes, A C; Richard, J P

2017-03-01

We consider 'the proposition that the intrinsic binding energy that results from the noncovalent interaction of a specific substrate with the active site of the enzyme is considerably larger than is generally believed. An important part of this binding energy may be utilized to provide the driving force for catalysis, so that the observed binding energy represents only what is left over after this utilization' [Jencks,W.P. (1975) Adv. Enzymol. Relat. Areas. Mol. Biol. , , 219-410]. The large ~12 kcal/mol intrinsic substrate phosphodianion binding energy for reactions catalyzed by triosephosphate isomerase (TIM), orotidine 5'-monophosphate decarboxylase and glycerol-3-phosphate dehydrogenase is divided into 4-6 kcal/mol binding energy that is expressed on the formation of the Michaelis complex in anchoring substrates to the respective enzyme, and 6-8 kcal/mol binding energy that is specifically expressed at the transition state in activating the respective enzymes for catalysis. A structure-based mechanism is described where the dianion binding energy drives a conformational change that activates these enzymes for catalysis. Phosphite dianion plays the active role of holding TIM in a high-energy closed active form, but acts as passive spectator in showing no effect on transition-state structure. The result of studies on mutant enzymes is presented, which support the proposal that the dianion-driven enzyme conformational change plays a role in enhancing the basicity of side chain of E167, the catalytic base, by clamping the base between a pair of hydrophobic side chains. The insight these results provide into the architecture of enzyme active sites and the development of strategies for the de novo design of protein catalysts is discussed. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Comparison of binding energies of SrcSH2-phosphotyrosyl peptides with structure-based prediction using surface area based empirical parameterization.

PubMed Central

Henriques, D. A.; Ladbury, J. E.; Jackson, R. M.

2000-01-01

The prediction of binding energies from the three-dimensional (3D) structure of a protein-ligand complex is an important goal of biophysics and structural biology. Here, we critically assess the use of empirical, solvent-accessible surface area-based calculations for the prediction of the binding of Src-SH2 domain with a series of tyrosyl phosphopeptides based on the high-affinity ligand from the hamster middle T antigen (hmT), where the residue in the pY+ 3 position has been changed. Two other peptides based on the C-terminal regulatory site of the Src protein and the platelet-derived growth factor receptor (PDGFR) are also investigated. Here, we take into account the effects of proton linkage on binding, and test five different surface area-based models that include different treatments for the contributions to conformational change and protein solvation. These differences relate to the treatment of conformational flexibility in the peptide ligand and the inclusion of proximal ordered solvent molecules in the surface area calculations. This allowed the calculation of a range of thermodynamic state functions (deltaCp, deltaS, deltaH, and deltaG) directly from structure. Comparison with the experimentally derived data shows little agreement for the interaction of SrcSH2 domain and the range of tyrosyl phosphopeptides. Furthermore, the adoption of the different models to treat conformational change and solvation has a dramatic effect on the calculated thermodynamic functions, making the predicted binding energies highly model dependent. While empirical, solvent-accessible surface area based calculations are becoming widely adopted to interpret thermodynamic data, this study highlights potential problems with application and interpretation of this type of approach. There is undoubtedly some agreement between predicted and experimentally determined thermodynamic parameters: however, the tolerance of this approach is not sufficient to make it ubiquitously applicable. PMID:11106171

Role of Ligand Reorganization and Conformational Restraints on the Binding Free Energies of DAPY Non-Nucleoside Inhibitors to HIV Reverse Transcriptase

PubMed Central

Gallicchio, Emilio

2012-01-01

The results of computer simulations of the binding of etravirine (TMC125) and rilpivirine (TMC278) to HIV reverse transcriptase are reported. It is confirmed that consistent binding free energy estimates are obtained with or without the application of torsional restraints when the free energies of imposing the restraints are taken into account. The restraints have a smaller influence on the thermodynamics and apparent kinetics of binding of TMC125 compared to the more flexible TMC278 inhibitor. The concept of the reorganization free energy of binding is useful to understand and categorize these effects. Contrary to expectations, the use of conformational restraints did not consistently enhance convergence of binding free energy estimates due to suppression of binding/unbinding pathways and due to the influence of rotational degrees of freedom not directly controlled by the restraints. Physical insights concerning the thermodynamic driving forces for binding and the role of “jiggling” and “wiggling” motion of the ligands are discussed. Based on these insights we conclude that an ideal inhibitor, if chemically realizable, would possess the electrostatic charge distribution of TMC125, so as to form strong interactions with the receptor, and the larger and more flexible substituents of TMC278, so as to minimize reorganization free energy penalties and the effects of resistance mutations, suitably modified, as in TMC125, so as to disfavor the formation of non-binding competent extended conformations when free in solution. PMID:22708073

Integrating water exclusion theory into βcontacts to predict binding free energy changes and binding hot spots

PubMed Central

2014-01-01

Background Binding free energy and binding hot spots at protein-protein interfaces are two important research areas for understanding protein interactions. Computational methods have been developed previously for accurate prediction of binding free energy change upon mutation for interfacial residues. However, a large number of interrupted and unimportant atomic contacts are used in the training phase which caused accuracy loss. Results This work proposes a new method, βACV ASA , to predict the change of binding free energy after alanine mutations. βACV ASA integrates accessible surface area (ASA) and our newly defined β contacts together into an atomic contact vector (ACV). A β contact between two atoms is a direct contact without being interrupted by any other atom between them. A β contact’s potential contribution to protein binding is also supposed to be inversely proportional to its ASA to follow the water exclusion hypothesis of binding hot spots. Tested on a dataset of 396 alanine mutations, our method is found to be superior in classification performance to many other methods, including Robetta, FoldX, HotPOINT, an ACV method of β contacts without ASA integration, and ACV ASA methods (similar to βACV ASA but based on distance-cutoff contacts). Based on our data analysis and results, we can draw conclusions that: (i) our method is powerful in the prediction of binding free energy change after alanine mutation; (ii) β contacts are better than distance-cutoff contacts for modeling the well-organized protein-binding interfaces; (iii) β contacts usually are only a small fraction number of the distance-based contacts; and (iv) water exclusion is a necessary condition for a residue to become a binding hot spot. Conclusions βACV ASA is designed using the advantages of both β contacts and water exclusion. It is an excellent tool to predict binding free energy changes and binding hot spots after alanine mutation. PMID:24568581

Energetics of protein-DNA interactions.

PubMed

Donald, Jason E; Chen, William W; Shakhnovich, Eugene I

2007-01-01

Protein-DNA interactions are vital for many processes in living cells, especially transcriptional regulation and DNA modification. To further our understanding of these important processes on the microscopic level, it is necessary that theoretical models describe the macromolecular interaction energetics accurately. While several methods have been proposed, there has not been a careful comparison of how well the different methods are able to predict biologically important quantities such as the correct DNA binding sequence, total binding free energy and free energy changes caused by DNA mutation. In addition to carrying out the comparison, we present two important theoretical models developed initially in protein folding that have not yet been tried on protein-DNA interactions. In the process, we find that the results of these knowledge-based potentials show a strong dependence on the interaction distance and the derivation method. Finally, we present a knowledge-based potential that gives comparable or superior results to the best of the other methods, including the molecular mechanics force field AMBER99.

Understanding AuNP interaction with low-generation PAMAM dendrimers: a CIELab and deconvolution study

NASA Astrophysics Data System (ADS)

Jimenez-Ruiz, A.; Carnerero, J. M.; Castillo, P. M.; Prado-Gotor, R.

2017-01-01

Low-generation polyamidoamine (PAMAM) dendrimers are known to adsorb on the surface of gold nanoparticles (AuNPs) causing aggregation and color changes. In this paper, a thorough study of this affinity using absorption spectroscopy, colorimetric, and emission methods has been carried out. Results show that, for citrate-capped gold nanoparticles, interaction with the dendrimer is not only of an electrostatic character but instead occurs, at least in part, through the dendrimer's uncharged internal amino groups. The possibilities of the CIELab chromaticity system parameters' evolution have also been explored in order to quantify dendrimer interaction with the red-colored nanoparticles. By measuring and quantifying 17 nm citrate-capped AuNP color changes, which are strongly dependant on their aggregation state, binding free energies are obtained for the first time for these systems. Results are confirmed via an alternate fitting method which makes use of deconvolution parameters from absorbance spectra. Binding free energies obtained through the use of both means are in good agreement with each other.

Analysis of hydrogen adsorption and surface binding configuration on tungsten using direct recoil spectrometry

DOE PAGES

Kolasinski, R. D.; Hammond, K. D.; Whaley, J. A.; ...

2014-12-03

In our work, we apply low energy ion beam analysis to examine directly how the adsorbed hydrogen concentration and binding configuration on W(1 0 0) depend on temperature. We exposed the tungsten surface to fluxes of both atomic and molecular H and D. We then probed the H isotopes adsorbed along different crystal directions using 1–2 keV Ne + ions. At saturation coverage, H occupies two-fold bridge sites on W(1 0 0) at 25 °C. Moreover, the H coverage dramatically changes the behavior of channeled ions, as does reconstruction of the surface W atoms. For the exposure conditions examined here,more » we find that surface sites remain populated with H until the surface temperature reaches 200 °C. Then, we observe H rapidly desorbing until only a residual concentration remains at 450 °C. Development of an efficient atomistic model that accurately reproduces the experimental ion energy spectra and azimuthal variation of recoiled H is underway.« less

3D calculation of Tucson-Melbourne 3NF effect in triton binding energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadizadeh, M. R.; Tomio, L.; Bayegan, S.

2010-08-04

As an application of the new realistic three-dimensional (3D) formalism reported recently for three-nucleon (3N) bound states, an attempt is made to study the effect of three-nucleon forces (3NFs) in triton binding energy in a non partial wave (PW) approach. The spin-isospin dependent 3N Faddeev integral equations with the inclusion of 3NFs, which are formulated as function of vector Jacobi momenta, specifically the magnitudes of the momenta and the angle between them, are solved with Bonn-B and Tucson-Melbourne NN and 3N forces in operator forms which can be incorporated in our 3D formalism. The comparison with numerical results in both,more » novel 3D and standard PW schemes, shows that non PW calculations avoid the very involved angular momentum algebra occurring for the permutations and transformations and it is more efficient and less cumbersome for considering the 3NF.« less

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

PubMed

Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2014-09-01

In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

NASA Astrophysics Data System (ADS)

Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

2006-03-01

Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

Effects of the Hydroxyl Group on Phenyl Based Ligand/ERRγ Protein Binding

PubMed Central

2015-01-01

Bisphenol-A (4,4′-dihydroxy-2,2-diphenylpropane, BPA, or BPA-A) and its derivatives, when exposed to humans, may affect functions of multiple organs by specific binding to the human estrogen-related receptor γ (ERRγ). We carried out atomistic molecular dynamics (MD) simulations of three ligand compounds including BPA-A, 4-α-cumylphenol (BPA-C), and 2,2-diphenylpropane (BPA-D) binding to the ligand binding domain (LBD) of a human ERRγ to study the structures and energies associated with the binding. We used the implicit Molecular Mechanics/Poisson–Boltzmann Surface Area (MM/PBSA) method to estimate the free energies of binding for the phenyl based compound/ERRγ systems. The addition of hydroxyl groups to the aromatic ring had only a minor effect on binding structures and a significant effect on ligand/protein binding energy in an aqueous solution. Free binding energies of BPA-D to the ERRγ were found to be considerably less than those of BPA-A and BPA-C to the ERRγ. These results are well correlated with those from experiments where no binding affinities were determined in the BPA-D/ERRγ complex. No conformational change was observed for the helix 12 (H-12) of ERRγ upon binding of these compounds preserving an active transcriptional conformation state. PMID:25098505

Global analysis of Skyrme forces with higher-order density dependencies

NASA Astrophysics Data System (ADS)

Zuo, Zhi-Wei; Pei, Jun-Chen; Xiong, Xue-Yu; Zhu, Yi

2018-05-01

The density-dependent term in Skyrme forces is essential to simulate three-body and many-body correlations beyond the low-momentum two-body interaction. We speculate that a single density term may be insufficient and a higher-order density dependent term is added. The present work investigates the influence of higher-order density dependencies based on extended UNEDF0 and SkM* forces. Global descriptions of nuclear masses and charge radii are presented. The extended UNEDF0 force gives a global rms error on binding energies of 1.29 MeV. The influence on fission barriers and equation of state are also investigated. Perspectives to improve Skyrme forces are discussed, including global center-of-mass corrections and Lipkin-Nogami pairing corrections. Supported by National Natural Science Foundation of China (11522538)

Interactions of solute (3p, 4p, 5p and 6p) with solute, vacancy and divacancy in bcc Fe

NASA Astrophysics Data System (ADS)

You, Yu-Wei; Kong, Xiang-Shan; Wu, Xue-Bang; Liu, Wei; Liu, C. S.; Fang, Q. F.; Chen, J. L.; Luo, G.-N.; Wang, Zhiguang

2014-12-01

Solute-vacancy binding energy is a key quantity in understanding solute diffusion kinetics and phase segregation, and may help choice of alloy compositions for future material design. However, the binding energy of solute with vacancy is notoriously difficult to measure and largely unknown in bcc Fe. With first-principles method, we systemically calculate the binding energies of solute (3p, 4p, 5p and 6p alloying solutes are included) with vacancy, divacancy and solute in bcc Fe. The binding energy of Si with vacancy in the present work is in good consistent with experimental value available. All the solutes considered are able to form stable solute-vacancy, solute-divacancy complexes, and the binding strength of solute-divacancy is about two times larger than that of solute-vacancy. Most solutes could not form stable solute-solute complexes except S, Se, In and Tl. The factors controlling the binding energies are analyzed at last.

Calcium-dependent regulation of SNARE-mediated membrane fusion by calmodulin.

PubMed

Di Giovanni, Jerome; Iborra, Cécile; Maulet, Yves; Lévêque, Christian; El Far, Oussama; Seagar, Michael

2010-07-30

Neuroexocytosis requires SNARE proteins, which assemble into trans complexes at the synaptic vesicle/plasma membrane interface and mediate bilayer fusion. Ca(2+) sensitivity is thought to be conferred by synaptotagmin, although the ubiquitous Ca(2+)-effector calmodulin has also been implicated in SNARE-dependent membrane fusion. To examine the molecular mechanisms involved, we examined the direct action of calmodulin and synaptotagmin in vitro, using fluorescence resonance energy transfer to assay lipid mixing between target- and vesicle-SNARE liposomes. Ca(2+)/calmodulin inhibited SNARE assembly and membrane fusion by binding to two distinct motifs located in the membrane-proximal regions of VAMP2 (K(D) = 500 nm) and syntaxin 1 (K(D) = 2 microm). In contrast, fusion was increased by full-length synaptotagmin 1 anchored in vesicle-SNARE liposomes. When synaptotagmin and calmodulin were combined, synaptotagmin overcame the inhibitory effects of calmodulin. Furthermore, synaptotagmin displaced calmodulin binding to target-SNAREs. These findings suggest that two distinct Ca(2+) sensors act antagonistically in SNARE-mediated fusion.

Interaction of arginine oligomer with model membrane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi, Dandan; Guoming, Li; Gao, Li

2007-08-10

Short oligomers of arginine (R8) have been shown to cross readily a variety of biological barriers. A hypothesis was put forward that inverted micelles form in biological membranes in the presence of arginine oligomer peptides, facilitating their transfer through the membranes. In order to define the role of peptide-lipid interaction in this mechanism, we prepared liposomes as the model membrane to study the ability of R8 inducing calcein release from liposomes, the fusion of liposomes, R8 binding to liposomes and membrane disturbing activity of the bound R8. The results show that R8 binding to liposome membrane depends on lipid compositions,more » negative surface charge density and interior water phase pH values of liposomes. R8 has no activity to induce the leakage of calcein from liposomes or improve liposome fusion. R8 does not permeabilize through the membrane spontaneously. These peptides delivering drugs through membranes may depend on receptors and energy.« less

Negatively charged excitons and photoluminescence in asymmetric quantum wells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szlufarska, Izabela; Wojs, Arkadiusz; Quinn, John J.

2001-02-15

We study photoluminescence (PL) of charged excitons (X{sup -}) in narrow asymmetric quantum wells in high magnetic fields B. The binding of all X{sup -} states strongly depends on the separation {delta} of electron and hole layers. The most sensitive is the ''bright'' singlet, whose binding energy decreases quickly with increasing {delta} even at relatively small B. As a result, the value of B at which the singlet-triplet crossing occurs in the X{sup -} spectrum also depends on {delta}, and decreases from 35 T in a symmetric 10 nm GaAs well to 16 T for {delta}=0.5 nm. Since the criticalmore » values of {delta} at which different X{sup -} states unbind are surprisingly small compared to the well width, the observation of strongly bound X{sup -} states in an experimental PL spectrum implies virtually no layer displacement in the sample. This casts doubt on the interpretation of PL spectra of heterojunctions in terms of X{sup -} recombination.« less

Modulated photophysics of a cationic DNA-staining dye inside protein bovine serum albumin: study of binding interaction and structural changes of protein.

PubMed

Samanta, Anuva; Jana, Sankar; Ray, Debarati; Guchhait, Nikhil

2014-01-01

The binding affinity of cationic DNA-staining dye, propidium iodide, with transport protein, bovine serum albumin, has been explored using UV-vis absorption, fluorescence, and circular dichroism spectroscopy. Steady state and time resolved fluorescence studies authenticate that fluorescence quenching of bovine serum albumin by propidium iodide is due to bovine serum albumin-propidium iodide complex formation. Thermodynamic parameters obtained from temperature dependent spectral studies cast light on binding interaction between the probe and protein. Site marker competitive binding has been encountered using phenylbutazone and flufenamic acid for site I and site II, respectively. Energy transfer efficiency and distance between bovine serum albumin and propidium iodide have been determined using Förster mechanism. Structural stabilization or destabilization of protein by propidium iodide has been investigated by urea denaturation study. The circular dichroism study as well as FT-IR measurement demonstrates some configurational changes of the protein in presence of the dye. Docking studies support the experimental data thereby reinforcing the binding site of the probe to the subdomain IIA of bovine serum albumin. Copyright © 2013 Elsevier B.V. All rights reserved.

Exciton binding energy in GaAsBiN spherical quantum dot heterostructures

NASA Astrophysics Data System (ADS)

Das, Subhasis; Dhar, S.

2017-03-01

The ground state exciton binding energies (EBE) of heavy hole excitons in GaAs1-x-yBixNy - GaAs spherical quantum dots (QD) are calculated using a variational approach under 1s hydrogenic wavefunctions within the framework of effective mass approximation. Both the nitrogen and the bismuth content in the material are found to affect the binding energy, in particular for larger nitrogen content and lower dot radii. Calculations also show that the ground state exciton binding energies of heavy holes increase more at smaller dot sizes as compared to that for the light hole excitons.

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

On the contribution of vibrational anharmonicity to the binding energies of water clusters.

PubMed

Diri, Kadir; Myshakin, Evgeniy M; Jordan, Kenneth D

2005-05-05

The second-order vibrational perturbation theory method has been used together with the B3LYP and MP2 electronic structure methods to investigate the effects of anharmonicity on the vibrational zero-point energy (ZPE) contributions to the binding energies of (H2O)n, n = 2-6, clusters. For the low-lying isomers of (H2O)6, the anharmonicity correction to the binding energy is calculated to range from -248 to -355 cm(-1). It is also demonstrated that although high-order electron correlation effects are important for the individual vibrational frequencies, they are relatively unimportant for the net ZPE contributions to the binding energies of water clusters.

The positive binding energy envelopes of low-mass helium stars

NASA Astrophysics Data System (ADS)

Hall, Philip D.; Jeffery, C. Simon

2018-04-01

It has been hypothesized that stellar envelopes with positive binding energy may be ejected if the release of recombination energy can be triggered and the calculation of binding energy includes this contribution. The implications of this hypothesis for the evolution of normal hydrogen-rich stars have been investigated, but the implications for helium stars - which may represent mass-transfer or merger remnants in binary star systems - have not. Making a set of model helium stars, we find that those with masses between 0.9 and 2.4 M⊙ evolve to configurations with positive binding energy envelopes. We discuss consequences of the ejection hypothesis for such stars, and possible observational tests of these predictions.

Munc13-4 reconstitutes calcium-dependent SNARE-mediated membrane fusion

PubMed Central

Boswell, Kristin L.; James, Declan J.; Esquibel, Joseph M.; Bruinsma, Stephen; Shirakawa, Ryutaro; Horiuchi, Hisanori

2012-01-01

Munc13-4 is a widely expressed member of the CAPS/Munc13 protein family proposed to function in priming secretory granules for exocytosis. Munc13-4 contains N- and C-terminal C2 domains (C2A and C2B) predicted to bind Ca2+, but Ca2+-dependent regulation of Munc13-4 activity has not been described. The C2 domains bracket a predicted SNARE-binding domain, but whether Munc13-4 interacts with SNARE proteins is unknown. We report that Munc13-4 bound Ca2+ and restored Ca2+-dependent granule exocytosis to permeable cells (platelets, mast, and neuroendocrine cells) dependent on putative Ca2+-binding residues in C2A and C2B. Munc13-4 exhibited Ca2+-stimulated SNARE interactions dependent on C2A and Ca2+-dependent membrane binding dependent on C2B. In an apparent coupling of membrane and SNARE binding, Munc13-4 stimulated SNARE-dependent liposome fusion dependent on putative Ca2+-binding residues in both C2A and C2B domains. Munc13-4 is the first priming factor shown to promote Ca2+-dependent SNARE complex formation and SNARE-mediated liposome fusion. These properties of Munc13-4 suggest its function as a Ca2+ sensor at rate-limiting priming steps in granule exocytosis. PMID:22508512

Munc13-4 reconstitutes calcium-dependent SNARE-mediated membrane fusion.

PubMed

Boswell, Kristin L; James, Declan J; Esquibel, Joseph M; Bruinsma, Stephen; Shirakawa, Ryutaro; Horiuchi, Hisanori; Martin, Thomas F J

2012-04-16

Munc13-4 is a widely expressed member of the CAPS/Munc13 protein family proposed to function in priming secretory granules for exocytosis. Munc13-4 contains N- and C-terminal C2 domains (C2A and C2B) predicted to bind Ca(2+), but Ca(2+)-dependent regulation of Munc13-4 activity has not been described. The C2 domains bracket a predicted SNARE-binding domain, but whether Munc13-4 interacts with SNARE proteins is unknown. We report that Munc13-4 bound Ca(2+) and restored Ca(2+)-dependent granule exocytosis to permeable cells (platelets, mast, and neuroendocrine cells) dependent on putative Ca(2+)-binding residues in C2A and C2B. Munc13-4 exhibited Ca(2+)-stimulated SNARE interactions dependent on C2A and Ca(2+)-dependent membrane binding dependent on C2B. In an apparent coupling of membrane and SNARE binding, Munc13-4 stimulated SNARE-dependent liposome fusion dependent on putative Ca(2+)-binding residues in both C2A and C2B domains. Munc13-4 is the first priming factor shown to promote Ca(2+)-dependent SNARE complex formation and SNARE-mediated liposome fusion. These properties of Munc13-4 suggest its function as a Ca(2+) sensor at rate-limiting priming steps in granule exocytosis.

SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

PubMed

Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

2016-04-12

Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

Prediction of Ras-effector interactions using position energy matrices.

PubMed

Kiel, Christina; Serrano, Luis

2007-09-01

One of the more challenging problems in biology is to determine the cellular protein interaction network. Progress has been made to predict protein-protein interactions based on structural information, assuming that structural similar proteins interact in a similar way. In a previous publication, we have determined a genome-wide Ras-effector interaction network based on homology models, with a high accuracy of predicting binding and non-binding domains. However, for a prediction on a genome-wide scale, homology modelling is a time-consuming process. Therefore, we here successfully developed a faster method using position energy matrices, where based on different Ras-effector X-ray template structures, all amino acids in the effector binding domain are sequentially mutated to all other amino acid residues and the effect on binding energy is calculated. Those pre-calculated matrices can then be used to score for binding any Ras or effector sequences. Based on position energy matrices, the sequences of putative Ras-binding domains can be scanned quickly to calculate an energy sum value. By calibrating energy sum values using quantitative experimental binding data, thresholds can be defined and thus non-binding domains can be excluded quickly. Sequences which have energy sum values above this threshold are considered to be potential binding domains, and could be further analysed using homology modelling. This prediction method could be applied to other protein families sharing conserved interaction types, in order to determine in a fast way large scale cellular protein interaction networks. Thus, it could have an important impact on future in silico structural genomics approaches, in particular with regard to increasing structural proteomics efforts, aiming to determine all possible domain folds and interaction types. All matrices are deposited in the ADAN database (http://adan-embl.ibmc.umh.es/). Supplementary data are available at Bioinformatics online.

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Improving the treatment of coarse-grain electrostatics: CVCEL.

PubMed

Ceres, N; Lavery, R

2015-12-28

We propose an analytic approach for calculating the electrostatic energy of proteins or protein complexes in aqueous solution. This method, termed CVCEL (Circular Variance Continuum ELectrostatics), is fitted to Poisson calculations and is able to reproduce the corresponding energies for different choices of solute dielectric constant. CVCEL thus treats both solute charge interactions and charge self-energies, and it can also deal with salt solutions. Electrostatic damping notably depends on the degree of solvent exposure of the charges, quantified here in terms of circular variance, a measure that reflects the vectorial distribution of the neighbors around a given center. CVCEL energies can be calculated rapidly and have simple analytical derivatives. This approach avoids the need for calculating effective atomic volumes or Born radii. After describing how the method was developed, we present test results for coarse-grain proteins of different shapes and sizes, using different internal dielectric constants and different salt concentrations and also compare the results with those from simple distance-dependent models. We also show that the CVCEL approach can be used successfully to calculate the changes in electrostatic energy associated with changes in protein conformation or with protein-protein binding.

Influences of Mutations on the Electrostatic Binding Free Energies of Chloride Ions in Escherichia Coli ClC

PubMed Central

Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin

2012-01-01

Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase

PubMed Central

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N.; Jiang, Hualiang

2013-01-01

Drug-target residence time (t = 1/koff, where koff is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, koff and activation free energy of dissociation (). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer’s disease drug (−)−Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (−)−Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development. PMID:23440190

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase.

PubMed

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N; Jiang, Hualiang

2013-03-12

Drug-target residence time (t = 1/k(off), where k(off) is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, k(off) and activation free energy of dissociation (ΔG(off)≠). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer's disease drug (-)-Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (-)-Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development.

Calcium-dependent antigen binding as a novel modality for antibody recycling by endosomal antigen dissociation

PubMed Central

Hironiwa, N; Ishii, S; Kadono, S; Iwayanagi, Y; Mimoto, F; Habu, K; Igawa, T; Hattori, K

2016-01-01

The pH-dependent antigen binding antibody, termed a recycling antibody, has recently been reported as an attractive type of second-generation engineered therapeutic antibody. A recycling antibody can dissociate antigen in the acidic endosome, and thus bind to its antigen multiple times. As a consequence, a recycling antibody can neutralize large amounts of antigen in plasma. Because this approach relies on histidine residues to achieve pH-dependent antigen binding, which could limit the epitopes that can be targeted and affect the rate of antigen dissociation in the endosome, we explored an alternative approach for generating recycling antibodies. Since calcium ion concentration is known to be lower in endosome than in plasma, we hypothesized that an antibody with antigen-binding properties that are calcium-dependent could be used as recycling antibody. Here, we report a novel anti-interleukin-6 receptor (IL-6R) antibody, identified from a phage library that binds to IL-6R only in the presence of a calcium ion. Thermal dynamics and a crystal structure study revealed that the calcium ion binds to the heavy chain CDR3 region (HCDR3), which changes and possibly stabilizes the structure of HCDR3 to make it bind to antigen calcium dependently (PDB 5AZE). In vitro and in vivo studies confirmed that this calcium-dependent antigen-binding antibody can dissociate its antigen in the endosome and accelerate antigen clearance from plasma, making it a novel approach for generating recycling antibody. PMID:26496237

Evidence of bovine serum albumin-viologen herbicide binding interaction and associated structural modifications

NASA Astrophysics Data System (ADS)

Roy, Swarup; Saxena, Shailendra K.; Mishra, Suryakant; Yogi, Priyanka; Sagdeo, P. R.; Kumar, Rajesh

2017-07-01

The binding ability of viologen herbicide with bovine serum albumin (BSA) has been investigated to understand viologen associated hazards by investigating ethyl viologen's (EV) binding using various spectroscopies and in-silico molecular docking approaches. Apparent association constant (1.3 × 104 L/mol), calculated using UV-Vis spectra indicating a moderate complex formation between BSA and EV. A static mode of fluorescence quenching has been observed as evident from inverse temperature dependence of Stern-Volmer quenching constant which also confirms an EV-BSA complex formation. Emission and time resolved fluorescence studies reveal that the emission quenching of BSA with EV is initiated by static quenching mechanism. A moderately strong binding affinity between EV and BSA has been observed (binding constant value of 7.58 × 104 L/Mol) using fluorescence quenching titration, obtained at 298 K. Quantitative measurements of thermodynamic parameters like enthalpy and entropy changes clearly indicates hydrophobic force responsible for EV-BSA complex formation. The binding distance between EV and BSA was found to be 4.48 nm are involved in non-radiative energy transfer process. Furthermore, from the circular dichroism spectra it was observed that addition of EV is also found to change the secondary structure of BSA which leads to decrease in α-helix. Above mentioned results are found to be in consonance with molecular docking simulations and supports the EV-BSA binding.

A computational docking study on the pH dependence of peptide binding to HLA-B27 sub-types differentially associated with ankylosing spondylitis

NASA Astrophysics Data System (ADS)

Serçinoğlu, Onur; Özcan, Gülin; Kabaş, Zeynep Kutlu; Ozbek, Pemra

2016-07-01

A single amino acid difference (Asp116His), having a key role in a pathogenesis pathway, distinguishes HLA-B*27:05 and HLA-B*27:09 sub-types as associated and non-associated with ankylosing spondylitis, respectively. In this study, molecular docking simulations were carried out with the aim of comprehending the differences in the binding behavior of both alleles at varying pH conditions. A library of modeled peptides was formed upon single point mutations aiming to address the effect of 20 naturally occurring amino acids at the binding core peptide positions. For both alleles, computational docking was applied using Autodock 4.2. Obtained free energies of binding (FEB) were compared within the peptide library and between the alleles at varying pH conditions. The amino acid preferences of each position were studied enlightening the role of each on binding. The preferred amino acids for each position of pVIPR were found to be harmonious with experimental studies. Our results indicate that, as the pH is lowered, the capacity of HLA-B*27:05 to bind peptides in the library is largely lost. Hydrogen bonding analysis suggests that the interaction between the main anchor positions of pVIPR and their respective binding pocket residues are affected from the pH the most, causing an overall shift in the FEB profiles.

A computational docking study on the pH dependence of peptide binding to HLA-B27 sub-types differentially associated with ankylosing spondylitis.

PubMed

Serçinoğlu, Onur; Özcan, Gülin; Kabaş, Zeynep Kutlu; Ozbek, Pemra

2016-07-01

A single amino acid difference (Asp116His), having a key role in a pathogenesis pathway, distinguishes HLA-B*27:05 and HLA-B*27:09 sub-types as associated and non-associated with ankylosing spondylitis, respectively. In this study, molecular docking simulations were carried out with the aim of comprehending the differences in the binding behavior of both alleles at varying pH conditions. A library of modeled peptides was formed upon single point mutations aiming to address the effect of 20 naturally occurring amino acids at the binding core peptide positions. For both alleles, computational docking was applied using Autodock 4.2. Obtained free energies of binding (FEB) were compared within the peptide library and between the alleles at varying pH conditions. The amino acid preferences of each position were studied enlightening the role of each on binding. The preferred amino acids for each position of pVIPR were found to be harmonious with experimental studies. Our results indicate that, as the pH is lowered, the capacity of HLA-B*27:05 to bind peptides in the library is largely lost. Hydrogen bonding analysis suggests that the interaction between the main anchor positions of pVIPR and their respective binding pocket residues are affected from the pH the most, causing an overall shift in the FEB profiles.

Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study

PubMed Central

Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

2011-01-01

Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570

Understanding the mechanisms of protein-DNA interactions

NASA Astrophysics Data System (ADS)

Lavery, Richard

2004-03-01

Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

Comments on polytropes

NASA Astrophysics Data System (ADS)

Ivanov, V. V.; Ilin, V. B.

The dimensionless central pressure pc = 4πR4Pc/GM2, gravitational binding energy ω = -ΩR/GM2 and moment of inertia i = I/MR2 of an arbitrary spherical configuration in hydrostatic equilibrium are shown to satisfy the inequalities pc ≥ 8 ω4, i ≥ 2/(125 ω2). The dependence of global characteristics of polytropes such as pc, i, central temperature tc = TcRR/μGM etc. on polytropic index n is studied.

Mahan excitons in Weyl semimetals

NASA Astrophysics Data System (ADS)

Garate, Ion; Bertrand, Simon; Côté, René

We report on a theoretical study of excitons in weakly doped Weyl semimetals. Solving a two-body Coulomb problem in the presence of a monopole Berry vector potential, we obtain the binding energies of electron-hole pairs and establish their dependence on the monopole charge and on the sign of the magnetic quantum number. We discuss the implications of our results for optical absorption experiments. This research has been supported by Canada's NSERC and Québec's RQMP.

Approximations to complete basis set-extrapolated, highly correlated non-covalent interaction energies.

PubMed

Mackie, Iain D; DiLabio, Gino A

2011-10-07

The first-principles calculation of non-covalent (particularly dispersion) interactions between molecules is a considerable challenge. In this work we studied the binding energies for ten small non-covalently bonded dimers with several combinations of correlation methods (MP2, coupled-cluster single double, coupled-cluster single double (triple) (CCSD(T))), correlation-consistent basis sets (aug-cc-pVXZ, X = D, T, Q), two-point complete basis set energy extrapolations, and counterpoise corrections. For this work, complete basis set results were estimated from averaged counterpoise and non-counterpoise-corrected CCSD(T) binding energies obtained from extrapolations with aug-cc-pVQZ and aug-cc-pVTZ basis sets. It is demonstrated that, in almost all cases, binding energies converge more rapidly to the basis set limit by averaging the counterpoise and non-counterpoise corrected values than by using either counterpoise or non-counterpoise methods alone. Examination of the effect of basis set size and electron correlation shows that the triples contribution to the CCSD(T) binding energies is fairly constant with the basis set size, with a slight underestimation with CCSD(T)∕aug-cc-pVDZ compared to the value at the (estimated) complete basis set limit, and that contributions to the binding energies obtained by MP2 generally overestimate the analogous CCSD(T) contributions. Taking these factors together, we conclude that the binding energies for non-covalently bonded systems can be accurately determined using a composite method that combines CCSD(T)∕aug-cc-pVDZ with energy corrections obtained using basis set extrapolated MP2 (utilizing aug-cc-pVQZ and aug-cc-pVTZ basis sets), if all of the components are obtained by averaging the counterpoise and non-counterpoise energies. With such an approach, binding energies for the set of ten dimers are predicted with a mean absolute deviation of 0.02 kcal/mol, a maximum absolute deviation of 0.05 kcal/mol, and a mean percent absolute deviation of only 1.7%, relative to the (estimated) complete basis set CCSD(T) results. Use of this composite approach to an additional set of eight dimers gave binding energies to within 1% of previously published high-level data. It is also shown that binding within parallel and parallel-crossed conformations of naphthalene dimer is predicted by the composite approach to be 9% greater than that previously reported in the literature. The ability of some recently developed dispersion-corrected density-functional theory methods to predict the binding energies of the set of ten small dimers was also examined. © 2011 American Institute of Physics

Enhanced conformational sampling to visualize a free-energy landscape of protein complex formation.

PubMed

Iida, Shinji; Nakamura, Haruki; Higo, Junichi

2016-06-15

We introduce various, recently developed, generalized ensemble methods, which are useful to sample various molecular configurations emerging in the process of protein-protein or protein-ligand binding. The methods introduced here are those that have been or will be applied to biomolecular binding, where the biomolecules are treated as flexible molecules expressed by an all-atom model in an explicit solvent. Sampling produces an ensemble of conformations (snapshots) that are thermodynamically probable at room temperature. Then, projection of those conformations to an abstract low-dimensional space generates a free-energy landscape. As an example, we show a landscape of homo-dimer formation of an endothelin-1-like molecule computed using a generalized ensemble method. The lowest free-energy cluster at room temperature coincided precisely with the experimentally determined complex structure. Two minor clusters were also found in the landscape, which were largely different from the native complex form. Although those clusters were isolated at room temperature, with rising temperature a pathway emerged linking the lowest and second-lowest free-energy clusters, and a further temperature increment connected all the clusters. This exemplifies that the generalized ensemble method is a powerful tool for computing the free-energy landscape, by which one can discuss the thermodynamic stability of clusters and the temperature dependence of the cluster networks. © 2016 The Author(s).

Computational active site analysis of molecular pathways to improve functional classification of enzymes.

PubMed

Ozyurt, A Sinem; Selby, Thomas L

2008-07-01

This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.

Orientation-dependent structural and photocatalytic properties of LaCoO3 epitaxial nano-thin films

NASA Astrophysics Data System (ADS)

Zhang, Yan-ping; Liu, Hai-feng; Hu, Hai-long; Xie, Rui-shi; Ma, Guo-hua; Huo, Ji-chuan; Wang, Hai-bin

2018-02-01

LaCoO3 epitaxial films were grown on (100), (110) and (111) oriented LaAlO3 substrates by the polymer-assisted deposition method. Crystal structure measurement and cross-section observation indicate that all the LaCoO3 films are epitaxially grown in accordance with the orientation of LaAlO3 substrates, with biaxial compressive strain in the ab plane. Owing to the different strain directions of CoO6 octahedron, the mean Co-O bond length increases by different amounts in (100), (110) and (111) oriented films compared with that of bulk LaCoO3, and the (100) oriented LaCoO3 has the largest increase. Photocatalytic degradation of methyl orange indicates that the order of photocatalytic activity of the three oriented films is (100) > (111) > (110). Combined with analysis of electronic nature and band structure for LaCoO3 films, it is found that the change of the photocatalytic activity is closely related to the crystal field splitting energy of Co3+ and Co-O binding energy. The increase in the mean Co-O bond length will decrease the crystal field splitting energy of Co3+ and Co-O binding energy and further reduce the value of band gap energy, thus improving the photocatalytic activity. This may also provide a clue for expanding the visible-light-induced photocatalytic application of LaCoO3.

Reshaping the Energy Landscape Transforms the Mechanism and Binding Kinetics of DNA Threading Intercalation.

PubMed

Clark, Andrew G; Naufer, M Nabuan; Westerlund, Fredrik; Lincoln, Per; Rouzina, Ioulia; Paramanathan, Thayaparan; Williams, Mark C

2018-02-06

Molecules that bind DNA via threading intercalation show high binding affinity as well as slow dissociation kinetics, properties ideal for the development of anticancer drugs. To this end, it is critical to identify the specific molecular characteristics of threading intercalators that result in optimal DNA interactions. Using single-molecule techniques, we quantify the binding of a small metal-organic ruthenium threading intercalator (Δ,Δ-B) and compare its binding characteristics to a similar molecule with significantly larger threading moieties (Δ,Δ-P). The binding affinities of the two molecules are the same, while comparison of the binding kinetics reveals significantly faster kinetics for Δ,Δ-B. However, the kinetics is still much slower than that observed for conventional intercalators. Comparison of the two threading intercalators shows that the binding affinity is modulated independently by the intercalating section and the binding kinetics is modulated by the threading moiety. In order to thread DNA, Δ,Δ-P requires a "lock mechanism", in which a large length increase of the DNA duplex is required for both association and dissociation. In contrast, measurements of the force-dependent binding kinetics show that Δ,Δ-B requires a large DNA length increase for association but no length increase for dissociation from DNA. This contrasts strongly with conventional intercalators, for which almost no DNA length change is required for association but a large DNA length change must occur for dissociation. This result illustrates the fundamentally different mechanism of threading intercalation compared with conventional intercalation and will pave the way for the rational design of therapeutic drugs based on DNA threading intercalation.

A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure-activity relationships using comparative binding energy (COMBINE) analysis.

PubMed

Coderch, Claire; Tang, Yong; Klett, Javier; Zhang, Shu-En; Ma, Yun-Tao; Shaorong, Wang; Matesanz, Ruth; Pera, Benet; Canales, Angeles; Jiménez-Barbero, Jesús; Morreale, Antonio; Díaz, J Fernando; Fang, Wei-Shuo; Gago, Federico

2013-05-14

Ten novel taxanes bearing modifications at the C2 and C13 positions of the baccatin core have been synthesized and their binding affinities for mammalian tubulin have been experimentally measured. The design strategy was guided by (i) calculation of interaction energy maps with carbon, nitrogen and oxygen probes within the taxane-binding site of β-tubulin, and (ii) the prospective use of a structure-based QSAR (COMBINE) model derived from an earlier series comprising 47 congeneric taxanes. The tubulin-binding affinity displayed by one of the new compounds (CTX63) proved to be higher than that of docetaxel, and an updated COMBINE model provided a good correlation between the experimental binding free energies and a set of weighted residue-based ligand-receptor interaction energies for 54 out of the 57 compounds studied. The remaining three outliers from the original training series have in common a large unfavourable entropic contribution to the binding free energy that we attribute to taxane preorganization in aqueous solution in a conformation different from that compatible with tubulin binding. Support for this proposal was obtained from solution NMR experiments and molecular dynamics simulations in explicit water. Our results shed additional light on the determinants of tubulin-binding affinity for this important class of antitumour agents and pave the way for further rational structural modifications.

Interaction of antithrombin with sulfated, low molecular weight lignins: opportunities for potent, selective modulation of antithrombin function.

PubMed

Henry, Brian L; Connell, Justin; Liang, Aiye; Krishnasamy, Chandravel; Desai, Umesh R

2009-07-31

Antithrombin, a major regulator of coagulation and angiogenesis, is known to interact with several natural sulfated polysaccharides. Previously, we prepared sulfated low molecular weight variants of natural lignins, called sulfated dehydrogenation polymers (DHPs) (Henry, B. L., Monien, B. H., Bock, P. E., and Desai, U. R. (2007) J. Biol. Chem. 282, 31891-31899), which have now been found to exhibit interesting antithrombin binding properties. Sulfated DHPs represent a library of diverse noncarbohydrate aromatic scaffolds that possess structures completely different from heparin and heparan sulfate. Fluorescence binding studies indicate that sulfated DHPs bind to antithrombin with micromolar affinity under physiological conditions. Salt dependence of binding affinity indicates that the antithrombin-sulfated DHP interaction involves a massive 80-87% non-ionic component to the free energy of binding. Competitive binding studies with heparin pentasaccharide, epicatechin sulfate, and full-length heparin indicate that sulfated DHPs bind to both the pentasaccharide-binding site and extended heparin-binding site of antithrombin. Affinity capillary electrophoresis resolves a limited number of peaks of antithrombin co-complexes suggesting preferential binding of selected DHP structures to the serpin. Computational genetic algorithm-based virtual screening study shows that only one sulfated DHP structure, out of the 11 present in a library of plausible sequences, bound in the heparin-binding site with a high calculated score supporting selectivity of recognition. Enzyme inhibition studies indicate that only one of the three sulfated DHPs studied is a potent inhibitor of free factor VIIa in the presence of antithrombin. Overall, the chemo-enzymatic origin and antithrombin binding properties of sulfated DHPs present novel opportunities for potent and selective modulation of the serpin function, especially for inhibiting the initiation phase of hemostasis.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

H{sub 2} Ortho-to-para Conversion on Grains: A Route to Fast Deuterium Fractionation in Dense Cloud Cores?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bovino, S.; Grassi, T.; Schleicher, D. R. G.

Deuterium fractionation, i.e., the enhancement of deuterated species with respect to non-deuterated ones, is considered to be a reliable chemical clock of star-forming regions. This process is strongly affected by the ortho-to-para H{sub 2} ratio. In this Letter we explore the effect of the ortho–para (o–p) H{sub 2} conversion on grains on the deuteration timescale in fully-depleted dense cores, including the most relevant uncertainties that affect this complex process. We show that (i) the o–p H{sub 2} conversion on grains is not strongly influenced by the uncertainties on the conversion time and the sticking coefficient, and (ii) that the processmore » is controlled by the temperature and the residence time of ortho-H{sub 2} on the surface, i.e., by the binding energy. We find that for binding energies between 330 and 550 K, depending on the temperature, the o–p H{sub 2} conversion on grains can shorten the deuterium fractionation timescale by orders of magnitude, opening a new route for explaining the large observed deuteration fraction D {sub frac} in dense molecular cloud cores. Our results suggest that the star formation timescale, when estimated through the timescale to reach the observed deuteration fractions, might be shorter than previously proposed. However, more accurate measurements of the binding energy are needed in order to better assess the overall role of this process.« less

Aqueous ionic liquids and their influence on peptide conformations: denaturation and dehydration mechanisms.

PubMed

Diddens, Diddo; Lesch, Volker; Heuer, Andreas; Smiatek, Jens

2017-08-09

Low concentrated aqueous ionic liquids (ILs) and their influence on protein structures have attracted a lot of interest over the last few years. This can be mostly attributed to the fact that aqueous ILs, depending on the ion species involved, can be used as protein protectants or protein denaturants. Atomistic molecular dynamics (MD) simulations are performed in order to study the influence of different aprotic ILs on the properties of a short hairpin peptide. Our results reveal distinct binding and denaturation effects for 1-ethyl-3-methylimidazolium (EMIM) in combination with different anions, namely, chloride (CL), tetrafluoroborate (BF4) and acetate (ACE). The simulation outcomes demonstrate that the studied ILs with larger anions reveal a more pronounced accumulation behavior of the individual ion species around the peptide, which is accomplished by a stronger dehydration effect. We can relate these findings to the implications of the Kirkwood-Buff theory, which provides a thermodynamic explanation for the denaturation strength in terms of the IL accumulation behavior. The results for the spatial distribution functions, the binding energies and the local/bulk partition coefficients are in good agreement with metadynamics simulations in order to determine the energetically most stable peptide conformations. The free energy landscapes indicate a decrease of the denaturation strength in the order EMIM/ACE, EMIM/BF4 and EMIM/CL, which coincides with a decreasing size of the anion species. An analysis of the potential binding energies reveals that this effect is mainly of enthalpic nature.

Role of Desolvation in Thermodynamics and Kinetics of Ligand Binding to a Kinase

PubMed Central

2015-01-01

Computer simulations are used to determine the free energy landscape for the binding of the anticancer drug Dasatinib to its src kinase receptor and show that before settling into a free energy basin the ligand must surmount a free energy barrier. An analysis based on using both the ligand-pocket separation and the pocket-water occupancy as reaction coordinates shows that the free energy barrier is a result of the free energy cost for almost complete desolvation of the binding pocket. The simulations further show that the barrier is not a result of the reorganization free energy of the binding pocket. Although a continuum solvent model gives the location of free energy minima, it is not able to reproduce the intermediate free energy barrier. Finally, it is shown that a kinetic model for the on rate constant in which the ligand diffuses up to a doorway state and then surmounts the desolvation free energy barrier is consistent with published microsecond time-scale simulations of the ligand binding kinetics for this system [Shaw, D. E. et al. J. Am. Chem. Soc.2011, 133, 9181−918321545110]. PMID:25516727

[Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

PubMed

Dambinova, S A; Gorodinskiĭ, A I

1984-01-01

The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

Constraining the surface properties of effective Skyrme interactions

NASA Astrophysics Data System (ADS)

Jodon, R.; Bender, M.; Bennaceur, K.; Meyer, J.

2016-08-01

Background: Deformation energy surfaces map how the total binding energy of a nuclear system depends on the geometrical properties of intrinsic configurations, thereby providing a powerful tool to interpret nuclear spectroscopy and large-amplitude collective-motion phenomena such as fission. The global behavior of the deformation energy is known to be directly connected to the surface properties of the effective interaction used for its calculation. Purpose: The precise control of surface properties during the parameter adjustment of an effective interaction is key to obtain a reliable and predictive description of nuclear properties. The most relevant indicator is the surface-energy coefficient asurf. There are several possibilities for its definition and estimation, which are not fully equivalent and require a computational effort that can differ by orders of magnitude. The purpose of this study is threefold: first, to identify a scheme for the determination of asurf that offers the best compromise between robustness, precision, and numerical efficiency; second, to analyze the correlation between values for asurf and the characteristic energies of the fission barrier of 240Pu; and third, to lay out an efficient and robust procedure for how the deformation properties of the Skyrme energy density functional (EDF) can be constrained during the parameter fit. Methods: There are several frequently used possibilities to define and calculate the surface energy coefficient asurf of effective interactions built for the purpose of self-consistent mean-field calculations. The most direct access is provided by the model system of semi-infinite nuclear matter, but asurf can also be extracted from the systematics of binding energies of finite nuclei. Calculations can be carried out either self-consistently [Hartree-Fock (HF)], which incorporates quantal shell effects, or in one of the semiclassical extended Thomas-Fermi (ETF) or modified Thomas-Fermi (MTF) approximations. The latter is of particular interest because it provides asurf as a numerical integral without the need to solve self-consistent equations. Results for semi-infinite nuclear matter obtained with the HF, ETF, and MTF methods will be compared with one another and with asurf, as deduced from ETF calculations of very heavy fictitious nuclei. Results: The surface energy coefficient of 76 parametrizations of the Skyrme EDF have been calculated. Values obtained with the HF, ETF, and MTF methods are not identical, but differ by fairly constant systematic offsets. By contrast, extracting asurf from the binding energy of semi-infinite matter or of very large nuclei within the same method gives the same result within the numerical uncertainties. Conclusions: Despite having some drawbacks compared to the other methods studied here, the MTF approach provides sufficiently precise values for asurf such that it can be used as a very robust constraint on surface properties during a parameter fit at negligible additional cost. While the excitation energy of superdeformed states and the height of fission barriers is obviously strongly correlated to asurf, the presence of shell effects prevents a one-to-one correspondence between them. As in addition the value of asurf providing realistic fission barriers depends on the choices made for corrections for spurious motion, its "best value" (within a given scheme to calculate it) depends on the fit protocol. Through the construction of a series of eight parametrizations SLy5s1-SLy5s8 of the standard Skyrme EDF with systematically varied asurf value, it is shown how to arrive at a fit with realistic deformation properties.

Noncovalent Interactions of Tiopronin-Protected Gold Nanoparticles with DNA: Two Methods to Quantify Free Energy of Binding

PubMed Central

Prado-Gotor, R.; Grueso, E.

2014-01-01

The binding of gold nanoparticles capped with N-(2-mercaptopropionyl)glycine (Au@tiopronin) with double-stranded DNA has been investigated and quantified in terms of free energies by using two different approaches. The first approach follows the DNA conformational changes induced by gold nanoparticles using the CD technique. The second methodology consists in the use of pyrene-1-carboxaldehyde as a fluorescent probe. This second procedure implies the determination of the “true” free energy of binding of the probe with DNA, after corrections through solubility measurements. Working at different salt concentrations, the nonelectrostatic and electrostatic components of the binding free energy have been separated. The results obtained revealed that the binding is of nonelectrostatic character, fundamentally. The procedure used in this work could be extended to quantify the binding affinity of other AuNPs/DNA systems. PMID:24587710

Topological Interaction by Entanglement of DNA

NASA Astrophysics Data System (ADS)

Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

2012-02-01

We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

PubMed

Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

2017-05-02

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

REVIEW ARTICLE: How do biomolecular systems speed up and regulate rates?

NASA Astrophysics Data System (ADS)

Zhou, Huan-Xiang

2005-09-01

The viability of a biological system depends upon careful regulation of the rates of various processes. These rates have limits imposed by intrinsic chemical or physical steps (e.g., diffusion). These limits can be expanded by interactions and dynamics of the biomolecules. For example, (a) a chemical reaction is catalyzed when its transition state is preferentially bound to an enzyme; (b) the folding of a protein molecule is speeded up by specific interactions within the transition-state ensemble and may be assisted by molecular chaperones; (c) the rate of specific binding of a protein molecule to a cellular target can be enhanced by mechanisms such as long-range electrostatic interactions, nonspecific binding and folding upon binding; (d) directional movement of motor proteins is generated by capturing favorable Brownian motion through intermolecular binding energy; and (e) conduction and selectivity of ions through membrane channels are controlled by interactions and the dynamics of channel proteins. Simple physical models are presented here to illustrate these processes and provide a unifying framework for understanding speed attainment and regulation in biomolecular systems.

Structure-based virtual screening and characterization of a novel IL-6 antagonistic compound from synthetic compound database.

PubMed

Wang, Jing; Qiao, Chunxia; Xiao, He; Lin, Zhou; Li, Yan; Zhang, Jiyan; Shen, Beifen; Fu, Tinghuan; Feng, Jiannan

2016-01-01

According to the three-dimensional (3D) complex structure of (hIL-6⋅hIL-6R⋅gp 130) 2 and the binding orientation of hIL-6, three compounds with high affinity to hIL-6R and bioactivity to block hIL-6 in vitro were screened theoretically from the chemical databases, including 3D-Available Chemicals Directory (ACD) and MDL Drug Data Report (MDDR), by means of the computer-guided virtual screening method. Using distance geometry, molecular modeling and molecular dynamics trajectory analysis methods, the binding mode and binding energy of the three compounds were evaluated theoretically. Enzyme-linked immunosorbent assay analysis demonstrated that all the three compounds could block IL-6 binding to IL-6R specifically. However, only compound 1 could effectively antagonize the function of hIL-6 and inhibit the proliferation of XG-7 cells in a dose-dependent manner, whereas it showed no cytotoxicity to SP2/0 or L929 cells. These data demonstrated that the compound 1 could be a promising candidate of hIL-6 antagonist.

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

Spin polarized first principles study of Mn doped gallium nitride monolayer nanosheet

NASA Astrophysics Data System (ADS)

Sharma, Venus; Kaur, Sumandeep; Srivastava, Sunita; Kumar, Tankeshwar

2017-05-01

The structural, electronic and magnetic properties of gallium nitride nanosheet (GaNs) doped with Mn atoms have been studied using spin polarized density functional theory. The binding energy per atom, Energy Band gap, Fermi energy, magnetic moment, electric dipole moment have been found. The doped nanosheet is found to be more stable than pure GaN monolayer nanosheet. Adsorption of Mn atom has been done at four different sites on GaNs which affects the fermi level position. It is found that depending on the doping site, Mn can behave both like p-type semiconductor and also as n-type semiconductor. Also, it is ascertained that Mn doped GaNs (GaNs-Mn) exhibits ferromagnetic behavior.

Volume dependence of N-body bound states

NASA Astrophysics Data System (ADS)

König, Sebastian; Lee, Dean

2018-04-01

We derive the finite-volume correction to the binding energy of an N-particle quantum bound state in a cubic periodic volume. Our results are applicable to bound states with arbitrary composition and total angular momentum, and in any number of spatial dimensions. The only assumptions are that the interactions have finite range. The finite-volume correction is a sum of contributions from all possible breakup channels. In the case where the separation is into two bound clusters, our result gives the leading volume dependence up to exponentially small corrections. If the separation is into three or more clusters, there is a power-law factor that is beyond the scope of this work, however our result again determines the leading exponential dependence. We also present two independent methods that use finite-volume data to determine asymptotic normalization coefficients. The coefficients are useful to determine low-energy capture reactions into weakly bound states relevant for nuclear astrophysics. Using the techniques introduced here, one can even extract the infinite-volume energy limit using data from a single-volume calculation. The derived relations are tested using several exactly solvable systems and numerical examples. We anticipate immediate applications to lattice calculations of hadronic, nuclear, and cold atomic systems.

Using the fast fourier transform in binding free energy calculations.

PubMed

Nguyen, Trung Hai; Zhou, Huan-Xiang; Minh, David D L

2018-04-30

According to implicit ligand theory, the standard binding free energy is an exponential average of the binding potential of mean force (BPMF), an exponential average of the interaction energy between the unbound ligand ensemble and a rigid receptor. Here, we use the fast Fourier transform (FFT) to efficiently evaluate BPMFs by calculating interaction energies when rigid ligand configurations from the unbound ensemble are discretely translated across rigid receptor conformations. Results for standard binding free energies between T4 lysozyme and 141 small organic molecules are in good agreement with previous alchemical calculations based on (1) a flexible complex ( R≈0.9 for 24 systems) and (2) flexible ligand with multiple rigid receptor configurations ( R≈0.8 for 141 systems). While the FFT is routinely used for molecular docking, to our knowledge this is the first time that the algorithm has been used for rigorous binding free energy calculations. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Thermodynamic investigations of protein's behaviour with ionic liquids in aqueous medium studied by isothermal titration calorimetry.

PubMed

Bharmoria, Pankaj; Kumar, Arvind

2016-05-01

While a number of reports appear on ionic liquids-proteins interactions, their thermodynamic behaviour using suitable technique like isothermal titration calorimetry is not systematically presented. Isothermal titration calorimetry (ITC) is a key technique which can directly measure the thermodynamic contribution of IL binding to protein, particularly the enthalpy, heat capacities and binding stoichiometry. Ionic liquids (ILs), owing to their unique and tunable physicochemical properties have been the central area of scientific research besides graphene in the last decade, and growing unabated. Their encounter with proteins in the biological system is inevitable considering their environmental discharge though most of them are recyclable for a number of cycles. In this article we will cover the thermodynamics of proteins upon interaction with ILs as osmolyte and surfactant. The up to date literature survey of IL-protein interactions using isothermal titration calorimetry will be discussed and parallel comparison with the results obtained for such studies with other techniques will be highlighted to demonstrate the accuracy of ITC technique. Net stability of proteins can be obtained from the difference in the free energy (ΔG) of the native (folded) and denatured (unfolded) state using the Gibbs-Helmholtz equation (ΔG=ΔH-TΔS). Isothermal titration calorimetry can directly measure the heat changes upon IL-protein interactions. Calculation of other thermodynamic parameters such as entropy, binding constant and free energy depends upon the proper fitting of the binding isotherms using various fitting models. Copyright © 2015 Elsevier B.V. All rights reserved.

Quantum confined Stark effects of single dopant in polarized hemispherical quantum dot: Two-dimensional finite difference approach and Ritz-Hassé variation method

NASA Astrophysics Data System (ADS)

El Harouny, El Hassan; Nakra Mohajer, Soukaina; Ibral, Asmaa; El Khamkhami, Jamal; Assaid, El Mahdi

2018-05-01

Eigenvalues equation of hydrogen-like off-center single donor impurity confined in polarized homogeneous hemispherical quantum dot deposited on a wetting layer, capped by insulated matrix and submitted to external uniform electric field is solved in the framework of the effective mass approximation. An infinitely deep potential is used to describe effects of quantum confinement due to conduction band offsets at surfaces where quantum dot and surrounding materials meet. Single donor ground state total and binding energies in presence of electric field are determined via two-dimensional finite difference approach and Ritz-Hassé variation principle. For the latter method, attractive coulomb correlation between electron and ionized single donor is taken into account in the expression of trial wave function. It appears that off-center single dopant binding energy, spatial extension and radial probability density are strongly dependent on hemisphere radius and single dopant position inside quantum dot. Influence of a uniform electric field is also investigated. It shows that Stark effect appears even for very small size dots and that single dopant energy shift is more significant when the single donor is near hemispherical surface.

Excitation-Energy Transfer Paths from Tryptophans to Coordinated Copper Ions in Engineered Azurins: a Source of Observables for Monitoring Protein Structural Changes

NASA Astrophysics Data System (ADS)

Di Rocco, Giulia; Bernini, Fabrizio; Borsari, Marco; Martinelli, Ilaria; Bortolotti, Carlo Augusto; Battistuzzi, Gianantonio; Ranieri, Antonio; Caselli, Monica; Sola, Marco; Ponterini, Glauco

2016-09-01

The intrinsic fluorescence of recombinant proteins offers a powerful tool to detect and characterize structural changes induced by chemical or biological stimuli. We show that metal-ion binding to a hexahistidine tail can significantly broaden the range of such structurally sensitive fluorescence observables. Bipositive metal-ions as Cu2+, Ni2+ and Zn2+ bind 6xHis-tag azurin and its 6xHis-tagged R129W and W48A-R129W mutants with good efficiency and, thereby, quench their intrinsic fluorescence. Due to a much more favourable spectral overlap, the 6xHis-tag/Cu2+ complex(es) are the most efficient quenchers of both W48 and W129 emissions. Based on simple Förster-type dependence of energy-transfer efficiency on donor/acceptor distance, we can trace several excitation-energy transfer paths across the protein structure. Unexpected lifetime components in the azurin 6xHis-tag/Cu2+ complex emission decays reveal underneath complexity in the conformational landscape of these systems. The new tryptophan emission quenching paths provide additional signals for detecting and identifying protein structural changes.

Elucidating the role of surface passivating ligand structural parameters in hole wave function delocalization in semiconductor cluster molecules.

PubMed

Teunis, Meghan B; Nagaraju, Mulpuri; Dutta, Poulami; Pu, Jingzhi; Muhoberac, Barry B; Sardar, Rajesh; Agarwal, Mangilal

2017-09-28

This article describes the mechanisms underlying electronic interactions between surface passivating ligands and (CdSe) 34 semiconductor cluster molecules (SCMs) that facilitate band-gap engineering through the delocalization of hole wave functions without altering their inorganic core. We show here both experimentally and through density functional theory calculations that the expansion of the hole wave function beyond the SCM boundary into the ligand monolayer depends not only on the pre-binding energetic alignment of interfacial orbitals between the SCM and surface passivating ligands but is also strongly influenced by definable ligand structural parameters such as the extent of their π-conjugation [π-delocalization energy; pyrene (Py), anthracene (Anth), naphthalene (Naph), and phenyl (Ph)], binding mode [dithiocarbamate (DTC, -NH-CS 2 - ), carboxylate (-COO - ), and amine (-NH 2 )], and binding head group [-SH, -SeH, and -TeH]. We observe an unprecedentedly large ∼650 meV red-shift in the lowest energy optical absorption band of (CdSe) 34 SCMs upon passivating their surface with Py-DTC ligands and the trend is found to be Ph- < Naph- < Anth- < Py-DTC. This shift is reversible upon removal of Py-DTC by triethylphosphine gold(i) chloride treatment at room temperature. Furthermore, we performed temperature-dependent (80-300 K) photoluminescence lifetime measurements, which show longer lifetime at lower temperature, suggesting a strong influence of hole wave function delocalization rather than carrier trapping and/or phonon-mediated relaxation. Taken together, knowledge of how ligands electronically interact with the SCM surface is crucial to semiconductor nanomaterial research in general because it allows the tuning of electronic properties of nanomaterials for better charge separation and enhanced charge transfer, which in turn will increase optoelectronic device and photocatalytic efficiencies.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. J.

1984-01-01

Rose, Smith, and Ferrante have discovered scaling relations which map the adhesive binding energy calculated by Ferrante and Smith onto a single universal binding energy curve. These binding energies are calculated for all combinations of Al(111), Zn(0001), Mg(0001), and Na(110) in contact. The scaling involves normalizing the energy by the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. Rose et al. have also found that the calculated cohesive energies of K, Ba, Cu, Mo, and Sm scale by similar simple relations, suggesting the universal relation may be more general than for the simple free electron metals for which it was derived. In addition, the scaling length was defined more generally in order to relate it to measurable physical properties. Further this universality can be extended to chemisorption. A simple and yet quite accurate prediction of a zero temperature equation of state (volume as a function of pressure for metals and alloys) is presented. Thermal expansion coefficients and melting temperatures are predicted by simple, analytic expressions, and results compare favorably with experiment for a broad range of metals.

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

PubMed

Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2015-03-01

In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

Comparing the conformational behavior of a series of diastereomeric cyclic urea HIV-1 inhibitors using the low mode:monte carlo conformational search method.

PubMed

Parish, Carol A; Yarger, Matthew; Sinclair, Kent; Dure, Myrianne; Goldberg, Alla

2004-09-23

The conformational flexibility of a series of diastereomeric cyclic urea HIV-1 protease inhibitors has been examined using the Low Mode:Monte Carlo conformational search method. Force fields were validated by a comparison of the energetic ordering of the minimum energy structures on the AMBER/GBSA(water), OPLSAA/GBSA(water) and HF/6-311G/SCRF(water) surfaces. The energetic ordering of the minima on the OPLSAA /GBSA(water) surface was in better agreement with the quantum calculations than the ordering on the AMBER/GBSA(water) surface. An ensemble of low energy structures was generated using OPLSAA/GBSA(water) and used to compare the molecular shape and flexibility of each diastereomer to the experimentally determined binding affinities and crystal structures of closely related systems. The results indicate that diastereomeric solution-phase energetic stability, conformational rigidity and ability to adopt a chair conformation correlate strongly with experimental binding affinities. Rigid body docking suggests that all of the diastereomers adopt solution-phase conformations suitable for alignment with the HIV-1 protease; however, these results indicate that the binding affinities are dependent upon subtle differences in the P1/P1' and P2/P2' substituent orientations.

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

Molecular interactions involved in proton-dependent gating in KcsA potassium channels

PubMed Central

Posson, David J.; Thompson, Ameer N.; McCoy, Jason G.

2013-01-01

The bacterial potassium channel KcsA is gated open by the binding of protons to amino acids on the intracellular side of the channel. We have identified, via channel mutagenesis and x-ray crystallography, two pH-sensing amino acids and a set of nearby residues involved in molecular interactions that influence gating. We found that the minimal mutation of one histidine (H25) and one glutamate (E118) near the cytoplasmic gate completely abolished pH-dependent gating. Mutation of nearby residues either alone or in pairs altered the channel’s response to pH. In addition, mutations of certain pairs of residues dramatically increased the energy barriers between the closed and open states. We proposed a Monod–Wyman–Changeux model for proton binding and pH-dependent gating in KcsA, where H25 is a “strong” sensor displaying a large shift in pKa between closed and open states, and E118 is a “weak” pH sensor. Modifying model parameters that are involved in either the intrinsic gating equilibrium or the pKa values of the pH-sensing residues was sufficient to capture the effects of all mutations. PMID:24218397

Sensitivity of the nuclear deformability and fission barriers to the equation of state

NASA Astrophysics Data System (ADS)

Seif, W. M.; Anwer, Hisham

2018-07-01

The model-dependent analysis of the fission data impacts the extracted fission-related quantities, which are not directly observables, such as the super- and hyperdeformed isomeric states and their energies. We investigated the model dependence of the deformability of a nucleus and its fission barriers on the nuclear equation of state. Within the microscopic-macroscopic model based on a large number of Skyrme nucleon-nucleon interactions, the total energy surfaces and the double-humped fission barrier of 230Th are calculated in a multidimensional deformation space. In addition to the ground-state (GS) and the superdeformed (SD) minima, all the investigated forces yielded a hyperdeformed (HD) minimum. The contour map of the shell-plus-pairing energy clearly displayed the three minima. We found that the GS binding energy and the deformation energy of the different deformation modes along the fission path increase with the incompressibility coefficient K0, while the fission barrier heights and the excitation energies of the SD and HD modes decrease with it. Conversely, the surface-energy coefficient asurf, the symmetry-energy, and its density-slope parameter decrease the GS energy and the deformation energies, but increase the fission barrier heights and the excitation energies. The obtained deformation parameters of the different deformation modes exhibit almost independence on K0, and on the symmetry-energy and its density-slope. The principle deformation parameters of the SD and HD isomeric states tend to decrease with asurf.

Donor impurity binding energies of coaxial GaAs / Alx Ga1 - x As cylindrical quantum wires in a parallel applied magnetic field

NASA Astrophysics Data System (ADS)

Tshipa, M.; Winkoun, D. P.; Nijegorodov, N.; Masale, M.

2018-04-01

Theoretical investigations are carried out of binding energies of a donor charge assumed to be located exactly at the center of symmetry of two concentric cylindrical quantum wires. The intrinsic confinement potential in the region of the inner cylinder is modeled in any one of the three profiles: simple parabolic, shifted parabolic or the polynomial potential. The potential inside the shell is taken to be a potential step or potential barrier of a finite height. Additional confinement of the charge carriers is due to the vector potential of the axial applied magnetic field. It is found that the binding energies attain maxima in their variations with the radius of the inner cylinder irrespective of the particular intrinsic confinement of the inner cylinder. As the radius of the inner cylinder is increased further, the binding energies corresponding to either the parabolic or the polynomial potentials attain minima at some critical core-radius. Finally, as anticipated, the binding energies increase with the increase of the parallel applied magnetic field. This behaviour of the binding energies is irrespective of the particular electric potential of the nanostructure or its specific dimensions.

BFEE: A User-Friendly Graphical Interface Facilitating Absolute Binding Free-Energy Calculations.

PubMed

Fu, Haohao; Gumbart, James C; Chen, Haochuan; Shao, Xueguang; Cai, Wensheng; Chipot, Christophe

2018-03-26

Quantifying protein-ligand binding has attracted the attention of both theorists and experimentalists for decades. Many methods for estimating binding free energies in silico have been reported in recent years. Proper use of the proposed strategies requires, however, adequate knowledge of the protein-ligand complex, the mathematical background for deriving the underlying theory, and time for setting up the simulations, bookkeeping, and postprocessing. Here, to minimize human intervention, we propose a toolkit aimed at facilitating the accurate estimation of standard binding free energies using a geometrical route, coined the binding free-energy estimator (BFEE), and introduced it as a plug-in of the popular visualization program VMD. Benefitting from recent developments in new collective variables, BFEE can be used to generate the simulation input files, based solely on the structure of the complex. Once the simulations are completed, BFEE can also be utilized to perform the post-treatment of the free-energy calculations, allowing the absolute binding free energy to be estimated directly from the one-dimensional potentials of mean force in simulation outputs. The minimal amount of human intervention required during the whole process combined with the ergonomic graphical interface makes BFEE a very effective and practical tool for the end-user.

Stretched proton-neutron configurations in fp-shell nuclei (II). Systematics

NASA Astrophysics Data System (ADS)

von Neumann-Cosel, P.; Fister, U.; Jahn, R.; Schenk, P.; Trelle, T. K.; Wenzel, D.; Wienands, U.

1994-03-01

The systematics of the binding energies of stretched proton-neutron configurations ( f{7}/{2}, g{9}/{2}) 8 -, ( p{3}/{2}, g{9}/{2}) 6 -, ( g{9}/{2}, p{3}/{2}) 6- and ( g{9}/{2}) 29 + are studied over a wide range of f p-shell nuclei. The effective proton-neutron interaction energies deduced from the data are nearly constant for ( p{3}/{2}, g{9}/{2}) 6 -and ( g{9}/{2}) 29 + states while the ( f{7}/{2}, g{9}/{2}) 8 - configuration reveals an additional repulsive term proportional to the partial filling of the f{7}/{2} orbit in the target ground state. Two-body matrix elements are extracted. A crude shell model, which predicts that the excitation energy of a stretched state is equal to the sum of the single-particle energies, works well for the 6 - and 9 + states, but fails for the 8 - levels due to neglect of the additional interactions described above. The physics underlying the empirically introduced basic assumptions of the crude shell model is discussed. The binding energies are found to be linearly dependent on the mass number A and the isospin Tz component and are well described by the weak-coupling model of Bansal and French. The derived parameters agree with averaged values of a similar analysis for the single-particle states in the corresponding odd-even neighbours. The data indicate a significant change of the particle-hole energies with closure of the proton f{7}/{2} shell.

Toward an Experimental Quantum Chemistry: Exploring a New Energy Partitioning.

PubMed

Rahm, Martin; Hoffmann, Roald

2015-08-19

Following the work of L. C. Allen, this work begins by relating the central chemical concept of electronegativity with the average binding energy of electrons in a system. The average electron binding energy, χ̅, is in principle accessible from experiment, through photoelectron and X-ray spectroscopy. It can also be estimated theoretically. χ̅ has a rigorous and understandable connection to the total energy. That connection defines a new kind of energy decomposition scheme. The changing total energy in a reaction has three primary contributions to it: the average electron binding energy, the nuclear-nuclear repulsion, and multielectron interactions. This partitioning allows one to gain insight into the predominant factors behind a particular energetic preference. We can conclude whether an energy change in a transformation is favored or resisted by collective changes to the binding energy of electrons, the movement of nuclei, or multielectron interactions. For example, in the classical formation of H2 from atoms, orbital interactions dominate nearly canceling nuclear-nuclear repulsion and two-electron interactions. While in electron attachment to an H atom, the multielectron interactions drive the reaction. Looking at the balance of average electron binding energy, multielectron, and nuclear-nuclear contributions one can judge when more traditional electronegativity arguments can be justifiably invoked in the rationalization of a particular chemical event.

Diamagnetic susceptibility of a hydrogenic donor in a group IV-VI quantum dot-quantum well heterostructure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saravanamoorthy, S. N.; Peter, A. John, E-mail: a.john.peter@gmail.com

2016-05-23

Electronic properties of a hydrogenic donor impurity in a CdSe/Pb{sub 0.8}Cd{sub 0.2}Se/CdSe quantum dot quantum well system are investigated for various radii of core with shell materials. Confined energies are obtained taking into account the geometrical size of the system and thereby the donor binding energies are found. The diamagnetic susceptibility is estimated for a confined shallow donor in the well system. The results show that the diamagnetic susceptibility strongly depends on core and shell radii and it is more sensitive to variations of the geometrical size of the well material.

Conformational Phase Diagram for Polymers Adsorbed on Ultrathin Nanowires

NASA Astrophysics Data System (ADS)

Vogel, Thomas; Bachmann, Michael

2010-05-01

We study the conformational behavior of a polymer adsorbed at an attractive stringlike nanowire and construct the complete structural phase diagram in dependence of the binding strength and effective thickness of the nanowire. For this purpose, Monte Carlo optimization techniques are employed to identify lowest-energy structures for a coarse-grained model of a polymer in contact with the nanowire. Among the representative conformations in the different phases are, for example, compact droplets attached to the wire and also nanotubelike monolayer films wrapping it in a very ordered way. We here systematically analyze low-energy shapes and structural order parameters to elucidate the transitions between the structural phases.

Conformational phase diagram for polymers adsorbed on ultrathin nanowires.

PubMed

Vogel, Thomas; Bachmann, Michael

2010-05-14

We study the conformational behavior of a polymer adsorbed at an attractive stringlike nanowire and construct the complete structural phase diagram in dependence of the binding strength and effective thickness of the nanowire. For this purpose, Monte Carlo optimization techniques are employed to identify lowest-energy structures for a coarse-grained model of a polymer in contact with the nanowire. Among the representative conformations in the different phases are, for example, compact droplets attached to the wire and also nanotubelike monolayer films wrapping it in a very ordered way. We here systematically analyze low-energy shapes and structural order parameters to elucidate the transitions between the structural phases.