Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy.

PubMed

Stadnik, Yevgeny V

2018-06-01

The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1/r^{5} potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s-wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy

NASA Astrophysics Data System (ADS)

Stadnik, Yevgeny V.

2018-06-01

The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1 /r5 potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s -wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

Δ isobars and nuclear saturation

NASA Astrophysics Data System (ADS)

Ekström, A.; Hagen, G.; Morris, T. D.; Papenbrock, T.; Schwartz, P. D.

2018-02-01

We construct a nuclear interaction in chiral effective field theory with explicit inclusion of the Δ -isobar Δ (1232 ) degree of freedom at all orders up to next-to-next-to-leading order (NNLO). We use pion-nucleon (π N ) low-energy constants (LECs) from a Roy-Steiner analysis of π N scattering data, optimize the LECs in the contact potentials up to NNLO to reproduce low-energy nucleon-nucleon scattering phase shifts, and constrain the three-nucleon interaction at NNLO to reproduce the binding energy and point-proton radius of 4He. For heavier nuclei we use the coupled-cluster method to compute binding energies, radii, and neutron skins. We find that radii and binding energies are much improved for interactions with explicit inclusion of Δ (1232 ) , while Δ -less interactions produce nuclei that are not bound with respect to breakup into α particles. The saturation of nuclear matter is significantly improved, and its symmetry energy is consistent with empirical estimates.

DD-bar production and their interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Yanrui; Oka, Makoto; Takizawa, Makoto

2011-05-23

We have explored the bound state problem and the scattering problem of the DD-bar pair in a meson exchange model. When considering their production in the e{sup +}e{sup -} process, we included the DD-bar rescattering effect. Although it is difficult to answer whether the S-wave DD-bar bound state exists or not from the binding energies and the phase shifts, one may get an upper limit of the binding energy from the production of the BB-bar, the bottom analog of DD-bar.

Crown oxygen-doping graphene with embedded main-group metal atoms

NASA Astrophysics Data System (ADS)

Wu, Liyuan; Wang, Qian; Yang, Chuanghua; Quhe, Ruge; Guan, Pengfei; Lu, Pengfei

2018-02-01

Different main-group metal atoms embedded in crown oxygen-doping graphene (metal@OG) systems are studied by the density functional theory. The binding energies and electronic structures are calculated by using first-principles calculations. The binding energy of metal@OG system mainly depends on the electronegativity of the metal atom. The lower the value of the electronegativity, the larger the binding energy, indicating the more stable the system. The electronic structure of metal@OG arouses the emergence of bandgap and shift of Dirac point. It is shown that interaction between metal atom and crown oxygen-doping graphene leads to the graphene's stable n-doping, and the metal@OG systems are stable semiconducting materials, which can be used in technological applications.

Twisting a β-Carotene, an Adaptive Trick from Nature for Dissipating Energy during Photoprotection*

PubMed Central

Sobotka, Roman; Kish, Elizabeth; Shukla, Mahendra Kumar; Pascal, Andrew A.; Polívka, Tomáš; Robert, Bruno

2017-01-01

Cyanobacteria possess a family of one-helix high light-inducible proteins (Hlips) that are homologous to light-harvesting antenna of plants and algae. An Hlip protein, high light-inducible protein D (HliD) purified as a small complex with the Ycf39 protein is evaluated using resonance Raman spectroscopy. We show that the HliD binds two different β-carotenes, each present in two non-equivalent binding pockets with different conformations, having their (0,0) absorption maxima at 489 and 522 nm, respectively. Both populations of β-carotene molecules were in all-trans configuration and the absorption position of the farthest blue-shifted β-carotene was attributed entirely to the polarizability of the environment in its binding pocket. In contrast, the absorption maximum of the red-shifted β-carotene was attributed to two different factors: the polarizability of the environment in its binding pocket and, more importantly, to the conformation of its β-rings. This second β-carotene has highly twisted β-rings adopting a flat conformation, which implies that the effective conjugation length N is extended up to 10.5 modifying the energetic levels. This increase in N will also result in a lower S1 energy state, which may provide a permanent energy dissipation channel. Analysis of the carbonyl stretching region for chlorophyll a excitations indicates that the HliD binds six chlorophyll a molecules in five non-equivalent binding sites, with at least one chlorophyll a presenting a slight distortion to its macrocycle. The binding modes and conformations of HliD-bound pigments are discussed with respect to the known structures of LHCII and CP29. PMID:27994060

Acceptor binding energies in GaN and AlN

NASA Astrophysics Data System (ADS)

Mireles, Francisco; Ulloa, Sergio E.

1998-08-01

We employ effective-mass theory for degenerate hole bands to calculate the acceptor binding energies for Be, Mg, Zn, Ca, C, and Si substitutional acceptors in GaN and AlN. The calculations are performed through the 6×6 Rashba-Sheka-Pikus and the Luttinger-Kohn matrix Hamiltonians for wurtzite (WZ) and zinc-blende (ZB) crystal phases, respectively. An analytic representation for the acceptor pseudopotential is used to introduce the specific nature of the impurity atoms. The energy shift due to polaron effects is also considered in this approach. The ionization energy estimates are in very good agreement with those reported experimentally in WZ GaN. The binding energies for ZB GaN acceptors are all predicted to be shallower than the corresponding impurities in the WZ phase. The binding-energy dependence upon the crystal-field splitting in WZ GaN is analyzed. Ionization levels in AlN are found to have similar ``shallow'' values to those in GaN, but with some important differences which depend on the band structure parametrizations, especially the value of the crystal-field splitting used.

Electronic structure evolution of fullerene on CH 3NH 3PbI 3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Liu, Xiaoliang

2015-03-19

The thickness dependence of fullerene on CH 3NH 3PbI 3 perovskitefilm surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy(XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskitefilm to fullerene molecules. Further deposition of fullerene forms C 60 solid, accompaniedmore » by the reduction of the electron transfer. As a result, the strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Electronic structure evolution of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chenggong; Wang, Congcong; Kauppi, John

2015-03-16

The thickness dependence of fullerene on CH{sub 3}NH{sub 3}PbI{sub 3} perovskite film surface has been investigated by using ultraviolet photoemission spectroscopy (UPS), X-ray photoemission spectroscopy (XPS), and inverse photoemission spectroscopy (IPES). The lowest unoccupied molecular orbital and highest occupied molecular orbital (HOMO) can be observed directly with IPES and UPS. It is observed that the HOMO level in fullerene shifts to lower binding energy. The XPS results show a strong initial shift of core levels to lower binding energy in the perovskite, which indicates that electrons transfer from the perovskite film to fullerene molecules. Further deposition of fullerene forms C{submore » 60} solid, accompanied by the reduction of the electron transfer. The strongest electron transfer happened at 1/4 monolayer of fullerene.« less

Dynamics, magnetic properties, and electron binding energies of H2O2 in water.

PubMed

C Cabral, Benedito J

2017-06-21

Results for the magnetic properties and electron binding energies of H 2 O 2 in liquid water are presented. The adopted methodology relies on the combination of Born-Oppenheimer molecular dynamics and electronic structure calculations. The Keal-Tozer functional was applied for predicting magnetic shieldings and H 2 O 2 intramolecular spin-spin coupling constants. Electron binding energies were calculated with electron propagator theory. In water, H 2 O 2 is a better proton donor than proton acceptor, and the present results indicate that this feature is important for understanding magnetic properties in solution. In comparison with the gas-phase, H 2 O 2 atoms are deshielded in water. For oxygen atoms, the deshielding is mainly determined by structural/conformational changes. Hydrogen-bond interactions explain the deshielding of protons in water. The predicted chemical shift for the H 2 O 2 protons in water (δ∼11.8 ppm) is in good agreement with experimental information (δ=11.2 ppm). The two lowest electron binding energies of H 2 O 2 in water (10.7±0.5 and 11.2±0.5 eV) are in reasonable agreement with experiment. In keeping with data from photoelectron spectroscopy, an ∼1.6 eV red-shift of the two first ionisation energies relative to the gas-phase is observed in water. The strong dependence of magnetic properties on changes of the electronic density in the nuclei environment is illustrated by a correlation between the σ( 17 O) magnetic shielding constant and the energy gap between the [2a] lowest valence and [1a] core orbitals of H 2 O 2 .

Kinetic and Thermodynamic Characterization of Dihydrotestosterone-Induced Conformational Perturbations in Androgen Receptor Ligand-Binding Domain

PubMed Central

Jasuja, Ravi; Ulloor, Jagadish; Yengo, Christopher M.; Choong, Karen; Istomin, Andrei Y.; Livesay, Dennis R.; Jacobs, Donald J.; Swerdloff, Ronald S.; Mikšovská, Jaroslava; Larsen, Randy W.; Bhasin, Shalender

2009-01-01

Ligand-induced conformational perturbations in androgen receptor (AR) are important in coactivator recruitment and transactivation. However, molecular rearrangements in AR ligand-binding domain (AR-LBD) associated with agonist binding and their kinetic and thermodynamic parameters are poorly understood. We used steady-state second-derivative absorption and emission spectroscopy, pressure and temperature perturbations, and 4,4′-bis-anilinonaphthalene 8-sulfonate (bis-ANS) partitioning to determine the kinetics and thermodynamics of the conformational changes in AR-LBD after dihydrotestosterone (DHT) binding. In presence of DHT, the second-derivative absorption spectrum showed a red shift and a change in peak-to-peak distance. Emission intensity increased upon DHT binding, and center of spectral mass was blue shifted, denoting conformational changes resulting in more hydrophobic environment for tyrosines and tryptophans within a more compact DHT-bound receptor. In pressure perturbation calorimetry, DHT-induced energetic stabilization increased the Gibbs free energy of unfolding to 8.4 ± 1.3 kcal/mol from 3.5 ± 1.6 kcal/mol. Bis-ANS partitioning studies revealed that upon DHT binding, AR-LBD underwent biphasic rearrangement with a high activation energy (13.4 kcal/mol). An initial, molten globule-like burst phase (k ∼30 sec−1) with greater solvent accessibility was followed by rearrangement (k ∼0.01 sec−1), leading to a more compact conformation than apo-AR-LBD. Molecular simulations demonstrated unique sensitivity of tyrosine and tryptophan residues during pressure unfolding with rearrangement of residues in the coactivator recruitment surfaces distant from the ligand-binding pocket. In conclusion, DHT binding leads to energetic stabilization of AR-LBD domain and substantial rearrangement of residues distant from the ligand-binding pocket. DHT binding to AR-LBD involves biphasic receptor rearrangement including population of a molten globule-like intermediate state. PMID:19443608

Short-range correlations in carbon-12, oxygen-16, and neon-20: Intrinsic properties

NASA Technical Reports Server (NTRS)

Braley, R. C.; Ford, W. F.; Becker, R. L.; Patterson, M. R.

1972-01-01

The Brueckner-Hartree-Fock (BHF) method has been applied to nuclei whose intrinsic structure is nonspherical. Reaction matrix elements were calculated as functions of starting energy for the Hamada-Johnston interaction using the Pauli operator appropriate to O-16 and a shifted oscillator spectrum for virtual excited states. Binding energies, single particle energies, radii, and shape deformations of the intrinsic state, in ordinary as well as renormalized BHF, are discussed and compared with previous HF studies and with experiment when possible. Results are presented for C-12, 0-16 and Ne-20. It is found that the binding energies and radii are too small, but that separation energies are well reproduced when the renormalized theory is used.

Tuning exciton energy and fine-structure splitting in single InAs quantum dots by applying uniaxial stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Dan; Dou, Xiuming; Wu, Xuefei

2016-04-15

Exciton and biexciton emission energies as well as excitonic fine-structure splitting (FSS) in single InAs/GaAs quantum dots (QDs) have been continuously tuned in situ in an optical cryostat using a developed uniaxial stress device. With increasing tensile stress, the red shift of excitonic emission is up to 5 nm; FSS decreases firstly and then increases monotonically, reaching a minimum value of approximately 10 μeV; biexciton binding energy decreases from 460 to 106 μeV. This technique provides a simple and convenient means to tune QD structural symmetry, exciton energy and biexciton binding energy and can be used for generating entangled andmore » indistinguishable photons.« less

Anomalous center of mass shift: gravitational dipole moment.

NASA Astrophysics Data System (ADS)

Jeong, Eue Jin

1997-02-01

The anomalous, energy dependent shift of the center of mass of an idealized, perfectly rigid, uniformly rotating hemispherical shell which is caused by the relativistic mass increase effect is investigated in detail. It is shown that a classical object on impact which has the harmonic binding force between the adjacent constituent particles has the similar effect of the energy dependent, anomalous shift of the center of mass. From these observations, the general mode of the linear acceleration is suggested to be caused by the anomalous center of mass shift whether it's due to classical or relativistic origin. The effect of the energy dependent center of mass shift perpendicular to the plane of rotation of a rotating hemisphere appears as the non zero gravitational dipole moment in general relativity. Controlled experiment for the measurement of the gravitational dipole field and its possible links to the cylindrical type line formation of a worm hole in the extreme case are suggested. The jets from the black hole accretion disc and the observed anomalous red shift from far away galaxies are considered to be the consequences of the two different aspects of the dipole gravity.

Mechanical work makes important contributions to surface chemistry at steps.

PubMed

Francis, M F; Curtin, W A

2015-02-13

The effect of mechanical strain on the binding energy of adsorbates to late transition metals is believed to be entirely controlled by electronic factors, with tensile stress inducing stronger binding. Here we show, via computation, that mechanical strain of late transition metals can modify binding at stepped surfaces opposite to well-established trends on flat surfaces. The mechanism driving the trend is mechanical, arising from the relaxation of stored mechanical energy. The mechanical energy change can be larger than, and of opposite sign than, the energy changes due to electronic effects and leads to a violation of trends predicted by the widely accepted electronic 'd-band' model. This trend has a direct impact on catalytic activity, which is demonstrated here for methanation, where biaxial tension is predicted to shift the activity of nickel significantly, reaching the peak of the volcano plot and comparable to cobalt and ruthenium.

Chromatic shifts in the fluorescence emitted by murine thymocytes stained with Hoechst 33342.

PubMed

Petersen, Timothy W; Ibrahim, Sherrif F; Diercks, Alan H; van den Engh, Ger

2004-08-01

Many methods in flow cytometry rely on staining DNA with a fluorescent dye to gauge DNA content. From the relative intensity of the fluorescence signature, one can then infer position in cell cycle, amount of DNA (i.e., for sperm selection), or, as in the case of flow karyotyping, to distinguish individual chromosomes. This work examines the staining of murine thymocytes with a common DNA dye, Hoechst 33342, to investigate nonlinearities in the florescence intensity as well as chromatic shifts. Murine thymocytes were stained with Hoechst 33342 and measured in a flow cytometer at two fluorescence emission bands. In other measurements, cells were stained at different dye concentrations, and then centrifuged. The supernatant was then used for a second round of staining to test the amount of dye uptake. Finally, to test for resonant energy transfer, we measured fluorescence anisotropy at two different wavelengths. The fluorescence of cells stained with Hoechst 33342 is a nonlinear process that shows an overall decrease in intensity with increased dye uptake, and spectral shift to the red. Along with the spectral shift of the fluorescence to the longer wavelengths, we document decreases in the fluorescence anisotropy that may indicate resonant energy transfer. At low concentrations, Hoechst 33342 binds to the minor groove of DNA and shows an increase in fluorescence and a blue shift upon binding. At higher concentrations, at which the dye molecules can no longer bind without overlapping, the blue fluorescence decreases and the red fluorescence increases until there is approximately one dye molecule per DNA base pair. The ratio of the blue fluorescence to the red fluorescence is an accurate indicator of the cellular dye concentration.

Adapting photosynthesis to the near-infrared: non-covalent binding of phycocyanobilin provides an extreme spectral red-shift to phycobilisome core-membrane linker from Synechococcus sp. PCC7335.

PubMed

Miao, Dan; Ding, Wen-Long; Zhao, Bao-Qing; Lu, Lu; Xu, Qian-Zhao; Scheer, Hugo; Zhao, Kai-Hong

2016-06-01

Phycobiliproteins that bind bilins are organized as light-harvesting complexes, phycobilisomes, in cyanobacteria and red algae. The harvested light energy is funneled to reaction centers via two energy traps, allophycocyanin B and the core-membrane linker, ApcE1 (conventional ApcE). The covalently bound phycocyanobilin (PCB) of ApcE1 absorbs near 660 nm and fluoresces near 675 nm. In cyanobacteria capable of near infrared photoacclimation, such as Synechococcus sp. PCC7335, there exist even further spectrally red shifted components absorbing >700 nm and fluorescing >710 nm. We expressed the chromophore domain of the extra core-membrane linker from Synechococcus sp. PCC7335, ApcE2, in E. coli together with enzymes generating the chromophore, PCB. The resulting chromoproteins, PCB-ApcE2(1-273) and the more truncated PCB-ApcE2(24-245), absorb at 700 nm and fluoresce at 714 nm. The red shift of ~40 nm compared with canonical ApcE1 results from non-covalent binding of the chromophore by which its full conjugation length including the Δ3,3(1) double bond is preserved. The extreme spectral red-shift could not be ascribed to exciton coupling: dimeric PCB-ApcE2(1-273) and monomeric-ApcE2(24-245) absorbed and fluoresced similarly. Chromophorylation of ApcE2 with phycoerythrobilin- or phytochromobilin resulted in similar red shifts (absorption at 615 and 711 nm, fluorescence at 628 or 726 nm, respectively), compared to the covalently bound chromophores. The self-assembled non-covalent chromophorylation demonstrates a novel access to red and near-infrared emitting fluorophores. Brightly fluorescent biomarking was exemplified in E. coli by single-plasmid transformation. Copyright © 2016 Elsevier B.V. All rights reserved.

Exciton diamagnetic shifts and valley Zeeman effects in monolayer WS2 and MoS2 to 65 Tesla

NASA Astrophysics Data System (ADS)

Stier, Andreas V.; McCreary, Kathleen M.; Jonker, Berend T.; Kono, Junichiro; Crooker, Scott A.

2016-02-01

In bulk and quantum-confined semiconductors, magneto-optical studies have historically played an essential role in determining the fundamental parameters of excitons (size, binding energy, spin, dimensionality and so on). Here we report low-temperature polarized reflection spectroscopy of atomically thin WS2 and MoS2 in high magnetic fields to 65 T. Both the A and B excitons exhibit similar Zeeman splittings of approximately -230 μeV T-1 (g-factor ~=-4), thereby quantifying the valley Zeeman effect in monolayer transition-metal disulphides. Crucially, these large fields also allow observation of the small quadratic diamagnetic shifts of both A and B excitons in monolayer WS2, from which radii of ~1.53 and ~1.16 nm are calculated. Further, when analysed within a model of non-local dielectric screening, these diamagnetic shifts also constrain estimates of the A and B exciton binding energies (410 and 470 meV, respectively, using a reduced A exciton mass of 0.16 times the free electron mass). These results highlight the utility of high magnetic fields for understanding new two-dimensional materials.

Free energy changes and components implicit in the MWC allosteric model for the cooperative oxygen binding of hemoglobin.#

PubMed Central

Bucci, Enrico

2013-01-01

Hill’s plots of oxygen binding isotherms reveal the presence of a transition between two different oxygen affinities at the beginning and end of the isotherm. They correspond to the two conformations anticipated by the MWC model, namely the T and R conformations at the beginning and end of oxygen binding, when the lower affinity of the T form develops into the higher affinity of the R form. The difference between the binding Gibbs free energies changes of the two affinities (ΔGL) is the free energy of binding cooperativity. Notably ΔGL is positive in favor of the T form, that moves to a higher energy level upon oxygen release. Osmotic stress reveals a higher volume/surface ratio of deoxyHb, with a positive ΔGW also in favor of the T form . Increasing protein concentration shifts the isotherms to the right indicating the formation of intermediate polymeric forms. Enthalpy of the intermediates show a strong absorption of heat at the third oxygenation step due to polymers formation with quinary, and above, structures. The disassembly of intermediate polymers releases energy with a negative ΔG that compensates and allow the positivity of ΔGL. High energy polymers are the barrier preventing the relaxation of the T and R conformations into one another. The MWC allosteric model is the best justification of oxygen binding cooperativity . PMID:23710673

Fractal dimension study of polaron effects in cylindrical GaAs/Al x Ga1- x As core-shell nanowires

NASA Astrophysics Data System (ADS)

Sun, Hui; Li, Hua; Tian, Qiang

2018-04-01

Polaron effects in cylindrical GaAs/Al x Ga1- x As core-shell nanowires are studied by applying the fractal dimension method. In this paper, the polaron properties of GaAs/Al x Ga1- x As core-shell nanowires with different core radii and aluminum concentrations are discussed. The polaron binding energy, polaron mass shift, and fractal dimension parameter are numerically determined as functions of shell width. The calculation results reveal that the binding energy and mass shift of the polaron first increase and then decrease as the shell width increases. A maximum value appears at a certain shell width for different aluminum concentrations and a given core radius. By using the fractal dimension method, polaron problems in cylindrical GaAs/Al x Ga1- x As core-shell nanowires are solved in a simple manner that avoids complex and lengthy calculations.

Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

PubMed

Kowalczyk, Tim; Le, Khoa; Irle, Stephan

2016-01-12

We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

Isoelectronic bound-exciton photoluminescence in strained beryllium-doped Si0.92Ge0.08 epilayers and Si0.92Ge0.08/Si superlattices at ambient and elevated hydrostatic pressure

NASA Astrophysics Data System (ADS)

Kim, Sangsig; Chang, Ganlin; Herman, Irving P.; Bevk, Joze; Moore, Karen L.; Hall, Dennis G.

1997-03-01

Photoluminescence (PL) from a beryllium-doped Si0.92Ge0.08 epilayer and three different beryllium-doped Si0.92Ge0.08/Si superlattices (SL's) commensurately grown on Si(100) substrates is examined at 9 K at ambient pressure and, for the epilayer and one SL, as a function of hydrostatic pressure. In each structure, excitons bind to the isoelectronic Be pairs in the strained Si0.92Ge0.08 layers. The zero-phonon PL peaks of the epilayer and the in situ doped 50-Å Si0.92Ge0.08/100-Å Si SL shift linearly with pressure toward lower energy at the rate of 0.68+/-0.03 and 0.97+/-0.03 meV/kbar, respectively, which are near the 0.77-meV/kbar value for Si:Be. The PL energies at ambient and elevated pressure are analyzed by accounting for strain, quantum confinement, and exciton binding. A modified Hopfield-Thomas-Lynch model is used to model exciton binding to the Be pairs. This model, in which potential wells bind electrons to a site (that then trap holes), predicts a distribution of electron binding energies when an inhomogeneous distribution of potential-well depths is used. This accounts for the large PL linewidth and the decrease of linewidth with increasing pressure, among other observations. In SL's, the exciton binding energy is shown to depend on the width of the wells as well as the spatial distribution of Be dopants in the superlattice. Also, at and above 58 kbar a very unusual peak is observed in one of the SL's, which is associated with a free-exciton peak in Si, that shifts very fast with pressure (-6.02+/-0.03 meV/kbar).

Characteristic vibration patterns of odor compounds from bread-baking volatiles upon protein binding: density functional and ONIOM study and principal component analysis.

PubMed

Treesuwan, Witcha; Hirao, Hajime; Morokuma, Keiji; Hannongbua, Supa

2012-05-01

As the mechanism underlying the sense of smell is unclear, different models have been used to rationalize structure-odor relationships. To gain insight into odorant molecules from bread baking, binding energies and vibration spectra in the gas phase and in the protein environment [7-transmembrane helices (7TMHs) of rhodopsin] were calculated using density functional theory [B3LYP/6-311++G(d,p)] and ONIOM [B3LYP/6-311++G(d,p):PM3] methods. It was found that acetaldehyde ("acid" category) binds strongly in the large cavity inside the receptor, whereas 2-ethyl-3-methylpyrazine ("roasted") binds weakly. Lys296, Tyr268, Thr118 and Ala117 were identified as key residues in the binding site. More emphasis was placed on how vibrational frequencies are shifted and intensities modified in the receptor protein environment. Principal component analysis (PCA) suggested that the frequency shifts of C-C stretching, CH(3) umbrella, C = O stretching and CH(3) stretching modes have a significant effect on odor quality. In fact, the frequency shifts of the C-C stretching and C = O stretching modes, as well as CH(3) umbrella and CH(3) symmetric stretching modes, exhibit different behaviors in the PCA loadings plot. A large frequency shift in the CH(3) symmetric stretching mode is associated with the sweet-roasted odor category and separates this from the acid odor category. A large frequency shift of the C-C stretching mode describes the roasted and oily-popcorn odor categories, and separates these from the buttery and acid odor categories.

The Free Energy Profile of Tubulin Straight-Bent Conformational Changes, with Implications for Microtubule Assembly and Drug Discovery

PubMed Central

Bonomi, Massimiliano; Agard, David A.; Jacobson, Matthew P.

2014-01-01

αβ-tubulin dimers need to convert between a ‘bent’ conformation observed for free dimers in solution and a ‘straight’ conformation required for incorporation into the microtubule lattice. Here, we investigate the free energy landscape of αβ-tubulin using molecular dynamics simulations, emphasizing implications for models of assembly, and modulation of the conformational landscape by colchicine, a tubulin-binding drug that inhibits microtubule polymerization. Specifically, we performed molecular dynamics, potential-of-mean force simulations to obtain the free energy profile for unpolymerized GDP-bound tubulin as a function of the ∼12° intradimer rotation differentiating the straight and bent conformers. Our results predict that the unassembled GDP-tubulin heterodimer exists in a continuum of conformations ranging between straight and bent, but, in agreement with existing structural data, suggests that an intermediate bent state has a lower free energy (by ∼1 kcal/mol) and thus dominates in solution. In agreement with predictions of the lattice model of microtubule assembly, lateral binding of two αβ-tubulins strongly shifts the conformational equilibrium towards the straight state, which is then ∼1 kcal/mol lower in free energy than the bent state. Finally, calculations of colchicine binding to a single αβ-tubulin dimer strongly shifts the equilibrium toward the bent states, and disfavors the straight state to the extent that it is no longer thermodynamically populated. PMID:24516374

Substrate effect on the growth of Sn thin films

NASA Astrophysics Data System (ADS)

Chakraborty, Suvankar; Menon, Krishnakumar S. R.

2018-05-01

Growth of tin (Sn) on Ag(001), Ag(111) and W(110) substrate has been studied at elevated temperatures (473 K) using x-ray photoemission spectroscopy (XPS) and low energy electron diffraction (LEED). For Sn growth on silver substrates, it is noticed that both Sn 3d and Ag 3d core-level spectra shift in the higher binding energy direction due to the formation of surface alloy with the substrate. In both cases, surface alloy finally transforms into bulk alloy finally reaching bulk Sn value. For Sn growth on W(110) only Sn 3d core-level spectra shift in the higher binding energy direction due to surface core-level effect whereas no shift for tungsten core-level was noticed confirming no alloy formation. Sn is incorporated into the surface of substrate silver layer by removing every alternate or every third silver atoms to relieve the surface tensile stress as confirmed by LEED. On the other hand, tungsten being hard, Sn forms an overlayer structure by sitting in different energetically available positions rather than forming an alloy as energetically also it is not possible. Sn forms alloy with soft substrate silver and form overlayer films with tungsten. These studies are important in understanding the growth mechanism of Sn films on metal substrates.

Element specificity of ortho-positronium annihilation for alkali-metal loaded SiO2 glasses.

PubMed

Sato, K; Hatta, T

2015-03-07

Momentum distributions associated with ortho-positronium (o-Ps) pick-off annihilation photon are often influenced by light elements, as, e.g., carbon, oxygen, and fluorine. This phenomenon, so-called element specificity of o-Ps pick-off annihilation, has been utilized for studying the elemental environment around the open spaces. To gain an insight into the element specificity of o-Ps pick-off annihilation, the chemical shift of oxygen 1s binding energy and the momentum distributions associated with o-Ps pick-off annihilation were systematically investigated for alkali-metal loaded SiO2 glasses by means of X-ray photoelectron spectroscopy and positron-age-momentum correlation spectroscopy, respectively. Alkali metals introduced into the open spaces surrounded by oxygen atoms cause charge transfer from alkali metals to oxygen atoms, leading to the lower chemical shift for the oxygen 1s binding energy. The momentum distribution of o-Ps localized into the open spaces is found to be closely correlated with the oxygen 1s chemical shift. This correlation with the deepest 1s energy level evidences that the element specificity of o-Ps originates from pick-off annihilation with orbital electrons, i.e., dominantly with oxygen 2p valence electrons and s electrons with lower probability.

Screening of excitons in single, suspended carbon nanotubes.

PubMed

Walsh, Andrew G; Vamivakas, A Nickolas; Yin, Yan; Cronin, Stephen B; Unlü, M Selim; Goldberg, Bennett B; Swan, Anna K

2007-06-01

Resonant Raman spectroscopy of single carbon nanotubes suspended across trenches displays red-shifts of up to 30 meV of the electronic transition energies as a function of the surrounding dielectric environment. We develop a simple scaling relationship between the exciton binding energy and the external dielectric function and thus quantify the effect of screening. Our results imply that the underlying particle interaction energies change by hundreds of meV.

Probing Bioluminescence Resonance Energy Transfer in Quantum Rod-Luciferase Nanoconjugates.

PubMed

Alam, Rabeka; Karam, Liliana M; Doane, Tennyson L; Coopersmith, Kaitlin; Fontaine, Danielle M; Branchini, Bruce R; Maye, Mathew M

2016-02-23

We describe the necessary design criteria to create highly efficient energy transfer conjugates containing luciferase enzymes derived from Photinus pyralis (Ppy) and semiconductor quantum rods (QRs) with rod-in-rod (r/r) microstructure. By fine-tuning the synthetic conditions, CdSe/CdS r/r-QRs were prepared with two different emission colors and three different aspect ratios (l/w) each. These were hybridized with blue, green, and red emitting Ppy, leading to a number of new BRET nanoconjugates. Measurements of the emission BRET ratio (BR) indicate that the resulting energy transfer is highly dependent on QR energy accepting properties, which include absorption, quantum yield, and optical anisotropy, as well as its morphological and topological properties, such as aspect ratio and defect concentration. The highest BR was found using r/r-QRs with lower l/w that were conjugated with red Ppy, which may be activating one of the anisotropic CdSe core energy levels. The role QR surface defects play on Ppy binding, and energy transfer was studied by growth of gold nanoparticles at the defects, which indicated that each QR set has different sites. The Ppy binding at those sites is suggested by the observed BRET red-shift as a function of Ppy-to-QR loading (L), where the lowest L results in highest efficiency and furthest shift.

Extended Fenske-Hall LCAO MO calculations of core-level shifts in solid P compounds

NASA Astrophysics Data System (ADS)

Franke, R.; Chassé, T.; Reinhold, J.; Streubel, P.; Szargan, R.

1997-08-01

Extended Fenske-Hall LCAO-MO ΔSCF calculations on solids modelled as H-pseudoatom saturated clusters are reported. The computational results verify the experimentally obtained initial-state (effective atomic charges, Madelung potential) and relaxation-energy contributions to the XPS phosphorus core-level binding energy shifts measured in Na 3PO 3S, Na 3PO 4, Na 2PO 3F and NH 4PF 6 in reference to red phosphorus. It is shown that the different initial-state contributions observed in the studied phosphates are determined by local and nonlocal terms while the relaxation-energy contributions are mainly dependent on the nature of the nearest neighbors of the phosphorus atom.

Computational scheme for pH-dependent binding free energy calculation with explicit solvent.

PubMed

Lee, Juyong; Miller, Benjamin T; Brooks, Bernard R

2016-01-01

We present a computational scheme to compute the pH-dependence of binding free energy with explicit solvent. Despite the importance of pH, the effect of pH has been generally neglected in binding free energy calculations because of a lack of accurate methods to model it. To address this limitation, we use a constant-pH methodology to obtain a true ensemble of multiple protonation states of a titratable system at a given pH and analyze the ensemble using the Bennett acceptance ratio (BAR) method. The constant pH method is based on the combination of enveloping distribution sampling (EDS) with the Hamiltonian replica exchange method (HREM), which yields an accurate semi-grand canonical ensemble of a titratable system. By considering the free energy change of constraining multiple protonation states to a single state or releasing a single protonation state to multiple states, the pH dependent binding free energy profile can be obtained. We perform benchmark simulations of a host-guest system: cucurbit[7]uril (CB[7]) and benzimidazole (BZ). BZ experiences a large pKa shift upon complex formation. The pH-dependent binding free energy profiles of the benchmark system are obtained with three different long-range interaction calculation schemes: a cutoff, the particle mesh Ewald (PME), and the isotropic periodic sum (IPS) method. Our scheme captures the pH-dependent behavior of binding free energy successfully. Absolute binding free energy values obtained with the PME and IPS methods are consistent, while cutoff method results are off by 2 kcal mol(-1) . We also discuss the characteristics of three long-range interaction calculation methods for constant-pH simulations. © 2015 The Protein Society.

X-ray excited Auger transitions of Pu compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelson, Art J., E-mail: nelson63@llnl.gov; Grant, William K.; Stanford, Jeff A.

2015-05-15

X-ray excited Pu core–valence–valence and core–core–valence Auger line-shapes were used in combination with the Pu 4f photoelectron peaks to characterize differences in the oxidation state and local electronic structure for Pu compounds. The evolution of the Pu 4f core-level chemical shift as a function of sputtering depth profiling and hydrogen exposure at ambient temperature was quantified. The combination of the core–valence–valence Auger peak energies with the associated chemical shift of the Pu 4f photoelectron line defines the Auger parameter and results in a reliable method for definitively determining oxidation states independent of binding energy calibration. Results show that PuO{sub 2},more » Pu{sub 2}O{sub 3}, PuH{sub 2.7}, and Pu have definitive Auger line-shapes. These data were used to produce a chemical state (Wagner) plot for select plutonium oxides. This Wagner plot allowed us to distinguish between the trivalent hydride and the trivalent oxide, which cannot be differentiated by the Pu 4f binding energy alone.« less

Binding energy of donor impurity states and optical absorption in the Tietz-Hua quantum well under an applied electric field

NASA Astrophysics Data System (ADS)

Al, E. B.; Kasapoglu, E.; Sakiroglu, S.; Duque, C. A.; Sökmen, I.

2018-04-01

For a quantum well which has the Tietz-Hua potential, the ground and some excited donor impurity binding energies and the total absorption coefficients, including linear and third order nonlinear terms for the transitions between the related impurity states with respect to the structure parameters and the impurity position as well as the electric field strength are investigated. The binding energies were obtained using the effective-mass approximation within a variational scheme and the optical transitions between any two impurity states were calculated by using the density matrix formalism and the perturbation expansion method. Our results show that the effects of the electric field and the structure parameters on the optical transitions are more pronounced. So we can adjust the red or blue shift in the peak position of the absorption coefficient by changing the strength of the electric field as well as the structure parameters.

A Critical Assessment of the Performance of Protein-ligand Scoring Functions Based on NMR Chemical Shift Perturbations

PubMed Central

Wang, Bing; Westerhoff, Lance M.; Merz, Kenneth M.

2008-01-01

We have generated docking poses for the FKBP-GPI complex using eight docking programs, and compared their scoring functions with scoring based on NMR chemical shift perturbations (NMRScore). Because the chemical shift perturbation (CSP) is exquisitely sensitive on the orientation of ligand inside the binding pocket, NMRScore offers an accurate and straightforward approach to score different poses. All scoring functions were inspected by their abilities to highly rank the native-like structures and separate them from decoy poses generated for a protein-ligand complex. The overall performance of NMRScore is much better than that of energy-based scoring functions associated with docking programs in both aspects. In summary, we find that the combination of docking programs with NMRScore results in an approach that can robustly determine the binding site structure for a protein-ligand complex, thereby, providing a new tool facilitating the structure-based drug discovery process. PMID:17867664

Tropomyosin movement on F-actin during muscle activation explained by energy landscapes

PubMed Central

Orzechowski, Marek; Moore, Jeffrey R.; Fischer, Stefan; Lehman, William

2014-01-01

Muscle contraction is regulated by tropomyosin movement across the thin filament surface, which exposes or blocks myosin-binding sites on actin. Recent atomic structures of F-actin-tropomyosin have yielded the positions of tropomyosin on myosin-free and myosin-decorated actin. Here, the repositioning of α-tropomyosin between these locations on F-actin was systematically examined by optimizing the energy of the complex for a wide range of tropomyosin positions on F-actin. The resulting energy landscape provides a full-map of the F-actin surface preferred by tropomyosin, revealing a broad energy basin associated with the tropomyosin position that blocks myosin-binding. This is consistent with previously proposed low-energy oscillations of semi-rigid tropomyosin, necessary for shifting of tropomyosin following troponin-binding. In contrast, the landscape shows much less favorable energies when tropomyosin locates near its myosin-induced “open-state” position. This indicates that spontaneous movement of tropomyosin away from its energetic “ground-state” to the open-state is unlikely in absence of myosin. Instead, myosin-binding must drive tropomyosin toward the open-state to activate the thin filament. Additional energy landscapes were computed for disease-causing actin mutants that distort the topology of the actin-tropomyosin energy landscape, explaining their phenotypes. Thus, the computation of such energy landscapes offers a sensitive way to estimate the impact of mutations. PMID:24412204

Tropomyosin movement on F-actin during muscle activation explained by energy landscapes.

PubMed

Orzechowski, Marek; Moore, Jeffrey R; Fischer, Stefan; Lehman, William

2014-03-01

Muscle contraction is regulated by tropomyosin movement across the thin filament surface, which exposes or blocks myosin-binding sites on actin. Recent atomic structures of F-actin-tropomyosin have yielded the positions of tropomyosin on myosin-free and myosin-decorated actin. Here, the repositioning of α-tropomyosin between these locations on F-actin was systematically examined by optimizing the energy of the complex for a wide range of tropomyosin positions on F-actin. The resulting energy landscape provides a full-map of the F-actin surface preferred by tropomyosin, revealing a broad energy basin associated with the tropomyosin position that blocks myosin-binding. This is consistent with previously proposed low-energy oscillations of semi-rigid tropomyosin, necessary for shifting of tropomyosin following troponin-binding. In contrast, the landscape shows much less favorable energies when tropomyosin locates near its myosin-induced "open-state" position. This indicates that spontaneous movement of tropomyosin away from its energetic "ground-state" to the open-state is unlikely in absence of myosin. Instead, myosin-binding must drive tropomyosin toward the open-state to activate the thin filament. Additional energy landscapes were computed for disease-causing actin mutants that distort the topology of the actin-tropomyosin energy landscape, explaining their phenotypes. Thus, the computation of such energy landscapes offers a sensitive way to estimate the impact of mutations. Copyright © 2014 Elsevier Inc. All rights reserved.

Exciton diamagnetic shifts and valley Zeeman effects in monolayer WS2 and MoS2 to 65 Tesla

PubMed Central

Stier, Andreas V.; McCreary, Kathleen M.; Jonker, Berend T.; Kono, Junichiro; Crooker, Scott A.

2016-01-01

In bulk and quantum-confined semiconductors, magneto-optical studies have historically played an essential role in determining the fundamental parameters of excitons (size, binding energy, spin, dimensionality and so on). Here we report low-temperature polarized reflection spectroscopy of atomically thin WS2 and MoS2 in high magnetic fields to 65 T. Both the A and B excitons exhibit similar Zeeman splittings of approximately −230 μeV T−1 (g-factor ≃−4), thereby quantifying the valley Zeeman effect in monolayer transition-metal disulphides. Crucially, these large fields also allow observation of the small quadratic diamagnetic shifts of both A and B excitons in monolayer WS2, from which radii of ∼1.53 and ∼1.16 nm are calculated. Further, when analysed within a model of non-local dielectric screening, these diamagnetic shifts also constrain estimates of the A and B exciton binding energies (410 and 470 meV, respectively, using a reduced A exciton mass of 0.16 times the free electron mass). These results highlight the utility of high magnetic fields for understanding new two-dimensional materials. PMID:26856412

Exciton diamagnetic shifts and valley Zeeman effects in monolayer WS 2 and MoS 2 to 65 Tesla

DOE PAGES

Stier, Andreas V.; McCreary, Kathleen M.; Jonker, Berend T.; ...

2016-02-09

In bulk and quantum-confined semiconductors, magneto-optical studies have historically played an essential role in determining the fundamental parameters of excitons (size, binding energy, spin, dimensionality and so on). Here we report low-temperature polarized reflection spectroscopy of atomically thin WS 2 and MoS 2 in high magnetic fields to 65 T. Both the A and B excitons exhibit similar Zeeman splittings of approximately –230 μeV T–1 (g-factor ≃–4), thereby quantifying the valley Zeeman effect in monolayer transition-metal disulphides. Crucially, these large fields also allow observation of the small quadratic diamagnetic shifts of both A and B excitons in monolayer WS 2,more » from which radii of ~1.53 and ~1.16 nm are calculated. Further, when analysed within a model of non-local dielectric screening, these diamagnetic shifts also constrain estimates of the A and B exciton binding energies (410 and 470 meV, respectively, using a reduced A exciton mass of 0.16 times the free electron mass). Lastly, these results highlight the utility of high magnetic fields for understanding new two-dimensional materials.« less

Exciton diamagnetic shifts and valley Zeeman effects in monolayer WS2 and MoS2 to 65 Tesla.

PubMed

Stier, Andreas V; McCreary, Kathleen M; Jonker, Berend T; Kono, Junichiro; Crooker, Scott A

2016-02-09

In bulk and quantum-confined semiconductors, magneto-optical studies have historically played an essential role in determining the fundamental parameters of excitons (size, binding energy, spin, dimensionality and so on). Here we report low-temperature polarized reflection spectroscopy of atomically thin WS2 and MoS2 in high magnetic fields to 65 T. Both the A and B excitons exhibit similar Zeeman splittings of approximately -230 μeV T(-1) (g-factor ≃-4), thereby quantifying the valley Zeeman effect in monolayer transition-metal disulphides. Crucially, these large fields also allow observation of the small quadratic diamagnetic shifts of both A and B excitons in monolayer WS2, from which radii of ∼1.53 and ∼1.16 nm are calculated. Further, when analysed within a model of non-local dielectric screening, these diamagnetic shifts also constrain estimates of the A and B exciton binding energies (410 and 470 meV, respectively, using a reduced A exciton mass of 0.16 times the free electron mass). These results highlight the utility of high magnetic fields for understanding new two-dimensional materials.

Contactless electroreflectance studies of free exciton binding energy in Zn1-xMgxO epilayers

NASA Astrophysics Data System (ADS)

Wełna, M.; Kudrawiec, R.; Kaminska, A.; Kozanecki, A.; Laumer, B.; Eickhoff, M.; Misiewicz, J.

2013-12-01

Contactless electroreflectance (CER) has been applied to study optical transitions in Zn1-xMgxO layers with magnesium concentration ≤44%. CER resonances related to free exciton and band-to-band transitions were clearly observed at room temperature. For ZnO the two transitions are separated by the energy of ˜65 meV, which is attributed to the free exciton binding energy in ZnO. Due to magnesium incorporation, the CER resonances broaden and shift to blue. The energy separation between excitonic and band-to-band transitions increases up to ˜100 meV when the magnesium concentration reaches 22%. For larger magnesium concentrations, CER resonances are significantly broadened and the excitonic transition is no longer resolved in the CER spectrum.

Sirt1 carboxyl-domain is an ATP-repressible domain that is transferrable to other proteins

PubMed Central

Kang, Hyeog; Oka, Shinichi; Lee, Duck-Yeon; Park, Junhong; Aponte, Angel M.; Jung, Young-Sang; Bitterman, Jacob; Zhai, Peiyong; He, Yi; Kooshapur, Hamed; Ghirlando, Rodolfo; Tjandra, Nico; Lee, Sean B.; Kim, Myung K.; Sadoshima, Junichi; Chung, Jay H.

2017-01-01

Sirt1 is an NAD+-dependent protein deacetylase that regulates many physiological functions, including stress resistance, adipogenesis, cell senescence and energy production. Sirt1 can be activated by energy deprivation, but the mechanism is poorly understood. Here, we report that Sirt1 is negatively regulated by ATP, which binds to the C-terminal domain (CTD) of Sirt1. ATP suppresses Sirt1 activity by impairing the CTD's ability to bind to the deacetylase domain as well as its ability to function as the substrate recruitment site. ATP, but not NAD+, causes a conformational shift to a less compact structure. Mutations that prevent ATP binding increase Sirt1's ability to promote stress resistance and inhibit adipogenesis under high-ATP conditions. Interestingly, the CTD can be attached to other proteins, thereby converting them into energy-regulated proteins. These discoveries provide insight into how extreme energy deprivation can impact Sirt1 activity and underscore the complex nature of Sirt1 structure and regulation. PMID:28504272

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

NASA Astrophysics Data System (ADS)

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.; Jin, Wencan; Dadap, Jerry I.; Hybertsen, Mark S.; Osgood, Richard M.

2018-04-01

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n =1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energy and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. This opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.

Excitons, trions, and biexcitons in transition-metal dichalcogenides: Magnetic-field dependence

NASA Astrophysics Data System (ADS)

Van der Donck, M.; Zarenia, M.; Peeters, F. M.

2018-05-01

The influence of a perpendicular magnetic field on the binding energy and structural properties of excitons, trions, and biexcitons in monolayers of semiconducting transition metal dichalcogenides (TMDs) is investigated. The stochastic variational method (SVM) with a correlated Gaussian basis is used to calculate the different properties of these few-particle systems. In addition, we present a simplified variational approach which supports the SVM results for excitons as a function of magnetic field. The exciton diamagnetic shift is compared with recent experimental results, and we extend this concept to trions and biexcitons. The effect of a local potential fluctuation, which we model by a circular potential well, on the binding energy of trions and biexcitons is investigated and found to significantly increase the binding of those excitonic complexes.

Electronic structure and mechanical properties of plasma nitrided ferrous alloys

NASA Astrophysics Data System (ADS)

Portolan, E.; Baumvol, I. J. R.; Figueroa, C. A.

2009-04-01

The electronic structures of the near-surface regions of two different nitrided steels (AISI 316 and 4140) were investigated using X-ray photoelectron spectroscopy. Photoelectron groups from all main chemical elements involved were addressed for steel samples with implanted-N concentrations in the range 16-32 at.%. As the implanted-N concentrations were increased, rather contrasting behaviors were observed for the two kinds of steel. The N1s photoelectrons had spectral shifts toward lower (nitrided AISI 316) or higher (nitrided AISI 4140) binding energies, whereas the Fe2p 3/2 photoelectron spectrum remains at a constant binding energy (nitrided AISI 316) or shifts toward higher binding energies (AISI 4140). These trends are discussed in terms of the metallic nitride formation and the overlapping of atomic orbitals. For nitrided AISI 316, a semi-classical approach of charge transfer between Cr and N is used to explain the experimental facts (formation of CrN), while for nitrided AISI 4140 we propose that the interaction between orbitals 4s from Fe and 2p from N promotes electrons to the conduction band increasing the electrical attraction of the N1s and Fe2p electrons in core shells (formation of FeN x). The increase in hardness of the steel upon N implantation is attributed to the localization of electrons in specific bonds, which diminishes the metallic bond character.

Band alignment at the Cu2ZnSn(SxSe1-x)4/CdS interface

NASA Astrophysics Data System (ADS)

Haight, Richard; Barkhouse, Aaron; Gunawan, Oki; Shin, Byungha; Copel, Matt; Hopstaken, Marinus; Mitzi, David B.

2011-06-01

Energy band alignments between CdS and Cu2ZnSn(SxSe1-x)4 (CZTSSe) grown via solution-based and vacuum-based deposition routes were studied as a function of the [S]/[S+Se] ratio with femtosecond laser ultraviolet photoelectron spectroscopy, photoluminescence, medium energy ion scattering, and secondary ion mass spectrometry. Band bending in the underlying CZTSSe layer was measured via pump/probe photovoltage shifts of the photoelectron spectra and offsets were determined with photoemission under flat band conditions. Increasing the S content of the CZTSSe films produces a valence edge shift to higher binding energy and increases the CZTSSe band gap. In all cases, the CdS conduction band offsets were spikes.

Two-loop self-energy in the Lamb shift of the ground and excited states of hydrogenlike ions

NASA Astrophysics Data System (ADS)

Yerokhin, V. A.

2018-05-01

The two-loop self-energy correction to the Lamb shift of hydrogenlike ions is calculated for the 1 s , 2 s , and 2 p1 /2 states and nuclear charge numbers Z =30 -100 . The calculation is performed to all orders in the nuclear binding strength parameter Z α . As compared to previous calculations of this correction, numerical accuracy is improved by an order of magnitude and the region of the nuclear charges is extended. An analysis of the Z dependence of the obtained results demonstrates their consistency with the known Z α -expansion coefficients.

Efficiency enhancement of ZnO nanostructure assisted Si solar cell based on fill factor enlargement and UV-blue spectral down-shifting

NASA Astrophysics Data System (ADS)

Gholizadeh, A.; Reyhani, A.; Parvin, P.; Mortazavi, S. Z.

2017-05-01

ZnO nanostructures (including nano-plates and nano-rods (NRs)) are grown in various temperatures and Ar/O2 flow rates using thermal chemical vapor deposition, which affect the structure, nano-plate/NR population, and the quality of ZnO nanostructures. X-ray diffraction (XRD) attests that the peak intensity of the crystallographic plane (1 0 0) is correlated to nano-plate abundance. Moreover, optical properties elucidate that the population of nano-plates in samples strongly affect the band gap, binding energy of the exciton, and UV-visible (UV-vis) absorption and spectral luminescence emissions. In fact, the exciton binding energy reduces from ~100 to 80 meV when the population of nano-plates increases in samples. Photovoltaic characteristics based on the drop-casting on Si solar cells reveals three dominant factors, namely, the equivalent series resistance, decreasing reflectance, and down-shifting, in order to scale up the absolute efficiency by 3%. As a consequence, the oxygen vacancies in ZnO nanostructures give rise to the down-shifting and increase of free-carriers, leading to a reduction in the equivalent series resistance and an enlargement of fill factor. To obtain a larger I sc, reduction of spectral reflectance is essential; however, the down-shifting process is shown to be dominant by lessening the surface electron-hole recombination rate over the UV-blue spectral range.

Temperature-induced band shift in bulk γ-InSe by angle-resolved photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Xu, Huanfeng; Wang, Wei; Zhao, Yafei; Zhang, Xiaoqian; Feng, Yue; Tu, Jian; Gu, Chenyi; Sun, Yizhe; Liu, Chang; Nie, Yuefeng; Edmond Turcu, Ion C.; Xu, Yongbing; He, Liang

2018-05-01

Indium selenide (InSe) has recently become popular research topics because of its unique layered crystal structure, direct band gap and high electron mobilities. In this work, we have acquired the electronic structure of bulk γ-InSe at various temperatures using angle-resolved photoemission spectroscopy (ARPES). We have also found that as the temperature decreases, the valence bands of γ-InSe exhibit a monotonic shift to lower binding energies. This band shift is attributed to the change of lattice parameters and has been validated by variable temperature X-ray diffraction measurements and theoretical calculations.

Microsolvation of Fluoromethane.

PubMed

Rosenberg, Robert E

2016-09-29

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the potential for and strength of hydrogen bonds involving fluorine. It is known that CH3F forms a hydrogen bond with H2O in the gas phase but does not dissolve in bulk water. This paper examines CH3F surrounded by one to six water molecules. For systems of similar topologies, CH3F formed hydrogen bonds of nearly the same strength as water. Although CH3F can bind to a second water cluster with only a modest loss in binding energy, it must bind to these clusters as a double hydrogen bond acceptor. This means that CH3F cannot form a low-energy cyclic 2D hydrogen bonding network with water molecules, which limits its solubility in bulk water. However, CH3F should be able to bind to the periphery of small hydrogen bonding networks. These conclusions were not appreciably altered by SMD calculations. A more complete consideration of solvation, especially entropic effects, was not undertaken. Data for geometries, population changes, and vibrational frequency shifts were also analyzed and compared to binding energies.

Measurement of Nanomolar Dissociation Constants by Titration Calorimetry and Thermal Shift Assay – Radicicol Binding to Hsp90 and Ethoxzolamide Binding to CAII

PubMed Central

Zubrienė, Asta; Matulienė, Jurgita; Baranauskienė, Lina; Jachno, Jelena; Torresan, Jolanta; Michailovienė, Vilma; Cimmperman, Piotras; Matulis, Daumantas

2009-01-01

The analysis of tight protein-ligand binding reactions by isothermal titration calorimetry (ITC) and thermal shift assay (TSA) is presented. The binding of radicicol to the N-terminal domain of human heat shock protein 90 (Hsp90αN) and the binding of ethoxzolamide to human carbonic anhydrase (hCAII) were too strong to be measured accurately by direct ITC titration and therefore were measured by displacement ITC and by observing the temperature-denaturation transitions of ligand-free and ligand-bound protein. Stabilization of both proteins by their ligands was profound, increasing the melting temperature by more than 10 ºC, depending on ligand concentration. Analysis of the melting temperature dependence on the protein and ligand concentrations yielded dissociation constants equal to 1 nM and 2 nM for Hsp90αN-radicicol and hCAII-ethoxzolamide, respectively. The ligand-free and ligand-bound protein fractions melt separately, and two melting transitions are observed. This phenomenon is especially pronounced when the ligand concentration is equal to about half the protein concentration. The analysis compares ITC and TSA data, accounts for two transitions and yields the ligand binding constant and the parameters of protein stability, including the Gibbs free energy and the enthalpy of unfolding. PMID:19582223

Size effects in electronic and catalytic properties of unsupported palladium nanoparticles in electrooxidation of formic acid.

PubMed

Zhou, Wei Ping; Lewera, Adam; Larsen, Robert; Masel, Rich I; Bagus, Paul S; Wieckowski, Andrzej

2006-07-13

We report a combined X-ray photoelectron spectroscopy (XPS), cyclic voltammetry (CV), and chronoamperometry (CA) study of formic acid electrooxidation on unsupported palladium nanoparticle catalysts in the particle size range from 9 to 40 nm. The CV and CA measurements show that the most active catalyst is made of the smallest (9 and 11 nm) Pd nanoparticles. Besides the high reactivity, XPS data show that such nanoparticles display the highest core-level binding energy (BE) shift and the highest valence band (VB) center downshift with respect to the Fermi level. We believe therefore that we found a correlation between formic acid oxidation current and BE and VB center shifts, which, in turn, can directly be related to the electronic structure of palladium nanoparticles of different particle sizes. Clearly, such a trend using unsupported catalysts has never been reported. According to the density functional theory of heterogeneous catalysis, and mechanistic considerations, the observed shifts are caused by a weakening of the bond strength of the COOH intermediate adsorption on the catalyst surface. This, in turn, results in the increase in the formic acid oxidation rate to CO2 (and in the associated oxidation current). Overall, our measurements demonstrate the particle size effect on the electronic properties of palladium that yields different catalytic activity in the HCOOH oxidation reaction. Our work highlights the significance of the core-level binding energy and center of the d-band shifts in electrocatalysis and underlines the value of the theory that connects the center of the d-band shifts to catalytic reactivity.

New insights into ETS-10 and titanate quantum wire: a comprehensive characterization.

PubMed

Jeong, Nak Cheon; Lee, Young Ju; Park, Jung-Hyun; Lim, Hyunjin; Shin, Chae-Ho; Cheong, Hyeonsik; Yoon, Kyung Byung

2009-09-16

The titanate quantum wires in ETS-10 crystals remain intact during ion exchange of the pristine cations (Na(+)(0.47) + K(+)(0.53)) with M(n+) ions (M(n+) = Na(+), K(+), Mg(2+), Ca(2+), Sr(2+), Ba(2+), Pb(2+), Cd(2+), Zn(2+)) and during reverse exchange of the newly exchanged cations with Na(+). The binding energies of O(1s) and Ti(2p) decrease as the electronegativity of the cation decreases, and they are inversely proportional to the negative partial charge of the framework oxygen [-delta(O(f))]. At least five different oxygen species were identified, and their binding energies (526.1-531.9 eV) indicate that the titanate-forming oxides are much more basic than those of aluminosilicate zeolites (530.2-533.3 eV), which explains the vulnerability of the quantum wire to acids and oxidants. The chemical shifts of the five NMR-spectroscopically nonequivalent Si sites, delta(I(A)), delta(I(B)), delta(II(A)), delta(II(B)), and delta(III), shift downfield as -delta(O(f)) increases, with slopes of 2.5, 18.6, 133.5, 216.3, and 93.8 ppm/[-delta(O(f))], respectively. The nonuniform responses of the chemical shifts to -delta(O(f)) arise from the phenomenon that the cations in the 12-membered-ring channels shift to the interiors of the cages surrounded by four seven-membered-ring windows. On the basis of the above, we assign delta(I(A)), delta(I(B)), delta(II(A)), and delta(II(B)) to the chemical shifts arising from Si(12,12), Si(12,7), Si(7,12), and Si(7,7) atoms, respectively. The frequency of the longitudinal stretching vibration of the titanate quantum wire increases linearly and the bandwidth decreases nonlinearly with increasing -delta(O(f)), indicating that the titanate quantum wire resembles a metallic carbon nanotube. As the degree of hydration increases, the vibrational frequency shifts linearly to higher frequencies while the bandwidth decreases. We identified another normal mode of vibration of the quantum wire, which vibrates in the region of 274-280 cm(-1). In the dehydrated state, the band-gap energy and the first absorption maximum shift to lower energies as -delta(O(f)) increases, indicating the oxide-to-titanium(IV) charge-transfer nature of the transitions.

Interfacial phenomena in high-kappa dielectrics

NASA Astrophysics Data System (ADS)

Mathew, Anoop

The introduction of novel high-kappa dielectric materials to replace the traditional SiO2 insulating layer in CMOS transistors is a watershed event in the history of transistor development. Further, replacement of the traditional highly-doped polycrystalline silicon gate electrode with a new set of materials for metal gates complicates the transition and introduces further integration challenges. A whole variety of new material surfaces and interfaces are thus introduced that merit close investigation to determine parameters for optimal device performance. Nitrogen is a key component that improves the performance of a variety of materials for the next generation of these CMOS transistors. Nitrogen is introduced into new gate dielectric materials such as hafnium silicates as well as in potential metal gate materials such as hafnium nitride. A photoemission study of the binding energies of the various atoms in these systems using photoemission reveals the nature of the atomic bonding. The current study compares hafnium silicates of various compositions which were thermally nitrided at different temperatures in ammonia, hafnium nitrides, and thin HfO2 films using photoelectron spectroscopy. A recurring theme that is explored is the competition between oxygen and nitrogen atoms in bonding with hafnium and other atoms. The N 1s photoemission peak is seen to have contributions from its bonding with hafnium, oxygen, and silicon atoms. The Hf 4f and O 1s spectra similarly exhibit signatures of their bonding environment with their neighboring atoms. Angle resolved photoemission and in-situ annealing/argon sputtering experiments are used to elucidate the nature of the bonding and its evolution with processing. A nondestructive profilitng of nitrogen distribution as a function of composition in nitrided hafnium silicates is also constructed using angle resolved photoemission as a function of the take-off angle. These results are corroborated with depth reconstruction obtained using medium energy ion scattering (MEIS). A comparison of samples nitrided at progressively increasing temperatures in an ammonia environment shows substitution of oxygen with nitrogen atoms and increasing penetration of nitrogen into the gate stack. Trends in the binding energy of the the as-prepared hafnium silicates suggest that they are non-phase separated, and the binding energy of the hafnium and silicon track the relative composition. Upon being subject to rapid thermal annealing, the samples are observed to show behavior consistent with phase separation. There is also the evidence of charges at the oxide/Si interface that modify the expected behavior of the shifts in binding energy. In another set of experiments, a one-cycle atomic layer deposition (ALD) growth reaction on the water terminated Si(100) -- (2x1) surface is shown to lead to successful nucleation, high metal oxide coverage, and an abrupt metal-oxide/silicon interface as confirmed by photoemission, reflection high energy electron diffraction (RHEED), and Rutherford back scattering (RBS) measurements. Photoemission results confirm the coordination states of the hafnium and oxygen atoms. A Hf 4f core level shift is observed and assigned to the presence of the Si-O-Hf bonding environment with the more electronegative Si atom inducing the binding energy shift. This Hf 4f shift is smaller than that reported previously for silicates because of the difference of the semiconductor bonding environment. The subspecies *(O)2HfCl2 and *OHfCl3 are seen to be the predominant intermediate species in these reactions and photoemission results provide corroborative evidence for their presence. Experiments indicate that the hydroxyl sites bound to Si(100) are active for adsorption. The abrupt interface could be useful for aggressive Effective Oxide Thickness (EOT) scaling.

Single-molecule FRET reveals the energy landscape of the full-length SAM-I riboswitch.

PubMed

Manz, Christoph; Kobitski, Andrei Yu; Samanta, Ayan; Keller, Bettina G; Jäschke, Andres; Nienhaus, G Ulrich

2017-11-01

S-adenosyl-L-methionine (SAM) ligand binding induces major structural changes in SAM-I riboswitches, through which gene expression is regulated via transcription termination. Little is known about the conformations and motions governing the function of the full-length Bacillus subtilis yitJ SAM-I riboswitch. Therefore, we have explored its conformational energy landscape as a function of Mg 2+ and SAM ligand concentrations using single-molecule Förster resonance energy transfer (smFRET) microscopy and hidden Markov modeling analysis. We resolved four conformational states both in the presence and the absence of SAM and determined their Mg 2+ -dependent fractional populations and conformational dynamics, including state lifetimes, interconversion rate coefficients and equilibration timescales. Riboswitches with terminator and antiterminator folds coexist, and SAM binding only gradually shifts the populations toward terminator states. We observed a pronounced acceleration of conformational transitions upon SAM binding, which may be crucial for off-switching during the brief decision window before expression of the downstream gene.

Theoretical structures and binding energies of RNA-RNA/cyanine dyes and spectroscopic properties of cyanine dyes

NASA Astrophysics Data System (ADS)

Salaeh, Salsabila; Chong, Wei Lim; Dokmaisrijan, Supaporn; Payaka, Apirak; Yana, Janchai; Nimmanpipug, Piyarat; Lee, Vannajan Sanghiran; Dumri, Kanchana; Anh, Dau Hung

2014-10-01

Cyanine dyes have been widely used as a fluorescence probe for biomolecules and protein labeling. The mostly used cyanine dyes for nucleic acids labeling are DiSC2(3), DiSC2(5), and DiSC2(7). The possible structures and binding energies of RNA-RNA/Cyanine dyes were predicted theoretically using AutoDock Vina. The results showed that cyanine dyes and bases of RNA-RNA have the van der Waals and pi-pi interactions. The maximum absorption wavelength in the visible region obtained from the TD-DFT calculations of all cyanine dyes in the absence of the RNA-RNA double strand showed the bathochromic shift.

Band bending at the heterointerface of GaAs/InAs core/shell nanowires monitored by synchrotron X-ray photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Khanbabaee, B.; Bussone, G.; Knutsson, J. V.; Geijselaers, I.; Pryor, C. E.; Rieger, T.; Demarina, N.; Grützmacher, D.; Lepsa, M. I.; Timm, R.; Pietsch, U.

2016-10-01

Unique electronic properties of semiconductor heterostructured nanowires make them useful for future nano-electronic devices. Here, we present a study of the band bending effect at the heterointerface of GaAs/InAs core/shell nanowires by means of synchrotron based X-ray photoelectron spectroscopy. Different Ga, In, and As core-levels of the nanowire constituents have been monitored prior to and after cleaning from native oxides. The cleaning process mainly affected the As-oxides and was accompanied by an energy shift of the core-level spectra towards lower binding energy, suggesting that the As-oxides turn the nanowire surfaces to n-type. After cleaning, both As and Ga core-levels revealed an energy shift of about -0.3 eV for core/shell compared to core reference nanowires. With respect to depth dependence and in agreement with calculated strain distribution and electron quantum confinement, the observed energy shift is interpreted by band bending of core-levels at the heterointerface between the GaAs nanowire core and the InAs shell.

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Study of protein-probe interaction and protective action of surfactant sodium dodecyl sulphate in urea-denatured HSA using charge transfer fluorescence probe methyl ester of N,N-dimethylamino naphthyl acrylic acid.

PubMed

Mahanta, Subrata; Singh, Rupashree Balia; Guchhait, Nikhil

2009-03-01

We have demonstrated that the intramolecular charge transfer (ICT) probe Methyl ester of N,N-dimethylamino naphthyl acrylic acid (MDMANA) serves as an efficient reporter of the proteinous microenvironment of Human Serum Albumin (HSA). This work reports the binding phenomenon of MDMANA with HSA and spectral modulation thereupon. The extent of binding and free energy change for complexation reaction along with efficient fluorescence resonance energy transfer from Trp-214 of HSA to MDMANA indicates strong binding between probe and protein. Fluorescence anisotropy, red edge excitation shift, acrylamide quenching and time resolved measurements corroborate the binding nature of the probe with protein and predicts that the probe molecule is located at the hydrophobic site of the protein HSA. Due to the strong binding ability of MDMANA with HSA, it is successfully utilized for the study of stabilizing action of anionic surfactant Sodium Dodecyl Sulphate to the unfolding and folding of protein with denaturant urea in concentration range 1M to 9M.

Protein Allostery and Conformational Dynamics.

PubMed

Guo, Jingjing; Zhou, Huan-Xiang

2016-06-08

The functions of many proteins are regulated through allostery, whereby effector binding at a distal site changes the functional activity (e.g., substrate binding affinity or catalytic efficiency) at the active site. Most allosteric studies have focused on thermodynamic properties, in particular, substrate binding affinity. Changes in substrate binding affinity by allosteric effectors have generally been thought to be mediated by conformational transitions of the proteins or, alternatively, by changes in the broadness of the free energy basin of the protein conformational state without shifting the basin minimum position. When effector binding changes the free energy landscape of a protein in conformational space, the change affects not only thermodynamic properties but also dynamic properties, including the amplitudes of motions on different time scales and rates of conformational transitions. Here we assess the roles of conformational dynamics in allosteric regulation. Two cases are highlighted where NMR spectroscopy and molecular dynamics simulation have been used as complementary approaches to identify residues possibly involved in allosteric communication. Perspectives on contentious issues, for example, the relationship between picosecond-nanosecond local and microsecond-millisecond conformational exchange dynamics, are presented.

Constrained Surface Complexation Modeling: Rutile in RbCl, NaCl, and NaCF 3SO 3 Media to 250 °C

DOE PAGES

Machesky, Michael L.; Předota, Milan; Ridley, Moira K.; ...

2015-06-01

In this paper, a comprehensive set of molecular-level results, primarily from classical molecular dynamics (CMD) simulations, are used to constrain CD-MUSIC surface complexation model (SCM) parameters describing rutile powder titrations conducted in RbCl, NaCl, and NaTr (Tr = triflate, CF 3SO 3 –) electrolyte media from 25 to 250 °C. Rb + primarily occupies the innermost tetradentate binding site on the rutile (110) surface at all temperatures (25, 150, 250 °C) and negative charge conditions (-0.1 and -0.2 C/m 2) probed via CMD simulations, reflecting the small hydration energy of this large, monovalent cation. Consequently, variable SCM parameters (Stern-layer capacitancemore » values and intrinsic Rb + binding constants) were adjusted relatively easily to satisfactorily match the CMD and titration data. The larger hydration energy of Na + results in a more complex inner-sphere distribution, which shifts from bidentate to tetradentate binding with increasing negative charge and temperature, and this distribution was not matched well for both negative charge conditions, which may reflect limitations in the CMD and/or SCM approaches. Finally, in particular, the CMD axial density profiles for Rb + and Na + reveal that peak binding distances shift toward the surface with increasing negative charge, suggesting that the CD-MUSIC framework may be improved by incorporating CD or Stern-layer capacitance values that vary with charge.« less

Constrained Surface Complexation Modeling: Rutile in RbCl, NaCl, and NaCF 3SO 3 Media to 250 °C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machesky, Michael L.; Předota, Milan; Ridley, Moira K.

In this paper, a comprehensive set of molecular-level results, primarily from classical molecular dynamics (CMD) simulations, are used to constrain CD-MUSIC surface complexation model (SCM) parameters describing rutile powder titrations conducted in RbCl, NaCl, and NaTr (Tr = triflate, CF 3SO 3 –) electrolyte media from 25 to 250 °C. Rb + primarily occupies the innermost tetradentate binding site on the rutile (110) surface at all temperatures (25, 150, 250 °C) and negative charge conditions (-0.1 and -0.2 C/m 2) probed via CMD simulations, reflecting the small hydration energy of this large, monovalent cation. Consequently, variable SCM parameters (Stern-layer capacitancemore » values and intrinsic Rb + binding constants) were adjusted relatively easily to satisfactorily match the CMD and titration data. The larger hydration energy of Na + results in a more complex inner-sphere distribution, which shifts from bidentate to tetradentate binding with increasing negative charge and temperature, and this distribution was not matched well for both negative charge conditions, which may reflect limitations in the CMD and/or SCM approaches. Finally, in particular, the CMD axial density profiles for Rb + and Na + reveal that peak binding distances shift toward the surface with increasing negative charge, suggesting that the CD-MUSIC framework may be improved by incorporating CD or Stern-layer capacitance values that vary with charge.« less

Aqueous Cation-Amide Binding: Free Energies and IR Spectral Signatures by Ab Initio Molecular Dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pluharova, Eva; Baer, Marcel D.; Mundy, Christopher J.

2014-07-03

Understanding specific ion effects on proteins remains a considerable challenge. N-methylacetamide serves as a useful proxy for the protein backbone that can be well characterized both experimentally and theoretically. The spectroscopic signatures in the amide I band reflecting the strength of the interaction of alkali cations and alkali earth dications with the carbonyl group remain difficult to assign and controversial to interpret. Herein, we directly compute the IR shifts corresponding to the binding of either sodium or calcium to aqueous N-methylacetamide using ab initio molecular dynamics simulations. We show that the two cations interact with aqueous N-methylacetamide with different affinitiesmore » and in different geometries. Since sodium exhibits a weak interaction with the carbonyl group, the resulting amide I band is similar to an unperturbed carbonyl group undergoing aqueous solvation. In contrast, the stronger calcium binding results in a clear IR shift with respect to N-methylacetamide in pure water. Support from the Czech Ministry of Education (grant LH12001) is gratefully acknowledged. EP thanks the International Max-Planck Research School for support and the Alternative Sponsored Fellowship program at Pacific Northwest National Laboratory (PNNL). PJ acknowledges the Praemium Academie award from the Academy of Sciences. Calculations of the free energy profiles were made possible through generous allocation of computer time from the North-German Supercomputing Alliance (HLRN). Calculations of vibrational spectra were performed in part using the computational resources in the National Energy Research Supercomputing Center (NERSC) at Lawrence Berkeley National Laboratory. This work was supported by National Science Foundation grant CHE-0431312. CJM is supported by the U.S. Department of Energy`s (DOE) Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences. PNNL is operated for the Department of Energy by Battelle. MDB is grateful for the support of the Linus Pauling Distinguished Postdoctoral Fellowship Program at PNNL.« less

Valence-band-edge shift due to doping in p + GaAs

NASA Astrophysics Data System (ADS)

Silberman, J. A.; de Lyon, T. J.; Woodall, J. M.

1991-05-01

Accurate knowledge of the shifts in valence- and conduction-band edges due to heavy doping effects is crucial in modeling GaAs device structures that utilize heavily doped layers. X-ray photoemission spectroscopy was used to deduce the shift in the valence-band-edge induced by carbon (p type) doping to a carrier density of 1×1020 cm-3 based on a determination of the bulk binding energy of the Ga and As core levels in this material. Analysis of the data indicates that the shift of the valence-band maximum into the gap and the penetration of the Fermi level into the valence bands exactly compensate at this degenerate carrier concentration, to give ΔEv =0.12±0.05 eV.

Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies

NASA Astrophysics Data System (ADS)

Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

2017-03-01

An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift ( 10 nm) and smaller Stokes' shift ( 5980 cm- 1) in BSA than HSA (Stokes'shift 6600 cm- 1), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (Ka 5.2 × 106 M- 1) than the DMOBA-HSA complex (Ka 1.0 × 106 M- 1). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5 Å) than HSA (25.4 Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (- 2.09 kcal/mol) compared to BSA (- 0.47 kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA.

Effects of shape, size, and pyrene doping on electronic properties of graphene nanoflakes.

PubMed

Kuamit, Thanawit; Ratanasak, Manussada; Rungnim, Chompoonut; Parasuk, Vudhichai

2017-11-25

Effects of size, shape, and pyrene doping on electronic properties of graphene nanoflakes (GNFs) were theoretically investigated using density functional theory method with PBE, B3PW91, and M06-2X functionals and cc-pVDZ basis set. Two shapes of zigzag GNFs, hexagonal (HGN) and rhomboidal (RGN), were considered. The energy band gap of GNF depends on shape and decreases with size. The HGN has larger band gap energy (1.23-3.96 eV) than the RGN (0.13-2.12 eV). The doping of pyrene and pyrene derivatives on both HGN and RGN was also studied. The adsorption energy of pyrene and pyrene derivatives on GNF does not depend on the shape of GNFs with energies between 21 and 27 kcal mol -1 . The substituent on pyrene enhances the binding to GNF but the strength does not depend on electron withdrawing or donating capability. The doping by pyrene and pyrene derivatives also shifts the HOMO and LUMO energies of GNFs. Both positive (destabilizing) and negative (stabilizing) shifts on HOMO and LUMO of GNFs were seen. The direction and magnitude of the shift do not follow the electron withdrawing and donating capability of pyrene substituents. However, only a slight shift was observed for doped RGN. A shift of 0.19 eV was noticed for HOMO of HGN doped with 1-aminopyrene (pyNH 2 ) and of 0.04 eV for LUMO of HGN doped with 1-pyrenecarboxylic acid (pyCOOH). Graphical Abstract HOMO and LUMO Energies of pyrene/pyrene derivatives doped Graphene Nanoflakes.

Deviations from Born-Oppenheimer mass scaling in spectroscopy and ultracold molecular physics

NASA Astrophysics Data System (ADS)

Lutz, Jesse J.; Hutson, Jeremy M.

2016-12-01

We investigate Born-Oppenheimer breakdown (BOB) effects (beyond the usual mass scaling) for the electronic ground states of a series of homonuclear and heteronuclear alkali-metal diatoms, together with the Sr2 and Yb2 diatomics. Several widely available electronic structure software packages are used to calculate the leading contributions to the total isotope shift for commonly occurring isotopologs of each species. Computed quantities include diagonal Born-Oppenheimer corrections (mass shifts) and isotopic field shifts. Mass shifts dominate for light nuclei up to and including K, but field shifts contribute significantly for Rb and Sr and are dominant for Yb. We compare the ab initio mass-shift functions for Li2, LiK and LiRb with spectroscopically derived ground-state BOB functions from the literature. We find good agreement in the values of the functions for LiK and LiRb at their equilibrium geometries, but significant disagreement with the shapes of the functions for all 3 systems. The differences may be due to contributions of nonadiabatic terms to the empirical BOB functions. We present a semiclassical model for the effect of BOB corrections on the binding energies of near-threshold states and the positions of zero-energy Feshbach resonances.

How strong is the edge effect in the adsorption of anticancer drugs on a graphene cluster?

PubMed

Rungnim, Chompoonut; Chanajaree, Rungroj; Rungrotmongkol, Thanyada; Hannongbua, Supot; Kungwan, Nawee; Wolschann, Peter; Karpfen, Alfred; Parasuk, Vudhichai

2016-04-01

The adsorption of nucleobase-analog anticancer drugs (fluorouracil, thioguanine, and mercaptopurine) on a graphene flake (C54H18) was investigated by shifting the site at which adsorption occurs from one end of the sheet to the other end. The counterpoise-corrected M06-2X/cc-pVDZ binding energies revealed that the binding stability decreases in the sequence thioguanine > mercaptopurine > fluorouracil. We found that adsorption near the middle of the sheet is more favorable than adsorption near the edge due to the edge effect. This edge effect is stronger for the adsorption of thioguanine or mercaptopurine than for fluorouracil adsorption. However, the edge effect reduces the binding energy of the drug to the flake by only a small amount, <5 kcal/mol, depending on the adsorption site and the alignment of the drug at this site.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stier, Andreas V.; McCreary, Kathleen M.; Jonker, Berend T.

In bulk and quantum-confined semiconductors, magneto-optical studies have historically played an essential role in determining the fundamental parameters of excitons (size, binding energy, spin, dimensionality and so on). Here we report low-temperature polarized reflection spectroscopy of atomically thin WS 2 and MoS 2 in high magnetic fields to 65 T. Both the A and B excitons exhibit similar Zeeman splittings of approximately –230 μeV T–1 (g-factor ≃–4), thereby quantifying the valley Zeeman effect in monolayer transition-metal disulphides. Crucially, these large fields also allow observation of the small quadratic diamagnetic shifts of both A and B excitons in monolayer WS 2,more » from which radii of ~1.53 and ~1.16 nm are calculated. Further, when analysed within a model of non-local dielectric screening, these diamagnetic shifts also constrain estimates of the A and B exciton binding energies (410 and 470 meV, respectively, using a reduced A exciton mass of 0.16 times the free electron mass). Lastly, these results highlight the utility of high magnetic fields for understanding new two-dimensional materials.« less

Magnetic field and dielectric environment effects on an exciton trapped by an ionized donor in a spherical quantum dot

NASA Astrophysics Data System (ADS)

Aghoutane, N.; Feddi, E.; El-Yadri, M.; Bosch Bailach, J.; Dujardin, F.; Duque, C. A.

2017-11-01

Magnetic field and host dielectric environment effects on the binding energy of an exciton trapped by an ionized donor in spherical quantum dot are investigated. In the framework of the effective mass approximation and by using a variational method, the calculations have been performed by developing a robust ten-terms wave function taking into account the different inter-particles correlations and the distortion of symmetry induced by the orientation of the applied magnetic field. The binding and the localization energies are determined as functions of dot size and magnetic field strength. It appears that the variation of magnetic shift obeys a quadratic law for low magnetic fields regime while, for strong magnetic fields, this shift tends to be linear versus the magnetic field strength. The stability of this complex subjected to a magnetic field is also discussed according to the electron-hole ratio and the dielectric constant of the surrounding medium. A last point to highlight is that the Haynes' rule remains valid even in the presence of an applied magnetic field.

Plasmon excitations in doped square-lattice atomic clusters

NASA Astrophysics Data System (ADS)

Wang, Yaxin; Yu, Ya-Bin

2017-12-01

Employing the tight-binding model, we theoretically study the properties of the plasmon excitations in doped square-lattice atomic clusters. The results show that the dopant atoms would blur the absorption spectra, and give rise to extra plasmon resonant peaks as reported in the literature; however, our calculated external-field induced oscillating charge density shows that no obvious evidences indicate the so-called local mode of plasmon appearing in two-dimensional-doped atomic clusters, but the dopants may change the symmetry of the charge distribution. Furthermore, we show that the disorder of the energy level due to dopant makes the absorption spectrum has a red- or blue-shift, which depends on the position of impurities; disorder of hopping due to dopant makes a blue- or red-shift, a larger (smaller) hopping gives a blue-shift (red-shift); and a larger (smaller) host-dopant and dopant-dopant intersite coulomb repulsion induces a blue-shift (red-shift).

The flexible C-terminal arm of the Lassa arenavirus Z-protein mediates interactions with multiple binding partners.

PubMed

May, Eric R; Armen, Roger S; Mannan, Aristotle M; Brooks, Charles L

2010-08-01

The arenavirus genome encodes for a Z-protein, which contains a RING domain that coordinates two zinc ions, and has been identified as having several functional roles at various stages of the virus life cycle. Z-protein binds to multiple host proteins and has been directly implicated in the promotion of viral budding, repression of mRNA translation, and apoptosis of infected cells. Using homology models of the Z-protein from Lassa strain arenavirus, replica exchange molecular dynamics (MD) was used to refine the structures, which were then subsequently clustered. Population-weighted ensembles of low-energy cluster representatives were predicted based upon optimal agreement of the chemical shifts computed with the SPARTA program with the experimental NMR chemical shifts. A member of the refined ensemble was identified to be a potential binder of budding factor Tsg101 based on its correspondence to the structure of the HIV-1 Gag late domain when bound to Tsg101. Members of these ensembles were docked against the crystal structure of human eIF4E translation initiation factor. Two plausible binding modes emerged based upon their agreement with experimental observation, favorable interaction energies and stability during MD trajectories. Mutations to Z are proposed that would either inhibit both binding mechanisms or selectively inhibit only one mode. The C-terminal domain conformation of the most populated member of the representative ensemble shielded protein-binding recognition motifs for Tsg101 and eIF4E and represents the most populated state free in solution. We propose that C-terminal flexibility is key for mediating the different functional states of the Z-protein. (c) 2010 Wiley-Liss, Inc.

The Flexible C-terminal Arm of the Lassa Arenavirus Z-Protein Mediates Interactions with Multiple Binding Partners

PubMed Central

May, Eric R.; Armen, Roger S.; Mannan, Aristotle M.; Brooks, Charles L.

2010-01-01

The arenavirus genome encodes for a Z-protein, which contains a RING domain that coordinates two zinc ions, and has been identified as having several functional roles at various stages of the virus life cycle. Z-protein binds to multiple host proteins and has been directly implicated in the promotion of viral budding, repression of mRNA translation and apoptosis of infected cells. Using homology models of the Z-protein from Lassa strain arenavirus, replica exchange molecular dynamics were employed to refine the structures, which were then subsequently clustered. Population weighted ensembles of low energy cluster representatives were predicted based upon optimal agreement of the chemical shifts computed with the SPARTA program with the experimental NMR chemical shifts. A member of the refined ensemble was indentified to be a potential binder of budding factor Tsg101 based on its correspondence to the structure of the HIV-1 Gag late domain when bound to Tsg101. Members of these ensembles were docked against the crystal structure of human eIF4E translation initiation factor. Two plausible binding modes emerged based upon their agreement with experimental observation, favorable interaction energies and stability during molecular dynamics trajectories. Mutations to Z are proposed that would either inhibit both binding mechanisms or selectively inhibit only one mode. The C-terminal domain conformation of the most populated member of the representative ensemble shielded protein binding recognition motifs for Tsg101 and eIF4E, and represents the most populated state free in solution. We propose that C-terminal flexibility is key for mediating the different functional states of the Z-protein. PMID:20544962

Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

PubMed

Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

2013-02-21

Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n = 1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energymore » and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. Finally, this opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.« less

Excitation and characterization of image potential state electrons on quasi-free-standing graphene

DOE PAGES

Lin, Yi; Li, Yunzhe; Sadowski, Jerzy T.; ...

2018-04-09

We investigate the band structure of image potential states in quasi-free-standing graphene (QFG) monolayer islands using angle-resolved two-photon-photoemission spectroscopy. Direct probing by low-energy electron diffraction shows that QFG is formed following oxygen intercalation into the graphene-Ir(111) interface. Despite the apparent decoupling of the monolayer graphene from the Ir substrate, we find that the binding energy of the n = 1 image potential state on these QFG islands increases by 0.17 eV, as compared to the original Gr/Ir(111) interface. We use calculations based on density-functional theory to construct an empirical, one-dimensional potential that quantitatively reproduces the image potential state binding energymore » and links the changes in the interface structure to the shift in energy. Specifically, two factors contribute comparably to this energy shift: a deeper potential well arising from the presence of intercalated oxygen adatoms and a wider potential well associated with the increase in the graphene-Ir distance. While image potential states have not been observed previously on QFG by photoemission, our paper now demonstrates that they may be strongly excited in a well-defined QFG system produced by oxygen intercalation. Finally, this opens an opportunity for studying the surface electron dynamics in QFG systems, beyond those found in typical nonintercalated graphene-on-substrate systems.« less

Strain engineering of the elasticity and the Raman shift of nanostructured TiO2

NASA Astrophysics Data System (ADS)

Liu, X. J.; Pan, L. K.; Sun, Z.; Chen, Y. M.; Yang, X. X.; Yang, L. W.; Zhou, Z. F.; Sun, Chang Q.

2011-08-01

Correlation between the elastic modulus (B) and the Raman shift (Δω) of TiO2 and their responses to the variation of crystal size, applied pressure, and measuring temperature have been established as a function depending on the order, length, and energy of a representative bond for the entire specimen. In addition to the derived fundamental information of the atomic cohesive energy, binding energy density, Debye temperature and nonlinear compressibility, theoretical reproduction of the observations clarified that (i) the size effect arises from the under-coordination induced cohesive energy loss and the energy density gain in the surface up to skin depth; (ii) the thermally softened B and Δω results from bond expansion and bond weakening due to vibration; and, (iii) the mechanically stiffened B and Δω results from bond compression and bond strengthening due to mechanical work hardening. With the developed premise, one can predict the changing trends of the concerned properties with derivatives of quantitative information as such from any single measurement alone.

Driving spin transition at interface: Role of adsorption configurations

NASA Astrophysics Data System (ADS)

Zhang, Yachao

2018-01-01

A clear insight into the electrical manipulation of molecular spins at interface is crucial to the design of molecule-based spintronic devices. Here we report on the electrically driven spin transition in manganocene physisorbed on a metallic surface in two different adsorption configurations predicted by ab initio techniques, including a Hubbard-U correction at the manganese site and accounting for the long-range van der Waals interactions. We show that the application of an electric field at the interface induces a high-spin to low-spin transition in the flat-lying manganocene, while it could hardly alter the high-spin ground state of the standing-up molecule. This phenomenon cannot be explained by either the molecule-metal charge transfer or the local electron correlation effects. We demonstrate a linear dependence of the intra-molecular spin-state splitting on the energy difference between crystal-field splitting and on-site Coulomb repulsion. After considering the molecule-surface binding energy shifts upon spin transition, we reproduce the obtained spin-state energetics. We find that the configuration-dependent responses of the spin-transition originate from the binding energy shifts instead of the variation of the local ligand field. Through these analyses, we obtain an intuitive understanding of the effects of molecule-surface contact on spin-crossover under electrical bias.

Free-energy relationships in ion channels activated by voltage and ligand

PubMed Central

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Adsorbate-induced shifts of electronic surface states: Cs on the (100) faces of tungsten, molybdenum, and tantalum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soukiassian, P.; Riwan, R.; Lecante, J.

1985-04-15

The adsorption of cesium on the (100) faces of W, Mo, and Ta for coverages between 0 and 1 monolayer is studied by angle-resolved ultraviolet photoemission spectroscopy with use of synchro- tron radiation, by electron-energy-loss spectroscopy, and by low-energy electron diffraction. With increasing cesiation, the W(100) surface state at Gamma-bar located 0.3 eV below the Fermi level is shifted by up to 1.0 eV to larger binding energies while remaining sharp and intense. A similar behavior is observed on Ta(100), whereas on Mo(100) the shift of 0.9 eV of this surface state is accompanied by a pronounced attenuation of itsmore » intensity. These experimental shifts are shown to be in excellent agreement with all-electron local-density-functional results obtained with the full-potential linearized augmented-plane-wave method for Cs monolayers on the W(100) and Mo(100) surfaces. Based on these ab initio results, the electronic origin of the shifts is understood by the formation of strongly polarized covalent bonds between the d-like surface states and the Cs 6s--derived valence states. It is argued that even at high Cs coverages, the main electron-energy-loss peaks, which are observed between 1 and 2 eV, could be interpreted as Cs 6s..-->..6p--like interband transitions rather than as surface-plasmon peaks.« less

Dominant Alcohol-Protein Interaction via Hydration-Enabled Enthalpy-Driven Binding Mechanism

PubMed Central

Chong, Yuan; Kleinhammes, Alfred; Tang, Pei; Xu, Yan; Wu, Yue

2015-01-01

Water plays an important role in weak associations of small drug molecules with proteins. Intense focus has been on binding-induced structural changes in the water network surrounding protein binding sites, especially their contributions to binding thermodynamics. However, water is also tightly coupled to protein conformations and dynamics, and so far little is known about the influence of water-protein interactions on ligand binding. Alcohols are a type of low-affinity drugs, and it remains unclear how water affects alcohol-protein interactions. Here, we present alcohol adsorption isotherms under controlled protein hydration using in-situ NMR detection. As functions of hydration level, Gibbs free energy, enthalpy, and entropy of binding were determined from the temperature dependence of isotherms. Two types of alcohol binding were found. The dominant type is low-affinity nonspecific binding, which is strongly dependent on temperature and the level of hydration. At low hydration levels, this nonspecific binding only occurs above a threshold of alcohol vapor pressure. An increased hydration level reduces this threshold, with it finally disappearing at a hydration level of h~0.2 (g water/g protein), gradually shifting alcohol binding from an entropy-driven to an enthalpy-driven process. Water at charged and polar groups on the protein surface was found to be particularly important in enabling this binding. Although further increase in hydration has smaller effects on the changes of binding enthalpy and entropy, it results in significant negative change in Gibbs free energy due to unmatched enthalpy-entropy compensation. These results show the crucial role of water-protein interplay in alcohol binding. PMID:25856773

Surface shift of the occupied and unoccupied 4f levels of the rare-earth metals

NASA Astrophysics Data System (ADS)

Aldén, M.; Johansson, B.; Skriver, H. L.

1995-02-01

The surface energy shifts of the occupied and unoccupied 4f levels for the lanthanide metals have been calculated from first principles by means of a Green's-function technique within the tight-binding linear muffin-tin orbitals method. We use the concept of complete screening to identify the occupied and unoccupied 4f energy level shifts as the surface segregation energy of a 4fn-1 and 4fn+1 impurity atom, respectively, in a 4fn host metal. The calculations include both initial- and final-state effects and give values that are considerably lower than those measured on polycrystalline samples as well as those found in previous initial-state model calculations. The present theory agrees well with very recent high-resolution, single-crystal film measurements for Gd, Tb, Dy, Ho, Er, Tm, and Lu. We furthermore utilize the unique possibility offered by the lanthanide metals to clarify the roles played by the initial and the different final states of the core-excitation process, permitted by the fact that the so-called initial-state effect is identical upon 4f removal and 4f addition. Surface energy and work function calculations are also reported.

Effects of two solvent conditions on the free energy landscape of the BBL peripheral subunit binding domain.

PubMed

Liu, Hanzhong; Huo, Shuanghong

2012-01-12

BBL is a small independently folding domain with two main parallel helices. The experiment of C(α) secondary shifts has shown that changing the pH from ~7 to ~5 results in the reduced helicity at the C-terminus of helix 2. Combining constant pH molecular dynamics with replica exchange, we sampled the protein conformation space and protonation states extensively under a neutral pH condition and an acidic condition. Our results reveal that the solvent conditions influence the free energy landscape. Under the neutral pH condition, the denatured state and the native state are well separated. The condition of the acidic pH reshapes the free energy surface, leading to a broadly populated denatured-state basin and a low free energy barrier between the denatured state and the native state. The acidic pH shifts the equilibrium between the denatured state and the native state in favor of the denatured state. Caution must be used to interpret experimental data under the acidic condition because the contribution of the denatured state is significant. Our simulation results are supported by the fact that the calculated chemical shifts are in good agreement with the experiment data.

Analysis of oxygen binding-energy variations for BaO on W

NASA Astrophysics Data System (ADS)

Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.

Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.

Spatially Resolved Sensitivity of Single-Particle Plasmon Sensors

PubMed Central

2018-01-01

The high sensitivity of localized surface plasmon resonance sensors to the local refractive index allows for the detection of single-molecule binding events. Though binding events of single objects can be detected by their induced plasmon shift, the broad distribution of observed shifts remains poorly understood. Here, we perform a single-particle study wherein single nanospheres bind to a gold nanorod, and relate the observed plasmon shift to the binding location using correlative microscopy. To achieve this we combine atomic force microscopy to determine the binding location, and single-particle spectroscopy to determine the corresponding plasmon shift. As expected, we find a larger plasmon shift for nanospheres binding at the tip of a rod compared to its sides, in good agreement with numerical calculations. However, we also find a broad distribution of shifts even for spheres that were bound at a similar location to the nanorod. Our correlative approach allows us to disentangle effects of nanoparticle dimensions and binding location, and by comparison to numerical calculations we find that the biggest contributor to this observed spread is the dispersion in nanosphere diameter. These experiments provide insight into the spatial sensitivity and signal-heterogeneity of single-particle plasmon sensors and provides a framework for signal interpretation in sensing applications. PMID:29520315

Exciton diamagnetic shift and optical properties in CdSe nanocrystal quantum dots in magnetic fields

NASA Astrophysics Data System (ADS)

Wu, Shudong; Cheng, Liwen

2018-04-01

The magnetic field dependence of the optical properties of CdSe nanocrystal quantum dots (NQDs) is investigated theoretically using a perturbation method within the effective-mass approximation. The results show that the magnetic field lifts the degeneracy of the electron (hole) states. A blue-shift in the absorption spectra of m ≥ 0 exciton states is observed while the absorption peak of m < 0 exciton states is first red-shifted and then blue-shifted with increasing the magnetic field strength B. This is attributed to the interplay of the orbital Zeeman effect and the additive confinement induced by the magnetic field. The excitonic absorption coefficient is almost independent of B in the strong confinement regime. The applied magnetic field causes the splitting of degenerated exciton states, resulting in the new absorption peaks. Based on the first-order perturbation theory, we propose the analytical expressions for the exciton binding energy, exciton transition energy and exciton diamagnetic shift of 1s, 1p-1, 1p0, 1p1, 1d-2, 1d-1, 1d0, 1d1, 1d2 and 2s exciton states on the applied magnetic field in the strong confinement regime.

How maltose influences structural changes to bind to maltose-binding protein: results from umbrella sampling simulation.

PubMed

Mascarenhas, Nahren Manuel; Kästner, Johannes

2013-02-01

A well-studied periplasmic-binding protein involved in the abstraction of maltose is maltose-binding protein (MBP), which undergoes a ligand-induced conformational transition from an open (ligand-free) to a closed (ligand-bound) state. Umbrella sampling simulations have been us to estimate the free energy of binding of maltose to MBP and to trace the potential of mean force of the unbinding event using the center-of-mass distance between the protein and ligand as the reaction coordinate. The free energy thus obtained compares nicely with the experimentally measured value justifying our theoretical basis. Measurement of the domain angle (N-terminal-domain - hinge - C-terminal-domain) along the unbinding pathway established the existence of three different states. Starting from a closed state, the protein shifts to an open conformation during the initial unbinding event of the ligand then resides in a semi-open conformation and later resides predominantly in an open-state. These transitions along the ligand unbinding pathway have been captured in greater depth using principal component analysis. It is proposed that in mixed-model, both conformational selection and an induced-fit mechanism combine to the ligand recognition process in MBP. Copyright © 2012 Wiley Periodicals, Inc.

Multisite occupation of divalent dopants in barium and strontium titanates

NASA Astrophysics Data System (ADS)

Zulueta, Yohandys A.; Nguyen, Minh Tho

2018-10-01

Based on recent experimental and theoretical proofs of calcium multisite occupation in barium titanate, we investigated a mixed incorporation mechanism for divalent dopants in barium and strontium titanates (BaTiO3 and SrTiO3). Our present theoretical results demonstrated the multisite occupation of divalent dopants in both perovskite structures. We determined the dependences of the solution, binding energies, and final solution energies with respect to the ionic radii of the dopants. Calculated results obtained based on classical simulations showed that the divalent dopants can occupy both A- and Ti- cation sites in ATiO3 perovskite structures. Such a multisite occupation has direct implications for other experimental findings regarding BaTiO3, such as non-stabilization of the tetragonal phase, shifts in the Curie temperature, intensification of the diffuse phase transition, and shifts in the absorption of ultraviolet light to the visible range in photocatalytic applications related to solar cells for producing energy.

Photoelectron spectroscopy of aqueous solutions: Streaming potentials of NaX (X = Cl, Br, and I) solutions and electron binding energies of liquid water and X{sup −}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurahashi, Naoya; Horio, Takuya; Suzuki, Toshinori, E-mail: suzuki@kuchem.kyoto-u.ac.jp

2014-05-07

The streaming potentials of liquid beams of aqueous NaCl, NaBr, and NaI solutions are measured using soft X-ray, He(I), and laser multiphoton ionization photoelectron spectroscopy. Gaseous molecules are ionized in the vicinity of liquid beams and the photoelectron energy shifts are measured as a function of the distance between the ionization point and the liquid beam. The streaming potentials change their polarity with concentration of electrolytes, from which the singular points of concentration eliminating the streaming potentials are determined. The streaming currents measured in air also vanish at these concentrations. The electron binding energies of liquid water and I{sup −},more » Br{sup −}, and Cl{sup −} anions are revisited and determined more accurately than in previous studies.« less

Study of behaviors of aluminum overlayers deposited on uranium via AES, EELS, and XPS

NASA Astrophysics Data System (ADS)

Liu, Kezhao; Luo, Lizhu; Zhou, Wei; Yang, Jiangrong; Xiao, Hong; Hong, Zhanglian; Yang, Hui

2013-04-01

Aluminum overlayers on uranium were prepared by sputtering at room temperature in an ultra-high vacuum chamber. The growth mode of aluminum overlayers and behaviors of the Al/U interface reaction were studied in situ by auger electron spectroscopy, electron energy loss spectroscopy, and X-ray photoelectron spectroscopy. The results suggested that the interdiffusion took place at the Al/U interface during the initial stage of deposition. The U4f spectra of the Al/U interface showed strong correlation satellites at binding energies of 380.4 and 392.7 eV and plasma loss features at 404.2 eV, respectively. The interactions between aluminum and uranium yielded the intermetallic compound of UAlx, inducing the shift to a low binding energy for Al2p peaks. The results indicated that aluminum overlayers were formed on the uranium by sputtering in an island growth mode.

Nondestructive depth profile of the chemical state of ultrathin Al2O3/Si interface

NASA Astrophysics Data System (ADS)

Lee, Jong Cheol; Oh, S.-J.

2004-05-01

We investigated a depth profile of the chemical states of an Al2O3/Si interface using nondestructive photon energy-dependent high-resolution x-ray photoelectron spectroscopy (HRXPS). The Si 2p binding energy, attributed to the oxide interfacial layer (OIL), was found to shift from 102.1 eV to 102.9 eV as the OIL region closer to Al2O3 layer was sampled, while the Al 2p binding energy remains the same. This fact strongly suggests that the chemical state of the interfacial layer is not Al silicate as previously believed. We instead propose from the HRXPS of Al 2p and Si 2p depth-profile studies that the chemical states of the Al2O3/Si interface mainly consist of SiO2 and Si2O3.

Metal-Ion Effects on the Polarization of Metal-Bound Water and Infrared Vibrational Modes of the Coordinated Metal Center of Mycobacterium tuberculosis Pyrazinamidase via Quantum Mechanical Calculations

PubMed Central

2014-01-01

Mycobacterium tuberculosis pyrazinamidase (PZAse) is a key enzyme to activate the pro-drug pyrazinamide (PZA). PZAse is a metalloenzyme that coordinates in vitro different divalent metal cofactors in the metal coordination site (MCS). Several metals including Co2+, Mn2+, and Zn2+ are able to reactivate the metal-depleted PZAse in vitro. We use quantum mechanical calculations to investigate the Zn2+, Fe2+, and Mn2+ metal cofactor effects on the local MCS structure, metal–ligand or metal–residue binding energy, and charge distribution. Results suggest that the major metal-dependent changes occur in the metal–ligand binding energy and charge distribution. Zn2+ shows the highest binding energy to the ligands (residues). In addition, Zn2+ and Mn2+ within the PZAse MCS highly polarize the O–H bond of coordinated water molecules in comparison with Fe2+. This suggests that the coordination of Zn2+ or Mn2+ to the PZAse protein facilitates the deprotonation of coordinated water to generate a nucleophile for catalysis as in carboxypeptidase A. Because metal ion binding is relevant to enzymatic reaction, identification of the metal binding event is important. The infrared vibrational mode shift of the C=Nε (His) bond from the M. tuberculosis MCS is the best IR probe to metal complexation. PMID:25055049

Ligand selectivity of estrogen receptors by a molecular dynamics study.

PubMed

Hu, Guodong; Wang, Jihua

2014-03-03

Estrogen receptors α (ERα) and β (ERβ) have different physiological functions and expression levels in different tissues. ERα and ERβ are highly homologous and have only two residue substitutions in the binding pocket. This high similarity at the active site stimulates the interests for discovering subtype selective ligands. In this study, molecular dynamics (MD) simulations combined with molecular mechanics generalized Born surface area (MM-GBSA) method have been carried out to analyze the basis of selectivity of three ligands (659, 818 and 041). The calculated binding free energies show that all the ligands bind more tightly to ERβ than to ERα. The dominant free energy components of selectivity for 659 are similar to that for 041, but different from that for 818. The decompositions of free energy contributions and structural analysis imply that there are eight residues primarily contributing to the selectivity for 659, five residues for 041, as well as two residues for 818. The structural analysis implies that two residue substitutions in binding packet cause the position of 659 in ERβ-659 complex to shift relative to that in ERα-659 complex and also cause the conformational changes of other residues in the binding pocket. The higher selectivity for 041 is mainly caused by three residues, Ile373 (Met421), His475 (His524) and Leu476 (Leu525). Copyright © 2013. Published by Elsevier Masson SAS.

The effects of the electric and intense laser field on the binding energies of donor impurity states (1s and 2p±) and optical absorption between the related states in an asymmetric parabolic quantum well

NASA Astrophysics Data System (ADS)

Kasapoglu, E.; Sakiroglu, S.; Sökmen, I.; Restrepo, R. L.; Mora-Ramos, M. E.; Duque, C. A.

2016-10-01

We have calculated the effects of electric and intense laser fields on the binding energies of the ground and some excited states of conduction electrons coupled to shallow donor impurities as well as the total optical absorption coefficient for transitions between 1s and 2p± electron-impurity states in a asymmetric parabolic GaAs/Ga1-x AlxAs quantum well. The binding energies were obtained using the effective-mass approximation within a variational scheme. Total absorption coefficient (linear and nonlinear absorption coefficient) for the transitions between any two impurity states were calculated from first- and third-order dielectric susceptibilities derived within a perturbation expansion for the density matrix formalism. Our results show that the effects of the electric field, intense laser field, and the impurity location on the binding energy of 1s-impurity state are more pronounced compared with other impurity states. If the well center is changed to be Lc<0 (Lc>0), the effective well width decreases (increases), and thus we can obtain the red or blue shift in the resonant peak position of the absorption coefficient by changing the intensities of the electric and non-resonant intense laser field as well as dimensions of the well and impurity positions.

Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies.

PubMed

Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

2017-03-15

An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift (~10nm) and smaller Stokes' shift (~5980cm -1 ) in BSA than HSA (Stokes'shift~6600cm -1 ), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (K a ~5.2×10 6 M -1 ) than the DMOBA-HSA complex (K a ~1.0×10 6 M -1 ). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5Å) than HSA (25.4Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (-2.09kcal/mol) compared to BSA (-0.47kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA. Copyright © 2016 Elsevier B.V. All rights reserved.

Temperature dependent dispersion and electron-phonon coupling surface states on Be(1010)

NASA Astrophysics Data System (ADS)

Tang, Shu-Jung; Ismail; Sprunger, Philip; Plummer, Ward

2002-03-01

Temperature dependent dispersion and electron-phonon coupling surface states on Be(10-10) S.-J Tang*, Ismail* , P.T . Sprunger#, E. W. Plummer* * Department of Physics and Astronomy, University of Tennessee, Knoxville, TN37996 , # Center for Advanced Microstructures and Devices (CAMD), Louisiana State University The surface states dispersing in a large band gap from -A to -Γ in Be(10-10) were studied with high-resolution, angle-resolved photoemission. Spectra reveal that the two zone-boundary surface states, S1 and S2, behave significantly different with respect to band dispersion, the temperature dependence of binding energies, and the electron-phonon coupling. The band dispersion of S1 is purely free-electron like with the maximum binding energy of 0.37+-0.05 eV at -A and effective mass m*/m =0835. However, the maximum binding energy 2.74+-0.05 eV of the S2 is located 0.2Åaway from -A and disperses into the bulk band edge at a binding energy of 1.75+-0.05 eV. Temperature dependent data reveal that the binding energies of S1 and S2 at -A shift in opposite directions at the rate of (-0.61+-0.3)+- 10E-4 eV/K and (1.71+-0.8)+-10E-4 eV/K, respectively. Moreover, from the temperature-dependent spectral widths of the surface states S1 and S2 at , the electron-phonon coupling parameters,λ, have been determined. Unusually different, the coupling strength λ for S1 and S2 are 0.67+-0.03 and 0.51+-0.04, respectively. The differences between the electron-phonon coupling, temperature dependent binding energies, and dispersions between these two zone-centered surface states will be discussed in light unique bonding at the surface and localization.

Nuclear-size correction to the Lamb shift of one-electron atoms

NASA Astrophysics Data System (ADS)

Yerokhin, Vladimir A.

2011-01-01

The nuclear-size effect on the one-loop self-energy and vacuum polarization is evaluated for the 1s, 2s, 3s, 2p1/2, and 2p3/2 states of hydrogen-like ions. The calculation is performed to all orders in the nuclear binding strength parameter Zα. Detailed comparison is made with previous all-order calculations and calculations based on the expansion in the parameter Zα. Extrapolation of the all-order numerical results obtained toward Z=1 provides results for the radiative nuclear-size effect on the hydrogen Lamb shift.

Ligand Binding Analysis and Screening by Chemical Denaturation Shift

PubMed Central

Sch n, Arne; Brown, Richard K.; Hutchins, Burleigh M.; Freire, Ernesto

2013-01-01

The identification of small molecule ligands is an important first step in drug development, especially drugs that target proteins with no intrinsic activity. Towards this goal, it is important to have access to technologies that are able to measure binding affinities for a large number of potential ligands in a fast and accurate way. Since ligand binding stabilizes the protein structure in a manner dependent on concentration and binding affinity, the magnitude of the protein stabilization effect elicited by binding can be used to identify and characterize ligands. For example, the shift in protein denaturation temperature (Tm shift) has become a popular approach to identify potential ligands. However, Tm shifts cannot be readily transformed into binding affinities and the ligand rank order obtained at denaturation temperatures (60°C or higher) does not necessarily coincide with the rank order at physiological temperature. An alternative approach is the use of chemical denaturation, which can be implemented at any temperature. Chemical denaturation shifts allow accurate determination of binding affinities with a surprisingly wide dynamic range (high micromolar to sub nanomolar) and in situations in which binding changes the cooperativity of the unfolding transition. In this paper we develop the basic analytical equations and provide several experimental examples. PMID:23994566

Ligand binding analysis and screening by chemical denaturation shift.

PubMed

Schön, Arne; Brown, Richard K; Hutchins, Burleigh M; Freire, Ernesto

2013-12-01

The identification of small molecule ligands is an important first step in drug development, especially drugs that target proteins with no intrinsic activity. Toward this goal, it is important to have access to technologies that are able to measure binding affinities for a large number of potential ligands in a fast and accurate way. Because ligand binding stabilizes the protein structure in a manner dependent on concentration and binding affinity, the magnitude of the protein stabilization effect elicited by binding can be used to identify and characterize ligands. For example, the shift in protein denaturation temperature (Tm shift) has become a popular approach to identify potential ligands. However, Tm shifts cannot be readily transformed into binding affinities, and the ligand rank order obtained at denaturation temperatures (≥60°C) does not necessarily coincide with the rank order at physiological temperature. An alternative approach is the use of chemical denaturation, which can be implemented at any temperature. Chemical denaturation shifts allow accurate determination of binding affinities with a surprisingly wide dynamic range (high micromolar to sub nanomolar) and in situations where binding changes the cooperativity of the unfolding transition. In this article, we develop the basic analytical equations and provide several experimental examples. Copyright © 2013 Elsevier Inc. All rights reserved.

Relativistic corrections for screening effects on the energies of hydrogen-like atoms embedded in plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poszwa, A., E-mail: poszwa@matman.uwm.edu.p; Bahar, M. K., E-mail: mussiv58@gmail.com

2015-01-15

The influence of relativistic and plasma screening effects on energies of hydrogen-like atoms embedded in plasmas has been studied. The Dirac equation with a more general exponential cosine screened potential has been solved numerically and perturbatively, by employing the direct perturbation theory. Properties of spectra corresponding to bound states and to different sets of the potential parameters have been studied both in nonrelativistic and relativistic approximations. Binding energies, fine-structure splittings, and relativistic energy shifts have been determined as functions of parameters of the potential. The results have been compared with the ones known from the literature.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1999-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander M.; Benson, Scott C.

1998-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1995-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, Alexander N.; Benson, Scott C.

1997-01-01

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated.

X-ray photoemission studies of Zn doped Cu 1- xTl xBa 2Ca 2Cu 3- yZn yO 10- δ ( y = 0, 2.65) superconductors

NASA Astrophysics Data System (ADS)

Khan, Nawazish A.; Mumtaz, M.; Ahadian, M. M.; Iraji-zad, Azam

2007-03-01

The X-ray photoemission (XPS) measurements of Cu 1- xTl xBa 2Ca 2Cu 3- yZn yO 10- δ ( y = 0, 2.65) superconductors have been performed and compared. These studies revealed that the charge state of thallium in the Cu 0.5Tl 0.5Ba 2O 4- δ charge reservoir layer in Zn doped samples is Tl 1+, while it is a mix of Tl 1+ and Tl 2+ in Zn free samples. The binding energy of Ba atoms in the Zn doped samples is shifted to higher energy, which when considered along with the presence of Tl 1+ suggested that it more efficiently directed the carriers to ZnO 2 and CuO 2 planes. The evidence of improved inter-plane coupling witnessed in X-ray diffraction is also confirmed by XPS measurements of Ca atoms in the Zn doped samples. The shift of the valance band spectrum in these Zn doped samples to higher energies suggested that the electrons at the top edge of the valance band were tied to a higher binding energy (relative to samples without Zn doping), which most likely resulted in a much lower energy state of the system in the superconducting state. The stronger superconducting state arising out of these effects is witnessed in the form of increased Tc( R = 0), Jc and the extent of diamagnetism in the final compound.

Magnetic field effect on the energy levels of an exciton in a GaAs quantum dot: Application for excitonic lasers.

PubMed

Jahan, K Luhluh; Boda, A; Shankar, I V; Raju, Ch Narasimha; Chatterjee, Ashok

2018-03-22

The problem of an exciton trapped in a Gaussian quantum dot (QD) of GaAs is studied in both two and three dimensions in the presence of an external magnetic field using the Ritz variational method, the 1/N expansion method and the shifted 1/N expansion method. The ground state energy and the binding energy of the exciton are obtained as a function of the quantum dot size, confinement strength and the magnetic field and compared with those available in the literature. While the variational method gives the upper bound to the ground state energy, the 1/N expansion method gives the lower bound. The results obtained from the shifted 1/N expansion method are shown to match very well with those obtained from the exact diagonalization technique. The variation of the exciton size and the oscillator strength of the exciton are also studied as a function of the size of the quantum dot. The excited states of the exciton are computed using the shifted 1/N expansion method and it is suggested that a given number of stable excitonic bound states can be realized in a quantum dot by tuning the quantum dot parameters. This can open up the possibility of having quantum dot lasers using excitonic states.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1997-07-08

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.M.; Benson, S.C.

1998-06-16

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figs.

DNA complexes with dyes designed for energy transfer as fluorescent markers

DOEpatents

Glazer, A.N.; Benson, S.C.

1995-03-28

Heteromultimeric fluorophores are provided for binding to DNA, which allow for the detection of DNA in electrical separations and preparation of probes having high-fluorescent efficiencies and large Stokes shifts. In addition, by appropriate choice of fluorescent molecules, one can use a single narrow wavelength band excitation light source, while obtaining fluorescent emissions having sufficient separation to be readily discriminated. 4 figures.

Benchmark results for few-body hypernuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruffino, Fabrizio Ferrari; Lonardoni, Diego; Barnea, Nir

2017-03-16

Here, the Non-Symmetrized Hyperspherical Harmonics method (NSHH) is introduced in the hypernuclear sector and benchmarked with three different ab-initio methods, namely the Auxiliary Field Diffusion Monte Carlo method, the Faddeev–Yakubovsky approach and the Gaussian Expansion Method. Binding energies and hyperon separation energies of three- to five-body hypernuclei are calculated by employing the two-body ΛN component of the phenomenological Bodmer–Usmani potential, and a hyperon-nucleon interaction simulating the scattering phase shifts given by NSC97f. The range of applicability of the NSHH method is briefly discussed.

Enhanced nitrogen diffusion induced by atomic attrition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochoa, E.A.; Figueroa, C.A.; Czerwiec, T.

2006-06-19

The nitrogen diffusion in steel is enhanced by previous atomic attrition with low energy xenon ions. The noble gas bombardment generates nanoscale texture surfaces and stress in the material. The atomic attrition increases nitrogen diffusion at lower temperatures than the ones normally used in standard processes. The stress causes binding energy shifts of the Xe 3d{sub 5/2} electron core level. The heavy ion bombardment control of the texture and stress of the material surfaces may be applied to several plasma processes where diffusing species are involved.

Mechanism of pKID/KIX Association Studied by Molecular Dynamics Free Energy Simulations.

PubMed

Bomblies, Rainer; Luitz, Manuel P; Zacharias, Martin

2016-08-25

The phosphorylated kinase-inducible domain (pKID) associates with the kinase interacting domain (KIX) via a coupled folding and binding mechanism. The pKID domain is intrinsically disordered when unbound and upon phosphorylation at Ser133 binds to the KIX domain adopting a well-defined kinked two-helix structure. In order to identify putative hot spot residues of binding that could serve as an initial stable anchor, we performed in silico alanine scanning free energy simulations. The simulations indicate that charged residues including the phosphorylated central Ser133 of pKID make significant contributions to binding. However, these are of slightly smaller magnitude compared to several hydrophobic side chains not defining a single dominant binding hot spot. Both continuous molecular dynamics (MD) simulations and free energy analysis demonstrate that phosphorylation significantly stabilizes the central kinked motif around Ser133 of pKID and shifts the conformational equilibrium toward the bound conformation already in the absence of KIX. This result supports a view that pKID/KIX association follows in part a conformational selection process. During a 1.5 μs explicit solvent MD simulation, folding of pKID on the surface of KIX was observed after an initial contact at the bound position of the phosphorylation site was enforced following a sequential process of αA helix association and a stepwise association and folding of the second αB helix compatible with available experimental results.

Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

PubMed

Aslanoglu, Mehmet

2006-03-01

The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

Direct Binding of the Corrector VX-809 to Human CFTR NBD1: Evidence of an Allosteric Coupling between the Binding Site and the NBD1:CL4 Interface.

PubMed

Hudson, Rhea P; Dawson, Jennifer E; Chong, P Andrew; Yang, Zhengrong; Millen, Linda; Thomas, Philip J; Brouillette, Christie G; Forman-Kay, Julie D

2017-08-01

Understanding the mechanism of action of modulator compounds for the cystic fibrosis transmembrane conductance regulator (CFTR) is key for the optimization of therapeutics as well as obtaining insights into the molecular mechanisms of CFTR function. We demonstrate the direct binding of VX-809 to the first nucleotide-binding domain (NBD1) of human CFTR. Disruption of the interaction between C-terminal helices and the NBD1 core upon VX-809 binding is observed from chemical shift changes in the NMR spectra of residues in the helices and on the surface of β -strands S3, S9, and S10. Binding to VX-809 leads to a significant negative shift in NBD1 thermal melting temperature (T m ), pointing to direct VX-809 interaction shifting the NBD1 conformational equilibrium. An inter-residue correlation analysis of the chemical shift changes provides evidence of allosteric coupling between the direct binding site and the NBD1:CL4 interface, thus enabling effects on the interface in the absence of direct binding in that location. These NMR binding data and the negative T m shifts are very similar to those previously reported by us for binding of the dual corrector-potentiator CFFT-001 to NBD1 (Hudson et al., 2012), suggesting that the two compounds may share some aspects of their mechanisms of action. Although previous studies have shown an important role for VX-809 in modulating the conformation of the first membrane spanning domain (Aleksandrov et al., 2012; Ren et al., 2013), this additional mode of VX-809 binding provides insight into conformational dynamics and allostery within CFTR. Copyright © 2017 by The Author(s).

Effects of hydrostatic pressure on the donor impurity in a cylindrical quantum dot with Morse confining potential

NASA Astrophysics Data System (ADS)

Hayrapetyan, David B.; Kotanjyan, Tigran V.; Tevosyan, Hovhannes Kh.; Kazaryan, Eduard M.

2016-12-01

The effects of hydrostatic pressure and size quantization on the binding energies of a hydrogen-like donor impurity in cylindrical GaAs quantum dot (QD) with Morse confining potential are studied using the variational method and effective-mass approximation. In the cylindrical QD, the effect of hydrostatic pressure on the binding energy of electron has been investigated and it has been found that the application of the hydrostatic pressure leads to the blue shift. The dependence of the absorption edge on geometrical parameters of cylindrical QD is obtained. Selection rules are revealed for transitions between levels with different quantum numbers. It is shown that for the radial quantum number, transitions are allowed between the levels with the same quantum numbers, and any transitions between different levels are allowed for the principal quantum number.

Isotope effect on electron-phonon interaction in the multiband superconductor MgB 2

DOE PAGES

Mou, Daixiang; Manni, Soham; Taufour, Valentin; ...

2016-04-07

We investigate the effect of isotope substitution on the electron-phonon interaction in the multiband superconductor MgB 2 using tunable laser-based angle-resolved photoemission spectroscopy. The kink structure around 70 meV in the σ band, which is caused by electron coupling to the E 2g phonon mode, is shifted to higher binding energy by ~3.5 meV in Mg 10B 2 and the shift is not affected by superconducting transition. Furthermore, these results serve as the benchmark for investigations of isotope effects in known, unconventional superconductors and newly discovered superconductors where the origin of pairing is unknown.

Identification of the hot spot residues for pyridine derivative inhibitor CCT251455 and ATP substrate binding on monopolar spindle 1 (MPS1) kinase by molecular dynamic simulation.

PubMed

Chen, Kai; Duan, Wenxiu; Han, Qianqian; Sun, Xuan; Li, Wenqian; Hu, Shuangyun; Wan, Jiajia; Wu, Jiang; Ge, Yushu; Liu, Dan

2018-03-08

Protein kinase monopolar spindle 1 plays an important role in spindle assembly checkpoint at the onset of mitosis. Over expression of MPS1 correlated with a wide range of human tumors makes it an attractive target for finding an effective and specific inhibitor. In this work, we performed molecular dynamics simulations of protein MPS1 itself as well as protein bound systems with the inhibitor and natural substrate based on crystal structures. The reported orally bioavailable 1 h-pyrrolo [3,2-c] pyridine inhibitors of MPS1 maintained stable binding in the catalytic site, while natural substrate ATP could not stay. Comparative study of stability and flexibility of three systems reveals position shifting of β-sheet region within the catalytic site, which indicates inhibition mechanism was through stabilizing the β-sheet region. Binding free energies calculated with MM-GB/PBSA method shows different binding affinity for inhibitor and ATP. Finally, interactions between protein and inhibitor during molecular dynamic simulations were measured and counted. Residue Gly605 and Leu654 were suggested as important hot spots for stable binding of inhibitor by molecular dynamic simulation. Our results reveal an important position shifting within catalytic site for non-inhibited proteins. Together with hot spots found by molecular dynamic simulation, the results provide important information of inhibition mechanism and will be referenced for designing novel inhibitors.

The nuclear size and mass effects on muonic hydrogen-like atoms embedded in Debye plasma

NASA Astrophysics Data System (ADS)

Poszwa, A.; Bahar, M. K.; Soylu, A.

2016-10-01

Effects of finite nuclear size and finite nuclear mass are investigated for muonic atoms and muonic ions embedded in the Debye plasma. Both nuclear charge radii and nuclear masses are taken into account with experimentally determined values. In particular, isotope shifts of bound state energies, radial probability densities, transition energies, and binding energies for several atoms are studied as functions of Debye length. The theoretical model based on semianalytical calculations, the Sturmian expansion method, and the perturbative approach has been constructed, in the nonrelativistic frame. For some limiting cases, the comparison with previous most accurate literature results has been made.

Spectroscopic ellipsometry and band structure of Si{sub 1{minus}y}C{sub y} alloys grown pseudomorphically on Si (001)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zollner, S.; Herzinger, C.M.; Woollam, J.A.

1995-10-01

The authors have measured the dielectric functions of three Si{sub 1{minus}y}C{sub y} alloys layers (y {le} 1.4%) grown pseudomorphically on Si (001) substrates using molecular beam epitaxy at low temperatures. From the numerical derivatives of the measured spectra, they determine the critical point energies E{sub 0}{prime} and E{sub 1} as a function of y (y {le} 1.4%) using a comparison with analytical line shapes and analyze these energies in terms of the expected shifts and splittings due to negative hydrostatic pressure, shear stress, and alloying. Their data agree well with the calculated shifts for E{sub 1}, but the E{sub 0}{prime}more » energies are lower than expected. They discuss their results in comparison with recent tight-binding molecular dynamics simulations by Demkov and Sankey predicting a total breakdown of the virtual-crystal approximation for such alloys.« less

Theory of nanobubble formation and induced force in nanochannels

NASA Astrophysics Data System (ADS)

Arai, Noriyoshi; Koishi, Takahiro; Ebisuzaki, Toshikazu

2017-10-01

This paper presents a fundamental theory of nanobubble formation and induced force in confined nanochannels. It is shown that nanobubble formation between hydrophobic plates can be predicted from their surface tension and geometry, with estimated values for the surface free energy and the force acting on the plates in good agreement with the results of molecular dynamics simulation and experimentation. When a bubble is formed between two plates, vertical attractive force and horizontal retract force due to the shifted plates are applied to the plates. The net force exerted on the plates is not dependent on the distance between them. The short-range force between hydrophobic surfaces due to hydrophobic interaction appears to correspond to the force estimated by our theory. We compared between experimental and theoretical values for the binding energy of a molecular motor system to validate our theory. The tendency that the binding energy increases as the size of the protein increases is consistent with the theory.

Theoretical Study on Sers of Wagging Vibrations of Benzyl Radical Adsorbed on Silver Electrodes

NASA Astrophysics Data System (ADS)

Wu, De-Yin; Chen, Yan-Li; Tian, Zhong-Qun

2016-06-01

Electrochemical surface-enhanced Raman spectroscopy (EC-SERS) has been used to characterize adsorbed species widely but reaction intermediates rarely on electrodes. In previous studies, the observed SERS signals were proposed from surface benzyl species due to the electrochemical reduction of benzyl chloride on silver electrode surfaces. In this work, we reinvestigated the vibrational assignments of benzyl chloride and benzyl radical as the reaction intermediate. On the basis of density functional theoretical (DFT) calculations and normal mode analysis, our systematical results provide more reasonable new assignments for both surface species. Further, we investigated adsorption configurations, binding energies, and vibrational frequency shifts of benzyl radical interacting with silver. Our calculated results show that the wagging vibration displays significant vibrational frequency shift, strong coupling with some intramolecular modes in the phenyl ring, and significant changes in intensity of Raman signals. The study also provides absolute Raman intensity in benzyl halides and discuss the enhancement effect mainly due to the binding interaction with respect to free benzyl radical.

Electronic excited states and relaxation dynamics in polymer heterojunction systems

NASA Astrophysics Data System (ADS)

Ramon, John Glenn Santos

The potential for using conducting polymers as the active material in optoelectronic devices has come to fruition in the past few years. Understanding the fundamental photophysics behind their operations points to the significant role played by the polymer interface in their performance. Current device architectures involve the use of bulk heterojunctions which intimately blend the donor and acceptor polymers to significantly increase not only their interfacial surface area but also the probability of exciton formation within the vicinity of the interface. In this dissertation, we detail the role played by the interface on the behavior and performance of bulk heterojunction systems. First, we explore the relation between the exciton binding energy to the band offset in determining device characteristics. As a general rule, when the exciton binding energy is greater than the band offset, the exciton remains the lowest energy excited state leading to efficient light-emitting properties. On the other hand, if the offset is greater than the binding energy, charge separation becomes favorable leading to better photovoltaic behavior. Here, we use a Wannier function, configuration interaction based approach to examine the essential excited states and predict the vibronic absorption and emission spectra of the PPV/BBL, TFB/F8BT and PFB/F8BT heterojunctions. Our results underscore the role of vibrational relaxation in the formation of charge-transfer states following photoexcitation. In addition, we look at the relaxation dynamics that occur upon photoexcitation. For this, we adopt the Marcus-Hush semiclassical method to account for lattice reorganization in the calculation of the interconversion rates in TFB/F8BT and PFB/F8BT. We find that, while a tightly bound charge-transfer state (exciplex) remains the lowest excited state, a regeneration pathway to the optically active lowest excitonic state in TFB/F8BT is possible via thermal repopulation from the exciplex. Finally, we examine the effect of the nanoscale interfacial morphology and solvation on the electronic excited states of TFB/F8BT. Here, we employ time-dependent density functional theory (TD-DFT) to investigate the relevant excited states of two stacking configurations. We show that the calculated states agree with the excited states responsible for the experimentally observed emission peaks and that these states are blue shifted relative to those of the isolated chain. Furthermore, slight lateral shifts in the stacking orientation not only shift the excited state energies; more importantly, they alter the nature of these states altogether. Lastly, we see that solvation greatly stabilizes the charge-transfer states.

Thermodynamics of proton transport coupled ATP synthesis.

PubMed

Turina, Paola; Petersen, Jan; Gräber, Peter

2016-06-01

The thermodynamic H(+)/ATP ratio of the H(+)-ATP synthase from chloroplasts was measured in proteoliposomes after energization of the membrane by an acid base transition (Turina et al. 2003 [13], 418-422). The method is discussed, and all published data obtained with this system are combined and analyzed as a single dataset. This meta-analysis led to the following results. 1) At equilibrium, the transmembrane ΔpH is energetically equivalent to the transmembrane electric potential difference. 2) The standard free energy for ATP synthesis (reference reaction) is ΔG°(ref)=33.8±1.3kJ/mol. 3) The thermodynamic H(+)/ATP ratio, as obtained from the shift of the ATP synthesis equilibrium induced by changing the transmembrane ΔpH (varying either pH(in) or pH(out)) is 4.0±0.1. The structural H(+)/ATP ratio, calculated from the ratio of proton binding sites on the c-subunit-ring in F(0) to the catalytic nucleotide binding sites on the β-subunits in F(1), is c/β=14/3=4.7. We infer that the energy of 0.7 protons per ATP that flow through the enzyme, but do not contribute to shifting the ATP/(ADP·Pi) ratio, is used for additional processes within the enzyme, such as activation, and/or energy dissipation, due e.g. to internal uncoupling. The ratio between the thermodynamic and the structural H(+)/ATP values is 0.85, and we conclude that this value represents the efficiency of the chemiosmotic energy conversion within the chloroplast H(+)-ATP synthase. Copyright © 2016 Elsevier B.V. All rights reserved.

Neutron-19C scattering: Emergence of universal properties in a finite range potential

NASA Astrophysics Data System (ADS)

Shalchi, M. A.; Yamashita, M. T.; Hadizadeh, M. R.; Frederico, T.; Tomio, Lauro

2017-01-01

The low-energy properties of the elastic s-wave scattering for the n-19C are studied near the critical condition for the occurrence of an excited Efimov state in n-n-18C. It is established to which extent the universal scaling laws, strictly valid in the zero-range limit, survive when finite range potentials are considered. By fixing the two-neutrons separation energy in 20C with available experimental data, it is studied the scaling of the real (δ0R) and imaginary parts of the s-wave phase-shift with the variation of the n-18C binding energy. We obtain some universal characteristics given by the pole-position of kcot ⁡ (δ0R) and effective-range parameters. By increasing the n-18C binding energy, it was verified that the excited state of 20C goes to a virtual state, resembling the neutron-deuteron behavior in the triton. It is confirmed that the analytical structure of the unitary cut is not affected by the range of the potential or mass asymmetry of the three-body system.

Molecular properties of metal difluorides and their interactions with CO2 and H2O molecules: a DFT investigation.

PubMed

Arokiyanathan, Agnes Lincy; Lakshmipathi, Senthilkumar

2017-11-18

A computational study of metal difluorides (MF 2 ; M = Ca to Zn) and their interactions with carbon dioxide and water molecules was performed. The structural parameter values obtained and the results of AIM analysis and energy decomposition analysis indicated that the Ca-F bond is weaker and less ionic than the bonds in the transition metal difluorides. A deformation density plot revealed the stablizing influence of the Jahn-Teller effect in nonlinear MF 2 molecules (e.g., where M= Sc, Ti, Cr). An anaysis of the metal K-edge peaks of the difluorides showed that shifts in the edge energy were due to the combined effects of the ionicity, effective nuclear charge, and the spin state of the metal. The interactions of CO 2 with ScF 2 (Scc3 geometry) and TiF 2 (Tic2 geometry) caused CO 2 to shift from its usual linear geometry to a bent geometry (η 2 (C=O) binding mode), while it retained its linear geometry (η 1 (O) binding mode) when it interacted with the other metal difluorides. Energy decomposition analysis showed that, among the various geometries considered, the Scc3 and Tic2 geometries possessed the highest interaction energies and orbital interaction energies. Heavier transition metal difluorides showed stronger affinities for H 2 O, whereas the lighter transition metal (Sc and Ti) difluorides preferred CO 2 . Overall, the results of this study suggest that fluorides of lighter transition metals with partially filled d orbitals (e.g., Sc and Ti) could be used for CO 2 capture under moist conditions. Graphical abstract Interaction of metal difluorides with carbon dioxide and water.

Effect of magnetic field on the donor impurity in CdTe/Cd1-xMnxTe quantum well wire

NASA Astrophysics Data System (ADS)

Kalpana, P.; Reuben, A. Merwyn Jasper D.; Nithiananthi, P.; Jayakumar, K.

2016-05-01

The donor impurity binding energy in CdTe / Cd1-xMnxTe QWW with square well confinement along x - direction and parabolic confinement along y - direction under the influence of externally applied magnetic field has been computed using variational principle in the effective mass approximation. The spin polaronic shift has also been computed. The results are presented and discussed.

Kinetic rate constant prediction supports the conformational selection mechanism of protein binding.

PubMed

Moal, Iain H; Bates, Paul A

2012-01-01

The prediction of protein-protein kinetic rate constants provides a fundamental test of our understanding of molecular recognition, and will play an important role in the modeling of complex biological systems. In this paper, a feature selection and regression algorithm is applied to mine a large set of molecular descriptors and construct simple models for association and dissociation rate constants using empirical data. Using separate test data for validation, the predicted rate constants can be combined to calculate binding affinity with accuracy matching that of state of the art empirical free energy functions. The models show that the rate of association is linearly related to the proportion of unbound proteins in the bound conformational ensemble relative to the unbound conformational ensemble, indicating that the binding partners must adopt a geometry near to that of the bound prior to binding. Mirroring the conformational selection and population shift mechanism of protein binding, the models provide a strong separate line of evidence for the preponderance of this mechanism in protein-protein binding, complementing structural and theoretical studies.

Ultrafast Structural Dynamics in Combustion Relevant Model Systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weber, Peter M.

2014-03-31

The research project explored the time resolved structural dynamics of important model reaction system using an array of novel methods that were developed specifically for this purpose. They include time resolved electron diffraction, time resolved relativistic electron diffraction, and time resolved Rydberg fingerprint spectroscopy. Toward the end of the funding period, we also developed time-resolved x-ray diffraction, which uses ultrafast x-ray pulses at LCLS. Those experiments are just now blossoming, as the funding period expired. In the following, the time resolved Rydberg Fingerprint Spectroscopy is discussed in some detail, as it has been a very productive method. The binding energymore » of an electron in a Rydberg state, that is, the energy difference between the Rydberg level and the ground state of the molecular ion, has been found to be a uniquely powerful tool to characterize the molecular structure. To rationalize the structure sensitivity we invoke a picture from electron diffraction: when it passes the molecular ion core, the Rydberg electron experiences a phase shift compared to an electron in a hydrogen atom. This phase shift requires an adjustment of the binding energy of the electron, which is measurable. As in electron diffraction, the phase shift depends on the molecular, geometrical structure, so that a measurement of the electron binding energy can be interpreted as a measurement of the molecule’s structure. Building on this insight, we have developed a structurally sensitive spectroscopy: the molecule is first elevated to the Rydberg state, and the binding energy is then measured using photoelectron spectroscopy. The molecule’s structure is read out as the binding energy spectrum. Since the photoionization can be done with ultrafast laser pulses, the technique is inherently capable of a time resolution in the femtosecond regime. For the purpose of identifying the structures of molecules during chemical reactions, and for the analysis of molecular species in the hot environments of combustion processes, there are several features that make the Rydberg ionization spectroscopy uniquely useful. First, the Rydberg electron’s orbit is quite large and covers the entire molecule for most molecular structures of combustion interest. Secondly, the ionization does not change vibrational quantum numbers, so that even complicated and large molecules can be observed with fairly well resolved spectra. In fact, the spectroscopy is blind to vibrational excitation of the molecule. This has the interesting consequence for the study of chemical dynamics, where the molecules are invariably very energetic, that the molecular structures are observed unobstructed by the vibrational congestion that dominates other spectroscopies. This implies also that, as a tool to probe the time-dependent structural dynamics of chemically interesting molecules, Rydberg spectroscopy may well be better suited than electron or x-ray diffraction. With recent progress in calculating Rydberg binding energy spectra, we are approaching the point where the method can be evolved into a structure determination method. To implement the Rydberg ionization spectroscopy we use a molecular beam based, time-resolved pump-probe multi-photon ionization/photoelectron scheme in which a first laser pulse excites the molecule to a Rydberg state, and a probe pulse ionizes the molecule. A time-of-flight detector measures the kinetic energy spectrum of the photoelectrons. The photoelectron spectrum directly provides the binding energy of the electron, and thereby reveals the molecule’s time-dependent structural fingerprint. Only the duration of the laser pulses limits the time resolution. With a new laser system, we have now reached time resolutions better than 100 fs, although very deep UV wavelengths (down to 190 nm) have slightly longer instrument functions. The structural dynamics of molecules in Rydberg-excited states is obtained by delaying the probe ionization photon from the pump photon; the structural dynamics of molecules in their ground state or excited valence states is measured by inducing the dynamics using a near UV laser pulse, and employing a multi-photon ionization scheme via the Rydberg states as a probe process. Thus, the technique is capable of measuring the reaction dynamics in any electronic state of neutral molecules.« less

Thermodynamics of Aryl-Dihydroxyphenyl-Thiadiazole Binding to Human Hsp90

PubMed Central

Kazlauskas, Egidijus; Petrikaitė, Vilma; Michailovienė, Vilma; Revuckienė, Jurgita; Matulienė, Jurgita; Grinius, Leonas; Matulis, Daumantas

2012-01-01

The design of specific inhibitors against the Hsp90 chaperone and other enzyme relies on the detailed and correct understanding of both the thermodynamics of inhibitor binding and the structural features of the protein-inhibitor complex. Here we present a detailed thermodynamic study of binding of aryl-dihydroxyphenyl-thiadiazole inhibitor series to recombinant human Hsp90 alpha isozyme. The inhibitors are highly potent, with the intrinsic Kd approximately equal to 1 nM as determined by isothermal titration calorimetry (ITC) and thermal shift assay (TSA). Dissection of protonation contributions yielded the intrinsic thermodynamic parameters of binding, such as enthalpy, entropy, Gibbs free energy, and the heat capacity. The differences in binding thermodynamic parameters between the series of inhibitors revealed contributions of the functional groups, thus providing insight into molecular reasons for improved or diminished binding efficiency. The inhibitor binding to Hsp90 alpha primarily depended on a large favorable enthalpic contribution combined with the smaller favorable entropic contribution, thus suggesting that their binding was both enthalpically and entropically optimized. The enthalpy-entropy compensation phenomenon was highly evident when comparing the inhibitor binding enthalpies and entropies. This study illustrates how detailed thermodynamic analysis helps to understand energetic reasons for the binding efficiency and develop more potent inhibitors that could be applied for therapeutic use as Hsp90 inhibitors. PMID:22655030

Infrared Spectroscopy of NaCl(CH3OH)n Complexes in Helium Nanodroplets.

PubMed

Sadoon, Ahmed M; Sarma, Gautam; Cunningham, Ethan M; Tandy, Jon; Hanson-Heine, Magnus W D; Besley, Nicholas A; Yang, Shengfu; Ellis, Andrew M

2016-10-10

Infrared (IR) spectra of complexes between NaCl and methanol have been recorded for the first time. These complexes were formed in liquid helium nanodroplets by consecutive pick-up of NaCl and CH 3 OH molecules. For the smallest NaCl(CH 3 OH) n , complexes where n = 1-3, the IR data suggest that the lowest-energy isomer is the primary product in each case. The predominant contribution to the binding comes from ionic hydrogen bonds between the OH in each methanol molecule and the chloride ion in the NaCl, as established by the large red shift of the OH stretching bands compared with the isolated CH 3 OH molecule. For n ≥ 4, there is a dramatic shift from discrete vibrational bands to very broad absorption envelopes, suggesting a profound change in the structural landscape and, in particular, access to multiple low-energy isomers.

Annealing induced atomic rearrangements on (Ga,In) (N,As) probed by hard X-ray photoelectron spectroscopy and X-ray absorption fine structure.

PubMed

Ishikawa, Fumitaro; Higashi, Kotaro; Fuyuno, Satoshi; Morifuji, Masato; Kondow, Masahiko; Trampert, Achim

2018-04-13

We study the effects of annealing on (Ga 0.64 ,In 0.36 ) (N 0.045 ,As 0.955 ) using hard X-ray photoelectron spectroscopy and X-ray absorption fine structure measurements. We observed surface oxidation and termination of the N-As bond defects caused by the annealing process. Specifically, we observed a characteristic chemical shift towards lower binding energies in the photoelectron spectra related to In. This phenomenon appears to be caused by the atomic arrangement, which produces increased In-N bond configurations within the matrix, as indicated by the X-ray absorption fine structure measurements. The reduction in the binding energies of group-III In, which occurs concomitantly with the atomic rearrangements of the matrix, causes the differences in the electronic properties of the system before and after annealing.

Conduction Band-Edge Non-Parabolicity Effects on Impurity States in (In,Ga)N/GaN Cylindrical QWWs

NASA Astrophysics Data System (ADS)

Haddou El, Ghazi; Anouar, Jorio

2014-02-01

In this paper, the conduction band-edge non-parabolicity (NP) and the circular cross-section radius effects on hydrogenic shallow-donor impurity ground-state binding energy in zinc-blende (ZB) InGaN/GaN cylindrical QWWs are reported. The finite potential barrier between (In,Ga)N well and GaN environment is considered. Two models of the conduction band-edge non-parabolicity are taking into account. The variational approach is used within the framework of single band effective-mass approximation with one-parametric 1S-hydrogenic trial wave-function. It is found that NP effect is more pronounced in the wire of radius equal to effective Bohr radius than in large and narrow wires. Moreover, the binding energy peak shifts to narrow wire under NP effect. A good agreement is shown compared to the findings results.

The Zeeman splitting of bulk 2H-MoTe2 single crystal in high magnetic field

NASA Astrophysics Data System (ADS)

Sun, Yan; Zhang, Junpei; Ma, Zongwei; Chen, Cheng; Han, Junbo; Chen, Fangchu; Luo, Xuan; Sun, Yuping; Sheng, Zhigao

2017-03-01

A high magnetic field magneto-optical spectrum is utilized to study the A exciton of bulk 2H-MoTe2 single crystal. A clear Zeeman splitting of the A exciton is observed under high magnetic fields up to 41.68 T, and the g-factor (-2.09 ± 0.08) is deduced. Moreover, a high magnetic field enables us to obtain the quadratic diamagnetic shifts of the A exciton (0.486 μeV T-2). Accordingly, the binding energy, reduced mass, and radius of the A exciton were obtained by using both two and three dimensional models. Compared with other transition metal dichalcogenides (TMDs), the A exciton of bulk 2H-MoTe2 has a relatively small binding energy and larger exciton radius, which provide fundamental parameters for comprehensive understanding of excitons in TMDs as well as their future applications.

Energy transfer in light-harvesting complexes LHCII and CP29 of spinach studied with three pulse echo peak shift and transient grating.

PubMed

Salverda, Jante M; Vengris, Mikas; Krueger, Brent P; Scholes, Gregory D; Czarnoleski, Adam R; Novoderezhkin, Vladimir; van Amerongen, Herbert; van Grondelle, Rienk

2003-01-01

Three pulse echo peak shift and transient grating (TG) measurements on the plant light-harvesting complexes LHCII and CP29 are reported. The LHCII complex is by far the most abundant light-harvesting complex in higher plants and fulfills several important physiological functions such as light-harvesting and photoprotection. Our study is focused on the light-harvesting function of LHCII and the very similar CP29 complex and reveals hitherto unresolved excitation energy transfer processes. All measurements were performed at room temperature using detergent isolated complexes from spinach leaves. Both complexes were excited in their Chl b band at 650 nm and in the blue shoulder of the Chl a band at 670 nm. Exponential fits to the TG and three pulse echo peak shift decay curves were used to estimate the timescales of the observed energy transfer processes. At 650 nm, the TG decay can be described with time constants of 130 fs and 2.2 ps for CP29, and 300 fs and 2.8 ps for LHCII. At 670 nm, the TG shows decay components of 230 fs and 6 ps for LHCII, and 300 fs and 5 ps for CP29. These time constants correspond to well-known energy transfer processes, from Chl b to Chl a for the 650 nm TG and from blue (670 nm) Chl a to red (680 nm) Chl a for the 670 nm TG. The peak shift decay times are entirely different. At 650 nm we find times of 150 fs and 0.5-1 ps for LHCII, and 360 fs and 3 ps for CP29, which we can associate mainly with Chl b <--> Chl b energy transfer. At 670 nm we find times of 140 fs and 3 ps for LHCII, and 3 ps for CP29, which we can associate with fast (only in LHCII) and slow transfer between relatively blue Chls a or Chl a states. From the occurrence of both fast Chl b <--> Chl b and fast Chl b --> Chl a transfer in CP29, we conclude that at least two mixed binding sites are present in this complex. A detailed comparison of our observed rates with exciton calculations on both CP29 and LHCII provides us with more insight in the location of these mixed sites. Most importantly, for CP29, we find that a Chl b pair must be present in some, but not all, complexes, on sites A(3) and B(3). For LHCII, the observed rates can best be understood if the same pair, A(3) and B(3), is involved in both fast Chl b <--> Chl b and fast Chl a <--> Chl a transfer. Hence, it is likely that mixed sites also occur in the native LHCII complex. Such flexibility in chlorophyll binding would agree with the general flexibility in aggregation form and xanthophyll binding of the LHCII complex and could be of use for optimizing the role of LHCII under specific circumstances, for example under high-light conditions. Our study is the first to provide spectroscopic evidence for mixed binding sites, as well as the first to show their existence in native complexes.

Hydrogen bonding in microsolvation: photoelectron imaging and theoretical studies on Au(x)(-)-(H2O)(n) and Au(x)(-)-(CH3OH)(n) (x = 1, 2; n = 1, 2) complexes.

PubMed

Wu, Xia; Tan, Kai; Tang, Zichao; Lu, Xin

2014-03-14

We have combined photoelectron velocity-map imaging (VMI) spectroscopy and theoretical calculations to elucidate the geometry and energy properties of Aux(-)(Solv)n clusters with x = 1, 2; n = 1, 2; and Solv = H2O and CH3OH. Besides the blue-shifted vertical electron detachment energies (VDEs) of the complexes Au1,2(-)(Solv)n with the increase of the solvation number (n), we independently probed two distinct Au(-)(CH3OH)2 isomers, which combined with MP2/aug-cc-pVTZ(pp) calculations represent a competition between O···H-O hydrogen bonds (HBs) and Au···H-O nonconventional hydrogen bonds (NHBs). Complementary calculations provide the total binding energies of the low-energy isomers. Moreover, the relationship between the total binding energies and total VDEshift is discussed. We found that the Au1,2(-) anions exhibit halide-analogous behavior in microsolvation. These findings also demonstrate that photoelectron velocity map imaging spectroscopy with the aid of the ab initio calculations is an effective tool for investigating weak-interaction complexes.

Investigation of DOTA-Metal Chelation Effects on the Chemical Shift of 129 Xe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Keunhong; Slack, Clancy C.; Vassiliou, Christophoros C.

2015-09-17

Recent work has shown that xenon chemical shifts in cryptophane-cage sensors are affected when tethered chelators bind to metals. Here in this paper, we explore the xenon shifts in response to a wide range of metal ions binding to diastereomeric forms of 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) linked to cryptophane-A. The shifts induced by the binding of Ca 2+, Cu 2+, Ce 3+, Zn 2+, Cd 2+, Ni 2+, Co 2+, Cr 2+, Fe 3+, and Hg 2+ are distinct. In addition, the different responses of the diastereomers for the same metal ion indicate that shifts are affected by partial folding withmore » a correlation between the expected coordination number of the metal in the DOTA complex and the chemical shift of 129Xe. Lastly, these sensors may be used to detect and quantify many important metal ions, and a better understanding of the basis for the induced shifts could enhance future designs.« less

Two nucleon systems at m π ~ 450 MeV from lattice QCD

DOE PAGES

Orginos, Kostas; Parreño, Assumpta; Savage, Martin J.; ...

2015-12-23

Nucleon-nucleon systems are studied with lattice quantum chromodynamics at a pion mass ofmore » $$m_\\pi\\sim 450~{\\rm MeV}$$ in three spatial volumes using $$n_f=2+1$$ flavors of light quarks. At the quark masses employed in this work, the deuteron binding energy is calculated to be $$B_d = 14.4^{+3.2}_{-2.6} ~{\\rm MeV}$$, while the dineutron is bound by $$B_{nn} = 12.5^{+3.0}_{-5.0}~{\\rm MeV}$$. Over the range of energies that are studied, the S-wave scattering phase shifts calculated in the 1S0 and 3S1-3D1 channels are found to be similar to those in nature, and indicate repulsive short-range components of the interactions, consistent with phenomenological nucleon-nucleon interactions. In both channels, the phase shifts are determined at three energies that lie within the radius of convergence of the effective range expansion, allowing for constraints to be placed on the inverse scattering lengths and effective ranges. Thus, the extracted phase shifts allow for matching to nuclear effective field theories, from which low energy counterterms are extracted and issues of convergence are investigated. As part of the analysis, a detailed investigation of the single hadron sector is performed, enabling a precise determination of the violation of the Gell-Mann–Okubo mass relation.« less

Structural, energetic, spectroscopic and QTAIM analyses of cation-π interactions involving mono- and bi-cyclic ring fused benzene systems.

PubMed

Hassan, Ayorinde; Dinadayalane, Tandabany C; Grabowski, Sławomir J; Leszczynski, Jerzy

2013-12-28

The effect of increasing the number of monocyclic six-membered rings or bicyclic rings of bicyclo[2.1.1]hexenyl fused to benzene on cation-π interactions involving alkali metal ions (Li(+), Na(+), and K(+)) has been investigated. The binding energy data at the B3LYP/6-311+G(2d,2p) level clearly indicate that the binding affinity of the metal ion with benzene is enhanced by increasing the number of rings fused irrespective of a monocyclic or a bicyclic ring. Calculated binding energies are in good agreement with the available experimental results. The binding strength of cations with ligands decreases in the order Li(+) > Na(+) > K(+). Our study establishes that trisannelation of bicyclo[2.1.1]hexene to benzene facilitates a very strong interaction between benzene and cations. Infrared (IR) frequencies and nuclear magnetic resonance (NMR) chemical shifts are shown to be valuable in characterizing cation-π interactions. The C-C bonds of the central six-membered rings are weakened due to metal ion binding. Based on the Quantum Theory of Atoms in Molecules (QTAIM), we have observed the presence of stabilizing H∙∙∙H interactions in two of the considered systems as opposed to the frequent description of these interactions as non-bonded repulsive interactions. Alkali metal ion binding with those two ligands slightly reduces the strength of such H∙∙∙H interactions.

Insights into susceptibility of antiviral drugs against the E119G mutant of 2009 influenza A (H1N1) neuraminidase by molecular dynamics simulations and free energy calculations.

PubMed

Pan, Peichen; Li, Lin; Li, Youyong; Li, Dan; Hou, Tingjun

2013-11-01

Neuraminidase inhibitors (NAIs) play vital roles in controlling human influenza epidemics and pandemics. However, the emergence of new human influenza virus mutant strains resistant to existing antiviral drugs has been becoming a major challenge. Therefore, it is critical to uncover the mechanisms of drug resistance and seek alternative treatments to combat drug resistance. In this study, molecular dynamics (MD) simulations and Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) were applied to investigate the different sensitivities of oseltamivir (OTV), zanamivir (ZNV), and peramivir (PRV) against the E119G mutant of 2009 A/H1N1 neuraminidase. The predicted binding free energies indicate that the E119G mutation in NA confers resistance to all of the three studied inhibitors. The ordering of the level of drug resistance predicted by the binding free energies for the three inhibitors is ZNV>PRV>OTV, which agrees well with the experimental data. Drug resistance arises primarily from the unfavorable shifts of the polar interactions between NA and the inhibitors. It comes as a surprise that the mutation of Glu119 that can form strong H-bonds with the inhibitors in the wild-type protein does not have direct impact on the binding affinities of both OTV and PRV due to the regulation of the strong unfavorable polar desolvation energies. The indirectly conformational variations of the inhibitors, which caused by the E119G mutation, are responsible for the loss of the binding free energies. However, for ZNV, the E119G mutation has both direct and indirect influences on the drug binding. The structural and quantitative viewpoint obtained from this study provides valuable information for the rational design of novel and effective drugs to combat drug resistance. Copyright © 2013 Elsevier B.V. All rights reserved.

Luminescence of BaBrI and SrBrI single crystals doped with Eu2+

NASA Astrophysics Data System (ADS)

Shalaev, A. A.; Shendrik, R.; Myasnikova, A. S.; Bogdanov, A.; Rusakov, A.; Vasilkovskyi, A.

2018-05-01

The crystal growth procedure and luminescence properties of pure and Eu2+-doped BaBrI and SrBrI crystals are reported. Emission and excitation spectra were recorded under ultraviolet and vacuum ultraviolet excitations. The energy of the first Eu2+ 4f-5d transition and SrBrI band gap are obtained. The electronic structure calculations were performed within GW approximation as implemented in the Vienna Ab Initio Simulation Package. The energy between lowest Eu2+ 5d state and the bottom of conduction band are found based on luminescence quenching parameters. The vacuum referred binding energy diagram of lanthanide levels was constructed using the chemical shift model.

A computational study of the open and closed forms of the N-lobe human serum transferrin apoprotein.

PubMed

Rinaldo, David; Field, Martin J

2003-12-01

Human serum transferrin tightly binds ferric ions in the blood stream but is able to release them in cells by a process involving receptor-mediated endocytosis and decrease in pH. Iron binding and release are accompanied by a large conformation change. In this study, we investigate theoretically the open and closed forms of the N-lobe human serum transferrin apoprotein by performing pKa calculations and molecular dynamics and free-energy simulations. In agreement with the hypothesis based on the x-ray crystal structures, our calculations show that there is a shift in the pKa values of the lysines forming the dilysine trigger when the conformation changes. We argue, however, that simple electrostatic repulsion between the lysines is not sufficient to trigger domain opening and, instead, propose an alternative explanation for the dilysine-trigger effect. Analysis of the molecular dynamics and free-energy results indicate that the open form is more mobile than the closed form and is much more stable at pH 5.3, in large part due to entropic effects. Despite a lower free energy, the dynamics simulation of the open form shows that it is flexible enough to sample conformations that are consistent with iron binding.

The Self-Association of Graphane Is Driven by London Dispersion and Enhanced Orbital Interactions.

PubMed

Wang, Changwei; Mo, Yirong; Wagner, J Philipp; Schreiner, Peter R; Jemmis, Eluvathingal D; Danovich, David; Shaik, Sason

2015-04-14

We investigated the nature of the cohesive energy between graphane sheets via multiple CH···HC interactions, using density functional theory (DFT) including dispersion correction (Grimme's D3 approach) computations of [n]graphane σ dimers (n = 6-73). For comparison, we also evaluated the binding between graphene sheets that display prototypical π/π interactions. The results were analyzed using the block-localized wave function (BLW) method, which is a variant of ab initio valence bond (VB) theory. BLW interprets the intermolecular interactions in terms of frozen interaction energy (ΔE(F)) composed of electrostatic and Pauli repulsion interactions, polarization (ΔE(pol)), charge-transfer interaction (ΔE(CT)), and dispersion effects (ΔE(disp)). The BLW analysis reveals that the cohesive energy between graphane sheets is dominated by two stabilizing effects, namely intermolecular London dispersion and two-way charge transfer energy due to the σ(CH) → σ*(HC) interactions. The shift of the electron density around the nonpolar covalent C-H bonds involved in the intermolecular interaction decreases the C-H bond lengths uniformly by 0.001 Å. The ΔE(CT) term, which accounts for ∼15% of the total binding energy, results in the accumulation of electron density in the interface area between two layers. This accumulated electron density thus acts as an electronic "glue" for the graphane layers and constitutes an important driving force in the self-association and stability of graphane under ambient conditions. Similarly, the "double faced adhesive tape" style of charge transfer interactions was also observed among graphene sheets in which it accounts for ∼18% of the total binding energy. The binding energy between graphane sheets is additive and can be expressed as a sum of CH···HC interactions, or as a function of the number of C-H bonds.

Prediction of core level binding energies in density functional theory: Rigorous definition of initial and final state contributions and implications on the physical meaning of Kohn-Sham energies.

PubMed

Pueyo Bellafont, Noèlia; Bagus, Paul S; Illas, Francesc

2015-06-07

A systematic study of the N(1s) core level binding energies (BE's) in a broad series of molecules is presented employing Hartree-Fock (HF) and the B3LYP, PBE0, and LC-BPBE density functional theory (DFT) based methods with a near HF basis set. The results show that all these methods give reasonably accurate BE's with B3LYP being slightly better than HF but with both PBE0 and LCBPBE being poorer than HF. A rigorous and general decomposition of core level binding energy values into initial and final state contributions to the BE's is proposed that can be used within either HF or DFT methods. The results show that Koopmans' theorem does not hold for the Kohn-Sham eigenvalues. Consequently, Kohn-Sham orbital energies of core orbitals do not provide estimates of the initial state contribution to core level BE's; hence, they cannot be used to decompose initial and final state contributions to BE's. However, when the initial state contribution to DFT BE's is properly defined, the decompositions of initial and final state contributions given by DFT, with several different functionals, are very similar to those obtained with HF. Furthermore, it is shown that the differences of Kohn-Sham orbital energies taken with respect to a common reference do follow the trend of the properly calculated initial state contributions. These conclusions are especially important for condensed phase systems where our results validate the use of band structure calculations to determine initial state contributions to BE shifts.

Good use of fruit wastes: eco-friendly synthesis of silver nanoparticles, characterization, BSA protein binding studies.

PubMed

Sreekanth, T V M; Ravikumar, Sambandam; Lee, Yong Rok

2016-06-01

A simple and eco-friendly methodology for the green synthesis of silver nanoparticles (AgNPs) using a mango seed extract was evaluated. The AgNPs were characterized by ultraviolet-visible spectrophotometry, Fourier transform infrared spectroscopy, transmission electron microscopy, energy dispersive X-ray spectroscopy, and X-ray diffraction. The interaction between the green synthesized AgNPs and bovine serum albumin (BSA) in an aqueous solution at physiological pH was examined by fluorescence spectroscopy. The results confirmed that the AgNPs quenched the fluorophore of BSA by forming a ground state complex in aqueous solution. This fluorescence quenching data were also used to determine the binding sites and binding constants at different temperatures. The calculated thermodynamic parameters (ΔG°, ΔH° and ΔS°) suggest that the binding process occurs spontaneously through the involvement of electrostatic interactions. The synchronous fluorescence spectra showed a blue shift, indicating increasing hydrophobicity. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

High resolution photoemission investigation: The oxidation of W

NASA Astrophysics Data System (ADS)

Morar, J. F.; Himpsel, F. J.; Hughes, G. J.; Jordan, J. L.; McFeely, F. R.; Hollinge, G.

High resolution photoemission measurements of surface oxide layers on tungsten has revealed a set of well resolved core level shifts characteristic of individual metal oxidation states. Measurement and analysis of this type of data can provide specific and quantitative chemical information about surface oxides. The formation of bonds between transition metals and strongly electronegative elements such as oxygen and fluorine results in charge transfer with the effect of shifting the metal core electron binding energies. The magnitude of such shifts depends primarily on two factors; the amount of charge transfer and the screening ability of the metals electrons. The size of core-level shifts tend to increase with additional charge transfer and be decreased by screening. In the case of tungsten the amount of screening should be a function of oxygen content since the oxygen ties up free electrons which are effective at screening. A continuous change in the tungsten core level shifts is observed with increasing oxygen content, i.e., as the screening changes from that characteristic of a metal screened to that characteristic of an insulator unscreened.

Intrinsic thermodynamics of ethoxzolamide inhibitor binding to human carbonic anhydrase XIII

PubMed Central

2012-01-01

Background Human carbonic anhydrases (CAs) play crucial role in various physiological processes including carbon dioxide and hydrocarbon transport, acid homeostasis, biosynthetic reactions, and various pathological processes, especially tumor progression. Therefore, CAs are interesting targets for pharmaceutical research. The structure-activity relationships (SAR) of designed inhibitors require detailed thermodynamic and structural characterization of the binding reaction. Unfortunately, most publications list only the observed thermodynamic parameters that are significantly different from the intrinsic parameters. However, only intrinsic parameters could be used in the rational design and SAR of the novel compounds. Results Intrinsic binding parameters for several inhibitors, including ethoxzolamide, trifluoromethanesulfonamide, and acetazolamide, binding to recombinant human CA XIII isozyme were determined. The parameters were the intrinsic Gibbs free energy, enthalpy, entropy, and the heat capacity. They were determined by titration calorimetry and thermal shift assay in a wide pH and temperature range to dissect all linked protonation reaction contributions. Conclusions Precise determination of the inhibitor binding thermodynamics enabled correct intrinsic affinity and enthalpy ranking of the compounds and provided the means for SAR analysis of other rationally designed CA inhibitors. PMID:22676044

Interaction between Saikosaponin D, Paeoniflorin, and Human Serum Albumin.

PubMed

Liang, Guo-Wu; Chen, Yi-Cun; Wang, Yi; Wang, Hong-Mei; Pan, Xiang-Yu; Chen, Pei-Hong; Niu, Qing-Xia

2018-01-27

Saikosaponin D (SSD) and paeoniflorin (PF) are the major active constituents of Bupleuri Radix and Paeonia lactiflora Pall , respectively, and have been widely used in China to treat liver and other diseases for many centuries. We explored the binding of SSD/PF to human serum albumin (HSA) by using fluorospectrophotometry, circular dichroism (CD) and molecular docking. Both SSD and PF produced a conformational change in HSA. Fluorescence quenching was accompanied by a blue shift in the fluorescence spectra. Co-binding of PF and SSD also induced quenching and a conformational change in HSA. The Stern-Volmer equation showed that quenching was dominated by static quenching. The binding constant for ternary interaction was below that for binary interaction. Site-competitive experiments demonstrated that SSD/PF bound to site I (subdomain IIA) and site II (subdomain IIIA) in HSA. Analysis of thermodynamic parameters indicated that hydrogen bonding and van der Waals forces were mostly responsible for the binary association. Also, there was energy transfer upon binary interaction. Molecular docking supported the experimental findings in conformation, binding sites and binding forces.

An allosterically regulated reversible mechanical molecular switch: A de novo protein maquette functions as a redox/ionic strength sensor coupling chemical binding energy or charge interactions to conformational change

NASA Astrophysics Data System (ADS)

Grosset, Anne Marie

2000-10-01

Switch-like structural rearrangements of subunits due to charge-interactions are common in the basic biological action of proteins that couple and transfer chemical and ionic signals, sensing and regulation, mechanical force and electrochemical free energy. A simple synthetic protein model (maquette) has been designed to better understand the engineering of natural switches. Basic thermodynamic principles define the two key elements required for biological or chemical function of a switch. First, there must be two well-defined states. In this case, the two conformational states must have an energetic difference (DeltaDeltaG°) that is spanned by the applied driving force. Second, there must be an external stimulus, which preferentially interacts with one of the two states. The external stimulus provides the driving force that shifts the equilibrium from the first state to the second state (≥10:1 shifting towards ≤1:10). The energetic difference between the states must be the same order of magnitude as the driving force. In this synthetic protein, the two conformational states correspond to parallel (syn) and antiparallel (anti) assembly of the two identical helix-ss-helix subunits that bind heme close to the di-sulfide loop region. Charge interactions between two ferric hemes bound to histidines provide a driving force on the order of 2 kcal/mol (corresponding in the syn-topology to the 75--100 mV split in the heme redox potentials, or the 25--80 times weaker binding for the second ferric heme). The tetra-alpha-helix bundle has been modified to have a DeltaG around 1.8--2.5 kcal/mol (a 50--80 fold difference in the anti/syn ratio). Therefore, oxidation and reduction of the heme, or the binding of a second charged ferric heme can reversibly switch between syn- and anti-topologies, providing a sensitive detector of redox state or heme concentration. External solution conditions (e.g. ionic composition) can act on the protein remotely from the primary internal switch action and confer a secondary level of allosteric regulation. Bifunctional ligands can link subunits to shift topology. Scanning redox potentiometry can monitor the kinetics of topological change. Point amino acid substitutions and computer repacking of the hydrophobic core can modulate both the kinetics and the energetics.

Quantum-well states in thin Ag films grown on the Ga/Si(111)-√{3 }×√{3 } surface

NASA Astrophysics Data System (ADS)

Starfelt, S.; Zhang, H. M.; Johansson, L. S. O.

2018-05-01

Silver thin films have been created by room temperature deposition on a Ga/Si(111)-√{3 }×√{3 } surface and their valence band structures and core levels have been measured by angle-resolved photoelectron spectroscopy (ARPES). Discrete quantum-well states (QWSs) quantized from the Ag s p valence band are observed already at 3 monolayers (ML). The characteristics of the QWSs have been examined in the phase accumulation model for thicknesses between 3 and 12 ML. The phase shift and QWSs binding energies dependence with Ag film thicknesses have all been consistently derived. In-plane energy dispersion follows a parabolic curve, and the effective mass of the QWSs shows an increasing trend with binding energies as well as with reduced film thicknesses. Furthermore, the ARPES measurements reveal umklapp mediated QWSs around the M ¯ points of the Si(111) 1 ×1 surface Brillouin zone. The study confirms that the Ga/Si(111)-√{3 }×√{3 } surface is a good substrate for growing uniform ultrathin Ag films in room temperature conditions.

Properties of complexes formed by Na(+), Mg(2+), and Fe(2+) binding with benzene molecules.

PubMed

Kolakkandy, Sujitha; Pratihar, Subha; Aquino, Adelia J A; Wang, Hai; Hase, William L

2014-10-09

A theoretical investigation was performed to study cation-π interactions in complexes of benzene (Bz) with cations, that is, M(z+)(Bz)n for M(z+) = Na(+), Mg(2+), Fe(2+) and n = 1-3, using MP2 theory with the 6-31+G* and 6-311++G** basis sets and the DFT/(B3LYP and B3LYP-D)/6-311++G** methods. Binding energies and structures of the complexes are reported. The splitting between the quintet and single states of the Fe(2+) complexes was found to depend on the number of benzene molecules in the complex and the complex's structure. All of the M(z+)(Bz) complexes prefer a half-sandwich geometry. A geometry with the cation sandwiched between the two benzene rings was found for the M(z+)(Bz)2 complexes, with the benzene rings either in an eclipsed or staggered conformation. An approximate cyclic structure, with the cation at its center, was found for three benzene molecules interacting with the cation. The cation-benzene binding energy is substantial and equal to 22, 108, and 151 kcal/mol for the Na(+)(Bz), Mg(2+)(Bz), and Fe(2+)(Bz) complexes, respectively. The strength of the interaction of the cation with an individual benzene molecule decreases as the number of benzene molecules bound to the cation increases; for example, it is 108 kcal/mol for Mg(2+)(Bz), but only 71 kcal/mol for Mg(2+)(Bz)3. There is a range of values for the M(z+)(Bz)n intermolecular vibrational frequencies; for example, they are ∼230-360 and ∼10-330 cm(-1) for the Mg(2+)(Bz) and Mg(2+)(Bz)3 complexes, respectively. Binding of the cation to benzene both red and blue shifts the benzene vibrational frequencies. This shifting is larger for the Mg(2+) and Fe(2+) complexes, as compared to those for Na(+), as a result of the former's stronger cation-benzene binding. The present study is an initial step to understand the possible importance of cation-π interactions for polycyclic aromatic hydrocarbon aggregation processes during soot formation.

Lamb Shift of n = 1 and n = 2 States of Hydrogen-like Atoms, 1 ≤ Z ≤ 110

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yerokhin, V. A.; Shabaev, V. M.

2015-09-15

Theoretical energy levels of the n = 1 and n = 2 states of hydrogen-like atoms with the nuclear charge numbers 1 ≤ Z ≤ 110 are tabulated. The tabulation is based on ab initio quantum electrodynamics calculations performed to all orders in the nuclear binding strength parameter Zα, where α is the fine structure constant. Theoretical errors due to various effects are critically examined and estimated.

Electronic state and photoionization cross section of a single dopant in GaN/InGaN core/shell quantum dot under magnetic field and hydrostatic pressure

NASA Astrophysics Data System (ADS)

Aouami, A. El; Feddi, E.; Talbi, A.; Dujardin, F.; Duque, C. A.

2018-06-01

In this study, we have investigated the simultaneous influence of magnetic field combined to the hydrostatic pressure and the geometrical confinement on the behavior of a single dopant confined in GaN/InGaN core/shell quantum dots. Within the scheme of the effective-mass approximation, the eigenvalues equation has solved by using the variational method with one-parameter trial wavefunctions. Variation of the ground state binding energy of the single dopant is determined according to the magnetic field and hydrostatic pressure for several dimensions of the heterostructure. The results show that the binding energy is strongly dependent on the core/shell sizes, the magnetic field, and the hydrostatic pressure. The analysis of the photoionization cross section, corresponding to optical transitions associated to the first donor energy level and the conduction band, shows clearly that the reduction of the dot dimensions and/or the simultaneous influences of applied magnetic field, combined to the hydrostatic pressure strength, cause a shift in resonance peaks towards the higher energies with important variations in the magnitude of the resonant peaks.

Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

NASA Astrophysics Data System (ADS)

David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

2010-09-01

Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

Band line-up determination at p- and n-type Al/4H-SiC Schottky interfaces using photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Kohlscheen, J.; Emirov, Y. N.; Beerbom, M. M.; Wolan, J. T.; Saddow, S. E.; Chung, G.; MacMillan, M. F.; Schlaf, R.

2003-09-01

The band lineup of p- and n-type 4H-SiC/Al interfaces was determined using x-ray photoemission spectroscopy (XPS). Al was deposited in situ on ex situ cleaned SiC substrates in several steps starting at 1.2 Å up to 238 Å nominal film thickness. Before growth and after each growth step, the sample surface was characterized in situ by XPS. The analysis of the spectral shifts indicated that during the initial deposition stages the Al films react with the ambient surface contamination layer present on the samples after insertion into vacuum. At higher coverage metallic Al clusters are formed. The band lineups were determined from the analysis of the core level peak shifts and the positions of the valence bands maxima (VBM) depending on the Al overlayer thickness. Shifts of the Si 2p and C 1s XPS core levels occurred to higher (lower) binding energy for the p-(n-)type substrates, which was attributed to the occurrence of band bending due to Fermi-level equilibration at the interface. The hole injection barrier at the p-type interface was determined to be 1.83±0.1 eV, while the n-type interface revealed an electron injection barrier of 0.98±0.1 eV. Due to the weak features in the SiC valence bands measured by XPS, the VBM positions were determined using the Si 2p peak positions. This procedure required the determination of the Si 2p-to-VBM binding energy difference (99.34 eV), which was obtained from additional measurements.

Atomistic tight-binding computations of the structural and optical properties of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak

2018-05-01

A study of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals is carried out using atomistic tight-binding theory and the configuration interaction method to provide information for applications in bioimaging, biolabeling, display devices and near-infrared electronic instruments. The calculations yield the dependences of the internal and external passivated shells on the natural behaviours of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals. The reduction of the optical band gaps is observed with increasing numbers of monolayers in the external ZnS shell due to quantum confinement. Interestingly, the optical band gaps of CdTe/CdS/ZnS core/shell/shell nanocrystals are greater than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. In the presence of an external ZnS-coated shell, electron-hole wave function overlaps, oscillation strengths, ground-state exchange energies and Stokes shift are improved, whereas ground-state coulomb energies and fine-structure splitting are reduced. The oscillation strengths, Stokes shift and fine-structure splitting are reduced with the increase in external ZnS shell thickness. The oscillation strengths, Stokes shift and fine-structure splitting of CdTe/CdS/ZnS core/shell/shell nanocrystals are larger than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. Reduction of the atomistic electron-hole interactions is observed with increasing external ZnS shell size. The strong electron-hole interactions are more probed in CdTe/CdS/ZnS core/shell/shell nanocrystals than in CdTe/CdSe/ZnS core/shell/shell nanocrystals.

Elucidating the role of surface passivating ligand structural parameters in hole wave function delocalization in semiconductor cluster molecules.

PubMed

Teunis, Meghan B; Nagaraju, Mulpuri; Dutta, Poulami; Pu, Jingzhi; Muhoberac, Barry B; Sardar, Rajesh; Agarwal, Mangilal

2017-09-28

This article describes the mechanisms underlying electronic interactions between surface passivating ligands and (CdSe) 34 semiconductor cluster molecules (SCMs) that facilitate band-gap engineering through the delocalization of hole wave functions without altering their inorganic core. We show here both experimentally and through density functional theory calculations that the expansion of the hole wave function beyond the SCM boundary into the ligand monolayer depends not only on the pre-binding energetic alignment of interfacial orbitals between the SCM and surface passivating ligands but is also strongly influenced by definable ligand structural parameters such as the extent of their π-conjugation [π-delocalization energy; pyrene (Py), anthracene (Anth), naphthalene (Naph), and phenyl (Ph)], binding mode [dithiocarbamate (DTC, -NH-CS 2 - ), carboxylate (-COO - ), and amine (-NH 2 )], and binding head group [-SH, -SeH, and -TeH]. We observe an unprecedentedly large ∼650 meV red-shift in the lowest energy optical absorption band of (CdSe) 34 SCMs upon passivating their surface with Py-DTC ligands and the trend is found to be Ph- < Naph- < Anth- < Py-DTC. This shift is reversible upon removal of Py-DTC by triethylphosphine gold(i) chloride treatment at room temperature. Furthermore, we performed temperature-dependent (80-300 K) photoluminescence lifetime measurements, which show longer lifetime at lower temperature, suggesting a strong influence of hole wave function delocalization rather than carrier trapping and/or phonon-mediated relaxation. Taken together, knowledge of how ligands electronically interact with the SCM surface is crucial to semiconductor nanomaterial research in general because it allows the tuning of electronic properties of nanomaterials for better charge separation and enhanced charge transfer, which in turn will increase optoelectronic device and photocatalytic efficiencies.

The effect of defect types on the electronic and optical properties of graphene nanoflakes physisorbed by ionic liquids.

PubMed

Shakourian-Fard, Mehdi; Kamath, Ganesh

2017-02-08

Defect engineering and non-covalent interaction strategies allow for dramatically tuning the optoelectronic properties of graphene. Using ab initio density functional theory (M06-2X/cc-pVDZ), we find that the nature of defects on the graphene nanoflakes (GNFs) and the size of defective GNF (DGNF) surfaces affect the binding energy (ΔE b ) of ionic liquids (ILs) and the UV-Vis absorption spectra of DGNFIL complexes. Further, our results indicate that increasing the size of DGNFs affects the geometrical structure of the surfaces and increases the binding energy of ILs by about 10%. Analysis based on AIM and EDA shows that the interactions between ILs and DGNFs are non-covalent in nature (dispersion energy being dominant) and associated with charge transfer between the IL and nanoflakes. A comparison between the ΔE b values of ILs on DGNFs, GNFs, and h-BN nanoflakes (h-BNNF) shows that the presence of defects on the GNF surfaces increases the binding energy values as follows: DGNFIL > pristine GNFIL > h-BNNFIL. Our calculations indicate that increasing the size of DGNF surfaces leads to a decrease in the HOMO-LUMO energy gap (E g ) of the DGNF surfaces. Orbital energy and density of state calculations show that the E g of DV(SW)-GNFs decreases upon IL adsorption and their Fermi energy level is shifted depending on the type of IL, thus enabling better conductivity. Reactivity descriptors generally indicate that the chemical potential (μ) and chemical hardness (η) of nanoflakes decrease upon IL adsorption, whereas the electrophilicity index (ω) increases. The UV-Vis absorption spectrum of DV-GNF and SW-GNF shows four bands in the visible spectrum which correspond to π → π* transitions with the absorption bands of SW-GNF appearing at higher wavelengths than those of DV-GNF. The most intense absorption bands in DV-GNF (λ = 348 nm) and SW-GNF (λ = 375 nm) are associated with electronic transitions HOMO-1 → LUMO+2 and HOMO → LUMO+1, respectively. In addition, these absorption bands undergo a red-shift by both increasing the size of the DV(SW)-GNF surfaces and IL adsorption. We also observe that the energy gaps and absorption spectra can be altered by varying the defect types and the type of IL adsorbate, where the defect types affect the spectral shapes of the bands and adsorbates at the first absorption peak, thus having potential application for light-emitting devices.

Methyl group reorientation under ligand binding probed by pseudocontact shifts.

PubMed

Lescanne, Mathilde; Ahuja, Puneet; Blok, Anneloes; Timmer, Monika; Akerud, Tomas; Ubbink, Marcellus

2018-06-02

Liquid-state NMR spectroscopy is a powerful technique to elucidate binding properties of ligands on proteins. Ligands binding in hydrophobic pockets are often in close proximity to methyl groups and binding can lead to subtle displacements of methyl containing side chains to accommodate the ligand. To establish whether pseudocontact shifts can be used to characterize ligand binding and the effects on methyl groups, the N-terminal domain of HSP90 was tagged with caged lanthanoid NMR probe 5 at three positions and titrated with a ligand. Binding was monitored using the resonances of leucine and valine methyl groups. The pseudocontact shifts (PCS) caused by ytterbium result in enhanced dispersion of the methyl spectrum, allowing more resonances to be observed. The effects of tag attachment on the spectrum and ligand binding are small. Significant changes in PCS were observed upon ligand binding, indicating displacements of several methyl groups. By determining the cross-section of PCS iso-surfaces generated by two or three paramagnetic centers, the new position of a methyl group can be estimated, showing displacements in the range of 1-3 Å for methyl groups in the binding site. The information about such subtle but significant changes may be used to improve docking studies and can find application in fragment-based drug discovery.

Magnetoreflection spectroscopy of monolayer transition-metal dichalcogenide semiconductors in pulsed magnetic fields

DOE PAGES

Stier, Andreas V.; McCreary, Kathleen M.; Jonker, Berend T.; ...

2016-05-13

The authors describe recent experimental efforts to perform polarization-resolved optical spectroscopy of monolayer transition-metal dichalcogenide semiconductors in very large pulsed magnetic fields to 65 T. The experimental setup and technical challenges are discussed in detail, and temperature-dependent magnetoreflection spectra from atomically thin tungsten disulphide are presented. The data clearly reveal not only the valley Zeeman effect in these two-dimensional semiconductors but also the small quadratic exciton diamagnetic shift from which the very small exciton size can be directly inferred. Lastly, the authors present model calculations that demonstrate how the measured diamagnetic shifts can be used to constrain estimates of themore » exciton binding energy in this new family of monolayer semiconductors.« less

Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands

PubMed Central

Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.

2013-01-01

Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375

Study Of The Specificity Of Xanthene Dye Binding To Mitochondria

NASA Astrophysics Data System (ADS)

Bunting, James R.; Kamali, Eleanor; Phan, Trung V.; Dowben, Robert M.; Matthews, J. Lester

1989-03-01

The binding of Rhodamine 123 (Rh123), Rhodamine 6G (R6G), and Rhodamine B (RhB) (from the cationic xanthene series) to isolated rat liver mitochondria maintained in State IV respiration in the presence of rotenone (NADH oxidase inhibitor) was monitored by following changes in the fluorescence signal of the dyes. Rh123 and Rh6G bind strongly with quenching, to 0.25 and 0.20, respectively, and red shift of emission maxima by 10 nm. RhB binds much less potently with slight emission enhancement of 1.2. For Rh123 added to 0.5 mg/ml mitochondria' protein, a sigmoidal relationship is obtained between percentage fluorescence quenching and log of Rh123 concentration with a 50% inflection point of 3.5x10-6M, estimating an apparent association constant of 2.9x 105M-1 for Rh123 binding. Addition of 7 uM RhB during Rh123 titration moves the sigmoidal inflection point to higher Rh123 concentrations, suggesting either RhB enhancement of binding of Rh123 fluorescence quenching by energy transfer to RhB bound. These results suggest that, to a great degree, the binding of the xanthene dyes to mitochondrial sites is specific, competitive, and probably cooperative.

Alternate binding modes for a ubiquitin-SH3 domain interaction studied by NMR spectroscopy.

PubMed

Korzhnev, Dmitry M; Bezsonova, Irina; Lee, Soyoung; Chalikian, Tigran V; Kay, Lewis E

2009-02-20

Surfaces of many binding domains are plastic, enabling them to interact with multiple targets. An understanding of how they bind and recognize their partners is therefore predicated on characterizing such dynamic interfaces. Yet, these interfaces are difficult to study by standard biophysical techniques that often 'freeze' out conformations or that produce data averaged over an ensemble of conformers. In this study, we used NMR spectroscopy to study the interaction between the C-terminal SH3 domain of CIN85 and ubiquitin that involves the 'classical' binding sites of these proteins. Notably, chemical shift titration data of one target with another and relaxation dispersion data that report on millisecond time scale exchange processes are both well fit to a simple binding model in which free protein is in equilibrium with a single bound conformation. However, dissociation constants and chemical shift differences between free and bound states measured from both classes of experiment are in disagreement. It is shown that the data can be reconciled by considering three-state binding models involving two distinct bound conformations. By combining titration and dispersion data, kinetic and thermodynamic parameters of the three-state binding reaction are obtained along with chemical shifts for each state. A picture emerges in which one bound conformer has increased entropy and enthalpy relative to the second and chemical shifts similar to that of the free state, suggesting a less packed interface. This study provides an example of the interplay between entropy and enthalpy to fine-tune molecular interactions involving the same binding surfaces.

Electronic structure of Fe- vs. Ru-based dye molecules

NASA Astrophysics Data System (ADS)

Johnson, Phillip S.; Cook, Peter L.; Zegkinoglou, Ioannis; García-Lastra, J. M.; Rubio, Angel; Ruther, Rose E.; Hamers, Robert J.; Himpsel, F. J.

2013-01-01

In order to explore whether Ru can be replaced by inexpensive Fe in dye molecules for solar cells, the differences in the electronic structure of Fe- and Ru-based dyes are investigated by X-ray absorption spectroscopy and first-principles calculations. Molecules with the metal in a sixfold, octahedral N cage, such as tris(bipyridines) and tris(phenanthrolines), exhibit a systematic downward shift of the N 1s-to-π* transition when Ru is replaced by Fe. This shift is explained by an extra transfer of negative charge from the metal to the N ligands in the case of Fe, which reduces the binding energy of the N 1s core level. The C 1s-to-π* transitions show the opposite trend, with an increase in the transition energy when replacing Ru by Fe. Molecules with the metal in a fourfold, planar N cage (porphyrins) exhibit a more complex behavior due to a subtle competition between the crystal field, axial ligands, and the 2+ vs. 3+ oxidation states.

Ab initio density functional theory study on the atomic and electronic structure of GaP/Si(001) heterointerfaces

NASA Astrophysics Data System (ADS)

Romanyuk, O.; Supplie, O.; Susi, T.; May, M. M.; Hannappel, T.

2016-10-01

The atomic and electronic band structures of GaP/Si(001) heterointerfaces were investigated by ab initio density functional theory calculations. Relative total energies of abrupt interfaces and mixed interfaces with Si substitutional sites within a few GaP layers were derived. It was found that Si diffusion into GaP layers above the first interface layer is energetically unfavorable. An interface with Si/Ga substitution sites in the first layer above the Si substrate is energetically the most stable one in thermodynamic equilibrium. The electronic band structure of the epitaxial GaP/Si(001) heterostructure terminated by the (2 ×2 ) surface reconstruction consists of surface and interface electronic states in the common band gap of two semiconductors. The dispersion of the states is anisotropic and differs for the abrupt Si-Ga, Si-P, and mixed interfaces. Ga 2 p , P 2 p , and Si 2 p core-level binding-energy shifts were computed for the abrupt and the lowest-energy heterointerface structures. Negative and positive core-level shifts due to heterovalent bonds at the interface are predicted for the abrupt Si-Ga and Si-P interfaces, respectively. The distinct features in the heterointerface electronic structure and in the core-level shifts open new perspectives in the experimental characterization of buried polar-on-nonpolar semiconductor heterointerfaces.

Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

NASA Astrophysics Data System (ADS)

Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

2006-03-01

Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kataoka, H.; Fujiwara, Y.

1991-03-29

The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

I = 2 ππ scattering phase shift from the HAL QCD method with the LapH smearing

NASA Astrophysics Data System (ADS)

Kawai, Daisuke; Aoki, Sinya; Doi, Takumi; Ikeda, Yoichi; Inoue, Takashi; Iritani, Takumi; Ishii, Noriyoshi; Miyamoto, Takaya; Nemura, Hidekatsu; Sasaki, Kenji

2018-04-01

Physical observables, such as the scattering phase shifts and binding energy, calculated from the non-local HAL QCD potential do not depend on the sink operators used to define the potential. In practical applications, the derivative expansion of the non-local potential is employed, so that physical observables may receive some scheme dependence at a given order of the expansion. In this paper, we compare the I=2ππ scattering phase shifts obtained in the point-sink scheme (the standard scheme in the HAL QCD method) and the smeared-sink scheme (the LapH smearing newly introduced in the HAL QCD method). Although potentials in different schemes have different forms as expected, we find that, for reasonably small smearing size, the resultant scattering phase shifts agree with each other if the next-to-leading-order (NLO) term is taken into account. We also find that the HAL QCD potential in the point-sink scheme has a negligible NLO term for a wide range of energies, which implies good convergence of the derivative expansion, while the potential in the smeared-sink scheme has a non-negligible NLO contribution. The implications of this observation for future studies of resonance channels (such as the I=0 and 1ππ scatterings) with smeared all-to-all propagators are briefly discussed.

Impact of mutations on the allosteric conformational equilibrium

PubMed Central

Weinkam, Patrick; Chen, Yao Chi; Pons, Jaume; Sali, Andrej

2012-01-01

Allostery in a protein involves effector binding at an allosteric site that changes the structure and/or dynamics at a distant, functional site. In addition to the chemical equilibrium of ligand binding, allostery involves a conformational equilibrium between one protein substate that binds the effector and a second substate that less strongly binds the effector. We run molecular dynamics simulations using simple, smooth energy landscapes to sample specific ligand-induced conformational transitions, as defined by the effector-bound and unbound protein structures. These simulations can be performed using our web server: http://salilab.org/allosmod/. We then develop a set of features to analyze the simulations and capture the relevant thermodynamic properties of the allosteric conformational equilibrium. These features are based on molecular mechanics energy functions, stereochemical effects, and structural/dynamic coupling between sites. Using a machine-learning algorithm on a dataset of 10 proteins and 179 mutations, we predict both the magnitude and sign of the allosteric conformational equilibrium shift by the mutation; the impact of a large identifiable fraction of the mutations can be predicted with an average unsigned error of 1 kBT. With similar accuracy, we predict the mutation effects for an 11th protein that was omitted from the initial training and testing of the machine-learning algorithm. We also assess which calculated thermodynamic properties contribute most to the accuracy of the prediction. PMID:23228330

Re-construction of action awareness depends on an internal model of action-outcome timing.

PubMed

Stenner, Max-Philipp; Bauer, Markus; Machts, Judith; Heinze, Hans-Jochen; Haggard, Patrick; Dolan, Raymond J

2014-04-01

The subjective time of an instrumental action is shifted towards its outcome. This temporal binding effect is partially retrospective, i.e., occurs upon outcome perception. Retrospective binding is thought to reflect post-hoc inference on agency based on sensory evidence of the action - outcome association. However, many previous binding paradigms cannot exclude the possibility that retrospective binding results from bottom-up interference of sensory outcome processing with action awareness and is functionally unrelated to the processing of the action - outcome association. Here, we keep bottom-up interference constant and use a contextual manipulation instead. We demonstrate a shift of subjective action time by its outcome in a context of variable outcome timing. Crucially, this shift is absent when there is no such variability. Thus, retrospective action binding reflects a context-dependent, model-based phenomenon. Such top-down re-construction of action awareness seems to bias agency attribution when outcome predictability is low. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Re-construction of action awareness depends on an internal model of action-outcome timing

PubMed Central

Stenner, Max-Philipp; Bauer, Markus; Machts, Judith; Heinze, Hans-Jochen; Haggard, Patrick; Dolan, Raymond J.

2014-01-01

The subjective time of an instrumental action is shifted towards its outcome. This temporal binding effect is partially retrospective, i.e., occurs upon outcome perception. Retrospective binding is thought to reflect post-hoc inference on agency based on sensory evidence of the action – outcome association. However, many previous binding paradigms cannot exclude the possibility that retrospective binding results from bottom-up interference of sensory outcome processing with action awareness and is functionally unrelated to the processing of the action – outcome association. Here, we keep bottom-up interference constant and use a contextual manipulation instead. We demonstrate a shift of subjective action time by its outcome in a context of variable outcome timing. Crucially, this shift is absent when there is no such variability. Thus, retrospective action binding reflects a context-dependent, model-based phenomenon. Such top-down re-construction of action awareness seems to bias agency attribution when outcome predictability is low. PMID:24555983

The androgen receptor malignancy shift in prostate cancer.

PubMed

Copeland, Ben T; Pal, Sumanta K; Bolton, Eric C; Jones, Jeremy O

2018-05-01

Androgens and the androgen receptor (AR) are necessary for the development, function, and homeostatic growth regulation of the prostate gland. However, once prostate cells are transformed, the AR is necessary for the proliferation and survival of the malignant cells. This change in AR function appears to occur in nearly every prostate cancer. We have termed this the AR malignancy shift. In this review, we summarize the current knowledge of the AR malignancy shift, including the DNA-binding patterns that define the shift, the transcriptome changes associated with the shift, the putative drivers of the shift, and its clinical implications. In benign prostate epithelial cells, the AR primarily binds consensus AR binding sites. In carcinoma cells, the AR cistrome is dramatically altered, as the AR associates with FOXA1 and HOXB13 motifs, among others. This shift leads to the transcription of genes associated with a malignant phenotype. In model systems, some mutations commonly found in localized prostate cancer can alter the AR cistrome, consistent with the AR malignancy shift. Current evidence suggests that the AR malignancy shift is necessary but not sufficient for transformation of prostate epithelial cells. Reinterpretation of prostate cancer genomic classification systems in light of the AR malignancy shift may improve our ability to predict clinical outcomes and treat patients appropriately. Identifying and targeting the molecular factors that contribute to the AR malignancy shift is not trivial but by doing so, we may be able to develop new strategies for the treatment or prevention of prostate cancer. © 2018 Wiley Periodicals, Inc.

Solution Structure of a Phytocystatin from Ananas comosus and Its Molecular Interaction with Papain

PubMed Central

Irene, Deli; Chung, Tse-Yu; Chen, Bo-Jiun; Liu, Ting-Hang; Li, Feng-Yin; Tzen, Jason T. C.; Wang, Cheng-I; Chyan, Chia-Lin

2012-01-01

The structure of a recombinant pineapple cystatin (AcCYS) was determined by NMR with the RMSD of backbone and heavy atoms of twenty lowest energy structures of 0.56 and 1.11 Å, respectively. It reveals an unstructured N-terminal extension and a compact inhibitory domain comprising a four-stranded antiparallel β-sheet wrapped around a central α-helix. The three structural motifs (G45, Q89XVXG, and W120) putatively responsible for the interaction with papain-like proteases are located in one side of AcCYS. Significant chemical shift perturbations in two loop regions, residues 45 to 48 (GIYD) and residues 89 to 91 (QVV), of AcCYS strongly suggest their involvement in the binding to papain, consistent with studies on other members of the cystatin family. However, the highly conserved W120 appears not to be involved in the binding with papain as no chemical shift perturbation was observed. Chemical shift index analysis further indicates that the length of the α-helix is shortened upon association with papain. Collectively, our data suggest that AcCYS undergoes local secondary structural rearrangements when papain is brought into close contact. A molecular model of AcCYS/papain complex is proposed to illustrate the interaction between AcCYS and papain, indicating a complete blockade of the catalytic triad by AcCYS. PMID:23139757

Integrating Solid-State NMR and Computational Modeling to Investigate the Structure and Dynamics of Membrane-Associated Ghrelin

PubMed Central

Els-Heindl, Sylvia; Chollet, Constance; Scheidt, Holger A.; Beck-Sickinger, Annette G.; Meiler, Jens; Huster, Daniel

2015-01-01

The peptide hormone ghrelin activates the growth hormone secretagogue receptor 1a, also known as the ghrelin receptor. This 28-residue peptide is acylated at Ser3 and is the only peptide hormone in the human body that is lipid-modified by an octanoyl group. Little is known about the structure and dynamics of membrane-associated ghrelin. We carried out solid-state NMR studies of ghrelin in lipid vesicles, followed by computational modeling of the peptide using Rosetta. Isotropic chemical shift data of isotopically labeled ghrelin provide information about the peptide’s secondary structure. Spin diffusion experiments indicate that ghrelin binds to membranes via its lipidated Ser3. Further, Phe4, as well as electrostatics involving the peptide’s positively charged residues and lipid polar headgroups, contribute to the binding energy. Other than the lipid anchor, ghrelin is highly flexible and mobile at the membrane surface. This observation is supported by our predicted model ensemble, which is in good agreement with experimentally determined chemical shifts. In the final ensemble of models, residues 8–17 form an α-helix, while residues 21–23 and 26–27 often adopt a polyproline II helical conformation. These helices appear to assist the peptide in forming an amphipathic conformation so that it can bind to the membrane. PMID:25803439

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

Antibody-mediated fluorescence enhancement based on shifting the intramolecular dimer<-->monomer equilibrium of fluorescent dyes.

PubMed

Wei, A P; Blumenthal, D K; Herron, J N

1994-05-01

A novel concept is described for directly coupling fluorescence emission to protein-ligand binding. It is based on shifting the intramolecular monomer<-->dimer equilibrium of two fluorescent dyes linked by a short spacer. A 13-residue peptide, recognized by a monoclonal antibody against human chorionic gonadotrophin (hCG), was labeled with fluorescein (F) and tetramethylrhodamine (T) at its N- and C-terminus, respectively. Spectral evidence suggests that when the conjugate is free in solution, F and T exist as an intramolecular dimer. Fluorescence quenching of fluorescein and rhodamine is approximately 98% and approximately 90%, respectively, due to dimerization. When the double-labeled peptide is bound to anti-hCG, however, the rhodamine fluorescence increases by up to 7.8-fold, depending upon the excitation wavelength. This is attributed to the dissociation of intramolecular dimers brought about by conformational changes of the conjugate upon binding. Fluorescein fluorescence, on the other hand, was still quenched because of excited-state energy transfer and residual ground-state interactions. Antibody binding also resulted in a approximately 3.4-fold increase in fluorescence anisotropy of the peptide. These changes in intensity and anisotropy allow direct measurement of antigen-antibody binding with a fluorescence plate reader or a polarization analyzer, without the need for separation steps and labeling antibodies. Because recent advances in peptide technology have allowed rapid and economical identification of antigen-mimicking peptides, the double-labeled peptide approach offers many opportunities for developing new diagnostic assays and screening new therapeutic drugs. It also has many potential applications to techniques involving recombinant antibodies, biosensors, cell sorting, and DNA probes.

Excitation energy shift and size difference of low-energy levels in p -shell Λ hypernuclei

NASA Astrophysics Data System (ADS)

Kanada-En'yo, Yoshiko

2018-02-01

Structures of low-lying 0 s -orbit Λ states in p -shell Λ hypernuclei (ZAΛ) are investigated by applying microscopic cluster models for nuclear structure and a single-channel folding potential model for a Λ particle. For A >10 systems, the size reduction of core nuclei is small, and the core polarization effect is regarded as a higher-order perturbation in the Λ binding. The present calculation qualitatively describes the systematic trend of experimental data for excitation energy change from Z-1A to ZAΛ, in A >10 systems. The energy change shows a clear correlation with the nuclear size difference between the ground and excited states. In Li7Λ and Be9Λ, the significant shrinkage of cluster structures occurs consistently with the prediction of other calculations.

5,10-Methylene-5,6,7,8-tetrahydrofolate conformational transitions upon binding to thymidylate synthase: molecular mechanics and continuum solvent studies

NASA Astrophysics Data System (ADS)

Jarmuła, Adam; Cieplak, Piotr; Montfort, William R.

2005-02-01

We applied the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) approach to evaluate relative stability of the extended (flat) and C-shaped (bent) solution conformational forms of the 5,10-methylene-5,6,7,8-tetrahydrofolate (mTHF) molecule in aqueous solution. Calculations indicated that both forms have similar free energies in aqueous solution but detailed energy components are different. The bent solution form has lower intramolecular electrostatic and van der Waals interaction energies. The flat form has more favorable solvation free energy and lower contribution from the bond, angle and torsion angle molecular mechanical internal energies. We exploit these results and combine them with known crystallographic data to provide a model for the progressive binding of the mTHF molecule, a natural cofactor of thymidylate synthase (TS), to the complex forming in the TS-catalyzed reaction. We propose that at the time of initial weak binding in the open enzyme the cofactor molecule remains in a close balance between the flat and bent solution conformations, with neither form clearly favored. Later, thymidylate synthase undergoes conformational change leading to the closure of the active site and the mTHF molecule is withdrawn from the solvent. That effect shifts the thermodynamic equilibrium of the mTHF molecule toward the bent solution form. At the same time, burying the cofactor molecule in the closed active site produces numerous contacts between mTHF and protein that render change in the shape of the mTHF molecule. As a result, the bent solution conformer is converted to more strained L-shaped bent enzyme conformer of the mTHF molecule. The strain in the bent enzyme conformation allows for the tight binding of the cofactor molecule to the productive ternary complex that forms in the closed active site, and facilitates the protonation of the imidazolidine N10 atom, which promotes further reaction.

Vibrational Stark effect spectroscopy at the interface of Ras and Rap1A bound to the Ras binding domain of RalGDS reveals an electrostatic mechanism for protein-protein interaction.

PubMed

Stafford, Amy J; Ensign, Daniel L; Webb, Lauren J

2010-11-25

Electrostatic fields at the interface of the Ras binding domain of the protein Ral guanine nucleotide dissociation stimulator (RalGDS) with the structurally analogous GTPases Ras and Rap1A were measured with vibrational Stark effect (VSE) spectroscopy. Eleven residues on the surface of RalGDS that participate in this protein-protein interaction were systematically mutated to cysteine and subsequently converted to cyanocysteine in order to introduce a nitrile VSE probe in the form of the thiocyanate (SCN) functional group. The measured SCN absorption energy on the monomeric protein was compared with solvent-accessible surface area (SASA) calculations and solutions to the Poisson-Boltzmann equation using Boltzmann-weighted structural snapshots from molecular dynamics simulations. We found a weak negative correlation between SASA and measured absorption energy, indicating that water exposure of protein surface amino acids can be estimated from experimental measurement of the magnitude of the thiocyanate absorption energy. We found no correlation between calculated field and measured absorption energy. These results highlight the complex structural and electrostatic nature of the protein-water interface. The SCN-labeled RalGDS was incubated with either wild-type Ras or wild-type Rap1A, and the formation of the docked complex was confirmed by measurement of the dissociation constant of the interaction. The change in absorption energy of the thiocyanate functional group due to complex formation was related to the change in electrostatic field experienced by the nitrile functional group when the protein-protein interface forms. At some locations, the nitrile experiences the same shift in field when bound to Ras and Rap1A, but at others, the change in field is dramatically different. These differences identify residues on the surface of RalGDS that direct the specificity of RalGDS binding to its in vivo binding partner, Rap1A, through an electrostatic mechanism.

Bichromophoric dyes for wavelength shifting of dye-protein fluoromodules.

PubMed

Pham, Ha H; Szent-Gyorgyi, Christopher; Brotherton, Wendy L; Schmidt, Brigitte F; Zanotti, Kimberly J; Waggoner, Alan S; Armitage, Bruce A

2015-03-28

Dye-protein fluoromodules consist of fluorogenic dyes and single chain antibody fragments that form brightly fluorescent noncovalent complexes. This report describes two new bichromophoric dyes that extend the range of wavelengths of excitation or emission of existing fluoromodules. In one case, a fluorogenic thiazole orange (TO) was attached to an energy acceptor dye, Cy5. Upon binding to a protein that recognizes TO, red emission due to efficient energy transfer from TO to Cy5 replaces the green emission observed for monochromophoric TO bound to the same protein. Separately, TO was attached to a coumarin that serves as an energy donor. The same green emission is observed for coumarin-TO and TO bound to a protein, but efficient energy transfer allows violet excitation of coumarin-TO, versus longer wavelength, blue excitation of monochromophoric TO. Both bichromophores exhibit low nanomolar KD values for their respective proteins, >95% energy transfer efficiency and high fluorescence quantum yields.

Bichromophoric Dyes for Wavelength Shifting of Dye-Protein Fluoromodules

PubMed Central

Pham, Ha H.; Szent-Gyorgyi, Christopher; Brotherton, Wendy L.; Schmidt, Brigitte F.; Zanotti, Kimberly J.; Waggoner, Alan S.

2015-01-01

Dye-protein fluoromodules consist of fluorogenic dyes and single chain antibody fragments that form brightly fluorescent noncovalent complexes. This report describes two new bichromophoric dyes that extend the range of wavelengths of excitation or emission of existing fluoromodules. In one case, a fluorogenic thiazole orange (TO) was attached to an energy acceptor dye, Cy5. Upon binding to a protein that recognizes TO, red emission due to efficient energy transfer from TO to Cy5 replaces the green emission observed for monochromophoric TO bound to the same protein. Separately, TO was attached to a coumarin that serves as an energy donor. The same green emission is observed for coumarin-TO and TO bound to a protein, but efficient energy transfer allows violet excitation of coumarin-TO, versus longer wavelength, blue excitation of monochromophoric TO. Both bichromophores exhibit low nanomolar KD values for their respective proteins, >95% energy transfer efficiency and high fluorescence quantum yields. PMID:25679477

The P K-near edge absorption spectra of phosphates

NASA Astrophysics Data System (ADS)

Franke, R.; Hormes, J.

1995-12-01

The X-ray absorption near edge structure (XANES) at the P K-edge in several orthophosphates with various cations, in condensed, and in substituted sodium phosphates have been measured using synchrotron radiation from the ELSA storage ring at the University of Bonn. The measured spectra demonstrate that chemical changes beyond the PO 4- tetrahedra are reflected by energy shifts of the pre-edge and continuum resonances, by the presence of characteristic shoulders and new peaks and by differences in the intensity of the white line. We discuss the energy differences between the white line positions and the corresponding P ls binding energies as a measure of half of the energy gap. The corresponding values correlate with the valence of the cations and the intensity of the white lines. The energy positions of the continuum resonances are discussed on the basis of an empirical bond-length correlation supporting a 1/ r2 - dependence.

Ligand Binding to WW Tandem Domains of YAP2 Transcriptional Regulator Is Under Negative Cooperativity

PubMed Central

Schuchardt, Brett J.; Mikles, David C.; Hoang, Lawrence M.; Bhat, Vikas; McDonald, Caleb B.; Sudol, Marius; Farooq, Amjad

2014-01-01

YAP2 transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well-documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. PMID:25283809

One-pot synthesis via 1, 3-dipolar cycloaddition reaction to piperazinyl-quinolinyl dispiro heterocyclic derivatives and spectrofluorometric and molecular docking studies on their binding with human serum albumin

NASA Astrophysics Data System (ADS)

Murugesan, Arul; Gengan, Robert Moonsamy; Rajamanikandan, Ramar; Ilanchelian, Malaichamy

2017-12-01

A series of novel dispiro piperazinyl-quinolinyl-thioxothiazolidin-2, 4-dione derivatives were synthesised and characterised by FT-IR 1H, 13C, 2D NMR and HRMS spectroscopic techniques. A representative compound 1'-(2-(4-methylpiperazin-1-yl)quinolin-3-yl)-2″-thioxo-5‧,6‧,7‧,7a'-tetrahydro-1‧H,2H-dispiro[acenaphthylene-1,3‧-pyrrolizine-2‧,5″-thiazolidine]-2,4″-dione was studied for its binding ability with human serum albumin (HSA) using the fluorescence quench titration method. Addition of the compound to HSA produced slight fluorescence quenching and red shift. The free energy change for the complexation process was evaluated as -29.98 kJ mol-1 thereby indicating a spontaneous and highly favourable reaction. Molecular docking analyses revealed the binding as -20.79 kJ mol-1 which was analogous with the experimental value obtained from emission data. It was concluded that TYR-263 is the moiety responsible for the binding in the complex.

Homogeneous and heterogeneous noncovalent dimers of formaldehyde and thioformaldehyde: structures, energetics, and vibrational frequencies.

PubMed

Van Dornshuld, Eric; Holy, Christina M; Tschumper, Gregory S

2014-05-08

This work provides the first characterization of five stationary points of the homogeneous thioformaldehyde dimer, (CH2S)2, and seven stationary points of the heterogeneous formaldehyde/thioformaldehyde dimer, CH2O/CH2S, with correlated ab initio electronic structure methods. Full geometry optimizations and corresponding harmonic vibrational frequencies were computed with second-order Møller-Plesset perturbation theory (MP2) and 13 different density functionals in conjunction with triple-ζ basis sets augmented with diffuse and multiple sets of polarization functions. The MP2 results indicate that the three stationary points of (CH2S)2 and four of CH2O/CH2S are minima, in contrast to two stationary points of the formaldehyde dimer, (CH2O)2. Single-point energies were also computed using the explicitly correlated MP2-F12 and CCSD(T)-F12 methods and basis sets as large as heavy-aug-cc-pVTZ. The (CH2O)2 and CH2O/CH2S MP2 and MP2-F12 binding energies deviated from the CCSD(T)-F12 binding energies by no more than 0.2 and 0.4 kcal mol(-1), respectively. The (CH2O)2 and CH2O/CH2S global minimum is the same at every level of theory. However, the MP2 methods overbind (CH2S)2 by as much as 1.1 kcal mol(-1), effectively altering the energetic ordering of the thioformaldehyde dimer minima relative to the CCSD(T)-F12 energies. The CCSD(T)-F12 binding energies of the (CH2O)2 and CH2O/CH2S stationary points are quite similar, with the former ranging from around -2.4 to -4.6 kcal mol(-1) and the latter from about -1.1 to -4.4 kcal mol(-1). Corresponding (CH2S)2 stationary points have appreciably smaller CCSD(T)-F12 binding energies ranging from ca. -1.1 to -3.4 kcal mol(-1). The vibrational frequency shifts upon dimerization are also reported for each minimum on the MP2 potential energy surfaces.

A heteronuclear zero quantum coherence Nz-exchange experiment that resolves resonance overlap and its application to measure the rates of heme binding to the IsdC protein.

PubMed

Robson, Scott A; Peterson, Robert; Bouchard, Louis-S; Villareal, Valerie A; Clubb, Robert T

2010-07-21

Chemical exchange phenomena in NMR spectra can be quantitatively interpreted to measure the rates of ligand binding, as well as conformational and chemical rearrangements. In macromolecules, processes that occur slowly on the chemical shift time scale are frequently studied using 2D heteronuclear ZZ or N(z)-exchange spectroscopy. However, to successfully apply this method, peaks arising from each exchanging species must have unique chemical shifts in both dimensions, a condition that is often not satisfied in protein-ligand binding equilibria for (15)N nuclei. To overcome the problem of (15)N chemical shift degeneracy we developed a heteronuclear zero-quantum (and double-quantum) coherence N(z)-exchange experiment that resolves (15)N chemical shift degeneracy in the indirect dimension. We demonstrate the utility of this new experiment by measuring the heme binding kinetics of the IsdC protein from Staphylococcus aureus. Because of peak overlap, we could not reliably analyze binding kinetics using conventional methods. However, our new experiment resulted in six well-resolved systems that yielded interpretable data. We measured a relatively slow k(off) rate of heme from IsdC (<10 s(-1)), which we interpret as necessary so heme loaded IsdC has time to encounter downstream binding partners to which it passes the heme. The utility of using this new exchange experiment can be easily expanded to (13)C nuclei. We expect our heteronuclear zero-quantum coherence N(z)-exchange experiment will expand the usefulness of exchange spectroscopy to slow chemical exchange events that involve ligand binding.

Photoemission study of CaF2- and SrF2-GaAs(110) interfaces formed at room temperature

NASA Astrophysics Data System (ADS)

Mao, D.; Young, K.; Kahn, A.; Zanoni, R.; McKinley, J.; Margaritondo, G.

1989-06-01

Interfaces formed by evaporating CaF2 or SrF2 on room-temperature GaAs(110) are studied with synchrotron-radiation photoemission spectroscopy. The fluoride films grow uniformly on the GaAs surface. The deposition of CaF2 and SrF2 induces a large initial band bending on p-type GaAs (~0.9 eV) and a small initial band bending on n-type GaAs (~0.25 eV). The valence band is dominated by the F 2p peak which shifts toward high binding energies by ~1.5 eV after the deposition of >=16 Å fluoride. This shift reflects an increase in the valence-band offset between the two materials as the film forms. The final band offsets are estimated at 7.7 and 8.0 eV for CaF2 and SrF2, respectively, and are in qualitative agreement with those expected from the fluoride-Si data. Core-level measurements indicate that no reaction or decomposition of the MF2 molecule takes place at the interface. The F 2s core-level line shape and the increase in the binding-energy separation of F 2s and Ca 3p with increasing coverage suggest the presence of an interface F component. Contrary to the CaF2/Si case, no measurable Ca-substrate bonding effect is observed. The dissociative effect of uv irradiation on the CaF2 film is also investigated.

A study on the interactions of amino acids with nitrogen doped graphene; docking, MD simulation, and QM/MM studies.

PubMed

Ghadari, Rahim

2016-02-14

The binding properties of twenty amino acids with nitrogen-doped graphene structures were studied using docking, MD simulation, and QM/MM methods. TDDFT studies were carried out to investigate the change in the electronic properties of the amino acids because of the presence of the solvent and nitrogen-doped graphene. The results revealed that π-π interactions between the amino acids with a benzene moiety and the surface of the graphene are the most important interactions. The observed red shifts in the TDDFT results which were related to the lower LUMO energies and higher HOMO energies are consistent with this statement.

How to calculate H3 better.

PubMed

Pavanello, Michele; Tung, Wei-Cheng; Adamowicz, Ludwik

2009-11-14

Efficient optimization of the basis set is key to achieving a very high accuracy in variational calculations of molecular systems employing basis functions that are explicitly dependent on the interelectron distances. In this work we present a method for a systematic enlargement of basis sets of explicitly correlated functions based on the iterative-complement-interaction approach developed by Nakatsuji [Phys. Rev. Lett. 93, 030403 (2004)]. We illustrate the performance of the method in the variational calculations of H(3) where we use explicitly correlated Gaussian functions with shifted centers. The total variational energy (-1.674 547 421 Hartree) and the binding energy (-15.74 cm(-1)) obtained in the calculation with 1000 Gaussians are the most accurate results to date.

Exciton and core-level electron confinement effects in transparent ZnO thin films

PubMed Central

Mosquera, Adolfo A.; Horwat, David; Rashkovskiy, Alexandr; Kovalev, Anatoly; Miska, Patrice; Wainstein, Dmitry; Albella, Jose M.; Endrino, Jose L.

2013-01-01

The excitonic light emission of ZnO films have been investigated by means of photoluminescence measurements in ultraviolet-visible region. Exciton confinement effects have been observed in thin ZnO coatings with thickness below 20 nm. This is enhanced by a rise of the intensity and a blue shift of the photoluminescence peak after extraction of the adsorbed species upon annealing in air. It is found experimentally that the free exciton energy (determined by the photoluminescence peak) is inversely proportional to the square of the thickness while core-level binding energy is inversely proportional to the thickness. These findings correlate very well with the theory of kinetic and potential confinements.

Character of intermolecular interaction in pyridine-argon complex: Ab initio potential energy surface, internal dynamics, and interrelations between SAPT energy components.

PubMed

Makarewicz, Jan; Shirkov, Leonid

2016-05-28

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center of mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy De of 392 cm(-1) is close to that of 387 cm(-1) calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, De for PAr becomes slightly lower than De for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.

Interband emission energy in a dilute nitride quaternary semiconductor quantum dot for longer wavelength applications

NASA Astrophysics Data System (ADS)

Mageshwari, P. Uma; Peter, A. John; Lee, Chang Woo; Duque, C. A.

2016-07-01

Excitonic properties are studied in a strained Ga1-xInxNyAs1-y/GaAs cylindrical quantum dot. The optimum condition for the desired band alignment for emitting wavelength 1.55 μm is investigated using band anticrossing model and the model solid theory. The band gap and the band discontinuities of a Ga1-xInxNyAs1-y/GaAs quantum dot on GaAs are computed with the geometrical confinement effect. The binding energy of the exciton, the oscillator strength and its radiative life time for the optimum condition are found taking into account the spatial confinement effect. The effects of geometrical confinement and the nitrogen incorporation on the interband emission energy are brought out. The result shows that the desired band alignment for emitting wavelength 1.55 μm is achieved for the inclusion of alloy contents, y=0.0554% and x=0.339% in Ga1-xInxNyAs1-y/GaAs quantum dot. And the incorporation of nitrogen and indium shows the red-shift and the geometrical confinement shows the blue-shift. And it can be applied for fibre optical communication networks.

Broadband ultrafast transient absorption of multiple exciton dynamics in lead sulfide nanocrystals

NASA Astrophysics Data System (ADS)

Gesuele, Felice; Wong, Chee Wei; Sfeir, Matthew; Misewich, James; Koh, Weonkyu; Murray, Christopher

2011-03-01

Multiple exciton generation (MEG) is under intense investigation as potential third-generation solar photovoltaics with efficiencies beyond the Shockley-Queisser limit. We examine PbS nanocrystals, dispersed and vigorously stirred in TCE solution, by means of supercontinuum femtosecond transient absorption (TA). TA spectra show the presence of first and second order bleaches for the 1Sh-Se and 1Ph-Pe excitonic transition while photoinduced absorption for the 1Sh,e-Ph,e transitions. We found evidence of carrier multiplication (MEG for single absorbed photon) from the analysis of the first and second order bleaches, in the limit of low number of absorbed photons (Nabs ~ 0.01), for energy three times and four times the Energy gap. The MEG efficiency, derived from the ratio between early-time to long-time TA signal, presents a strongly dispersive behavior with maximum red shifted respect the first absorption peak. Analysis of population dynamics shows that in presence of biexciton, the 1Sh-Se bleach peak is red-shifted indicating a positive binding energy. MEG efficiency estimation will be discussed with regards to spectral integration, correlated higher-order and first excitonic transitions, as well as the nanocrystal morphologies.

Quantum confined Stark effects of single dopant in polarized hemispherical quantum dot: Two-dimensional finite difference approach and Ritz-Hassé variation method

NASA Astrophysics Data System (ADS)

El Harouny, El Hassan; Nakra Mohajer, Soukaina; Ibral, Asmaa; El Khamkhami, Jamal; Assaid, El Mahdi

2018-05-01

Eigenvalues equation of hydrogen-like off-center single donor impurity confined in polarized homogeneous hemispherical quantum dot deposited on a wetting layer, capped by insulated matrix and submitted to external uniform electric field is solved in the framework of the effective mass approximation. An infinitely deep potential is used to describe effects of quantum confinement due to conduction band offsets at surfaces where quantum dot and surrounding materials meet. Single donor ground state total and binding energies in presence of electric field are determined via two-dimensional finite difference approach and Ritz-Hassé variation principle. For the latter method, attractive coulomb correlation between electron and ionized single donor is taken into account in the expression of trial wave function. It appears that off-center single dopant binding energy, spatial extension and radial probability density are strongly dependent on hemisphere radius and single dopant position inside quantum dot. Influence of a uniform electric field is also investigated. It shows that Stark effect appears even for very small size dots and that single dopant energy shift is more significant when the single donor is near hemispherical surface.

Intrinsic Thermodynamics and Structure Correlation of Benzenesulfonamides with a Pyrimidine Moiety Binding to Carbonic Anhydrases I, II, VII, XII, and XIII

PubMed Central

Kišonaitė, Miglė; Zubrienė, Asta; Čapkauskaitė, Edita; Smirnov, Alexey; Smirnovienė, Joana; Kairys, Visvaldas; Michailovienė, Vilma; Manakova, Elena; Gražulis, Saulius; Matulis, Daumantas

2014-01-01

The early stage of drug discovery is often based on selecting the highest affinity lead compound. To this end the structural and energetic characterization of the binding reaction is important. The binding energetics can be resolved into enthalpic and entropic contributions to the binding Gibbs free energy. Most compound binding reactions are coupled to the absorption or release of protons by the protein or the compound. A distinction between the observed and intrinsic parameters of the binding energetics requires the dissection of the protonation/deprotonation processes. Since only the intrinsic parameters can be correlated with molecular structural perturbations associated with complex formation, it is these parameters that are required for rational drug design. Carbonic anhydrase (CA) isoforms are important therapeutic targets to treat a range of disorders including glaucoma, obesity, epilepsy, and cancer. For effective treatment isoform-specific inhibitors are needed. In this work we investigated the binding and protonation energetics of sixteen [(2-pyrimidinylthio)acetyl]benzenesulfonamide CA inhibitors using isothermal titration calorimetry and fluorescent thermal shift assay. The compounds were built by combining four sulfonamide headgroups with four tailgroups yielding 16 compounds. Their intrinsic binding thermodynamics showed the limitations of the functional group energetic additivity approach used in fragment-based drug design, especially at the level of enthalpies and entropies of binding. Combined with high resolution crystal structural data correlations were drawn between the chemical functional groups on selected inhibitors and intrinsic thermodynamic parameters of CA-inhibitor complex formation. PMID:25493428

Hard X-ray photoemission study of the Fabre salts (TMTTF)2X (X = SbF6 and PF6)

NASA Astrophysics Data System (ADS)

Medjanik, Katerina; de Souza, Mariano; Kutnyakhov, Dmytro; Gloskovskii, Andrei; Müller, Jens; Lang, Michael; Pouget, Jean-Paul; Foury-Leylekian, Pascale; Moradpour, Alec; Elmers, Hans-Joachim; Schönhense, Gerd

2014-11-01

Core-level photoemission spectra of the Fabre salts with X = SbF6 and PF6 were taken using hard X-rays from PETRA III, Hamburg. In these salts TMTTF layers show a significant stack dimerization with a charge transfer of 1 e per dimer to the anion SbF6 or PF6. At room temperature and slightly below the core-level spectra exhibit single lines, characteristic for a well-screened metallic state. At reduced temperatures progressive charge localization sets in, followed by a 2nd order phase transition into a charge-ordered ground state. In both salts groups of new core-level signals occur, shifted towards lower kinetic energies. This is indicative of a reduced transverse-conductivity across the anion layers, visible as layer-dependent charge depletion for both samples. The surface potential was traced via shifts of core-level signals of an adsorbate. A well-defined potential could be established by a conducting cap layer of 5 nm aluminum which appears "transparent" due to the large probing depth of HAXPES (8-10 nm). At the transition into the charge-ordered phase the fluorine 1 s line of (TMTTF)2SbF6 shifts by 2.8 eV to higher binding energy. This is a spectroscopic fingerprint of the loss of inversion symmetry accompanied by a cooperative shift of the SbF6 anions towards the more positively charged TMTTF donors. This shift does not occur for the X = PF6 compound, most likely due to smaller charge disproportion or due to the presence of charge disorder.

Protein NMR Studies of Substrate Binding to Human Blood Group A and B Glycosyltransferases.

PubMed

Grimm, Lena Lisbeth; Weissbach, Sophie; Flügge, Friedemann; Begemann, Nora; Palcic, Monica M; Peters, Thomas

2017-07-04

Donor and acceptor substrate binding to human blood group A and B glycosyltransferases (GTA, GTB) has been studied by a variety of protein NMR experiments. Prior crystallographic studies had shown these enzymes to adopt an open conformation in the absence of substrates. Binding either of the donor substrate UDP-Gal or of UDP induces a semiclosed conformation. In the presence of both donor and acceptor substrates, the enzymes shift towards a closed conformation with ordering of an internal loop and the C-terminal residues, which then completely cover the donor-binding pocket. Chemical-shift titrations of uniformly 2 H, 15 N-labeled GTA or GTB with UDP affected about 20 % of all crosspeaks in 1 H, 15 N TROSY-HSQC spectra, reflecting substantial plasticity of the enzymes. On the other hand, it is this conformational flexibility that impedes NH backbone assignments. Chemical-shift-perturbation experiments with δ1-[ 13 C]methyl-Ile-labeled samples revealed two Ile residues-Ile123 at the bottom of the UDP binding pocket, and Ile192 as part of the internal loop-that were significantly disturbed upon stepwise addition of UDP and H-disaccharide, also revealing long-range perturbations. Finally, methyl TROSY-based relaxation dispersion experiments do not reveal micro- to millisecond timescale motions. Although this study reveals substantial conformational plasticity of GTA and GTB, the matter of how binding of substrates shifts the enzymes into catalytically competent states remains enigmatic. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Importance of polar solvation and configurational entropy for design of antiretroviral drugs targeting HIV-1 protease.

PubMed

Kar, Parimal; Lipowsky, Reinhard; Knecht, Volker

2013-05-16

Both KNI-10033 and KNI-10075 are high affinity preclinical HIV-1 protease (PR) inhibitors with affinities in the picomolar range. In this work, the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) method has been used to investigate the potency of these two HIV-1 PR inhibitors against the wild-type and mutated proteases assuming that potency correlates with the affinity of the drugs for the target protein. The decomposition of the binding free energy reveals the origin of binding affinities or mutation-induced affinity changes. Our calculations indicate that the mutation I50V causes drug resistance against both inhibitors. On the other hand, we predict that the mutant I84V causes drug resistance against KNI-10075 while KNI-10033 is more potent against the I84V mutant compared to wild-type protease. Drug resistance arises mainly from unfavorable shifts in van der Waals interactions and configurational entropy. The latter indicates that neglecting changes in configurational entropy in the computation of relative binding affinities as often done is not appropriate in general. For the bound complex PR(I50V)-KNI-10075, an increased polar solvation free energy also contributes to the drug resistance. The importance of polar solvation free energies is revealed when interactions governing the binding of KNI-10033 or KNI-10075 to the wild-type protease are compared to the inhibitors darunavir or GRL-06579A. Although the contributions from intermolecular electrostatic and van der Waals interactions as well as the nonpolar component of the solvation free energy are more favorable for PR-KNI-10033 or PR-KNI-10075 compared to PR-DRV or PR-GRL-06579A, both KNI-10033 and KNI-10075 show a similar affinity as darunavir and a lower binding affinity relative to GRL-06579A. This is because of the polar solvation free energy which is less unfavorable for darunavir or GRL-06579A relative to KNI-10033 or KNI-10075. The importance of the polar solvation as revealed here highlights that structural inspection alone is not sufficient for identifying the key contributions to binding affinities and affinity changes for the design of drugs but that solvation effects must be taken into account. A detailed understanding of the molecular forces governing binding and drug resistance might assist in the design of new inhibitors against HIV-1 PR variants that are resistant against current drugs.

Dynamic XPS measurements of ultrathin polyelectrolyte films containing antibacterial Ag–Cu nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taner-Camcı, Merve; Suzer, Sefik, E-mail: suzer@fen.bilkent.edu.tr

Ultrathin films consisting of polyelectrolyte layers prepared by layer-by-layer deposition technique and containing also Ag and Cu nanoparticles exhibit superior antibacterial activity toward Escherichia coli. These films have been investigated with XPS measurements under square wave excitation at two different frequencies, in order to further our understanding about the chemical/physical nature of the nanoparticles. Dubbed as dynamical XPS, such measurements bring out similarities and differences among the surface structures by correlating the binding energy shifts of the corresponding XPS peaks. Accordingly, it is observed that the Cu2p, Ag3d of the metal nanoparticles, and S2p of cysteine, the stabilizer and themore » capping agent, exhibit similar shifts. On the other hand, the C1s, N1s, and S2p peaks of the polyelectrolyte layers shift differently. This finding leads us the claim that the Ag and Cu atoms are in a nanoalloy structure, capped with cystein, as opposed to phase separated entities.« less

A computational docking study on the pH dependence of peptide binding to HLA-B27 sub-types differentially associated with ankylosing spondylitis

NASA Astrophysics Data System (ADS)

Serçinoğlu, Onur; Özcan, Gülin; Kabaş, Zeynep Kutlu; Ozbek, Pemra

2016-07-01

A single amino acid difference (Asp116His), having a key role in a pathogenesis pathway, distinguishes HLA-B*27:05 and HLA-B*27:09 sub-types as associated and non-associated with ankylosing spondylitis, respectively. In this study, molecular docking simulations were carried out with the aim of comprehending the differences in the binding behavior of both alleles at varying pH conditions. A library of modeled peptides was formed upon single point mutations aiming to address the effect of 20 naturally occurring amino acids at the binding core peptide positions. For both alleles, computational docking was applied using Autodock 4.2. Obtained free energies of binding (FEB) were compared within the peptide library and between the alleles at varying pH conditions. The amino acid preferences of each position were studied enlightening the role of each on binding. The preferred amino acids for each position of pVIPR were found to be harmonious with experimental studies. Our results indicate that, as the pH is lowered, the capacity of HLA-B*27:05 to bind peptides in the library is largely lost. Hydrogen bonding analysis suggests that the interaction between the main anchor positions of pVIPR and their respective binding pocket residues are affected from the pH the most, causing an overall shift in the FEB profiles.

A computational docking study on the pH dependence of peptide binding to HLA-B27 sub-types differentially associated with ankylosing spondylitis.

PubMed

Serçinoğlu, Onur; Özcan, Gülin; Kabaş, Zeynep Kutlu; Ozbek, Pemra

2016-07-01

A single amino acid difference (Asp116His), having a key role in a pathogenesis pathway, distinguishes HLA-B*27:05 and HLA-B*27:09 sub-types as associated and non-associated with ankylosing spondylitis, respectively. In this study, molecular docking simulations were carried out with the aim of comprehending the differences in the binding behavior of both alleles at varying pH conditions. A library of modeled peptides was formed upon single point mutations aiming to address the effect of 20 naturally occurring amino acids at the binding core peptide positions. For both alleles, computational docking was applied using Autodock 4.2. Obtained free energies of binding (FEB) were compared within the peptide library and between the alleles at varying pH conditions. The amino acid preferences of each position were studied enlightening the role of each on binding. The preferred amino acids for each position of pVIPR were found to be harmonious with experimental studies. Our results indicate that, as the pH is lowered, the capacity of HLA-B*27:05 to bind peptides in the library is largely lost. Hydrogen bonding analysis suggests that the interaction between the main anchor positions of pVIPR and their respective binding pocket residues are affected from the pH the most, causing an overall shift in the FEB profiles.

Distinguishing multiple chemotaxis Y protein conformations with laser-polarized 129Xe NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowery, Thomas J.; Doucleff, Michealeen; Ruiz, E. Janette

2005-02-01

The chemical shift of the {sup 129}Xe NMR signal has been shown to be extremely sensitive to the local environment around the atom and has been used to follow processes such as ligand binding by bacterial periplasmic binding proteins (Rubin et al. 2000; Lowery et al. 2004). Here we show that the {sup 129}Xe shift can sense more subtle changes: magnesium binding, BeF{sub 3}{sup -} activation, and peptide binding by the E. coli chemotaxis Y protein. {sup 1}H-{sup 15}N correlation spectroscopy and x-ray crystallography were used to identify two xenon-binding cavities in CheY that are primarily responsible for the shiftmore » changes. One site is near the active site, and the other is near the peptide binding site.« less

Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

PubMed

Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

2013-01-01

Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

Computational Chemistry-Based Identification of Ultra-Low Temperature Water-Gas-Shift Catalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manos Mavrikakis

2008-08-31

The current work seeks to identify novel, catalytically-active, stable, poison-resistant LWGS catalysts that retain the superior activity typical of conventional Cu catalysts but can be operated at similar or lower temperatures. A database for the Binding Energies (BEs) of the LWGS relevant species, namely CO, O and OH on the most-stable, close-packed facets of a set of 17 catalytically relevant transition metals was established. This BE data and a database of previously established segregation energies was utilized to predict the stability of bimetallic NSAs that could be synthesized by combinations of the 17 parent transition metals. NSAs that were potentiallymore » stable both in vacuo and under the influence of strong-binding WGS intermediates were then selected for adsorption studies. A set of 40 NSAs were identified that satisfied all three screener criteria and the binding energies of CO, O and OH were calculated on a set of 66, 43 and 79 NSA candidates respectively. Several NSAs were found that bound intermediates weaker than the monometallic catalysts and were thus potentially poison-resistant. Finally, kinetic studies were performed and resulted in the discovery of a specific NSA-based bimetallic catalyst Cu/Pt that is potentially a promising LWGS catalyst. This stable Cu/Pt subsurface alloy is expected to provide facile H{sub 2}O activation and remain relatively resistant from the poisoning by CO, S and formate intermediates.« less

Measurement of the adsorption energy difference between ortho- and para-D2 on an amorphous ice surface.

PubMed

Amiaud, L; Momeni, A; Dulieu, F; Fillion, J H; Matar, E; Lemaire, J-L

2008-02-08

Molecular hydrogen interaction on water ice surfaces is a major process taking place in interstellar dense clouds. By coupling laser detection and classical thermal desorption spectroscopy, it is possible to study the effect of rotation of D(2) on adsorption on amorphous solid water ice surfaces. The desorption profiles of ortho- and para-D(2) are different. This difference is due to a shift in the adsorption energy distribution of the two lowest rotational states. Molecules in J''=1 rotational state are on average more strongly bound to the ice surface than those in J''=0 rotational state. This energy difference is estimated to be 1.4+/-0.3 meV. This value is in agreement with previous calculation and interpretation. The nonspherical wave function J'' =1 has an interaction with the asymmetric part of the adsorption potential and contributes positively in the binding energy.

Ligand binding to WW tandem domains of YAP2 transcriptional regulator is under negative cooperativity.

PubMed

Schuchardt, Brett J; Mikles, David C; Hoang, Lawrence M; Bhat, Vikas; McDonald, Caleb B; Sudol, Marius; Farooq, Amjad

2014-12-01

YES-associated protein 2 (YAP2) transcriptional regulator drives a multitude of cellular processes, including the newly discovered Hippo tumor suppressor pathway, by virtue of the ability of its WW domains to bind and recruit PPXY-containing ligands to specific subcellular compartments. Herein, we employ an array of biophysical tools to investigate allosteric communication between the WW tandem domains of YAP2. Our data show that the WW tandem domains of YAP2 negatively cooperate when binding to their cognate ligands. Moreover, the molecular origin of such negative cooperativity lies in an unfavorable entropic contribution to the overall free energy relative to ligand binding to isolated WW domains. Consistent with this notion, the WW tandem domains adopt a fixed spatial orientation such that the WW1 domain curves outwards and stacks onto the binding groove of the WW2 domain, thereby sterically hindering ligand binding to both itself and its tandem partner. Although ligand binding to both WW domains disrupts such interdomain stacking interaction, they reorient themselves and adopt an alternative fixed spatial orientation in the liganded state by virtue of their ability to engage laterally so as to allow their binding grooves to point outwards and away from each other. In short, while the ability of WW tandem domains to aid ligand binding is well documented, our demonstration that they may also be subject to negative binding cooperativity represents a paradigm shift in our understanding of the molecular action of this ubiquitous family of protein modules. © 2014 FEBS.

Marine derived compounds as binders of the White spot syndrome virus VP28 envelope protein: In silico insights from molecular dynamics and binding free energy calculations.

PubMed

Sivakumar, K C; Sajeevan, T P; Bright Singh, I S

2016-10-01

White spot syndrome virus (WSSV) remains as one of the most dreadful pathogen of the shrimp aquaculture industry owing to its high virulence. The cumulative mortality reaches up to 100% within in 2-10days in a shrimp farm. Currently, no chemotherapeutics are available to control WSSV. The viral envelope protein, VP28, located on the surface of the virus particle acts as a vital virulence factor in the initial phases of inherent WSSV infection in shrimp. Hence, inhibition of envelope protein VP28 could be a novel way to deal with infection by inhibiting its interaction in the endocytic pathway. In this direction, a timely attempt was made to recognize a potential drug candidate of marine origin against WSSV using VP28 as a target by employing in silico docking and molecular dynamic simulations. A virtual library of 388 marine bioactive compounds was extracted from reports published in Marine Drugs. The top ranking compounds from docking studies were chosen from the flexible docking based on the binding affinities (ΔGb). In addition, the MD simulation and binding free energy analysis were implemented to validate and capture intermolecular interactions. The results suggested that the two compounds obtained a negative binding free energy with -40.453kJ/mol and -31.031kJ/mol for compounds with IDs 30797199 and 144162 respectively. The RMSD curve indicated that 30797199 moves into the hydrophobic core, while the position of 144162 atoms changes abruptly during simulation and is mostly stabilized by water bridges. The shift in RMSD values of VP28 corresponding to ligand RMSD gives an insight into the ligand induced conformational changes in the protein. This study is first of its kind to elucidate the explicit binding of chemical inhibitor to WSSV major structural protein VP28. Copyright © 2016 Elsevier Ltd. All rights reserved.

Electronic behaviour of Au-Pt alloys and the 4f binding energy shift anomaly in Au bimetallics- X-ray spectroscopy studies

NASA Astrophysics Data System (ADS)

Wang, Dongniu; Cui, Xiaoyu; Xiao, Qunfeng; Hu, Yongfeng; Wang, Zhiqiang; Yiu, Y. M.; Sham, T. K.

2018-06-01

The electronic structure and charge redistribution of 6s conduction charge and 5d charge in Au and Pt alloys, Au9Pt and AuPt9 have been investigated using a charge compensation model. It is found that, both the Au and Pt 4f binding energy (BE) exhibits a negative shift in the alloys relatively to the pure metal in apparent disagreement with electroneutrality considerations (Au is the most electronegative metallic element); more interestingly, the negative Au 4f BE shift in Au-Pt alloy is in contrast to previous observations for a large number of Au bimetallic systems with more electropositive hosts in which the more electropositive the host„ the more positive the Au 4f BE shift. This anomaly is counter intuitive to electronegativity considerations. This dilemma was resolved by the charge compensation model in which both electronegativity and charge neutrality can be satisfied and the overall charge flow δ, onto Au is small and positive and δ arises from charge flow of 6s conduction charge, Δnc onto Au site, which is partially compensated by the depletion of 6d charge Δnd at the Au site (δ = Δnc+ Δnd ˜0.1 >0). The much larger Coulomb interaction between 4f and 5d than that between 4f and 6s results in positive 4f BE shifts. The Au 4f BE shift in Au-Pt alloys together with 193Au Mössbauer data were used in the charge compensation model analysis which shows that the model is still valid in that the Au 4f shift in Au-Pt alloy arises from mainly conduction charge gain with little depletion of d charge at the Au site. The model also works for Pt. The Au and Pt 5d character in the alloys have been examined with valence band spectra which show both maintain their d characteristic in dilute alloys with Pt d piling up at the Fermi level, and the top of the Au valence band being pushed toward the Fermi level; this is confirmed with DFT densities of state calculations. When Pt is diluted in Au, it gains d charge as evident from the reduction in whiteline intensity at the Pt L3-edge XANES. What emerges from this work is a picture in which the s-d charge compensation in Au bimetallic alloys is triggered by electronegativity difference between Au and the host. For Au-Pt and Au-Pd systems, the difference in electronegativity is very small, conduction charge transfer dominates, and the Au 4f shift is negative whereas in most Au bimetallics, the larger the electronegativity difference, the larger the compensation and the larger the Au 4f shifts.

Gel shift analysis of the empA promoter region in Vibrio anguillarum.

PubMed

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-10-29

The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 microg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm.

Biochemical analysis of NSs from different tospoviruses.

PubMed

Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

2017-10-15

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Electronic and structural properties at the interface between CuPc and graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Yongsheng; College of Modern Science and Technology, China Jiliang University, Hangzhou 310018; Mao, Hongying

2015-01-07

The electronic and structural properties at Copper phthalocyanine (CuPc)/graphene have been studied using ultraviolet photoemission spectroscopy and first-principles density function theory calculation. The five emission features α, β, γ, δ, and ε originating from the CuPc molecules locate at 1.48, 3.66, 4.98, 6.90, and 9.04 eV, respectively. These features shift in binding energy with the increasing CuPc coverage. The feature α is mostly deriving from Cu 3d orbital with some contributions from C 2p orbital. Further theoretical calculation indicates that the adsorption of CuPc on a top site is the most favorable configuration, and the separation between the adsorbate and graphenemore » is about 3.47 Å. According to the density of states before and after CuPc adsorption, the LUMO of CuPc is slightly occupied, while the Dirac point of graphene slightly shift towards higher energy, suggesting that a small amount of electron transfer from graphene to CuPc upon contact.« less

Molecular modeling and residue interaction network studies on the mechanism of binding and resistance of the HCV NS5B polymerase mutants to VX-222 and ANA598.

PubMed

Xue, Weiwei; Jiao, Pingzu; Liu, Huanxiang; Yao, Xiaojun

2014-04-01

Hepatitis C virus (HCV) NS5B protein is an RNA-dependent RNA polymerase (RdRp) with essential functions in viral genome replication and represents a promising therapeutic target to develop direct-acting antivirals (DAAs). Multiple nonnucleoside inhibitors (NNIs) binding sites have been identified within the polymerase. VX-222 and ANA598 are two NNIs targeting thumb II site and palm I site of HCV NS5B polymerase, respectively. These two molecules have been shown to be very effective in phase II clinical trials. However, the emergence of resistant HCV replicon variants (L419M, M423T, I482L mutants to VX-222 and M414T, M414L, G554D mutants to ANA598) has significantly decreased their efficacy. To elucidate the molecular mechanism about how these mutations influenced the drug binding mode and decreased drug efficacy, we studied the binding modes of VX-222 and ANA598 to wild-type and mutant polymerase by molecular modeling approach. Molecular dynamics (MD) simulations results combined with binding free energy calculations indicated that the mutations significantly altered the binding free energy and the interaction for the drugs to polymerase. The further per-residue binding free energy decomposition analysis revealed that the mutations decreased the interactions with several key residues, such as L419, M423, L474, S476, I482, L497, for VX-222 and L384, N411, M414, Y415, Q446, S556, G557 for ANA598. These were the major origins for the resistance to these two drugs. In addition, by analyzing the residue interaction network (RIN) of the complexes between the drugs with wild-type and the mutant polymerase, we found that the mutation residues in the networks involved in the drug resistance possessed a relatively lower size of topology centralities. The shift of betweenness and closeness values of binding site residues in the mutant polymerase is relevant to the mechanism of drug resistance of VX-222 and ANA598. These results can provide an atomic-level understanding about the mechanisms of drug resistance conferred by the studied mutations and will be helpful to design more potent inhibitors which could effectively overcome drug resistance of antivirus agents. Copyright © 2014 Elsevier B.V. All rights reserved.

Enzyme-free colorimetric detection systems based on the DNA strand displacement competition reaction

NASA Astrophysics Data System (ADS)

Zhang, Z.; Birkedal, V.; Gothelf, K. V.

2016-05-01

The strand displacement competition assay is based on the dynamic equilibrium of the competitive hybridization of two oligonucleotides (A and B) to a third oligonucleotide (S). In the presence of an analyte that binds to a specific affinity-moiety conjugated to strand B, the equilibrium shifts, which can be detected by a shift in the fluorescence resonance energy transfer signal between dyes attached to the DNA strands. In the present study we have integrated an ATP aptamer in the strand B and demonstrated the optical detection of ATP. Furthermore we explore a new readout method using a split G-quadruplex DNAzyme for colorimetric readout of the detection of streptavidin by the naked eye. Finally, we integrate the whole G-quadruplex DNAzyme system in a single DNA strand and show that it is applicable to colorimetric detection.

Esr Spectra of Alkali-Metal Atoms on Helium Nanodroplets: a Theoretical Model for the Prediction of Helium Induced Hyperfine Structure Shifts

NASA Astrophysics Data System (ADS)

Hauser, Reas W.; Filatov, Michael; Ernst, Wolfgang E.

2013-06-01

We predict He-droplet-induced changes of the isotropic HFS constant a_{HFS} of the alkali-metal atoms M = Li, Na, K and Rb on the basis of a model description. Optically detected electron spin resonance spectroscopy has allowed high resolution measurements that show the influence of the helium droplet and its size on the unpaired electron spin density at the alkali nucleus. Our theoretical approach to describe this dependence is based on a combination of two well established techniques: Results of relativistic coupled-cluster calculations on the alkali-He dimers (energy and HFS constant as functions of the binding length) are mapped onto the doped-droplet-situation with the help of helium-density functional theory. We simulate doped droplets He_{N} with N ranging from 50 to 10000, using the diatomic alkali-He-potential energy curves as input. From the obtained density profiles we evaluate average distances between the dopant atom and its direct helium neighborhood. The distances are then set in relation to the variation of the HFS constant with binding length in the simplified alkali-He-dimer model picture. This method yields reliable relative shifts but involves a systematic absolute error. Hence, the absolute values of the shifts are tied to one experimentally determined HFS constant for ^{85}Rb-He_{N = 2000}. With this parameter choice we obtain results in good agreement with the available experimental data for Rb and K^{a,b} confirming the predicted 1/N trend of the functional dependence^{c}. M. Koch, G. Auböck, C. Callegari, and W. E. Ernst, Phys. Rev. Lett. 103, 035302-1-4 (2009) M. Koch, C. Callegari, and W. E. Ernst, Mol. Phys. 108 (7), 1005-1011 (2010) A. W. Hauser, T. Gruber, M. Filatov, and W. E. Ernst, ChemPhysChem (2013) online DOI: 10.1002/cphc.201200697

Role of Molecular Interactions for Synergistic Precipitation Inhibition of Poorly Soluble Drug in Supersaturated Drug-Polymer-Polymer Ternary Solution.

PubMed

Prasad, Dev; Chauhan, Harsh; Atef, Eman

2016-03-07

We are reporting a synergistic effect of combined Eudragit E100 and PVP K90 in precipitation inhibition of indomethacin (IND) in solutions at low polymer concentration, a phenomenon that has significant implications on the usefulness of developing novel ternary solid dispersion of poorly soluble drugs. The IND supersaturation was created by cosolvent technique, and the precipitation studies were performed in the absence and the presence of individual and combined PVP K90 and Eudragit E100. The studies were also done with PEG 8000 as a noninteracting control polymer. A continuous UV recording of the IND absorption was used to observe changes in the drug concentration over time. The polymorphic form and morphology of precipitated IND were characterized by Raman spectroscopy and scanning electron microscopy. The change in the chemical shift in solution (1)H NMR was used as novel approach to probe IND-polymer interactions. Molecular modeling was used for calculating binding energy between IND-polymer as another indication of IND-polymer interaction. Spontaneous IND precipitation was observed in the absence of polymers. Eudragit E100 showed significant inhibitory effect on nuclei formation due to stronger interaction as reflected in higher binding energy and greater change in chemical shift by NMR. PVP K90 led to significant crystal growth inhibition due to adsorption on growing IND crystals as confirmed by modified crystal habit of precipitate in the presence of PVP K90. Combination of polymers resulted in a synergistic precipitation inhibition and extended supersaturation. The NMR confirmed interaction between IND-Eudragit E100 and IND-PVP K90 in solution. The combination of polymers showed similar peak shift albeit using lower polymer concentration indicating stronger interactions. The results established the significant synergistic precipitation inhibition effect upon combining Eudragit E100 and PVP K90 due to drug-polymer interaction.

Temperature-dependent excitonic photoluminescence of hybrid organometal halide perovskite films.

PubMed

Wu, Kewei; Bera, Ashok; Ma, Chun; Du, Yuanmin; Yang, Yang; Li, Liang; Wu, Tom

2014-11-07

Organometal halide perovskites have recently attracted tremendous attention due to their potential for photovoltaic applications, and they are also considered as promising materials in light emitting and lasing devices. In this work, we investigated in detail the cryogenic steady state photoluminescence properties of a prototypical hybrid perovskite CH3NH3PbI3-xClx. The evolution of the characteristics of two excitonic peaks coincides with the structural phase transition around 160 K. Our results further revealed an exciton binding energy of 62.3 ± 8.9 meV and an optical phonon energy of 25.3 ± 5.2 meV, along with an abnormal blue-shift of the band gap in the high-temperature tetragonal phase.

A human transcription factor in search mode.

PubMed

Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

2016-01-08

Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effect of the PreBind Engagement Process on Scrum Timing and Stability in the 2013 to 2016 Six Nations.

PubMed

Bradley, Edward J; Hogg, Bob; Archer, David T

2017-12-28

This study examined if changes in scrum engagement laws from the "crouch-touch-set" (CTS) in 2013 to the "PreBind" engagement from 2014 onwards have led to changes in scrum characteristics, specifically timing, in international rugby union. Duration and outcomes were identified for all scrums occurring in the 2013-2016 Six Nations (n=60 games) using video analysis. Scrum duration increased after the introduction of the PreBind engagement from 59 s in 2013 to 69 s in 2016 (ρ=0.024, ES 0.93). A significant increase in mean contact duration per scrum occurred when prebinding was adopted (ρ<0.05), moving from 7.5 s under the CTS process to 8.5, 10.0 and 10.8 s with PreBind in 2014, 2015 and 2016 (ES 0.71, 2.05 and 3.0, respectively). The number of scrum resets and collapsed scrums, along with early engagement and pulling down infringements were lower under the PreBind process. Overall, the PreBind engagement resulted in longer scrums with significant increases observed in overall and contact durations, with improved stability related characteristics. The longer contact time is a consequence of increased stability with a shift from high energy impact to a sustained push phase with a lower force that is a benefit to player welfare.

Mutation-Induced Population Shift in the MexR Conformational Ensemble Disengages DNA Binding: A Novel Mechanism for MarR Family Derepression.

PubMed

Anandapadamanaban, Madhanagopal; Pilstål, Robert; Andresen, Cecilia; Trewhella, Jill; Moche, Martin; Wallner, Björn; Sunnerhagen, Maria

2016-08-02

MexR is a repressor of the MexAB-OprM multidrug efflux pump operon of Pseudomonas aeruginosa, where DNA-binding impairing mutations lead to multidrug resistance (MDR). Surprisingly, the crystal structure of an MDR-conferring MexR mutant R21W (2.19 Å) presented here is closely similar to wild-type MexR. However, our extended analysis, by molecular dynamics and small-angle X-ray scattering, reveals that the mutation stabilizes a ground state that is deficient of DNA binding and is shared by both mutant and wild-type MexR, whereas the DNA-binding state is only transiently reached by the more flexible wild-type MexR. This population shift in the conformational ensemble is effected by mutation-induced allosteric coupling of contact networks that are independent in the wild-type protein. We propose that the MexR-R21W mutant mimics derepression by small-molecule binding to MarR proteins, and that the described allosteric model based on population shifts may also apply to other MarR family members. Copyright © 2016 Elsevier Ltd. All rights reserved.

A High Affinity Red Fluorescence and Colorimetric Probe for Amyloid β Aggregates

NASA Astrophysics Data System (ADS)

Rajasekhar, K.; Narayanaswamy, Nagarjun; Murugan, N. Arul; Kuang, Guanglin; Ågren, Hans; Govindaraju, T.

2016-04-01

A major challenge in the Alzheimer’s disease (AD) is its timely diagnosis. Amyloid β (Aβ) aggregates have been proposed as the most viable biomarker for the diagnosis of AD. Here, we demonstrate hemicyanine-based benzothiazole-coumarin (TC) as a potential probe for the detection of highly toxic Aβ42 aggregates through switch-on, enhanced (~30 fold) red fluorescence (Emax = 654 nm) and characteristic colorimetric (light red to purple) optical outputs. Interestingly, TC exhibits selectivity towards Aβ42 fibrils compared to other abnormal protein aggregates. TC probe show nanomolar binding affinity (Ka = 1.72 × 107 M-1) towards Aβ42 aggregates and also displace ThT bound to Aβ42 fibrils due to its high binding affinity. The Aβ42 fibril-specific red-shift in the absorption spectra of TC responsible for the observed colorimetric optical output has been attributed to micro-environment change around the probe from hydrophilic-like to hydrophobic-like nature. The binding site, binding energy and changes in optical properties observed for TC upon interaction with Aβ42 fibrils have been further validated by molecular docking and time dependent density functional theory studies.

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

Energetics of muscle contraction: further trials.

PubMed

Yamada, Kazuhiro

2017-01-01

Knowledge accumulated in the field of energetics of muscle contraction has been reviewed in this article. Active muscle converts chemical energy into heat and work. Therefore, measurements of heat production and mechanical work provide the framework for understanding the process of energy conversion in contraction. In the 1970s, precise comparison between energy output and the associated chemical reactions was performed. It has been found that the two do not match in several situations, resulting in an energy balance discrepancy. More recently, efforts in resolving these discrepancies in the energy balance have been made involving chemical analysis, phosphorus nuclear magnetic resonance spectroscopy, and microcalorimetry. Through reviewing the evidence from these studies, the energy balance discrepancy developed early during isometric contraction has become well understood on a quantitative basis. In this situation energy balance is established when we take into account the binding of Ca to sarcoplasmic proteins such as troponin and parvalbumin, and also the shift of cross-bridge states. On the other hand, the energy balance discrepancy observed during rapid shortening still remains to be clarified. The problem may be related to the essential mechanism of cross-bridge action.

The solvent effects on dimethyl phthalate investigated by FTIR characterization, solvent parameter correlation and DFT computation

NASA Astrophysics Data System (ADS)

Chen, Yi; Zhang, Hui; Zhou, Wenzhao; Deng, Chao; Liao, Jian

2018-06-01

This study set out with the aim of investigating the solvent effects on dimethyl phthalate (DMP) using FTIR characterization, solvent parameter correlation and DFT calculation. DMP exposed to 17 organic solvents manifested varying shift in the carbonyl stretching vibration frequency (νCdbnd O). Non-alkanols induced Band I and alkanols produced Band I and Band II. Through correlating the νCdbnd O with the empirical solvent scales including acceptor parameter (AN), Schleyer's linear free energy parameter (G), and linear free salvation energy relationships (LSER), Band I was mainly ascribed to non-specific effects from either non-alkanols or alkanol polymers ((alkanol)n). νCdbnd O of the latter indicated minor red shift and less variability compared to the former. An assumption was made and validated about the sequestering of hydroxyl group by the bulky hydrophobic chain in (alkanol)n, creating what we refer to as "screening effects". Ab initio calculation, on the other hand, provided insights for possible hydrogen binding between DMP and (ethanol)n or between ethanol monomers. The two components of Band I observed in inert solvents were assigned to the two Cdbnd O groups adopting differentiated conformations. This in turn prompted our consideration that hydrogen binding was highly selective in favor of lowly associated (alkanol)n and the particular Cdbnd O group having relatively less steric hindrance and stronger electron-donating capacity. Band II was therefore believed to derive from hydrogen-bond interactions mainly in manner of 1:1 and 1:2 DMP-(alkanol)n complexes.

Estimation of Hammett sigma constants of substituted benzenes through accurate density-functional calculation of core-electron binding energy shifts

NASA Astrophysics Data System (ADS)

Takahata, Yuji; Chong, Delano P.

For substituted benzenes such as (p-F-C6H4-Z), Linderberg et al. 1 demonstrated the validity of an equation similar to: ΔCEBE ≈ κσ, where ΔCEBE is the difference in core-electron binding energies (CEBEs) of the fluorinated carbon in p-F-C6H4-Z and that in FC6H5, the parameter κ is a function of the type of reaction, and σ is the Hammett substituent (σ) constant. In this work, CEBEs of ring carbon atoms for a series of para disubstituted molecules p-F-C6H4-Z were first calculated using Density Functional Theory (DFT) with the scheme ΔEKS (PW86-PW91)/TZP+Crel//HF/6-31G*. An average absolute deviation of 0.13 eV from experiment was obtained for the CEBEs. Then we performed a linear regression analysis in the form of Y = A+B*X for a plot of Hammett σp constants against calculated shifts ΔCEBEs (in eV) for the fluorinated carbon. The results were: A = -0.08 and B = 1.01, with correlation coefficient R = 0.973, standard deviation = 0.12, and P < 0.0001. The intercept A of the fitted line, close to zero, shows that the Hammett σp constant is proportional to the calculated ΔCEBEs. On the other hand, the slope B of the straight line gives an estimate of the parameter κ. Similar statistical correlations were obtained for the carbon atoms ortho and meta to the substituent Z.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makarewicz, Jan, E-mail: jama@amu.edu.pl; Shirkov, Leonid

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center ofmore » mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy D{sub e} of 392 cm{sup −1} is close to that of 387 cm{sup −1} calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, D{sub e} for PAr becomes slightly lower than D{sub e} for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.« less

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

NASA Astrophysics Data System (ADS)

Hong, Sung-Young; Xu, Pan; Camillone, Nina R.; White, Michael G.; Camillone, Nicholas

2016-07-01

We report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate-adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probability increases roughly two orders magnitude, and (ii) the adsorbate-substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate-substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, ηel, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of ηel largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Sung -Young; Xu, Pan; Camillone, Nina R.

Here, we report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probabilitymore » increases roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η el, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η el largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Sung-Young; Camillone, Nina R.; Camillone, Nicholas, E-mail: nicholas@bnl.gov

We report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probability increasesmore » roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η{sub el}, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η{sub el} largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

Adlayer structure dependent ultrafast desorption dynamics in carbon monoxide adsorbed on Pd (111)

DOE PAGES

Hong, Sung -Young; Xu, Pan; Camillone, Nina R.; ...

2016-07-01

Here, we report our ultrafast photoinduced desorption investigation of the coverage dependence of substrate–adsorbate energy transfer in carbon monoxide adlayers on the (111) surface of palladium. As the CO coverage is increased, the adsorption site population shifts from all threefold hollows (up to 0.33 ML), to bridge and near bridge (>0.5 to 0.6 ML) and finally to mixed threefold hollow plus top site (at saturation at 0.75 ML). We show that between 0.24 and 0.75 ML this progression of binding site motifs is accompanied by two remarkable features in the ultrafast photoinduced desorption of the adsorbates: (i) the desorption probabilitymore » increases roughly two orders magnitude, and (ii) the adsorbate–substrate energy transfer rate observed in two-pulse correlation experiments varies nonmonotonically, having a minimum at intermediate coverages. Simulations using a phenomenological model to describe the adsorbate–substrate energy transfer in terms of frictional coupling indicate that these features are consistent with an adsorption-site dependent electron-mediated energy coupling strength, η el, that decreases with binding site in the order: three-fold hollow > bridge and near bridge > top site. This weakening of η el largely counterbalances the decrease in the desorption activation energy that accompanies this progression of adsorption site motifs, moderating what would otherwise be a rise of several orders of magnitude in the desorption probability. Within this framework, the observed energy transfer rate enhancement at saturation coverage is due to interadsorbate energy transfer from the copopulation of molecules bound in three-fold hollows to their top-site neighbors.« less

The stark effect on the spectrum energy of tritium in first excited state with relativistic condition

NASA Astrophysics Data System (ADS)

Prastowo, S. H. B.; Supriadi, B.; Bahri, S.; Ridlo, Z. R.

2018-04-01

This research discussed about the correction of Stark Effect on Tritium atoms in the first excited state with relativistic conditions. The approach used to solve this Stark Effect correction was the perturbation theory which was from time independent degenerate perturbation theory to second-order correction. The Stark Effect on the excited state made the spectrum energy polarization of Tritium which was included in the isotope of hydrogen with an electron moving around the nucleus with high velocity. Hence, the relativistic correction affected the spectrum energy shift. Tritium was a radioactive material having half-time 12,3 years and relatively safe. The Tritium application was a material for the manufacture of nuclear battery. The most effective external electric field that should give to Tritium was 108 V/mith the total correction energy that was 0,97398557 × 10-21 Joule. Therefore, its effect reduced the binding energy between electron and nucleus, and increased the power of Tritium Betavoltaics Battery.

Astrophysical 3He(α ,γ )7Be and 3H(α ,γ )7Li direct capture reactions in a potential-model approach

NASA Astrophysics Data System (ADS)

Tursunov, E. M.; Turakulov, S. A.; Kadyrov, A. S.

2018-03-01

The astrophysical 3He(α ,γ )7Be and 3H(α ,γ )7Li direct capture processes are studied in the framework of the two-body model with potentials of a simple Gaussian form, which describe correctly the phase shifts in the s , p , d , and f waves, as well as the binding energy and the asymptotic normalization constant of the ground p3 /2 and the first excited p1 /2 bound states. It is shown that the E 1 transition from the initial s wave to the final p waves is strongly dominant in both capture reactions. On this basis the s -wave potential parameters are adjusted to reproduce the new data of the LUNA Collaboration around 100 keV and the newest data at the Gamov peak estimated with the help of the observed neutrino fluxes from the sun, S34(23-5+6keV ) =0.548 ±0.054 keV b for the astrophysical S factor of the capture process 3He(α ,γ )7Be . The resulting model describes well the astrophysical S factor in the low-energy big-bang nucleosynthesis region of 180-400 keV; however, it has a tendency to underestimate the data above 0.5 MeV. The energy dependence of the S factor is mostly consistent with the data and the results of the no-core shell model with continuum, but substantially different from the fermionic molecular dynamics model predictions. Two-body potentials, adjusted for the properties of the 7Be nucleus, 3He+α elastic scattering data, and the astrophysical S factor of the 3He(α ,γ )7Be direct capture reaction, are able to reproduce the properties of the 7Li nucleus, the binding energies of the ground 3 /2- and first excited 1 /2- states, and phase shifts of the 3H+α elastic scattering in partial waves. Most importantly, these potential models can successfully describe both absolute value and energy dependence of the existing experimental data for the mirror astrophysical 3H(α ,γ )7Li capture reaction without any additional adjustment of the parameters.

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

Photoluminescence Studies of P-type Modulation Doped GaAs/AlGaAs Quantum Wells in the High Doping Regime

NASA Astrophysics Data System (ADS)

Wongmanerod, S.; Holtz, P. O.; Reginski, K.; Bugaiski, M.; Monemar, B.

The influence of high Be-acceptor doping on the modulation-doped GaAs/Al0.3Ga0.7As quantum wells structures has been optically studied by using the low-temperature photoluminescence (PL) and photoluminescence excitation (PLE) techniques.The modulation doped samples were grown by the molecular-beam epitaxy technique with a varying Be acceptor concentration ranging from 1×1018 to 8×1018cm-3. Several novels physical effects were observed. The main effect is a significant shift of the main emission towards lower energies as the doping concentrations increase. There are two contradictory mechanisms, which determine the peak energy of the main emission; the shrinkage of the effective bandgap due to many body effects and the reduction of the exciton binding energy due to the carrier screening effect. We conclude that the first one is the dominating effect. At a sufficiently high doping concentration (roughly 2×1018cm-3), the lineshape of the main PL emission is modified, and a new feature, the so called Fermi-edge singularity (FES), appears on the high energy side of the PL emission and exhibits a blue-shift as a function of doping concentration. This feature has been found to be very sensitive to a temperature change, already in the range of 4.4-50K. In addition, PLE spectra with a suitable detection energy show that the absorption edge is blue-shifted with respect to the PL main emission. The resulting Stoke shift is due to phase-space-filling of the carriers, in agreement with the FES interpretation. Finally, we have found from the PLE spectra that the exciton quenching is initiated in the same doping regime. Compared to the exciton quenching in other p-type structures, the critical acceptor concentration required to quench the excitons is significantly lower than in the case of 2D structures with acceptor doping within the well, but larger than in the case of 3D bulk.

Long tailed trions in monolayer MoS2: Temperature dependent asymmetry and resulting red-shift of trion photoluminescence spectra.

PubMed

Christopher, Jason W; Goldberg, Bennett B; Swan, Anna K

2017-10-25

Monolayer molybdenum disulfide (MoS 2 ) has emerged as a model system for studying many-body physics because the low dimensionality reduces screening leading to tightly bound states stable at room temperature. Further, the many-body states possess a pseudo-spin degree of freedom that corresponds with the two direct-gap valleys of the band structure, which can be optically manipulated. Here we focus on one bound state, the negatively charged trion. Unlike excitons, trions can radiatively decay with non-zero momentum by kicking out an electron, resulting in an asymmetric trion photoluminescence (PL) peak with a long low-energy tail and peak position that differs from the zero momentum trion energy. The asymmetry of the trion PL peak and resulting peak red-shift depends both on the trion size and a temperature-dependent contribution. Ignoring the trion asymmetry will result in over estimating the trion binding energy by nearly 20 meV at room temperature. We analyze the temperature-dependent PL to reveal the effective trion size, consistent with the literature, and the temperature dependence of the band gap and spin-orbit splitting of the valence band. This is the first time the temperature-dependence of the trion PL has been analyzed with such detail in any system.

The effects of the NMR shift-reagents Dy(PPP)2, Dy(TTHA) and Tm(DOTP) on developed pressure in isolated perfused rat hearts. The role of shift-reagent calcium complexes.

PubMed

Gaszner, B; Simor, T; Hild, G; Elgavish, G A

2001-11-01

The 23Na NMR shift-reagent complexes (Dy(PPP)2, Dy(TTHA), and Tm(DOTP)) bind stoichiometric amounts of Ca2+. Thus, in perfused rat heart systems, a supplementation of Ca2+ is required to maintain the requisite extracellular free calcium concentration ([Ca(o)]f) and to approximate a physiological level of contractile function. The amount of reagent-bound Ca2+ in a heart perfusate that contains a shift-reagent depends on: (1) Ca2+ binding by excess ligand used during the preparation of the shift-reagent; and (2) the Ca2+ binding affinity of the shift-reagent. To address point 1), we introduced a 1H and 31P NMR spectroscopic titration method to quantify directly the concentration of the excess ligand. We also used this method to minimize the amount of excess ligand (L) and thus the amount of Ca*L complex. To address point (2), we determined the stepwise Kd (microm) values of the Ca complexes of the three shift-reagents.: Dy(PPP)2, Kd=0.09, Kd2=7.9; Dy(TTHA), Kd1=10.66, Kd2=10.12; and Tm(DOTP), K(d1)=0.502, Kd2=4.98. The Kd values of the Ca complexes of the phosphonate and triphosphate based shift-reagents, Tm(DOTP) and Dy(PPP)2, respectively, are lower than those of the polyaminocarboxylate-based Dy(TTHA), indicating stronger Ca binding affinities for the former two types of complexes. We have also shown a positive correlation between [Ca(o)]f and left ventricular developed pressure (LVDP) in perfused rat hearts. Dy(TTHA) has shown no effect on LVDP v[Ca(o)]f. The LVDP values in the presence of the phosphonate and triphosphate based shift-reagents, however, were significantly higher than expected from the [Ca(o)]f levels alone. Thus a positive inotropic effect, independent of [Ca(o)]f, is evident in the presence of Tm(DOTP) or Dy(PPP)2. Copyright 2001 Academic Press.

Matrix Isolation and ab initio study of the noncovalent complexes between formamide and acetylene.

PubMed

Mardyukov, Artur; Sánchez-García, Elsa; Sander, Wolfram

2009-02-12

Matrix isolation spectroscopy in combination with ab initio calculations is a powerful technique for the identification of weakly bound intermolecular complexes. Here, weak complexes between formamide and acetylene are studied, and three 1:1 complexes with binding energies of -2.96, -2.46, and -1.79 kcal/mol have been found at the MP2 level of theory (MP2/cc-pVTZ + ZPE + BSSE). The two most stable dimers A and B are identified in argon and nitrogen matrices by comparison between the experimental and calculated infrared frequencies. Both complexes are stabilized by the formamide C=O...HC acetylene and H...pi interactions. Large shifts have been observed experimentally for the C-H stretching vibrations of the acetylene molecule, in very good agreement with the calculated values. Eight 1:2 FMA-acetylene trimers (T-A to T-H) with binding energies between -5.44 and -2.62 kcal/mol (MP2/aug-cc-pVDZ + ZPE + BSSE) were calculated. The two most stable trimers T-A and T-B are very close in energy and have similar infrared spectra. Several weak bands that are in agreement with the calculated frequencies of the trimers T-A and T-B are observed under matrix isolation conditions. However, the differences are too small for a definitive assignment.

Multiexcitation Fluorogenic Labeling of Surface, Intracellular, and Total Protein Pools in Living Cells

PubMed Central

2016-01-01

Malachite green (MG) is a fluorogenic dye that shows fluorescence enhancement upon binding to its engineered cognate protein, a fluorogen activating protein (FAP). Energy transfer donors such as cyanine and rhodamine dyes have been conjugated with MG to modify the spectral properties of the fluorescent complexes, where the donor dyes transfer energy through Förster resonance energy transfer to the MG complex resulting in binding-conditional fluorescence emission in the far-red region. In this article, we use a violet-excitable dye as a donor to sensitize the far-red emission of the MG-FAP complex. Two blue emitting fluorescent coumarin dyes were coupled to MG and evaluated for energy transfer to the MG-FAP complex via its secondary excitation band. 6,8-Difluoro-7-hydroxycoumarin-3-carboxylic acid (Pacific blue, PB) showed the most efficient energy transfer and maximum brightness in the far-red region upon violet (405 nm) excitation. These blue-red (BluR) tandem dyes are spectrally varied from other tandem dyes and are able to produce fluorescence images of the MG-FAP complex with a large Stokes shift (>250 nm). These dyes are cell-permeable and are used to label intracellular proteins. Used together with a cell-impermeable hexa-Cy3-MG (HCM) dye that labels extracellular proteins, we are able to visualize extracellular, intracellular, and total pools of cellular protein using one fluorogenic tag that combines with distinct dyes to effect different spectral characteristics. PMID:27159569

Analytical methods to determine the comparative DNA binding studies of curcumin-Cu(II) complexes

NASA Astrophysics Data System (ADS)

Rajesh, Jegathalaprathaban; Rajasekaran, Marichamy; Rajagopal, Gurusamy; Athappan, Periakaruppan

2012-11-01

DNA interaction studies of two mononuclear [1:1(1); 1:2(2)] copper(II) complexes of curcumin have been studied. The interaction of these complexes with CT-DNA has been explored by physical methods to propose modes of DNA binding of the complexes. Absorption spectral titrations of complex 1 with CT-DNA shows a red-shift of 3 nm with the DNA binding affinity of Kb, 5.21 × 104 M-1 that are higher than that obtained for 2 (red-shift, 2 nm; Kb, 1.73 × 104 M-1) reveal that the binding occurs in grooves as a result of the interaction is via exterior phosphates. The CD spectra of these Cu(II) complexes show a red shift of 3-10 nm in the positive band with increase in intensities. This spectral change of induced CD due to the hydrophobic interaction of copper complexes with DNA is the characteristic of B to A conformational change. The EB displacement assay also reveals the same trend as observed in UV-Vis spectral titration. The addition of complexes 1 and 2 to the DNA bound ethidium bromide (EB) solutions causes an obvious reduction in emission intensities indicating that these complexes competitively bind to DNA with EB. The positive shift of both the Epc and E0' accompanied by reduction of peak currents in differential pulse voltammogram (DPV), upon adding different concentrations of DNA to the metal complexes, are obviously in favor of strong binding to DNA. The super coiled plasmid pUC18 DNA cleavage ability of Cu(II) complexes in the presence of reducing agent reveals the single strand DNA cleavage (ssDNA) is observed. The hydroxyl radical (HOrad ) and the singlet oxygen are believed to be the reactive species responsible for the cleavage.

Periplasmic binding protein-based detection of maltose using liposomes: a new class of biorecognition elements in competitive assays.

PubMed

Edwards, Katie A; Baeumner, Antje J

2013-03-05

A periplasmic binding protein (PBP) was investigated as a novel binding species in a similar manner to an antibody in a competitive enzyme linked immunosorbent assay (ELISA), resulting in a highly sensitive and specific assay utilizing liposome-based signal amplification. PBPs are located at high concentrations (10(-4) M) between the inner and outer membranes of gram negative bacteria and are involved in the uptake of solutes and chemotaxis of bacteria toward nutrient sources. Previous sensors relying on PBPs took advantage of the change in local environment or proximity of site-specific fluorophore labels resulting from the significant conformational shift of these proteins' two globular domains upon target binding. Here, rather than monitoring conformational shifts, we have instead utilized the maltose binding protein (MBP) in lieu of an antibody in an ELISA. To our knowledge, this is the first PBP-based sensor without the requirement for engineering site-specific modifications within the protein. MBP conjugated fluorescent dye-encapsulating liposomes served to provide recognition and signal amplification in a competitive assay for maltose using amylose magnetic beads in a microtiter plate-based format. The development of appropriate binding buffers and competitive surfaces are described, with general observations expected to extend to PBPs for other analytes. The resulting assay was specific for d-(+)-maltose versus other sugar analogs including d-(+)-raffinose, sucrose, d-trehalose, d-(+)-xylose, d-fructose, 1-thio-β-d-glucose sodium salt, d-(+)-galactose, sorbitol, glycerol, and dextrose. Cross-reactivity with d-lactose and d-(+)-glucose occurred only at concentrations >10(4)-fold greater than d-(+)-maltose. The limit of detection was 78 nM with a dynamic range covering over 3 orders of magnitude. Accurate detection of maltose as an active ingredient in a pharmaceutical preparation was demonstrated. This method offers a significant improvement over existing enzymatic detection approaches that cannot discriminate between maltose and glucose and over existing fluorescence resonance energy transfer (FRET)-based detection methods that are sensitivity limited. In addition, it opens up a new strategy for the development of biosensors to difficult analytes refractory to immunological detection.

Blue- and Red-Shifting Hydrogen Bonding: A Gas Phase FTIR and Ab Initio Study of RR'CO···DCCl3 and RR'S···DCCl3 Complexes.

PubMed

Behera, B; Das, Puspendu K

2018-05-10

Blue-shifting H-bonded (C-D···O) complexes between CDCl 3 and CH 3 HCO, (CH 3 ) 2 CO, and C 2 H 5 (CH 3 )CO, and red-shifting H-bonded (C-D···S) complexes between CDCl 3 with (CH 3 ) 2 S and (C 2 H 5 ) 2 S have been identified by Fourier transform infrared spectroscopy in the gas phase at room temperature. With increasing partial pressure of the components, a new band appears in the C-D stretching region of the vibrational spectra. The intensity of this band decreases with an increase in temperature at constant pressure, which provides the basis for identification of the H-bonded bands in the spectrum. The C-D stretching frequency of CDCl 3 is blue-shifted by +7.1, +4, and +3.2 cm -1 upon complexation with CH 3 HCO, (CH 3 ) 2 CO, and C 2 H 5 (CH 3 )CO, respectively, and red-shifted by -14 and -19.2 cm -1 upon complexation with (CH 3 ) 2 S and (C 2 H 5 ) 2 S, respectively. By using quantum chemical calculations at the MP2/6-311++G** level, we predict the geometry, electronic structural parameters, binding energy, and spectral shift of H-bonded complexes between CDCl 3 and two series of compounds named RCOR' (H 2 CO, CH 3 HCO, (CH 3 ) 2 CO, and C 2 H 5 (CH 3 )CO) and RSR' (H 2 S, CH 3 HS, (CH 3 ) 2 S, and (C 2 H 5 ) 2 S) series. The calculated and observed spectral shifts follow the same trends. With an increase in basicity of the H-bond acceptor, the C-D bond length increases, force constant decreases, and the frequency shifts to the red from the blue. The potential energy scans of the above complexes are done, which show that electrostatic attraction between electropositive D and electron-rich O/S causes bond elongation and red shift, and the electronic and nuclear repulsions lead to bond contraction and blue shifts. The dominance of the two opposing forces at the equilibrium geometry of the complex determines the nature of the shift, which changes both in magnitude and in direction with the basicity of the hydrogen-bond acceptor.

Endohedral metallofullerene Sc3NC@C84: a theoretical prediction.

PubMed

Wang, Dong-Lai; Xu, Hong-Liang; Su, Zhong-Min; Xin, Guang

2012-11-21

Very recently, two novel Sc(3)NC-based cluster fullerenes Sc(3)NC@C(80) (Wang et. al. J. Am. Chem. Soc. 2010, 132, 16362) and Sc(3)NC@C(78) (Wu et. al. J. Phys. Chem. C 2011, 115, 23755) were prepared and characterized, respectively. Inspired by these findings, the possibility of encapsulating Sc(3)NC cluster in the C(84) fullerene is performed using density functional theory (DFT). Firstly, the isolated pentagon rule (IPR) D(2d) (23) C(84) fullerene is employed to encase the Sc(3)NC cluster: four possible endohedral metallofullerene isomers a-d are designed. The large binding energies (ranging from 163.7 to 210.0 kcal mol(-1)) indicate that the planar quinary cluster Sc(3)NC can be stably encapsulated in the C(84) (isomer 23) cage. Further, we consider the incorporation of Sc(3)NC into the non-IPR C(s) (51365) C(84) cage leading to isomer e and show the high stability of isomer e, which has a larger binding energy, larger HOMO-LUMO gap, higher adiabatic (vertical) ionization potential, and lower adiabatic (vertical) electron affinity than the former four Sc(3)NC@C(84) (isomer 23). Significantly, the predicted binding energy (294.2 kcal mol(-1)) of isomer e is even larger than that (289.2 and 277.7 kcal mol(-1), respectively) of the synthesized Sc(3)NC@C(80) and Sc(3)NC@C(78,) suggesting a considerable possibility for experimental realization. The (13)C NMR chemical shifts and Raman spectra of this a new endofullerene have been explored to assist future experimental characterization.

An X-ray photoelectron spectroscopy study of BF3 adsorption on positively and negatively poled LiNbO3 (0001)

NASA Astrophysics Data System (ADS)

Herdiech, M. W.; Mönig, H.; Altman, E. I.

2014-08-01

Adsorption of the strong Lewis acid BF3 was investigated to probe the sensitivity of the Lewis basicity of surface oxygens on LiNbO3 (0001) to the ferroelectric polarization direction. Adsorption and desorption were characterized by using X-ray photoelectron spectroscopy (XPS) to monitor the intensity and binding energy of the F 1s core level as a function of BF3 exposure and temperature. The results indicate that both BF3 uptake and desorption are very similar on the positively and negatively poled surfaces. In particular, BF3 only weakly adsorbs with the majority of the adsorbed BF3 desorbing below 200 K. Despite the similarities in the uptake and desorption behavior, the binding energy of the F 1s peak relative to the substrate Nb 3d5/2 peak was sensitive to the polarization direction, with the F 1s peak occurring at a binding energy up to 0.3 eV lower on positively poled than negatively poled LiNbO3 for equivalent BF3 exposures. Rather than reflecting a difference in bonding to the surface, however, this shift could be associated with oppositely oriented dipoles at the positively and negatively poled surfaces creating opposite band offsets between the adsorbate and the substrate. A similar effect was observed with lead zirconate titanate thin films where the Pb 4f XPS peak position changes as a function of temperature as a result of the pyroelectric effect which changes the magnitude of the surface and interface dipoles.

Alchemical free energy simulations for biological complexes: powerful but temperamental....

PubMed

Aleksandrov, Alexey; Thompson, Damien; Simonson, Thomas

2010-01-01

Free energy simulations compare multiple ligand:receptor complexes by "alchemically" transforming one into another, yielding binding free energy differences. Since their introduction in the 1980s, many technical and theoretical obstacles were surmounted, and the method ("MDFE," since molecular dynamics are often used) has matured into a powerful tool. We describe its current status, its effectiveness, and the challenges it faces. MDFE has provided chemical accuracy for many systems but remains expensive, with significant human overhead costs. The bottlenecks have shifted, partly due to increased computer power. To study diverse sets of ligands, force field availability and accuracy can be a major difficulty. Another difficulty is the frequent need to consider multiple states, related to sidechain protonation or buried waters, for example. Sophisticated, automated methods to sample these states are maturing, such as constant pH simulations. Meanwhile, combinations of MDFE and simpler approaches, like continuum dielectric models, can be very effective. As illustrations, we show how, with careful force field parameterization, MDFE accurately predicts binding specificities between complex tetracycline ligands and their targets. We describe substrate binding to the aspartyl-tRNA synthetase enzyme, where many distinct electrostatic states play a role, and a histidine and a Mg(2+) ion act as coupled switches that help enforce a strict preference for the aspartate substrate, relative to several analogs. Overall, MDFE has achieved a predictive status, where novel ligands can be studied and molecular recognition elucidated in depth. It should play an increasing role in the analysis of complex cellular processes and biomolecular engineering. 2009 John Wiley & Sons, Ltd.

Gel shift analysis of the empA promoter region in Vibrio anguillarum

PubMed Central

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-01-01

Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 μg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm. PMID:15516264

5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

PubMed

Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

2016-09-12

We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

Coelenterazine-v ligated to Ca2+-triggered coelenterazine-binding protein is a stable and efficient substrate of the red-shifted mutant of Renilla muelleri luciferase.

PubMed

Stepanyuk, Galina A; Unch, James; Malikova, Natalia P; Markova, Svetlana V; Lee, John; Vysotski, Eugene S

2010-10-01

It has been shown that the coelenterazine analog, coelenterazine-v, is an efficient substrate for a reaction catalyzed by Renilla luciferase. The resulting bioluminescence emission maximum is shifted to a longer wavelength up to 40 nm, which allows the use of some "yellow" Renilla luciferase mutants for in vivo imaging. However, the utility of coelenterazine-v in small-animal imaging has been hampered by its instability in solution and in biological tissues. To overcome this drawback, we ligated coelenterazine-v to Ca(2+)-triggered coelenterazine-binding protein from Renilla muelleri, which apparently functions in the organism for stabilizing and protecting coelenterazine from oxidation. The coelenterazine-v bound within coelenterazine-binding protein has revealed a greater long-term stability at both 4 and 37 °C. In addition, the coelenterazine-binding protein ligated by coelenterazine-v yields twice the total light over free coelenterazine-v as a substrate for the red-shifted R. muelleri luciferase. These findings suggest the possibility for effective application of coelenterazine-v in various in vitro assays.

Exploring the core level shift origin of sulfur and thiolates on Pd(111) surfaces.

PubMed

Salvarezza, Roberto Carlos; Carro, Pilar

2015-10-07

Thiol molecules on planar metal surfaces are widely used for building sensing and electronic devices and also as capping agents to protect and to control the size and shape of nanoparticles. In the case of Pd the thiol molecules exhibit a complex behavior because C-S bond scission is possible, resulting in a significant amount of co-adsorbed S. Therefore identification of these species on Pd is a key point for many applications, a task that is usually achieved by XPS. Here we show, from DFT calculations, that the core level shift (CLS) of the S 2p binding energy (BE) of thiol and sulfur on different thiol-Pd(111) surface models strongly depends on the adsorbed or subsurface state of sulfur atoms. Our results reflect the complexity of S 2p BE behavior and contribute to understanding and reanalyzing the experimental data of thiolated Pd surfaces.

Viking gas exchange reaction - Simulation on UV-irradiated manganese dioxide substrate

NASA Technical Reports Server (NTRS)

Blackburn, T. R.; Holland, H. D.; Ceasar, G. P.

1979-01-01

The exchange of O2 for H2O, analogous to that recorded on Mars by the Viking GEX experiment, has been observed on humidifying powdered beta-MnO2 (pyrolusite) which had been irradiated by UV in a humidified analog of the Martian atmosphere. Pyrolusite irradiated in a dry atmosphere did not release O2 on humidification. The XPS spectra of Mn and O of the reactive pyrolusite were shifted toward higher binding energies during UV irradiation. These shifts are consistent with the creation of a surface layer of a Mn(V) or Mn(VI) compound. The destruction of such a layer on humidification could account for the observed O2 release. Although manganese has not been identified in the Martian regolith, the upper limit of the Mn concentration is sufficiently high that O2 release from pyrolusite could have been responsible for the results of the Viking GEX experiment.

Oscillator strength and quantum-confined Stark effect of excitons in a thin PbS quantum disk

NASA Astrophysics Data System (ADS)

Oukerroum, A.; El-Yadri, M.; El Aouami, A.; Feddi, E.; Dujardin, F.; Duque, C. A.; Sadoqi, M.; Long, G.

2018-01-01

In this paper, we report a study of the effect of a lateral electric field on a quantum-confined exciton in a thin PbS quantum disk. Our approach was performed in the framework of the effective mass theory and adiabatic approximation. The ground state energy and the stark shift were determined by using a variational method with an adequate trial wavefunction, by investigating a 2D oscillator strength under simultaneous consideration of the geometrical confinement and the electric field strength. Our results showed a strong dependence of the exciton binding and the Stark shift on the disk dimensions in both axial and longitudinal directions. On the other hand, our results also showed that the Stark shift’s dependence on the electric field is not purely quadratic but the linear contribution is also important and cannot be neglected, especially when the confinement gets weaker.

Decoupling of epitaxial graphene via gold intercalation probed by dispersive Raman spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pillai, P. B., E-mail: p.pillai@sheffield.ac.uk, E-mail: m.desouza@sheffield.ac.uk; DeSouza, M., E-mail: p.pillai@sheffield.ac.uk, E-mail: m.desouza@sheffield.ac.uk; Narula, R.

Signatures of a superlattice structure composed of a quasi periodic arrangement of atomic gold clusters below an epitaxied graphene (EG) layer are examined using dispersive Raman spectroscopy. The gold-graphene system exhibits a laser excitation energy dependant red shift of the 2D mode as compared to pristine epitaxial graphene. The phonon dispersions in both the systems are mapped using the experimentally observed Raman signatures and a third-nearest neighbour tight binding electronic band structure model. Our results reveal that the observed excitation dependent Raman red shift in gold EG primarily arise from the modifications of the phonon dispersion in gold-graphene and showsmore » that the extent of decoupling of graphene from the underlying SiC substrate can be monitored from the dispersive nature of the Raman 2D modes. The intercalated gold atoms restore the phonon band structure of epitaxial graphene towards free standing graphene.« less

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

PubMed

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Understanding PGM-free Catalysts by Linking Density Functional Theory Calculations and Structural Analysis: Perspectives and Challenges

DOE PAGES

Gonzales, Ivana; Artyushkova, Kateryna; Atanassov, Plamen

2018-03-13

Here, we discuss perspectives and challenges in applying density functional theory for the calculation of spectroscopic properties of platinum group metal (PGM)-free electrocatalysts for oxygen reduction. More specifically, we discuss recent advances in the density functional theory calculations of core-level shifts in binding energies of N 1s electrons as measured by X-ray photoelectron spectroscopy. The link between the density functional theory calculations, the electrocatalytic performance of the catalysts, and structural analysis using modern spectroscopic techniques is expected to significantly increase our understanding of PGM-free catalysts at the molecular level.

Understanding PGM-free Catalysts by Linking Density Functional Theory Calculations and Structural Analysis: Perspectives and Challenges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzales, Ivana; Artyushkova, Kateryna; Atanassov, Plamen

Here, we discuss perspectives and challenges in applying density functional theory for the calculation of spectroscopic properties of platinum group metal (PGM)-free electrocatalysts for oxygen reduction. More specifically, we discuss recent advances in the density functional theory calculations of core-level shifts in binding energies of N 1s electrons as measured by X-ray photoelectron spectroscopy. The link between the density functional theory calculations, the electrocatalytic performance of the catalysts, and structural analysis using modern spectroscopic techniques is expected to significantly increase our understanding of PGM-free catalysts at the molecular level.

Electromagnetic Properties of Materials and Metamaterials

DTIC Science & Technology

2010-09-20

sm-meta l int e rface. The di sr e rs ion of the pri s m-Illetal asymptoticall y approaches "’:j;" where (’l"", is the plas illa frequ ency for the...nj; IOn Rd. Il an~"m Al’li , MAOI1ll -2m Klflj!\\lnn. RI mllill II llk:rM;a. MA 011121 Iktlfurd. MA Ol7l0 9. SPONSORING I MON ITORI NG AGENCY NAM E(S...etching. A 0.29 eV shift in the Ba binding energy is seen from (a) to (b) . ... ........ .......... ... ... ...... ......... ....... ..... 8 Figure 8

Effective solubilization of chalcones in micellar phase: Conductivity and voltammetric study

NASA Astrophysics Data System (ADS)

Ahmed, Safeer; Khan, Gul Tiaz; Shah, Syed Sakhawat

2013-12-01

The solubilization of four chalcones, between aqueous and micellar phases of ionic surfactants (SDS and CTAB), was investigated by conductivity and cyclic voltammetry (CV) techniques. From conductivity data, a decrease in the critical micellar concentration (CMC) of the surfactants, in presence of the chalcones was ascribed to the decreased charge density over the surfactants. The results were seconded by thermodynamic parameters including degree of ionization (α), counter ion binding (β), and standard Gibbs free energy of micellization (Δ G {m/○}). The added surfactant decreased the peak current of the oxidized chalcone and shifted the peak potential either positively (in presence of SDS) or negatively (in presence of CTAB). The effect is rationalized as chalcone-surfactant interaction and quantitated as binding constant ( K b) assorting values from 8.78 to 552.97 M-1. The preferred solubilization of the chalcones in the micellar phase has been inferred.

A molecular dynamics study of chloride binding by the cryptand SC24

NASA Technical Reports Server (NTRS)

Owenson, B.; MacElroy, R. D.; Pohorille, A.

1988-01-01

The capture of chloride from water by the tetraprotonated form of the spherical macrotricyclic molecule SC24 was studied using molecular dynamics simulation methods. This model ionophore represents a broad class of molecules which remove ions from water. Two binding sites for the chloride were found, one inside and one outside the ligand. These sites are separated by a potential energy barrier of approximately 20 kcal mol-1. The major contribution to this barrier comes from dehydration of the chloride. The large, unfavorable dehydration effect is compensated for by an increase in electrostatic attraction between the oppositely charged chloride and cryptand, and by energetically favorable rearrangements of water structure. Additional assistance in crossing the barrier and completing the dehydration of the ion is provided by the shift of three positively charged hydrogen atoms of the cryptand towards the chloride. This structural rigidity is partially responsible for its selectivity.

Characterization of the free-energy landscapes of proteins by NMR-guided metadynamics

PubMed Central

Granata, Daniele; Camilloni, Carlo; Vendruscolo, Michele; Laio, Alessandro

2013-01-01

The use of free-energy landscapes rationalizes a wide range of aspects of protein behavior by providing a clear illustration of the different states accessible to these molecules, as well as of their populations and pathways of interconversion. The determination of the free-energy landscapes of proteins by computational methods is, however, very challenging as it requires an extensive sampling of their conformational spaces. We describe here a technique to achieve this goal with relatively limited computational resources by incorporating nuclear magnetic resonance (NMR) chemical shifts as collective variables in metadynamics simulations. As in this approach the chemical shifts are not used as structural restraints, the resulting free-energy landscapes correspond to the force fields used in the simulations. We illustrate this approach in the case of the third Ig-binding domain of protein G from streptococcal bacteria (GB3). Our calculations reveal the existence of a folding intermediate of GB3 with nonnative structural elements. Furthermore, the availability of the free-energy landscape enables the folding mechanism of GB3 to be elucidated by analyzing the conformational ensembles corresponding to the native, intermediate, and unfolded states, as well as the transition states between them. Taken together, these results show that, by incorporating experimental data as collective variables in metadynamics simulations, it is possible to enhance the sampling efficiency by two or more orders of magnitude with respect to standard molecular dynamics simulations, and thus to estimate free-energy differences among the different states of a protein with a kBT accuracy by generating trajectories of just a few microseconds. PMID:23572592

Determination of human serum albumin using an intramolecular charge transfer fluorescence probe: 4'-dimethylamino-2,5-dihydroxychalcone.

PubMed

Xu, Zhicheng; Yang, Weibing; Dong, Chuan

2005-09-15

A new intramolecular charge transfer fluorescence probe, namely, 4'-dimethylamino-2,5-dihydroxychalcone (DMADHC), exhibited dramatic enhancement of fluorescence intensity with an accompanying blue shift of the emission maximum when the concentration of human serum albumin (HSA) was increased. Binding to HSA also caused a progressive shift in the absorption spectrum of DMADHC, and a clear isosbestic point appeared. The binding site number and binding constant were calculated. Thermodynamic parameters were given and possible binding site was speculated. The optimum conditions for the determination of HSA were also investigated. A new, fast, and simple spectrofluorimetric method for the determination of HSA was developed. In the detection of HSA in samples of human plasma, this method gave values close to that of the Erythrosin B method.

Targeted mutations and MD simulations of a methanol-stable lipase YLIP9 from Yarrowia lipolytica MSR80 to develop a biodiesel enzyme.

PubMed

Syal, Poonam; Verma, Ved Vrat; Gupta, Rani

2017-11-01

Biodiesel, an environment friendly alternative for fuels, contains methyl esters of long-chain fatty acids. Our group has reported a methanol-stable YLIP9 from Yarrowia lipolytica MSR80 that shows poor catalysis of long-chain fatty acids. To shift its substrate specificity, residues within lid and binding pocket were identified for sequential mutations using YLIP2 as the template. Of the two point mutations (Glu116Leu and Ser119Val) introduced in the lid, the former mutation (YLIP9L1) increased the catalytic rate by ∼2-fold without any change in substrate specificity. In this mutant, six binding pocket residues (Bp2-Bp7) were further mutated to obtain six double mutants. YLIP9L1Bp3 showed significant shift in substrate specificity towards long-chain pNPesters with 11-fold increase in catalytic efficiency than YLIP9. Double mutations also led to increased thermostability and lowered activation energy of YLIP9L1Bp3 thereby shifting its optimum temperature from 60°C to 50°C. In silico molecular dynamics simulations revealed improved lid flexibility and increased catalytic triad volume in YLIP9L1Bp3. The enzyme YLIP9L1Bp3 was methanol-stable having selectivity for long-chain fatty acids with improved catalytic efficiency. Its application as a biodiesel enzyme was validated by transesterification of palm oil in presence of methanol, where it showed 8-fold increase in conversion of oil to methyl esters. Copyright © 2017 Elsevier B.V. All rights reserved.

Auger parameter and Wagner plot studies of small copper clusters

NASA Astrophysics Data System (ADS)

Moretti, Giuliano; Palma, Amedeo; Paparazzo, Ernesto; Satta, Mauro

2016-04-01

We discuss application of the Auger parameter and Wagner plot concepts to the study of small copper clusters deposited on various supports such as C(graphite), SiO2 and Al2O3. We demonstrate that the cluster size and the electronic properties of the support influence the shifts of both the binding energy of the Cu 2p3/2 transition and the kinetic energy of the Cu L3M45M45; 1G Auger transition. We find that the Cu L3M45M45; 1G-2p3/2 Auger parameter and Wagner plot allow one to single out and measure both initial- and final-state effects with a detail which is superior to that achieved in photoemission studies.

Effect of periodic potential on exciton states in semiconductor carbon nanotubes

DOE PAGES

Roslyak, Oleksiy; Piryatinski, Andrei

2016-05-28

Here we develop a theoretical background to treat exciton states in semiconductor single-walled carbon nanotubes (SWCNTs) in the presence of a periodic potential induced by a surface acoustic wave (SAW) propagating along SWCNT. The formalism accounts for the electronic band splitting into the Floquet subbands induced by the Bragg scattering on the SAW potential. Optical transitions between the Floquet states and correlated electron–hole pairs (excitons) are numerically examined. Formation of new van Hove singularities within the edges of Floquet sub-bands and associated transfer of the exciton oscillator strengths resulting in the photoluminescence quenching are predicted. The simulations demonstrate the excitonmore » energy red Stark shift and reduction in the exciton binding energy. We provide comparison of our results with reported theoretical and experimental studies.« less

Chiral Three-Nucleon Interactions in Light Nuclei, Neutron-α Scattering, and Neutron Matter

DOE PAGES

Lynn, J. E.; Tews, I.; Carlson, Joseph Allen; ...

2016-02-09

Here we present quantum Monte Carlo calculations of light nuclei, neutron- scattering, and neutron matter using local two- and three-nucleon (3N) interactions derived from chiral e effective fi eld theory up to next-to-next-to-leading order (N 2LO). The two undetermined 3N low-energy couplings are fi t to the 4He binding energy and, for the first time, to the spin-orbit splitting in the neutron- P-wave phase shifts. Furthermore, we investigate different choices of local 3N-operator structures and find that chiral interactions at N 2LO are able to simultaneously reproduce the properties of A = 3; 4; 5 systems and of neutron matter,more » in contrast to commonly used phenomenological 3N interactions.« less

Chiral Three-Nucleon Interactions in Light Nuclei, Neutron-α Scattering, and Neutron Matter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lynn, J. E.; Tews, I.; Carlson, Joseph Allen

Here we present quantum Monte Carlo calculations of light nuclei, neutron- scattering, and neutron matter using local two- and three-nucleon (3N) interactions derived from chiral e effective fi eld theory up to next-to-next-to-leading order (N 2LO). The two undetermined 3N low-energy couplings are fi t to the 4He binding energy and, for the first time, to the spin-orbit splitting in the neutron- P-wave phase shifts. Furthermore, we investigate different choices of local 3N-operator structures and find that chiral interactions at N 2LO are able to simultaneously reproduce the properties of A = 3; 4; 5 systems and of neutron matter,more » in contrast to commonly used phenomenological 3N interactions.« less

Characterizing the binding interaction between antimalarial artemether (AMT) and bovine serum albumin (BSA): Spectroscopic and molecular docking methods.

PubMed

Shi, Jie-Hua; Pan, Dong-Qi; Wang, Xiou-Xiou; Liu, Ting-Ting; Jiang, Min; Wang, Qi

2016-09-01

Artemether (AMT), a peroxide sesquiterpenoides, has been widely used as an antimalarial for the treatment of multiple drug-resistant strains of plasmodium falciparum malaria. In this work, the binding interaction of AMT with bovine serum albumin (BSA) under the imitated physiological conditions (pH7.4) was investigated by UV spectroscopy, fluorescence emission spectroscopy, synchronous fluorescence spectroscopy, Fourier transform infrared spectroscopy (FT-IR), circular dichroism (CD), three-dimensional fluorescence spectroscopy and molecular docking methods. The experimental results indicated that there was a change in UV absorption of BSA along with a slight red shift of absorption wavelength, indicating that the interaction of AMT with BSA occurred. The intrinsic fluorescence of BSA was quenched by AMT due to the formation of AMT-BSA complex. The number of binding sites (n) and binding constant of AMT-BSA complex were about 1 and 2.63×10(3)M(-1) at 298K, respectively, suggesting that there was stronger binding interaction of AMT with BSA. Based on the analysis of the signs and magnitudes of the free energy change (ΔG(0)), enthalpic change (ΔH(0)) and entropic change (ΔS(0)) in the binding process, it can be concluded that the binding of AMT with BSA was enthalpy-driven process due to |ΔH°|>|TΔS°|. The results of experiment and molecular docking confirmed the main interaction forces between AMT and BSA were van der Waals force. And, there was a slight change in the BSA conformation after binding AMT but BSA still retains its secondary structure α-helicity. However, it had been confirmed that AMT binds on the interface between sub-domain IIA and IIB of BSA. Copyright © 2016 Elsevier B.V. All rights reserved.

Photonic crystal borax competitive binding carbohydrate sensing motif†

PubMed Central

Cui, Qingzhou; Muscatello, Michelle M. Ward; Asher, Sanford A.

2009-01-01

We developed a photonic crystal sensing method for diol containing species such as carbohydrates based on a poly(vinyl alcohol) (PVA) hydrogel containing an embedded crystalline colloidal array (CCA). The polymerized CCA (PCCA) diffracts visible light. We show that in the presence of borax the diffraction wavelength shifts as the concentration of glucose changes. The diffraction shifts result from the competitive binding of glucose to borate, which reduces the concentration of borate bound to the PVA diols. PMID:19381378

Iii-V Compound Multiple Quantum Well Based Modulator and Switching Devices.

NASA Astrophysics Data System (ADS)

Hong, Songcheol

A general formalism to study the absorption and photocurrent in multiple quantum well is provided with detailed consideration of quantum confined Stark shift, exciton binding energy, line broadening, tunneling, polarization, and strain effects. Results on variation of exciton size, binding energies and transition energies as a function electric field and well size have been presented. Inhomogeneous line broadening of exciton lines due to interface roughness, alloy disorder and well to well size fluctuation is calculated. The potential of material tailoring by introducing strain for specific optical response is discussed. Theoretical and experimental results on excitonic and band-to-band absorption spectra in strained multi-quantum well structures are shown. I also report on polarization dependent optical absorption for excitonic and interband transitions in lattice matched and strained multiquantum well structures in presence of transverse electric field. Photocurrent in a p-i(MQW)-n diode with monochromatic light is examined with respect to different temperatures and intensities. The negative resistance of I-V characteristic of the p-i-n diode is based on the quantum confined Stark effect of the heavy hole excitonic transition in a multiquantum well. This exciton based photocurrent characteristic allows efficient switching. A general purpose low power optical logic device using the controller-modulator concept bas been proposed and realized. The controller is a heterojunction phototransistor with multiquantum wells in the base-collector depletion region. This allows an amplified photocurrent controlled voltage feedback with low light intensity levels. Detailed analysis of the sensitivity of this device in various modes of operation is studied. Studies are also presented on the cascadability of the device as well as its integrating -thresholding properties. A multiquantum well heterojunction bipolar transistor (MHBT), which has N^+ -p^+-i(MQW)-N structure has been fabricated to test the concept. Gain (>30) is obtained in the MBE grown devices and efficient switching occurs due to the amplification of the exciton based photocurrent. The level shift operation of the base contacted MHBT are demonstrated.

Structure-based drug design enables conversion of a DFG-in binding CSF-1R kinase inhibitor to a DFG-out binding mode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meyers, Marvin J.; Pelc, Matthew; Kamtekar, Satwik

2010-08-11

The work described herein demonstrates the utility of structure-based drug design (SBDD) in shifting the binding mode of an HTS hit from a DFG-in to a DFG-out binding mode resulting in a class of novel potent CSF-1R kinase inhibitors suitable for lead development.

Binding Isotherms and Time Courses Readily from Magnetic Resonance.

PubMed

Xu, Jia; Van Doren, Steven R

2016-08-16

Evidence is presented that binding isotherms, simple or biphasic, can be extracted directly from noninterpreted, complex 2D NMR spectra using principal component analysis (PCA) to reveal the largest trend(s) across the series. This approach renders peak picking unnecessary for tracking population changes. In 1:1 binding, the first principal component captures the binding isotherm from NMR-detected titrations in fast, slow, and even intermediate and mixed exchange regimes, as illustrated for phospholigand associations with proteins. Although the sigmoidal shifts and line broadening of intermediate exchange distorts binding isotherms constructed conventionally, applying PCA directly to these spectra along with Pareto scaling overcomes the distortion. Applying PCA to time-domain NMR data also yields binding isotherms from titrations in fast or slow exchange. The algorithm readily extracts from magnetic resonance imaging movie time courses such as breathing and heart rate in chest imaging. Similarly, two-step binding processes detected by NMR are easily captured by principal components 1 and 2. PCA obviates the customary focus on specific peaks or regions of images. Applying it directly to a series of complex data will easily delineate binding isotherms, equilibrium shifts, and time courses of reactions or fluctuations.

Orientation-dependent surface core-level shifts and chemical shifts on clean and H 2S-covered GaAs

NASA Astrophysics Data System (ADS)

Ranke, W.; Finster, J.; Kuhr, H. J.

1987-08-01

Photoelectron spectra of the As 3d and Ga 3d core levels were studied in situ on a cylindrically shaped GaAs single crystal for the six inequivalent orientations (001), (113), (111), (110), (11¯1) and (11¯3). On the clean surface, prepared by molecular beam epitaxy (MBE), surface core levels are shifted by 0.25 to 0.55 eV towards smaller binding energy (BE) for As 3d and -0.25 to -0.35 eV towards higher BE for Ga, depending on orientation. Additional As causes As 3d contributions shifted between -0.45 and -0.7 eV towards higher BE. The position and intensity of them is influenced by H 2S adsorption. At 150 K, H 2S adsorbs preferentially on As sites. As chemical shifts appear at -0.6 to -0.9 eV towards higher BE. Simultaneously, As accumulation occurs on all orientations with the exception of (110). High temperature adsorption (550 K, 720 K) influences mainly the Ga 3d peaks. Two peaks shifted by about -0.45 and -0.8 eV towards higher Be were found which are attributed to Ga atoms with one or two sulfur ligands, respectively. At 720 K, also As depletion is observed. The compatibility of surface core-level positions and intensities with recent structural models for the (111) and (11¯1) surfaces is discussed.

The allosteric switching mechanism in bacteriophage MS2

NASA Astrophysics Data System (ADS)

Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F.

2016-07-01

We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we use all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.

The allosteric switching mechanism in bacteriophage MS2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perkett, Matthew R.; Mirijanian, Dina T.; Hagan, Michael F., E-mail: hagan@brandeis.edu

2016-07-21

We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we usemore » all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates.« less

The allosteric switching mechanism in bacteriophage MS2

PubMed Central

Perkett, Matthew R.; Mirijanian, Dina T.

2016-01-01

We use all-atom simulations to elucidate the mechanisms underlying conformational switching and allostery within the coat protein of the bacteriophage MS2. Assembly of most icosahedral virus capsids requires that the capsid protein adopts different conformations at precise locations within the capsid. It has been shown that a 19 nucleotide stem loop (TR) from the MS2 genome acts as an allosteric effector, guiding conformational switching of the coat protein during capsid assembly. Since the principal conformational changes occur far from the TR binding site, it is important to understand the molecular mechanism underlying this allosteric communication. To this end, we use all-atom simulations with explicit water combined with a path sampling technique to sample the MS2 coat protein conformational transition, in the presence and absence of TR-binding. The calculations find that TR binding strongly alters the transition free energy profile, leading to a switch in the favored conformation. We discuss changes in molecular interactions responsible for this shift. We then identify networks of amino acids with correlated motions to reveal the mechanism by which effects of TR binding span the protein. We find that TR binding strongly affects residues located at the 5-fold and quasi-sixfold interfaces in the assembled capsid, suggesting a mechanism by which the TR binding could direct formation of the native capsid geometry. The analysis predicts amino acids whose substitution by mutagenesis could alter populations of the conformational substates or their transition rates. PMID:27448905

Contributions of the Histidine Side Chain and the N-terminal α-Amino Group to the Binding Thermodynamics of Oligopeptides to Nucleic Acids as a Function of pH

PubMed Central

Ballin, Jeff D.; Prevas, James P.; Ross, Christina R.; Toth, Eric A.; Wilson, Gerald M.; Record, M. Thomas

2010-01-01

Interactions of histidine with nucleic acid phosphates and histidine pKa shifts make important contributions to many protein-nucleic acid binding processes. To characterize these phenomena in simplified systems, we quantified binding of a histidine-containing model peptide HWKK (+NH3-His-Trp-Lys-Lys-NH2) and its lysine analog KWKK (+NH3-Lys-Trp-Lys-Lys-NH2) to a single-stranded RNA model, polyuridylate (polyU), by changes in tryptophan fluorescence as a function of salt concentration and pH. For both HWKK and KWKK, equilibrium binding constants, Kobs, and magnitudes of log-log salt derivatives SKobs ≡ (∂logKobs/∂log[Na+]), decreased with increasing pH in the manner expected for a titration curve model in which deprotonation of the histidine and α-amino groups weakens binding and reduces its salt-dependence. Fully protonated HWKK and KWKK exhibit the same Kobs and SKobs within uncertainty, and these SKobs values are consistent with limiting-law polyelectrolyte theory for +4 cationic oligopeptides binding to single-stranded nucleic acids. The pH-dependence of HWKK binding to polyU provides no evidence for pKa shifts nor any requirement for histidine protonation, in stark contrast to the thermodynamics of coupled protonation often seen for these cationic residues in the context of native protein structure where histidine protonation satisfies specific interactions (e.g., salt-bridge formation) within highly complementary binding interfaces. The absence of pKa shifts in our studies indicates that additional Coulombic interactions across the nonspecific-binding interface between RNA and protonated histidine or the α-amino group are not sufficient to promote proton uptake for these oligopeptides. We present our findings in the context of hydration models for specific versus nonspecific nucleic acid binding. PMID:20108951

Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

ERIC Educational Resources Information Center

Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai

2010-01-01

The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

Molecular docking and structural analysis of non-opioid analgesic drug acemetacin with halogen substitution: A DFT approach

NASA Astrophysics Data System (ADS)

Leenaraj, D. R.; Manimaran, D.; Joe, I. Hubert

2016-11-01

Acemetacin is a non-opioid analgesic which belongs to the class, the non-steroidal anti-inflammatory drug. The bioactive conformer was identified through potential energy surface scan studies. Spectral features of acemetacin have been probed by the techniques of Fourier transform infrared, Raman and Nuclear magnetic resonance combined with density functional theory calculations at the B3LYP level with 6-311 + G(d,p) basis set. The detailed interpretation of vibrational spectral assignments has been carried out on the basis of potential energy distribution method. Geometrical parameters reveal that the carbonyl substitution in between chlorophenyl and indole ring leads to a significant loss of planarity. The red-shifted Cdbnd O stretching wavenumber describe the conjugation between N and O atoms. The shifted Csbnd H stretching wavenumbers of Osbnd CH3 and Osbnd CH2 groups depict the back-donation and induction effects. The substitution of halogen atoms on the title molecule influences the charge distribution and the geometrical parameters. Drug activity and binding affinity of halogen substitution in title molecule with target protein were undertaken by molecular docking study. This study enlightens the effects of bioefficiency due to the halogen substitution in the molecule.

Determination of the Stoichiometry between α- and γ1 Subunits of the BK Channel Using LRET.

PubMed

Carrasquel-Ursulaez, Willy; Alvarez, Osvaldo; Bezanilla, Francisco; Latorre, Ramon

2018-06-05

Two families of accessory proteins, β and γ, modulate BK channel gating and pharmacology. Notably, in the absence of internal Ca 2+ , the γ1 subunit promotes a large shift of the BK conductance-voltage curve to more negative potentials. However, very little is known about how α- and γ1 subunits interact. In particular, the association stoichiometry between both subunits is unknown. Here, we propose a method to answer this question using lanthanide resonance energy transfer. The method assumes that the kinetics of lanthanide resonance energy transfer-sensitized emission of the donor double-labeled α/γ1 complex is the linear combination of the kinetics of the sensitized emission in single-labeled complexes. We used a lanthanide binding tag engineered either into the α- or the γ1 subunits to bind Tb +3 as the donor. The acceptor (BODIPY) was attached to the BK pore-blocker iberiotoxin. We determined that γ1 associates with the α-subunit with a maximal 1:1 stoichiometry. This method could be applied to determine the stoichiometry of association between proteins within heteromultimeric complexes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Hydrogen bonding in hydrates with one acetic acid molecule.

PubMed

Pu, Liang; Sun, Yueming; Zhang, Zhibing

2010-10-14

Hydrogen bonding (H-bond) interaction significantly influences the separation of acetic acid (HAc) from the HAc/H(2)O mixtures, especially the dilute solution, in distillation processes. It has been examined from the HAc mono-, di-, tri-, and tetrahydrates by analyzing the structures, binding energies, and infrared vibrational frequencies from quantum chemical calculations. For the first coordinate shell the 6-membered head-on ring is surely the most favorable structure because it has (1) the most favorable H-bonding parameters, (2) almost the largest binding energy per H-bond, (3) the biggest wavenumber shifts, and (4) the highest ring distribution (the AIMD simulations). Moreover, the comparison of the calculations with the experiments (the X-ray scattering data and IR frequencies) suggests that the possible structures in dilute aqueous solution are those involving two or more coordinate shells. The H-bonding in these water-surrounded HAc hydrates are the origin of the low-efficiency problem of isolating HAc from the dilute HAc/H(2)O mixtures. It is apparently a tougher work to break the H-bonds among HAc and the surrounded H(2)O molecules with respect to the case of more concentrated solutions, where the dominant structures are HAc or H(2)O aggregates.

Electronic properties and bonding in Zr Hx thin films investigated by valence-band x-ray photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Magnuson, Martin; Schmidt, Susann; Hultman, Lars; Högberg, Hans

2017-11-01

The electronic structure and chemical bonding in reactively magnetron sputtered Zr Hx (x =0.15 , 0.30, 1.16) thin films with oxygen content as low as 0.2 at.% are investigated by 4d valence band, shallow 4p core-level, and 3d core-level x-ray photoelectron spectroscopy. With increasing hydrogen content, we observe significant reduction of the 4d valence states close to the Fermi level as a result of redistribution of intensity toward the H 1s-Zr 4d hybridization region at ˜6 eV below the Fermi level. For low hydrogen content (x =0.15 , 0.30), the films consist of a superposition of hexagonal closest-packed metal (α phase) and understoichiometric δ -Zr Hx (Ca F2 -type structure) phases, while for x =1.16 , the films form single-phase Zr Hx that largely resembles that of stoichiometric δ -Zr H2 phase. We show that the cubic δ -Zr Hx phase is metastable as thin film up to x =1.16 , while for higher H contents the structure is predicted to be tetragonally distorted. For the investigated Zr H1.16 film, we find chemical shifts of 0.68 and 0.51 eV toward higher binding energies for the Zr 4 p3 /2 and 3 d5 /2 peak positions, respectively. Compared to the Zr metal binding energies of 27.26 and 178.87 eV, this signifies a charge transfer from Zr to H atoms. The change in the electronic structure, spectral line shapes, and chemical shifts as a function of hydrogen content is discussed in relation to the charge transfer from Zr to H that affects the conductivity by charge redistribution in the valence band.

Theoretical study of hydrogen bond interactions of fluvastatin with ι-carrageenan and λ-carrageenan.

PubMed

Papadopoulos, Anastasios G; Sigalas, Michael P

2011-07-01

The binding of the reductase inhibitor drug fluvastatin, hydroxy-3-methylglutaryl coenzyme A, with the hydrophilic ι- or λ-carrageenan polymers, serving as potential controllers of the drug's release rate, have been studied at the density functional level of theory with the B3LYP exchange correlation functional. Three low energy conformers of fluvastatin have been calculated. The vibrational spectroscopic properties calculated for the most stable conformer were in satisfactory agreement with the experimental data. A series of hydrogen bonded complexes of the most stable conformer of fluvastatin anion with low molecular weight models of the polymers have been fully optimized. In almost all, intermolecular H-bonds are formed between the sulfate groups of ι- or λ-carrageenan and fluvastatin's hydroxyls, resulting in a red shift of the fluvastatin's O - H stretching vibrations. Cooperative intramolecular H-bonds within fluvastatin or ι-, λ-carrageenan are also present. The BSSE and ZPE corrected interaction energies were estimated in the range 281-318 kJ mol⁻¹ for ι-carrageenan - fluvastatin and 145-200 kJ mol⁻¹ for λ-carrageenan - fluvastatin complexes. The electron density (ρ (bcp)) and Laplacian (∇²ρ (bcp)) properties at critical points of the intermolecular hydrogen bonds, estimated by AIM (atoms in molecules) calculations, have a low and positive character (∇²ρ(bcp) > 0), consistent with the electrostatic character of the hydrogen bonds. The structural and energetic data observed, as well as the extent of the red shift of the fluvastatin's O - H stretching vibrations upon complex formation and the properties of electron density show a stronger binding of fluvastatin to ι- than to λ-carrageenan.

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

PubMed

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is found as the side chain of the rhamnogalacturonan type I complex in pectin, has remained partially studied. Here, we investigated the galactan utilization system consisting of the ganSPQAB operon and its regulator ganR This study improves our knowledge of the carbohydrate degradation systems of B. subtilis, especially the pectin degradation systems. Moreover, the galactan-degrading enzymes may be exploited for the production of galacto-oligosaccharides, which are used as prebiotic substances in the food industry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

NASA Astrophysics Data System (ADS)

Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

2017-10-01

We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA complex.

Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations

PubMed Central

Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M.

2011-01-01

The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on λ -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

Conformational Changes in IpaD from Shigella flexneri Upon Binding Bile Salts Provide Insight into the Second Step of Type III Secretion†

PubMed Central

Dickenson, Nicholas E.; Zhang, Lingling; Epler, Chelsea R.; Adam, Philip R.; Picking, Wendy L.; Picking, William D.

2011-01-01

Shigella flexneri uses its type III secretion apparatus (TTSA) to inject host-altering proteins into targeted eukaryotic cells. The TTSA is composed of a basal body and an exposed needle with invasion plasmid antigen D (IpaD) forming a tip complex that controls secretion. The bile salt deoxycholate (DOC) stimulates recruitment of the translocator protein IpaB into the maturing TTSA needle tip complex. This process appears to be triggered by a direct interaction between DOC and IpaD. Fluorescence spectroscopy and NMR spectroscopy are used here to confirm the DOC-IpaD interaction and to reveal that IpaD conformational changes upon DOC binding trigger the appearance of IpaB at the needle tip. Förster resonance energy transfer between specific sites on IpaD was used here to identify changes in distances between IpaD domains as a result of DOC binding. To further explore the effects of DOC binding on IpaD structure, NMR chemical shift mapping was employed. The environments of residues within the proposed DOC binding site and additional residues within the “distal” globular domain were perturbed upon DOC binding, further indicating that conformational changes occur within IpaD upon DOC binding. These events are proposed to be responsible for the recruitment of IpaB at the TTSA needle tip. Mutation analyses combined with additional spectroscopic analyses confirms that conformational changes in IpaD induced by DOC binding contribute to the recruitment of IpaB to the S. flexneri TTSA needle tip. These findings lay the foundation for determining how environmental factors promote TTSA needle tip maturation prior to host cell contact. PMID:21126091

How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

PubMed

Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

2015-06-09

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

Protein Structure Determination from Pseudocontact Shifts Using ROSETTA

PubMed Central

Schmitz, Christophe; Vernon, Robert; Otting, Gottfried; Baker, David; Huber, Thomas

2013-01-01

Paramagnetic metal ions generate pseudocontact shifts (PCSs) in nuclear magnetic resonance spectra that are manifested as easily measurable changes in chemical shifts. Metals can be incorporated into proteins through metal binding tags, and PCS data constitute powerful long-range restraints on the positions of nuclear spins relative to the coordinate system of the magnetic susceptibility anisotropy tensor (Δχ-tensor) of the metal ion. We show that three-dimensional structures of proteins can reliably be determined using PCS data from a single metal binding site combined with backbone chemical shifts. The program PCS-ROSETTA automatically determines the Δχ-tensor and metal position from the PCS data during the structure calculations, without any prior knowledge of the protein structure. The program can determine structures accurately for proteins of up to 150 residues, offering a powerful new approach to protein structure determination that relies exclusively on readily measurable backbone chemical shifts and easily discriminates between correctly and incorrectly folded conformations. PMID:22285518

Kinetics and equilibria of cyanide binding to prostaglandin H synthase.

PubMed

MacDonald, I D; Dunford, H B

1989-09-01

Cyanide binding to prostaglandin H (PGH) synthase results in a spectral shift in the Soret region. This shift was exploited to determine equilibrium and kinetic parameters of the cyanide binding process. At pH 8.0, ionic strength 0.22 M, 4 degrees C, the cyanide dissociation constant, determined from equilibrium experiments, is (65 +/- 10) microM. The binding rate constant is (2.8 +/- 0.2) x 10(3) M-1 s-1, and the dissociation rate constant is zero within experimental error. Through a kinetic study of the binding process as a function of pH, from pH 3.96 to 8.00, it was possible to determine the pKa of a heme-linked acid group on the enzyme of 4.15 +/- 0.10 with citrate buffer. An apparent pKa of 4.75 +/- 0.03 was determined with acetate buffer; this different value is attributed to complexation of the enzyme with one of the components of the acetate buffer.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

New template family for the detection of gravitational waves from comparable-mass black hole binaries

NASA Astrophysics Data System (ADS)

Porter, Edward K.

2007-11-01

In order to improve the phasing of the comparable-mass waveform as we approach the last stable orbit for a system, various resummation methods have been used to improve the standard post-Newtonian waveforms. In this work we present a new family of templates for the detection of gravitational waves from the inspiral of two comparable-mass black hole binaries. These new adiabatic templates are based on reexpressing the derivative of the binding energy and the gravitational wave flux functions in terms of shifted Chebyshev polynomials. The Chebyshev polynomials are a useful tool in numerical methods as they display the fastest convergence of any of the orthogonal polynomials. In this case they are also particularly useful as they eliminate one of the features that plagues the post-Newtonian expansion. The Chebyshev binding energy now has information at all post-Newtonian orders, compared to the post-Newtonian templates which only have information at full integer orders. In this work, we compare both the post-Newtonian and Chebyshev templates against a fiducially exact waveform. This waveform is constructed from a hybrid method of using the test-mass results combined with the mass dependent parts of the post-Newtonian expansions for the binding energy and flux functions. Our results show that the Chebyshev templates achieve extremely high fitting factors at all post-Newtonian orders and provide excellent parameter extraction. We also show that this new template family has a faster Cauchy convergence, gives a better prediction of the position of the last stable orbit and in general recovers higher Signal-to-Noise ratios than the post-Newtonian templates.

Host-guest chemistry of dendrimer-drug complexes. 4. An in-depth look into the binding/encapsulation of guanosine monophosphate by dendrimers.

PubMed

Hu, Jingjing; Fang, Min; Cheng, Yiyun; Zhang, Jiahai; Wu, Qinglin; Xu, Tongwen

2010-06-03

In the present study, we investigated the host-guest chemistry of dendrimer/guanosine monophosphate (GMP) and present an in-depth look into the binding/encapsulation of GMP by dendrimers using NMR studies. (1)H NMR spectra showed a significant downfield shift of methylene protons in the outmost layer of the G5 dendrimer, indicating the formation of ion pairs between cationic amine groups of dendrimer and anionic phosphate groups of GMP. Chemical shift titration results showed that the binding constant between G5 dendrimer and GMP is 17,400 M(-1) and each G5 dendrimer has 107 binding sites. The binding of GMP to dendrimers prevents its aggregation in aqueous solutions and thereby enhances its stability. Nuclear Overhauser effect measurements indicated that a GMP binding and encapsulation balance occurs on the surface and in the interior of dendrimer. The binding/encapsulation transitions can be easily tailored by altering the surface and interior charge densities of the dendrimer. All these findings provide a new insight into the host-guest chemistry of dendrimer/guest complexes and may play important roles in the study of dendrimer/DNA aggregates by a "bottom-up" strategy.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Characterization of high affinity (/sup 3/H)triazolam binding in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earle, M.; Concas, A.; Yamamura, H.I.

1986-03-01

The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on (/sup 3/H)TZ binding. Saturation studies showed a shift to lower affinity at 37/sup 0/C (K/sub d/ = 0.25 +/- 0.01 nM at O/sup 0/C; K/sub d/ = 1.46 +/- 0.03 nM at 37/sup 0/C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. atmore » 0/sup 0/C and 1001 +/- 43 fmoles/mg prot. at 37/sup 0/C). Inhibition studies showed that (/sup 3/H)TZ binding displayed no GABA shift at 0/sup 0/C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37/sup 0/C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37/sup 0/C. In Ro 15-1788/(/sup 3/H)TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on (/sup 3/H)TZ binding at both temperatures. In conclusion (/sup 3/H)TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists.« less

Tautomeric preferences of the cis and trans isomers of axitinib

NASA Astrophysics Data System (ADS)

Mirzaei, M. Saeed; Taherpour, Avat Arman

2018-05-01

The tautomeric preferences of axitinib, a potent anticancer drug, as tyrosine kinase inhibitor have been investigated using quantum chemical calculations and docking methods. The energy differences between the two tautomers of trans-isomer are around 4 and 3 kcal mol-1 in vacuo and water, respectively, and for its cis-isomer (major photochemical isomerization product) this equilibrium reversed completely in favour of the second tautomer (not considered previously), which is about 7-8 kcal mol-1 more stable in both gas and aqueous media. The results indicate a very high activation energy for proton exchange for both [1,2] and [1,5] H-shift (around 50 kcal mol-1) in the gas phase, but inclusion of protic solvents (e.g. water) decrease this barrier to around 14 and 35 kcal mol-1 for the both hydrogen shift processes, respectively. In order to have better insight about the electronic structure of axitinib tautomers, the NBO, HOMO-LUMO, NICS and molecular electrostatic potential surfaces (MESP) calculations have been carried out. Docking investigations on the two more stable tautomers revealed that binding of the trans isomer of tautomer I to the active site of the receptor is the most favourable in the terms of energy and structure. This more stability could be attributed to the more hydrogen bonding of this tautomer with the protein residues in comparison to the second tautomer.

In Situ Soft X-ray Spectromicroscopy of Early Tricalcium Silicate Hydration

DOE PAGES

Bae, Sungchul; Kanematsu, Manabu; Hernandez-Cruz, Daniel; ...

2016-12-01

The understanding and control of early hydration of tricalcium silicate (C 3S) is of great importance to cement science and concrete technology. However, traditional characterization methods are incapable of providing morphological and spectroscopic information about in situ hydration at the nanoscale. Using soft X-ray spectromicroscopy, we report the changes in morphology and molecular structure of C 3S at an early stage of hydration. In situ C 3S hydration in a wet cell, beginning with induction (~1 h) and acceleration (~4 h) periods of up to ~8 h, was studied and compared with ex situ measurements in the deceleration period aftermore » 15 h of curing. Analysis of the near-edge X-ray absorption fine structure showed that the Ca binding energy and energy splitting of C 3S changed rapidly in the early age of hydration and exhibited values similar to calcium silicate hydrate (C–S–H). The formation of C–S–H nanoseeds in the C 3S solution and the development of a fibrillar C–S–H morphology on the C 3S surface were visualized. Following this, silicate polymerization accompanied by C–S–H precipitation produced chemical shifts in the peaks of the main Si K edge and in multiple scattering. However, the silicate polymerization process did not significantly affect the Ca binding energy of C–S–H.« less

In Situ Soft X-ray Spectromicroscopy of Early Tricalcium Silicate Hydration

PubMed Central

Bae, Sungchul; Kanematsu, Manabu; Hernández-Cruz, Daniel; Moon, Juhyuk; Kilcoyne, David; Monteiro, Paulo J. M.

2016-01-01

The understanding and control of early hydration of tricalcium silicate (C3S) is of great importance to cement science and concrete technology. However, traditional characterization methods are incapable of providing morphological and spectroscopic information about in situ hydration at the nanoscale. Using soft X-ray spectromicroscopy, we report the changes in morphology and molecular structure of C3S at an early stage of hydration. In situ C3S hydration in a wet cell, beginning with induction (~1 h) and acceleration (~4 h) periods of up to ~8 h, was studied and compared with ex situ measurements in the deceleration period after 15 h of curing. Analysis of the near-edge X-ray absorption fine structure showed that the Ca binding energy and energy splitting of C3S changed rapidly in the early age of hydration and exhibited values similar to calcium silicate hydrate (C–S–H). The formation of C–S–H nanoseeds in the C3S solution and the development of a fibrillar C–S–H morphology on the C3S surface were visualized. Following this, silicate polymerization accompanied by C–S–H precipitation produced chemical shifts in the peaks of the main Si K edge and in multiple scattering. However, the silicate polymerization process did not significantly affect the Ca binding energy of C–S–H. PMID:28774096

Binding of oxytocin and 8-arginine-vasopressin to neurophysin studied by /sup 15/N NMR using magnetization transfer and indirect detection via protons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Live, D.H.; Cowburn, D.

1987-10-06

NMR was used to monitor the binding to neurophysin of oxytocin and 8-arginine-vasopressin, /sup 15/N labeling being used to identify specific backbone /sup 15/N and /sup 1/H signals. The most significant effects of binding were large downfield shifts in the amino nitrogen resonance of Phe-3 of vasopressin and in its associated proton, providing evidence that the peptide bond between residues 2 and 3 of the hormones is hydrogen-bonded to the protein within hormone-neurophysin complexes. Suggestive evidence for hydrogen bonding of the amino nitrogen of Tyr-2 was also obtained in the form of decreased proton exchange rates on binding; however, themore » chemical shift changes of this nitrogen and its associated proton indicated that such hydrogen bonding, if present, is probably weak. Shifts in the amino nitrogen of Asn-5 and in the -NH protons of both Asn-5 and Cys-6 demonstrated that these residues are significantly perturbed by binding, suggesting conformational changes of the ring on binding and/or the presence of binding sites on the hormone outside the 1-3 region. No support was obtained for the thesis that there is a significant second binding site for vasopressin on each neutrophysin chain. The behavior of both oxytocin and vasopressin on binding was consistent with formation of 1:1 complexes in slow exchange with the free state under most pH conditions. At low pH there was evidence of an increased exchange rate. Additionally, broadening of /sup 15/N resonances in the bound state at low pH occurred without a corresponding change in the resonances of equilibrating free hormone. The results suggest significant conformational alteration in neurophysin-hormone complexes at low pH possibly associated with protonation of the carboxyl group of the hormone-protein salt bridge.« less

Enlightening the ultrahigh electrical conductivities of doped double-wall carbon nanotube fibers by Raman spectroscopy and first-principles calculations.

PubMed

Tristant, Damien; Zubair, Ahmed; Puech, Pascal; Neumayer, Frédéric; Moyano, Sébastien; Headrick, Robert J; Tsentalovich, Dmitri E; Young, Colin C; Gerber, Iann C; Pasquali, Matteo; Kono, Junichiro; Leotin, Jean

2016-12-01

Highly aligned, packed, and doped carbon nanotube (CNT) fibers with electrical conductivities approaching that of copper have recently become available. These fibers are promising for high-power electrical applications that require light-weight, high current-carrying capacity cables. However, a microscopic understanding of how doping affects the electrical conductance of such CNT fibers in a quantitative manner has been lacking. Here, we performed Raman spectroscopy measurements combined with first-principles calculations to determine the position of the average Fermi energy and to obtain the temperature of chlorosulfonic-acid-doped double-wall CNT fibers under high current. Due to the unique way in which double-wall CNT Raman spectra depend on doping, it is possible to use Raman data to determine the doping level quantitatively. The correspondence between the Fermi level shift and the carbon charge transfer is derived from a tight-binding model and validated by several calculations. For the doped fiber, we were able to associate an average Fermi energy shift of ∼-0.7 eV with a conductance increase by a factor of ∼5. Furthermore, since current induces heating, local temperature determination is possible. Through the Stokes-to-anti-Stokes intensity ratio of the G-band peaks, we estimated a temperature rise at the fiber surface of ∼135 K at a current density of 2.27 × 10 8 A m -2 identical to that from the G-band shift, suggesting that thermalization between CNTs is well achieved.

Differential Dynamic Engagement within 24 SH3 Domain: Peptide Complexes Revealed by Co-Linear Chemical Shift Perturbation Analysis

PubMed Central

Stollar, Elliott J.; Lin, Hong; Davidson, Alan R.; Forman-Kay, Julie D.

2012-01-01

There is increasing evidence for the functional importance of multiple dynamically populated states within single proteins. However, peptide binding by protein-protein interaction domains, such as the SH3 domain, has generally been considered to involve the full engagement of peptide to the binding surface with minimal dynamics and simple methods to determine dynamics at the binding surface for multiple related complexes have not been described. We have used NMR spectroscopy combined with isothermal titration calorimetry to comprehensively examine the extent of engagement to the yeast Abp1p SH3 domain for 24 different peptides. Over one quarter of the domain residues display co-linear chemical shift perturbation (CCSP) behavior, in which the position of a given chemical shift in a complex is co-linear with the same chemical shift in the other complexes, providing evidence that each complex exists as a unique dynamic rapidly inter-converting ensemble. The extent the specificity determining sub-surface of AbpSH3 is engaged as judged by CCSP analysis correlates with structural and thermodynamic measurements as well as with functional data, revealing the basis for significant structural and functional diversity amongst the related complexes. Thus, CCSP analysis can distinguish peptide complexes that may appear identical in terms of general structure and percent peptide occupancy but have significant local binding differences across the interface, affecting their ability to transmit conformational change across the domain and resulting in functional differences. PMID:23251481

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Charging and exciton-mediated decharging of metal nanoparticles in organic semiconductor matrices

NASA Astrophysics Data System (ADS)

Ligorio, Giovanni; Vittorio Nardi, Marco; Christodoulou, Christos; Florea, Ileana; Monteiro, Nicolas-Crespo; Ersen, Ovidiu; Brinkmann, Martin; Koch, Norbert

2014-04-01

Gold nanoparticles (Au-NPs) were deposited on the surface of n- and p-type organic semiconductors to form defined model systems for charge storage based electrically addressable memory elements. We used ultraviolet photoelectron spectroscopy to study the electronic properties and found that the Au-NPs become positively charged because of photoelectron emission, evidenced by spectral shifts to higher binding energy. Upon illumination with light that can be absorbed by the organic semiconductors, dynamic charge neutrality of the Au-NPs could be re-established through electron transfer from excitons. The light-controlled charge state of the Au-NPs could add optical addressability to memory elements.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

A Cu/Pt Near-Surface Alloy for Water-Gas Shift Catalysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knudsen, Jan; Nilekar, Anand U.; Vang, Ronnie T.

2007-05-01

The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. The primary route to hydrogen production from fossil fuels involves the water-gas shift (WGS) reaction, and an improvement in the efficiency of WGS catalysts could therefore lead to a major leap forward in the realization of hydrogen economy. On the basis of a combination of high-resolution scanning tunneling microscopy, X-ray photoelectron spectroscopy, and density functional theory (DFT) calculations, we suggestmore » the existence of a new thermodynamically stable Cu/Pt near-surface alloy (NSA). Temperature-programmed desorption and DFT reveal that this Cu/Pt NSA binds CO significantly more weakly than does Pt alone, thereby implying a considerable reduction in the potential for CO poisoning of the Cu/Pt NSA surface as compared to that of pure Pt. In addition, DFT calculations show that this Cu/Pt NSA is able to activate H2O easily, which is the rate-determining step for the WGS on several metal surfaces, and, at the same time, to bind the products of that reaction and formate intermediates rather weakly, thus avoiding possible poisoning of the catalyst surface. The Cu/Pt NSA is thus a promising candidate for an improved WGS catalyst.« less

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

Orbital-Dependent-Functionals within Density Functional Theory: Methodology and Applications

NASA Astrophysics Data System (ADS)

Makmal, Adi

I have designed and implemented a new numerical scheme for solving Kohn-Sham (KS) equations for diatomic systems, together with a full solution of the OEP equation. The equations are solved on a real-space prolate spheroidal coordinate grid, such that all the system's electrons are taken into account. The OEP equation is solved via the S-iteration scheme. This newly developed software package is called DARSEC (DiAtomic Real-Space Electronic structure Calculations). It involves no approximation except for the one inherent in the XC functional. Thus it is especially suitable for examining new functionals of any kind, and ODFs in particular. It is also an ideal tool for assessing the validity of commonly used approximations, for the same reasons. One case for which this uniqueness of DARSEC was exploited in this thesis is the examination of the validity of the pseudopotential approximation for KS gaps that are calculated with EXX OEP (xOEP). Before this study, use of the pseudopotential approximation in such calculations was called into question. I have shown that KS gaps obtained with pseudopotentials that have been constructed in a manner consistent with the exact-exchange functional agree with the all-electron results (i.e. without the pseudopotential approximation), for the cases studied. This confirmed the reliability of the pseudopotential approximation for ODFs such as EXX. Explicit density-dependent XC functionals traditionally fail to obtain atomization-energy as well as charge-dissociation curves that are, at least qualitatively, correct for diatomic systems. On the other hand, Hartree-Fock (HF) theory encounters no such problem. Hence, an additional goal of this research was to study the performances of the EXX functional (being the DFT counterpart of HF) in describing binding energies and charge dissociations for stretched diatomic molecules. Moreover, I wanted to investigate the special features of the resulting single and local EXX KS potential, as opposed to the non-local orbital specific HF potentials. I asked the following questions: Is it at all possible to obtain correct binding energy curves and charge dissociation curves with the local exact-exchange KS potential? What are the main features of such a local KS potential? And how are they related to the spatial shapes of the KS orbitals? To answer these questions, I calculated the electronic structures of highly stretched H2, HF and LiF molecules with EXX, using the Krieger, Li, and Iafrate (KLI) scheme. All calculations were done with DARSEC, whose coordinate system is highly suitable for calculating such stretched diatomic molecules. By examining several electronic configurations in a systematic manner, low energy ones were identified, and qualitatively correct binding-energy curves were obtained. For the LiF molecule a qualitatively correct charge separation curve was also achieved. Once the local EXX KLI potential was obtained for highly stretched diatomic systems, I could study its properties. Specifically, I have identified and demonstrated the following features: (a) The location and size of a constant shift in the potential and its relation to orbital spatial shapes; (b) The dependence of the shift's position on the inter-atomic separation length; (c) The existence of multiple constant shifts of the same kind; (d) The relation between the eigenvalues of the highly stretched diatomic system and the corresponding eigenvalues of the separated atoms - and how this relation is correlated with the asymptotic shift of the local potential. Understanding this unique combination of features sheds light on the mechanism with which the EXX potential enforces the correct charge dissociation. Last, a study on a novel ODF was initiated. The new ODF, suggested by Stephan Kummel, has a local function that mixes a fraction of EXX with a complementary fraction of exchange of the homogenous electronic gas (LDA), where a different fraction is assigned for each point in space. To derive the corresponding potential, the functional derivative of the new energy expression with respect to the KS orbitals was analytically derived. The new energy and potential expressions were implemented into DARSEC, and preliminary examinations were carried out. (Abstract shortened by UMI.)

External electric field effect on the binding energy of a hydrogenic donor impurity in InGaAsP/InP concentric double quantum rings

NASA Astrophysics Data System (ADS)

Hu, Min; Wang, Hailong; Gong, Qian; Wang, Shumin

2018-04-01

Within the framework of effective-mass envelope-function theory, the ground state binding energy of a hydrogenic donor impurity is calculated in the InGaAsP/InP concentric double quantum rings (CDQRs) using the plane wave method. The effects of geometry, impurity position, external electric field and alloy composition on binding energy are considered. It is shown that the peak value of the binding energy appears in two rings with large gap as the donor impurity moves along the radial direction. The binding energy reaches the peak value at the center of ring height when the donor impurity moves along the axial direction. The binding energy shows nonlinear variation with the increase of ring height. With the external electric field applied along the z-axis, the binding energy of the donor impurity located at zi ≥ 0 decreases while that located at zi < 0 increases. In addition, the binding energy decreases with increasing Ga composition, but increases with the increasing As composition.

Projectile n distributions following charge transfer of Ar+ and Na+ in a Na Rydberg target

NASA Astrophysics Data System (ADS)

MacAdam, K. B.; Gray, L. G.; Rolfes, R. G.

1990-11-01

The n distributions produced by charge transfer of Ar+ and Na+ ions in a target of Na(nl) Rydberg atoms were extensively measured at intermediate velocities. The 60-2100-eV ions bombarded a laser-excited atomic-beam target. The projectiles were neutralized by capture into Rydberg states of Ar and Na and were analyzed by field ionization in an inhomogeneous-field detector whose response over states and energies was carefully mapped. The choice of initially prepared Na states, 24d, 25s, 28d, 29s, 33d, and 34s, allowed a comparison of l=0 and >=2 targets at nearly equal binding energies over a range of reduced velocity v~=0.187 to 1.95. Capture populates m sublevels broadly, not merely m~=0. Overlapping contributions from adiabatic and diabatic modes of field ionization were accommodated in the analysis, which used a maximum-entropy-principle parametric form to fit the observed final-state distributions. The peak of the distributions, nmax, shifts upward from a value less than the initial state ni to a value one to three units higher than ni at v~ between 0.7 and 0.9 and ultimately shifts downward below ni as v~ is further increased. The distributions become significantly sharper where the maximum upward shift occurs. Two ratios were defined to express the widths of final-state distributions in relative terms, one measuring the spread of orbital kinetic energy and the other the spread of Bohr-orbit velocity. By these ratios a universal behavior over energies, states, and projectile species is observed, and small differences between l=0 and >=2 targets may be seen. A theoretical understanding of the present results, which span velocities where both molecular and perturbative theories are normally used, will require a quantal formulation that models the free-ranging response that is a hallmark of the high-quantum-number limit.

In-situ growth of HfO2 on clean 2H-MoS2 surface: Growth mode, interface reactions and energy band alignment

NASA Astrophysics Data System (ADS)

Chen, Chang Pang; Ong, Bin Leong; Ong, Sheau Wei; Ong, Weijie; Tan, Hui Ru; Chai, Jian Wei; Zhang, Zheng; Wang, Shi Jie; Pan, Ji Sheng; Harrison, Leslie John; Kang, Hway Chuan; Tok, Eng Soon

2017-10-01

Room temperature growth of HfO2 thin film on clean 2H-MoS2 via plasma-sputtering of Hf-metal target in an argon/oxygen environment was studied in-situ using x-ray photoelectron spectroscopy (XPS). The deposited film was observed to grow akin to a layer-by-layer growth mode. At the onset of growth, a mixture of sulfate- and sulfite-like species (SOx2- where x = 3, 4), and molybdenum trioxide (MoO3), are formed at the HfO2/MoS2 interface. An initial decrease in binding energies for both Mo 3d and S 2p core-levels of the MoS2 substrate by 0.4 eV was also observed. Their binding energies, however, did not change further with increasing HfO2 thickness. There was no observable change in the Hf4f core-level binding energy throughout the deposition process. With increasing HfO2 deposition, MoO3 becomes buried at the interface while SOx2- was observed to be present in the film. The shift of 0.4 eV for both Mo 3d and S 2p core-levels of the MoS2 substrate can be attributed to a charge transfer from the substrate to the MoO3/SOx2--like interface layer. Consequently, the Type I heterojunction valence band offset (conduction band offset) becomes 1.7 eV (2.9 eV) instead of 1.3 eV (3.3 eV) expected from considering the bulk HfO2 and MoS2 valence band offset (conduction band offset). The formation of these states and its influence on band offsets will need to be considered in their device applications.

Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

PubMed

Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

2012-10-01

The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

Simultaneous effects of temperature and pressure on the donor binding energy in a V-groove quantum wire

NASA Astrophysics Data System (ADS)

Khordad, R.

2010-03-01

The influence of temperature and pressure, simultaneously, on the binding energy of a hydrogenic donor impurity in a ridge GaAs/Ga 1- xAl xAs quantum wire is studied using a variational procedure within the effective mass approximation. The subband energy and the binding energy of the donor impurity in its ground state as a function of the wire bend width and impurity location at different temperatures and pressures are calculated. The results show that, when the temperature increases, the donor binding energy decreases for a constant applied pressure for all wire bend widths. Also, the binding energy increases by increasing the pressure for a constant temperature for all wire bend widths. In addition, when the temperature and pressure are applied simultaneously the binding energy decreases as the quantum wire bend width increases. On the whole, it is deduced that the temperature and pressure have important effects on the donor binding energy in a V-groove quantum wire.

Analysis of the Spectroscopic Aspects of Cationic Dye Basic Orange 21.

PubMed

Eizig, Zehavit; Major, Dan T; Kasdan, Harvey L; Afrimzon, Elena; Zurgil, Naomi; Sobolev, Maria; Deutsch, Mordechai

2015-09-24

Spectroscopic properties of cationic dye basic orange 21 (BO21) in solutions, in solids, and within leukocytes were examined. Results obtained with solutions indicate that influence of variables such as pH, viscosity, salt composition, and various proteins on the absorption spectrum of BO21 is negligible. However, in the presence of heparin, a blue shift (484-465 nm) is observed, which is attributed to the aggregation of BO21 on the polyanion. Applying density functional theory demonstrates that in aqueous solutions (a) the formation of BO21 oligomers is thermodynamically favorable, they are oriented in an antiparallel dipolar arrangement, and their binding energies are lower than those of parallel dipolar arrangements, (b) association between BO21 aggregates and heparin is highly favorable, and (c) the blue shift is due to the mixing of π → π* transitions caused by BO21 molecule stacking. However, when embedded in basophils, the absorption spectra of intracellular BO21 is extremely red-shifted, with two peaks (at 505 and 550 nm) found to be attributed to BO21 and the BO21-heparin complex, respectively, which are intracellularly hosted in nonaqueous environments. Initial evidence of the ability to differentiate between leukocyte types by BO21 is presented.

Entropy–enthalpy transduction caused by conformational shifts can obscure the forces driving protein–ligand binding

PubMed Central

Fenley, Andrew T.; Muddana, Hari S.; Gilson, Michael K.

2012-01-01

Molecular dynamics simulations of unprecedented duration now can provide new insights into biomolecular mechanisms. Analysis of a 1-ms molecular dynamics simulation of the small protein bovine pancreatic trypsin inhibitor reveals that its main conformations have different thermodynamic profiles and that perturbation of a single geometric variable, such as a torsion angle or interresidue distance, can select for occupancy of one or another conformational state. These results establish the basis for a mechanism that we term entropy–enthalpy transduction (EET), in which the thermodynamic character of a local perturbation, such as enthalpic binding of a small molecule, is camouflaged by the thermodynamics of a global conformational change induced by the perturbation, such as a switch into a high-entropy conformational state. It is noted that EET could occur in many systems, making measured entropies and enthalpies of folding and binding unreliable indicators of actual thermodynamic driving forces. The same mechanism might also account for the high experimental variance of measured enthalpies and entropies relative to free energies in some calorimetric studies. Finally, EET may be the physical mechanism underlying many cases of entropy–enthalpy compensation. PMID:23150595

Thermally induced anchoring of a zinc-carboxyphenylporphyrin on rutile TiO2 (110)

NASA Astrophysics Data System (ADS)

Jöhr, Res; Hinaut, Antoine; Pawlak, Rémy; Zajac, Łukasz; Olszowski, Piotr; Such, Bartosz; Glatzel, Thilo; Zhang, Jun; Muntwiler, Matthias; Bergkamp, Jesse J.; Mateo, Luis-Manuel; Decurtins, Silvio; Liu, Shi-Xia; Meyer, Ernst

2017-05-01

Functionalization of surfaces has become of high interest for a wealth of applications such as sensors, hybrid photovoltaics, catalysis, and molecular electronics. Thereby molecule-surface interactions are of crucial importance for the understanding of interface properties. An especially relevant point is the anchoring of molecules to surfaces. In this work, we analyze this process for a zinc-porphyrin equipped with carboxylic acid anchoring groups on rutile TiO2 (110) using scanning probe microscopy. After evaporation, the porphyrins are not covalently bound to the surface. Upon annealing, the carboxylic acid anchors undergo deprotonation and bind to surface titanium atoms. The formation of covalent bonds is evident from the changed stability of the molecule on the surface as well as the adsorption configuration. Annealed porphyrins are rotated by 45° and adopt another adsorption site. The influence of binding on electronic coupling with the surface is investigated using photoelectron spectroscopy. The observed shifts of Zn 2p and N 1s levels to higher binding energies indicate charging of the porphyrin core, which is accompanied by a deformation of the macrocycle due to a strong interaction with the surface.

Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

PubMed

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

2012-09-19

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

PubMed Central

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

2012-01-01

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

Molecular mechanism of carbon nanotube to activate Subtilisin Carlsberg in polar and non-polar organic media

NASA Astrophysics Data System (ADS)

Zhang, Liyun; Li, Yuzhi; Yuan, Yuan; Jiang, Yuanyuan; Guo, Yanzhi; Li, Menglong; Pu, Xuemei

2016-11-01

In the work, we mainly used molecular dynamics (MD) simulation and protein structure network (PSN) to study subtilisin Carlsberg (SC) immobilized onto carbon nanotube (CNT) in water, acetonitrile and heptane solvents, in order to explore activation mechanism of enzymes in non-aqueous media. The result indicates that the affinity of SC with CNT follows the decreasing order of water > acetonitrile > heptane. The overall structure of SC and the catalytic triad display strong robustness to the change of environments, responsible for the activity retaining. However, the distances between two β-strands of substrate-binding pocket are significantly expanded by the immobilization in the increasing order of water < acetonitrile < heptane, contributing to the highest substrate-binding energy in heptane media. PSN analysis further reveals that the immobilization enhances structural communication paths to the substrate-binding pocket, leading to its larger change than the free-enzymes. Interestingly, the increase in the number of the pathways upon immobilization is not dependent on the absorbed extent but the desorbed one, indicating significant role of shifting process of experimental operations in influencing the functional region. In addition, some conserved and important hot-residues in the paths are identified, providing molecular information for functional modification.

Rational Design of Highly Potent and Slow-Binding Cytochrome bc1 Inhibitor as Fungicide by Computational Substitution Optimization

PubMed Central

Hao, Ge-Fei; Yang, Sheng-Gang; Huang, Wei; Wang, Le; Shen, Yan-Qing; Tu, Wen-Long; Li, Hui; Huang, Li-Shar; Wu, Jia-Wei; Berry, Edward A.; Yang, Guang-Fu

2015-01-01

Hit to lead (H2L) optimization is a key step for drug and agrochemical discovery. A critical challenge for H2L optimization is the low efficiency due to the lack of predictive method with high accuracy. We described a new computational method called Computational Substitution Optimization (CSO) that has allowed us to rapidly identify compounds with cytochrome bc1 complex inhibitory activity in the nanomolar and subnanomolar range. The comprehensively optimized candidate has proved to be a slow binding inhibitor of bc1 complex, ~73-fold more potent (Ki = 4.1 nM) than the best commercial fungicide azoxystrobin (AZ; Ki = 297.6 nM) and shows excellent in vivo fungicidal activity against downy mildew and powdery mildew disease. The excellent correlation between experimental and calculated binding free-energy shifts together with further crystallographic analysis confirmed the prediction accuracy of CSO method. To the best of our knowledge, CSO is a new computational approach to substitution-scanning mutagenesis of ligand and could be used as a general strategy of H2L optimisation in drug and agrochemical design.

Investigating the interaction of anticancer drug temsirolimus with human transferrin: Molecular docking and spectroscopic approach.

PubMed

Shamsi, Anas; Ahmed, Azaj; Khan, Mohd Shahnawaz; Husain, Fohad Mabood; Amani, Samreen; Bano, Bilqees

2018-05-16

In our present study, binding between an important anti renal cancer drug temsirolimus and human transferrin (hTF) was investigated employing spectroscopic and molecular docking approach. In the presence of temsirolimus, hyper chromaticity is observed in hTF in UV spectroscopy suggestive of complex formation between hTF and temsirolimus. Fluorescence spectroscopy revealed the occurrence of quenching in hTF in the presence of temsirolimus implying complex formation taking place between hTF and temsirolimus. Further, the mode of interaction between hTF and temsirolimus was revealed to be static by fluorescence quenching analysis at 3 different temperatures. Binding constant values obtained employing fluorescence spectroscopy depicts strong interaction between hTF and temsirolimus; temsirolimus binds to hTF at 298 K with a binding constant of .32 × 10 4  M -1 implying the strength of this interaction. The negative Gibbs free energy obtained through quenching experiments is evident of the fact that the binding is spontaneous. CD spectra of hTF also showed a downward shift in the presence of temsirolimus as compared with free hTF implying complex formation between hTF and temsirolimus. Molecular docking was performed with a view to find out which residues are key players in this interaction. The importance of our study stems from the fact it will provide an insight into binding pattern of commonly administered renal cancer drug with an important protein that plays a pivotal role in many physiological processes. Copyright © 2018 John Wiley & Sons, Ltd.

Allosteric response and substrate sensitivity in peptide binding of the signal recognition particle.

PubMed

Wang, Connie Y; Miller, Thomas F

2014-10-31

We characterize the conformational dynamics and substrate selectivity of the signal recognition particle (SRP) using a thermodynamic free energy cycle approach and microsecond timescale molecular dynamics simulations. The SRP is a central component of the co-translational protein targeting machinery that binds to the N-terminal signal peptide (SP) of nascent proteins. We determined the shift in relative conformational stability of the SRP upon substrate binding to quantify allosteric coupling between SRP domains. In particular, for dipeptidyl aminopeptidase, an SP that is recognized by the SRP for co-translational targeting, it is found that substrate binding induces substantial changes in the SRP toward configurations associated with targeting of the nascent protein, and it is found that the changes are modestly enhanced by a mutation that increases the hydrophobicity of the SP. However, for alkaline phosphatase, an SP that is recognized for post-translational targeting, substrate binding induces the reverse change in the SRP conformational distribution away from targeting configurations. Microsecond timescale trajectories reveal the intrinsic flexibility of the SRP conformational landscape and provide insight into recent single molecule studies by illustrating that 10-nm lengthscale changes between FRET pairs occur via the rigid-body movement of SRP domains connected by the flexible linker region. In combination, these results provide direct evidence for the hypothesis that substrate-controlled conformational switching in the SRP provides a mechanism for discriminating between different SPs and for connecting substrate binding to downstream steps in the protein targeting pathway. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Membrane-Protein Binding Measured with Solution-Phase Plasmonic Nanocube Sensors

PubMed Central

Wu, Hung-Jen; Henzie, Joel; Lin, Wan-Chen; Rhodes, Christopher; Li, Zhu; Sartorel, Elodie; Thorner, Jeremy; Yang, Peidong; Groves, Jay. T.

2013-01-01

We describe a solution-phase sensor of lipid-protein binding based on localized surface plasmon resonance (LSPR) of silver nanocubes. When silica-coated nanocubes are mixed into a suspension of lipid vesicles, supported membranes spontaneously assemble on their surfaces. Using a standard laboratory spectrophotometer, we calibrate the LSPR peak shift due to protein binding to the membrane surface and then characterize the lipid-binding specificity of a pleckstrin-homology domain protein. PMID:23085614

New mixed ligand palladium(II) complexes based on the antiepileptic drug sodium valproate and bioactive nitrogen-donor ligands: Synthesis, structural characterization, binding interactions with DNA and BSA, in vitro cytotoxicity studies and DFT calculations

NASA Astrophysics Data System (ADS)

Tabrizi, Leila; Chiniforoshan, Hossein; Tavakol, Hossein

2015-04-01

The complexes [Pd(valp)2(imidazole)2] (1), [Pd(valp)2(pyrazine)2] (2) (valp is sodium valproate) have been synthesized and characterized using IR, 1H NMR, 13C{1H} NMR and UV-Vis spectrometry. The interaction of complexes with CT-DNA has been investigated using spectroscopic tools and viscosity measurement. In each case, the association constant (Kb) was deduced from the absorption spectral study and the number of binding sites (n) and the binding constant (K) were calculated from relevant fluorescence quenching data. As a result, a non-covalent interaction between the metal complex and DNA was suggested, which could be assigned to an intercalative binding. In addition, the interaction of 1 and 2 was ventured with bovine serum albumin (BSA) with the help of absorption and fluorescence spectroscopy measurements. Through these techniques, the apparent association constant (Kapp) and the binding constant (K) could be calculated for each complex. Evaluation of cytotoxic activity of the complexes against four different cancer cell lines proved that the complexes exhibited cytotoxic specificity and significant cancer cell inhibitory rate. Moreover, density functional theory (DFT) calculations were employed to provide more evidence about the observed data. The majority of trans isomers were supported not only by energies, but also by the similarity of its calculated IR frequencies, UV adsorptions and NMR chemical shifts to the experimental values.

Theoretical Study on the Complexes of Benzene with Isoelectronic Nitrogen-Containing Heterocycles

PubMed Central

Wang, Weizhou; Hobza, Pavel

2008-01-01

The π–π interactions between benzene and the aromatic nitrogen heterocycles pyridine, pyrimidine, 1,3,5-triazine, 1,2,3-triazine, 1,2,4,5-tetrazine, and 1,2,3,4,5-pentazine are systematically investigated. The T-shaped structures of all complexes studied exhibit a contraction of the C—H bond accompanied by a rather large blue shift (40–52 cm−1) of its stretching frequency, and they are almost isoenergetic with the corresponding displaced-parallel structures at reliable levels of theory. With increasing number of nitrogen atoms in the heterocycle, the geometries, frequencies, energies, percentage of s character at C, and the electron density in the C—H σ antibonding orbital of the complexes all increase or decrease systematically. Decomposition analysis of the total binding energy showed that for all the complexes, the dispersion energy is the dominant attractive contribution, and a rather large attraction originating from electrostatic contribution is compensated by its exchange counterpart. PMID:18389512

Optical absorption of zigzag single walled boron nitride nanotubes

NASA Astrophysics Data System (ADS)

Moradian, Rostam; Chegel, Raad; Behzad, Somayeh

2010-11-01

In a realistic three-dimensional model, optical matrix element and linear optical absorption of zigzag single walled boron nitride nanotubes (BNNTs) in the tight binding approximation are studied. In terms of absolute value of dipole matrix elements of the first three direct transitions at kz=0, we divided the zigzag BNNTs into three groups and investigated their optical absorption spectrum in energy ranges E<5, 77.5 eV. We found that in lower energies, E<5 eV, all groups show different behaviors while in the higher energies, 77.5 eV, their behaviors depend on their even or odd nanotube index. We also found that in the energy range 7

Comparing alchemical and physical pathway methods for computing the absolute binding free energy of charged ligands.

PubMed

Deng, Nanjie; Cui, Di; Zhang, Bin W; Xia, Junchao; Cruz, Jeffrey; Levy, Ronald

2018-06-13

Accurately predicting absolute binding free energies of protein-ligand complexes is important as a fundamental problem in both computational biophysics and pharmaceutical discovery. Calculating binding free energies for charged ligands is generally considered to be challenging because of the strong electrostatic interactions between the ligand and its environment in aqueous solution. In this work, we compare the performance of the potential of mean force (PMF) method and the double decoupling method (DDM) for computing absolute binding free energies for charged ligands. We first clarify an unresolved issue concerning the explicit use of the binding site volume to define the complexed state in DDM together with the use of harmonic restraints. We also provide an alternative derivation for the formula for absolute binding free energy using the PMF approach. We use these formulas to compute the binding free energy of charged ligands at an allosteric site of HIV-1 integrase, which has emerged in recent years as a promising target for developing antiviral therapy. As compared with the experimental results, the absolute binding free energies obtained by using the PMF approach show unsigned errors of 1.5-3.4 kcal mol-1, which are somewhat better than the results from DDM (unsigned errors of 1.6-4.3 kcal mol-1) using the same amount of CPU time. According to the DDM decomposition of the binding free energy, the ligand binding appears to be dominated by nonpolar interactions despite the presence of very large and favorable intermolecular ligand-receptor electrostatic interactions, which are almost completely cancelled out by the equally large free energy cost of desolvation of the charged moiety of the ligands in solution. We discuss the relative strengths of computing absolute binding free energies using the alchemical and physical pathway methods.

Comparative surface studies on wet and dry sacrificial thermal oxidation on silicon carbide

NASA Astrophysics Data System (ADS)

Koh, A.; Kestle, A.; Wright, C.; Wilks, S. P.; Mawby, P. A.; Bowen, W. R.

2001-04-01

A comparative study on the effect of wet and dry thermal oxidation on 4H-silicon carbide (SiC) and on sacrificial silicon (Si) thermal oxidation on 4H-SiC surface has been conducted using atomic force microscopy (AFM) and X-ray photoelectron spectroscopy (XPS). The AFM images show the formation of 'nano-islands' of varying density on the SiC surface after the removal of thermal oxide using hydrofluoric (HF) acid etch. These nano-islands are resistant to HF acid and have been previously linked to residual carbon [1-3] resulting from the oxidation process. This paper presents the use of a sacrificial silicon oxidation (SSO) step as a form of surface preparation that gives a reproducible clean SiC surface. XPS results show a slight electrical shift in binding energy between the wet and dry thermal oxidation on the standard SiC surface, while the surface produced by the SSO technique shows a minimal shift.

NMR Studies of Protein Hydration and Protein-Ligand Interactions

NASA Astrophysics Data System (ADS)

Chong, Yuan

Water on the surface of a protein is called hydration water. Hydration water is known to play a crucial role in a variety of biological processes including protein folding, enzymatic activation, and drug binding. Although the significance of hydration water has been recognized, the underlying mechanism remains far from being understood. This dissertation employs a unique in-situ nuclear magnetic resonance (NMR) technique to study the mechanism of protein hydration and the role of hydration in alcohol-protein interactions. Water isotherms in proteins are measured at different temperatures via the in-situ NMR technique. Water is found to interact differently with hydrophilic and hydrophobic groups on the protein. Water adsorption on hydrophilic groups is hardly affected by the temperature, while water adsorption on hydrophobic groups strongly depends on the temperature around 10 C, below which the adsorption is substantially reduced. This effect is induced by the dramatic decrease in the protein flexibility below 10 C. Furthermore, nanosecond to microsecond protein dynamics and the free energy, enthalpy, and entropy of protein hydration are studied as a function of hydration level and temperature. A crossover at 10 C in protein dynamics and thermodynamics is revealed. The effect of water at hydrophilic groups on protein dynamics and thermodynamics shows little temperature dependence, whereas water at hydrophobic groups has stronger effect above 10 C. In addition, I investigate the role of water in alcohol binding to the protein using the in-situ NMR detection. The isotherms of alcohols are first measured on dry proteins, then on proteins with a series of controlled hydration levels. The free energy, enthalpy, and entropy of alcohol binding are also determined. Two distinct types of alcohol binding are identified. On the one hand, alcohols can directly bind to a few specific sites on the protein. This type of binding is independent of temperature and can be facilitated by hydration. On the other hand, alcohols can bind to many nonspecific sites on the protein. In dry proteins, this type of binding only occurs above a threshold of alcohol vapor pressure. Such a threshold is gradually reduced by increasing the hydration level and can be removed above a critical hydration level. Hydration also shifts the nonspecific alcohol binding from an entropy-driven to an enthalpy-driven process. This dissertation reveals the mechanism of protein hydration and the detailed roles of hydration in ligand binding, with important implications for the understanding of protein functions.

Free energy profiles of cocaine esterase-cocaine binding process by molecular dynamics and potential of mean force simulations.

PubMed

Zhang, Yuxin; Huang, Xiaoqin; Han, Keli; Zheng, Fang; Zhan, Chang-Guo

2016-11-25

The combined molecular dynamics (MD) and potential of mean force (PMF) simulations have been performed to determine the free energy profile of the CocE)-(+)-cocaine binding process in comparison with that of the corresponding CocE-(-)-cocaine binding process. According to the MD simulations, the equilibrium CocE-(+)-cocaine binding mode is similar to the CocE-(-)-cocaine binding mode. However, based on the simulated free energy profiles, a significant free energy barrier (∼5 kcal/mol) exists in the CocE-(+)-cocaine binding process whereas no obvious free energy barrier exists in the CocE-(-)-cocaine binding process, although the free energy barrier of ∼5 kcal/mol is not high enough to really slow down the CocE-(+)-cocaine binding process. In addition, the obtained free energy profiles also demonstrate that (+)-cocaine and (-)-cocaine have very close binding free energies with CocE, with a negligible difference (∼0.2 kcal/mol), which is qualitatively consistent with the nearly same experimental K M values of the CocE enzyme for (+)-cocaine and (-)-cocaine. The consistency between the computational results and available experimental data suggests that the mechanistic insights obtained from this study are reasonable. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Colorimetric fluoride ion sensing by polyborylated ferrocenes: structural influences on thermodynamics and kinetics.

PubMed

Day, Joanna K; Bresner, Christopher; Coombs, Natalie D; Fallis, Ian A; Ooi, Li-Ling; Aldridge, Simon

2008-02-04

The thermodynamic factors underlying the use of ferroceneboronic esters as electrochemical or colorimetric fluoride ion sensors have been investigated through the synthesis of a range of systematically related derivatives differing in the number/nature of the boronic ester substituents and in the nature of ancillary ligands. Thus, if the shift in electrochemical potential associated with the conversion of one (or more) boronic ester group(s) to anionic boronate(s) on fluoride binding is sufficient to allow oxidation of the resulting host/guest complex by dioxygen, colorimetric sensing is possible. In practice, while monofunctional systems of the type CpFe[eta(5)-C(5)H(4)B(OR)(2)] offer selectivity in fluoride binding, electrochemical shifts in chloroform solution are insufficient to allow for a colorimetric response. Two chemical modification strategies have been shown to be successful in realizing a colorimetric sensor: (i) the use of the more strongly electron-donating Cp(*) ancillary ligand (which shifts the oxidation potential of both the free receptor and the resulting fluoride adduct cathodically by ca. -400 mV) and (ii) receptors featuring two or more binding sites and consequently a larger fluoride-induced electrochemical shift. Thus, in the case of [eta(5)-C(5)H(4)B(OR)(2)](2)Fe [(OR)(2) = OC(H)PhC(H)PhO, 2(s)], the binding of 2 equiv of fluoride gives an electrochemical shift (in chloroform) of -960 mV (cf. -530 mV for the corresponding monofunctional analogue, 1(s)). Related tris- and tetrakis-functionalized systems are also shown to be oxidized as the bis(fluoride) adducts, presumably because of fast oxidation kinetics, relative to the rate of the (electrostatically unfavorable) binding of a third equivalent of fluoride. Furthermore, the rate of sensor response (as measured by UV/vis spectroscopy) is found to be strongly enhanced by the presence of pendant (uncomplexed) three-coordinate boronic ester functions (e.g., a rate enhancement of 1-2 orders of magnitude for 3(s)/4(s) with respect to 2(s)) and/or delocalized aromatic substituents.

NMR Chemical Exchange as a Probe for Ligand-Binding Kinetics in a Theophylline-Binding RNA Aptamer

PubMed Central

Latham, Michael P.; Zimmermann, Grant R.; Pardi, Arthur

2009-01-01

The apparent on- and off-rate constants for theophylline binding to its RNA aptamer in the absence of Mg2+ were determined here by 2D 1H-1H NMR ZZ-exchange spectroscopy. Analysis of the build-up rate of the exchange cross peaks for several base-paired imino protons in the RNA yielded an apparent kon of 600 M-1 s-1. This small apparent kon results from the free RNA existing as a dynamic equilibrium of inactive states rapidly interconverting with a low population of active species. The data here indicate that the RNA aptamer employs a conformational selection mechanism for binding theophylline in the absence of Mg2+. The kinetic data here also explain a very unusual property of this RNA-theophylline system, slow exchange on the NMR chemical shift timescale for a weak-binding complex. To our knowledge, it is unprecedented to have such a weak binding complex (Kd ≈ 3.0 mM at 15 °C) show slow exchange on the NMR chemical shift timescale, but the results clearly demonstrate that slow exchange and weak binding are readily rationalized by a small kon. Comparisons with other ligand-receptor interactions are presented. PMID:19317486

NH3 adsorption on anatase-TiO2(101)

NASA Astrophysics Data System (ADS)

Koust, Stig; Adamsen, Kræn C.; Kolsbjerg, Esben Leonhard; Li, Zheshen; Hammer, Bjørk; Wendt, Stefan; Lauritsen, Jeppe V.

2018-03-01

The adsorption of ammonia on anatase TiO2 is of fundamental importance for several catalytic applications of TiO2 and for probing acid-base interactions. Utilizing high-resolution scanning tunneling microscopy (STM), synchrotron X-ray photoelectron spectroscopy, temperature-programmed desorption (TPD), and density functional theory (DFT), we identify the adsorption mode and quantify the adsorption strength on the anatase TiO2(101) surface. It was found that ammonia adsorbs non-dissociatively as NH3 on regular five-fold coordinated titanium surface sites (5f-Ti) with an estimated exothermic adsorption energy of 1.2 eV for an isolated ammonia molecule. For higher adsorbate coverages, the adsorption energy progressively shifts to smaller values, due to repulsive intermolecular interactions. The repulsive adsorbate-adsorbate interactions are quantified using DFT and autocorrelation analysis of STM images, which both showed a repulsive energy of ˜50 meV for nearest neighbor sites and a lowering in binding energy for an ammonia molecule in a full monolayer of 0.28 eV, which is in agreement with TPD spectra.

The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.

PubMed

Rosenberg, Robert E

2018-05-10

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.

Ligand induced stabilization of the melting temperature of the HSV-1 single-strand DNA binding protein using the thermal shift assay.

PubMed

Rupesh, Kanchi Ravi; Smith, Aaron; Boehmer, Paul E

2014-11-28

We have adapted the thermal shift assay to measure the ligand binding properties of the herpes simplex virus-1 single-strand DNA binding protein, ICP8. By measuring SYPRO Orange fluorescence in microtiter plates using a fluorescence-enabled thermal cycler, we have quantified the effects of oligonucleotide ligands on the melting temperature of ICP8. We found that single-stranded oligomers raise the melting temperature of ICP8 in a length- and concentration-dependent manner, ranging from 1°C for (dT)5 to a maximum of 9°C with oligomers ⩾10 nucleotides, with an apparent Kd of <1μM for (dT)20. Specifically, the results indicate that ICP8 is capable of interacting with oligomers as short as 5 nucleotides. Moreover, the observed increases in melting temperature of up to 9°C, indicates that single-strand DNA binding significantly stabilizes the structure of ICP8. This assay may be applied to investigate the ligand binding proteins of other single-strand DNA binding proteins and used as a high-throughput screen to identify compounds with therapeutic potential that inhibit single-strand DNA binding. As proof of concept, the single-strand DNA binding agent ciprofloxacin reduces the ligand induced stabilization of the melting temperature of ICP8 in a dose-dependent manner. Copyright © 2014 Elsevier Inc. All rights reserved.

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

PubMed

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Optical microcavities for real-time detection of bacteria

NASA Astrophysics Data System (ADS)

Ghali, Hala

Researchers showed a lot of interest in studying whispering gallery microcavities as a tool for biosensing in the last decade. Optical microcavities are structures that confine light at the microscale due to total internal reflection of light at the interface between the cavity and its surrounding medium. If a molecule binds to the surface of the microcavity, light can interact with it several times, making optical microcavities very sensitive tools for label-free sensing. During this Ph.D. project, optical microdisks are used to detect the presence of Staphylococcus aureus (S. aureus) bacteria. To our knowledge, this is the first time optical microdisks are used to specifically detect bacteria. In order to have a reliable and efficient biosensor, it needs to be highly specific. Specificity is achieved by choosing an appropriate functionalization process. The functionalization process uses the antibody that is specific to the antigen of interest. In this case, the choice of a specific bacteriophage to bind S. aureus bacteria is crucial to obtain a specific sensor, and many experiences were done in order to identify the most appropriate. However, the purification of bacteriophages can be long and complex. An alternative to working with whole bacteriophages is the use of purified protein phages that can be easier to prepare. The functionalization process used in this thesis was developed in collaboration with professor Jay L. Nadeau's group from the biomedical engineering department at McGill university. LysK protein phage is added to the microdisk and will attach S. aureus bacteria during the real-time detection experiments. In order to demonstrate the specificity of the functionalization process, LysK was used with E. coli bacteria. As predicted, since LysK is only specific to S. aureus strains, it did not attach any E. coli. The binding of bacteria to the microdisk surface is observed through the reactive sensing mechanism. When bacteria bind to the surface of the resonator, it increases the optical path length and changes the refractive index, which leads to a shift of the resonance peaks towards longer wavelengths. This shift can give practical information about the kinetics of the binding between the bacteria and the protein. For a concentration of 5.109 cfu/ml, a shift of 0.22 nm was observed. When the concentration was decreased, the value of the shift also decreased, meaning less bacteria bind to the surface of the resonator. Using the approximate expression of the electric field inside a microdisk, a theoretical formulation of the wavelength shift was developed for the first time. It helped give an approximation of the number of bacteria that attach to the surface. For the 0.22 nm shift, around 46 bacteria bound to the sensitive area of the microdisk and contributed to the shift. It takes about 15 minutes to attach a maximum number of bacteria.

Influence of polarization and self-polarization charges on impurity binding energy in spherical quantum dot with parabolic confinement

NASA Astrophysics Data System (ADS)

Sarkar, Supratik; Sarkar, Samrat; Bose, Chayanika

2018-07-01

We present a general formulation of the ground state binding energy of a shallow hydrogenic impurity in spherical quantum dot with parabolic confinement, considering the effects of polarization and self energy. The variational approach within the effective mass approximation is employed here. The binding energy of an on-center impurity is computed for a GaAs/AlxGa1-xAs quantum dot as a function of the dot size with the dot barrier as parameter. The influence of polarization and self energy are also treated separately. Results indicate that the binding energy increases due to the presence of polarization charge, while decreases due to the self energy of the carrier. An overall enhancement in impurity binding energy, especially for small dots is noted.

Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

PubMed

Dubinets, Nikita; Slipchenko, Lyudmila V

2017-07-20

Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. H.

1981-01-01

Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

Porous nano-cerium oxide wood chip biochar composites for aqueous levofloxacin removal and sorption mechanism insights.

PubMed

Yi, Shengze; Sun, Yuanyuan; Hu, Xin; Xu, Hongxia; Gao, Bin; Wu, Jichun

2017-01-14

The adsorption removal of levofloxacin (LEV), a widely used fluoroquinolone antibiotic, by using the biochars derived from the pyrolysis of pine wood chip pretreated with cerium trichloride was investigated through batch sorption experiments and multiple characterization techniques. The differences in the basic physicochemical properties between Ce-impregnated biochars and the pristine biochars were confirmed by the analysis of elemental compositions, specific surface areas, energy dispersive spectrometry, X-ray diffraction, and thermo-gravimetry. FT-IR spectra of the pre- and post-sorption biochars confirmed the chemical adsorption for LEV sorption onto the biochars. Large shifts in the binding energy of Ce 3d , O 1s , C 1s , and N 1s regions on the pre- and post-sorption biochars indicated the surface complexation of LEV molecule onto the biochars. The binding species of Ce 4+ and Ce 3+ identified by X-ray photoelectron spectroscopy reflect the role of Ce oxides during sorption. Batch adsorption showed the significant enhancement of adsorption capacity for LEV after the Ce modification. Batch adsorption kinetic data fitted well with the pseudo-second-order model. Both the Langmuir and the Freundlich models reproduced the isotherm data well. Findings from this work indicated that Ce-impregnated biochars can be effective for the removal of aqueous LEV.

Dissociation of heavy quarkonia in an anisotropic hot QCD medium in a quasiparticle model

NASA Astrophysics Data System (ADS)

Jamal, Mohammad Yousuf; Nilima, Indrani; Chandra, Vinod; Agotiya, Vineet Kumar

2018-05-01

The present article is the follow-up work of Phys. Rev. D 94, 094006 (2016), 10.1103/PhysRevD.94.094006, where we have extended the study of quarkonia dissociation in (momentum) anisotropic hot QCD medium. As evident by the experimentally observed collective flow at the RHIC and LHC, the momentum anisotropy is present at almost all the stages after the collision, and therefore, it is important to include its effects in the analysis. Employing the in-medium (corrected) potential while considering the anisotropy (both oblate and prolate cases) in the medium, the thermal widths and the binding energies of the heavy quarkonia states (s -wave charmonia and s -wave bottomonia specifically, for radial quantum numbers n =1 and 2) have been determined. The hot QCD medium effects have been included by employing a quasiparticle description. The presence of anisotropy has modified the potential and then the thermal widths and binding energies of these states in a significant manner. The results show a quite visible shift in the values of dissociation temperatures as compared to the isotropic case. Further, the hot QCD medium interaction effects suppress the dissociation temperature as compared to the case where we consider the medium as a noninteracting ultrarelativistic gas of quarks (antiquarks) and gluons.

Mechanism of Protein Denaturation: Partial Unfolding of the P22 Coat Protein I-Domain by Urea Binding

PubMed Central

Newcomer, Rebecca L.; Fraser, LaTasha C.R.; Teschke, Carolyn M.; Alexandrescu, Andrei T.

2015-01-01

The I-domain is an insertion domain of the bacteriophage P22 coat protein that drives rapid folding and accounts for over half of the stability of the full-length protein. We sought to determine the role of hydrogen bonds (H-bonds) in the unfolding of the I-domain by examining 3JNC’ couplings transmitted through H-bonds, the temperature and urea-concentration dependence of 1HN and 15N chemical shifts, and native-state hydrogen exchange at urea concentrations where the domain is predominantly folded. The native-state hydrogen-exchange data suggest that the six-stranded β-barrel core of the I-domain is more stable against unfolding than a smaller subdomain comprised of a short α-helix and three-stranded β-sheet. H-bonds, separately determined from solvent protection and 3JNC’ H-bond couplings, are identified with an accuracy of 90% by 1HN temperature coefficients. The accuracy is improved to 95% when 15N temperature coefficients are also included. In contrast, the urea dependence of 1HN and 15N chemical shifts is unrelated to H-bonding. The protein segments with the largest chemical-shift changes in the presence of urea show curved or sigmoidal titration curves suggestive of direct urea binding. Nuclear Overhauser effects to urea for these segments are also consistent with specific urea-binding sites in the I-domain. Taken together, the results support a mechanism of urea unfolding in which denaturant binds to distinct sites in the I-domain. Disordered segments bind urea more readily than regions in stable secondary structure. The locations of the putative urea-binding sites correlate with the lower stability of the structure against solvent exchange, suggesting that partial unfolding of the structure is related to urea accessibility. PMID:26682823

Characterization of sarcoplasmic reticulum Ca{sup 2+} ATPase nucleotide binding domain mutants using NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myint, Wazo; Gong, Qingguo; Ahn, Jinwoo

2011-02-04

Research highlights: {yields} Structural consequence by substitution mutations on the isolated SERCA-nucleotide binding (SERCA-N) domain was studied. {yields} The study fills a gap between the previous clinical, physiological, and biochemical data and the molecular basis of SERCA-N. {yields} The E412G mutation, known to be seen in patients with Darier's disease, was found to maintain the active conformation but exhibit reduced protein stability. -- Abstract: Sarcoplasmic reticulum Ca{sup 2+} ATPase (SERCA) is essential for muscle function by transporting Ca{sup 2+} from the cytosol into the sarcoplasmic reticulum through ATP hydrolysis. In this report, the effects of substitution mutations on the isolatedmore » SERCA-nucleotide binding domain (SERCA-N) were studied using NMR. {sup 15}N-{sup 1}H HSQC spectra of substitution mutants at the nucleotide binding site, T441A, R560V, and C561A, showed chemical shift changes, primarily in residues adjacent to the mutation sites, indicating only local effects. Further, the patterns of chemical shift changes upon AMP-PNP binding to these mutants were similar to that of the wild type SERCA-N (WT). In contrast to these nucleotide binding site mutants, a mutant found in patients with Darier's disease, E412G, showed small but significant chemical shift changes throughout the protein and rapid precipitation. However, the AMP-PNP dissociation constant ({approx}2.5 mM) was similar to that of WT ({approx}3.8 mM). These results indicate that the E412G mutant retains its catalytic activity but most likely reduces its stability. Our findings provide molecular insight into previous clinical, physiological, and biochemical observations.« less

Deposition of TiOxNy Thin Films with Various Nitrogen Flow Rate:. Growth Behavior and Structural Properties

NASA Astrophysics Data System (ADS)

Cho, S.-J.; Jung, C.-K.; Bae, I.-S.; Song, Y.-H.; Boo, J.-H.

2011-06-01

We have deposited TiOxNy thin films on Si(100) substrates at 500 °C using RF PECVD system. Titanium iso-propoxide was used as precursor with different nitrogen flow rate to control oxygen and nitrogen contents in the films. Changes of chemical states of constituent elements in the deposited films were examined by XPS analysis. The data showed that with increasing nitrogen flow rate, the total amounts of nitrogen and titanium were increased while that of oxygen was decreased, resulting in a binding energy shift toward high energy side. The characteristics of film growth orientation and structure as well as morphology change behavior were also analyzed by XRD, TED, FT-IR, TEM, and SEM. Deposition at higher nitrogen flow rate results in finer clusters with a nanograin size and more effective photocatalytic TiOxNy thin films with hydrophilic surface.

Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

PubMed

Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

2018-05-04

Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

π-Stacking, C-H/π, and halogen bonding interactions in bromobenzene and mixed bromobenzene-benzene clusters.

PubMed

Reid, Scott A; Nyambo, Silver; Muzangwa, Lloyd; Uhler, Brandon

2013-12-19

Noncovalent interactions play an important role in many chemical and biochemical processes. Building upon our recent study of the homoclusters of chlorobenzene, where π-π stacking and CH/π interactions were identified as the most important binding motifs, in this work we present a study of bromobenzene (PhBr) and mixed bromobenzene-benzene clusters. Electronic spectra in the region of the PhBr monomer S0-S1 (ππ*) transition were obtained using resonant two-photon ionization (R2PI) methods combined with time-of-flight mass analysis. As previously found for related systems, the PhBr cluster spectra show a broad feature whose center is red-shifted from the monomer absorption, and electronic structure calculations indicate the presence of multiple isomers and Franck-Condon activity in low-frequency intermolecular modes. Calculations at the M06-2X/aug-cc-pVDZ level find in total eight minimum energy structures for the PhBr dimer: four π-stacked structures differing in the relative orientation of the Br atoms (denoted D1-D4), one T-shaped structure (D5), and three halogen bonded structures (D6-D8). The calculated binding energies of these complexes, corrected for basis set superposition error (BSSE) and zero-point energy (ZPE), are in the range of -6 to -24 kJ/mol. Time-dependent density functional theory (TDDFT) calculations predict that these isomers absorb over a range that is roughly consistent with the breadth of the experimental spectrum. To examine the influence of dipole-dipole interaction, R2PI spectra were also obtained for the mixed PhBr···benzene dimer, where the spectral congestion is reduced and clear vibrational structure is observed. This structure is well-simulated by Franck-Condon calculations that incorporate the lowest frequency intermolecular modes. Calculations find four minimum energy structures for the mixed dimer and predict that the binding energy of the global minimum is reduced by ~30% relative to the global minimum PhBr dimer structure.

Ultra-cold molecules in an atomic Bose-Einstein condensate

NASA Astrophysics Data System (ADS)

Wynar, Roahn Helden

2000-08-01

This thesis is about photoassociation of Bose-condensed 87Rb. Most importantly we report that state selected 87Rb2 molecules were created at rest in a condensate of 87Rb using two-photon photoassociation. Additionally, we have identified three weakly bound states of the 87Rb2 S+u3 , potential for the |1, -1> + |1, - 1> collisional channel. The binding energies of these states are 529.4 +/- .07, 636.0094 +/- .0012, and 24.24 +/- .01 MHz respectively. We have also carried out a detailed study of the density dependence of the shift and width of the two-photon lineshape. This shift and width is modeled using the theory of Bohn and Julienne [34] and in addition to the precise measurement of binding energy we also report the first measurement of an atom molecule scattering length, aam, which we conclude is -180 +/- 150 a0, and the inelastic collision rate, Kinel < 8 × 10-11 cm-3/s. Stimulated Raman free bound coupling in an atomic Bose- Einstein condensate may lead to the formation of a molecular condensate. In order to evaluate this possibility we present a many-body quantum mean field theory of a Bose-Einstein condensate that includes a density dependent coherent coupling between atoms and molecules. This theory yields two coupled equations, one for the evolution of atomic condensate amplitude and one for the evolution of molecular condensate amplitude. The nature of the atomic-molecular condensate evolution is shown to depend on six, model parameters including the coherent coupling, given by cn . The other five parameters can be interpreted as light-shifts and incoherent loss rates. We present a calculation intended to estimate the values of these six parameters for the 87Rb - 87Rb 2 system. Based on the results of this calculation we identify two locations in the 87Rb2 spectrum where coherent transfer of population from atomic condensate to molecular condensate is plausible. Finally, we examine the credibility of the theoretical model used to estimate the six parameters used by the mean field theory. By comparing the measured Stark shifts of two-color resonances with predictions based on our theoretical model we conclude that the model is satisfactory for the v = 37 level of the S+u3 potential. This work also describes the experimental details of stabilizing a Coherent 899-01 Ti:Saphire laser and the experimental methods important to executing photoassociation in a time-averaged-orbiting potential (TOP) trap.

Total enantioselectivity in the DNA binding of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [bpm = 2,2'-bipyrimidine; Me2bpy = 4,4'-dimethyl-2,2'-bipyridine].

PubMed

Smith, Jayden A; Collins, J Grant; Patterson, Bradley T; Keene, F Richard

2004-05-07

The binding of the three stereoisomers (DeltaDelta-, LambdaLambda- and DeltaLambda-) of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to a tridecanucleotide containing a single adenine bulge has been studied by 1H NMR spectroscopy. The addition of the DeltaDelta-isomer to d(CCGAGAATTCCGG)2 induced significant chemical shift changes for the base and sugar resonances of the residues at the bulge site (G3A4G5/C11C10), whereas small shifts were observed upon addition of the enantiomeric LambdaLambda-form. NOESY spectra of the tridecanucleotide bound with the DeltaDelta-isomer revealed intermolecular NOE's between the metal complex and the nucleotide residues at the bulge site, while only weak NOE's were observed to terminal residues to the LambdaLambda-form. Competitive binding studies were performed where both enantiomers were simultaneously added to the tridecanucleotide, and for all ratios of the two stereoisomers the DeltaDelta-isomer remained selectively bound at the bulge site with the LambdaLambda-enantiomer localised at the terminal regions of the tridecanucleotide. The meso-diastereoisomer (DeltaLambda) was found to bind to the tridecanucleotide with characteristics intermediate between the DeltaDelta- and LambdaLambda-enantiomers of the rac form. Two distinct sets of metal complex resonances were observed, with one set having essentially the same shift as the free metal complex, whilst the other set of resonances exhibited significant shifts. The NOE data indicated that the meso-diastereoisomer does not bind as selectively as the DeltaDelta-isomer, with NOE's observed to a greater number of nucleotide residues compared to the DeltaDelta-form. This study provides a rare example of total enantioselectivity in the binding of an inert transition metal complex to DNA, produced by the shape recognition of both ruthenium(II) centres.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Solution structure and interactions of the Escherichia coli cell division activator protein CedA.

PubMed

Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen

2005-05-10

CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.

Mechanism of the calcium-regulation of muscle contraction--in pursuit of its structural basis.

PubMed

Wakabayashi, Takeyuki

2015-01-01

The author reviewed the research that led to establish the structural basis for the mechanism of the calcium-regulation of the contraction of striated muscles. The target of calcium ions is troponin on the thin filaments, of which the main component is the double-stranded helix of actin. A model of thin filament was generated by adding tropomyosin and troponin. During the process to provide the structural evidence for the model, the troponin arm was found to protrude from the calcium-depleted troponin and binds to the carboxyl-terminal region of actin. As a result, the carboxyl-terminal region of tropomyosin shifts and covers the myosin-binding sites of actin to block the binding of myosin. At higher calcium concentrations, the troponin arm changes its partner from actin to the main body of calcium-loaded troponin. Then, tropomyosin shifts back to the position near the grooves of actin double helix, and the myosin-binding sites of actin becomes available to myosin resulting in force generation through actin-myosin interactions.

HLA-DR allele reading register shifting is associated with immunity induced by SERA peptide analogues.

PubMed

Salazar, Luz Mary; Bermúdez, Adriana; Patarroyo, Manuel E

2008-07-18

SERA protein is a leading candidate molecule to be included in an antimalarial vaccine. Conserved high activity binding peptides (HABP) binding to red blood cells (RBC) have been identified in this protein. One of them (6762) localising in the 18-kDa C-terminal fragment was used to induce protective immunity with negative result. Critical RBC binding residues (assessed by glycine-analogue scanning) were replaced by others having the same mass, volume and surface but different polarity, rendering some of them immunogenic as assessed by antibody production against the parasite or its proteins and protection-inducing against challenge with a highly infectious Aotus monkey-adapted Plasmodium falciparum strain. A shift in binding to purified HLA-DR allelic molecules from the same haplotype and in their reading register was found, suggesting that modified molecules had adopted a different (1)H NMR 3D structure allowing a better fit into the MHCII-pept-TCR complex, thereby representing a new mechanism for inducing immune protection.

FTIR study of hydrogen bonding interaction between fluorinated alcohol and unsaturated esters

NASA Astrophysics Data System (ADS)

Sheng, Xia; Jiang, Xiaotong; Zhao, Hailiang; Wan, Dongjin; Liu, Yongde; Ngwenya, Cleopatra Ashley; Du, Lin

2018-06-01

The 1:1 complexes of two unsaturated esters with 2,2,2-trifluoroethanol (TFE) were investigated experimentally and computationally. The experimental observations of the spectral shifts of the OH-stretching vibrational transitions were obtained at 113 cm-1 for TFE-methyl acrylate (MA) and 92 cm-1 for TFE-vinyl acetate (VA). There are three docking sites in the two unsaturated esters for the incoming TFE. The predicted red shifts of the OH-stretching vibrational transitions were found to be larger for the Osbnd H⋯Odbnd C hydrogen bonded conformer than those for the Osbnd H⋯π and Osbnd H⋯O ones. The binding energies further prove that the Osbnd H⋯Odbnd C hydrogen bonded conformers are the most stable ones. On the basis of the DFT calculations as well as previous works, the carbonyl group is the best docking site for TFE. Furthermore, the thermodynamic equilibrium constants of TFE-MA and TFE-VA were obtained at 0.28 and 0.15 by combining the experimental spectra data and the DFT calculations. Consequently, the Gibbs free energies of formation were determined to be 3.2 and 4.8 kJ mol-1 for TFE-MA and TFE-VA, respectively. The quantum theory of atoms in molecules (AIM) and generalized Kohn-Sham energy decomposition analysis (GKS-EDA) were carried out for further characterization of the hydrogen bonding interactions. GKS-EDA shows an "electrostatic" dominated hydrogen bonding character for the Osbnd H⋯Odbnd C hydrogen bonds.

Binding free energy calculations between bovine β-lactoglobulin and four fatty acids using the MMGBSA method.

PubMed

Bello, Martiniano

2014-10-01

The bovine dairy protein β-lactoglobulin (βlg) is a promiscuous protein that has the ability to bind several hydrophobic ligands. In this study, based on known experimental data, the dynamic interaction mechanism between bovine βlg and four fatty acids was investigated by a protocol combining molecular dynamics (MD) simulations and molecular mechanics generalized Born surface area (MMGBSA) binding free energy calculations. Energetic analyses revealed binding free energy trends that corroborated known experimental findings; larger ligand size corresponded to greater binding affinity. Finally, binding free energy decomposition provided detailed information about the key residues stabilizing the complex. © 2014 Wiley Periodicals, Inc.

A Prediction Method of Binding Free Energy of Protein and Ligand

NASA Astrophysics Data System (ADS)

Yang, Kun; Wang, Xicheng

2010-05-01

Predicting the binding free energy is an important problem in bimolecular simulation. Such prediction would be great benefit in understanding protein functions, and may be useful for computational prediction of ligand binding strengths, e.g., in discovering pharmaceutical drugs. Free energy perturbation (FEP)/thermodynamics integration (TI) is a classical method to explicitly predict free energy. However, this method need plenty of time to collect datum, and that attempts to deal with some simple systems and small changes of molecular structures. Another one for estimating ligand binding affinities is linear interaction energy (LIE) method. This method employs averages of interaction potential energy terms from molecular dynamics simulations or other thermal conformational sampling techniques. Incorporation of systematic deviations from electrostatic linear response, derived from free energy perturbation studies, into the absolute binding free energy expression significantly enhances the accuracy of the approach. However, it also is time-consuming work. In this paper, a new prediction method based on steered molecular dynamics (SMD) with direction optimization is developed to compute binding free energy. Jarzynski's equality is used to derive the PMF or free-energy. The results for two numerical examples are presented, showing that the method has good accuracy and efficiency. The novel method can also simulate whole binding proceeding and give some important structural information about development of new drugs.

Impact of segregation energetics on oxygen conductivity at ionic grain boundaries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aidhy, Dilpuneet S; Zhang, Yanwen; Weber, William J

2014-01-01

In pursuit of whether nanocrystallinity could lead to higher anion conductivity, research has revealed contradicting results exposing the limited understanding of point defect energetics at grain boundaries (GBs)/interfaces. By disentangling and addressing key GB energetics issues, i.e., segregation, migration and binding energies of oxygen vacancies in the presence and absence of dopants at the GBs, and the segregation energetics of dopants, we elucidate, using atomic simulations of doped ceria, that dopant segregation is the key factor leading to degradation of oxygen conductivity in nanocrystalline materials. A framework for designing enhanced conducting nanocrystalline materials is proposed where the focus of dopingmore » strategies shifts from bulk to segregation at GBs.« less

Nanoparticle formation of deposited Agn-clusters on free-standing graphene

NASA Astrophysics Data System (ADS)

Al-Hada, M.; Peters, S.; Gregoratti, L.; Amati, M.; Sezen, H.; Parisse, P.; Selve, S.; Niermann, T.; Berger, D.; Neeb, M.; Eberhardt, W.

2017-11-01

Size-selected Agn-clusters on unsupported graphene of a commercial Quantifoil sample have been investigated by surface and element-specific techniques such as transmission electron microscopy (TEM), spatially-resolved inner-shell X-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES). An agglomeration of the highly mobile clusters into nm-sized Ag-nanodots of 2-3 nm is observed. Moreover, crystalline as well as non-periodic fivefold symmetric structures of the Ag-nanoparticles are evident by high-resolution TEM. Using a lognormal size-distribution as revealed by TEM, the measured positive binding energy shift of the air-exposed Ag-nanodots can be explained by the size-dependent dynamical liquid-drop model.

Density functional theoretical analysis with experimental, invitro bioactivity and molecular docking investigations on the pesticide Albendazole

NASA Astrophysics Data System (ADS)

Divya, P.; Bena Jothy, V.

2018-03-01

Optimized structural parameters of Albendazole and corresponding vibrational assignments have been studied using infrared and Raman spectroscopy combined with quantum-chemical calculations. Results of these spectroscopic studies have been successfully compared against obtained experimental data. Difference between experimental and calculated CH3 group wavenumbers was blue-shifted by 58 cm-1 and 43 cm-1, respectively due to electronic effects. In NBO analysis the increase in energies and the shortening of Csbnd N and Cdbnd O bonds gives clear evidence that the resonance of the benzimidazole ring is increased by the groups. Best binding score of Albendazole was obtained with protein 4NQ6 (-5.58 kcal/mol).

Diurnal rhythm of melatonin binding in the rat suprachiasmatic nucleus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Laitinen, J.T.; Castren, E.; Vakkuri, O.

1989-03-01

We used quantitative in vitro autoradiography to localize and characterize 2-/sup 125/I-melatonin binding sites in the rat suprachiasmatic nuclei in relation to pineal melatonin production. In a light:dark cycle of 12:12 h, binding density exhibited significant diurnal variation with a peak at the dark-light transition and a trough 12 hours later. Saturation studies suggested that the decreased binding at light-dark transition might be due to a shift of the putative melatonin receptor to a low affinity state.

Zinc finger protein binding to DNA: an energy perspective using molecular dynamics simulation and free energy calculations on mutants of both zinc finger domains and their specific DNA bases.

PubMed

Hamed, Mazen Y; Arya, Gaurav

2016-05-01

Energy calculations based on MM-GBSA were employed to study various zinc finger protein (ZF) motifs binding to DNA. Mutants of both the DNA bound to their specific amino acids were studied. Calculated energies gave evidence for a relationship between binding energy and affinity of ZF motifs to their sites on DNA. ΔG values were -15.82(12), -3.66(12), and -12.14(11.6) kcal/mol for finger one, finger two, and finger three, respectively. The mutations in the DNA bases reduced the value of the negative energies of binding (maximum value for ΔΔG = 42Kcal/mol for F1 when GCG mutated to GGG, and ΔΔG = 22 kcal/mol for F2, the loss in total energy of binding originated in the loss in electrostatic energies upon mutation (r = .98). The mutations in key amino acids in the ZF motif in positions-1, 2, 3, and 6 showed reduced binding energies to DNA with correlation coefficients between total free energy and electrostatic was .99 and with Van der Waal was .93. Results agree with experimentally found selectivity which showed that Arginine in position-1 is specific to G, while Aspartic acid (D) in position 2 plays a complicated role in binding. There is a correlation between the MD calculated free energies of binding and those obtained experimentally for prepared ZF motifs bound to triplet bases in other reports (), our results may help in the design of ZF motifs based on the established recognition codes based on energies and contributing energies to the total energy.

Regulation of Na(+)/K(+)-ATPase by nuclear respiratory factor 1: implication in the tight coupling of neuronal activity, energy generation, and energy consumption.

PubMed

Johar, Kaid; Priya, Anusha; Wong-Riley, Margaret T T

2012-11-23

NRF-1 regulates mediators of neuronal activity and energy generation. NRF-1 transcriptionally regulates Na(+)/K(+)-ATPase subunits α1 and β1. NRF-1 functionally regulates mediators of energy consumption in neurons. NRF-1 mediates the tight coupling of neuronal activity, energy generation, and energy consumption at the molecular level. Energy generation and energy consumption are tightly coupled to neuronal activity at the cellular level. Na(+)/K(+)-ATPase, a major energy-consuming enzyme, is well expressed in neurons rich in cytochrome c oxidase, an important enzyme of the energy-generating machinery, and glutamatergic receptors that are mediators of neuronal activity. The present study sought to test our hypothesis that the coupling extends to the molecular level, whereby Na(+)/K(+)-ATPase subunits are regulated by the same transcription factor, nuclear respiratory factor 1 (NRF-1), found recently by our laboratory to regulate all cytochrome c oxidase subunit genes and some NMDA and AMPA receptor subunit genes. By means of multiple approaches, including in silico analysis, electrophoretic mobility shift and supershift assays, in vivo chromatin immunoprecipitation, promoter mutational analysis, and real-time quantitative PCR, NRF-1 was found to functionally bind to the promoters of Atp1a1 and Atp1b1 genes but not of the Atp1a3 gene in neurons. The transcripts of Atp1a1 and Atp1b1 subunit genes were up-regulated by KCl and down-regulated by tetrodotoxin. Atp1b1 is positively regulated by NRF-1, and silencing of NRF-1 with small interference RNA blocked the up-regulation of Atp1b1 induced by KCl, whereas overexpression of NRF-1 rescued these transcripts from being suppressed by tetrodotoxin. On the other hand, Atp1a1 is negatively regulated by NRF-1. The binding sites of NRF-1 on Atp1a1 and Atp1b1 are conserved among mice, rats, and humans. Thus, NRF-1 regulates key Na(+)/K(+)-ATPase subunits and plays an important role in mediating the tight coupling between energy consumption, energy generation, and neuronal activity at the molecular level.

A study of planar anchor groups for graphene-based single-molecule electronics.

PubMed

Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

NASA Astrophysics Data System (ADS)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-02-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

From clusters to bulk: A relativistic density functional investigation on a series of gold clusters Aun, n=6,…,147

NASA Astrophysics Data System (ADS)

Häberlen, Oliver D.; Chung, Sai-Cheong; Stener, Mauro; Rösch, Notker

1997-03-01

A series of gold clusters spanning the size range from Au6 through Au147 (with diameters from 0.7 to 1.7 nm) in icosahedral, octahedral, and cuboctahedral structure has been theoretically investigated by means of a scalar relativistic all-electron density functional method. One of the main objectives of this work was to analyze the convergence of cluster properties toward the corresponding bulk metal values and to compare the results obtained for the local density approximation (LDA) to those for a generalized gradient approximation (GGA) to the exchange-correlation functional. The average gold-gold distance in the clusters increases with their nuclearity and correlates essentially linearly with the average coordination number in the clusters. An extrapolation to the bulk coordination of 12 yields a gold-gold distance of 289 pm in LDA, very close to the experimental bulk value of 288 pm, while the extrapolated GGA gold-gold distance is 297 pm. The cluster cohesive energy varies linearly with the inverse of the calculated cluster radius, indicating that the surface-to-volume ratio is the primary determinant of the convergence of this quantity toward bulk. The extrapolated LDA binding energy per atom, 4.7 eV, overestimates the experimental bulk value of 3.8 eV, while the GGA value, 3.2 eV, underestimates the experiment by almost the same amount. The calculated ionization potentials and electron affinities of the clusters may be related to the metallic droplet model, although deviations due to the electronic shell structure are noticeable. The GGA extrapolation to bulk values yields 4.8 and 4.9 eV for the ionization potential and the electron affinity, respectively, remarkably close to the experimental polycrystalline work function of bulk gold, 5.1 eV. Gold 4f core level binding energies were calculated for sites with bulk coordination and for different surface sites. The core level shifts for the surface sites are all positive and distinguish among the corner, edge, and face-centered sites; sites in the first subsurface layer show still small positive shifts.

Theoretical study of transition-metal ions bound to benzene

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

1992-01-01

Theoretical binding energies are reported for all first-row and selected second-row transition metal ions (M+) bound to benzene. The calculations employ basis sets of at least double-zeta plus polarization quality and account for electron correlation using the modified coupled-pair functional method. While the bending is predominantly electrostatic, the binding energies are significantly increased by electron correlation, because the donation from the metal d orbitals to the benzene pi* orbitals is not well described at the self-consistent-field level. The uncertainties in the computed binding energies are estimated to be about 5 kcal/mol. Although the calculated and experimental binding energies generally agree to within their combined uncertainties, it is likely that the true binding energies lie in the lower portion of the experimental range. This is supported by the very good agreement between the theoretical and recent experimental binding energies for AgC6H6(+).

Conformational change of Sos-derived proline-rich peptide upon binding Grb2 N-terminal SH3 domain probed by NMR

NASA Astrophysics Data System (ADS)

Ogura, Kenji; Okamura, Hideyasu

2013-10-01

Growth factor receptor-bound protein 2 (Grb2) is a small adapter protein composed of a single SH2 domain flanked by two SH3 domains. The N-terminal SH3 (nSH3) domain of Grb2 binds a proline-rich region present in the guanine nucleotide releasing factor, son of sevenless (Sos). Using NMR relaxation dispersion and chemical shift analysis methods, we investigated the conformational change of the Sos-derived proline-rich peptide during the transition between the free and Grb2 nSH3-bound states. The chemical shift analysis revealed that the peptide does not present a fully random conformation but has a relatively rigid structure. The relaxation dispersion analysis detected conformational exchange of several residues of the peptide upon binding to Grb2 nSH3.

Executive Resources and Item-Context Binding: Exploring the Influence of Concurrent Inhibition, Updating, and Shifting Tasks on Context Memory

PubMed Central

Nieznański, Marek; Obidziński, Michał; Zyskowska, Emilia; Niedziałkowska, Daria

2015-01-01

Previous research has demonstrated that context memory performance decreases as a result of cognitive load. However, the role of specific executive resources availability has not been specified yet. In a dual-task experiment, participants performed three kinds of concurrent task engaging: inhibition, updating, or shifting operations. In comparison with a no-load single-task condition, a significant decrease in item and context memory was observed, regardless of the kind of executive task. When executive load conditions were compared with non-specific cognitive load conditions, a significant interference effect was observed in the case of the inhibition task. The inhibition process appears to be an aspect of executive control, which relies on the same resource as item-context binding does, especially when binding refers to associations retrieved from long-term memory. PMID:26435761

Interaction of Merocyanine 540 with serum albumins: photophysical and binding studies.

PubMed

Banerjee, Mousumi; Pal, Uttam; Subudhhi, Arijita; Chakrabarti, Abhijit; Basu, Samita

2012-03-01

Photophysical studies on binding interactions of a negatively charged anti-tumor photosensitizer, Merocyanine 540 (MC 540), with serum proteins, bovine serum albumin (BSA) and human serum albumin (HSA), have been performed using absorption and steady-state as well as time-resolved fluorescence techniques. Formation of ground state complex has been confirmed from the detailed studies of absorption spectra of MC 540 in presence of SAs producing isosbestic points. Binding between the proteins and MC 540, which perturbs the existing equilibrium between the fluorescent monomer and its non-fluorescent dimer, induces a remarkable enhancement in fluorescence anisotropy and intensity of MC 540 along with a red shift of its maximum. The binding stoichiometry of MC 540 and SAs are more than 1.0 which depicts that two types of complexes, i.e., 1:1 and 2:1 are formed with addition of varied concentration of protein. Both the steady-state and time-resolved fluorescence results show that in 2:1 complex one of the MC 540 molecules is exposed towards aqueous environment with a greater extent when bound with HSA compared to BSA due to the structural flexibility of that protein. Thermodynamic analyses using van't Hoff plot indicate that the binding between MC 540 and individual SA is an entropy-driven phenomenon. The probable hydrophobic binding site has been located by denaturation of proteins, micropolarity measurement and Förster resonance energy transfer and that is further supported by molecular docking studies. Changes in circular dichroism spectra of BSA in presence of MC 540 depict secondary structural changes of the protein. The induced-CD shows that BSA due to its rigid structure generates chirality in MC 540 much more efficiently compared to HSA. Copyright © 2011 Elsevier B.V. All rights reserved.

Triple-resonance multidimensional NMR study of calmodulin complexed with the binding domain of skeletal muscle myosin light-chain kinase: Indication of a conformational change in the central helix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ikura, Mitsuhiko; Kay, L.E.; Bax, A.

Heteronuclear 3D and 4D NMR experiments have been used to obtain {sup 1}H, {sup 13}C, and {sup 15}N backbone chemical shift assignments in Ca{sup 2+}-loaded clamodulin complexed with a 26-residue synthetic peptide (M13) corresponding to the calmodulin-bionding domain (residues 577-602) of rabbit skeletal muscle muosin light-chain kinase. Comparison of the chemical shift values with those observed in peptide-free calmodulin shows that binding of M13 peptide induces substantial chemical shift changes that are not localized in one particular region of the protein. The largest changes are found in the first helix of the Ca{sup 2+}-binding site 1 (E11-E14), the N-terminal portionmore » of the central helix (M72-D78), and the second helix of the Ca{sup 2+}-binding site 4 (F141-M145). Analysis of backbone NOE connectivities indicates a change from {alpha}-helical to an extended conformation for residues 75-77 upon complexation with M13. Upon complexation with M13, a significant decrease in the amide exchange rate is observed for residues T110, L112, G113, and E114 at the end of the second helix of site 3.« less

Differential recognition of syk-binding sites by each of the two phosphotyrosine-binding pockets of the Vav SH2 domain.

PubMed

Chen, Chih-Hong; Piraner, Dan; Gorenstein, Nina M; Geahlen, Robert L; Beth Post, Carol

2013-11-01

The association of spleen tyrosine kinase (Syk), a central tyrosine kinase in B cell signaling, with Vav SH2 domain is controlled by phosphorylation of two closely spaced tyrosines in Syk linker B: Y342 and Y346. Previous studies established both singly phosphorylated and doubly phosphorylated forms play a role in signaling. The structure of the doubly phosphorylated form identified a new recognition of phosphotyrosine whereby two phosphotyrosines bind simultaneously to the Vav SH2 domain, one in the canonical pTyr pocket and one in the specificity pocket on the opposite side of the central β-sheet. It is unknown if the specificity pocket can bind phosphotyrosine independent of phosphotyrosine binding the pTyr pocket. To address this gap in knowledge, we determined the structure of the complex between Vav1 SH2 and a peptide (SykLB-YpY) modeling the singly phosphorylated-Y346 form of Syk with unphosphorylated Y342. The nuclear magnetic resonance (NMR) data conclusively establish that recognition of phosphotyrosine is swapped between the two pockets; phosphorylated pY346 binds the specificity pocket of Vav1 SH2, and unphosphorylated Y342 occupies what is normally the pTyr binding pocket. Nearly identical changes in chemical shifts occurred upon binding all three forms of singly and doubly phosphorylated peptides; however, somewhat smaller shift perturbations for SykLB-YpY from residues in regions of high internal mobility suggest that internal motions are coupled to binding affinity. The differential recognition that includes this swapped binding of phosphotyrosine to the specificity pocket of Vav SH2 increases the repertoire of possible phosphotyrosine binding by SH2 domains in regulating protein-protein interactions in cellular signaling. Copyright © 2013 Wiley Periodicals, Inc.

Simulation of Reversible Protein–Protein Binding and Calculation of Binding Free Energies Using Perturbed Distance Restraints

PubMed Central

2017-01-01

Virtually all biological processes depend on the interaction between proteins at some point. The correct prediction of biomolecular binding free-energies has many interesting applications in both basic and applied pharmaceutical research. While recent advances in the field of molecular dynamics (MD) simulations have proven the feasibility of the calculation of protein–protein binding free energies, the large conformational freedom of proteins and complex free energy landscapes of binding processes make such calculations a difficult task. Moreover, convergence and reversibility of resulting free-energy values remain poorly described. In this work, an easy-to-use, yet robust approach for the calculation of standard-state protein–protein binding free energies using perturbed distance restraints is described. In the binding process the conformations of the proteins were restrained, as suggested earlier. Two approaches to avoid end-state problems upon release of the conformational restraints were compared. The method was evaluated by practical application to a small model complex of ubiquitin and the very flexible ubiquitin-binding domain of human DNA polymerase ι (UBM2). All computed free energy differences were closely monitored for convergence, and the calculated binding free energies had a mean unsigned deviation of only 1.4 or 2.5 kJ·mol–1 from experimental values. Statistical error estimates were in the order of thermal noise. We conclude that the presented method has promising potential for broad applicability to quantitatively describe protein–protein and various other kinds of complex formation. PMID:28898077

Correlating hydrogen oxidation and evolution activity on platinum at different pH with measured hydrogen binding energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, WC; Zhuang, ZB; Gao, MR

2015-01-08

The hydrogen oxidation/evolution reactions are two of the most fundamental reactions in distributed renewable electrochemical energy conversion and storage systems. The identification of the reaction descriptor is therefore of critical importance for the rational catalyst design and development. Here we report the correlation between hydrogen oxidation/evolution activity and experimentally measured hydrogen binding energy for polycrystalline platinum examined in several buffer solutions in a wide range of electrolyte pH from 0 to 13. The hydrogen oxidation/evolution activity obtained using the rotating disk electrode method is found to decrease with the pH, while the hydrogen binding energy, obtained from cyclic voltammograms, linearlymore » increases with the pH. Correlating the hydrogen oxidation/evolution activity to the hydrogen binding energy renders a monotonic decreasing hydrogen oxidation/evolution activity with the hydrogen binding energy, strongly supporting the hypothesis that hydrogen binding energy is the sole reaction descriptor for the hydrogen oxidation/evolution activity on monometallic platinum.« less

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

PubMed

Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

2013-11-01

We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

Binding Energy and Enzymatic Catalysis.

ERIC Educational Resources Information Center

Hansen, David E.; Raines, Ronald T.

1990-01-01

Discussed is the fundamental role that the favorable free energy of binding of the rate-determining transition state plays in catalysis. The principle that all of the catalytic factors discussed are realized by the use of this binding energy is reviewed. (CW)

Determination of the absolute binding free energies of HIV-1 protease inhibitors using non-equilibrium molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ngo, Son Tung; Nguyen, Minh Tung; Nguyen, Minh Tho

2017-05-01

The absolute binding free energy of an inhibitor to HIV-1 Protease (PR) was determined throughout evaluation of the non-bonded interaction energy difference between the two bound and unbound states of the inhibitor and surrounding molecules by the fast pulling of ligand (FPL) process using non-equilibrium molecular dynamics (NEMD) simulations. The calculated free energy difference terms help clarifying the nature of the binding. Theoretical binding affinities are in good correlation with experimental data, with R = 0.89. The paradigm used is able to rank two inhibitors having the maximum difference of ∼1.5 kcal/mol in absolute binding free energies.

Simultaneous effects of pressure and temperature on donor binding energy in Pöschl-Teller quantum well

NASA Astrophysics Data System (ADS)

Hakimyfard, Alireza; Barseghyan, M. G.; Duque, C. A.; Kirakosyan, A. A.

2009-12-01

In the frame of the variational method and the effective-mass approximation, the effects of hydrostatic pressure and temperature on the binding energy for donor impurities in the Pöschl-Teller quantum well are studied. The binding energy dependencies on the width of the quantum well, the hydrostatic pressure, the impurity position, the temperature, and the parameters of the confining potential are reported. The results show that the binding energy increases (decreases) with the increasing of the hydrostatic pressure (temperature). It is also found that, associated with the symmetry breaking in the Pöschl-Teller quantum well, and depending on the impurity position, the binding energy can increase or decrease.

Implicit ligand theory for relative binding free energies

NASA Astrophysics Data System (ADS)

Nguyen, Trung Hai; Minh, David D. L.

2018-03-01

Implicit ligand theory enables noncovalent binding free energies to be calculated based on an exponential average of the binding potential of mean force (BPMF)—the binding free energy between a flexible ligand and rigid receptor—over a precomputed ensemble of receptor configurations. In the original formalism, receptor configurations were drawn from or reweighted to the apo ensemble. Here we show that BPMFs averaged over a holo ensemble yield binding free energies relative to the reference ligand that specifies the ensemble. When using receptor snapshots from an alchemical simulation with a single ligand, the new statistical estimator outperforms the original.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

The social impacts of the energy shortage, behavioral and attitude shifts

DOT National Transportation Integrated Search

1975-09-01

An analysis of the social impacts of the energy shortage; specifically, an : analysis of shifts in social behavior, or trip-making characteristics, and : shifts in social attitudes towards the energy shortage and conservation policies, : Data were ob...

Curcumin as an amyloid-indicator dye in E. coli.

PubMed

McCrate, Oscar A; Zhou, Xiaoxue; Cegelski, Lynette

2013-05-14

We have demonstrated that curcumin is an amyloid-specific dye in E. coli. Curcumin binds to curliated whole cells and to isolated curli amyloid fibers. Similar to Congo red, curcumin exhibits a red-shift in absorbance and a significant increase in fluorescence upon binding to isolated curli.

Curcumin as an Amyloid-indicator Dye in E. coli †

PubMed Central

McCrate, Oscar A.; Zhou, Xiaoxue; Cegelski, Lynette

2013-01-01

We have demonstrated that curcumin is an amyloid-specific dye in E. coli. Curcumin binds to curliated whole cells and to isolated curli amyloid fibers. Similar to Congo red, curcumin exhibits a red-shift in absorbance and a significant increase in fluorescence upon binding to isolated curli. PMID:23287899

An investigation on the effect of impurity position on the binding energy of quantum box under electric field with pressure and temperature

NASA Astrophysics Data System (ADS)

Yilmaz, S.; Kirak, M.

2018-05-01

In the present study, we have studied theoretically the influences of donor impurity position on the binding energy of a GaAs cubic quantum box structure. The binding energy is calculated as functions of the position of impurity, electric field, temperature and hydrostatic pressure. The variational method is employed to obtain the energy eigenvalues of the structure in the framework of the effective mass approximation. It has been found that the impurity positions with electric field, pressure and temperature have an important effect on the binding energy of structure considered. The results can be used to manufacture semiconductor device application by manipulating the binding energy with the impurity positions, electric field, pressure and temperature.

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

PubMed

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

PubMed

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

2011-10-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

PubMed Central

Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

2011-01-01

The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

Kinetic and CD/MCD spectroscopic studies of the atypical, three-His-ligated, non-heme Fe2+ center in diketone dioxygenase: the role of hydrophilic outer shell residues in catalysis.

PubMed

Straganz, Grit D; Diebold, Adrienne R; Egger, Sigrid; Nidetzky, Bernd; Solomon, Edward I

2010-02-09

Diketone cleaving enzyme (Dke1) is a dioxygenase with an atypical, three-histidine-ligated, mononuclear non-heme Fe(2+) center. To assess the role in enzyme catalysis of the hydrophilic residues in the active site pocket, residues Glu98, Arg80, Tyr70, and Thr107 were subjected to mutational analysis. Steady state and pre-steady state kinetics indicated a role for Glu98 in promoting both substrate binding and O(2) reduction. Additionally, the Glu98 substitution eliminated the pH dependence of substrate binding (k(cat)(app)/K(M)(app)-pH profile) present in wild-type Dke1 (pK(a) = 6.3 +/- 0.4 and 8.4 +/- 0.4). MCD spectroscopy revealed that the Glu98 --> Gln mutation leads to the conversion of the six-coordinate (6C) resting Fe(2+) center present in the wild-type enzyme at pH 7.0 to a mixture of five-coordinate (5C) and 6C sites. The 6C geometry was restored with a pH shift to 9.5 which also resulted in ligand field (LF) energy splittings identical to that found for wild-type (WT) Dke1 at pH 9.5. In WT Dke1, these LF transitions are shifted up in energy by approximately 300 cm(-1) at pH 9.5 relative to pH 7.0. These data, combined with CD pH titrations which reveal a pK(a) of approximately 8.2 for resting WT Dke1 and the Glu98 --> Gln variant, indicate the deprotonation of a metal-ligated water. Together, the kinetic and spectroscopic data reveal a stabilizing effect of Glu98 on the 6C geometry of the metal center, priming it for substrate ligation. Arg80 and Tyr70 are shown to promote O(2) reduction, while Thr107 stabilizes the Fe(II) cofactor.

Phosphine Functionalization GaAs(111)A Surfaces

DOE Office of Scientific and Technical Information (OSTI.GOV)

Traub, M.; Biteen, J; Michalak, D

Phosphorus-functionalized GaAs surfaces have been prepared by exposure of Cl-terminated GaAs(111)A surfaces to triethylphosphine (PEt3) or trichlorophosphine (PCl3), or by the direct functionalization of the native-oxide terminated GaAs(111)A surface with PCl3. The presence of phosphorus on each functionalized surface was confirmed by X-ray photoelectron spectroscopy. High-resolution, soft X-ray photoelectron spectroscopy was used to evaluate the As and Ga 3d regions of such surfaces. On PEt3 treated surfaces, the Ga 3d spectra exhibited a bulk Ga peak as well as peaks that were shifted to 0.35, 0.92 and 1.86 eV higher binding energy. These peaks were assigned to residual Cl-terminated Gamore » surface sites, surficial Ga2O and surficial Ga2O3, respectively. For PCl3-treated surfaces, the Ga 3d spectra displayed peaks ascribable to bulk Ga(As), Ga2O, and Ga2O3, as well as a peak shifted 0.30 eV to higher binding energy relative to the bulk signal. A peak corresponding to Ga(OH)3, observed on the Cl-terminated surface, was absent from all of the phosphine-functionalized surfaces. After reaction of the Cl-terminated GaAs(111)A surface with PCl3 or PEt3, the As 3d spectral region was free of As oxides and As0. Although native oxide-terminated GaAs surfaces were free of As oxides after reaction with PCl3, such surfaces contained detectable amounts of As0. Photoluminescence measurements indicted that phosphine-functionalized surfaces prepared from Cl-terminated GaAs(111)A surfaces had better electrical properties than the native-oxide capped GaAs(111)A surface, while the native-oxide covered surface treated with PCl3 showed no enhancement in PL intensity.« less

Pairwise additivity of energy components in protein-ligand binding: The HIV II protease-Indinavir case

NASA Astrophysics Data System (ADS)

Ucisik, Melek N.; Dashti, Danial S.; Faver, John C.; Merz, Kenneth M.

2011-08-01

An energy expansion (binding energy decomposition into n-body interaction terms for n ≥ 2) to express the receptor-ligand binding energy for the fragmented HIV II protease-Indinavir system is described to address the role of cooperativity in ligand binding. The outcome of this energy expansion is compared to the total receptor-ligand binding energy at the Hartree-Fock, density functional theory, and semiempirical levels of theory. We find that the sum of the pairwise interaction energies approximates the total binding energy to ˜82% for HF and to >95% for both the M06-L density functional and PM6-DH2 semiempirical method. The contribution of the three-body interactions amounts to 18.7%, 3.8%, and 1.4% for HF, M06-L, and PM6-DH2, respectively. We find that the expansion can be safely truncated after n = 3. That is, the contribution of the interactions involving more than three parties to the total binding energy of Indinavir to the HIV II protease receptor is negligible. Overall, we find that the two-body terms represent a good approximation to the total binding energy of the system, which points to pairwise additivity in the present case. This basic principle of pairwise additivity is utilized in fragment-based drug design approaches and our results support its continued use. The present results can also aid in the validation of non-bonded terms contained within common force fields and in the correction of systematic errors in physics-based score functions.

Bovine serum albumin adsorption on functionalized porous silicon surfaces

NASA Astrophysics Data System (ADS)

Tay, Li-Lin; Rowell, Nelson L.; Lockwood, David J.; Boukherroub, Rabah

2004-10-01

The large surface area within porous Si (pSi) and its strong room temperature photoluminescence (PL) make it an ideal host for biological sensors. In particular, the development of pSi-based optical sensors for DNA, enzyme and other biochemical molecules have become of great interest. Here, we demonstrate that the in-situ monitoring of the pSi PL behaviour can be used as a positive identification of bovine serum albumin (BSA) protein adsorption inside the porous matrix. Electrochemically prepared pSi films were first functionalized with undecylenic acid to produce an organic monolayer covalently attached to the porous silicon surfaces. The acid terminal group also provided favourable BSA binding sites on the pSi matrix sidewalls. In-situ PL spectra showed a gradual red shift (up to 12 meV) in the PL peak energy due to the protein incorporation into the porous matrix. The PL then exhibited a continuous blue shift after saturation of the protein molecules in the pores. This blue shift of the PL peak frequency and a steady increase in the PL intensity is evidence of surface oxidation. Comparing the specular reflectance obtained by Fourier transform infrared spectroscopy (FTIR) before and after BSA incubation confirmed the adsorption of protein in the pSi matrix.

A comparative study between para-aminophenyl and ortho-aminophenyl benzothiazoles using NMR and DFT calculations.

PubMed

Pierens, G K; Venkatachalam, T K; Reutens, D

2014-08-01

Ortho-substituted and para-substituted aminophenyl benzothiazoles were synthesised and characterised using NMR spectroscopy. A comparison of the proton chemical shift values reveals significant differences in the observed chemical shift values for the NH protons indicating the presence of a hydrogen bond in all ortho-substituted compounds as compared to the para compounds. The presence of intramolecular hydrogen bond in the ortho amino substituted aminophenyl benzothiazole forces the molecule to be planar which may be an additional advantage in developing these compounds as Alzheimer's imaging agent because the binding to amyloid fibrils prefers planar compounds. The splitting pattern of the methylene proton next to the amino group also showed significant coupling to the amino proton consistent with the notion of the existence of slow exchange and hydrogen bond in the ortho-substituted compounds. This is further verified by density functional theory calculations which yielded a near planar low energy conformer for all the o-aminophenyl benzothiazoles and displayed a hydrogen bond from the amine proton to the nitrogen of the thiazole ring. A detailed analysis of the (1)H, (13)C and (15)N NMR chemical shifts and density functional theory calculated structures of the compounds are described. Copyright © 2014 John Wiley & Sons, Ltd.

Electrocatalytic Reduction of CO 2 at Au Nanoparticle Electrodes: Effects of Interfacial Chemistry on Reduction Behavior

DOE PAGES

Andrews, Evan; Katla, Sai; Kumar, Challa; ...

2015-09-12

Nanoscale Au electrocatalysts demonstrate the extraordinary ability to reduce CO 2 at low overpotentials with high selectivity to CO. Here, we investigate the role of surface chemistry on CO 2 reduction behavior using Au 25 and 5 nm Au nanoparticles. Onset potentials for CO 2 reduction at Au 25 nanoparticles in Nafion binders are shifted anodically by 190 mV while the hydrogen evolution reaction is shifted cathodically by 300 mV relative to Au foil. The net effect of this beneficial separation in onset potentials is relatively high Faradayic efficiencies for CO (90% at 0.8 V versus RHE) at high currentmore » densities. Experimental results show Faradayic efficiencies for CO are greatest using electrodes made with Nafion-immobilized Au 25 nanoparticles. Likewise, CO 2 reduction onset potential shifts are greater for smaller nanoparticles and when Nafion binders are used instead of (sulfonate-free) polyvinylidene fluoride. X-ray photoelectron spectroscopy analysis reveals Au nanoparticles may react with the sulfonates of Nafion binders. Here, the results suggest sulfonate interfaces may alter the binding energies of key species or lead to favorable reconstructions, either of which ultimately results in remarkable improvements in Faradayic efficiencies relative to Au foil electrodes.« less

Influence of Ionic Liquids on Thermodynamics of Small Molecule-DNA Interaction: The Binding of Ethidium Bromide to Calf Thymus DNA.

PubMed

Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik

2016-03-17

Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.

Calculations of proton-binding thermodynamics in proteins.

PubMed

Beroza, P; Case, D A

1998-01-01

Computational models of proton binding can range from the chemically complex and statistically simple (as in the quantum calculations) to the chemically simple and statistically complex. Much progress has been made in the multiple-site titration problem. Calculations have improved with the inclusion of more flexibility in regard to both the geometry of the proton binding and the larger scale protein motions associated with titration. This article concentrated on the principles of current calculations, but did not attempt to survey their quantitative performance. This is (1) because such comparisons are given in the cited papers and (2) because continued developments in understanding conformational flexibility and interaction energies will be needed to develop robust methods with strong predictive power. Nevertheless, the advances achieved over the past few years should not be underestimated: serious calculations of protonation behavior and its coupling to conformational change can now be confidently pursued against a backdrop of increasing understanding of the strengths and limitations of such models. It is hoped that such theoretical advances will also spur renewed experimental interest in measuring both overall titration curves and individual pKa values or pKa shifts. Exploration of the shapes of individual titration curves (as measured by Hill coefficients and other parameters) would also be useful in assessing the accuracy of computations and in drawing connections to functional behavior.

Electronic and optical properties of exciton, trions and biexciton in II-VI parabolic quantum dot

NASA Astrophysics Data System (ADS)

Sujanah, P.; John Peter, A.; Woo Lee, Chang

2015-08-01

Binding energies of exciton, trions and biexciton and their interband optical transition energies are studied in a CdTe/ZnTe quantum dot nanostructure taking into consideration the geometrical confinement effect. The radial spread of the wavefunctions, binding energies, optical transition energies, oscillator strength, radiative life time and the absorption coefficients of exciton, positively and negatively charged excitons and biexciton are carried out. It is found that the ratio of the radiative life time of exciton with the trions and biexciton enhances with the reduction of geometrical confinement. The results show that (i) the binding energies of exciton, positive and negative trions and the biexciton have strong influence on the reduction of geometrical confinement effect, (ii) the binding energy is found to decrease from the binding energies of exciton to positive trion through biexciton and negative trion binding energies, (iii) the oscillator strength of trions is found to be lesser than exciton and the biexciton and (iv) the electronic and optical properties of exciton, trions and the biexciton are considerably dependent on the spatial confinement, incident photon energy and the radiative life time. The obtained results are in good agreement with the other existing literature.

Calculation of Host-Guest Binding Affinities Using a Quantum-Mechanical Energy Model.

PubMed

Muddana, Hari S; Gilson, Michael K

2012-06-12

The prediction of protein-ligand binding affinities is of central interest in computer-aided drug discovery, but it is still difficult to achieve a high degree of accuracy. Recent studies suggesting that available force fields may be a key source of error motivate the present study, which reports the first mining minima (M2) binding affinity calculations based on a quantum mechanical energy model, rather than an empirical force field. We apply a semi-empirical quantum-mechanical energy function, PM6-DH+, coupled with the COSMO solvation model, to 29 host-guest systems with a wide range of measured binding affinities. After correction for a systematic error, which appears to derive from the treatment of polar solvation, the computed absolute binding affinities agree well with experimental measurements, with a mean error 1.6 kcal/mol and a correlation coefficient of 0.91. These calculations also delineate the contributions of various energy components, including solute energy, configurational entropy, and solvation free energy, to the binding free energies of these host-guest complexes. Comparison with our previous calculations, which used empirical force fields, point to significant differences in both the energetic and entropic components of the binding free energy. The present study demonstrates successful combination of a quantum mechanical Hamiltonian with the M2 affinity method.

Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo

PubMed Central

Plamont, Marie-Aude; Billon-Denis, Emmanuelle; Maurin, Sylvie; Gauron, Carole; Pimenta, Frederico M.; Specht, Christian G.; Shi, Jian; Quérard, Jérôme; Pan, Buyan; Rossignol, Julien; Moncoq, Karine; Morellet, Nelly; Volovitch, Michel; Lescop, Ewen; Chen, Yong; Triller, Antoine; Vriz, Sophie; Le Saux, Thomas; Jullien, Ludovic; Gautier, Arnaud

2016-01-01

This paper presents Yellow Fluorescence-Activating and absorption-Shifting Tag (Y-FAST), a small monomeric protein tag, half as large as the green fluorescent protein, enabling fluorescent labeling of proteins in a reversible and specific manner through the reversible binding and activation of a cell-permeant and nontoxic fluorogenic ligand (a so-called fluorogen). A unique fluorogen activation mechanism based on two spectroscopic changes, increase of fluorescence quantum yield and absorption red shift, provides high labeling selectivity. Y-FAST was engineered from the 14-kDa photoactive yellow protein by directed evolution using yeast display and fluorescence-activated cell sorting. Y-FAST is as bright as common fluorescent proteins, exhibits good photostability, and allows the efficient labeling of proteins in various organelles and hosts. Upon fluorogen binding, fluorescence appears instantaneously, allowing monitoring of rapid processes in near real time. Y-FAST distinguishes itself from other tagging systems because the fluorogen binding is highly dynamic and fully reversible, which enables rapid labeling and unlabeling of proteins by addition and withdrawal of the fluorogen, opening new exciting prospects for the development of multiplexing imaging protocols based on sequential labeling. PMID:26711992

Small fluorescence-activating and absorption-shifting tag for tunable protein imaging in vivo.

PubMed

Plamont, Marie-Aude; Billon-Denis, Emmanuelle; Maurin, Sylvie; Gauron, Carole; Pimenta, Frederico M; Specht, Christian G; Shi, Jian; Quérard, Jérôme; Pan, Buyan; Rossignol, Julien; Moncoq, Karine; Morellet, Nelly; Volovitch, Michel; Lescop, Ewen; Chen, Yong; Triller, Antoine; Vriz, Sophie; Le Saux, Thomas; Jullien, Ludovic; Gautier, Arnaud

2016-01-19

This paper presents Yellow Fluorescence-Activating and absorption-Shifting Tag (Y-FAST), a small monomeric protein tag, half as large as the green fluorescent protein, enabling fluorescent labeling of proteins in a reversible and specific manner through the reversible binding and activation of a cell-permeant and nontoxic fluorogenic ligand (a so-called fluorogen). A unique fluorogen activation mechanism based on two spectroscopic changes, increase of fluorescence quantum yield and absorption red shift, provides high labeling selectivity. Y-FAST was engineered from the 14-kDa photoactive yellow protein by directed evolution using yeast display and fluorescence-activated cell sorting. Y-FAST is as bright as common fluorescent proteins, exhibits good photostability, and allows the efficient labeling of proteins in various organelles and hosts. Upon fluorogen binding, fluorescence appears instantaneously, allowing monitoring of rapid processes in near real time. Y-FAST distinguishes itself from other tagging systems because the fluorogen binding is highly dynamic and fully reversible, which enables rapid labeling and unlabeling of proteins by addition and withdrawal of the fluorogen, opening new exciting prospects for the development of multiplexing imaging protocols based on sequential labeling.

Estimation of the Binding Free Energy of AC1NX476 to HIV-1 Protease Wild Type and Mutations Using Free Energy Perturbation Method.

PubMed

Ngo, Son Tung; Mai, Binh Khanh; Hiep, Dinh Minh; Li, Mai Suan

2015-10-01

The binding mechanism of AC1NX476 to HIV-1 protease wild type and mutations was studied by the docking and molecular dynamics simulations. The binding free energy was calculated using the double-annihilation binding free energy method. It is shown that the binding affinity of AC1NX476 to wild type is higher than not only ritonavir but also darunavir, making AC1NX476 become attractive candidate for HIV treatment. Our theoretical results are in excellent agreement with the experimental data as the correlation coefficient between calculated and experimentally measured binding free energies R = 0.993. Residues Asp25-A, Asp29-A, Asp30-A, Ile47-A, Gly48-A, and Val50-A from chain A, and Asp25-B from chain B play a crucial role in the ligand binding. The mutations were found to reduce the receptor-ligand interaction by widening the binding cavity, and the binding propensity is mainly driven by the van der Waals interaction. Our finding may be useful for designing potential drugs to combat with HIV. © 2015 John Wiley & Sons A/S.

Relative Energy Shift of a Two-Level Atom in a Cylindrical Spacetime

NASA Astrophysics Data System (ADS)

Zhang, Jia-Lin

2012-11-01

We investigate the evolution dynamics of a two-level atom system interacting with the massless scalar field in a Cylindrical spacetime. We find that both the energy shifts of ground state and excited state can be separated into two parts due to the vacuum fluctuations. One is the corresponding energy shift for a rest atom in four-dimensional Minkowski space without spatial compactification, the other is just the modification of the spatial compactified periodic length. It will reveal that the influence of the presence of one spatial compactified dimension can not be neglected in Lamb shift as the relative energy level shift of an atom.

N-glycan based ER molecular chaperone and protein quality control system: the calnexin binding cycle

PubMed Central

Lamriben, Lydia; Graham, Jill B.; Adams, Benjamin M.; Hebert, Daniel N.

2015-01-01

Helenius and colleagues proposed over twenty-years ago a paradigm-shifting model for how chaperone binding in the endoplasmic reticulum was mediated and controlled for a new type of molecular chaperone- the carbohydrate binding chaperones, calnexin and calreticulin. While the originally established basics for this lectin chaperone binding cycle holds true today, there has been a number of important advances that have expanded our understanding of its mechanisms of action, role in protein homeostasis, and its connection to disease states that are highlighted in this review. PMID:26676362

Large scale affinity calculations of cyclodextrin host-guest complexes: Understanding the role of reorganization in the molecular recognition process

PubMed Central

Wickstrom, Lauren; He, Peng; Gallicchio, Emilio; Levy, Ronald M.

2013-01-01

Host-guest inclusion complexes are useful models for understanding the structural and energetic aspects of molecular recognition. Due to their small size relative to much larger protein-ligand complexes, converged results can be obtained rapidly for these systems thus offering the opportunity to more reliably study fundamental aspects of the thermodynamics of binding. In this work, we have performed a large scale binding affinity survey of 57 β-cyclodextrin (CD) host guest systems using the binding energy distribution analysis method (BEDAM) with implicit solvation (OPLS-AA/AGBNP2). Converged estimates of the standard binding free energies are obtained for these systems by employing techniques such as parallel Hamitionian replica exchange molecular dynamics, conformational reservoirs and multistate free energy estimators. Good agreement with experimental measurements is obtained in terms of both numerical accuracy and affinity rankings. Overall, average effective binding energies reproduce affinity rank ordering better than the calculated binding affinities, even though calculated binding free energies, which account for effects such as conformational strain and entropy loss upon binding, provide lower root mean square errors when compared to measurements. Interestingly, we find that binding free energies are superior rank order predictors for a large subset containing the most flexible guests. The results indicate that, while challenging, accurate modeling of reorganization effects can lead to ligand design models of superior predictive power for rank ordering relative to models based only on ligand-receptor interaction energies. PMID:25147485

Selective Co-Encapsulation Inside an M6 L4 Cage.

PubMed

Leenders, Stefan H A M; Becker, René; Kumpulainen, Tatu; de Bruin, Bas; Sawada, Tomohisa; Kato, Taito; Fujita, Makoto; Reek, Joost N H

2016-10-17

There is broad interest in molecular encapsulation as such systems can be utilized to stabilize guests, facilitate reactions inside a cavity, or give rise to energy-transfer processes in a confined space. Detailed understanding of encapsulation events is required to facilitate functional molecular encapsulation. In this contribution, it is demonstrated that Ir and Rh-Cp-type metal complexes can be encapsulated inside a self-assembled M 6 L 4 metallocage only in the presence of an aromatic compound as a second guest. The individual guests are not encapsulated, suggesting that only the pair of guests can fill the void of the cage. Hence, selective co-encapsulation is observed. This principle is demonstrated by co-encapsulation of a variety of combinations of metal complexes and aromatic guests, leading to several ternary complexes. These experiments demonstrate that the efficiency of formation of the ternary complexes depends on the individual components. Moreover, selective exchange of the components is possible, leading to formation of the most favorable complex. Besides the obvious size effect, a charge-transfer interaction may also contribute to this effect. Charge-transfer bands are clearly observed by UV/Vis spectrophotometry. A change in the oxidation potential of the encapsulated electron donor also leads to a shift in the charge-transfer energy bands. As expected, metal complexes with a higher oxidation potential give rise to a higher charge-transfer energy and a larger hypsochromic shift in the UV/Vis spectrum. These subtle energy differences may potentially be used to control the binding and reactivity of the complexes bound in a confined space. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Feature-binding errors after eye movements and shifts of attention.

PubMed

Golomb, Julie D; L'heureux, Zara E; Kanwisher, Nancy

2014-05-01

When people move their eyes, the eye-centered (retinotopic) locations of objects must be updated to maintain world-centered (spatiotopic) stability. Here, we demonstrated that the attentional-updating process temporarily distorts the fundamental ability to bind object locations with their features. Subjects were simultaneously presented with four colors after a saccade-one in a precued spatiotopic target location-and were instructed to report the target's color using a color wheel. Subjects' reports were systematically shifted in color space toward the color of the distractor in the retinotopic location of the cue. Probabilistic modeling exposed both crude swapping errors and subtler feature mixing (as if the retinotopic color had blended into the spatiotopic percept). Additional experiments conducted without saccades revealed that the two types of errors stemmed from different attentional mechanisms (attention shifting vs. splitting). Feature mixing not only reflects a new perceptual phenomenon, but also provides novel insight into how attention is remapped across saccades.

Free energy decomposition of protein-protein interactions.

PubMed

Noskov, S Y; Lim, C

2001-08-01

A free energy decomposition scheme has been developed and tested on antibody-antigen and protease-inhibitor binding for which accurate experimental structures were available for both free and bound proteins. Using the x-ray coordinates of the free and bound proteins, the absolute binding free energy was computed assuming additivity of three well-defined, physical processes: desolvation of the x-ray structures, isomerization of the x-ray conformation to a nearby local minimum in the gas-phase, and subsequent noncovalent complex formation in the gas phase. This free energy scheme, together with the Generalized Born model for computing the electrostatic solvation free energy, yielded binding free energies in remarkable agreement with experimental data. Two assumptions commonly used in theoretical treatments; viz., the rigid-binding approximation (which assumes no conformational change upon complexation) and the neglect of vdW interactions, were found to yield large errors in the binding free energy. Protein-protein vdW and electrostatic interactions between complementary surfaces over a relatively large area (1400--1700 A(2)) were found to drive antibody-antigen and protease-inhibitor binding.

Quantitative proteomics analysis by iTRAQ revealed underlying changes in thermotolerance of Arthrospira platensis.

PubMed

Chang, Rong; Lv, Bingxin; Li, Bosheng

2017-08-08

Growth temperature is a critical factor that affects cultivation of Arthrospira platensis which is a type of cyanobacterium widely known as Spirulina that has significant commercial value. To investigate the molecular mechanism underlying the thermotolerance of Spirulina, differential protein expression profiling was carried out using iTRAQ-based quantitative proteomic analysis. This study only analyzed changes in thylakoids. Among the 2085 proteins quantified, 43 differentially expressed proteins were selected based on the fold change cutoff scores of ≥2 or ≤0.5 for up-regulation or down-regulation, respectively. An analysis of these 43 proteins found that 23% of them are photosynthetic system proteins which include photosynthetic enzymes and pigment proteins. The dynamic change of these proteins indicates that photosynthetic system functions were profoundly affected under heat stress and the light-dependent reactions were probably the most sensitive to temperature changes. Meanwhile, to cope with the low energy production due to impaired photosynthesis there was a considerable down-shift in protein synthesis which is a very energy demanding process. The impaired photosynthesis led to low energy generation that was compensated by a down-shift in translation (the most energy-demanding process) and an up-shift of glycolysis. The reduction of many ribosome proteins may lead to a loss in translation efficiency; therefore, Spirulina may adopted a different mechanism to increase translational elongation under heat stress to compensate for this loss, such as elevate L7/L12 proteins. Changes were also found in the classical heat shock proteins, the ROS scavenging system, DNA-binding proteins, and some membrane proteins. In conclusion, this research demonstrate that heat stress induces profound changes in cellular physiology and shed light on the mechanism of the heat stress response and thermotolerance of Arthrospira platensis. Arthrospira platensis, widely known as Spirulina, is a type of cyanobacteria which is cultivated at large scale for it great commercial value. It has become a consensus that continually increasing temperature due to global warming is bringing serious threat to agriculture, including the Spirulina cultivation. High temperature not only limits biomass accumulation by Spirulina, but also changes the composition of nutrition. Therefore there is a greater need than ever before to understand how Spirulina tolerates and cope with high temperature. In this study, we for the first time applied the iTRAQ-based quantitative proteomic technology to investigate the thermotolerance of Spirulina. Our results showed that many biological processes were altered by heat stress. Most significantly, we found that heat stress harmed the photosynthesis ability and caused low energy production, and to deal with this situation, energy demanding processes like protein synthesis were down-shifted and the alternative energy metabolism process glycolysis was up-shifted. Our results also show other important proteins, like the classical heat shock proteins and some antioxidant proteins, are also increased. Thus our study sheds light to our understanding of the mechanism underlying the thermotolerance of Spirulina. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of metal in M 3(btc) 2 and M 2(dobdc) MOFs for O 2/N 2 separations: A combined density functional theory and experimental study

DOE PAGES

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.; ...

2015-03-02

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Counter-ion binding and mobility in the presence of hydrophobic polyions – combining molecular dynamics simulations and NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Druchok, Maksym; Malikova, Natalie; Rollet, Anne-Laure

Counter-ion binding and mobility in aqueous solutions of partially hydrophobic ionene oligoions is studied here by a combination of all-atomic molecular dynamics (MD) simulations and NMR ({sup 19}F and {sup 81}Br nuclei) measurements. We present results for 12, 12–ionenes in the presence of different halide ions (F{sup −}, Cl{sup −}, Br{sup −} and I{sup −}), as well as their mixtures; the latter allowing us to probe counter-ion selectivity of these oligoions. We consolidate both structural and dynamic information, in particular simulated radial distribution functions and average residence times of counter-ions in the vicinity of ionenes and NMR data in themore » form of counter-ion chemical shift and self-diffusion coefficients. On one hand, previously reported enthalpy of dilution and mixing measurements show a reverse counter-ion sequence for 12, 12–ionenes with respect to their less hydrophobic 3, 3– and 6, 6– analogues. On the other hand, the current MD and NMR data, reflecting the counter-ion binding tendencies to the ionene chain, give evidence for the same ordering as that observed by MD for 3, 3–ionenes. This is not seen as a contradiction and can be rationalized on the basis of increasing chain hydrophobicity, which has different consequences for enthalpy and ion-binding. The latter is reflecting free energy changes and as such includes both enthalpic and entropic contributions.« less

Binding free energies for nicotine analogs inhibiting cytochrome P450 2A6 by a combined use of molecular dynamics simulations and QM/MM-PBSA calculations.

PubMed

Lu, Haiting; Huang, Xiaoqin; AbdulHameed, Mohamed Diwan M; Zhan, Chang-Guo

2014-04-01

Molecular dynamics (MD) simulations and hybrid quantum mechanical/molecular mechanical (QM/MM) calculations have been performed to explore the dynamic behaviors of cytochrome P450 2A6 (CYP2A6) binding with nicotine analogs (that are typical inhibitors) and to calculate their binding free energies in combination with Poisson-Boltzmann surface area (PBSA) calculations. The combined MD simulations and QM/MM-PBSA calculations reveal that the most important structural parameters affecting the CYP2A6-inhibitor binding affinity are two crucial internuclear distances, that is, the distance between the heme iron atom of CYP2A6 and the coordinating atom of the inhibitor, and the hydrogen-bonding distance between the N297 side chain of CYP2A6 and the pyridine nitrogen of the inhibitor. The combined MD simulations and QM/MM-PBSA calculations have led to dynamic CYP2A6-inhibitor binding structures that are consistent with the observed dynamic behaviors and structural features of CYP2A6-inhibitor binding, and led to the binding free energies that are in good agreement with the experimentally-derived binding free energies. The agreement between the calculated binding free energies and the experimentally-derived binding free energies suggests that the combined MD and QM/MM-PBSA approach may be used as a valuable tool to accurately predict the CYP2A6-inhibitor binding affinities in future computational design of new, potent and selective CYP2A6 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

Reexamine structures and relative stability of medium-sized silicon clusters: Low-lying endohedral fullerene-like clusters Si 30-Si 38

NASA Astrophysics Data System (ADS)

Yoo, Soohaeng; Shao, Nan; Zeng, X. C.

2009-10-01

We report improved results of lowest-lying silicon clusters Si 30-Si 38. A large population of low-energy clusters are collected from previous searches by several research groups and the binding energies of these clusters are computed using density-functional theory (DFT) methods. Best candidates (isomers with high binding energies) are identified from the screening calculations. Additional constrained search is then performed for the best candidates using the basin-hopping method combined with DFT geometry optimization. The obtained low-lying clusters are classified according to binding energies computed using either the Perdew-Burke-Ernzerhof (PBE) functional or the Becke exchange and Lee-Yang-Parr correlation (BLYP) functional. We propose to rank low-lying clusters according to the mean PBE/BLYP binding energies in view that the PBE functional tends to give greater binding energies for more compact clusters whereas the BLYP functional tends to give greater binding energies for less compact clusters or clusters composed of small-sized magic-number clusters. Except for Si 30, the new search confirms again that medium-size silicon clusters Si 31-Si 38 constructed with proper fullerene cage motifs are most promising to be the lowest-energy structures.

Frequency-Shift Detectors Bind Binaural as Well as Monaural Frequency Representations

ERIC Educational Resources Information Center

Carcagno, Samuele; Semal, Catherine; Demany, Laurent

2011-01-01

Previous psychophysical work provided evidence for the existence of automatic frequency-shift detectors (FSDs) that establish perceptual links between successive sounds. In this study, we investigated the characteristics of the FSDs with respect to the binaural system. Listeners were presented with sound sequences consisting of a chord of pure…

Visuospatial bootstrapping: Binding useful visuospatial information during verbal working memory encoding does not require set-shifting executive resources.

PubMed

Calia, Clara; Darling, Stephen; Havelka, Jelena; Allen, Richard J

2018-05-01

Immediate serial recall of digits is better when the digits are shown by highlighting them in a familiar array, such as a phone keypad, compared with presenting them serially in a single location, a pattern referred to as "visuospatial bootstrapping." This pattern implies the establishment of temporary links between verbal and spatial working memory, alongside access to information in long-term memory. However, the role of working memory control processes like those implied by the "Central Executive" in bootstrapping has not been directly investigated. Here, we report a study addressing this issue, focusing on executive processes of attentional shifting. Tasks in which information has to be sequenced are thought to be heavily dependent on shifting. Memory for digits presented in keypads versus single locations was assessed under two secondary task load conditions, one with and one without a sequencing requirement, and hence differing in the degree to which they invoke shifting. Results provided clear evidence that multimodal binding (visuospatial bootstrapping) can operate independently of this form of executive control process.

NMR assignments of juvenile hormone binding protein in complex with JH III.

PubMed

Suzuki, Rintaro; Tase, Akira; Fujimoto, Zui; Shiotsuki, Takahiro; Yamazaki, Toshimasa

2009-06-01

A hemolymph juvenile hormone binding protein (JHBP) shuttles hydrophobic JH, a key hormone in regulation of the insect life cycle, from the site of the JH biosynthesis to the cells of target organs. We report complete NMR chemical shift assignments of Bombyx mori JHBP in the JH III-bound state.

Mechanism of the calcium-regulation of muscle contraction — In pursuit of its structural basis —

PubMed Central

WAKABAYASHI, Takeyuki

2015-01-01

The author reviewed the research that led to establish the structural basis for the mechanism of the calcium-regulation of the contraction of striated muscles. The target of calcium ions is troponin on the thin filaments, of which the main component is the double-stranded helix of actin. A model of thin filament was generated by adding tropomyosin and troponin. During the process to provide the structural evidence for the model, the troponin arm was found to protrude from the calcium-depleted troponin and binds to the carboxyl-terminal region of actin. As a result, the carboxyl-terminal region of tropomyosin shifts and covers the myosin-binding sites of actin to block the binding of myosin. At higher calcium concentrations, the troponin arm changes its partner from actin to the main body of calcium-loaded troponin. Then, tropomyosin shifts back to the position near the grooves of actin double helix, and the myosin-binding sites of actin becomes available to myosin resulting in force generation through actin-myosin interactions. PMID:26194856

Statistical modeling of competitive threshold collision-induced dissociation

NASA Astrophysics Data System (ADS)

Rodgers, M. T.; Armentrout, P. B.

1998-08-01

Collision-induced dissociation of (R1OH)Li+(R2OH) with xenon is studied using guided ion beam mass spectrometry. R1OH and R2OH include the following molecules: water, methanol, ethanol, 1-propanol, 2-propanol, and 1-butanol. In all cases, the primary products formed correspond to endothermic loss of one of the neutral alcohols, with minor products that include those formed by ligand exchange and loss of both ligands. The cross-section thresholds are interpreted to yield 0 and 298 K bond energies for (R1OH)Li+-R2OH and relative Li+ binding affinities of the R1OH and R2OH ligands after accounting for the effects of multiple ion-molecule collisions, internal energy of the reactant ions, and dissociation lifetimes. We introduce a means to simultaneously analyze the cross sections for these competitive dissociations using statistical theories to predict the energy dependent branching ratio. Thermochemistry in good agreement with previous work is obtained in all cases. In essence, this statistical approach provides a detailed means of correcting for the "competitive shift" inherent in multichannel processes.

Druggable pockets and binding site centric chemical space: a paradigm shift in drug discovery.

PubMed

Pérot, Stéphanie; Sperandio, Olivier; Miteva, Maria A; Camproux, Anne-Claude; Villoutreix, Bruno O

2010-08-01

Detection, comparison and analyses of binding pockets are pivotal to structure-based drug design endeavors, from hit identification, screening of exosites and de-orphanization of protein functions to the anticipation of specific and non-specific binding to off- and anti-targets. Here, we analyze protein-ligand complexes and discuss methods that assist binding site identification, prediction of druggability and binding site comparison. The full potential of pockets is yet to be harnessed, and we envision that better understanding of the pocket space will have far-reaching implications in the field of drug discovery, such as the design of pocket-specific compound libraries and scoring functions.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

PubMed

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Understanding the electronic structure of CdSe quantum dot-fullerene (C{sub 60}) hybrid nanostructure for photovoltaic applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarkar, Sunandan; Rajbanshi, Biplab; Sarkar, Pranab, E-mail: pranab.sarkar@visva-bharati.ac.in

2014-09-21

By using the density-functional tight binding method, we studied the electronic structure of CdSe quantum dot(QD)-buckminsterfullerene (C{sub 60}) hybrid systems as a function of both the size of the QD and concentration of the fullerene molecule. Our calculation reveals that the lowest unoccupied molecular orbital energy level of the hybrid CdSeQD-C{sub 60} systems lies on the fullerene moiety, whereas the highest occupied molecular orbital (HOMO) energy level lies either on the QD or the fullerene depending on size of the CdSe QD. We explored the possibility of engineering the energy level alignment by varying the size of the CdSe QD.more » With increase in size of the QD, the HOMO level is shifted upward and crosses the HOMO level of the C{sub 60}-thiol molecule resulting transition from the type-I to type-II band energy alignment. The density of states and charge density plot support these types of band gap engineering of the CdSe-C{sub 60} hybrid systems. This type II band alignment indicates the possibility of application of this nanohybrid for photovoltaic purpose.« less

Confinement of water molecule inside (2, 2) graphyne nanotube

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deb, Jyotirmoy; Bhattacharya, Barnali; Sarkar, Utpal, E-mail: utpalchemiitkgp@yahoo.com

2016-05-23

Using density functional theory (DFT) calculations with generalized gradient approximation, the interaction between H{sub 2}O molecule and (2, 2) graphyne nanotube (GNT) has been investigated. The stable configuration due to the insertion of H{sub 2}O molecule inside (2, 2) GNT is determined on the basis of binding energy. The band gap of the GNT decreases due to the confinement of H{sub 2}O molecule. The charge analysis reveals that electrons are shifted from the H{sub 2}O molecule to the GNT. The electronic property of the GNT is highly influenced by the presence of H{sub 2}O molecule; thus, we may design amore » GNT based sensor for the detection of water molecule.« less

Binding free energy analysis of protein-protein docking model structures by evERdock.

PubMed

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-14

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

Binding free energy analysis of protein-protein docking model structures by evERdock

NASA Astrophysics Data System (ADS)

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-01

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

Allosteric activation via kinetic control: Potassium accelerates a conformational change in IMP dehydrogenase†

PubMed Central

Riera, Thomas V.; Zheng, Lianqing; Josephine, Helen R.; Min, Donghong; Yang, Wei; Hedstrom, Lizbeth

2011-01-01

Allosteric activators are generally believed to shift the equilibrium distribution of enzyme conformations to favor a catalytically productive structure; the kinetics of conformational exchange is seldom addressed. Several observations suggested that the usual allosteric mechanism might not apply to the activation of IMP dehydrogenase (IMPDH) by monovalent cations. Therefore we investigated the mechanism of K+ activation in IMPDH by delineating the kinetic mechanism in the absence of monovalent cations. Surprisingly, the K+-dependence of kcat derives from the rate of flap closure, which increases by ≥65-fold in the presence of K+. We performed both alchemical free energy simulations and potential of mean force calculations using the orthogonal space random walk strategy to computationally analyze how K+ accelerates this conformational change. The simulations recapitulate the preference of IMPDH for K+, validating the computational models. When K+ is replaced with a dummy ion, the residues of the K+ binding site relax into ordered secondary structure, creating a barrier to conformational exchange. K+ mobilizes these residues by providing alternate interactions for the main chain carbonyls. Potential of mean force calculations indicate that K+ changes the shape of the energy well, shrinking the reaction coordinate by shifting the closed conformation toward the open state. This work suggests that allosteric regulation can be under kinetic as well as thermodynamic control. PMID:21870820

Adsorption orientation effects of porphyrin dyes on the performance of DSSC: Comparison of benzoic acid and tropolone anchoring groups binding onto the TiO2 anatase (101) surface

NASA Astrophysics Data System (ADS)

Zhu, Han-Cheng; Zhang, Ji; Wang, Ying-Lin

2018-03-01

A new porphyrin dye with tropolone anchoring group showing superior stability but lower efficiency versus the promising dye YD2-o-C8 with benzoic acid anchoring group was theoretically investigated for the first time. A series of important parameters related to the efficiency of DSSC were calculated to explore the nature of the experimentally observed lower efficiency and superior stability of tropolone-based solar cells. We found these two dyes with different anchoring groups show comparable electron injection and dye regeneration process. Interestingly, the red-shifted absorption spectrum, relatively weaker ability of releasing protons, and the larger conduction band energy shift of tropolone-based dyes all demonstrated it should show better performance than the benzoic acid dyes, which contradicts with the experimental results. However, through investigating the interaction between the porphyrin dye and the semiconductor by analyzing the electron localization function of the porphyrin dye and preforming energy decomposition analysis, we found that the direction of lone-pair electrons of carbonyl oxygen in the tropolone-based dye makes the dye prefer to adsorb on the surface in an inclined way, in contrary to the benzoic acid-based dye that favored a vertical adsorption. The inclined adsorption could significantly accelerate the charge recombination process between the injected electrons and the oxidized dye, leading to a decreased efficiency of DSSC.

Hard templating ultrathin polycrystalline hematite nanosheets: effect of nano-dimension on CO2 to CO conversion via the reverse water-gas shift reaction.

PubMed

Fishman, Zachary S; He, Yulian; Yang, Ke R; Lounsbury, Amanda W; Zhu, Junqing; Tran, Thanh Minh; Zimmerman, Julie B; Batista, Victor S; Pfefferle, Lisa D

2017-09-14

Understanding how nano-dimensionality impacts iron oxide based catalysis is central to a wide range of applications. Here, we focus on hematite nanosheets, nanowires and nanoparticles as applied to catalyze the reverse water gas shift (RWGS) probe reaction. We introduce a novel approach to synthesize ultrathin (4-7 nm) hematite nanosheets using copper oxide nanosheets as a hard template and propose a reaction mechanism based on density functional theory (DFT) calculations. Hematite nanowires and nanoparticles were also synthesized and characterized. H 2 temperature programmed reduction (H 2 -TPR) and RWGS reactions were performed to glean insights into the mechanism of CO 2 conversion to CO over the iron oxide nanomaterials and were compared to H 2 binding energy calculations based on density functional theory. While the nanosheets did exhibit high CO 2 conversion, 28% at 510 °C, we found that the iron oxide nanowires had the highest CO 2 conversion, reaching 50% at 750 °C under atmospheric pressure. No products besides CO and H 2 O were detected.

Fermi Level shifting, Charge Transfer and Induced Magnetic Coupling at La0.7Ca0.3MnO3/LaNiO3 Interface

PubMed Central

Ning, Xingkun; Wang, Zhanjie; Zhang, Zhidong

2015-01-01

A large magnetic coupling has been observed at the La0.7Ca0.3MnO3/LaNiO3 (LCMO/LNO) interface. The x-ray photoelectron spectroscopy (XPS) study results show that Fermi level continuously shifted across the LCMO/LNO interface in the interface region. In addition, the charge transfer between Mn and Ni ions of the type Mn3+ − Ni3+ → Mn4+ − Ni2+ with the oxygen vacancies are observed in the interface region. The intrinsic interfacial charge transfer can give rise to itinerant electrons, which results in a “shoulder feature” observed at the low binding energy in the Mn 2p core level spectra. Meanwhile, the orbital reconstruction can be mapped according to the Fermi level position and the charge transfer mode. It can be considered that the ferromagnetic interaction between Ni2+ and Mn4+ gives rise to magnetic regions that pin the ferromagnetic LCMO and cause magnetic coupling at the LCMO/LNO interface. PMID:25676088

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE PAGES

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

2017-04-06

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Electronic structure of a laterally graded ZrO2-TiO2 film on Si(100) prepared by metal-organic chemical vapor deposition in ultrahigh vacuum

NASA Astrophysics Data System (ADS)

Richter, J. H.; Karlsson, P. G.; Sandell, A.

2008-05-01

A TiO2-ZrO2 film with laterally graded stoichiometry has been prepared by metal-organic chemical vapor deposition in ultrahigh vacuum. The film was characterized in situ using synchrotron radiation photoelectron spectroscopy (PES) and x-ray absorption spectroscopy. PES depth profiling clearly shows that Ti ions segregate toward the surface region when mixed with ZrO2. The binding energy of the ZrO2 electronic levels is constant with respect to the local vacuum level. The binding energy of the TiO2 electronic levels is aligned to the Fermi level down to a Ti /Zr ratio of about 0.5. At a Ti /Zr ratio between 0.1 and 0.5, the TiO2 related electronic levels become aligned to the local vacuum level. The addition of small amounts of TiO2 to ZrO2 results in a ZrO2 band alignment relative to the Fermi level that is less asymmetric than for pure ZrO2. The band edge positions shift by -0.6eV for a Ti /Zr ratio of 0.03. This is explained in terms of an increase in the work function when adding TiO2, an effect that becomes emphasized by Ti surface segregation.

Bioluminescence resonance energy transfer (BRET) imaging of protein–protein interactions within deep tissues of living subjects

PubMed Central

Dragulescu-Andrasi, Anca; Chan, Carmel T.; Massoud, Tarik F.; Gambhir, Sanjiv S.

2011-01-01

Identifying protein–protein interactions (PPIs) is essential for understanding various disease mechanisms and developing new therapeutic approaches. Current methods for assaying cellular intermolecular interactions are mainly used for cells in culture and have limited use for the noninvasive assessment of small animal disease models. Here, we describe red light-emitting reporter systems based on bioluminescence resonance energy transfer (BRET) that allow for assaying PPIs both in cell culture and deep tissues of small animals. These BRET systems consist of the recently developed Renilla reniformis luciferase (RLuc) variants RLuc8 and RLuc8.6, used as BRET donors, combined with two red fluorescent proteins, TagRFP and TurboFP635, as BRET acceptors. In addition to the native coelenterazine luciferase substrate, we used the synthetic derivative coelenterazine-v, which further red-shifts the emission maxima of Renilla luciferases by 35 nm. We show the use of these BRET systems for ratiometric imaging of both cells in culture and deep-tissue small animal tumor models and validate their applicability for studying PPIs in mice in the context of rapamycin-induced FK506 binding protein 12 (FKBP12)-FKBP12 rapamycin binding domain (FRB) association. These red light-emitting BRET systems have great potential for investigating PPIs in the context of drug screening and target validation applications. PMID:21730157

Enzymology below 200 K: The kinetics and thermodynamics of the photochemistry catalyzed by protochlorophyllide oxidoreductase

PubMed Central

Heyes, Derren J.; Ruban, Alexander V.; Wilks, Helen M.; Hunter, C. Neil

2002-01-01

The chlorophyll biosynthesis enzyme protochlorophyllide reductase (POR) catalyzes the light-dependent reduction of protochlorophyllide (Pchlide) into chlorophyllide in the presence of NADPH. As POR is light-dependent, catalysis can be initiated by illumination of the enzyme-substrate complex at low temperatures, making it an attractive model for studying aspects of biological proton and hydride transfers. The early stages in the photoreduction, involving Pchlide binding and an initial photochemical reaction, have been studied in vitro by using low-temperature fluorescence and absorbance measurements. Formation of the ternary POR-NADPH-Pchlide complex produces red shifts in the fluorescence and absorbance maxima of Pchlide, allowing the dissociation constant for Pchlide binding to be measured. We demonstrate that the product of an initial photochemical reaction, which can occur below 200 K, is a nonfluorescent intermediate with a broad absorbance band at 696 nm (A696) that is suggested to represent an ion radical complex. The temperature dependence of the rate of A696 formation has allowed the activation energy for the photochemical step to be calculated and has shown that POR catalysis can proceed at much lower temperatures than previously thought. Calculations of differences in free energy between various reaction intermediates have been calculated; these, together with the quantum efficiency for Pchlide conversion, suggest a quantitative model for the thermodynamics of the light-driven step of Pchlide reduction. PMID:12177453

Effects of non-enzymatic glycation in human serum albumin. Spectroscopic analysis

NASA Astrophysics Data System (ADS)

Szkudlarek, A.; Sułkowska, A.; Maciążek-Jurczyk, M.; Chudzik, M.; Równicka-Zubik, J.

2016-01-01

Human serum albumin (HSA), transporting protein, is exposed during its life to numerous factors that cause its functions become impaired. One of the basic factors - glycation of HSA - occurs in diabetes and may affect HSA-drug binding. Accumulation of advanced glycation end-products (AGEs) leads to diseases e.g. diabetic and non-diabetic cardiovascular diseases, Alzheimer disease, renal disfunction and in normal aging. The aim of the present work was to estimate how non-enzymatic glycation of human serum albumin altered its tertiary structure using fluorescence technique. We compared glycated human serum albumin by glucose (gHSAGLC) with HSA glycated by fructose (gHSAFRC). We focused on presenting the differences between gHSAFRC and nonglycated (HSA) albumin used acrylamide (Ac), potassium iodide (KI) and 2-(p-toluidino)naphthalene-6-sulfonic acid (TNS). Changes of the microenvironment around the tryptophan residue (Trp-214) of non-glycated and glycated proteins was investigated by the red-edge excitation shift method. Effect of glycation on ligand binding was examined by the binding of phenylbutazone (PHB) and ketoprofen (KP), which a primary high affinity binding site in serum albumin is subdomain IIA and IIIA, respectively. At an excitation and an emission wavelength of λex 335 nm and λem 420 nm, respectively the increase of fluorescence intensity and the blue-shift of maximum fluorescence was observed. It indicates that the glycation products decreases the polarity microenvironment around the fluorophores. Analysis of red-edge excitation shift method showed that the red-shift for gHSAFRC is higher than for HSA. Non-enzymatic glycation also caused, that the Trp residue of gHSAFRC becomes less accessible for the negatively charged quencher (I-), KSV value is smaller for gHSAFRC than for HSA. TNS fluorescent measurement demonstrated the decrease of hydrophobicity in the glycated albumin. KSV constants for gHSA-PHB systems are higher than for the unmodified serum albumin, while KSV values for gHSA-KP systems are only slightly lower than that obtained for HSA-KP. The affinity of PHB to the glycated HSA is stronger than to the non-glycated in the first class binding sites within subdomain IIA, in the vicinity of Trp-214. Ketoprofen bound to unmodified human serum albumin stronger than for glycated albumin and one class of binding sites is observed (Scatchard linear plots).

Direct multiplex imaging and optogenetics of Rho GTPases enabled by near-infrared FRET.

PubMed

Shcherbakova, Daria M; Cox Cammer, Natasha; Huisman, Tsipora M; Verkhusha, Vladislav V; Hodgson, Louis

2018-06-01

Direct visualization and light control of several cellular processes is a challenge, owing to the spectral overlap of available genetically encoded probes. Here we report the most red-shifted monomeric near-infrared (NIR) fluorescent protein, miRFP720, and the fully NIR Förster resonance energy transfer (FRET) pair miRFP670-miRFP720, which together enabled design of biosensors compatible with CFP-YFP imaging and blue-green optogenetic tools. We developed a NIR biosensor for Rac1 GTPase and demonstrated its use in multiplexed imaging and light control of Rho GTPase signaling pathways. Specifically, we combined the Rac1 biosensor with CFP-YFP FRET biosensors for RhoA and for Rac1-GDI binding, and concurrently used the LOV-TRAP tool for upstream Rac1 activation. We directly observed and quantified antagonism between RhoA and Rac1 dependent on the RhoA-downstream effector ROCK; showed that Rac1 activity and GDI binding closely depend on the spatiotemporal coordination between these two molecules; and simultaneously observed Rac1 activity during optogenetic manipulation of Rac1.

Biochip-based instruments development for space exploration: influence of the antibody immobilization process on the biochip resistance to freeze-drying, temperature shifts and cosmic radiations

NASA Astrophysics Data System (ADS)

Coussot, G.; Moreau, T.; Faye, C.; Vigier, F.; Baqué, M.; Le Postollec, A.; Incerti, S.; Dobrijevic, M.; Vandenabeele-Trambouze, O.

2017-04-01

Due to the diversity of antibody (Ab)-based biochips chemistries available and the little knowledge about biochips resistance to space constraints, immobilization of Abs on the surface of the biochips dedicated to Solar System exploration is challenging. In the present paper, we have developed ten different biochip models including covalent or affinity immobilization with full-length Abs or Ab fragments. Ab immobilizations were carried out in oriented/non-oriented manner using commercial activated surfaces with N-hydroxysuccinic ester (NHS-surfaces) or homemade surfaces using three generations of dendrimers (dendrigraft of poly L-lysine (DGL) surfaces). The performances of the Ab -based surfaces were cross-compared on the following criteria: (i) analytical performances (expressed by both the surface density of immobilized Abs and the amount of antigens initially captured by the surface) and (ii) resistance of surfaces to preparation procedure (freeze-drying, storage) or spatial constraints (irradiation and temperature shifts) encountered during a space mission. The latter results have been expressed as percentage of surface binding capacity losses (or percentage of remaining active Abs). The highest amount of captured antigen was achieved with Ab surfaces having full-length Abs and DGL-surfaces that have much higher surface densities than commercial NHS-surface. After freeze-drying process, thermal shift and storage sample exposition, we found that more than 80% of surface binding sites remained active in this case. In addition, the resistance of Ab surfaces to irradiation with particles such as electron, carbon ions or protons depends not only on the chemistries (covalent/affinity linkages) and strategies (oriented/non-oriented) used to construct the biochip, but also on the type, energy and fluence of incident particles. Our results clearly indicate that full-length Ab immobilization on NHS-surfaces and DGL-surfaces should be preferred for potential use in instruments for planetary exploration.

High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

PubMed

Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

1997-07-01

The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

A poly-epoxy surface explored by Hartree-Fock ΔSCF simulations of C1s XPS spectra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gavrielides, A.; Duguet, T., E-mail: thomas.duguet@ensiacet.fr, E-mail: Paul.Bagus@unt.edu; Esvan, J.

Whereas poly-epoxy polymers represent a class of materials with a wide range of applications, the structural disorder makes them difficult to model. In the present work, we use good experimental model samples in the sense that they are pure, fully polymerized, flat and smooth, defect-free, and suitable for ultrahigh vacuum x-ray photoelectron spectroscopy, XPS, experiments. In parallel, we perform Hartree-Fock, HF, calculations of the binding energies, BEs, of the C1s electrons in a model molecule composed of the two constituents of the poly-epoxy sample. These C1s BEs were determined using the HF ΔSCF method, which is known to yield accuratemore » values, especially for the shifts of the BEs, ΔBEs. We demonstrate the benefits of combining rigorous theory with careful XPS measurements in order to obtain correct assignments of the C1s XPS spectra of the polymer sample. Both the relative binding energies—by the ΔSCF method—and relative intensities—in the sudden approximation, SA, are calculated. It results in an excellent match with the experimental spectra. We are able to identify 9 different chemical environments under the C1s peak, where an exclusively experimental work would have found only 3 contributions. In addition, we observe that some contributions are localized at discrete binding energies, whereas others allow a much wider range because of the variation of their second neighbor bound polarization. Therefore, HF-ΔSCF simulations significantly increase the spectral resolution of XPS and thus offer a new avenue for the exploration of the surface of polymers.« less

On binding energy of trions in bulk materials

NASA Astrophysics Data System (ADS)

Filikhin, Igor; Kezerashvili, Roman Ya.; Vlahovic, Branislav

2018-03-01

We study the negatively T- and positively T+ charged trions in bulk materials in the effective mass approximation within the framework of a potential model. The binding energies of trions in various semiconductors are calculated by employing Faddeev equation in configuration space. Results of calculations of the binding energies for T- are consistent with previous computational studies and are in reasonable agreement with experimental measurements, while the T+ is unbound for all considered cases. The mechanism of formation of the binding energy of trions is analyzed by comparing contributions of a mass-polarization term related to kinetic energy operators and a term related to the Coulomb repulsion of identical particles.

Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

PubMed Central

Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

2017-01-01

We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

Mechanism of Protein Denaturation: Partial Unfolding of the P22 Coat Protein I-Domain by Urea Binding.

PubMed

Newcomer, Rebecca L; Fraser, LaTasha C R; Teschke, Carolyn M; Alexandrescu, Andrei T

2015-12-15

The I-domain is an insertion domain of the bacteriophage P22 coat protein that drives rapid folding and accounts for over half of the stability of the full-length protein. We sought to determine the role of hydrogen bonds (H-bonds) in the unfolding of the I-domain by examining (3)JNC' couplings transmitted through H-bonds, the temperature and urea-concentration dependence of (1)HN and (15)N chemical shifts, and native-state hydrogen exchange at urea concentrations where the domain is predominantly folded. The native-state hydrogen-exchange data suggest that the six-stranded β-barrel core of the I-domain is more stable against unfolding than a smaller subdomain comprised of a short α-helix and three-stranded β-sheet. H-bonds, separately determined from solvent protection and (3)JNC' H-bond couplings, are identified with an accuracy of 90% by (1)HN temperature coefficients. The accuracy is improved to 95% when (15)N temperature coefficients are also included. In contrast, the urea dependence of (1)HN and (15)N chemical shifts is unrelated to H-bonding. The protein segments with the largest chemical-shift changes in the presence of urea show curved or sigmoidal titration curves suggestive of direct urea binding. Nuclear Overhauser effects to urea for these segments are also consistent with specific urea-binding sites in the I-domain. Taken together, the results support a mechanism of urea unfolding in which denaturant binds to distinct sites in the I-domain. Disordered segments bind urea more readily than regions in stable secondary structure. The locations of the putative urea-binding sites correlate with the lower stability of the structure against solvent exchange, suggesting that partial unfolding of the structure is related to urea accessibility. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Using Tryptophan Mutants To Probe the Structural and Functional Status of BsSCO, a Copper Binding, Cytochrome c Oxidase Assembly Protein from Bacillus subtilis.

PubMed

Hussain, Shina; Andrews, Diann; Hill, Bruce C

2017-12-05

The synthesis of cytochrome c oxidase protein from Bacillus subtilis (i.e., BsSCO) binds copper with picomolar affinity, which increases the protein's melting temperature (i.e., T M ) by 20 °C. Here two native tryptophans (i.e., W36 and W101) are identified as major contributors to BsSCO's structural form, and their contributions to the stability, intrinsic fluorescence, and copper binding properties of BsSCO are explored. Single mutations of tryptophan to phenylalanine decrease the T M by 10 °C and the folding free energy by 3-4 kcal/mol. A more severe change to alanine (i.e., W36A BsSCO) decreases the T M by 20 °C and the stability by 9 kcal/mol. However, these mutants bind copper with high affinity and assemble cytochrome c oxidase in vivo. Replacing phenylalanine at a position near (∼5 Å) the copper binding site with tryptophan (i.e., F42W) increases the T M of apo-BsSCO by 3 °C but diminishes the effect of copper binding. When both native tryptophans are changed to alanine, apo-BsSCO is unfolded in vitro and is not functional in cytochrome c oxidase assembly in vivo. A double-mutant of BsSCO in which W36A is combined with F42W exhibits a form of metastability. Apo-W36A/F42W BsSCO melts at 37 °C, which upon binding of copper shifts to 65 °C. B. subtilis expressing W36A/F42W BsSCO and grown at 37 °C does not assemble cytochrome c oxidase. However, when these cells are cooled to 25 °C, cytochrome c oxidase activity is recovered. Our results illustrate the subtle relationship between the structural stability and functional properties of BsSCO in the assembly of cytochrome c oxidase.

Construction of genetically engineered M13K07 helper phage for simultaneous phage display of gold binding peptide 1 and nuclear matrix protein 22 ScFv antibody.

PubMed

Fatemi, Farnaz; Amini, Seyed Mohammad; Kharrazi, Sharmin; Rasaee, Mohammad Javad; Mazlomi, Mohammad Ali; Asadi-Ghalehni, Majid; Rajabibazl, Masoumeh; Sadroddiny, Esmaeil

2017-11-01

The most common techniques of antibody phage display are based on the use of M13 filamentous bacteriophages. This study introduces a new genetically engineered M13K07 helper phage displaying multiple copies of a known gold binding peptide on p8 coat proteins. The recombinant helper phages were used to rescue a phagemid vector encoding the p3 coat protein fused to the nuclear matrix protein 22 (NMP22) ScFv antibody. Transmission electron microscopy (TEM), UV-vis absorbance spectroscopy, and field emission scanning electron microscopy (FE-SEM) with energy dispersive X-ray spectroscopy (EDX) analysis revealed that the expression of gold binding peptide 1 (GBP1) on major coat protein p8 significantly enhances the gold-binding affinity of M13 phages. The recombinant bacteriophages at concentrations above 5×10 4 pfu/ml red-shifted the UV-vis absorbance spectra of gold nanoparticles (AuNPs); however, the surface plasmon resonance of gold nanoparticles was not changed by the wild type bacteriophages at concentrations up to 10 12 pfu/ml. The phage ELISA assay demonstrated the high affinity binding of bifunctional bacteriophages to NMP22 antigen at concentrations of 10 5 and 10 6 pfu/ml. Thus, the p3 end of the bifunctional bacteriophages would be able to bind to specific target antigen, while the AuNPs were assembled along the coat of virus for signal generation. Our results indicated that the complex of antigen-bacteriophages lead to UV-vis spectral changes of AuNPs and NMP22 antigen in concentration range of 10-80μg/ml can be detected by bifunctional bacteriophages at concentration of 10 4 pfu/ml. The ability of bifunctional bacteriophages to bind to antigen and generate signal at the same time, makes this approach applicable for identifying different antigens in immunoassay techniques. Copyright © 2017 Elsevier B.V. All rights reserved.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Curcumin Binding to Beta Amyloid: A Computational Study.

PubMed

Rao, Praveen P N; Mohamed, Tarek; Teckwani, Karan; Tin, Gary

2015-10-01

Curcumin, a chemical constituent present in the spice turmeric, is known to prevent the aggregation of amyloid peptide implicated in the pathophysiology of Alzheimer's disease. While curcumin is known to bind directly to various amyloid aggregates, no systematic investigations have been carried out to understand its ability to bind to the amyloid aggregates including oligomers and fibrils. In this study, we constructed computational models of (i) Aβ hexapeptide (16) KLVFFA(21) octamer steric-zipper β-sheet assembly and (ii) full-length Aβ fibril β-sheet assembly. Curcumin binding in these models was evaluated by molecular docking and molecular dynamics (MD) simulation studies. In both the models, curcumin was oriented in a linear extended conformation parallel to fiber axis and exhibited better stability in the Aβ hexapeptide (16) KLVFFA(21) octamer steric-zipper model (Ebinding  = -10.05 kcal/mol) compared to full-length Aβ fibril model (Ebinding  = -3.47 kcal/mol). Analysis of MD trajectories of curcumin bound to full-length Aβ fibril shows good stability with minimum Cα-atom RMSD shifts. Interestingly, curcumin binding led to marked fluctuations in the (14) HQKLVFFA(21) region that constitute the fibril spine with RMSF values ranging from 1.4 to 3.6 Å. These results show that curcumin binding to Aβ shifts the equilibrium in the aggregation pathway by promoting the formation of non-toxic aggregates. © 2015 John Wiley & Sons A/S.

Exploring the free-energy landscape of carbohydrate-protein complexes: development and validation of scoring functions considering the binding-site topology

NASA Astrophysics Data System (ADS)

Eid, Sameh; Saleh, Noureldin; Zalewski, Adam; Vedani, Angelo

2014-12-01

Carbohydrates play a key role in a variety of physiological and pathological processes and, hence, represent a rich source for the development of novel therapeutic agents. Being able to predict binding mode and binding affinity is an essential, yet lacking, aspect of the structure-based design of carbohydrate-based ligands. We assembled a diverse data set comprising 273 carbohydrate-protein crystal structures with known binding affinity and evaluated the prediction accuracy of a large collection of well-established scoring and free-energy functions, as well as combinations thereof. Unfortunately, the tested functions were not capable of reproducing binding affinities in the studied complexes. To simplify the complex free-energy surface of carbohydrate-protein systems, we classified the studied proteins according to the topology and solvent exposure of the carbohydrate-binding site into five distinct categories. A free-energy model based on the proposed classification scheme reproduced binding affinities in the carbohydrate data set with an r 2 of 0.71 and root-mean-squared-error of 1.25 kcal/mol ( N = 236). The improvement in model performance underlines the significance of the differences in the local micro-environments of carbohydrate-binding sites and demonstrates the usefulness of calibrating free-energy functions individually according to binding-site topology and solvent exposure.

Engineering the work function of buckled boron α-sheet by lithium adsorption: a first-principles investigation.

PubMed

Zheng, Bing; Yu, Hai-tao; Xie, Ying; Lian, Yong-fu

2014-11-26

First-principles density functional theory calculations were performed to study the effect of Li adsorption on the structural and electronic properties, particularly the work function, of boron α-sheet. The calculated binding energies indicated that boron α-sheet could be well stabilized by the adsorption of Li atoms. Furthermore, the work functions of Li-adsorbed boron α-sheets were observed to decrease drastically with increasing Li coverage. The work functions are lower than that of Mg and even, for some of them, lower than that of Ca, indicating a considerable potential application of Li-adsorbed boron α-sheets as field-emission and electrode materials. Based on the calculated geometric and electronic structures, we discuss in details some possible aspects affecting the work function. The Li coverage dependence of the work functions of Li-adsorbed boron α-sheets was further confirmed by electrostatic potential analyses. The relationship between the work function variation and the Fermi and vacuum energy level shifts was also discussed, and we observed that the variation of the work function is primarily associated with the shift of the Fermi energy level. It is the surface dipole formed by the interaction between adatoms and substrate that should be responsible for the observed variation of the work function, whereas the increasing negative charge and rumpling for boron α-sheet only play minor roles. Additionally, the effect of Li adatoms on the work function of boron α-sheet was confirmed to be much stronger than that of graphene or a graphene double layer.

Pattern analysis uncovers a chronic ethanol-induced disruption of the switch-like dynamics of C/EBP-β and C/EBP-α genome-wide binding during liver regeneration

PubMed Central

Kuttippurathu, Lakshmi; Patra, Biswanath; Cook, Daniel; Hoek, Jan B.

2017-01-01

Chronic ethanol intake impairs liver regeneration through a system-wide alteration in the regulatory networks driving the response to injury. Our study focused on the initial phase of response to 2/3rd partial hepatectomy (PHx) to investigate how adaptation to chronic ethanol intake affects the genome-wide binding profiles of the transcription factors C/EBP-β and C/EBP-α. These factors participate in complementary and often opposing functions for maintaining cellular differentiation, regulating metabolism, and governing cell growth during liver regeneration. We analyzed ChIP-seq data with a comparative pattern count (COMPACT) analysis, which exhaustively enumerates temporal patterns of discretized binding profiles to identify dominant as well as subtle patterns that may not be apparent from conventional clustering analyses. We found that adaptation to chronic ethanol intake significantly alters the genome-wide binding profile of C/EBP-β and C/EBP-α before and following PHx. A subset of these ethanol-induced changes include C/EBP-β binding to promoters of genes involved in the profibrogenic transforming growth factor-β pathway, and both C/EBP-β and C/EBP-α binding to promoters of genes involved in the cell cycle, apoptosis, homeostasis, and metabolic processes. The shift in C/EBP binding loci, coupled with an ethanol-induced increase in C/EBP-β binding at 6 h post-resection, indicates that ethanol adaptation may change both the amount and nature of C/EBP binding postresection. Taken together, our results suggest that chronic ethanol consumption leads to a spatially and temporally reorganized activity at many genomic loci, resulting in a shift in the dynamic balance and coordination of cellular processes underlying regenerative response. PMID:27815535

Measuring the Influence of Dielectric Environment on 2D Excitons in Monolayer Semiconductors: Insight from High Magnetic Fields1

NASA Astrophysics Data System (ADS)

Stier, Andreas

The relatively heavy electrons and holes in monolayer semiconductors such as MoS2 form tightly-bound excitons with large binding energies, thus motivating magneto-optical studies in high magnetic fields. Because 2D excitons in these materials necessarily lie close to a surface, their properties are expected to be strongly influenced by the surrounding dielectric environment. However, systematic studies exploring this role are challenging, in part because the most readily accessible exciton parameter - the exciton's optical transition energy - is largely unaffected by the surrounding medium. Here we show that the role of the dielectric environment can be revealed through its systematic influence on the size of the exciton, which can be directly measured via the diamagnetic shift of the exciton transition in high magnetic fields. Using exfoliated WSe2 monolayers affixed to single-mode optical fibers, we tune the surrounding dielectric environment by encapsulating the monolayers with different materials, and perform polarization resolved low-temperature magneto-absorption studies to 65 tesla. The systematic increase of the exciton's size with dielectric screening, and concurrent two-fold reduction in binding energy (also inferred from these measurements), is quantitatively compared with leading theoretical models based on the Keldysh potential. These results demonstrate how exciton properties can be tuned in future 2D devices and van der Waals heterostructures. 1In collaboration with S.A. Crooker (NHMFL); J. Kono (Rice University); K.M. McCreary, B.T. Jonker (Naval Research Lab); N.P. Wilson, G. Clark, X. Xu (University of Washington).

Comprehensive study of interaction between biocompatible PEG-InP/ZnS QDs and bovine serum albumin.

PubMed

Sannaikar, M S; Inamdar, Laxmi S; Pujar, G H; Wari, M N; Balasinor, Nafisa H; Inamdar, S R

2018-05-01

Polyethylene glycol (PEG) surface modified biocompatible InP/ZnS quantum dots (QDs) act as a potential alternative for conventional carcinogenic cadmium-based quantum dots for in vivo and in vitro studies. Comprehensively, we studied the interaction between a model protein bovine serum albumin (BSA) and PEGylated toxic free InP/ZnS QDs using various spectroscopic tools such as absorption, fluorescence quenching, time resolved and synchronous fluorescence spectroscopic measurements. These studies principally show that tryptophan (Trp) residues of BSA have preferable binding affinity towards PEG-InP/ZnS QDs surface and a blue shift in Trp fluorescence emission is a signature of conformational changes in its hydrophobic microenvironment. Photoluminescence (PL) intensity of Trp is quenched by ground state complex formation (static quenching) at room temperature. However, InP/ZnS@BSA conjugates become unstable with increasing temperature and PL intensity of Trp is quenched via dynamic quenching by PEG-InP/ZnS QDs. Experimentally determined thermodynamic parameters for these conjugates have shown spontaneity, entropy driven and exothermic nature of bio-conjugation. The calculated binding affinity (n ≅ 1, Hill coefficient) suggest that the affinity of InP/ZnS QDs for a BSA protein is not dependent on whether or not other BSA proteins are already bound to the QD surface. Energy transfer efficiency (E), Trp residue to InP/ZnS QDs distances and energy transfer rate (k T ) were all obtained from FÖrster resonance energy. Copyright © 2017 John Wiley & Sons, Ltd.

Van der Waals Epitaxy of GaSe/Graphene Heterostructure: Electronic and Interfacial Properties.

PubMed

Ben Aziza, Zeineb; Henck, Hugo; Pierucci, Debora; Silly, Mathieu G; Lhuillier, Emmanuel; Patriarche, Gilles; Sirotti, Fausto; Eddrief, Mahmoud; Ouerghi, Abdelkarim

2016-10-07

Stacking two-dimensional materials in so-called van der Waals (vdW) heterostructures, like the combination of GaSe and graphene, provides the ability to obtain hybrid systems which are suitable to design optoelectronic devices. Here, we report the structural and electronic properties of the direct growth of multilayered GaSe by Molecular beam Epitaxy (MBE) on graphene. Reflection high-energy electron diffraction (RHEED) images exhibited sharp streaky features indicative of high quality GaSe layer produced via a vdW epitaxy. Micro-Raman spectroscopy showed that, after the vdW hetero-interface formation, the Raman signature of pristine graphene is preserved. However, the GaSe film tuned the charge density of graphene layer by shifting the Dirac point by about 80 meV toward lower binding energies, attesting an electron transfer from graphene to GaSe. Angle-resolved photoemission spectroscopy (ARPES) measurements showed that the maximum of the valence band of few layers of GaSe are located at the Γ point at a binding energy of about -0.73 eV relatively to the Fermi level (p-type doping). From the ARPES measurements, a hole effective mass defined along the ΓM direction and equal to about m*/m0 = -1.1 was determined. By coupling the ARPES data with high resolution X-ray photoemission spectroscopy (HR-XPS) measurements, the Schottky interface barrier height was estimated to be 1.2 eV. These findings allow deeper understanding of the interlayer interactions and the electronic structure of GaSe/graphene vdW heterostructure.

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

Funnel metadynamics as accurate binding free-energy method

PubMed Central

Limongelli, Vittorio; Bonomi, Massimiliano; Parrinello, Michele

2013-01-01

A detailed description of the events ruling ligand/protein interaction and an accurate estimation of the drug affinity to its target is of great help in speeding drug discovery strategies. We have developed a metadynamics-based approach, named funnel metadynamics, that allows the ligand to enhance the sampling of the target binding sites and its solvated states. This method leads to an efficient characterization of the binding free-energy surface and an accurate calculation of the absolute protein–ligand binding free energy. We illustrate our protocol in two systems, benzamidine/trypsin and SC-558/cyclooxygenase 2. In both cases, the X-ray conformation has been found as the lowest free-energy pose, and the computed protein–ligand binding free energy in good agreement with experiments. Furthermore, funnel metadynamics unveils important information about the binding process, such as the presence of alternative binding modes and the role of waters. The results achieved at an affordable computational cost make funnel metadynamics a valuable method for drug discovery and for dealing with a variety of problems in chemistry, physics, and material science. PMID:23553839

Regulation of the sodium bicarbonate cotransporter kNBC1 function: role of Asp(986), Asp(988) and kNBC1-carbonic anhydrase II binding.

PubMed

Gross, Eitan; Pushkin, Alexander; Abuladze, Natalia; Fedotoff, Olga; Kurtz, Ira

2002-11-01

The HCO(3)(-) : Na(+) cotransport stoichiometry of the electrogenic sodium bicarbonate cotransporter kNBC1 determines the reversal potential (E(rev)) and thus the net direction of transport of these ions through the cotransporter. Previously, we showed that phosphorylation of kNBC1-Ser(982) in the carboxy-terminus of kNBC1 (kNBC1-Ct), by cAMP-protein kinase A (PKA), shifts the stoichiometry from 3 : 1 to 2 : 1 and that binding of bicarbonate to the cotransporter is electrostaticaly modulated. These results raise the possibility that phosphorylated kNBC1-Ser(982), or other nearby negatively charged residues shift the stoichiometry by blocking a bicarbonate-binding site. In the current study, we examined the role of the negative charge on Ser(982)-phosphate and three aspartate residues in a D986NDD custer in altering the stoichiometry of kNBC1. mPCT cells expressing kNBC1 mutants were grown on filters and mounted in an Ussing chamber for electrophysiological studies. Enhanced green fluorescence protein (EGFP)-tagged mutant constructs expressed in the same cells were used to determine the phosphorylation status of kNBC1-Ser(982). The data indicate that both kNBC1-Asp(986) and kNBC1-Asp(988), but not kNBC1-Asp(989), are required for the phosphorylation-induced shift in stoichiometry. A homologous motif (D887ADD) in the carboxy-terminus of the anion exchanger AE1 binds to carbonic anhydrase II (CAII). In isothermal titration calorimetry experiments, CAII was found to bind to kNBC1-Ct with a K(D) of 160 +/- 10 nM. Acetazolamide inhibited the short-circuit current through the cotransporter by 65 % when the latter operated in the 3 : 1 mode, but had no effect on the current in the 2 : 1 mode. Acetazolamide did not affect the cotransport stoichiometry or the ability of 8-Br-cAMP to shift the stoichiometry. Although CAII does not affect the transport stoichiometry, it may play an important role in enhancing the flux through the transporter when kNBC1-Ser(982) is unphosphorylated.

Enzyme activation through the utilization of intrinsic dianion binding energy.

PubMed

Amyes, T L; Malabanan, M M; Zhai, X; Reyes, A C; Richard, J P

2017-03-01

We consider 'the proposition that the intrinsic binding energy that results from the noncovalent interaction of a specific substrate with the active site of the enzyme is considerably larger than is generally believed. An important part of this binding energy may be utilized to provide the driving force for catalysis, so that the observed binding energy represents only what is left over after this utilization' [Jencks,W.P. (1975) Adv. Enzymol. Relat. Areas. Mol. Biol. , , 219-410]. The large ~12 kcal/mol intrinsic substrate phosphodianion binding energy for reactions catalyzed by triosephosphate isomerase (TIM), orotidine 5'-monophosphate decarboxylase and glycerol-3-phosphate dehydrogenase is divided into 4-6 kcal/mol binding energy that is expressed on the formation of the Michaelis complex in anchoring substrates to the respective enzyme, and 6-8 kcal/mol binding energy that is specifically expressed at the transition state in activating the respective enzymes for catalysis. A structure-based mechanism is described where the dianion binding energy drives a conformational change that activates these enzymes for catalysis. Phosphite dianion plays the active role of holding TIM in a high-energy closed active form, but acts as passive spectator in showing no effect on transition-state structure. The result of studies on mutant enzymes is presented, which support the proposal that the dianion-driven enzyme conformational change plays a role in enhancing the basicity of side chain of E167, the catalytic base, by clamping the base between a pair of hydrophobic side chains. The insight these results provide into the architecture of enzyme active sites and the development of strategies for the de novo design of protein catalysts is discussed. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Role of Ligand Reorganization and Conformational Restraints on the Binding Free Energies of DAPY Non-Nucleoside Inhibitors to HIV Reverse Transcriptase

PubMed Central

Gallicchio, Emilio

2012-01-01

The results of computer simulations of the binding of etravirine (TMC125) and rilpivirine (TMC278) to HIV reverse transcriptase are reported. It is confirmed that consistent binding free energy estimates are obtained with or without the application of torsional restraints when the free energies of imposing the restraints are taken into account. The restraints have a smaller influence on the thermodynamics and apparent kinetics of binding of TMC125 compared to the more flexible TMC278 inhibitor. The concept of the reorganization free energy of binding is useful to understand and categorize these effects. Contrary to expectations, the use of conformational restraints did not consistently enhance convergence of binding free energy estimates due to suppression of binding/unbinding pathways and due to the influence of rotational degrees of freedom not directly controlled by the restraints. Physical insights concerning the thermodynamic driving forces for binding and the role of “jiggling” and “wiggling” motion of the ligands are discussed. Based on these insights we conclude that an ideal inhibitor, if chemically realizable, would possess the electrostatic charge distribution of TMC125, so as to form strong interactions with the receptor, and the larger and more flexible substituents of TMC278, so as to minimize reorganization free energy penalties and the effects of resistance mutations, suitably modified, as in TMC125, so as to disfavor the formation of non-binding competent extended conformations when free in solution. PMID:22708073

The binding cavity of mouse major urinary protein is optimised for a variety of ligand binding modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pertinhez, Thelma A.; Ferrari, Elena; Casali, Emanuela

2009-12-25

{sup 15}N and {sup 1}HN chemical shift data and {sup 15}N relaxation studies have been used to characterise the binding of N-phenyl-naphthylamine (NPN) to mouse major urinary protein (MUP). NPN binds in the {beta}-barrel cavity of MUP, hydrogen bonding to Tyr120 and making extensive non-bonded contacts with hydrophobic side chains. In contrast to the natural pheromone 2-sec-butyl-4,5-dihydrothiazole, NPN binding gives no change to the overall mobility of the protein backbone of MUP. Comparison with 11 different ligands that bind to MUP shows a range of binding modes involving 16 different residues in the {beta}-barrel cavity. These finding justify why MUPmore » is able to adapt to allow for many successful binding partners.« less

Integrating water exclusion theory into βcontacts to predict binding free energy changes and binding hot spots

PubMed Central

2014-01-01

Background Binding free energy and binding hot spots at protein-protein interfaces are two important research areas for understanding protein interactions. Computational methods have been developed previously for accurate prediction of binding free energy change upon mutation for interfacial residues. However, a large number of interrupted and unimportant atomic contacts are used in the training phase which caused accuracy loss. Results This work proposes a new method, βACV ASA , to predict the change of binding free energy after alanine mutations. βACV ASA integrates accessible surface area (ASA) and our newly defined β contacts together into an atomic contact vector (ACV). A β contact between two atoms is a direct contact without being interrupted by any other atom between them. A β contact’s potential contribution to protein binding is also supposed to be inversely proportional to its ASA to follow the water exclusion hypothesis of binding hot spots. Tested on a dataset of 396 alanine mutations, our method is found to be superior in classification performance to many other methods, including Robetta, FoldX, HotPOINT, an ACV method of β contacts without ASA integration, and ACV ASA methods (similar to βACV ASA but based on distance-cutoff contacts). Based on our data analysis and results, we can draw conclusions that: (i) our method is powerful in the prediction of binding free energy change after alanine mutation; (ii) β contacts are better than distance-cutoff contacts for modeling the well-organized protein-binding interfaces; (iii) β contacts usually are only a small fraction number of the distance-based contacts; and (iv) water exclusion is a necessary condition for a residue to become a binding hot spot. Conclusions βACV ASA is designed using the advantages of both β contacts and water exclusion. It is an excellent tool to predict binding free energy changes and binding hot spots after alanine mutation. PMID:24568581

DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

PubMed Central

Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

2008-01-01

Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015.

PubMed

Deng, Nanjie; Flynn, William F; Xia, Junchao; Vijayan, R S K; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015

NASA Astrophysics Data System (ADS)

Deng, Nanjie; Flynn, William F.; Xia, Junchao; Vijayan, R. S. K.; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M.

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Effects of the Hydroxyl Group on Phenyl Based Ligand/ERRγ Protein Binding

PubMed Central

2015-01-01

Bisphenol-A (4,4′-dihydroxy-2,2-diphenylpropane, BPA, or BPA-A) and its derivatives, when exposed to humans, may affect functions of multiple organs by specific binding to the human estrogen-related receptor γ (ERRγ). We carried out atomistic molecular dynamics (MD) simulations of three ligand compounds including BPA-A, 4-α-cumylphenol (BPA-C), and 2,2-diphenylpropane (BPA-D) binding to the ligand binding domain (LBD) of a human ERRγ to study the structures and energies associated with the binding. We used the implicit Molecular Mechanics/Poisson–Boltzmann Surface Area (MM/PBSA) method to estimate the free energies of binding for the phenyl based compound/ERRγ systems. The addition of hydroxyl groups to the aromatic ring had only a minor effect on binding structures and a significant effect on ligand/protein binding energy in an aqueous solution. Free binding energies of BPA-D to the ERRγ were found to be considerably less than those of BPA-A and BPA-C to the ERRγ. These results are well correlated with those from experiments where no binding affinities were determined in the BPA-D/ERRγ complex. No conformational change was observed for the helix 12 (H-12) of ERRγ upon binding of these compounds preserving an active transcriptional conformation state. PMID:25098505

Fragmentation cross sections and binding energies of neutron-rich nuclei

NASA Astrophysics Data System (ADS)

Tsang, M. B.; Lynch, W. G.; Friedman, W. A.; Mocko, M.; Sun, Z. Y.; Aoi, N.; Cook, J. M.; Delaunay, F.; Famiano, M. A.; Hui, H.; Imai, N.; Iwasaki, H.; Motobayashi, T.; Niikura, M.; Onishi, T.; Rogers, A. M.; Sakurai, H.; Suzuki, H.; Takeshita, E.; Takeuchi, S.; Wallace, M. S.

2007-10-01

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of Cu76,77,78,79 have been extracted. They are 636.94±0.4,647.1±0.4,651.6±0.4, and 657.8±0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of Cu75 is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-line nuclei, Na39 and Mg40 from the fragmentation of Ca48 are discussed.

Chemical shift assignments of the first and second RRMs of Nrd1, a fission yeast MAPK-target RNA binding protein.

PubMed

Kobayashi, Ayaho; Kanaba, Teppei; Satoh, Ryosuke; Ito, Yutaka; Sugiura, Reiko; Mishima, Masaki

2017-10-01

Negative regulator differentiation 1 (Nrd1), a fission yeast RNA binding protein, modulates cytokinesis and sexual development and contributes to stress granule formation in response to environmental stresses. Nrd1 comprises four RRM domains and binds and stabilizes Cdc4 mRNA that encodes the myosin II light chain. Nrd1 binds the Cpc2 fission-yeast RACK1 homolog, and the interaction promotes Nrd1 localization to stress granules. Interestingly, Pmk1 mitogen-activated protein kinase phosphorylates Thr40 in the unstructured N-terminal region and Thr126 in the first RRM domain of Nrd1. Phosphorylation significantly reduces RNA-binding activity and likely modulates Nrd1 function. To reveal the relationship between the structure and function of Nrd1 and how phosphorylation affects structure, we used heteronuclear NMR techniques to investigate the three-dimensional structure of Nrd1. Here we report the 1 H, 13 C, and 15 N resonance assignments of RRM1-RRM2 (residues 108-284) comprising the first and second RRMs obtained using heteronuclear NMR techniques. Secondary structures derived from the chemical shifts are reported. These data should contribute to the understanding of the three-dimensional structure of the RRM1-RRM2 region of Nrd1 and the perturbation caused by phosphorylation.

Interactions of solute (3p, 4p, 5p and 6p) with solute, vacancy and divacancy in bcc Fe

NASA Astrophysics Data System (ADS)

You, Yu-Wei; Kong, Xiang-Shan; Wu, Xue-Bang; Liu, Wei; Liu, C. S.; Fang, Q. F.; Chen, J. L.; Luo, G.-N.; Wang, Zhiguang

2014-12-01

Solute-vacancy binding energy is a key quantity in understanding solute diffusion kinetics and phase segregation, and may help choice of alloy compositions for future material design. However, the binding energy of solute with vacancy is notoriously difficult to measure and largely unknown in bcc Fe. With first-principles method, we systemically calculate the binding energies of solute (3p, 4p, 5p and 6p alloying solutes are included) with vacancy, divacancy and solute in bcc Fe. The binding energy of Si with vacancy in the present work is in good consistent with experimental value available. All the solutes considered are able to form stable solute-vacancy, solute-divacancy complexes, and the binding strength of solute-divacancy is about two times larger than that of solute-vacancy. Most solutes could not form stable solute-solute complexes except S, Se, In and Tl. The factors controlling the binding energies are analyzed at last.

Proton transfer and hydrogen bonding in the organic solid state: a combined XRD/XPS/ssNMR study of 17 organic acid-base complexes.

PubMed

Stevens, Joanna S; Byard, Stephen J; Seaton, Colin C; Sadiq, Ghazala; Davey, Roger J; Schroeder, Sven L M

2014-01-21

The properties of nitrogen centres acting either as hydrogen-bond or Brønsted acceptors in solid molecular acid-base complexes have been probed by N 1s X-ray photoelectron spectroscopy (XPS) as well as (15)N solid-state nuclear magnetic resonance (ssNMR) spectroscopy and are interpreted with reference to local crystallographic structure information provided by X-ray diffraction (XRD). We have previously shown that the strong chemical shift of the N 1s binding energy associated with the protonation of nitrogen centres unequivocally distinguishes protonated (salt) from hydrogen-bonded (co-crystal) nitrogen species. This result is further supported by significant ssNMR shifts to low frequency, which occur with proton transfer from the acid to the base component. Generally, only minor chemical shifts occur upon co-crystal formation, unless a strong hydrogen bond is formed. CASTEP density functional theory (DFT) calculations of (15)N ssNMR isotropic chemical shifts correlate well with the experimental data, confirming that computational predictions of H-bond strengths and associated ssNMR chemical shifts allow the identification of salt and co-crystal structures (NMR crystallography). The excellent agreement between the conclusions drawn by XPS and the combined CASTEP/ssNMR investigations opens up a reliable avenue for local structure characterization in molecular systems even in the absence of crystal structure information, for example for non-crystalline or amorphous matter. The range of 17 different systems investigated in this study demonstrates the generic nature of this approach, which will be applicable to many other molecular materials in organic, physical, and materials chemistry.

Characterization of ligand binding to melanocortin 4 receptors using fluorescent peptides with improved kinetic properties.

PubMed

Link, Reet; Veiksina, Santa; Rinken, Ago; Kopanchuk, Sergei

2017-03-15

Melanocortin 4 (MC 4 ) receptors are important drug targets as they regulate energy homeostasis, eating behaviour and sexual functions. The ligand binding process to these G protein-coupled receptors is subject to considerable complexity. Different steps in the complex dynamic regulation can be characterized by ligand binding kinetics. Optimization of these kinetic parameters in terms of on-rate and residence time can increase the rapid onset of drug action and reduce off-target effects. Fluorescence anisotropy (FA) is one of the homogeneous fluorescence-based assays that enable continuous online monitoring of ligand binding kinetics. FA has been implemented for the kinetic study of melanocortin MC 4 receptors expressed on budded baculoviruses. However, the slow dissociation of the fluorescently labelled peptide NDP-α-MSH does not enable reaching equilibrium nor enable more in-depth study of the binding mechanisms. To overcome this problem, two novel red-shifted fluorescent ligands were designed. These cyclized heptapeptide derivatives (UTBC101 and UTBC102) exhibited nanomolar affinity toward melanocortin MC 4 receptors but had relatively different kinetic properties. The dissociation half-lives of UTBC101 (τ 1/2 =160min) and UTBC102 (τ 1/2 =7min) were shorter compared to that what was previously reported for Cy3B-NDP-α-MSH (τ 1/2 =224min). The significantly shorter dissociation half-life of UTBC102 enables equilibrium in screening assays, whereas the higher affinity of UTBC101 helps to resolve a wider range of competitor potencies. These two ligands are suitable for further kinetic screening of novel melanocortin MC 4 receptor specific ligands and could complement each other in these studies. Copyright © 2017 Elsevier B.V. All rights reserved.

Comparative study of the interaction of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP) in its free base and Fe derivative form with oligo(dA.dT)15 and oligo(dG.dC)15.

PubMed

Bathaie, S Zahra; Ajloo, Davood; Daraie, Marzieh; Ghadamgahi, Maryam

2015-01-01

Interaction between a cationic porphyrin and its ferric derivative with oligo(dA.dT)15 and oligo(dG.dC)15 was studied by UV-vis spectroscopy, resonance light scattering (RLS), and circular dichroism (CD) at different ionic strengths; molecular docking and molecular dynamics simulation were also used for completion. Followings are the observed changes in the spectral properties of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP), as a free-base porphyrin with no axial ligand, and its Fe derivative (FeTMAP) upon interaction with oligo(dA.dT)15 and oligo(dG.dC)15: (1) the substantial red shift and hypochromicity at the Soret maximum in the UV-vis spectra; (2) the increased RLS intensity by increasing the ionic strength; and (3) an intense bisignate excitonic CD signal. All of them are the reasons for TMAP and FeTMAP binding to oligo(dA.dT)15 and oligo(dG.dC)15 with the outside binding mode, accompanied by the self-stacking of the ligands along the oligonucleotide helix. The CD results demonstrated a drastic change from excitonic in monomeric behavior at higher ionic strengths, which indicates the groove binding of the ligands with oligonucleotides. Molecular docking also confirmed the groove binding mode of the ligands and estimated the binding constants and energies of the interactions. Their interaction trend was further confirmed by molecular dynamics technique and structure parameters obtained from simulation. It showed that TMAP reduced the number of intermolecular hydrogen bonds and increased the solvent accessible surface area in the oligonucleotide. The self-aggregation of ligands at lower concentrations was also confirmed.

Exciton binding energy in GaAsBiN spherical quantum dot heterostructures

NASA Astrophysics Data System (ADS)

Das, Subhasis; Dhar, S.

2017-03-01

The ground state exciton binding energies (EBE) of heavy hole excitons in GaAs1-x-yBixNy - GaAs spherical quantum dots (QD) are calculated using a variational approach under 1s hydrogenic wavefunctions within the framework of effective mass approximation. Both the nitrogen and the bismuth content in the material are found to affect the binding energy, in particular for larger nitrogen content and lower dot radii. Calculations also show that the ground state exciton binding energies of heavy holes increase more at smaller dot sizes as compared to that for the light hole excitons.

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

On the contribution of vibrational anharmonicity to the binding energies of water clusters.

PubMed

Diri, Kadir; Myshakin, Evgeniy M; Jordan, Kenneth D

2005-05-05

The second-order vibrational perturbation theory method has been used together with the B3LYP and MP2 electronic structure methods to investigate the effects of anharmonicity on the vibrational zero-point energy (ZPE) contributions to the binding energies of (H2O)n, n = 2-6, clusters. For the low-lying isomers of (H2O)6, the anharmonicity correction to the binding energy is calculated to range from -248 to -355 cm(-1). It is also demonstrated that although high-order electron correlation effects are important for the individual vibrational frequencies, they are relatively unimportant for the net ZPE contributions to the binding energies of water clusters.

The positive binding energy envelopes of low-mass helium stars

NASA Astrophysics Data System (ADS)

Hall, Philip D.; Jeffery, C. Simon

2018-04-01

It has been hypothesized that stellar envelopes with positive binding energy may be ejected if the release of recombination energy can be triggered and the calculation of binding energy includes this contribution. The implications of this hypothesis for the evolution of normal hydrogen-rich stars have been investigated, but the implications for helium stars - which may represent mass-transfer or merger remnants in binary star systems - have not. Making a set of model helium stars, we find that those with masses between 0.9 and 2.4 M⊙ evolve to configurations with positive binding energy envelopes. We discuss consequences of the ejection hypothesis for such stars, and possible observational tests of these predictions.

The volume- and surface-binding energies of ice systems containing CO, CO2, and H2O

NASA Technical Reports Server (NTRS)

Sandford, Scott A.; Allamandola, Louis J.

1990-01-01

Laboratory-measured, temperature-dependent sticking efficiencies are presently used to derive the surface-binding energies of CO and CO2 on H2O-rich ices, with a view to determining the condensation and vaporization properties of these systems as well as to the measured energies' implications for both cometary behavior and the evolution of interstellar ices. The molecular volume and the surface binding energies are not found to be necessarily related on the basis of simple nearest-neighbor scaling in surface and bulk sites; this may be due to the physical constraints associated with matrix structure-associated physical constraints, which sometimes dominate the volume-binding energies.

SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

PubMed

Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

2016-04-12

Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

Prediction of Ras-effector interactions using position energy matrices.

PubMed

Kiel, Christina; Serrano, Luis

2007-09-01

One of the more challenging problems in biology is to determine the cellular protein interaction network. Progress has been made to predict protein-protein interactions based on structural information, assuming that structural similar proteins interact in a similar way. In a previous publication, we have determined a genome-wide Ras-effector interaction network based on homology models, with a high accuracy of predicting binding and non-binding domains. However, for a prediction on a genome-wide scale, homology modelling is a time-consuming process. Therefore, we here successfully developed a faster method using position energy matrices, where based on different Ras-effector X-ray template structures, all amino acids in the effector binding domain are sequentially mutated to all other amino acid residues and the effect on binding energy is calculated. Those pre-calculated matrices can then be used to score for binding any Ras or effector sequences. Based on position energy matrices, the sequences of putative Ras-binding domains can be scanned quickly to calculate an energy sum value. By calibrating energy sum values using quantitative experimental binding data, thresholds can be defined and thus non-binding domains can be excluded quickly. Sequences which have energy sum values above this threshold are considered to be potential binding domains, and could be further analysed using homology modelling. This prediction method could be applied to other protein families sharing conserved interaction types, in order to determine in a fast way large scale cellular protein interaction networks. Thus, it could have an important impact on future in silico structural genomics approaches, in particular with regard to increasing structural proteomics efforts, aiming to determine all possible domain folds and interaction types. All matrices are deposited in the ADAN database (http://adan-embl.ibmc.umh.es/). Supplementary data are available at Bioinformatics online.

Glucocorticoid receptor-PPARα axis in fetal mouse liver prepares neonates for milk lipid catabolism

PubMed Central

Rando, Gianpaolo; Tan, Chek Kun; Khaled, Nourhène; Montagner, Alexandra; Leuenberger, Nicolas; Bertrand-Michel, Justine; Paramalingam, Eeswari; Guillou, Hervé; Wahli, Walter

2016-01-01

In mammals, hepatic lipid catabolism is essential for the newborns to efficiently use milk fat as an energy source. However, it is unclear how this critical trait is acquired and regulated. We demonstrate that under the control of PPARα, the genes required for lipid catabolism are transcribed before birth so that the neonatal liver has a prompt capacity to extract energy from milk upon suckling. The mechanism involves a fetal glucocorticoid receptor (GR)-PPARα axis in which GR directly regulates the transcriptional activation of PPARα by binding to its promoter. Certain PPARα target genes such as Fgf21 remain repressed in the fetal liver and become PPARα responsive after birth following an epigenetic switch triggered by β-hydroxybutyrate-mediated inhibition of HDAC3. This study identifies an endocrine developmental axis in which fetal GR primes the activity of PPARα in anticipation of the sudden shifts in postnatal nutrient source and metabolic demands. DOI: http://dx.doi.org/10.7554/eLife.11853.001 PMID:27367842

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

RF power recovery feedback circulator

DOEpatents

Sharamentov, Sergey I [Bolingbrook, IL

2011-03-29

A device and method for improving the efficiency of RF systems having a Reflective Load. In the preferred embodiment, Reflected Energy from a superconducting resonator of a particle accelerator is reintroduced to the resonator after the phase of the Reflected Energy is aligned with the phase of the Supply Energy from a RF Energy Source. In one embodiment, a Circulator is used to transfer Reflected Energy from the Reflective Load into a Phase Adjuster which aligns the phase of the Reflected Energy with that of the Supply Energy. The phase-aligned energy is then combined with the Supply Energy, and reintroduced into the Reflective Load. In systems having a constant phase shift, the Phase Adjuster may be designed to shift the phase of the Reflected Energy by a constant amount using a Phase Shifter. In systems having a variety (variable) phase shifts, a Phase Shifter controlled by a phase feedback loop comprising a Phase Detector and a Feedback Controller to account for the various phase shifts is preferable.

Influences of Mutations on the Electrostatic Binding Free Energies of Chloride Ions in Escherichia Coli ClC

PubMed Central

Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin

2012-01-01

Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase

PubMed Central

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N.; Jiang, Hualiang

2013-01-01

Drug-target residence time (t = 1/koff, where koff is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, koff and activation free energy of dissociation (). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer’s disease drug (−)−Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (−)−Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development. PMID:23440190

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase.

PubMed

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N; Jiang, Hualiang

2013-03-12

Drug-target residence time (t = 1/k(off), where k(off) is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, k(off) and activation free energy of dissociation (ΔG(off)≠). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer's disease drug (-)-Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (-)-Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development.

Approximations to complete basis set-extrapolated, highly correlated non-covalent interaction energies.

PubMed

Mackie, Iain D; DiLabio, Gino A

2011-10-07

The first-principles calculation of non-covalent (particularly dispersion) interactions between molecules is a considerable challenge. In this work we studied the binding energies for ten small non-covalently bonded dimers with several combinations of correlation methods (MP2, coupled-cluster single double, coupled-cluster single double (triple) (CCSD(T))), correlation-consistent basis sets (aug-cc-pVXZ, X = D, T, Q), two-point complete basis set energy extrapolations, and counterpoise corrections. For this work, complete basis set results were estimated from averaged counterpoise and non-counterpoise-corrected CCSD(T) binding energies obtained from extrapolations with aug-cc-pVQZ and aug-cc-pVTZ basis sets. It is demonstrated that, in almost all cases, binding energies converge more rapidly to the basis set limit by averaging the counterpoise and non-counterpoise corrected values than by using either counterpoise or non-counterpoise methods alone. Examination of the effect of basis set size and electron correlation shows that the triples contribution to the CCSD(T) binding energies is fairly constant with the basis set size, with a slight underestimation with CCSD(T)∕aug-cc-pVDZ compared to the value at the (estimated) complete basis set limit, and that contributions to the binding energies obtained by MP2 generally overestimate the analogous CCSD(T) contributions. Taking these factors together, we conclude that the binding energies for non-covalently bonded systems can be accurately determined using a composite method that combines CCSD(T)∕aug-cc-pVDZ with energy corrections obtained using basis set extrapolated MP2 (utilizing aug-cc-pVQZ and aug-cc-pVTZ basis sets), if all of the components are obtained by averaging the counterpoise and non-counterpoise energies. With such an approach, binding energies for the set of ten dimers are predicted with a mean absolute deviation of 0.02 kcal/mol, a maximum absolute deviation of 0.05 kcal/mol, and a mean percent absolute deviation of only 1.7%, relative to the (estimated) complete basis set CCSD(T) results. Use of this composite approach to an additional set of eight dimers gave binding energies to within 1% of previously published high-level data. It is also shown that binding within parallel and parallel-crossed conformations of naphthalene dimer is predicted by the composite approach to be 9% greater than that previously reported in the literature. The ability of some recently developed dispersion-corrected density-functional theory methods to predict the binding energies of the set of ten small dimers was also examined. © 2011 American Institute of Physics