Free energy profiles of cocaine esterase-cocaine binding process by molecular dynamics and potential of mean force simulations.

PubMed

Zhang, Yuxin; Huang, Xiaoqin; Han, Keli; Zheng, Fang; Zhan, Chang-Guo

2016-11-25

The combined molecular dynamics (MD) and potential of mean force (PMF) simulations have been performed to determine the free energy profile of the CocE)-(+)-cocaine binding process in comparison with that of the corresponding CocE-(-)-cocaine binding process. According to the MD simulations, the equilibrium CocE-(+)-cocaine binding mode is similar to the CocE-(-)-cocaine binding mode. However, based on the simulated free energy profiles, a significant free energy barrier (∼5 kcal/mol) exists in the CocE-(+)-cocaine binding process whereas no obvious free energy barrier exists in the CocE-(-)-cocaine binding process, although the free energy barrier of ∼5 kcal/mol is not high enough to really slow down the CocE-(+)-cocaine binding process. In addition, the obtained free energy profiles also demonstrate that (+)-cocaine and (-)-cocaine have very close binding free energies with CocE, with a negligible difference (∼0.2 kcal/mol), which is qualitatively consistent with the nearly same experimental K M values of the CocE enzyme for (+)-cocaine and (-)-cocaine. The consistency between the computational results and available experimental data suggests that the mechanistic insights obtained from this study are reasonable. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Prediction of kinase-inhibitor binding affinity using energetic parameters

PubMed Central

Usha, Singaravelu; Selvaraj, Samuel

2016-01-01

The combination of physicochemical properties and energetic parameters derived from protein-ligand complexes play a vital role in determining the biological activity of a molecule. In the present work, protein-ligand interaction energy along with logP values was used to predict the experimental log (IC50) values of 25 different kinase-inhibitors using multiple regressions which gave a correlation coefficient of 0.93. The regression equation obtained was tested on 93 kinase-inhibitor complexes and an average deviation of 0.92 from the experimental log IC50 values was shown. The same set of descriptors was used to predict binding affinities for a test set of five individual kinase families, with correlation values > 0.9. We show that the protein-ligand interaction energies and partition coefficient values form the major deterministic factors for binding affinity of the ligand for its receptor. PMID:28149052

Calculating binding free energies of host-guest systems using the AMOEBA polarizable force field.

PubMed

Bell, David R; Qi, Rui; Jing, Zhifeng; Xiang, Jin Yu; Mejias, Christopher; Schnieders, Michael J; Ponder, Jay W; Ren, Pengyu

2016-11-09

Molecular recognition is of paramount interest in many applications. Here we investigate a series of host-guest systems previously used in the SAMPL4 blind challenge by using molecular simulations and the AMOEBA polarizable force field. The free energy results computed by Bennett's acceptance ratio (BAR) method using the AMOEBA polarizable force field ranked favorably among the entries submitted to the SAMPL4 host-guest competition [Muddana, et al., J. Comput.-Aided Mol. Des., 2014, 28, 305-317]. In this work we conduct an in-depth analysis of the AMOEBA force field host-guest binding thermodynamics by using both BAR and the orthogonal space random walk (OSRW) methods. The binding entropy-enthalpy contributions are analyzed for each host-guest system. For systems of inordinate binding entropy-enthalpy values, we further examine the hydrogen bonding patterns and configurational entropy contribution. The binding mechanism of this series of host-guest systems varies from ligand to ligand, driven by enthalpy and/or entropy changes. Convergence of BAR and OSRW binding free energy methods is discussed. Ultimately, this work illustrates the value of molecular modelling and advanced force fields for the exploration and interpretation of binding thermodynamics.

Atomic and molecular adsorption on Au(111)

DOE PAGES

Santiago-Rodriguez, Yohaselly; Herron, Jeffrey A.; Curet-Arana, Maria C.; ...

2014-05-02

Periodic self-consistent density functional theory (DFT-GGA) calculations were used to study the adsorption of several atomic species, molecular species and molecular fragments on the Au(111) surface with a coverage of 1/4 monolayer (ML). Binding geometries, binding energies, and diffusion barriers were calculated for 27 species. Furthermore, we calculated the surface deformation energy associated with the binding events. The binding strength for all the analyzed species can be ordered as follows: NH 3 < NO < CO < CH 3 < HCO < NH 2 < COOH < OH < HCOO < CNH 2 < H < N < NH

Protein surface roughness accounts for binding free energy of Plasmepsin II-ligand complexes.

PubMed

Valdés-Tresanco, Mario E; Valdés-Tresanco, Mario S; Valiente, Pedro A; Cocho, Germinal; Mansilla, Ricardo; Nieto-Villar, J M

2018-01-01

The calculation of absolute binding affinities for protein-inhibitor complexes remains as one of the main challenges in computational structure-based ligand design. The present work explored the calculations of surface fractal dimension (as a measure of surface roughness) and the relationship with experimental binding free energies of Plasmepsin II complexes. Plasmepsin II is an attractive target for novel therapeutic compounds to treat malaria. However, the structural flexibility of this enzyme is a drawback when searching for specific inhibitors. Concerning that, we performed separate explicitly solvated molecular dynamics simulations using the available high-resolution crystal structures of different Plasmepsin II complexes. Molecular dynamics simulations allowed a better approximation to systems dynamics and, therefore, a more reliable estimation of surface roughness. This constitutes a novel approximation in order to obtain more realistic values of fractal dimension, because previous works considered only x-ray structures. Binding site fractal dimension was calculated considering the ensemble of structures generated at different simulation times. A linear relationship between binding site fractal dimension and experimental binding free energies of the complexes was observed within 20 ns. Previous studies of the subject did not uncover this relationship. Regression model, coined FD model, was built to estimate binding free energies from binding site fractal dimension values. Leave-one-out cross-validation showed that our model reproduced accurately the absolute binding free energies for our training set (R 2  = 0.76; <|error|> =0.55 kcal/mol; SD error  = 0.19 kcal/mol). The fact that such a simple model may be applied raises some questions that are addressed in the article. Copyright © 2017 John Wiley & Sons, Ltd.

Photoionization cross section and binding energy of single dopant in hollow cylindrical core/shell quantum dot

NASA Astrophysics Data System (ADS)

Feddi, E.; El-Yadri, M.; Dujardin, F.; Restrepo, R. L.; Duque, C. A.

2017-02-01

In this study, we have investigated the confined donor impurity in a hollow cylindrical-shell quantum dot. The charges are assumed to be completely confined to the interior of the shell with rigid walls. Within the framework of the effective-mass approximation and by using a simple variational approach, we have computed the donor binding energy as a function of the shell sizes in order to study the behavior of the electron-impurity attraction for a very small thickness. Our results show that the binding energy of a donor impurity placed at the center of cylindrical core/shell dots depends strongly on the shell size. The binding energy increases when the shell-wideness becomes smaller and shows the same behavior as in a simple cylindrical quantum dot. A special case has been studied, which corresponds to the ratio between the inner and outer radii near to one (a/b → 1) for which our model gives a non-significant behavior of the impurity binding energy. This fact implies the existence of a critical value (a/b) for which the binding energy of the donor impurity tends to the limit value of 4 effective Rydbergs as in a 2D quantum well. We also analyse the photoionization cross section considering only the in-plane incident radiation polarization. We determine its behavior as a function of photon energy, shell size, and donor position. The measurement of photoionization in such systems would be of great interest to understand the optical properties of carriers in quantum dots.

Independent-Trajectory Thermodynamic Integration: a practical guide to protein-drug binding free energy calculations using distributed computing.

PubMed

Lawrenz, Morgan; Baron, Riccardo; Wang, Yi; McCammon, J Andrew

2012-01-01

The Independent-Trajectory Thermodynamic Integration (IT-TI) approach for free energy calculation with distributed computing is described. IT-TI utilizes diverse conformational sampling obtained from multiple, independent simulations to obtain more reliable free energy estimates compared to single TI predictions. The latter may significantly under- or over-estimate the binding free energy due to finite sampling. We exemplify the advantages of the IT-TI approach using two distinct cases of protein-ligand binding. In both cases, IT-TI yields distributions of absolute binding free energy estimates that are remarkably centered on the target experimental values. Alternative protocols for the practical and general application of IT-TI calculations are investigated. We highlight a protocol that maximizes predictive power and computational efficiency.

Interactions of solute (3p, 4p, 5p and 6p) with solute, vacancy and divacancy in bcc Fe

NASA Astrophysics Data System (ADS)

You, Yu-Wei; Kong, Xiang-Shan; Wu, Xue-Bang; Liu, Wei; Liu, C. S.; Fang, Q. F.; Chen, J. L.; Luo, G.-N.; Wang, Zhiguang

2014-12-01

Solute-vacancy binding energy is a key quantity in understanding solute diffusion kinetics and phase segregation, and may help choice of alloy compositions for future material design. However, the binding energy of solute with vacancy is notoriously difficult to measure and largely unknown in bcc Fe. With first-principles method, we systemically calculate the binding energies of solute (3p, 4p, 5p and 6p alloying solutes are included) with vacancy, divacancy and solute in bcc Fe. The binding energy of Si with vacancy in the present work is in good consistent with experimental value available. All the solutes considered are able to form stable solute-vacancy, solute-divacancy complexes, and the binding strength of solute-divacancy is about two times larger than that of solute-vacancy. Most solutes could not form stable solute-solute complexes except S, Se, In and Tl. The factors controlling the binding energies are analyzed at last.

Spectrophotometric analysis of flavonoid-DNA binding interactions at physiological conditions

NASA Astrophysics Data System (ADS)

Janjua, Naveed Kausar; Siddiqa, Asima; Yaqub, Azra; Sabahat, Sana; Qureshi, Rumana; Haque, Sayed ul

2009-12-01

Mode of interactions of three flavonoids [morin (M), quercetin (Q), and rutin (R)] with chicken blood ds.DNA (ck.DNA) has been investigated spectrophotometrically at different temperatures including body temperature (310 K) and at two physiological pH values, i.e. 7.4 (human blood pH) and 4.7 (stomach pH). The binding constants, Kf, evaluated using Benesi-Hildebrand equation showed that the flavonoids bind effectively through intercalation at both pH values and body temperature. Quercetin, somehow, showed greater binding capabilities with DNA. The free energies of flavonoid-DNA complexes indicated the spontaneity of their binding. The order of binding constants of three flavonoids at both pH values were found to be Kf(Q) > Kf(R) > Kf(M) and at 310 K.

Approximations to complete basis set-extrapolated, highly correlated non-covalent interaction energies.

PubMed

Mackie, Iain D; DiLabio, Gino A

2011-10-07

The first-principles calculation of non-covalent (particularly dispersion) interactions between molecules is a considerable challenge. In this work we studied the binding energies for ten small non-covalently bonded dimers with several combinations of correlation methods (MP2, coupled-cluster single double, coupled-cluster single double (triple) (CCSD(T))), correlation-consistent basis sets (aug-cc-pVXZ, X = D, T, Q), two-point complete basis set energy extrapolations, and counterpoise corrections. For this work, complete basis set results were estimated from averaged counterpoise and non-counterpoise-corrected CCSD(T) binding energies obtained from extrapolations with aug-cc-pVQZ and aug-cc-pVTZ basis sets. It is demonstrated that, in almost all cases, binding energies converge more rapidly to the basis set limit by averaging the counterpoise and non-counterpoise corrected values than by using either counterpoise or non-counterpoise methods alone. Examination of the effect of basis set size and electron correlation shows that the triples contribution to the CCSD(T) binding energies is fairly constant with the basis set size, with a slight underestimation with CCSD(T)∕aug-cc-pVDZ compared to the value at the (estimated) complete basis set limit, and that contributions to the binding energies obtained by MP2 generally overestimate the analogous CCSD(T) contributions. Taking these factors together, we conclude that the binding energies for non-covalently bonded systems can be accurately determined using a composite method that combines CCSD(T)∕aug-cc-pVDZ with energy corrections obtained using basis set extrapolated MP2 (utilizing aug-cc-pVQZ and aug-cc-pVTZ basis sets), if all of the components are obtained by averaging the counterpoise and non-counterpoise energies. With such an approach, binding energies for the set of ten dimers are predicted with a mean absolute deviation of 0.02 kcal/mol, a maximum absolute deviation of 0.05 kcal/mol, and a mean percent absolute deviation of only 1.7%, relative to the (estimated) complete basis set CCSD(T) results. Use of this composite approach to an additional set of eight dimers gave binding energies to within 1% of previously published high-level data. It is also shown that binding within parallel and parallel-crossed conformations of naphthalene dimer is predicted by the composite approach to be 9% greater than that previously reported in the literature. The ability of some recently developed dispersion-corrected density-functional theory methods to predict the binding energies of the set of ten small dimers was also examined. © 2011 American Institute of Physics

Importance of ligand reorganization free energy in protein-ligand binding-affinity prediction.

PubMed

Yang, Chao-Yie; Sun, Haiying; Chen, Jianyong; Nikolovska-Coleska, Zaneta; Wang, Shaomeng

2009-09-30

Accurate prediction of the binding affinities of small-molecule ligands to their biological targets is fundamental for structure-based drug design but remains a very challenging task. In this paper, we have performed computational studies to predict the binding models of 31 small-molecule Smac (the second mitochondria-derived activator of caspase) mimetics to their target, the XIAP (X-linked inhibitor of apoptosis) protein, and their binding affinities. Our results showed that computational docking was able to reliably predict the binding models, as confirmed by experimentally determined crystal structures of some Smac mimetics complexed with XIAP. However, all the computational methods we have tested, including an empirical scoring function, two knowledge-based scoring functions, and MM-GBSA (molecular mechanics and generalized Born surface area), yield poor to modest prediction for binding affinities. The linear correlation coefficient (r(2)) value between the predicted affinities and the experimentally determined affinities was found to be between 0.21 and 0.36. Inclusion of ensemble protein-ligand conformations obtained from molecular dynamic simulations did not significantly improve the prediction. However, major improvement was achieved when the free-energy change for ligands between their free- and bound-states, or "ligand-reorganization free energy", was included in the MM-GBSA calculation, and the r(2) value increased from 0.36 to 0.66. The prediction was validated using 10 additional Smac mimetics designed and evaluated by an independent group. This study demonstrates that ligand reorganization free energy plays an important role in the overall binding free energy between Smac mimetics and XIAP. This term should be evaluated for other ligand-protein systems and included in the development of new scoring functions. To our best knowledge, this is the first computational study to demonstrate the importance of ligand reorganization free energy for the prediction of protein-ligand binding free energy.

How to deal with multiple binding poses in alchemical relative protein-ligand binding free energy calculations.

PubMed

Kaus, Joseph W; Harder, Edward; Lin, Teng; Abel, Robert; McCammon, J Andrew; Wang, Lingle

2015-06-09

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges.

How To Deal with Multiple Binding Poses in Alchemical Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Recent advances in improved force fields and sampling methods have made it possible for the accurate calculation of protein–ligand binding free energies. Alchemical free energy perturbation (FEP) using an explicit solvent model is one of the most rigorous methods to calculate relative binding free energies. However, for cases where there are high energy barriers separating the relevant conformations that are important for ligand binding, the calculated free energy may depend on the initial conformation used in the simulation due to the lack of complete sampling of all the important regions in phase space. This is particularly true for ligands with multiple possible binding modes separated by high energy barriers, making it difficult to sample all relevant binding modes even with modern enhanced sampling methods. In this paper, we apply a previously developed method that provides a corrected binding free energy for ligands with multiple binding modes by combining the free energy results from multiple alchemical FEP calculations starting from all enumerated poses, and the results are compared with Glide docking and MM-GBSA calculations. From these calculations, the dominant ligand binding mode can also be predicted. We apply this method to a series of ligands that bind to c-Jun N-terminal kinase-1 (JNK1) and obtain improved free energy results. The dominant ligand binding modes predicted by this method agree with the available crystallography, while both Glide docking and MM-GBSA calculations incorrectly predict the binding modes for some ligands. The method also helps separate the force field error from the ligand sampling error, such that deviations in the predicted binding free energy from the experimental values likely indicate possible inaccuracies in the force field. An error in the force field for a subset of the ligands studied was identified using this method, and improved free energy results were obtained by correcting the partial charges assigned to the ligands. This improved the root-mean-square error (RMSE) for the predicted binding free energy from 1.9 kcal/mol with the original partial charges to 1.3 kcal/mol with the corrected partial charges. PMID:26085821

Relative Binding Free Energy Calculations in Drug Discovery: Recent Advances and Practical Considerations.

PubMed

Cournia, Zoe; Allen, Bryce; Sherman, Woody

2017-12-26

Accurate in silico prediction of protein-ligand binding affinities has been a primary objective of structure-based drug design for decades due to the putative value it would bring to the drug discovery process. However, computational methods have historically failed to deliver value in real-world drug discovery applications due to a variety of scientific, technical, and practical challenges. Recently, a family of approaches commonly referred to as relative binding free energy (RBFE) calculations, which rely on physics-based molecular simulations and statistical mechanics, have shown promise in reliably generating accurate predictions in the context of drug discovery projects. This advance arises from accumulating developments in the underlying scientific methods (decades of research on force fields and sampling algorithms) coupled with vast increases in computational resources (graphics processing units and cloud infrastructures). Mounting evidence from retrospective validation studies, blind challenge predictions, and prospective applications suggests that RBFE simulations can now predict the affinity differences for congeneric ligands with sufficient accuracy and throughput to deliver considerable value in hit-to-lead and lead optimization efforts. Here, we present an overview of current RBFE implementations, highlighting recent advances and remaining challenges, along with examples that emphasize practical considerations for obtaining reliable RBFE results. We focus specifically on relative binding free energies because the calculations are less computationally intensive than absolute binding free energy (ABFE) calculations and map directly onto the hit-to-lead and lead optimization processes, where the prediction of relative binding energies between a reference molecule and new ideas (virtual molecules) can be used to prioritize molecules for synthesis. We describe the critical aspects of running RBFE calculations, from both theoretical and applied perspectives, using a combination of retrospective literature examples and prospective studies from drug discovery projects. This work is intended to provide a contemporary overview of the scientific, technical, and practical issues associated with running relative binding free energy simulations, with a focus on real-world drug discovery applications. We offer guidelines for improving the accuracy of RBFE simulations, especially for challenging cases, and emphasize unresolved issues that could be improved by further research in the field.

Small Au clusters on a defective MgO(1 0 0) surface

NASA Astrophysics Data System (ADS)

Barcaro, Giovanni; Fortunelli, Alessandro

2008-05-01

The lowest energy structures of small T]>rndm where rndm is a random number (Metropolis criterion), the new configuration is accepted, otherwise the old configuration is kept, and the process is iterated. For each size we performed 3-5 BH runs, each one composed of 20-25 Monte Carlo steps, using a value of 0.5 eV as kT in the Metropolis criterion. Previous experience [13-15] shows that this is sufficient to single out the global minimum for adsorbed clusters of this size, and that the BH approach is more efficient as a global optimization algorithm than other techniques such as simulated annealing [18]. The MgO support was described via an (Mg 12O 12) cluster embedded in an array of ±2.0 a.u. point charges and repulsive pseudopotentials on the positive charges in direct contact with the cluster (see Ref. [15] for more details on the method). The atoms of the oxide cluster and the point charges were located at the lattice positions of the MgO rock-salt bulk structure using the experimental lattice constant of 4.208 Å. At variance with the ), evaluated by subtracting the energy of the oxide surface and of the metal cluster, both frozen in their interacting configuration, from the value of the total energy of the system, and by taking the absolute value; (ii) the binding energy of the metal cluster (E), evaluated by subtracting the energy of the isolated metal atoms from the total energy of the metal cluster in its interacting configuration, and by taking the absolute value; (iii) the metal cluster distortion energy (E), which corresponds to the difference between the energy of the metal cluster in the configuration interacting with the surface minus the energy of the cluster in its lowest-energy gas-phase configuration (a positive quantity); (iv) the oxide distortion energy (ΔE), evaluated subtracting the energy of the relaxed isolated defected oxide from the energy of the isolated defected oxide in the interacting configuration; and (v) the total binding energy (E), which is the sum of the binding energy of the metal cluster, the adhesion energy and the oxide distortion energy (E=E+E-ΔE). Note that the total binding energy of gas-phase clusters in their global minima can be obtained by summing E+E.

Exciton size and binding energy limitations in one-dimensional organic materials.

PubMed

Kraner, S; Scholz, R; Plasser, F; Koerner, C; Leo, K

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent density functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.

Binding free energy prediction in strongly hydrophobic biomolecular systems.

PubMed

Charlier, Landry; Nespoulous, Claude; Fiorucci, Sébastien; Antonczak, Serge; Golebiowski, Jérome

2007-11-21

We present a comparison of various computational approaches aiming at predicting the binding free energy in ligand-protein systems where the ligand is located within a highly hydrophobic cavity. The relative binding free energy between similar ligands is obtained by means of the thermodynamic integration (TI) method and compared to experimental data obtained through isothermal titration calorimetry measurements. The absolute free energy of binding prediction was obtained on a similar system (a pyrazine derivative bound to a lipocalin) by TI, potential of mean force (PMF) and also by means of the MMPBSA protocols. Although the TI protocol performs poorly either with an explicit or an implicit solvation scheme, the PMF calculation using an implicit solvation scheme leads to encouraging results, with a prediction of the binding affinity being 2 kcal mol(-1) lower than the experimental value. The use of an implicit solvation scheme appears to be well suited for the study of such hydrophobic systems, due to the lack of water molecules within the binding site.

Binding energy of the donor impurities in GaAs-Ga 1- x Al x As quantum well wires with Morse potential in the presence of electric and magnetic fields

NASA Astrophysics Data System (ADS)

Aciksoz, Esra; Bayrak, Orhan; Soylu, Asim

2016-10-01

The behavior of a donor in the GaAs-Ga1-x Al x As quantum well wire represented by the Morse potential is examined within the framework of the effective-mass approximation. The donor binding energies are numerically calculated for with and without the electric and magnetic fields in order to show their influence on the binding energies. Moreover, how the donor binding energies change for the constant potential parameters (D e, r e, and a) as well as with the different values of the electric and magnetic field strengths is determined. It is found that the donor binding energy is highly dependent on the external electric and magnetic fields as well as parameters of the Morse potential. Project supported by the Turkish Science Research Council (TÜBİTAK) and the Financial Supports from Akdeniz and Nigde Universities.

Binding of an adatom to a simple metal surface

NASA Technical Reports Server (NTRS)

Huntington, H. B.; Turk, L. A.; White, W. W., III

1975-01-01

The density functional formalism of Hohenberg and Kohn is used to investigate the energies, charge densities and forces which hold an adatom on the surface of a simple metal. The valence wavefunction of the adatom is fitted to the Herman-Skillman solutions at large distance and is simplified somewhat in the core region. The field of the ion is represented by the Ashcroft pseudopotential. For the metal the jellium model is used. Detailed calculations are carried out for a sodium adatom on a sodium surface. Simply juxtaposing adatom and surface gives a binding energy of about 1/3 eV. This value is approximately twice the surface energy per atom in the close-packed plane. Charge redistributions as determined variationally increase the binding energy by about 10%. The equilibrium distance for the adatom turns out to be 1.66 A from the surface, as compared with 1.52 A, the observed value for one-half the distance between the close-packed planes.

Neutral-atom electron binding energies from relaxed-orbital relativistic Hartree-Fock-Slater calculations for Z between 2 and 106

NASA Technical Reports Server (NTRS)

Huang, K.-N.; Aoyagi, M.; Mark, H.; Chen, M. H.; Crasemann, B.

1976-01-01

Electron binding energies in neutral atoms have been calculated relativistically, with the requirement of complete relaxation. Hartree-Fock-Slater wave functions served as zeroth-order eigenfunctions to compute the expectation of the total Hamiltonian. A first-order correction to the local approximation was thus included. Quantum-electrodynamic corrections were made. For all elements with atomic numbers ranging from 2 to 106, the following quantities are listed: total energies, electron kinetic energies, electron-nucleus potential energies, electron-electron potential energies consisting of electrostatic and Breit interaction (magnetic and retardation) terms, and vacuum polarization energies. Binding energies including relaxation are listed for all electrons in all atoms over the indicated range of atomic numbers. A self-energy correction is included for the 1s, 2s, and 2p(1/2) levels. Results for selected atoms are compared with energies calculated by other methods and with experimental values.

The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

Binding energies of the ground triplet state a{sup 3}Σ{sub u}{sup +} of Rb{sub 2} and Cs{sub 2} in terms of the generalized Le Roy–Bernstein near-dissociation expansion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sovkov, V. B.; Ivanov, V. S.

Formulae of Le Roy–Bernstein near-dissociation theory are derived in a general isotope–invariant form, applicable to any term in the rotational expansion of a diatomic ro-vibrational term value. It is proposed to use the generalized Le Roy–Bernstein expansion to describe the binding energies (ro-vibrational term values) of the ground triplet state a{sup 3}Σ{sub u}{sup +} of alkali metal dimers. The parameters of this description are determined for Rb{sub 2} and Cs{sub 2} molecules. This approach gives a recipe to calculate the whole variety of the binding energies with characteristic accuracies from ∼1 × 10{sup −3} to 1 × 10{sup −2} cm{supmore » −1} using a relatively simple algebraic equation.« less

a New Phenomenological Formula for Ground-State Binding Energies

NASA Astrophysics Data System (ADS)

Gangopadhyay, G.

A phenomenological formula based on liquid drop model has been proposed for ground-state binding energies of nuclei. The effect due to bunching of single particle levels has been incorporated through a term resembling the one-body Hamiltonian. The effect of n-p interaction has been included through a function of valence nucleons. A total of 50 parameters has been used in the present calculation. The root mean square (r.m.s.) deviation for the binding energy values for 2140 nuclei comes out to be 0.376 MeV, and that for 1091 alpha decay energies is 0.284 MeV. The correspondence with the conventional liquid drop model is discussed.

Superhalogens as building blocks of two-dimensional organic-inorganic hybrid perovskites for optoelectronics applications.

PubMed

Yao, Qiushi; Fang, Hong; Deng, Kaiming; Kan, Erjun; Jena, Puru

2016-10-20

Organic-inorganic hybrid perovskites, well known for their potential as the next generation solar cells, have found another niche application in optoelectronics. This was demonstrated in a recent experiment (L. Dou, et al., Science, 2015, 349, 1518) on atomically thin (C 4 H 9 NH 3 ) 2 PbBr 4 , where, due to quantum confinement, the bandgap and the exciton binding energy are enhanced over their corresponding values in the three-dimensional bulk phase. Using density functional theory we show that when halogen atoms (e.g. I) are sequentially replaced with superhalogen molecules (e.g. BH 4 ) the bandgap and exciton binding energy increase monotonically with the superhalogen content with the exciton binding energy of (C 4 H 9 NH 3 ) 2 Pb(BH 4 ) 4 approaching the value in monolayer black phosphorus. Lead-free admixtures (C 4 H 9 NH 3 ) 2 MI 4-x (BH 4 ) x (M = Sn and Ge; x = 0-4) also show a similar trend. Thus, a combination of quantum confinement and compositional change can be used as an effective strategy to tailor the bandgap and the exciton binding energy of two-dimensional hybrid perovskites, making them promising candidates for optoelectronic applications.

Structure-based multiscale approach for identification of interaction partners of PDZ domains.

PubMed

Tiwari, Garima; Mohanty, Debasisa

2014-04-28

PDZ domains are peptide recognition modules which mediate specific protein-protein interactions and are known to have a complex specificity landscape. We have developed a novel structure-based multiscale approach which identifies crucial specificity determining residues (SDRs) of PDZ domains from explicit solvent molecular dynamics (MD) simulations on PDZ-peptide complexes and uses these SDRs in combination with knowledge-based scoring functions for proteomewide identification of their interaction partners. Multiple explicit solvent simulations ranging from 5 to 50 ns duration have been carried out on 28 PDZ-peptide complexes with known binding affinities. MM/PBSA binding energy values calculated from these simulations show a correlation coefficient of 0.755 with the experimental binding affinities. On the basis of the SDRs of PDZ domains identified by MD simulations, we have developed a simple scoring scheme for evaluating binding energies for PDZ-peptide complexes using residue based statistical pair potentials. This multiscale approach has been benchmarked on a mouse PDZ proteome array data set by calculating the binding energies for 217 different substrate peptides in binding pockets of 64 different mouse PDZ domains. Receiver operating characteristic (ROC) curve analysis indicates that, the area under curve (AUC) values for binder vs nonbinder classification by our structure based method is 0.780. Our structure based method does not require experimental PDZ-peptide binding data for training.

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase

PubMed Central

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N.; Jiang, Hualiang

2013-01-01

Drug-target residence time (t = 1/koff, where koff is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, koff and activation free energy of dissociation (). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer’s disease drug (−)−Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (−)−Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development. PMID:23440190

Free energy landscape for the binding process of Huperzine A to acetylcholinesterase.

PubMed

Bai, Fang; Xu, Yechun; Chen, Jing; Liu, Qiufeng; Gu, Junfeng; Wang, Xicheng; Ma, Jianpeng; Li, Honglin; Onuchic, José N; Jiang, Hualiang

2013-03-12

Drug-target residence time (t = 1/k(off), where k(off) is the dissociation rate constant) has become an important index in discovering better- or best-in-class drugs. However, little effort has been dedicated to developing computational methods that can accurately predict this kinetic parameter or related parameters, k(off) and activation free energy of dissociation (ΔG(off)≠). In this paper, energy landscape theory that has been developed to understand protein folding and function is extended to develop a generally applicable computational framework that is able to construct a complete ligand-target binding free energy landscape. This enables both the binding affinity and the binding kinetics to be accurately estimated. We applied this method to simulate the binding event of the anti-Alzheimer's disease drug (-)-Huperzine A to its target acetylcholinesterase (AChE). The computational results are in excellent agreement with our concurrent experimental measurements. All of the predicted values of binding free energy and activation free energies of association and dissociation deviate from the experimental data only by less than 1 kcal/mol. The method also provides atomic resolution information for the (-)-Huperzine A binding pathway, which may be useful in designing more potent AChE inhibitors. We expect this methodology to be widely applicable to drug discovery and development.

Quantifying Intrinsic Specificity: A Potential Complement to Affinity in Drug Screening

NASA Astrophysics Data System (ADS)

Wang, Jin; Zheng, Xiliang; Yang, Yongliang; Drueckhammer, Dale; Yang, Wei; Verkhivker, Gennardy; Wang, Erkang

2007-11-01

We report here the investigation of a novel description of specificity in protein-ligand binding based on energy landscape theory. We define a new term, intrinsic specificity ratio (ISR), which describes the level of discrimination in binding free energies of the native basin for a protein-ligand complex from the weaker binding states of the same ligand. We discuss the relationship between the intrinsic specificity we defined here and the conventional definition of specificity. In a docking study of molecules with the enzyme COX-2, we demonstrate a statistical correspondence between ISR value and geometrical shapes of the small molecules binding to COX-2. We further observe that the known selective (nonselective) inhibitors of COX-2 have higher (lower) ISR values. We suggest that intrinsic specificity ratio may be a useful new criterion and a complement to affinity in drug screening and in searching for potential drug lead compounds.

The Modified Hartmann Potential Effects on γ-rigid Bohr Hamiltonian

NASA Astrophysics Data System (ADS)

Suparmi, A.; Cari, C.; Nur Pratiwi, Beta

2018-04-01

In this paper, we present the solution of Bohr Hamiltonian in the case of γ-rigid for the modified Hartmann potential. The modified Hartmann potential was formed from the original Hartmann potential, consists of β function and θ function. By using the separation method, the three-dimensional Bohr Hamiltonian equation was reduced into three one-dimensional Schrodinger-like equation which was solved analytically. The results for the wavefunction were shown in mathematically, while for the binding energy was solved numerically. The numerical binding energy for the presence of the modified Hartmann potential is lower than the binding energy value in the absence of modified Hartmann potential effect.

Extended fenske-hall calculation of inner-shell binding energies using ( Z + 1)-bazis sets: Sulfur-containing molecules

NASA Astrophysics Data System (ADS)

Zwanziger, Ch.; Zwanziger, H.; Szargan, R.; Reinhold, J.

1981-08-01

It is shown that the S1s and S2p binding energies and their chemical shifts in the molecules H 2S, SO 2, SF 6 and COS obtained with hole-state calculations using an extended Fenske-Hall method are in good agreement with experimental values if mixed ( Z + 1)-basis sets are applied.

Exciton size and binding energy limitations in one-dimensional organic materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraner, S., E-mail: stefan.kraner@iapp.de; Koerner, C.; Leo, K.

2015-12-28

In current organic photovoltaic devices, the loss in energy caused by the charge transfer step necessary for exciton dissociation leads to a low open circuit voltage, being one of the main reasons for rather low power conversion efficiencies. A possible approach to avoid these losses is to tune the exciton binding energy to a value of the order of thermal energy, which would lead to free charges upon absorption of a photon, and therefore increase the power conversion efficiency towards the Shockley-Queisser limit. We determine the size of the excitons for different organic molecules and polymers by time dependent densitymore » functional theory calculations. For optically relevant transitions, the exciton size saturates around 0.7 nm for one-dimensional molecules with a size longer than about 4 nm. For the ladder-type polymer poly(benzimidazobenzophenanthroline), we obtain an exciton binding energy of about 0.3 eV, serving as a lower limit of the exciton binding energy for the organic materials investigated. Furthermore, we show that charge transfer transitions increase the exciton size and thus identify possible routes towards a further decrease of the exciton binding energy.« less

Molecular dynamics and MM/GBSA-integrated protocol probing the correlation between biological activities and binding free energies of HIV-1 TAR RNA inhibitors.

PubMed

Peddi, Saikiran Reddy; Sivan, Sree Kanth; Manga, Vijjulatha

2018-02-01

The interaction of HIV-1 transactivator protein Tat with its cognate transactivation response (TAR) RNA has emerged as a promising target for developing antiviral compounds and treating HIV infection, since it is a crucial step for efficient transcription and replication. In the present study, molecular dynamics (MD) simulations and MM/GBSA calculations have been performed on a series of neamine derivatives in order to estimate appropriate MD simulation time for acceptable correlation between ΔG bind and experimental pIC 50 values. Initially, all inhibitors were docked into the active site of HIV-1 TAR RNA. Later to explore various conformations and examine the docking results, MD simulations were carried out. Finally, binding free energies were calculated using MM/GBSA method and were correlated with experimental pIC 50 values at different time scales (0-1 to 0-10 ns). From this study, it is clear that in case of neamine derivatives as simulation time increased the correlation between binding free energy and experimental pIC 50 values increased correspondingly. Therefore, the binding energies which can be interpreted at longer simulation times can be used to predict the bioactivity of new neamine derivatives. Moreover, in this work, we have identified some plausible critical nucleotide interactions with neamine derivatives that are responsible for potent inhibitory activity. Furthermore, we also provide some insights into a new class of oxadiazole-based back bone cyclic peptides designed by incorporating the structural features of neamine derivatives. On the whole, this approach can provide a valuable guidance for designing new potent inhibitors and modify the existing compounds targeting HIV-1 TAR RNA.

Accurate Binding Free Energy Predictions in Fragment Optimization.

PubMed

Steinbrecher, Thomas B; Dahlgren, Markus; Cappel, Daniel; Lin, Teng; Wang, Lingle; Krilov, Goran; Abel, Robert; Friesner, Richard; Sherman, Woody

2015-11-23

Predicting protein-ligand binding free energies is a central aim of computational structure-based drug design (SBDD)--improved accuracy in binding free energy predictions could significantly reduce costs and accelerate project timelines in lead discovery and optimization. The recent development and validation of advanced free energy calculation methods represents a major step toward this goal. Accurately predicting the relative binding free energy changes of modifications to ligands is especially valuable in the field of fragment-based drug design, since fragment screens tend to deliver initial hits of low binding affinity that require multiple rounds of synthesis to gain the requisite potency for a project. In this study, we show that a free energy perturbation protocol, FEP+, which was previously validated on drug-like lead compounds, is suitable for the calculation of relative binding strengths of fragment-sized compounds as well. We study several pharmaceutically relevant targets with a total of more than 90 fragments and find that the FEP+ methodology, which uses explicit solvent molecular dynamics and physics-based scoring with no parameters adjusted, can accurately predict relative fragment binding affinities. The calculations afford R(2)-values on average greater than 0.5 compared to experimental data and RMS errors of ca. 1.1 kcal/mol overall, demonstrating significant improvements over the docking and MM-GBSA methods tested in this work and indicating that FEP+ has the requisite predictive power to impact fragment-based affinity optimization projects.

Nuclear binding energy using semi empirical mass formula

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ankita,, E-mail: ankitagoyal@gmail.com; Suthar, B.

2016-05-06

In the present communication, semi empirical mass formula using the liquid drop model has been presented. Nuclear binding energies are calculated using semi empirical mass formula with various constants given by different researchers. We also compare these calculated values with experimental data and comparative study for finding suitable constants is added using the error plot. The study is extended to find the more suitable constant to reduce the error.

Extending, and repositioning, a thermochemical ladder: high-level quantum chemical calculations on the sodium cation affinity scale.

PubMed

Bloomfield, Jolyon; Davies, Erin; Gatt, Phillip; Petrie, Simon

2006-01-26

High-level ab initio quantum chemical calculations, at the CP-dG2thaw level of theory, are reported for coordination of Na+ to a wide assortment of small organic and inorganic ligands. The ligands range in size from H to C6H6, and include 22 of the ligands for which precise relative sodium ion binding free energies have been determined by recent Fourier transform ion cyclotron resonance and guided ion beam studies. Agreement with the relative experimental values is excellent (+/-1.1 kJ mol(-1)), and agreement with the absolute scale (obtained when these relative values are pegged to the CH3NH2 "anchor" value measured in a high-pressure mass spectrometric study) is only marginally poorer, with CP-dG2thaw values exceeding the absolute experimental DeltaG(298) values by an average of 2.1 kJ mol(-1). The excellent agreement between experiment and the CP-dG2thaw technique also suggests that the additional 97 ligands surveyed here (which, in many cases, are not readily susceptible to laboratory investigation) can also be reliably fitted to the existing experimental scale. However, while CP-dG2thaw and the experimental ladder are in close accord, a small set of higher level ab initio calculations on sodium ion/ligand complexes (including several values obtained here using the W1 protocol) suggests that the CP-dG2thaw values are themselves too low by approximately 2.5 kJ mol(-1), thereby implying that the accepted laboratory values are typically 4.6 kJ mol(-1) too low. The present work also highlights the importance of Na+/ligand binding energy determinations (whether by experimental or theoretical approaches) on a case-by-case basis: trends in increasing binding energy along homologous series of compounds are not reliably predictable, nor are binding site preferences or chelating tendencies in polyfunctional compounds.

Experimental Determination of pK[subscript a] Values and Metal Binding for Biomolecular Compounds Using [superscript 31]P NMR Spectroscopy

ERIC Educational Resources Information Center

Swartz, Mason A.; Tubergen, Philip J.; Tatko, Chad D.; Baker, Rachael A.

2018-01-01

This lab experiment uses [superscript 31]P NMR spectroscopy of biomolecules to determine pK[subscript a] values and the binding energies of metal/biomolecule complexes. Solutions of adenosine nucleotides are prepared, and a series of [superscript 31]P NMR spectra are collected as a function of pH and in the absence and presence of magnesium or…

Intermolecular symmetry-adapted perturbation theory study of large organic complexes.

PubMed

Heßelmann, Andreas; Korona, Tatiana

2014-09-07

Binding energies for the complexes of the S12L database by Grimme [Chem. Eur. J. 18, 9955 (2012)] were calculated using intermolecular symmetry-adapted perturbation theory combined with a density-functional theory description of the interacting molecules. The individual interaction energy decompositions revealed no particular change in the stabilisation pattern as compared to smaller dimer systems at equilibrium structures. This demonstrates that, to some extent, the qualitative description of the interaction of small dimer systems may be extrapolated to larger systems, a method that is widely used in force-fields in which the total interaction energy is decomposed into atom-atom contributions. A comparison of the binding energies with accurate experimental reference values from Grimme, the latter including thermodynamic corrections from semiempirical calculations, has shown a fairly good agreement to within the error range of the reference binding energies.

Analysis of oxygen binding-energy variations for BaO on W

NASA Astrophysics Data System (ADS)

Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.

Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.

Binding Energies of the Proton-Bound Amino Acid Dimers Gly·Gly, Ala·Ala, Gly·Ala, and Lys·Lys Measured by Blackbody Infrared Radiative Dissociation

PubMed Central

Price, William D.; Schnier, Paul D.

2005-01-01

Arrhenius activation energies in the zero-pressure limit for dissociation of gas-phase proton-bound homodimers of N,N-dimethylacetamide (N,N-DMA), glycine, alanine, and lysine and the heterodimer alanine·glycine were measured using blackbody infrared radiative dissociation (BIRD). In combination with master equation modeling of the kinetic data, binding energies of these dimers were determined. A value of 1.25 ± 0.05 eV is obtained for N,N-DMA and is in excellent agreement with that reported in the literature. The value obtained from the truncated Boltzmann model is significantly higher, indicating that the assumptions of this model do not apply to these ions. This is due to the competitive rates of photon emission and dissociation for these relatively large ions. The binding energies of the amino acid dimers are ~1.15 ± 0.05 eV and are indistinguishable despite the difference in their gas-phase basicity and structure. The threshold dissociation energies can be accurately modeled using a range of dissociation parameters and absorption/emission rates. However, the absolute values of the dissociation rates depend more strongly on the absorption/emission rates. For N,N-DMA and glycine, an accurate fit was obtained using frequencies and transition dipole moments calculated at the ab initio RHF/2-31G* and MP2/2-31G* level, respectively. In order to obtain a similar accuracy using values obtained from AM1 semiempirical calculations, it was necessary to multiply the transition dipole moments by a factor of 3. These results demonstrate that in combination with master equation modeling, BIRD can be used to obtain accurate threshold dissociation energies of relatively small ions of biological interest. PMID:17235378

Tinker-OpenMM: Absolute and relative alchemical free energies using AMOEBA on GPUs.

PubMed

Harger, Matthew; Li, Daniel; Wang, Zhi; Dalby, Kevin; Lagardère, Louis; Piquemal, Jean-Philip; Ponder, Jay; Ren, Pengyu

2017-09-05

The capabilities of the polarizable force fields for alchemical free energy calculations have been limited by the high computational cost and complexity of the underlying potential energy functions. In this work, we present a GPU-based general alchemical free energy simulation platform for polarizable potential AMOEBA. Tinker-OpenMM, the OpenMM implementation of the AMOEBA simulation engine has been modified to enable both absolute and relative alchemical simulations on GPUs, which leads to a ∼200-fold improvement in simulation speed over a single CPU core. We show that free energy values calculated using this platform agree with the results of Tinker simulations for the hydration of organic compounds and binding of host-guest systems within the statistical errors. In addition to absolute binding, we designed a relative alchemical approach for computing relative binding affinities of ligands to the same host, where a special path was applied to avoid numerical instability due to polarization between the different ligands that bind to the same site. This scheme is general and does not require ligands to have similar scaffolds. We show that relative hydration and binding free energy calculated using this approach match those computed from the absolute free energy approach. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Precise determination of neutron binding energy of 64Cu

NASA Astrophysics Data System (ADS)

Telezhnikov, S. A.; Granja, C.; Honzatko, J.; Pospisil, S.; Tomandl, I.

2016-05-01

The neutron binding energy in 64Cu has been accurately measured in thermal neutron capture. A composite target of natural Cu and NaCl was used on a high flux neutron beam using a large measuring time. The γ-ray spectrum emitted in the ( n, γ) reaction was measured with a HPGe detector in large statistics (up to 106 events per channel). Intrinsic limitations of HPGe detectors, which restrict the accuracy of energy calibration, were determined. The value B n of 64Cu was determined as 7915.867(24) keV.

Comparison of gas-solid chromatography and MM2 force field molecular binding energies for greenhouse gases on a carbonaceous surface.

PubMed

Rybolt, Thomas R; Bivona, Kevin T; Thomas, Howard E; O'Dell, Casey M

2009-10-01

Gas-solid chromatography was used to determine B(2s) (gas-solid virial coefficient) values for eight molecular adsorbates interacting with a carbon powder (Carbopack B, Supelco). B(2s) values were determined by multiple size variant injections within the temperature range of 313-553 K. The molecular adsorbates included: carbon dioxide (CO(2)); tetrafluoromethane (CF(4)); hexafluoroethane (C(2)F(6)); 1,1-difluoroethane (C(2)H(4)F(2)); 1-chloro-1,1-difluoroethane (C(2)H(3)ClF(2)); dichlorodifluoromethane (CCl(2)F(2)); trichlorofluoromethane (CCl(3)F); and 1,1,1-trichloroethane (C(2)H(3)Cl(3)). Two of these molecules are of special interest because they are "super greenhouse gases". The global warming potential, GWP, for CF(4) is 6500 and for C(2)F(6) is 9200 relative to the reference value of 1 for CO(2). The GWP index considers both radiative blocking and molecular lifetime. For these and other industrial greenhouse gases, adsorptive trapping on a carbonaceous solid, which depends on molecule-surface binding energy, could avoid atmospheric release. The temperature variations of the gas-solid virial coefficients in conjunction with van't Hoff plots were used to find the experimental adsorption energy or binding energy values (E(*)) for each adsorbate. A molecular mechanics based, rough-surface model was used to calculate the molecule-surface binding energy (Ecal(*)) using augmented MM2 parameters. The surface model consisted of parallel graphene layers with two separated nanostructures each containing 17 benzene rings arranged in linear strips. The separation of the parallel nanostructures had been optimized in a prior study to appropriately represent molecule-surface interactions for Carbopack B. Linear regressions of E(*) versus Ecal(*) for the current data set of eight molecules and the same surface model gave E(*)=0.926 Ecal(*) and r(2)=0.956. A combined set of the current and prior Carbopack B adsorbates studied (linear alkanes, branched alkanes, cyclic alkanes, ethers, and halogenated hydrocarbons) gave a data set with 33 molecules and a regression of E(*)=0.991 Ecal(*) and r(2)=0.968. These results indicated a good correlation between the experimental and the MM2 computed molecule-surface binding energies.

Combined effects of an intense laser field, electric field and hydrostatic pressure on donor impurity states in zinc-blende InGaN/GaN quantum dots

NASA Astrophysics Data System (ADS)

Wang, Guangxin; Zhou, Rui; Duan, Xiuzhi

2016-07-01

The shallow-donor impurity states in cylindrical zinc-blende (ZB) In x Ga1- x N/GaN quantum dots (QDs) have been theoretically investigated, considering the combined effects of an intense laser field (ILF), an external electric field, and hydrostatic pressure. The numerical results show that for an on-center impurity in ZB In x Ga1- x N/GaN QD, (1) the ground-state binding energy of the donor impurity is a decreasing function of the laser-dressing parameter and/or the QD's height; (2) as the QD's radius decreases, the binding energy of the donor impurity increases at first, reaches a maximum value, and then drops rapidly; (3) the binding energy of the donor impurity is a decreasing function of the external electric field due to the Stark effect; (4) the binding energy of the donor impurity increases as the applied hydrostatic pressure becomes large. In addition, the position of the impurity ion was also found to have an important influence on the binding energy of the donor impurity. The physical reasons have been analyzed in detail.

Using docking and alchemical free energy approach to determine the binding mechanism of eEF2K inhibitors and prioritizing the compound synthesis.

PubMed

Wang, Qiantao; Edupuganti, Ramakrishna; Tavares, Clint D J; Dalby, Kevin N; Ren, Pengyu

2015-01-01

A-484954 is a known eEF2K inhibitor with submicromolar IC50 potency. However, the binding mechanism and the crystal structure of the kinase remains unknown. Here, we employ a homology eEF2K model, docking and alchemical free energy simulations to probe the binding mechanism of eEF2K, and in turn, guide the optimization of potential lead compounds. The inhibitor was docked into the ATP-binding site of a homology model first. Three different binding poses, hypothesis 1, 2, and 3, were obtained and subsequently applied to molecular dynamics (MD) based alchemical free energy simulations. The calculated relative binding free energy of the analogs of A-484954 using the binding pose of hypothesis 1 show a good correlation with the experimental IC50 values, yielding an r (2) coefficient of 0.96 after removing an outlier (compound 5). Calculations using another two poses show little correlation with experimental data, (r (2) of less than 0.5 with or without removing any outliers). Based on hypothesis 1, the calculated relative free energy suggests that bigger cyclic groups, at R1 e.g., cyclobutyl and cyclopentyl promote more favorable binding than smaller groups, such as cyclopropyl and hydrogen. Moreover, this study also demonstrates the ability of the alchemical free energy approach in combination with docking and homology modeling to prioritize compound synthesis. This can be an effective means of facilitating structure-based drug design when crystal structures are not available.

Binding energies from diffusion Monte Carlo for the MB-pol H{sub 2}O and D{sub 2}O dimer: A comparison to experimental values

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mallory, Joel D.; Mandelshtam, Vladimir A.

2015-10-14

The diffusion Monte Carlo (DMC) method is applied to compute the ground state energies of the water monomer and dimer and their D{sub 2}O isotopomers using MB-pol; the most recent and most accurate ab inito-based potential energy surface (PES). MB-pol has already demonstrated excellent agreement with high level electronic structure data, as well as agreement with some experimental, spectroscopic, and thermodynamic data. Here, the DMC binding energies of (H{sub 2}O){sub 2} and (D{sub 2}O){sub 2} agree with the corresponding values obtained from velocity map imaging within, respectively, 0.01 and 0.02 kcal/mol. This work adds two more valuable data points thatmore » highlight the accuracy of the MB-pol PES.« less

Binding of two-electron metastable states in semiconductor quantum dots under a magnetic field

NASA Astrophysics Data System (ADS)

Garagiola, Mariano; Pont, Federico M.; Osenda, Omar

2018-04-01

Applying a strong enough magnetic field results in the binding of few-electron resonant states. The mechanism was proposed many years ago but its verification in laboratory conditions is far more recent. In this work we study the binding of two-electron resonant states. The electrons are confined in a cylindrical quantum dot which is embedded in a semiconductor wire. The geometry considered is similar to the one used in actual experimental setups. The low-energy two-electron spectrum is calculated numerically from an effective-mass approximation Hamiltonian modelling the system. Methods for binding threshold calculations in systems with one and two electrons are thoroughly studied; in particular, we use quantum information quantities to assess when the strong lateral confinement approximation can be used to obtain reliable low-energy spectra. For simplicity, only cases without bound states in the absence of an external field are considered. Under these conditions, the binding threshold for the one-electron case is given by the lowest Landau energy level. Moreover, the energy of the one-electron bounded resonance can be used to obtain the two-electron binding threshold. It is shown that for realistic values of the two-electron model parameters it is feasible to bind resonances with field strengths of a few tens of tesla.

The structure and energetics of Cr(CO)6 and Cr(CO)5

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.; Liu, Bowen; Lindh, Roland

1992-01-01

The geometric structure of Cr(CO)6 is optimized at the modified coupled pair functional (MCPF), single and double excitation coupled-cluster (CCSD) and CCSD(T) levels of theory (including a perturbational estimate for connected triple excitations), and the force constants for the totally symmetric representation are determined. The geometry of Cr(CO)5 is partially optimized at the MCPF, CCSD, and CCSD(T) levels of theory. Comparison with experimental data shows that the CCSD(T) method gives the best results for the structures and force constants, and that remaining errors are probably due to deficiencies in the one-particle basis sets used for CO. The total binding energies of Cr(CO)6 and Cr(CO)5 are also determined at the MCPF, CCSD, and CCSD(T) levels of theory. The CCSD(T) method gives a much larger total binding energy than either the MCPF or CCSD methods. An analysis of the basis set superposition error (BSSE) at the MCPF level of treatment points out limitations in the one-particle basis used. Calculations using larger basis sets reduce the BSSE, but the total binding energy of Cr(CO)6 is still significantly smaller than the experimental value, although the first CO bond dissociation energy of Cr(CO)6 is well described. An investigation of 3s3p correlation reveals only a small effect. In the largest basis set, the total CO binding energy of Cr(CO)6 is estimated to be 140 kcal/mol at the CCSD(T) level of theory, or about 86 percent of the experimental value. The remaining discrepancy between the experimental and theoretical value is probably due to limitations in the one-particle basis, rather than limitations in the correlation treatment. In particular an additional d function and an f function on each C and O are needed to obtain quantitative results. This is underscored by the fact that even using a very large primitive set (1042 primitive functions contracted to 300 basis functions), the superposition error for the total binding energy of Cr(CO)6 is 22 kcal/mol at the MCPF level of treatment.

Crown oxygen-doping graphene with embedded main-group metal atoms

NASA Astrophysics Data System (ADS)

Wu, Liyuan; Wang, Qian; Yang, Chuanghua; Quhe, Ruge; Guan, Pengfei; Lu, Pengfei

2018-02-01

Different main-group metal atoms embedded in crown oxygen-doping graphene (metal@OG) systems are studied by the density functional theory. The binding energies and electronic structures are calculated by using first-principles calculations. The binding energy of metal@OG system mainly depends on the electronegativity of the metal atom. The lower the value of the electronegativity, the larger the binding energy, indicating the more stable the system. The electronic structure of metal@OG arouses the emergence of bandgap and shift of Dirac point. It is shown that interaction between metal atom and crown oxygen-doping graphene leads to the graphene's stable n-doping, and the metal@OG systems are stable semiconducting materials, which can be used in technological applications.

Experimentally Determined Binding Energies of Astrophysically Relevant Hydrocarbons in Pure and H2O-Layered Ices

NASA Astrophysics Data System (ADS)

Behmard, Aida; Graninger, Dawn; Fayolle, Edith; Oberg, Karin I.

2017-01-01

Small hydrocarbons represent an important organic reservoir in a variety of interstellar environments. Constraints on desorption temperatures and binding energies of hydrocarbons are thus necessary for accurate predictions of where and in which phase these molecules exist. Through a series of temperature programmed desorption experiments, we determined binding energies of 1, 2, and 3-carbon interstellar hydrocarbons (CH4, C2H2, C2H4, C2H6, C3H4, C3H6, and C3H8) in pure ices and in relation to water ice, the dominant ice constituent during star and planet formation. These empirically determined values can be used to inform observations and models of the molecular spatial distribution in protoplanetary disks, thus providing insight into planetesimal composition. In addition, knowledge of hydrocarbon binding energies will refine simulations of grain surface chemistry, allowing for better predictions of the chemical conditions that lead to the production of complex organic molecules vital for life.

Anionic water pentamer and hexamer clusters: An extensive study of structures and energetics

NASA Astrophysics Data System (ADS)

Ünal, Aslı; Bozkaya, Uǧur

2018-03-01

An extensive study of structures and energetics for anionic pentamer and hexamer clusters is performed employing high level ab initio quantum chemical methods, such as the density-fitted orbital-optimized linearized coupled-cluster doubles (DF-OLCCD), coupled-cluster singles and doubles (CCSD), and coupled-cluster singles and doubles with perturbative triples [CCSD(T)] methods. In this study, sixteen anionic pentamer clusters and eighteen anionic hexamer clusters are reported. Relative, binding, and vertical detachment energies (VDE) are presented at the complete basis set limit (CBS), extrapolating energies of aug4-cc-pVTZ and aug4-cc-pVQZ custom basis sets. The largest VDE values obtained at the CCSD(T)/CBS level are 9.9 and 11.2 kcal mol-1 for pentamers and hexamers, respectively, which are in very good agreement with the experimental values of 9.5 and 11.1 kcal mol-1. Our binding energy results, at the CCSD(T)/CBS level, indicate strong bindings in anionic clusters due to hydrogen bond interactions. The average binding energy per water molecules is -5.0 and -5.3 kcal mol-1 for pentamers and hexamers, respectively. Furthermore, our results demonstrate that the DF-OLCCD method approaches to the CCSD(T) quality for anionic clusters. The inexpensive analytic gradients of DF-OLCCD compared to CCSD or CCSD(T) make it very attractive for high-accuracy studies.

Anionic water pentamer and hexamer clusters: An extensive study of structures and energetics.

PubMed

Ünal, Aslı; Bozkaya, Uğur

2018-03-28

An extensive study of structures and energetics for anionic pentamer and hexamer clusters is performed employing high level ab initio quantum chemical methods, such as the density-fitted orbital-optimized linearized coupled-cluster doubles (DF-OLCCD), coupled-cluster singles and doubles (CCSD), and coupled-cluster singles and doubles with perturbative triples [CCSD(T)] methods. In this study, sixteen anionic pentamer clusters and eighteen anionic hexamer clusters are reported. Relative, binding, and vertical detachment energies (VDE) are presented at the complete basis set limit (CBS), extrapolating energies of aug4-cc-pVTZ and aug4-cc-pVQZ custom basis sets. The largest VDE values obtained at the CCSD(T)/CBS level are 9.9 and 11.2 kcal mol -1 for pentamers and hexamers, respectively, which are in very good agreement with the experimental values of 9.5 and 11.1 kcal mol -1 . Our binding energy results, at the CCSD(T)/CBS level, indicate strong bindings in anionic clusters due to hydrogen bond interactions. The average binding energy per water molecules is -5.0 and -5.3 kcal mol -1 for pentamers and hexamers, respectively. Furthermore, our results demonstrate that the DF-OLCCD method approaches to the CCSD(T) quality for anionic clusters. The inexpensive analytic gradients of DF-OLCCD compared to CCSD or CCSD(T) make it very attractive for high-accuracy studies.

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015.

PubMed

Deng, Nanjie; Flynn, William F; Xia, Junchao; Vijayan, R S K; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015

NASA Astrophysics Data System (ADS)

Deng, Nanjie; Flynn, William F.; Xia, Junchao; Vijayan, R. S. K.; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M.

2016-09-01

We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate binders from nonbinders in virtual screening and to more accurately predict the ligand binding modes prior to the more computationally expensive FEP calculations of binding affinity.

Molecular dynamics simulation and binding free energy studies of novel leads belonging to the benzofuran class inhibitors of Mycobacterium tuberculosis Polyketide Synthase 13.

PubMed

Cruz, Jorddy N; Costa, José F S; Khayat, André S; Kuca, Kamil; Barros, Carlos A L; Neto, A M J C

2018-05-04

In this work, the binding mechanism of new Polyketide Synthase 13 (Pks13) inhibitors has been studied through molecular dynamics simulation and free energy calculations. The drug Tam1 and its analogs, belonging to the benzofuran class, were submitted to 100 ns simulations, and according to the results obtained for root mean square deviation, all the simulations converged from approximately 30 ns. For the analysis of backbone flotation, the root mean square fluctuations were plotted for the Cα atoms; analysis revealed that the greatest fluctuation occurred in the residues that are part of the protein lid domain. The binding free energy value (ΔG bind ) obtained for the Tam16 lead molecule was of -51.43 kcal/mol. When comparing this result with the ΔG bind values for the remaining analogs, the drug Tam16 was found to be the highest ranked: this result is in agreement with the experimental results obtained by Aggarwal and collaborators, where it was verified that the IC 50 for Tam16 is the smallest necessary to inhibit the Pks13 (IC 50  = 0.19 μM). The energy decomposition analysis suggested that the residues which most interact with inhibitors are: Ser1636, Tyr1637, Asn1640, Ala1667, Phe1670, and Tyr1674, from which the greatest energy contribution to Phe1670 was particularly notable. For the lead molecule Tam16, a hydrogen bond with the hydroxyl of the phenol not observed in the other analogs induced a more stable molecular structure. Aggarwal and colleagues reported this hydrogen bonding as being responsible for the stability of the molecule, optimizing its physic-chemical, toxicological, and pharmacokinetic properties.

Computational scheme for pH-dependent binding free energy calculation with explicit solvent.

PubMed

Lee, Juyong; Miller, Benjamin T; Brooks, Bernard R

2016-01-01

We present a computational scheme to compute the pH-dependence of binding free energy with explicit solvent. Despite the importance of pH, the effect of pH has been generally neglected in binding free energy calculations because of a lack of accurate methods to model it. To address this limitation, we use a constant-pH methodology to obtain a true ensemble of multiple protonation states of a titratable system at a given pH and analyze the ensemble using the Bennett acceptance ratio (BAR) method. The constant pH method is based on the combination of enveloping distribution sampling (EDS) with the Hamiltonian replica exchange method (HREM), which yields an accurate semi-grand canonical ensemble of a titratable system. By considering the free energy change of constraining multiple protonation states to a single state or releasing a single protonation state to multiple states, the pH dependent binding free energy profile can be obtained. We perform benchmark simulations of a host-guest system: cucurbit[7]uril (CB[7]) and benzimidazole (BZ). BZ experiences a large pKa shift upon complex formation. The pH-dependent binding free energy profiles of the benchmark system are obtained with three different long-range interaction calculation schemes: a cutoff, the particle mesh Ewald (PME), and the isotropic periodic sum (IPS) method. Our scheme captures the pH-dependent behavior of binding free energy successfully. Absolute binding free energy values obtained with the PME and IPS methods are consistent, while cutoff method results are off by 2 kcal mol(-1) . We also discuss the characteristics of three long-range interaction calculation methods for constant-pH simulations. © 2015 The Protein Society.

Edge currents in frustrated Josephson junction ladders

NASA Astrophysics Data System (ADS)

Marques, A. M.; Santos, F. D. R.; Dias, R. G.

2016-09-01

We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method

PubMed Central

2011-01-01

Background The reliable and robust estimation of ligand binding affinity continues to be a challenge in drug design. Many current methods rely on molecular mechanics (MM) calculations which do not fully explain complex molecular interactions. Full quantum mechanical (QM) computation of the electronic state of protein-ligand complexes has recently become possible by the latest advances in the development of linear-scaling QM methods such as the ab initio fragment molecular orbital (FMO) method. This approximate molecular orbital method is sufficiently fast that it can be incorporated into the development cycle during structure-based drug design for the reliable estimation of ligand binding affinity. Additionally, the FMO method can be combined with approximations for entropy and solvation to make it applicable for binding affinity prediction for a broad range of target and chemotypes. Results We applied this method to examine the binding affinity for a series of published cyclin-dependent kinase 2 (CDK2) inhibitors. We calculated the binding affinity for 28 CDK2 inhibitors using the ab initio FMO method based on a number of X-ray crystal structures. The sum of the pair interaction energies (PIE) was calculated and used to explain the gas-phase enthalpic contribution to binding. The correlation of the ligand potencies to the protein-ligand interaction energies gained from FMO was examined and was seen to give a good correlation which outperformed three MM force field based scoring functions used to appoximate the free energy of binding. Although the FMO calculation allows for the enthalpic component of binding interactions to be understood at the quantum level, as it is an in vacuo single point calculation, the entropic component and solvation terms are neglected. For this reason a more accurate and predictive estimate for binding free energy was desired. Therefore, additional terms used to describe the protein-ligand interactions were then calculated to improve the correlation of the FMO derived values to experimental free energies of binding. These terms were used to account for the polar and non-polar solvation of the molecule estimated by the Poisson-Boltzmann equation and the solvent accessible surface area (SASA), respectively, as well as a correction term for ligand entropy. A quantitative structure-activity relationship (QSAR) model obtained by Partial Least Squares projection to latent structures (PLS) analysis of the ligand potencies and the calculated terms showed a strong correlation (r2 = 0.939, q2 = 0.896) for the 14 molecule test set which had a Pearson rank order correlation of 0.97. A training set of a further 14 molecules was well predicted (r2 = 0.842), and could be used to obtain meaningful estimations of the binding free energy. Conclusions Our results show that binding energies calculated with the FMO method correlate well with published data. Analysis of the terms used to derive the FMO energies adds greater understanding to the binding interactions than can be gained by MM methods. Combining this information with additional terms and creating a scaled model to describe the data results in more accurate predictions of ligand potencies than the absolute values obtained by FMO alone. PMID:21219630

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kolmann, Stephen J.; D'Arcy, Jordan H.; Jordan, Meredith J. T., E-mail: m.jordan@chem.usyd.edu.au

Quantum and anharmonic effects are investigated in H{sub 2}-Li{sup +}-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials. Three- and 8-dimensional quantum diffusion Monte Carlo (QDMC) and rigid-body diffusion Monte Carlo (RBDMC) simulations are performed on potential energy surfaces interpolated from electronic structure calculations at the M05-2X/6-31+G(d,p) and M05-2X/6-311+G(2df,p) levels of theory using a three-dimensional spline or a modified Shepard interpolation. These calculations investigate the intermolecular interactions in this system, with three- and 8-dimensional 0 K H{sub 2} binding enthalpy estimates, ΔH{sub bind} (0 K), being 16.5 kJ mol{sup −1} and 12.4 kJ mol{sup −1}, respectively: 0.1 and 0.6more » kJ mol{sup −1} higher than harmonic values. Zero-point energy effects are 35% of the value of ΔH{sub bind} (0 K) at M05-2X/6-311+G(2df,p) and cannot be neglected; uncorrected electronic binding energies overestimate ΔH{sub bind} (0 K) by at least 6 kJ mol{sup −1}. Harmonic intermolecular binding enthalpies can be corrected by treating the H{sub 2} “helicopter” and “ferris wheel” rotations as free and hindered rotations, respectively. These simple corrections yield results within 2% of the 8-dimensional anharmonic calculations. Nuclear ground state probability density histograms obtained from the QDMC and RBDMC simulations indicate the H{sub 2} molecule is delocalized above the Li{sup +}-benzene system at 0 K.« less

Calculations of antiproton-nucleus quasi-bound states using the Paris N bar N potential

NASA Astrophysics Data System (ADS)

Hrtánková, Jaroslava; Mareš, Jiří

2018-01-01

An optical potential constructed using the p bar N scattering amplitudes derived from the 2009 version of the Paris N bar N potential is applied in calculations of p bar quasi-bound states in selected nuclei across the periodic table. A proper self-consistent procedure for treating energy dependence of the amplitudes in a nucleus appears crucial for evaluating p bar binding energies and widths. Particular attention is paid to the role of P-wave amplitudes. While the P-wave potential nearly does not affect calculated p bar binding energies, it reduces considerably the corresponding widths. The Paris S-wave potential supplemented by a phenomenological P-wave term yields in dynamical calculations p bar binding energies Bpbar ≈ 200 MeV and widths Γpbar ∼ 200- 230 MeV, which is very close to the values obtained within the RMF model consistent with p bar -atom data.

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

Enhanced Ligand Sampling for Relative Protein–Ligand Binding Free Energy Calculations

PubMed Central

2016-01-01

Free energy calculations are used to study how strongly potential drug molecules interact with their target receptors. The accuracy of these calculations depends on the accuracy of the molecular dynamics (MD) force field as well as proper sampling of the major conformations of each molecule. However, proper sampling of ligand conformations can be difficult when there are large barriers separating the major ligand conformations. An example of this is for ligands with an asymmetrically substituted phenyl ring, where the presence of protein loops hinders the proper sampling of the different ring conformations. These ring conformations become more difficult to sample when the size of the functional groups attached to the ring increases. The Adaptive Integration Method (AIM) has been developed, which adaptively changes the alchemical coupling parameter λ during the MD simulation so that conformations sampled at one λ can aid sampling at the other λ values. The Accelerated Adaptive Integration Method (AcclAIM) builds on AIM by lowering potential barriers for specific degrees of freedom at intermediate λ values. However, these methods may not work when there are very large barriers separating the major ligand conformations. In this work, we describe a modification to AIM that improves sampling of the different ring conformations, even when there is a very large barrier between them. This method combines AIM with conformational Monte Carlo sampling, giving improved convergence of ring populations and the resulting free energy. This method, called AIM/MC, is applied to study the relative binding free energy for a pair of ligands that bind to thrombin and a different pair of ligands that bind to aspartyl protease β-APP cleaving enzyme 1 (BACE1). These protein–ligand binding free energy calculations illustrate the improvements in conformational sampling and the convergence of the free energy compared to both AIM and AcclAIM. PMID:25906170

Onset of η-meson binding in the He isotopes

NASA Astrophysics Data System (ADS)

Barnea, N.; Friedman, E.; Gal, A.

2017-12-01

The onset of binding η (548) mesons in nuclei is studied in the He isotopes by doing precise ηNNN and ηNNNN few-body stochastic variational method calculations for two semi-realistic NN potentials and two energy dependent ηN potentials derived from coupled-channel models of the N* (1535) nucleon resonance. The energy dependence of the ηN subthreshold input is treated self consistently. It is found that a minimal value of the real part of the ηN scattering length aηN close to 1 fm is required to bind η mesons in 3He, yielding then a few MeV η binding in 4He. The onset of η-meson binding in 4He requires that Re aηN exceeds 0.7 fm approximately. These results compare well with results of recent ηNNN and ηNNNN pionless effective field theory calculations. Related optical-model calculations are also discussed.

Tuning exciton energy and fine-structure splitting in single InAs quantum dots by applying uniaxial stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Dan; Dou, Xiuming; Wu, Xuefei

2016-04-15

Exciton and biexciton emission energies as well as excitonic fine-structure splitting (FSS) in single InAs/GaAs quantum dots (QDs) have been continuously tuned in situ in an optical cryostat using a developed uniaxial stress device. With increasing tensile stress, the red shift of excitonic emission is up to 5 nm; FSS decreases firstly and then increases monotonically, reaching a minimum value of approximately 10 μeV; biexciton binding energy decreases from 460 to 106 μeV. This technique provides a simple and convenient means to tune QD structural symmetry, exciton energy and biexciton binding energy and can be used for generating entangled andmore » indistinguishable photons.« less

Calculations of binding affinity between C8-substituted GTP analogs and the bacterial cell-division protein FtsZ

PubMed Central

Hritz, Jozef; Läppchen, Tilman

2010-01-01

The FtsZ protein is a self-polymerizing GTPase that plays a central role in bacterial cell division. Several C8-substituted GTP analogs are known to inhibit the polymerization of FtsZ by competing for the same binding site as its endogenous activating ligand GTP. Free energy calculations of the relative binding affinities to FtsZ for a set of five C8-substituted GTP analogs were performed. The calculated values agree well with the available experimental data, and the main contribution to the free energy differences is determined to be the conformational restriction of the ligands. The dihedral angle distributions around the glycosidic bond of these compounds in water are known to vary considerably depending on the physicochemical properties of the substituent at C8. However, within the FtsZ protein, this substitution has a negligible influence on the dihedral angle distributions, which fall within the narrow range of −140° to −90° for all investigated compounds. The corresponding ensemble average of the coupling constants 3J(C4,H1′) is calculated to be 2.95 ± 0.1 Hz. The contribution of the conformational selection of the GTP analogs upon binding was quantified from the corresponding populations. The obtained restraining free energy values follow the same trend as the relative binding affinities to FtsZ, indicating their dominant contribution. PMID:20559630

Ligand binding to telomeric G-quadruplex DNA investigated by funnel-metadynamics simulations

PubMed Central

Moraca, Federica; Amato, Jussara; Ortuso, Francesco; Artese, Anna; Novellino, Ettore; Alcaro, Stefano; Parrinello, Michele; Limongelli, Vittorio

2017-01-01

G-quadruplexes (G4s) are higher-order DNA structures typically present at promoter regions of genes and telomeres. Here, the G4 formation decreases the replicative DNA at each cell cycle, finally leading to apoptosis. The ability to control this mitotic clock, particularly in cancer cells, is fascinating and passes through a rational understanding of the ligand/G4 interaction. We demonstrate that an accurate description of the ligand/G4 binding mechanism is possible using an innovative free-energy method called funnel-metadynamics (FM), which we have recently developed to investigate ligand/protein interaction. Using FM simulations, we have elucidated the binding mechanism of the anticancer alkaloid berberine to the human telomeric G4 (d[AG3(T2AG3)3]), computing also the binding free-energy landscape. Two ligand binding modes have been identified as the lowest energy states. Furthermore, we have found prebinding sites, which are preparatory to reach the final binding mode. In our simulations, the ions and the water molecules have been explicitly represented and the energetic contribution of the solvent during ligand binding evaluated. Our theoretical results provide an accurate estimate of the absolute ligand/DNA binding free energy (ΔGb0 = −10.3 ± 0.5 kcal/mol) that we validated through steady-state fluorescence binding assays. The good agreement between the theoretical and experimental value demonstrates that FM is a most powerful method to investigate ligand/DNA interaction and can be a useful tool for the rational design also of G4 ligands. PMID:28232513

Rational design of biaryl pharmacophore inserted noscapine derivatives as potent tubulin binding anticancer agents.

PubMed

Santoshi, Seneha; Manchukonda, Naresh Kumar; Suri, Charu; Sharma, Manya; Sridhar, Balasubramanian; Joseph, Silja; Lopus, Manu; Kantevari, Srinivas; Baitharu, Iswar; Naik, Pradeep Kumar

2015-03-01

We have strategically designed a series of noscapine derivatives by inserting biaryl pharmacophore (a major structural constituent of many of the microtubule-targeting natural anticancer compounds) onto the scaffold structure of noscapine. Molecular interaction of these derivatives with α,β-tubulin heterodimer was investigated by molecular docking, molecular dynamics simulation, and binding free energy calculation. The predictive binding affinity indicates that the newly designed noscapinoids bind to tubulin with a greater affinity. The predictive binding free energy (ΔG(bind, pred)) of these derivatives (ranging from -5.568 to -5.970 kcal/mol) based on linear interaction energy (LIE) method with a surface generalized Born (SGB) continuum solvation model showed improved binding affinity with tubulin compared to the lead compound, natural α-noscapine (-5.505 kcal/mol). Guided by the computational findings, these new biaryl type α-noscapine congeners were synthesized from 9-bromo-α-noscapine using optimized Suzuki reaction conditions for further experimental evaluation. The derivatives showed improved inhibition of the proliferation of human breast cancer cells (MCF-7), human cervical cancer cells (HeLa) and human lung adenocarcinoma cells (A549), compared to natural noscapine. The cell cycle analysis in MCF-7 further revealed that these compounds alter the cell cycle profile and cause mitotic arrest at G2/M phase more strongly than noscapine. Tubulin binding assay revealed higher binding affinity to tubulin, as suggested by dissociation constant (Kd) of 126 ± 5.0 µM for 5a, 107 ± 5.0 µM for 5c, 70 ± 4.0 µM for 5d, and 68 ± 6.0 µM for 5e compared to noscapine (Kd of 152 ± 1.0 µM). In fact, the experimentally determined value of ΔG(bind, expt) (calculated from the Kd value) are consistent with the predicted value of ΔG(bind, pred) calculated based on LIE-SGB. Based on these results, one of the derivative 5e of this series was used for further toxicological evaluation. Treatment of mice with a daily dose of 300 mg/kg and a single dose of 600 mg/kg indicates that the compound does not induce detectable pathological abnormalities in normal tissues. Also there were no significant differences in hematological parameters between the treated and untreated groups. Hence, the newly designed noscapinoid, 5e is an orally bioavailable, safe and effective anticancer agent with a potential for the treatment of cancer and might be a candidate for clinical evaluation.

Statistical Analysis on the Performance of Molecular Mechanics Poisson–Boltzmann Surface Area versus Absolute Binding Free Energy Calculations: Bromodomains as a Case Study

PubMed Central

2017-01-01

Binding free energy calculations that make use of alchemical pathways are becoming increasingly feasible thanks to advances in hardware and algorithms. Although relative binding free energy (RBFE) calculations are starting to find widespread use, absolute binding free energy (ABFE) calculations are still being explored mainly in academic settings due to the high computational requirements and still uncertain predictive value. However, in some drug design scenarios, RBFE calculations are not applicable and ABFE calculations could provide an alternative. Computationally cheaper end-point calculations in implicit solvent, such as molecular mechanics Poisson–Boltzmann surface area (MMPBSA) calculations, could too be used if one is primarily interested in a relative ranking of affinities. Here, we compare MMPBSA calculations to previously performed absolute alchemical free energy calculations in their ability to correlate with experimental binding free energies for three sets of bromodomain–inhibitor pairs. Different MMPBSA approaches have been considered, including a standard single-trajectory protocol, a protocol that includes a binding entropy estimate, and protocols that take into account the ligand hydration shell. Despite the improvements observed with the latter two MMPBSA approaches, ABFE calculations were found to be overall superior in obtaining correlation with experimental affinities for the test cases considered. A difference in weighted average Pearson () and Spearman () correlations of 0.25 and 0.31 was observed when using a standard single-trajectory MMPBSA setup ( = 0.64 and = 0.66 for ABFE; = 0.39 and = 0.35 for MMPBSA). The best performing MMPBSA protocols returned weighted average Pearson and Spearman correlations that were about 0.1 inferior to ABFE calculations: = 0.55 and = 0.56 when including an entropy estimate, and = 0.53 and = 0.55 when including explicit water molecules. Overall, the study suggests that ABFE calculations are indeed the more accurate approach, yet there is also value in MMPBSA calculations considering the lower compute requirements, and if agreement to experimental affinities in absolute terms is not of interest. Moreover, for the specific protein–ligand systems considered in this study, we find that including an explicit ligand hydration shell or a binding entropy estimate in the MMPBSA calculations resulted in significant performance improvements at a negligible computational cost. PMID:28786670

Design, synthesis and antimalarial screening of some hybrid 4-aminoquinoline-triazine derivatives against pf-DHFR-TS.

PubMed

Sahu, Supriya; Ghosh, Surajit Kumar; Kalita, Junmoni; Dutta, Mayurakhi; Bhat, Hans Raj

2016-04-01

Existing antifolate antimalarial drugs have shown resistance due to the mutations at some amino acid positions of Plasmodium falciparum DHFR-TS. In the present study, to overcome this resistance, a new series of hybrid 4-aminoquinoline-triazine derivatives were designed and docked into the active site of Pf-DHFR-TS (PDB i.d. 1J3K) using validated CDOCKER protocol. Binding energy was calculated by applying CHARMm forcefield. Binding energy and the pattern of interaction of the docked compounds were analysed. Fifteen compounds were selected for synthesis based on their binding energy values and docking poses. Synthesized compounds were characterised by FTIR, (1)H NMR, (13)C NMR, mass spectroscopy and were screened for antimalarial activity against 3D7 strain of Plasmodium falciparum. Copyright © 2016 Elsevier Inc. All rights reserved.

Comparison of molecular mechanics-Poisson-Boltzmann surface area (MM-PBSA) and molecular mechanics-three-dimensional reference interaction site model (MM-3D-RISM) method to calculate the binding free energy of protein-ligand complexes: Effect of metal ion and advance statistical test

NASA Astrophysics Data System (ADS)

Pandey, Preeti; Srivastava, Rakesh; Bandyopadhyay, Pradipta

2018-03-01

The relative performance of MM-PBSA and MM-3D-RISM methods to estimate the binding free energy of protein-ligand complexes is investigated by applying these to three proteins (Dihydrofolate Reductase, Catechol-O-methyltransferase, and Stromelysin-1) differing in the number of metal ions they contain. None of the computational methods could distinguish all the ligands based on their calculated binding free energies (as compared to experimental values). The difference between the two comes from both polar and non-polar part of solvation. For charged ligand case, MM-PBSA and MM-3D-RISM give a qualitatively different result for the polar part of solvation.

Estimating Atomic Contributions to Hydration and Binding Using Free Energy Perturbation.

PubMed

Irwin, Benedict W J; Huggins, David J

2018-06-12

We present a general method called atom-wise free energy perturbation (AFEP), which extends a conventional molecular dynamics free energy perturbation (FEP) simulation to give the contribution to a free energy change from each atom. AFEP is derived from an expansion of the Zwanzig equation used in the exponential averaging method by defining that the system total energy can be partitioned into contributions from each atom. A partitioning method is assumed and used to group terms in the expansion to correspond to individual atoms. AFEP is applied to six example free energy changes to demonstrate the method. Firstly, the hydration free energies of methane, methanol, methylamine, methanethiol, and caffeine in water. AFEP highlights the atoms in the molecules that interact favorably or unfavorably with water. Finally AFEP is applied to the binding free energy of human immunodeficiency virus type 1 protease to lopinavir, and AFEP reveals the contribution of each atom to the binding free energy, indicating candidate areas of the molecule to improve to produce a more strongly binding inhibitor. FEP gives a single value for the free energy change and is already a very useful method. AFEP gives a free energy change for each "part" of the system being simulated, where part can mean individual atoms, chemical groups, amino acids, or larger partitions depending on what the user is trying to measure. This method should have various applications in molecular dynamics studies of physical, chemical, or biochemical phenomena, specifically in the field of computational drug discovery.

A combined spectroscopic, molecular docking and molecular dynamic simulation study on the interaction of quercetin with β-casein nanoparticles.

PubMed

Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Parastar, Hadi

2013-10-05

The interaction of quercetin with β-casein nanoparticle micelle was studied at various temperatures in order to do a complete thermodynamic and molecular analysis on the binding process. The results of fluorescence studies showed the possibility of fluorescence energy transfer between excited tryptophan and quercetin. The determined values of critical transfers distance and the mean distance of ligand from Trp-143 residues in β-casein micelle represents a non-radiative energy transfer mechanism for quenching and the existence of a significant interaction between this flavonoid and β-casein nanoparticle. The equilibrium binding of quercetin with β-casein micelle at different temperatures was studied by using UV-Vis absorption spectroscopy. The chemometric analysis (principal component analysis (PCA) and multivariate curve resolution-alternating least squares (MCR-ALS) methods) on spectrophotometric data revealed the existence of two components in solution (quercetin and β-casein-quercetin complex) and resolved their pure concentration and spectral profiles. This information let us to calculate the equilibrium binding constant at various temperatures and the relevant thermodynamic parameters of interaction (enthalpy, entropy and Gibbs free energy) with low uncertainty. The negative values of entropy and enthalpy changes represent the predominate role of hydrogen binding and van der Waals interactions in the binding process. Docking calculations showed the probable binding site of quercetin is located in the hydrophobic core of β-casein where the quercetin molecule is lined by hydrophobic residues and make five hydrogen bonds and several van der Waals contacts with them. Moreover, molecular dynamic (MD) simulation results suggested that this flavonoid can interact with β-casein, without affecting the secondary structure of β-casein. Simulations, molecular docking and experimental data reciprocally supported each other. Copyright © 2013 Elsevier B.V. All rights reserved.

Unraveling the Molecular Mechanism of Benzothiophene and Benzofuran scaffold merged compounds binding to anti-apoptotic Myeloid cell leukemia 1.

PubMed

Marimuthu, Parthiban; Singaravelu, Kalaimathy

2018-05-10

Myeloid cell leukemia 1 (Mcl1), is an anti-apoptotic member of the Bcl-2 family proteins, has gained considerable importance due to its overexpression activity prevents the oncogenic cells to undergo apoptosis. This overexpression activity of Mcl1 eventually develops strong resistance to a wide variety of anticancer agents. Therefore, designing novel inhibitors with potentials to elicit higher binding affinity and specificity to inhibit Mcl1 activity is of greater importance. Thus, Mcl1 acts as an attractive cancer target. Despite recent experimental advancement in the identification and characterization of Benzothiophene and Benzofuran scaffold merged compounds the molecular mechanisms of their binding to Mcl1 are yet to be explored. The current study demonstrates an integrated approach -pharmacophore-based 3D-QSAR, docking, Molecular Dynamics (MD) simulation and free-energy estimation- to access the precise and comprehensive effects of current inhibitors targeting Mcl1 together with its known activity values. The pharmacophore -ANRRR.240- based 3D-QSAR model from the current study provided high confidence (R 2 =0.9154, Q 2 =0.8736, and RMSE=0.3533) values. Furthermore, the docking correctly predicted the binding mode of highly active compound 42. Additionally, the MD simulation for docked complex under explicit-solvent conditions together with free-energy estimation exhibited stable interaction and binding strength over the time period. Also, the decomposition analysis revealed potential energy contributing residues -M231, M250, V253, R265, L267, and F270- to the complex stability. Overall, the current investigation might serve as a valuable insight, either to (i) improve the binding affinity of the current compounds or (ii) discover new generation anti-cancer agents that can effectively downregulate Mcl1 activity.

Effect of Wigner energy on the symmetry energy coefficient in nuclei

NASA Astrophysics Data System (ADS)

Tian, Jun-Long; Cui, Hai-Tao; Gao, Teng; Wang, Ning

2016-09-01

The nuclear symmetry energy coefficient (including the coefficient of the I4 term) of finite nuclei is extracted by using the differences of available experimental binding energies of isobaric nuclei. It is found that the extracted symmetry energy coefficient decreases with increasing isospin asymmetry I, which is mainly caused by Wigner correction, since is the summation of the traditional symmetry energy esym and the Wigner energy eW. We obtain the optimal values J = 30.25 ± 0.10 MeV, ass = 56.18 ± 1.25 MeV, and the Wigner parameter x = 2.38 ± 0.12 through a polynomial fit to 2240 measured binding energies for nuclei with 20 ⩽ A ⩽ 261 with an rms deviation of 23.42 keV. We also find that the volume symmetry coefficient J ≃ 30 MeV is insensitive to the value x, whereas the surface symmetry coefficient ass and the coefficient are very sensitive to the value of x in the range 1 ⩽ x ⩽ 4. The contribution of the term increases rapidly with increasing isospin asymmetry I. For very neutron-rich nuclei, the contribution of the term will play an important role. Supported by National Natural Science Foundation of China (11475004, 11275052, 11305003, 11375094 and 11465005), Natural Science Foundation of He'nan Educational Committee (2011A140001 and 2011GGJS-147), Open Project Program of State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences (Y4KF041CJ1)

Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

PubMed

Aslanoglu, Mehmet

2006-03-01

The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

Genuine binding energy of the hydrated electron

PubMed Central

Luckhaus, David; Yamamoto, Yo-ichi; Suzuki, Toshinori; Signorell, Ruth

2017-01-01

The unknown influence of inelastic and elastic scattering of slow electrons in water has made it difficult to clarify the role of the solvated electron in radiation chemistry and biology. We combine accurate scattering simulations with experimental photoemission spectroscopy of the hydrated electron in a liquid water microjet, with the aim of resolving ambiguities regarding the influence of electron scattering on binding energy spectra, photoelectron angular distributions, and probing depths. The scattering parameters used in the simulations are retrieved from independent photoemission experiments of water droplets. For the ground-state hydrated electron, we report genuine values devoid of scattering contributions for the vertical binding energy and the anisotropy parameter of 3.7 ± 0.1 eV and 0.6 ± 0.2, respectively. Our probing depths suggest that even vacuum ultraviolet probing is not particularly surface-selective. Our work demonstrates the importance of quantitative scattering simulations for a detailed analysis of key properties of the hydrated electron. PMID:28508051

An accurate redetermination of the 118Sn binding energy

NASA Astrophysics Data System (ADS)

Borzakov, S. B.; Chrien, R. E.; Faikow-Stanczyk, H.; Grigoriev, Yu. V.; Panteleev, Ts. Ts.; Pospisil, S.; Smotritsky, L. M.; Telezhnikov, S. A.

2002-03-01

The energy of well-known strong γ line from 198Au, the "gold standard", has been modified in the light of new adjustments in the fundamental constants and the value of 411.80176(12) keV was determined, which is 0.29 eV lower than the latest 1999 value. An energy calibration procedure for determining the neutron binding energy, Bn, from complicated (n, γ) spectra has been developed. A mathematically simple minimization function consisting only of terms having as parameters the coefficients of the energy calibration curve (polynomial) is used. A priori information about the relationships among the energies of different peaks on the spectrum is taken into account by a Monte-Carlo simulation. The procedure was used in obtaining Bn for 118Sn. The γ-ray spectrum from thermal neutron radiative capture by 117Sn has been measured on the IBR-2 pulsed reactor. γ-rays were detected by a 72 cm 3 HPGe detector. For a better determination of Bn it was important to determine Bn for 64Cu. This value was obtained from two γ-spectra. One spectrum was measured on the IBR-2 by the same detector. The other spectrum was measured with a pair spectrometer at the Brookhaven High Flux Beam Reactor. From these two spectra, Bn for 64Cu was determined to be equal to 7915.52(8) keV. This result essentially differs from the previous value of 7915.96(11) keV. The mean value of the two most precise results of the Bn for 118Sn, was determined to be 9326.35(9) keV. The Bn for 57Fe was determined to be 7646.08(9) keV.

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE PAGES

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.; ...

2017-08-30

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Developing a molecular picture of soil organic matter–mineral interactions by quantifying organo–mineral binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newcomb, C. J.; Qafoku, N. P.; Grate, J. W.

Long residence times of soil organic matter have been attributed to reactive mineral surface sites that sorb organic species and cause inaccessibility due to isolation and chemical stabilization at the organic-mineral interface. Instrumentation for probing this interface is limited. As a result, much of the micron- and molecular-scale knowledge about organic-mineral interactions remains largely qualitative. We report the use of force spectroscopy to directly measure the binding between organic ligands with known chemical functionalities to soil minerals in aqueous environments. By systematically studying the role of organic functional group chemistry with model minerals, we demonstrate that the chemistry of bothmore » the organic ligand and mineral contribute to values of binding free energy and that changes in pH and ionic strength produce significant differences in binding energies. These direct measurements of molecular binding provide mechanistic insights into organo-mineral interactions, which could potentially inform land-carbon models that explicitly include mineral-bound C pools.« less

Computational Studies of Difference in Binding Modes of Peptide and Non-Peptide Inhibitors to MDM2/MDMX Based on Molecular Dynamics Simulations

PubMed Central

Chen, Jianzhong; Zhang, Dinglin; Zhang, Yuxin; Li, Guohui

2012-01-01

Inhibition of p53-MDM2/MDMX interaction is considered to be a promising strategy for anticancer drug design to activate wild-type p53 in tumors. We carry out molecular dynamics (MD) simulations to study the binding mechanisms of peptide and non-peptide inhibitors to MDM2/MDMX. The rank of binding free energies calculated by molecular mechanics generalized Born surface area (MM-GBSA) method agrees with one of the experimental values. The results suggest that van der Waals energy drives two kinds of inhibitors to MDM2/MDMX. We also find that the peptide inhibitors can produce more interaction contacts with MDM2/MDMX than the non-peptide inhibitors. Binding mode predictions based on the inhibitor-residue interactions show that the π–π, CH–π and CH–CH interactions dominated by shape complimentarity, govern the binding of the inhibitors in the hydrophobic cleft of MDM2/MDMX. Our studies confirm the residue Tyr99 in MDMX can generate a steric clash with the inhibitors due to energy and structure. This finding may theoretically provide help to develop potent dual-specific or MDMX inhibitors. PMID:22408446

Polarizability and binding energy of a shallow donor in spherical quantum dot-quantum well (QD-QW)

NASA Astrophysics Data System (ADS)

Rahmani, K.; Chrafih, Y.; M’Zred, S.; Janati, S.; Zorkani, I.; Jorio, A.; Mmadi, A.

2018-03-01

The polarizability and the binding energy is estimated for a shallow donor confined to move in inhomogeneous quantum dots (CdS/HgS/CdS). In this work, the Hass variational method within the effective mass approximation in used in the case of an infinitely deep well. The polarizability and the binding energy depend on the inner and the outer radius of the QDQW, also it depends strongly on the donor position. It’s found that the stark effect is more important when the impurity is located at the center of the (QDQW) and becomes less important when the donor moves toward the extremities of the spherical layer. When the electric field increases, the binding energy and the polarizability decreases. Its effects is more pronounced when the impurity is placed on the center of the spherical layer and decrease when the donor move toward extremities of this spherical layer. We have demonstrated the existence of a critical value {≤ft( {{{{R_1}} \\over {{R_2}}}} \\right)cri} which can be used to distinguish the tree dimension confinement from the spherical surface confinement and it’s may be important for the nanofabrication techniques.

Determination of the binding energies of the np Rydberg states of H{sub 2}, HD, and D{sub 2} from high-resolution spectroscopic data by multichannel quantum-defect theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sprecher, Daniel; Merkt, Frédéric, E-mail: frederic.merkt@phys.chem.ethz.ch; Jungen, Christian

2014-03-14

Multichannel quantum-defect theory (MQDT) is used to calculate the electron binding energies of np Rydberg states of H{sub 2}, HD, and D{sub 2} around n = 60 at an accuracy of better than 0.5 MHz. The theory includes the effects of rovibronic channel interactions and the hyperfine structure, and has been extended to the calculation of the asymmetric hyperfine structure of Rydberg states of a heteronuclear diatomic molecule (HD). Starting values for the eigenquantum-defect parameters of MQDT were extracted from ab initio potential-energy functions for the low-lying p Rydberg states of molecular hydrogen and subsequently refined in a global weighted fitmore » to available experimental data on the singlet and triplet Rydberg states of H{sub 2} and D{sub 2}. The electron binding energies of high-np Rydberg states derived in this work represent important quantities for future determinations of the adiabatic ionization energies of H{sub 2}, HD, and D{sub 2} at sub-MHz accuracy.« less

Modulation of P-glycoprotein activity by novel synthetic curcumin derivatives in sensitive and multidrug-resistant T-cell acute lymphoblastic leukemia cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ooko, Edna

Background: Multidrug resistance (MDR) and drug transporter P-glycoprotein (P-gp) represent major obstacles in cancer chemotherapy. We investigated 19 synthetic curcumin derivatives in drug-sensitive acute lymphoblastic CCRF–CEM leukemia cells and their multidrug-resistant P-gp-overexpressing subline, CEM/ADR5000. Material and methods: Cytotoxicity was tested by resazurin assays. Doxorubicin uptake was assessed by flow cytometry. Binding modes of compounds to P-gp were analyzed by molecular docking. Chemical features responsible for bioactivity were studied by quantitative structure activity relationship (QSAR) analyses. A 7-descriptor QSAR model was correlated with doxorubicin uptake values, IC{sub 50} values and binding energies. Results: The compounds displayed IC{sub 50} values between 0.7more » ± 0.03 and 20.2 ± 0.25 μM. CEM/ADR5000 cells exhibited cross-resistance to 10 compounds, collateral sensitivity to three compounds and regular sensitivity to the remaining six curcumins. Molecular docking studies at the intra-channel transmembrane domain of human P-gp resulted in lowest binding energies ranging from − 9.00 ± 0.10 to − 6.20 ± 0.02 kcal/mol and pKi values from 0.24 ± 0.04 to 29.17 ± 0.88 μM. At the ATP-binding site of P-gp, lowest binding energies ranged from − 9.78 ± 0.17 to − 6.79 ± 0.01 kcal/mol and pKi values from 0.07 ± 0.02 to 0.03 ± 0.03 μM. CEM/ADR5000 cells accumulated approximately 4-fold less doxorubicin than CCRF–CEM cells. The control P-gp inhibitor, verapamil, partially increased doxorubicin uptake in CEM/ADR5000 cells. Six curcumins increased doxorubicin uptake in resistant cells or even exceeded uptake levels compared to sensitive one. QSAR yielded good activity prediction (R = 0.797 and R = 0.794 for training and test sets). Conclusion: Selected derivatives may serve to guide future design of novel P-gp inhibitors and collateral sensitive drugs to combat MDR. - Highlights: • Novel derivatives of curcumin in reversing multidrug resistance (MDR) • Biological and Insilco assays to assess effect on P-glycoprotein (P-gp) • Curcumin synthetic derivatives as possible lead compound against multidrug resistant cancer.« less

Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

PubMed Central

Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

2017-01-01

Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

Semi-empirical quantum evaluation of peptide - MHC class II binding

NASA Astrophysics Data System (ADS)

González, Ronald; Suárez, Carlos F.; Bohórquez, Hugo J.; Patarroyo, Manuel A.; Patarroyo, Manuel E.

2017-01-01

Peptide presentation by the major histocompatibility complex (MHC) is a key process for triggering a specific immune response. Studying peptide-MHC (pMHC) binding from a structural-based approach has potential for reducing the costs of investigation into vaccine development. This study involved using two semi-empirical quantum chemistry methods (PM7 and FMO-DFTB) for computing the binding energies of peptides bonded to HLA-DR1 and HLA-DR2. We found that key stabilising water molecules involved in the peptide binding mechanism were required for finding high correlation with IC50 experimental values. Our proposal is computationally non-intensive, and is a reliable alternative for studying pMHC binding interactions.

Discovery of HIV Type 1 Aspartic Protease Hit Compounds through Combined Computational Approaches.

PubMed

Xanthopoulos, Dimitrios; Kritsi, Eftichia; Supuran, Claudiu T; Papadopoulos, Manthos G; Leonis, Georgios; Zoumpoulakis, Panagiotis

2016-08-05

A combination of computational techniques and inhibition assay experiments was employed to identify hit compounds from commercial libraries with enhanced inhibitory potency against HIV type 1 aspartic protease (HIV PR). Extensive virtual screening with the aid of reliable pharmacophore models yielded five candidate protease inhibitors. Subsequent molecular dynamics and molecular mechanics Poisson-Boltzmann surface area free-energy calculations for the five ligand-HIV PR complexes suggested a high stability of the systems through hydrogen-bond interactions between the ligands and the protease's flaps (Ile50/50'), as well as interactions with residues of the active site (Asp25/25'/29/29'/30/30'). Binding-energy calculations for the three most promising compounds yielded values between -5 and -10 kcal mol(-1) and suggested that van der Waals interactions contribute most favorably to the total energy. The predicted binding-energy values were verified by in vitro inhibition assays, which showed promising results in the high nanomolar range. These results provide structural considerations that may guide further hit-to-lead optimization toward improved anti-HIV drugs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Functional anatomy of an allosteric protein

NASA Astrophysics Data System (ADS)

Purohit, Prasad; Gupta, Shaweta; Jadey, Snehal; Auerbach, Anthony

2013-12-01

Synaptic receptors are allosteric proteins that switch on and off to regulate cell signalling. Here, we use single-channel electrophysiology to measure and map energy changes in the gating conformational change of a nicotinic acetylcholine receptor. Two separated regions in the α-subunits—the transmitter-binding sites and αM2-αM3 linkers in the membrane domain—have the highest ϕ-values (change conformation the earliest), followed by the extracellular domain, most of the membrane domain and the gate. Large gating-energy changes occur at the transmitter-binding sites, α-subunit interfaces, the αM1 helix and the gate. We hypothesize that rearrangements of the linkers trigger the global allosteric transition, and that the hydrophobic gate unlocks in three steps. The mostly local character of side-chain energy changes and the similarly high ϕ-values of separated domains, both with and without ligands, suggest that gating is not strictly a mechanical process initiated by the affinity change for the agonist.

Theory of nanobubble formation and induced force in nanochannels

NASA Astrophysics Data System (ADS)

Arai, Noriyoshi; Koishi, Takahiro; Ebisuzaki, Toshikazu

2017-10-01

This paper presents a fundamental theory of nanobubble formation and induced force in confined nanochannels. It is shown that nanobubble formation between hydrophobic plates can be predicted from their surface tension and geometry, with estimated values for the surface free energy and the force acting on the plates in good agreement with the results of molecular dynamics simulation and experimentation. When a bubble is formed between two plates, vertical attractive force and horizontal retract force due to the shifted plates are applied to the plates. The net force exerted on the plates is not dependent on the distance between them. The short-range force between hydrophobic surfaces due to hydrophobic interaction appears to correspond to the force estimated by our theory. We compared between experimental and theoretical values for the binding energy of a molecular motor system to validate our theory. The tendency that the binding energy increases as the size of the protein increases is consistent with the theory.

Binding analysis for interaction of diacetylcurcumin with β-casein nanoparticles by using fluorescence spectroscopy and molecular docking calculations

NASA Astrophysics Data System (ADS)

Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Fani, Najme; Keyhanfar, Mehrnaz

2013-11-01

The interaction of diacetylcurcumin (DAC), as a novel synthetic derivative of curcumin, with bovine β-casein (an abundant milk protein that is highly amphiphilic and self assembles into stable micellar nanoparticles in aqueous solution) was investigated using fluorescence quenching experiments, Forster energy transfer measurements and molecular docking calculations. The fluorescence quenching measurements revealed the presence of a single binding site on β-casein for DAC with the binding constant value equals to (4.40 ± 0.03) × 104 M-1. Forster energy transfer measurements suggested that the distance between bound DAC and Trp143 residue is higher than the respective critical distance, hence, the static quenching is more likely responsible for fluorescence quenching other than the mechanism of non-radiative energy transfer. Our results from molecular docking calculations indicated that binding of DAC to β-casein predominantly occurred through hydrophobic contacts in the hydrophobic core of protein. Additionally, in vitro investigation of the cytotoxicity of free DAC and DAC-β-casein complex in human breast cancer cell line MCF7 revealed the higher cytotoxic effect of DAC-β-casein complex.

Statistical Analysis on the Performance of Molecular Mechanics Poisson-Boltzmann Surface Area versus Absolute Binding Free Energy Calculations: Bromodomains as a Case Study.

PubMed

Aldeghi, Matteo; Bodkin, Michael J; Knapp, Stefan; Biggin, Philip C

2017-09-25

Binding free energy calculations that make use of alchemical pathways are becoming increasingly feasible thanks to advances in hardware and algorithms. Although relative binding free energy (RBFE) calculations are starting to find widespread use, absolute binding free energy (ABFE) calculations are still being explored mainly in academic settings due to the high computational requirements and still uncertain predictive value. However, in some drug design scenarios, RBFE calculations are not applicable and ABFE calculations could provide an alternative. Computationally cheaper end-point calculations in implicit solvent, such as molecular mechanics Poisson-Boltzmann surface area (MMPBSA) calculations, could too be used if one is primarily interested in a relative ranking of affinities. Here, we compare MMPBSA calculations to previously performed absolute alchemical free energy calculations in their ability to correlate with experimental binding free energies for three sets of bromodomain-inhibitor pairs. Different MMPBSA approaches have been considered, including a standard single-trajectory protocol, a protocol that includes a binding entropy estimate, and protocols that take into account the ligand hydration shell. Despite the improvements observed with the latter two MMPBSA approaches, ABFE calculations were found to be overall superior in obtaining correlation with experimental affinities for the test cases considered. A difference in weighted average Pearson ([Formula: see text]) and Spearman ([Formula: see text]) correlations of 0.25 and 0.31 was observed when using a standard single-trajectory MMPBSA setup ([Formula: see text] = 0.64 and [Formula: see text] = 0.66 for ABFE; [Formula: see text] = 0.39 and [Formula: see text] = 0.35 for MMPBSA). The best performing MMPBSA protocols returned weighted average Pearson and Spearman correlations that were about 0.1 inferior to ABFE calculations: [Formula: see text] = 0.55 and [Formula: see text] = 0.56 when including an entropy estimate, and [Formula: see text] = 0.53 and [Formula: see text] = 0.55 when including explicit water molecules. Overall, the study suggests that ABFE calculations are indeed the more accurate approach, yet there is also value in MMPBSA calculations considering the lower compute requirements, and if agreement to experimental affinities in absolute terms is not of interest. Moreover, for the specific protein-ligand systems considered in this study, we find that including an explicit ligand hydration shell or a binding entropy estimate in the MMPBSA calculations resulted in significant performance improvements at a negligible computational cost.

Docking analysis targeted to the whole enzyme: an application to the prediction of inhibition of PTP1B by thiomorpholine and thiazolyl derivatives.

PubMed

Ganou, C A; Eleftheriou, P Th; Theodosis-Nobelos, P; Fesatidou, M; Geronikaki, A A; Lialiaris, T; Rekka, E A

2018-02-01

PTP1b is a protein tyrosine phosphatase involved in the inactivation of insulin receptor. Since inhibition of PTP1b may prolong the action of the receptor, PTP1b has become a drug target for the treatment of type II diabetes. In the present study, prediction of inhibition using docking analysis targeted specifically to the active or allosteric site was performed on 87 compounds structurally belonging to 10 different groups. Two groups, consisting of 15 thiomorpholine and 10 thiazolyl derivatives exhibiting the best prediction results, were selected for in vitro evaluation. All thiomorpholines showed inhibitory action (with IC 50 = 4-45 μΜ, Ki = 2-23 μM), while only three thiazolyl derivatives showed low inhibition (best IC 50 = 18 μΜ, Ki = 9 μΜ). However, free binding energy (E) was in accordance with the IC 50 values only for some compounds. Docking analysis targeted to the whole enzyme revealed that the compounds exhibiting IC 50 values higher than expected could bind to other peripheral sites with lower free energy, E o , than when bound to the active/allosteric site. A prediction factor, E- (Σ Eo × 0.16), which takes into account lower energy binding to peripheral sites, was proposed and was found to correlate well with the IC 50 values following an asymmetrical sigmoidal equation with r 2 = 0.9692.

Computational active site analysis of molecular pathways to improve functional classification of enzymes.

PubMed

Ozyurt, A Sinem; Selby, Thomas L

2008-07-01

This study describes a method to computationally assess the function of homologous enzymes through small molecule binding interaction energy. Three experimentally determined X-ray structures and four enzyme models from ornithine cyclo-deaminase, alanine dehydrogenase, and mu-crystallin were used in combination with nine small molecules to derive a function score (FS) for each enzyme-model combination. While energy values varied for a single molecule-enzyme combination due to differences in the active sites, we observe that the binding energies for the entire pathway were proportional for each set of small molecules investigated. This proportionality of energies for a reaction pathway appears to be dependent on the amino acids in the active site and their direct interactions with the small molecules, which allows a function score (FS) to be calculated to assess the specificity of each enzyme. Potential of mean force (PMF) calculations were used to obtain the energies, and the resulting FS values demonstrate that a measurement of function may be obtained using differences between these PMF values. Additionally, limitations of this method are discussed based on: (a) larger substrates with significant conformational flexibility; (b) low homology enzymes; and (c) open active sites. This method should be useful in accurately predicting specificity for single enzymes that have multiple steps in their reactions and in high throughput computational methods to accurately annotate uncharacterized proteins based on active site interaction analysis. 2008 Wiley-Liss, Inc.

Introducing folding stability into the score function for computational design of RNA-binding peptides boosts the probability of success.

PubMed

Xiao, Xingqing; Agris, Paul F; Hall, Carol K

2016-05-01

A computational strategy that integrates our peptide search algorithm with atomistic molecular dynamics simulation was used to design rational peptide drugs that recognize and bind to the anticodon stem and loop domain (ASL(Lys3)) of human tRNAUUULys3 for the purpose of interrupting HIV replication. The score function of the search algorithm was improved by adding a peptide stability term weighted by an adjustable factor λ to the peptide binding free energy. The five best peptide sequences associated with five different values of λ were determined using the search algorithm and then input in atomistic simulations to examine the stability of the peptides' folded conformations and their ability to bind to ASL(Lys3). Simulation results demonstrated that setting an intermediate value of λ achieves a good balance between optimizing the peptide's binding ability and stabilizing its folded conformation during the sequence evolution process, and hence leads to optimal binding to the target ASL(Lys3). Thus, addition of a peptide stability term significantly improves the success rate for our peptide design search. © 2016 Wiley Periodicals, Inc.

Gas Adsorption and Selectivity in Zeolitic Imidazolate Frameworks from First Principles Calculations

NASA Astrophysics Data System (ADS)

Ray, Keith; Olmsted, David; He, Ning; Houndonougbo, Yao; Laird, Brian; Asta, Mark

2012-02-01

Zeolitic Imidazolate Framework (ZIFs) are excellent candidate materials for carbon capture and gas separation. Here we employ the van der Waals density functional (vdW-DF) [1] in an analysis of the binding energetics for CO2, CH4 and N2 molecules in a set of ZIFs featuring different chemical functionalizations. We investigate multiple low-energy binding sites, which differ in their positions relative to functional groups on the imidazole linkers. In all cases an accurate treatment of van der Waals forces appears essential to provide reasonable binding energy magnitudes. We report results obtained from different parameterizations of the vdW-DF, providing comparisons between calculations and experimental values of the heat of adsorption [2]. This research is supported by the Energy Frontier Research Center ``Molecularly Engineered Energy Materials,'' funded by the US Department of Energy, Office of Science, Office of Basic Energy Sciences under Award Number DE-SC0001342. [1] M. Dion, H. Rydberg, E. Schroder, D. C. Langreth, B. I. Lundqvist, Phys. Rev. Let. 92, 246401 (2004) [2] W. Morris, B. Leung, H. Furukawa, O. K. Yaghi, N. He, H. Hayashi, Y. Houndonougbo, M. Asta, B. B. Laird, O. M. Yaghi, J. AM. CHEM. SOC. 2010, 132, 11006-11008

Coupled-cluster and explicitly correlated perturbation-theory calculations of the uracil anion.

PubMed

Bachorz, Rafał A; Klopper, Wim; Gutowski, Maciej

2007-02-28

A valence-type anion of the canonical tautomer of uracil has been characterized using explicitly correlated second-order Moller-Plesset perturbation theory (RI-MP2-R12) in conjunction with conventional coupled-cluster theory with single, double, and perturbative triple excitations. At this level of electron-correlation treatment and after inclusion of a zero-point vibrational energy correction, determined in the harmonic approximation at the RI-MP2 level of theory, the valence anion is adiabatically stable with respect to the neutral molecule by 40 meV. The anion is characterized by a vertical detachment energy of 0.60 eV. To obtain accurate estimates of the vertical and adiabatic electron binding energies, a scheme was applied in which electronic energy contributions from various levels of theory were added, each of them extrapolated to the corresponding basis-set limit. The MP2 basis-set limits were also evaluated using an explicitly correlated approach, and the results of these calculations are in agreement with the extrapolated values. A remarkable feature of the valence anionic state is that the adiabatic electron binding energy is positive but smaller than the adiabatic electron binding energy of the dipole-bound state.

Investigation of differences in the binding affinities of two analogous ligands for untagged and tagged p38 kinase using thermodynamic integration MD simulation.

PubMed

Sun, Ying-Chieh; Hsu, Wen-Chi; Hsu, Chia-Jen; Chang, Chia-Ming; Cheng, Kai-Hsiang

2015-11-01

Thermodynamic integration (TI) molecular dynamics (MD) simulations for the binding of a pair of a reference ("ref") ligand and an analogous ("analog") ligand to either tagged (with six extra residues at the N-terminus) or untagged p38 kinase proteins were carried out in order to probe how the binding affinity is influenced by the presence or absence of the peptide tag in p38 kinase. This possible effect of protein length on the binding affinity of a ligand-which is seldom addressed in the literature-is important because, even when two labs claim to have performed experiments with the same protein, they may actually have studied variants of the same protein with different lengths because they applied different protein expression conditions/procedures. Thus, if we wanted to compare ligand binding affinities measured in the two labs, it would be necessary to account for any variation in ligand binding affinity with protein length. The pair of ligand-p38 kinase complexes examined in this work (pdb codes: 3d7z and 3lhj, respectively) were ideal for investigating this effect. The experimentally determined binding energy for the ref ligand with the untagged p38 kinase was -10.9 kcal mol(-1), while that for the analog ligand with the tagged p38 kinase was -11.9 kcal mol(-1). The present TI-MD simulation of the mutation of the ref ligand into the analog ligand while the ligand is bound to the untagged p38 kinase predicted that the binding affinity of the analog ligand is 2.0 kcal mol(-1) greater than that of the ref ligand. A similar simulation also indicated that the same was true for ligand binding to the tagged protein, but in this case the binding affinity for the analog ligand is 2.5 kcal mol(-1) larger than that for the ref ligand. These results therefore suggest that the presence of the peptide tag on p38 kinase increased the difference in the binding energies of the ligands by a small amount of 0.5 kcal mol(-1). This result supports the assumption that the presence of a peptide tag has only a minor effect on ΔG values. The error bars in the computed ΔG values were then estimated via confidence interval analysis and a time autocorrelation function for the quantity dV/dλ. The estimated correlation time was ~0.5 ps and the error bar in the ΔG values estimated using nanosecond-scale simulations was ±0.3 kcal mol(-1) at a confidence level of 95%. These predicted results can be verified in future experiments and should prove useful in subsequent similar studies. Graphical Abstract Thermodynamic cycles for binding of two analogous ligands with untagged and tagged p38 kinases and associated Gibbs free energy.

Rational design of biaryl pharmacophore inserted noscapine derivatives as potent tubulin binding anticancer agents

NASA Astrophysics Data System (ADS)

Santoshi, Seneha; Manchukonda, Naresh Kumar; Suri, Charu; Sharma, Manya; Sridhar, Balasubramanian; Joseph, Silja; Lopus, Manu; Kantevari, Srinivas; Baitharu, Iswar; Naik, Pradeep Kumar

2015-03-01

We have strategically designed a series of noscapine derivatives by inserting biaryl pharmacophore (a major structural constituent of many of the microtubule-targeting natural anticancer compounds) onto the scaffold structure of noscapine. Molecular interaction of these derivatives with α,β-tubulin heterodimer was investigated by molecular docking, molecular dynamics simulation, and binding free energy calculation. The predictive binding affinity indicates that the newly designed noscapinoids bind to tubulin with a greater affinity. The predictive binding free energy (ΔGbind, pred) of these derivatives (ranging from -5.568 to -5.970 kcal/mol) based on linear interaction energy (LIE) method with a surface generalized Born (SGB) continuum solvation model showed improved binding affinity with tubulin compared to the lead compound, natural α-noscapine (-5.505 kcal/mol). Guided by the computational findings, these new biaryl type α-noscapine congeners were synthesized from 9-bromo-α-noscapine using optimized Suzuki reaction conditions for further experimental evaluation. The derivatives showed improved inhibition of the proliferation of human breast cancer cells (MCF-7), human cervical cancer cells (HeLa) and human lung adenocarcinoma cells (A549), compared to natural noscapine. The cell cycle analysis in MCF-7 further revealed that these compounds alter the cell cycle profile and cause mitotic arrest at G2/M phase more strongly than noscapine. Tubulin binding assay revealed higher binding affinity to tubulin, as suggested by dissociation constant (Kd) of 126 ± 5.0 µM for 5a, 107 ± 5.0 µM for 5c, 70 ± 4.0 µM for 5d, and 68 ± 6.0 µM for 5e compared to noscapine (Kd of 152 ± 1.0 µM). In fact, the experimentally determined value of ΔGbind, expt (calculated from the Kd value) are consistent with the predicted value of ΔGbind, pred calculated based on LIE-SGB. Based on these results, one of the derivative 5e of this series was used for further toxicological evaluation. Treatment of mice with a daily dose of 300 mg/kg and a single dose of 600 mg/kg indicates that the compound does not induce detectable pathological abnormalities in normal tissues. Also there were no significant differences in hematological parameters between the treated and untreated groups. Hence, the newly designed noscapinoid, 5e is an orally bioavailable, safe and effective anticancer agent with a potential for the treatment of cancer and might be a candidate for clinical evaluation.

Thermodynamics of surface defects at the aspirin/water interface

NASA Astrophysics Data System (ADS)

Schneider, Julian; Zheng, Chen; Reuter, Karsten

2014-09-01

We present a simulation scheme to calculate defect formation free energies at a molecular crystal/water interface based on force-field molecular dynamics simulations. To this end, we adopt and modify existing approaches to calculate binding free energies of biological ligand/receptor complexes to be applicable to common surface defects, such as step edges and kink sites. We obtain statistically accurate and reliable free energy values for the aspirin/water interface, which can be applied to estimate the distribution of defects using well-established thermodynamic relations. As a show case we calculate the free energy upon dissolving molecules from kink sites at the interface. This free energy can be related to the solubility concentration and we obtain solubility values in excellent agreement with experimental results.

Communication: Local energetic analysis of the interfacial and surface energies of graphene from the single layer to graphite

NASA Astrophysics Data System (ADS)

Kocherlakota, Lakshmi S.; Krajina, Brad A.; Overney, René M.

2015-12-01

Recent advances in scanning probe methods that provide direct access to the surface free energy of inorganic layered materials in terms of the Hamaker constant yield energetic values for monolayer graphene that differ substantially, by a factor of around 0.4, from bulk graphite. The onset of bulk deviating energy values was observed at a multilayer slab thickness of ˜3 nm, corresponding to a layer number of 10. The findings, complemented with extractions from water contact angle measurements and calculated interlayer binding energies, find short-range ordinary van der Waals interactions to be most prominently affected by dimensional constraints and many-body interactions.

Communication: Local energetic analysis of the interfacial and surface energies of graphene from the single layer to graphite.

PubMed

Kocherlakota, Lakshmi S; Krajina, Brad A; Overney, René M

2015-12-28

Recent advances in scanning probe methods that provide direct access to the surface free energy of inorganic layered materials in terms of the Hamaker constant yield energetic values for monolayer graphene that differ substantially, by a factor of around 0.4, from bulk graphite. The onset of bulk deviating energy values was observed at a multilayer slab thickness of ∼3 nm, corresponding to a layer number of 10. The findings, complemented with extractions from water contact angle measurements and calculated interlayer binding energies, find short-range ordinary van der Waals interactions to be most prominently affected by dimensional constraints and many-body interactions.

The Formation of Fibrils by Intertwining of Filaments: Model and Application to Amyloid Aβ Protein

PubMed Central

van Gestel, Jeroen; de Leeuw, Simon W.

2007-01-01

We outline a model that describes the interaction of rods that form intertwined bundles. In this simple model, we compare the elastic energy penalty that arises due to the deformation of the rods to the gain in binding energy upon intertwining. We find that, for proper values of the bending Young's modulus and the binding energy, a helical pitch may be found for which the energy of intertwining is most favorable. We apply our description to the problem of Alzheimer's Aβ protein fibrillization. If we forbid configurations that exhibit steric overlap between the protofilaments that make up a protein fibril, our model predicts that fibrils consisting of three protofilaments shall form. This agrees well with experimental results. Our model can also provide an estimate for the helical pitch of suitable fibrils. PMID:17114229

Energetic basis for the molecular-scale organization of bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Jinhui; Battle, Keith C.; Pan, Haihua

2014-12-24

The remarkable properties of bone derive from a highly organized arrangement of co-aligned nm-scale apatite platelets within a fibrillar collagen matrix. The origin of this arrangement is poorly understood and the crystal structures of hydroxyapatite (HAP) and the non-mineralized collagen fibrils alone do not provide an explanation. Moreover, little is known about collagen-apatite interaction energies, which should strongly influence both the molecular-scale organization and the resulting mechanical properties of the composite. We investigated collagen-mineral interactions by combining dynamic force spectroscopy (DFS) measurements of binding energies with molecular dynamics (MD) simulations of binding and AFM observations of collagen adsorption on singlemore » crystals of calcium phosphate for four mineral phases of potential importance in bone formation. In all cases, we observe a strong preferential orientation of collagen binding, but comparison between the observed orientations and TEM analyses native tissues shows only calcium-deficient apatite (CDAP) provides an interface with collagen that is consistent with both. MD simulations predict preferred collagen orientations that agree with observations and results from both MD and DFS reveal large values for the binding energy due to multiple binding sites. These findings reconcile apparent contradictions inherent in a hydroxyapatite or carbonated apatite (CAP) model of bone mineral and provide an energetic rationale for the molecular scale organization of bone.« less

Energetic basis for the molecular-scale organization of bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Jinhui; Battle, Keith C.; Pan, Haihua

The remarkable properties of bone derive from a highly organized arrangement of co-aligned nm-scale apatite platelets within a fibrillar collagen matrix. The origin of this arrangement is poorly understood and the crystal structures of hydroxyapatite (HAP) and the non-mineralized collagen fibrils alone do not provide an explanation. Moreover, little is known about collagen-apatite interaction energies, which should strongly influence both the molecular-scale organization and the resulting mechanical properties of the composite. We investigated collagen-mineral interactions by combining dynamic force spectroscopy (DFS) measurements of binding energies with molecular dynamics (MD) simulations of binding and AFM observations of collagen adsorption on singlemore » crystals of calcium phosphate for four mineral phases of potential importance in bone formation. In all cases, we observe a strong preferential orientation of collagen binding, but comparison between the observed orientations and TEM analyses native tissues shows only calcium-deficient apatite (CDAP) provides an interface with collagen that is consistent with both. MD simulations predict preferred collagen orientations that agree with observations and results from both MD and DFS reveal large values for the binding energy due to multiple binding sites. These findings reconcile apparent contradictions inherent in a hydroxyapatite or carbonated apatite (CAP) model of bone mineral and provide an energetic rationale for the molecular scale organization of bone.« less

Correlation between the Open-Circuit Voltage and Charge Transfer State Energy in Organic Photovoltaic Cells.

PubMed

Zou, Yunlong; Holmes, Russell J

2015-08-26

In order to further improve the performance of organic photovoltaic cells (OPVs), it is essential to better understand the factors that limit the open-circuit voltage (VOC). Previous work has sought to correlate the value of VOC in donor-acceptor (D-A) OPVs to the interface energy level offset (EDA). In this work, measurements of electroluminescence are used to extract the charge transfer (CT) state energy for multiple small molecule D-A pairings. The CT state as measured from electroluminescence is found to show better correlation to the maximum VOC than EDA. The difference between EDA and the CT state energy is attributed to the Coulombic binding energy of the CT state. This correlation is demonstrated explicitly by inserting an insulating spacer layer between the donor and acceptor materials, reducing the binding energy of the CT state and increasing the measured VOC. These results demonstrate a direct correlation between maximum VOC and CT state energy.

Crystal molecular dynamics simulations to speed up MM/PB(GB)SA evaluation of binding free energies of di-mannose deoxy analogs with P51G-m4-Cyanovirin-N.

PubMed

Vorontsov, Ivan I; Miyashita, Osamu

2011-04-30

Complexes of two Cyanovirin-N (CVN) mutants, m4-CVN and P51G-m4-CVN, with deoxy di-mannose analogs were employed as models to generate conformational ensembles using explicit water Molecular Dynamics (MD) simulations in solution and in crystal environment. The results were utilized for evaluation of binding free energies with the molecular mechanics Poisson-Boltzmann (or Generalized Born) surface area, MM/PB(GB)SA, methods. The calculations provided the ranking of deoxy di-mannose ligands affinity in agreement with available qualitative experimental evidences. This confirms the importance of the hydrogen-bond network between di-mannose 3'- and 4'-hydroxyl groups and the protein binding site B(M) as a basis of the CVN activity as an effective HIV fusion inhibitor. Comparison of binding free energies averaged over snapshots from the solution and crystal simulations showed high promises in the use of the crystal matrix for acceleration of the conformational ensemble generation, the most time consuming step in MM/PB(GB)SA approach. Correlation between energy values based on solution versus crystal ensembles is 0.95 for both MM/PBSA and MM/GBSA methods. Copyright © 2010 Wiley Periodicals, Inc.

Equilibrium structure and atomic vibrations of Nin clusters

NASA Astrophysics Data System (ADS)

Borisova, Svetlana D.; Rusina, Galina G.

2017-12-01

The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

Dissociation free-energy profiles of specific and nonspecific DNA-protein complexes.

PubMed

Yonetani, Yoshiteru; Kono, Hidetoshi

2013-06-27

DNA-binding proteins recognize DNA sequences with at least two different binding modes: specific and nonspecific. Experimental structures of such complexes provide us a static view of the bindings. However, it is difficult to reveal further mechanisms of their target-site search and recognition only from static information because the transition process between the bound and unbound states is not clarified by static information. What is the difference between specific and nonspecific bindings? Here we performed adaptive biasing force molecular dynamics simulations with the specific and nonspecific structures of DNA-Lac repressor complexes to investigate the dissociation process. The resultant free-energy profiles showed that the specific complex has a sharp, deep well consistent with tight binding, whereas the nonspecific complex has a broad, shallow well consistent with loose binding. The difference in the well depth, ~5 kcal/mol, was in fair agreement with the experimentally obtained value and was found to mainly come from the protein conformational difference, particularly in the C-terminal tail. Also, the free-energy profiles were found to be correlated with changes in the number of protein-DNA contacts and that of surface water molecules. The derived protein spatial distributions around the DNA indicate that any large dissociation occurs rarely, regardless of the specific and nonspecific sites. Comparison of the free-energy barrier for sliding [~8.7 kcal/mol; Furini J. Phys. Chem. B 2010, 114, 2238] and that for dissociation (at least ~16 kcal/mol) calculated in this study suggests that sliding is much preferred to dissociation.

Predicting binding modes of reversible peptide-based inhibitors of falcipain-2 consistent with structure-activity relationships.

PubMed

Hernández González, Jorge Enrique; Hernández Alvarez, Lilian; Pascutti, Pedro Geraldo; Valiente, Pedro A

2017-09-01

Falcipain-2 (FP-2) is a major hemoglobinase of Plasmodium falciparum, considered an important drug target for the development of antimalarials. A previous study reported a novel series of 20 reversible peptide-based inhibitors of FP-2. However, the lack of tridimensional structures of the complexes hinders further optimization strategies to enhance the inhibitory activity of the compounds. Here we report the prediction of the binding modes of the aforementioned inhibitors to FP-2. A computational approach combining previous knowledge on the determinants of binding to the enzyme, docking, and postdocking refinement steps, is employed. The latter steps comprise molecular dynamics simulations and free energy calculations. Remarkably, this approach leads to the identification of near-native ligand conformations when applied to a validation set of protein-ligand structures. Overall, we proposed substrate-like binding modes of the studied compounds fulfilling the structural requirements for FP-2 binding and yielding free energy values that correlated well with the experimental data. Proteins 2017; 85:1666-1683. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Prediction of potency of protease inhibitors using free energy simulations with polarizable quantum mechanics-based ligand charges and a hybrid water model.

PubMed

Das, Debananda; Koh, Yasuhiro; Tojo, Yasushi; Ghosh, Arun K; Mitsuya, Hiroaki

2009-12-01

Reliable and robust prediction of the binding affinity for drug molecules continues to be a daunting challenge. We simulated the binding interactions and free energy of binding of nine protease inhibitors (PIs) with wild-type and various mutant proteases by performing GBSA simulations in which each PI's partial charge was determined by quantum mechanics (QM) and the partial charge accounts for the polarization induced by the protease environment. We employed a hybrid solvation model that retains selected explicit water molecules in the protein with surface-generalized Born (SGB) implicit solvent. We examined the correlation of the free energy with the antiviral potency of PIs with regard to amino acid substitutions in protease. The GBSA free energy thus simulated showed strong correlations (r > 0.75) with antiviral IC(50) values of PIs when amino acid substitutions were present in the protease active site. We also simulated the binding free energy of PIs with P2-bis-tetrahydrofuranylurethane (bis-THF) or related cores, utilizing a bis-THF-containing protease crystal structure as a template. The free energy showed a strong correlation (r = 0.93) with experimentally determined anti-HIV-1 potency. The present data suggest that the presence of selected explicit water in protein and protein polarization-induced quantum charges for the inhibitor, compared to lack of explicit water and a static force-field-based charge model, can serve as an improved lead optimization tool and warrants further exploration.

A calorimetric investigation of the interaction of the lac repressor with inducer.

PubMed

Donnér, J; Caruthers, M H; Gill, S J

1982-12-25

A calorimetric study has been made of the interaction between the lac repressor and isopropyl-1-thio-beta-D-galactopyranoside (IPTG). The buffer-corrected enthalpy of reaction at 25 degrees C was found to be -15.6, -24.7, -4.6 kJ/mol of bound IPTG at pH 7.0, pH 8.1, and pH 9.0, respectively. This large range of enthalpy values is in contrast to a maximum difference in the free energy of the reaction of only 1.5 kJ/mol of bound IPTG between these pH values. The reaction was found by calorimetric measurements in different buffers to be accompanied by an uptake of 0.29 mol of protons/mol of bound IPTG at pH 8.1. The pH dependency of the reaction enthalpy suggests differences in the extent of protonation of the binding site and the involvement of H bonding with IPTG. The lack of strong hydrophobic contributions in the IPTG binding process is revealed by the absence of any determinable heat capacity change for the reaction at pH 7.0. The presence of phosphate buffer significantly alters the enthalpy of IPTG binding at higher pH values, but has little effect upon the binding constant. This implies that highly negative phosphate species change the nature of the IPTG binding site without any displacement of phosphate upon IPTG binding.

Structure and stability of fluorine-substituted benzene-argon complexes: The decisive role of exchange-repulsion and dispersion interactions

NASA Astrophysics Data System (ADS)

Tarakeshwar, P.; Kim, Kwang S.; Kraka, Elfi; Cremer, Dieter

2001-10-01

The van der Waals complexes benzene-argon (BAr), fluorobenzene-argon (FAr), p-difluorobenzene-argon (DAr) are investigated at the second-order Møller-Plesset (MP2) level of theory using the 6-31+G(d), cc-pVDZ, aug-cc-pVTZ, and [7s4p2d1f/4s3p1d/3s1p] basis sets. Geometries, binding energies, harmonic vibrational frequencies, and density distribution are calculated where basis set superposition errors are corrected with the counterpoise method. Binding energies turn out to be almost identical (MP2/[7s4p2d1f/4s3p1d/3s1p]: 408, 409, 408 cm-1) for BAr, FAr, and DAr. Vibrationally corrected binding energies (357, 351, 364 cm-1) agree well with experimental values (340, 344, and 339 cm-1). Symmetry adapted perturbation theory (SAPT) is used to decompose binding energies and to examine the influence of attractive and repulsive components. Fluorine substituents lead to a contraction of the π density of the benzene ring, thus reducing the destabilizing exchange-repulsion and exchange-induction effects. At the same time, both the polarizing power and the polarizability of the π-density of the benzene derivative decreases thus reducing stabilizing induction and dispersion interactions. Stabilizing and destabilizing interactions largely cancel each other out to give comparable binding energies. The equilibrium geometry of the Ar complex is also a result of the decisive influence of exchange-repulsion and dispersive interactions.

GMXPBSA 2.0: A GROMACS tool to perform MM/PBSA and computational alanine scanning

NASA Astrophysics Data System (ADS)

Paissoni, C.; Spiliotopoulos, D.; Musco, G.; Spitaleri, A.

2014-11-01

GMXPBSA 2.0 is a user-friendly suite of Bash/Perl scripts for streamlining MM/PBSA calculations on structural ensembles derived from GROMACS trajectories, to automatically calculate binding free energies for protein-protein or ligand-protein complexes. GMXPBSA 2.0 is flexible and can easily be customized to specific needs. Additionally, it performs computational alanine scanning (CAS) to study the effects of ligand and/or receptor alanine mutations on the free energy of binding. Calculations require only for protein-protein or protein-ligand MD simulations. GMXPBSA 2.0 performs different comparative analysis, including a posteriori generation of alanine mutants of the wild-type complex, calculation of the binding free energy values of the mutant complexes and comparison of the results with the wild-type system. Moreover, it compares the binding free energy of different complexes trajectories, allowing the study the effects of non-alanine mutations, post-translational modifications or unnatural amino acids on the binding free energy of the system under investigation. Finally, it can calculate and rank relative affinity to the same receptor utilizing MD simulations of proteins in complex with different ligands. In order to dissect the different MM/PBSA energy contributions, including molecular mechanic (MM), electrostatic contribution to solvation (PB) and nonpolar contribution to solvation (SA), the tool combines two freely available programs: the MD simulations software GROMACS and the Poisson-Boltzmann equation solver APBS. All the calculations can be performed in single or distributed automatic fashion on a cluster facility in order to increase the calculation by dividing frames across the available processors. The program is freely available under the GPL license.

Heat Capacity Changes and Disorder-to-Order Transitions in Allosteric Activation.

PubMed

Cressman, William J; Beckett, Dorothy

2016-01-19

Allosteric coupling in proteins is ubiquitous but incompletely understood, particularly in systems characterized by coupling over large distances. Binding of the allosteric effector, bio-5'-AMP, to the Escherichia coli biotin protein ligase, BirA, enhances the protein's dimerization free energy by -4 kcal/mol. Previous studies revealed that disorder-to-order transitions at the effector binding and dimerization sites, which are separated by 33 Å, are integral to functional coupling. Perturbations to the transition at the ligand binding site alter both ligand binding and coupled dimerization. Alanine substitutions in four loops on the dimerization surface yield a range of energetic effects on dimerization. A glycine to alanine substitution at position 142 in one of these loops results in a complete loss of allosteric coupling, disruption of the disorder-to-order transitions at both functional sites, and a decreased affinity for the effector. In this work, allosteric communication between the effector binding and dimerization surfaces in BirA was further investigated by performing isothermal titration calorimetry measurements on nine proteins with alanine substitutions in three dimerization surface loops. In contrast to BirAG142A, at 20 °C all variants bind to bio-5'-AMP with free energies indistinguishable from that measured for wild-type BirA. However, the majority of the variants exhibit altered heat capacity changes for effector binding. Moreover, the ΔCp values correlate with the dimerization free energies of the effector-bound proteins. These thermodynamic results, combined with structural information, indicate that allosteric activation of the BirA monomer involves formation of a network of intramolecular interactions on the dimerization surface in response to bio-5'-AMP binding at the distant effector binding site.

Automated docking of ligands to an artificial active site: augmenting crystallographic analysis with computer modeling

NASA Astrophysics Data System (ADS)

Rosenfeld, Robin J.; Goodsell, David S.; Musah, Rabi A.; Morris, Garrett M.; Goodin, David B.; Olson, Arthur J.

2003-08-01

The W191G cavity of cytochrome c peroxidase is useful as a model system for introducing small molecule oxidation in an artificially created cavity. A set of small, cyclic, organic cations was previously shown to bind in the buried, solvent-filled pocket created by the W191G mutation. We docked these ligands and a set of non-binders in the W191G cavity using AutoDock 3.0. For the ligands, we compared docking predictions with experimentally determined binding energies and X-ray crystal structure complexes. For the ligands, predicted binding energies differed from measured values by ± 0.8 kcal/mol. For most ligands, the docking simulation clearly predicted a single binding mode that matched the crystallographic binding mode within 1.0 Å RMSD. For 2 ligands, where the docking procedure yielded an ambiguous result, solutions matching the crystallographic result could be obtained by including an additional crystallographically observed water molecule in the protein model. For the remaining 2 ligands, docking indicated multiple binding modes, consistent with the original electron density, suggesting disordered binding of these ligands. Visual inspection of the atomic affinity grid maps used in docking calculations revealed two patches of high affinity for hydrogen bond donating groups. Multiple solutions are predicted as these two sites compete for polar hydrogens in the ligand during the docking simulation. Ligands could be distinguished, to some extent, from non-binders using a combination of two trends: predicted binding energy and level of clustering. In summary, AutoDock 3.0 appears to be useful in predicting key structural and energetic features of ligand binding in the W191G cavity.

Binding Mode Analyses and Pharmacophore Model Development for Stilbene Derivatives as a Novel and Competitive Class of α-Glucosidase Inhibitors

PubMed Central

Kim, Jun Young; Arooj, Mahreen; Kim, Siu; Hwang, Swan; Kim, Byeong-Woo; Park, Ki Hun; Lee, Keun Woo

2014-01-01

Stilbene urea derivatives as a novel and competitive class of non-glycosidic α-glucosidase inhibitors are effective for the treatment of type II diabetes and obesity. The main purposes of our molecular modeling study are to explore the most suitable binding poses of stilbene derivatives with analyzing the binding affinity differences and finally to develop a pharmacophore model which would represents critical features responsible for α-glucosidase inhibitory activity. Three-dimensional structure of S. cerevisiae α-glucosidase was built by homology modeling method and the structure was used for the molecular docking study to find out the initial binding mode of compound 12, which is the most highly active one. The initial structure was subjected to molecular dynamics (MD) simulations for protein structure adjustment at compound 12-bound state. Based on the adjusted conformation, the more reasonable binding modes of the stilbene urea derivatives were obtained from molecular docking and MD simulations. The binding mode of the derivatives was validated by correlation analysis between experimental Ki value and interaction energy. Our results revealed that the binding modes of the potent inhibitors were engaged with important hydrogen bond, hydrophobic, and π-interactions. With the validated compound 12-bound structure obtained from combining approach of docking and MD simulation, a proper four featured pharmacophore model was generated. It was also validated by comparison of fit values with the Ki values. Thus, these results will be helpful for understanding the relationship between binding mode and bioactivity and for designing better inhibitors from stilbene derivatives. PMID:24465730

Spectroscopic and microcalorimetric studies on the molecular binding of food colorant acid red 27 with deoxyribonucleic acid.

PubMed

Basu, Anirban; Kumar, Gopinatha Suresh

2016-08-01

Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4)  M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Binding site feature description of 2-substituted benzothiazoles as potential AcrAB-TolC efflux pump inhibitors in E. coli.

PubMed

Yilmaz, S; Altinkanat-Gelmez, G; Bolelli, K; Guneser-Merdan, D; Ufuk Over-Hasdemir, M; Aki-Yalcin, E; Yalcin, I

2015-01-01

The resistance-nodulation-division (RND) family efflux pumps are important in the antibiotic resistance of Gram-negative bacteria. However, although a number of bacterial RND efflux pump inhibitors have been developed, there has been no clinically available RND efflux pump inhibitor to date. A set of BSN-coded 2-substituted benzothiazoles were tested alone and in combinations with ciprofloxacin (CIP) against the AcrAB-TolC overexpressor Escherichia coli AG102 clinical strain. The results indicated that the BSN compounds did not show intrinsic antimicrobial activity when tested alone. However, when used in combinations with CIP, a reversal in the antibacterial activity of CIP with up to 10-fold better MIC values was observed. In order to describe the binding site features of these BSN compounds with AcrB, docking studies were performed using the CDocker method. The performed docking poses and the calculated binding energy scores revealed that the tested compounds BSN-006, BSN-023, and BSN-004 showed significant binding interactions with the phenylalanine-rich region in the distal binding site of the AcrB binding monomer. Moreover, the tested compounds BSN-006 and BSN-023 possessed stronger binding energies than CIP, verifying that BSN compounds are acting as the putative substrates of AcrB.

Characterization of the binding of metoprolol tartrate and guaifenesin drugs to human serum albumin and human hemoglobin proteins by fluorescence and circular dichroism spectroscopy.

PubMed

Duman, Osman; Tunç, Sibel; Kancı Bozoğlan, Bahar

2013-07-01

The interactions of metoprolol tartrate (MPT) and guaifenesin (GF) drugs with human serum albumin (HSA) and human hemoglobin (HMG) proteins at pH 7.4 were studied by fluorescence and circular dichroism (CD) spectroscopy. Drugs quenched the fluorescence spectra of HSA and HMG proteins through a static quenching mechanism. For each protein-drug system, the values of Stern-Volmer quenching constant, bimolecular quenching constant, binding constant and number of binding site on the protein molecules were determined at 288.15, 298.15, 310.15 and 318.15 K. It was found that the binding constants of HSA-MPT and HSA-GF systems were smaller than those of HMG-MPT and HMG-GF systems. For both drugs, the affinity of HMG was much higher than that of HSA. An increase in temperature caused a negative effect on the binding reactions. The number of binding site on blood proteins for MPT and GF drugs was approximately one. Thermodynamic parameters showed that MPT interacted with HSA through electrostatic attraction forces. However, hydrogen bonds and van der Waals forces were the main interaction forces in the formation of HSA-GF, HMG-MPT and HMG-GF complexes. The binding processes between protein and drug molecules were exothermic and spontaneous owing to negative ∆H and ∆G values, respectively. The values of binding distance between protein and drug molecules were calculated from Förster resonance energy transfer theory. It was found from CD analysis that the bindings of MPT and GF drugs to HSA and HMG proteins altered the secondary structure of HSA and HMG proteins.

A DFT study for the structural and electronic properties of Zn m Se n nanoclusters

NASA Astrophysics Data System (ADS)

Yadav, Phool Singh; Pandey, Dheeraj Kumar

2012-09-01

An ab initio study has been performed for the stability, structural and electronic properties of 19 small zinc selenide Zn m Se n ( m + n = 2-4) nanoclusters. Out of these nanoclusters, one nanocluster is found to be unstable due to its imaginary vibrational frequency. A B3LYP-DFT/6-311G(3df) method is used in the optimization of the geometries of the nanoclusters. We have calculated the zero point energy (ZPE), which is ignored by the other workers. The binding energies (BE), HOMO-LUMO gaps and bond lengths have been obtained for all the optimized nanoclusters. For the same value of ` m' and ` n', we designate the most stable structure the one, which has maximum final binding energy (FBE) per atom. The adiabatic and vertical ionization potentials (IP) and electron affinities (EA), dipole moments and charge on atoms have been investigated for the most stable nanoclusters. For the same value of ` m' and ` n', the nanocluster containing maximum number of Se atoms is found to be most stable.

Extracting ligands from receptors by reversed targeted molecular dynamics.

PubMed

Wolf, Romain M

2015-11-01

Short targeted MD trajectories are used to expel ligands from binding sites. The expulsion is governed by a linear increase of the target RMSD value, growing from zero to an arbitrary chosen final RMSD that forces the ligand to a selected distance outside of the receptor. The RMSD lag (i.e., the difference between the imposed and the actual RMSD) can be used to follow barriers encountered by the ligand during its way out of the receptor. The force constant used for the targeted MD can transform the RMSD lag into a strain energy. Integration of the (time-dependent) strain energy over time yields a value with the dimensions of "action" (i.e, energy multiplied by time) and can serve as a measure for the overall effort required to extract the ligand from its binding site. Possibilities to compare (numerically and graphically) the randomly detected exit pathways are discussed. As an example, the method is tested on the exit of bisphenol A from the human estrogen-related receptor [Formula: see text] and of GW0072 from the peroxysome proliferator activated receptor.

Hydrogen molecules and chains in a superstrong magnetic field

NASA Technical Reports Server (NTRS)

Lai, Dong; Salpeter, Edwin E.; Shapiro, Stuart L.

1992-01-01

The electronic structures of hydrogen polymolecules H(n) (n = 2,3,4,...) is studied in a superstrong magnetic field (B greater than about 10 exp 12 G) typically found on the surface of a neutron star. Simple analytical scaling relations for several limiting cases (e.g., large n, high B field) are derived. The binding energies of H(n) molecules are numerically calculated for various magnetic-field strengths. For a given magnetic-field strength, the binding energy per atom in the H(n) molecules is found to approach a constant value as n increases. For typical field strengths of interest, energy saturation is essentially achieved once n exceeds 3 to 4. Also considered is the structure of negative H ions in a high magnetic field. For B about 10 exp 12 G, the dissociation energy of an atom in a hydrogen chain and the ionization potential of H(-) are smaller than the ionization potential of neutral atomic hydrogen.

Interaction of two walkers: wave-mediated energy and force.

PubMed

Borghesi, Christian; Moukhtar, Julien; Labousse, Matthieu; Eddi, Antonin; Fort, Emmanuel; Couder, Yves

2014-12-01

A bouncing droplet, self-propelled by its interaction with the waves it generates, forms a classical wave-particle association called a "walker." Previous works have demonstrated that the dynamics of a single walker is driven by its global surface wave field that retains information on its past trajectory. Here we investigate the energy stored in this wave field for two coupled walkers and how it conveys an interaction between them. For this purpose, we characterize experimentally the "promenade modes" where two walkers are bound and propagate together. Their possible binding distances take discrete values, and the velocity of the pair depends on their mutual binding. The mean parallel motion can be either rectilinear or oscillating. The experimental results are recovered analytically with a simple theoretical framework. A relation between the kinetic energy of the droplets and the total energy of the standing waves is established.

Electron binding energy of uranium-ligand and uranyl-ligand anions

NASA Astrophysics Data System (ADS)

Wang, Lei; Horowitz, Steven; Marston, Brad

2012-02-01

Electron binding energies of the early actinide element uranium in gas-phase anion complexes are calculated by relativistic density functional theory (DFT) with two different exchange-correlation functions (RPBE and B3LYP) and also in the Hartree-Fock (HF) approximationootnotetextADF2010.02, SCM.com. Scalar and spin-orbit calculations are performed, and the calculated energies are compared to available experimental measurements and shown to disagree by energies of order 1 eV. Strong correlations that are poorly treated in DFT and HF can be included by a hybrid approach in which a generalized Anderson impurity model is numerically diagonalized. Reduction-oxidation (redox) potentials of aqueous actinide ions show improved agreement with measured values in the hybrid approachootnotetextS. E. Horowitz and J. B. Marston, J. Chem. Phys 134 064510 (2011).. We test whether or not similar improvements are found in the gas-phase.

Synthesis, characterization, and binding assessment with human serum albumin of three bipyridine lanthanide(III) complexes.

PubMed

Aramesh-Boroujeni, Zahra; Bordbar, Abdol-Khalegh; Khorasani-Motlagh, Mozhgan; Sattarinezhad, Elham; Fani, Najme; Noroozifar, Meissam

2018-05-18

In this work, the terbium(III), dysprosium(III), and ytterbium(III) complexes containing 2, 2'-bipyridine (bpy) ligand have been synthesized and characterized using CHN elemental analysis, FT-IR, UV-Vis and 1 H-NMR techniques and their binding behavior with human serum albumin (HSA) was studied by UV-Vis, fluorescence and molecular docking examinations. The experimental data indicated that all three lanthanide complexes have high binding affinity to HSA with effective quenching of HSA fluorescence via static mechanism. The binding parameters, the type of interaction, the value of resonance energy transfer, and the binding distance between complexes and HSA were estimated from the analysis of fluorescence measurements and Förster theory. The thermodynamic parameters suggested that van der Waals interactions and hydrogen bonds play an important role in the binding mechanism. While, the energy transfer from HSA molecules to all these complexes occurs with high probability, the order of binding constants (BpyTb > BpyDy > BpyYb) represents the importance of radius of Ln 3+ ion in the complex-HSA interaction. The results of molecular docking calculation and competitive experiments assessed site 3 of HSA, located in subdomain IB, as the most probable binding site for these ligands and also indicated the microenvironment residues around the bound mentioned complexes. The computational results kept in good agreement with experimental data.

Validation of tautomeric and protomeric binding modes by free energy calculations. A case study for the structure based optimization of D-amino acid oxidase inhibitors.

PubMed

Orgován, Zoltán; Ferenczy, György G; Steinbrecher, Thomas; Szilágyi, Bence; Bajusz, Dávid; Keserű, György M

2018-02-01

Optimization of fragment size D-amino acid oxidase (DAAO) inhibitors was investigated using a combination of computational and experimental methods. Retrospective free energy perturbation (FEP) calculations were performed for benzo[d]isoxazole derivatives, a series of known inhibitors with two potential binding modes derived from X-ray structures of other DAAO inhibitors. The good agreement between experimental and computed binding free energies in only one of the hypothesized binding modes strongly support this bioactive conformation. Then, a series of 1-H-indazol-3-ol derivatives formerly not described as DAAO inhibitors was investigated. Binding geometries could be reliably identified by structural similarity to benzo[d]isoxazole and other well characterized series and FEP calculations were performed for several tautomers of the deprotonated and protonated compounds since all these forms are potentially present owing to the experimental pKa values of representative compounds in the series. Deprotonated compounds are proposed to be the most important bound species owing to the significantly better agreement between their calculated and measured affinities compared to the protonated forms. FEP calculations were also used for the prediction of the affinities of compounds not previously tested as DAAO inhibitors and for a comparative structure-activity relationship study of the benzo[d]isoxazole and indazole series. Selected indazole derivatives were synthesized and their measured binding affinity towards DAAO was in good agreement with FEP predictions.

Validation of tautomeric and protomeric binding modes by free energy calculations. A case study for the structure based optimization of d-amino acid oxidase inhibitors

NASA Astrophysics Data System (ADS)

Orgován, Zoltán; Ferenczy, György G.; Steinbrecher, Thomas; Szilágyi, Bence; Bajusz, Dávid; Keserű, György M.

2018-02-01

Optimization of fragment size d-amino acid oxidase (DAAO) inhibitors was investigated using a combination of computational and experimental methods. Retrospective free energy perturbation (FEP) calculations were performed for benzo[d]isoxazole derivatives, a series of known inhibitors with two potential binding modes derived from X-ray structures of other DAAO inhibitors. The good agreement between experimental and computed binding free energies in only one of the hypothesized binding modes strongly support this bioactive conformation. Then, a series of 1-H-indazol-3-ol derivatives formerly not described as DAAO inhibitors was investigated. Binding geometries could be reliably identified by structural similarity to benzo[d]isoxazole and other well characterized series and FEP calculations were performed for several tautomers of the deprotonated and protonated compounds since all these forms are potentially present owing to the experimental pKa values of representative compounds in the series. Deprotonated compounds are proposed to be the most important bound species owing to the significantly better agreement between their calculated and measured affinities compared to the protonated forms. FEP calculations were also used for the prediction of the affinities of compounds not previously tested as DAAO inhibitors and for a comparative structure-activity relationship study of the benzo[d]isoxazole and indazole series. Selected indazole derivatives were synthesized and their measured binding affinity towards DAAO was in good agreement with FEP predictions.

Temperature-Dependent Energy Gap Shift and Thermally Activated Transition in Multilayer CdTe/ZnTe Quantum Dots.

PubMed

Man, Minh Tan; Lee, Hong Seok

2015-10-01

We investigated the influence of growth conditions on carrier dynamics in multilayer CdTe/ZnTe quantum dots (QDs) by monitoring the temperature dependence of the photoluminescence emission energy. The results were analyzed using the empirical Varshni and O'Donnell relations for temperature variation of the energy gap shift. Best fit values showed that the thermally activated transition between two different states occurs due to band low-temperature quenching with values separated by 5.0-6.5 meV. The addition of stack periods in multilayer CdTe/ZnTe QDs plays an important role in the energy gap shift, where the exciton binding energy is enhanced, and, conversely, the exciton-phonon coupling strength is suppressed with an average energy of 19.3-19.8 meV.

Energy-resolved collision-induced dissociation studies of 1,10-phenanthroline complexes of the late first-row divalent transition metal cations: determination of the third sequential binding energies.

PubMed

Nose, Holliness; Chen, Yu; Rodgers, M T

2013-05-23

The third sequential binding energies of the late first-row divalent transition metal cations to 1,10-phenanthroline (Phen) are determined by energy-resolved collision-induced dissociation (CID) techniques using a guided ion beam tandem mass spectrometer. Five late first-row transition metal cations in their +2 oxidation states are examined including: Fe(2+), Co(2+), Ni(2+), Cu(2+), and Zn(2+). The kinetic energy dependent CID cross sections for loss of an intact Phen ligand from the M(2+)(Phen)3 complexes are modeled to obtain 0 and 298 K bond dissociation energies (BDEs) after accounting for the effects of the internal energy of the complexes, multiple ion-neutral collisions, and unimolecular decay rates. Electronic structure theory calculations at the B3LYP, BHandHLYP, and M06 levels of theory are employed to determine the structures and theoretical estimates for the first, second, and third sequential BDEs of the M(2+)(Phen)x complexes. B3LYP was found to deliver results that are most consistent with the measured values. Periodic trends in the binding of these complexes are examined and compared to the analogous complexes to the late first-row monovalent transition metal cations, Co(+), Ni(+), Cu(+), and Zn(+), previously investigated.

Strontium and barium in aqueous solution and a potassium channel binding site

NASA Astrophysics Data System (ADS)

Chaudhari, Mangesh I.; Rempe, Susan B.

2018-06-01

Ion hydration structure and free energy establish criteria for understanding selective ion binding in potassium (K+) ion channels and may be significant to understanding blocking mechanisms as well. Recently, we investigated the hydration properties of Ba2+, the most potent blocker of K+ channels among the simple metal ions. Here, we use a similar method of combining ab initio molecular dynamics simulations, statistical mechanical theory, and electronic structure calculations to probe the fundamental hydration properties of Sr2+, which does not block bacterial K+ channels. The radial distribution of water around Sr2+ suggests a stable 8-fold geometry in the local hydration environment, similar to Ba2+. While the predicted hydration free energy of -331.8 kcal/mol is comparable with the experimental result of -334 kcal/mol, the value is significantly more favorable than the -305 kcal/mol hydration free energy of Ba2+. When placed in the innermost K+ channel blocking site, the solvation free energies and lowest energy structures of both Sr2+ and Ba2+ are nearly unchanged compared with their respective hydration properties. This result suggests that the block is not attributable to ion trapping due to +2 charge, and differences in blocking behavior arise due to free energies associated with the exchange of water ligands for channel ligands instead of free energies of transfer from water to the binding site.

Nucleotide-dependent conformational states of actin

PubMed Central

Pfaendtner, Jim; Branduardi, Davide; Parrinello, Michele; Pollard, Thomas D.; Voth, Gregory A.

2009-01-01

The influence of the state of the bound nucleotide (ATP, ADP-Pi, or ADP) on the conformational free-energy landscape of actin is investigated. Nucleotide-dependent folding of the DNase-I binding (DB) loop in monomeric actin and the actin trimer is carried out using all-atom molecular dynamics (MD) calculations accelerated with a multiscale implementation of the metadynamics algorithm. Additionally, an investigation of the opening and closing of the actin nucleotide binding cleft is performed. Nucleotide-dependent free-energy profiles for all of these conformational changes are calculated within the framework of metadynamics. We find that in ADP-bound monomer, the folded and unfolded states of the DB loop have similar relative free-energy. This result helps explain the experimental difficulty in obtaining an ordered crystal structure for this region of monomeric actin. However, we find that in the ADP-bound actin trimer, the folded DB loop is stable and in a free-energy minimum. It is also demonstrated that the nucleotide binding cleft favors a closed conformation for the bound nucleotide in the ATP and ADP-Pi states, whereas the ADP state favors an open confirmation, both in the monomer and trimer. These results suggest a mechanism of allosteric interactions between the nucleotide binding cleft and the DB loop. This behavior is confirmed by an additional simulation that shows the folding free-energy as a function of the nucleotide cleft width, which demonstrates that the barrier for folding changes significantly depending on the value of the cleft width. PMID:19620726

Energetic basis for the molecular-scale organization of bone

DOE PAGES

Tao, Jinhui; Battle, Keith C.; Pan, Haihua; ...

2014-12-24

Here, the remarkable properties of bone derive from a highly organized arrangement of co-aligned nm-scale apatite platelets within a fibrillar collagen matrix. The origin of this arrangement is poorly understood and the crystal structures of hydroxyapatite (HAP) and the non-mineralized collagen fibrils alone do not provide an explanation. Moreover, little is known about collagen-apatite interaction energies, which should strongly influence both the molecular-scale organization and the resulting mechanical properties of the composite. We investigated collagen-mineral interactions by combining dynamic force spectroscopy (DFS) measurements of binding energies with molecular dynamics (MD) simulations of binding and AFM observations of collagen adsorption onmore » single crystals of calcium phosphate for four mineral phases of potential importance in bone formation. In all cases, we observe a strong preferential orientation of collagen binding, but comparison between the observed orientations and TEM analyses native tissues shows only calcium-deficient apatite (CDAP) provides an interface with collagen that is consistent with both. MD simulations predict preferred collagen orientations that agree with observations and results from both MD and DFS reveal large values for the binding energy due to multiple binding sites. These findings reconcile apparent contradictions inherent in a hydroxyapatite or carbonated apatite (CAP) model of bone mineral and provide an energetic rationale for the molecular scale organization of bone.« less

Energetic basis for the molecular-scale organization of bone.

PubMed

Tao, Jinhui; Battle, Keith C; Pan, Haihua; Salter, E Alan; Chien, Yung-Ching; Wierzbicki, Andrzej; De Yoreo, James J

2015-01-13

The remarkable properties of bone derive from a highly organized arrangement of coaligned nanometer-scale apatite platelets within a fibrillar collagen matrix. The origin of this arrangement is poorly understood and the crystal structures of hydroxyapatite (HAP) and the nonmineralized collagen fibrils alone do not provide an explanation. Moreover, little is known about collagen-apatite interaction energies, which should strongly influence both the molecular-scale organization and the resulting mechanical properties of the composite. We investigated collagen-mineral interactions by combining dynamic force spectroscopy (DFS) measurements of binding energies with molecular dynamics (MD) simulations of binding and atomic force microscopy (AFM) observations of collagen adsorption on single crystals of calcium phosphate for four mineral phases of potential importance in bone formation. In all cases, we observe a strong preferential orientation of collagen binding, but comparison between the observed orientations and transmission electron microscopy (TEM) analyses of native tissues shows that only calcium-deficient apatite (CDAP) provides an interface with collagen that is consistent with both. MD simulations predict preferred collagen orientations that agree with observations, and results from both MD and DFS reveal large values for the binding energy due to multiple binding sites. These findings reconcile apparent contradictions inherent in a hydroxyapatite or carbonated apatite (CAP) model of bone mineral and provide an energetic rationale for the molecular-scale organization of bone.

Benchmark CCSD(T) and DFT study of binding energies in Be7 - 12: in search of reliable DFT functional for beryllium clusters

NASA Astrophysics Data System (ADS)

Labanc, Daniel; Šulka, Martin; Pitoňák, Michal; Černušák, Ivan; Urban, Miroslav; Neogrády, Pavel

2018-05-01

We present a computational study of the stability of small homonuclear beryllium clusters Be7 - 12 in singlet electronic states. Our predictions are based on highly correlated CCSD(T) coupled cluster calculations. Basis set convergence towards the complete basis set limit as well as the role of the 1s core electron correlation are carefully examined. Our CCSD(T) data for binding energies of Be7 - 12 clusters serve as a benchmark for performance assessment of several density functional theory (DFT) methods frequently used in beryllium cluster chemistry. We observe that, from Be10 clusters on, the deviation from CCSD(T) benchmarks is stable with respect to size, and fluctuating within 0.02 eV error bar for most examined functionals. This opens up the possibility of scaling the DFT binding energies for large Be clusters using CCSD(T) benchmark values for smaller clusters. We also tried to find analogies between the performance of DFT functionals for Be clusters and for the valence-isoelectronic Mg clusters investigated recently in Truhlar's group. We conclude that it is difficult to find DFT functionals that perform reasonably well for both beryllium and magnesium clusters. Out of 12 functionals examined, only the M06-2X functional gives reasonably accurate and balanced binding energies for both Be and Mg clusters.

Binding Free Energy Calculations for Lead Optimization: Assessment of Their Accuracy in an Industrial Drug Design Context.

PubMed

Homeyer, Nadine; Stoll, Friederike; Hillisch, Alexander; Gohlke, Holger

2014-08-12

Correctly ranking compounds according to their computed relative binding affinities will be of great value for decision making in the lead optimization phase of industrial drug discovery. However, the performance of existing computationally demanding binding free energy calculation methods in this context is largely unknown. We analyzed the performance of the molecular mechanics continuum solvent, the linear interaction energy (LIE), and the thermodynamic integration (TI) approach for three sets of compounds from industrial lead optimization projects. The data sets pose challenges typical for this early stage of drug discovery. None of the methods was sufficiently predictive when applied out of the box without considering these challenges. Detailed investigations of failures revealed critical points that are essential for good binding free energy predictions. When data set-specific features were considered accordingly, predictions valuable for lead optimization could be obtained for all approaches but LIE. Our findings lead to clear recommendations for when to use which of the above approaches. Our findings also stress the important role of expert knowledge in this process, not least for estimating the accuracy of prediction results by TI, using indicators such as the size and chemical structure of exchanged groups and the statistical error in the predictions. Such knowledge will be invaluable when it comes to the question which of the TI results can be trusted for decision making.

Investigation on the individual contributions of N-H...O=C and C-H...O=C interactions to the binding energies of beta-sheet models.

PubMed

Wang, Chang-Sheng; Sun, Chang-Liang

2010-04-15

In this article, the binding energies of 16 antiparallel and parallel beta-sheet models are estimated using the analytic potential energy function we proposed recently and the results are compared with those obtained from MP2, AMBER99, OPLSAA/L, and CHARMM27 calculations. The comparisons indicate that the analytic potential energy function can produce reasonable binding energies for beta-sheet models. Further comparisons suggest that the binding energy of the beta-sheet models might come mainly from dipole-dipole attractive and repulsive interactions and VDW interactions between the two strands. The dipole-dipole attractive and repulsive interactions are further obtained in this article. The total of N-H...H-N and C=O...O=C dipole-dipole repulsive interaction (the secondary electrostatic repulsive interaction) in the small ring of the antiparallel beta-sheet models is estimated to be about 6.0 kcal/mol. The individual N-H...O=C dipole-dipole attractive interaction is predicted to be -6.2 +/- 0.2 kcal/mol in the antiparallel beta-sheet models and -5.2 +/- 0.6 kcal/mol in the parallel beta-sheet models. The individual C(alpha)-H...O=C attractive interaction is -1.2 +/- 0.2 kcal/mol in the antiparallel beta-sheet models and -1.5 +/- 0.2 kcal/mol in the parallel beta-sheet models. These values are important in understanding the interactions at protein-protein interfaces and developing a more accurate force field for peptides and proteins. 2009 Wiley Periodicals, Inc.

Investigation of glucose binding sites on insulin.

PubMed

Zoete, Vincent; Meuwly, Markus; Karplus, Martin

2004-05-15

Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

Transformation of cooperative free energies between ligation systems of hemoglobin: resolution of the carbon monoxide binding intermediates.

PubMed

Huang, Y; Ackers, G K

1996-01-23

A strategy has been developed for quantitatively "translating" the distributions of cooperative free energy between different oxygenation analogs of hemoglobin (Hb). The method was used to resolve the cooperative free energies of all eight carbon monoxide binding intermediates. These parameters of the FeCOHb system were determined by thermodynamic transformation of corresponding free energies obtained previously for all species of the Co/FeCO system, i.e., where cobalt-substituted hemes comprise the unligated sites [Speros, P. C., et al. (1991) Biochemistry 30, 7254-7262]. Using hybridized combinations of normal and cobalt-substituted Hb, ligation analog systems Co/FeX (X = CO, CN) were constructed and experimentally quantified. Energetics of cobalt-induced structural perturbation were determined for all species of both the "mixed metal" Co/Fe system and also the ligated Co/FeCN system. It was found that major energetic perturbations of the Co/Fe hybrid species originate from a pure cobalt substitution effect on the alpha subunits. These perturbations are transduced to the beta subunit within the same dimeric half-tetramer, resulting in alteration of the free energies for binding at the nonsubstituted (Fe) sites. Using the linkage strategy developed in this study along with the determined energetics of these couplings, the experimental assembly free energies for the Co/FeCO species were transformed into cooperative free energies of the 10 Fe/FeCO species. The resulting values were found to distribute according to predictions of a symmetry rule mechanism proposed previously [Ackers, G. K., et al. (1992) Science 255, 54-63]. Their distribution is consistent with accurate CO binding data of normal Hb [Perrella, M., et al. (1990b) Biophys. Chem. 37, 211-223] and also with accurate O2 binding data obtained under the same conditions [Chu, A. H., et al. (1984) Biochemistry 23, 604-617].

Noncovalent Interactions of DNA Bases with Naphthalene and Graphene.

PubMed

Cho, Yeonchoo; Min, Seung Kyu; Yun, Jeonghun; Kim, Woo Youn; Tkatchenko, Alexandre; Kim, Kwang S

2013-04-09

The complexes of a DNA base bound to graphitic systems are studied. Considering naphthalene as the simplest graphitic system, DNA base-naphthalene complexes are scrutinized at high levels of ab initio theory including coupled cluster theory with singles, doubles, and perturbative triples excitations [CCSD(T)] at the complete basis set (CBS) limit. The stacked configurations are the most stable, where the CCSD(T)/CBS binding energies of guanine, adenine, thymine, and cytosine are 9.31, 8.48, 8.53, 7.30 kcal/mol, respectively. The energy components are investigated using symmetry-adapted perturbation theory based on density functional theory including the dispersion energy. We compared the CCSD(T)/CBS results with several density functional methods applicable to periodic systems. Considering accuracy and availability, the optB86b nonlocal functional and the Tkatchenko-Scheffler functional are used to study the binding energies of nucleobases on graphene. The predicted values are 18-24 kcal/mol, though many-body effects on screening and energy need to be further considered.

Gas-Phase Interaction of Anions with Polyisobutylenes: Collision-Induced Dissociation Study and Quantum Chemical Modeling.

PubMed

Nagy, Lajos; Kuki, Ákos; Deák, György; Purgel, Mihály; Vékony, Ádám; Zsuga, Miklós; Kéki, Sándor

2016-09-01

The gas-phase interaction of anions including fluoride, chloride, bromide, iodide, ethyl sulfate, chlorate, and nitrate with polyisobutylene (PIB) derivatives was studied using collision-induced dissociation (CID). The gas-phase adducts of anions with PIBs ([PIB + anion](-)) were generated from the electrosprayed solution of PIBs in the presence of the corresponding anions. The so-formed adducts subjected to CID showed a loss of anion at different characteristic collision energies, thus allowing the study of the strength of interaction between the anions and nonpolar PIBs having different end-groups. The values of characteristic collision energies (the energy needed to obtain 50% fragmentation) obtained by CID experiments correlated linearly with the binding enthalpies between the anion and PIB, as determined by density functional theory calculations. In the case of halide ions, the critical energies for dissociation, that is, the binding enthalpies for [PIB + anion](-) adducts, increased in the order of I(-) < Br(-) < Cl(-) < F(-). Furthermore, it was found that the binding enthalpies for the adducts formed with halide ions decreased approximately with the square radius of the halide ion, suggesting that the strength of interaction is mainly determined by the "surface" charge density of the halide ion. In addition, the characteristic collision energy versus the number of isobutylene units revealed a linear dependence.

Binding mode analysis, dynamic simulation and binding free energy calculations of the MurF ligase from Acinetobacter baumannii.

PubMed

Ahmad, Sajjad; Raza, Saad; Uddin, Reaz; Azam, Syed Sikander

2017-10-01

MurF ligase catalyzes the final cytoplasmic step of bacterial peptidoglycan biosynthesis and, as such, is a validated target for therapeutic intervention. Herein, we performed molecular docking to identify putative inhibitors of Acinetobacter baumannii MurF (AbMurF). Based on comparative docking analysis, compound 114 (ethyl pyridine substituted 3-cyanothiophene) was predicted to potentially be the most active ligand. Computational pharmacokinetic characterization of drug-likeness of the compound showed it to fulfil all the parameters of Muegge and the MDDR rule. A molecular dynamic simulation of 114 indicated the complex to be stable on the basis of an average root mean square deviation (RMSD) value of 2.09Å for the ligand. The stability of the complex was further supported by root mean square fluctuation (RMSF), beta factor and radius of gyration values. Analyzing the complex using radial distribution function (RDF) and a novel analytical tool termed the axial frequency distribution (AFD) illustrated that after simulation the ligand is positioned in close vicinity of the protein active site where Thr42 and Asp43 participate in hydrogen bonding and stabilization of the complex. Binding free energy calculations based on the Poisson-Boltzmann or Generalized-Born Surface Area Continuum Solvation (MM(PB/GB)SA) method indicated the van der Waals contribution to the overall binding energy of the complex to be dominant along with electrostatic contributions involving the hot spot amino acids from the protein active site. The present results indicate that the screened compound 114 may act as a parent structure for designing potent derivatives against AbMurF in specific and MurF of other bacterial pathogens in general. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of pH on the association between the inhibitor cystatin and the proteinase chymopapain.

PubMed

Reyes-Espinosa, Francisco; Arroyo-Reyna, Alfonso; Garcia-Gutierrez, Ponciano; Serratos, Iris N; Zubillaga, Rafael A

2014-01-01

Cysteine proteinases are involved in many aspects of physiological regulation. In humans, some cathepsins have shown another function in addition to their role as lysosomal proteases in intracellular protein degradation; they have been implicated in the pathogenesis of several heart and blood vessel diseases and in cancer development. In this work, we present a fluorometric and computational study of the binding of one representative plant cysteine proteinase, chymopapain, to one of the most studied inhibitors of these proteinases: chicken cystatin. The binding equilibrium constant, Kb, was determined in the pH range between 3.5 and 10.0, revealing a maximum in the affinity at pH 9.0. We constructed an atomic model for the chymopapain-cystatin dimer by docking the individual 3D protein structures; subsequently, the model was refined using a 100 ns NPT molecular dynamics simulation in explicit water. Upon scrutiny of this model, we identified 14 ionizing residues at the interface of the complex using a cutoff distance of 5.0 Å. Using the pKa values predicted with PROPKA and a modified proton-linkage model, we performed a regression analysis on our data to obtain the composite pKavalues for three isoacidic residues. We also calculated the electrostatic component of the binding energy (ΔGb,elec) at different pH values using an implicit solvent model and APBS software. The pH profile of this calculated energy compares well with the experimentally obtained binding energy, ΔGb. We propose that the residues that form an interchain ionic pair, Lys139A from chymopapain and Glu19B from cystatin, as well as Tyr61A and Tyr67A from chymopapain are the main residues responsible for the observed pH dependence in the chymopapain- cystatin affinity.

Quantifying protein microstructure and electrostatic effects on the change in Gibbs free energy of binding in immobilized metal affinity chromatography.

PubMed

Pathange, Lakshmi P; Bevan, David R; Zhang, Chenming

2008-03-01

Electrostatic forces play a major role in maintaining both structural and functional properties of proteins. A major component of protein electrostatics is the interactions between the charged or titratable amino acid residues (e.g., Glu, Lys, and His), whose pK(a) (or the change of the pK(a)) value could be used to study protein electrostatics. Here, we report the study of electrostatic forces through experiments using a well-controlled model protein (T4 lysozyme) and its variants. We generated 10 T4 lysozyme variants, in which the electrostatic environment of the histidine residue was perturbed by altering charged and neutral amino acid residues at various distances from the histidine (probe) residue. The electrostatic perturbations were theoretically quantified by calculating the change in free energy (DeltaDeltaG(E)) using Coulomb's law. On the other hand, immobilized metal affinity chromatography (IMAC) was used to quantify these perturbations in terms of protein binding strength or change in free energy of binding (DeltaDeltaG(B)), which varies from -0.53 to 0.99 kcal/mol. For most of the variants, there is a good correlation (R(2) = 0.97) between the theoretical DeltaDeltaG(E) and experimental DeltaDeltaG(B) values. However, there are three deviant variants, whose histidine residue was found to be involved in site-specific interactions (e.g., ion pair and steric hindrance), which were further investigated by molecular dynamics simulation. This report demonstrates that the electrostatic (DeltaDeltaG(Elec)) and microstructural effects (DeltaDeltaG(Micro)) in a protein can be quantified by IMAC through surface histidine mediated protein-metal ion interaction and that the unique microstructure around a histidine residue can be identified by identifying the abnormal binding behaviors during IMAC.

Binding of basic amphipathic peptides to neutral phospholipid membranes: a thermodynamic study applied to dansyl-labeled melittin and substance P analogues.

PubMed

Pérez-Payá, E; Porcar, I; Gómez, C M; Pedrós, J; Campos, A; Abad, C

1997-08-01

A thermodynamic approach is proposed to quantitatively analyze the binding isotherms of peptides to model membranes as a function of one adjustable parameter, the actual peptide charge in solution z(p)+. The main features of this approach are a theoretical expression for the partition coefficient calculated from the molar free energies of the peptide in the aqueous and lipid phases, an equation proposed by S. Stankowski [(1991) Biophysical Journal, Vol. 60, p. 341] to evaluate the activity coefficient of the peptide in the lipid phase, and the Debye-Hückel equation that quantifies the activity coefficient of the peptide in the aqueous phase. To assess the validity of this approach we have studied, by means of steady-state fluorescence spectroscopy, the interaction of basic amphipathic peptides such as melittin and its dansylcadaverine analogue (DNC-melittin), as well as a new fluorescent analogue of substance P, SP (DNC-SP) with neutral phospholipid membranes. A consistent quantitative analysis of each binding curve was achieved. The z(p)+ values obtained were always found to be lower than the physical charge of the peptide. These z(p)+ values can be rationalized by considering that the peptide charged groups are strongly associated with counterions in buffer solution at a given ionic strength. The partition coefficients theoretically derived using the z(p)+ values were in agreement with those deduced from the Gouy-Chapman formalism. Ultimately, from the z(p)+ values the molar free energies for the free and lipid-bound states of the peptides have been calculated.

Computational study concerning the effect of some pesticides on the Proteus Mirabilis catalase activity

NASA Astrophysics Data System (ADS)

Isvoran, Adriana

2016-03-01

Assessment of the effects of the herbicides nicosulfuron and chlorsulfuron and the fungicides difenoconazole and drazoxlone upon catalase produced by soil microorganism Proteus mirabilis is performed using the molecular docking technique. The interactions of pesticides with the enzymes are predicted using SwissDock and PatchDock docking tools. There are correlations for predicted binding energy values for enzyme-pesticide complexes obtained using the two docking tools, all the considered pesticides revealing favorable binding to the enzyme, but only the herbicides bind to the catalytic site. These results suggest the inhibitory potential of chlorsulfuron and nicosulfuron on the catalase activity in soil.

How maltose influences structural changes to bind to maltose-binding protein: results from umbrella sampling simulation.

PubMed

Mascarenhas, Nahren Manuel; Kästner, Johannes

2013-02-01

A well-studied periplasmic-binding protein involved in the abstraction of maltose is maltose-binding protein (MBP), which undergoes a ligand-induced conformational transition from an open (ligand-free) to a closed (ligand-bound) state. Umbrella sampling simulations have been us to estimate the free energy of binding of maltose to MBP and to trace the potential of mean force of the unbinding event using the center-of-mass distance between the protein and ligand as the reaction coordinate. The free energy thus obtained compares nicely with the experimentally measured value justifying our theoretical basis. Measurement of the domain angle (N-terminal-domain - hinge - C-terminal-domain) along the unbinding pathway established the existence of three different states. Starting from a closed state, the protein shifts to an open conformation during the initial unbinding event of the ligand then resides in a semi-open conformation and later resides predominantly in an open-state. These transitions along the ligand unbinding pathway have been captured in greater depth using principal component analysis. It is proposed that in mixed-model, both conformational selection and an induced-fit mechanism combine to the ligand recognition process in MBP. Copyright © 2012 Wiley Periodicals, Inc.

Higher-Order Binding Corrections to the Lamb Shift

NASA Astrophysics Data System (ADS)

Pachucki, K.

1993-08-01

In this work a new analytical method for calculating the one-loop self-energy correction to the Lamb shift is presented in detail. The technique relies on division into the low and the high energy parts. The low energy part is calculated using the multipole expansion and the high energy part is calculated by expanding the Dirac-Coulomb propagator in powers of the Coulomb field. The obtained results are in agreement with those previously known, but are more accurate. A new theoretical value of the Lamb shift is also given.

RBscore&NBench: a high-level web server for nucleic acid binding residues prediction with a large-scale benchmarking database.

PubMed

Miao, Zhichao; Westhof, Eric

2016-07-08

RBscore&NBench combines a web server, RBscore and a database, NBench. RBscore predicts RNA-/DNA-binding residues in proteins and visualizes the prediction scores and features on protein structures. The scoring scheme of RBscore directly links feature values to nucleic acid binding probabilities and illustrates the nucleic acid binding energy funnel on the protein surface. To avoid dataset, binding site definition and assessment metric biases, we compared RBscore with 18 web servers and 3 stand-alone programs on 41 datasets, which demonstrated the high and stable accuracy of RBscore. A comprehensive comparison led us to develop a benchmark database named NBench. The web server is available on: http://ahsoka.u-strasbg.fr/rbscorenbench/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Growth of AlGaN under the conditions of significant gallium evaporation: Phase separation and enhanced lateral growth

NASA Astrophysics Data System (ADS)

Mayboroda, I. O.; Knizhnik, A. A.; Grishchenko, Yu. V.; Ezubchenko, I. S.; Zanaveskin, Maxim L.; Kondratev, O. A.; Presniakov, M. Yu.; Potapkin, B. V.; Ilyin, V. A.

2017-09-01

The growth kinetics of AlGaN in NH3 MBE under significant Ga desorption was studied. It was found that the addition of gallium stimulates 2D growth and provides better morphology of films compared to pure AlN. The effect was experimentally observed at up to 98% desorption of the impinging gallium. We found that under the conditions of significant thermal desorption, larger amounts of gallium were retained at lateral boundaries of 3D surface features than at flat terraces because of the higher binding energy of Ga atoms at specific surface defects. The selective accumulation of gallium resulted in an increase in the lateral growth component through the formation of the Ga-enriched AlGaN phase at boundaries of 3D surface features. We studied the temperature dependence of AlGaN growth rate and developed a kinetic model analytically describing this dependence. As the model was in good agreement with the experimental data, we used it to estimate the increase in the binding energy of Ga atoms at surface defects compared to terrace surface sites using data on the Ga content in different AlGaN phases. We also applied first-principles calculations to the thermodynamic analysis of stable configurations on the AlN surface and then used these surface configurations to compare the binding energy of Ga atoms at terraces and steps. Both first-principles calculations and analytical estimations of the experimental results gave similar values of difference in binding energies; this value is 0.3 eV. Finally, it was studied experimentally whether gallium can act as a surfactant in AlN growth by NH3 MBE at elevated temperatures. Gallium application has allowed us to grow a 300 nm thick AlN film with a RMS surface roughness of 2.2 Å over an area of 10 × 10 μm and a reduced density of screw dislocations.

Probing the interaction of anticancer drug temsirolimus with human serum albumin: molecular docking and spectroscopic insight.

PubMed

Shamsi, Anas; Ahmed, Azaj; Bano, Bilqees

2018-05-01

The binding interaction between temsirolimus, an important antirenal cancer drug, and HSA, an important carrier protein was scrutinized making use of UV and fluorescence spectroscopy. Hyper chromaticity observed in UV spectroscopy in the presence of temsirolimus as compared to free HSA suggests the formation of complex between HSA and temsirolimus. Fluorescence quenching experiments clearly showed quenching in the fluorescence of HSA in the presence of temsirolimus confirming the complex formation and also confirmed that static mode of interaction is operative for this binding process. Binding constant values obtained through UV and fluorescence spectroscopy reveal strong interaction; temsirolimus binds to HSA at 298 K with a binding constant of 2.9 × 10 4  M -1 implying the strength of interaction. The negative Gibbs free energy obtained through Isothermal titration calorimetry as well as quenching experiments suggests that binding process is spontaneous. Molecular docking further provides an insight of various residues that are involved in this binding process; showing the binding energy to be -12.9 kcal/mol. CD spectroscopy was retorted to analyze changes in secondary structure of HSA; increased intensity in presence of temsirolimus showing changes in secondary structure of HSA induced by temsirolimus. This study is of importance as it provides an insight into the binding mechanism of an important antirenal cancer drug with an important carrier protein. Once temsirolimus binds to HSA, it changes conformation of HSA which in turn can alter the functionality of this important carrier protein and this altered functionality of HSA can be highlighted in variety of diseases.

Investigating the binding behaviour of two avidin-based testosterone binders using molecular recognition force spectroscopy.

PubMed

Rangl, Martina; Leitner, Michael; Riihimäki, Tiina; Lehtonen, Soili; Hytönen, Vesa P; Gruber, Hermann J; Kulomaa, Markku; Hinterdorfer, Peter; Ebner, Andreas

2014-02-01

Molecular recognition force spectroscopy, a biosensing atomic force microscopy technique allows to characterise the dissociation of ligand-receptor complexes at the molecular level. Here, we used molecular recognition force spectroscopy to study the binding capability of recently developed testosterone binders. The two avidin-based proteins called sbAvd-1 and sbAvd-2 are expected to bind both testosterone and biotin but differ in their binding behaviour towards these ligands. To explore the ligand binding and dissociation energy landscape of these proteins, we tethered biotin or testosterone to the atomic force microscopy probe while the testosterone-binding protein was immobilized on the surface. Repeated formation and rupture of the ligand-receptor complex at different pulling velocities allowed determination of the loading rate dependence of the complex-rupturing force. In this way, we obtained the molecular dissociation rate (k(off)) and energy landscape distances (x(β)) of the four possible complexes: sbAvd-1-biotin, sbAvd-1-testosterone, sbAvd-2-biotin and sbAvd-2-testosterone. It was found that the kinetic off-rates for both proteins and both ligands are similar. In contrast, the x(β) values, as well as the probability of complex formations, varied considerably. In addition, competitive binding experiments with biotin and testosterone in solution differ significantly for the two testosterone-binding proteins, implying a decreased cross-reactivity of sbAvd-2. Unravelling the binding behaviour of the investigated testosterone-binding proteins is expected to improve their usability for possible sensing applications. Copyright © 2014 John Wiley & Sons, Ltd.

Structural study of biologically significant ligands with major birch pollen allergen Betv1 by docking and molecular dynamics simulation

PubMed Central

Kundu, Sangeeta; Roy, Debjani

2010-01-01

The major birch pollen allergen, Betv1 of Betula verrucosa is the main causative agent of birch pollen allergy in humans. Betv1 is capable of binding several physiological ligands including fatty acids, flavones, cytokinins and sterols. Until now, no structural information from crystallography or NMR is available regarding binding mode of any of these ligands into the binding pocket of Betv1. In the present study thirteen ligands have been successfully docked into the hydrophobic cavity of Betv1 and binding free energies of the complexes have been calculated using AutoDock 3.0.5. A linear relationship with correlation coefficient (R2) of 0.6 is obtained between ΔGbs values plotted against their corresponding IC50 values. The complex formed between Betv1 and the best docking pose for each ligand has been optimized by molecular dynamics simulation. Here, we describe the ligand binding of Betv1, which provides insight into the biological function of this protein. This knowledge is required for structural alteration or inhibition of some of these ligands in order to modify the allergenic properties of this protein. PMID:20978606

Mutations of Electrons as Constituents of Hadrons

NASA Astrophysics Data System (ADS)

Driscoll, R. B.

1997-04-01

Conjecture (C) 1: Coulomb-charged constituents of electron (e) are attracted to its barycentre by lepto-strong force F=K/r^2+f; f is stably perturbative for r < the "radius" of e. An exterior magnetic field (MF) with gradient (G) secularly perturbs the eccentricities but not the energies of the constituents' orbits, changing the spin (s) and magnetic moment (μ) of e. (C) 2: F coheres two or more e's dynamically with r approximately equal to the "radius" of e. The resulting MF and G at each e oscillate. Stable values of s and μ result for each e which differs from the atomic values. Binding energies change the masses of the e's. A hadron results. (C) 3: An e similarly may bind to a proton to form a Rutherford- Santilli neutron. The proton is negligibly mutated.(References: H. Dehmelt, Science 247, 539 (1990); T.E. Phipps, Jr., Heretical Verities (Classic Non-fiction Library, Urbana, 1986); R.M. Santilli, Hadronic Mechanics (Ukrainian Academy of Sciences, Kiev, 1995 and 1996), 3 volumes.)

Influence of the size and charge of gold nanoclusters on complexation with siRNA: a molecular dynamics simulation study.

PubMed

Mudedla, Sathish Kumar; Azhagiya Singam, Ettayapuram Ramaprasad; Balamurugan, Kanagasabai; Subramanian, Venkatesan

2015-11-11

The complexation of small interfering RNA (siRNA) with positively charged gold nanoclusters has been studied in the present investigation with the help of classical molecular dynamics and steered molecular dynamics simulations accompanied by free energy calculations. The results show that gold nanoclusters form a stable complex with siRNA. The wrapping of siRNA around the gold nanocluster depends on the size and charge on the surface of the gold cluster. The binding pattern of the gold nanocluster with siRNA is also influenced by the presence of another cluster. The interaction between the positively charged amines in the gold nanocluster and the negatively charged phosphate group in the siRNA is responsible for the formation of complexes. The binding free energy value increases with the size of the gold cluster and the number of positive charges present on the surface of the gold nanocluster. The results reveal that the binding energy of small gold nanoclusters increases in the presence of another gold nanocluster while the binding of large gold nanoclusters decreases due to the introduction of another gold nanocluster. Overall, the findings have clearly demonstrated the effect of size and charge of gold nanoclusters on their interaction pattern with siRNA.

Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Blockade of Neuronal α7-nAChR by α-Conotoxin ImI Explained by Computational Scanning and Energy Calculations

PubMed Central

Yu, Rilei; Craik, David J.; Kaas, Quentin

2011-01-01

α-Conotoxins potently inhibit isoforms of nicotinic acetylcholine receptors (nAChRs), which are essential for neuronal and neuromuscular transmission. They are also used as neurochemical tools to study nAChR physiology and are being evaluated as drug leads to treat various neuronal disorders. A number of experimental studies have been performed to investigate the structure-activity relationships of conotoxin/nAChR complexes. However, the structural determinants of their binding interactions are still ambiguous in the absence of experimental structures of conotoxin-receptor complexes. In this study, the binding modes of α-conotoxin ImI to the α7-nAChR, currently the best-studied system experimentally, were investigated using comparative modeling and molecular dynamics simulations. The structures of more than 30 single point mutants of either the conotoxin or the receptor were modeled and analyzed. The models were used to explain qualitatively the change of affinities measured experimentally, including some nAChR positions located outside the binding site. Mutational energies were calculated using different methods that combine a conformational refinement procedure (minimization with a distance dependent dielectric constant or explicit water, or molecular dynamics using five restraint strategies) and a binding energy function (MM-GB/SA or MM-PB/SA). The protocol using explicit water energy minimization and MM-GB/SA gave the best correlations with experimental binding affinities, with an R2 value of 0.74. The van der Waals and non-polar desolvation components were found to be the main driving force for binding of the conotoxin to the nAChR. The electrostatic component was responsible for the selectivity of the various ImI mutants. Overall, this study provides novel insights into the binding mechanism of α-conotoxins to nAChRs and the methodological developments reported here open avenues for computational scanning studies of a rapidly expanding range of wild-type and chemically modified α-conotoxins. PMID:21390272

Molecular Dynamics Simulations of Protein-Ligand Complexes in Near Physiological Conditions

NASA Astrophysics Data System (ADS)

Wambo, Thierry Oscar

Proteins are important molecules for their key functions. However, under certain circumstances, the function of these proteins needs to be regulated to keep us healthy. Ligands are small molecules often used to modulate the function of proteins. The binding affinity is a quantitative measure of how strong the ligand will modulate the function of the protein: a strong binding affinity will highly impact the performance of the protein. It becomes clear that it is critical to have appropriate techniques to accurately compute the binding affinity. The most difficult task in computer simulations is how to efficiently sample the space spanned by the ligand during the binding process. In this work, we have developed some schemes to compute the binding affinity of a ligand to a protein, and of a metal ion to a protein. Application of these techniques to some complexes yield results in agreement with experimental values. These methods are a brute force approach and make no assumption other than that the complexes are governed by the force field used. Specifically, we computed the free energy of binding between (1) human carbonic anhydrase II and the drug acetazolamide (hcaII-AZM), (2) human carbonic anhydrase II and the zinc ion (hcaII-Zinc), and (3) beta-lactoglobulin and five fatty acids complexes (BLG-FAs). We found the following free energies of binding in unit of kcal/mol: -12.96 +/-2.44 (-15.74) for hcaII-Zinc complex, -5.76+/-0.76 (-5.57) for BLG-OCA , -4.44+/-1.08 (-5.22) for BLG-DKA,-6.89+/-1.25 (-7.24) for BLG-DAO, -8.57+/-0.82 (-8.14) for BLG-MYR, -8.99+/-0.87 (-8.72) for BLG-PLM, and -11.87+/-1.8 (-10.8) for hcaII-AZM. The values inside the parentheses are experimental results. The simulations and quantitative analysis of each system provide interesting insights into the interactions between each entity and helps us to better understand the dynamics of these systems.

Spectrophotometric and molecular modelling studies on in vitro interaction of tyrosine kinase inhibitor linifanib with bovine serum albumin.

PubMed

Wani, Tanveer A; Bakheit, Ahmed H; Zargar, Seema; Hamidaddin, Mohammed A; Darwish, Ibrahim A

2017-01-01

Linifanib (LNF) possess antitumor activity and acts by inhibiting receptor tyrosine kinase VEGF and PDGF. The interaction of BSA with the drug can provide valuable information regarding the pharmacokinetic and pharmacodynamics behavior of drug. In our study the spectrophotometric methods and molecular docking studies were executed to understand the interaction behavior of BSA and LNF. BSA has an intrinsic fluorescence and that fluorescence was quenched by LNF. This quenching process was studied at three different temperatures of 288, 300and 308 K. The interaction between LNF and BSA was due to static quenching because the Ksv (Stern-Volmer constant) at 288 K was higher than at 300 and 308 K. Kq (quenching rate constant) behaved in a similar fashion as the Ksv. Several other parameters like binding constants, number of binding sites and binding energy in addition to molecular docking studies were also used to evaluate the interaction process. A decrease in the binding constants was observed with increasing temperatures and the binding site number approximated unity. The decreasing binding constant indicates LNF-BSA complex stability. The site mark competition experiment confirmed the binding site for LNF was located on site II of BSA. UV-visible studies along with synchronous fluorescence confirm a small change in the conformation of BSA upon interaction with LNF. The thermodynamic analysis provided the values for free energy ΔG0, ΔH0 and ΔS0. The ΔG0 at the 288, 300 and 308 K ranged in between -21.5 to -23.3 kJ mol-1, whereas the calculated values of ΔH (-55.91 kJ mol-1) and ΔS0 (-111.74 J mol-1·K-1). The experimental and molecular docking results suggest that the interaction between LNF and BSA was spontaneous and they exhibited hydrogen bonding and van der Waals force between them.

Interplay between binding affinity and kinetics in protein-protein interactions.

PubMed

Cao, Huaiqing; Huang, Yongqi; Liu, Zhirong

2016-07-01

To clarify the interplay between the binding affinity and kinetics of protein-protein interactions, and the possible role of intrinsically disordered proteins in such interactions, molecular simulations were carried out on 20 protein complexes. With bias potential and reweighting techniques, the free energy profiles were obtained under physiological affinities, which showed that the bound-state valley is deep with a barrier height of 12 - 33 RT. From the dependence of the affinity on interface interactions, the entropic contribution to the binding affinity is approximated to be proportional to the interface area. The extracted dissociation rates based on the Arrhenius law correlate reasonably well with the experimental values (Pearson correlation coefficient R = 0.79). For each protein complex, a linear free energy relationship between binding affinity and the dissociation rate was confirmed, but the distribution of the slopes for intrinsically disordered proteins showed no essential difference with that observed for ordered proteins. A comparison with protein folding was also performed. Proteins 2016; 84:920-933. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Interaction between Pin1 and its natural product inhibitor epigallocatechin-3-gallate by spectroscopy and molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Xi, Lei; Wang, Yu; He, Qing; Zhang, Qingyan; Du, Linfang

2016-12-01

The binding of epigallocatechin-3-gallate (EGCG) to wild type Pin1 in solution was studied by spectroscopic methods and molecular dynamics simulations in this research to explore the binding mode and inhibition mechanism. The binding constants and number of binding sites per Pin1 for EGCG were calculated through the Stern-Volmer equation. The values of binding free energy and thermodynamic parameters were calculated and indicated that hydrogen bonds, electrostatic interaction and Van der Waals interaction played the major role in the binding process. The alterations of Pin1 secondary structure in the presence of EGCG were confirmed by far-UV circular dichroism spectra. The binding model at atomic-level revealed that EGCG was bound to the Glu12, Lys13, Arg14, Met15 and Arg17 in WW domain. Furthermore, EGCG could also interact with Arg69, Asp112, Cys113 and Ser114 in PPIase domain.

Milk β-casein as a vehicle for delivery of bis(indolyl)methane: Spectroscopy and molecular docking studies

NASA Astrophysics Data System (ADS)

Dezhampanah, Hamid; Esmaili, Masoomeh; Khorshidi, Alireza

2017-05-01

The interaction of bis(indolyl)methane with bovine milk β-casein was investigated using spectroscopy and molecular docking studies at different temperatures (25-37 °C). The circular dichroism and Fourier transform infrared spectroscopic data demonstrated that β-casein interacts with BIM molecule mainly via both the hydrophobic and hydrophilic interactions with a minor change in the secondary structure of β-casein. The fluorescence quenching measurements revealed that the presence of a single binding site on β-casein for BIM with the binding constant value of ∼104 M-1. The negative values of entropy and enthalpy changes confirm the predominate role of hydrogen binding and van der Waals interactions in the binding process. Fӧrster energy transfer measurement suggested that the distance between bound BIM and Trp residue is higher than the respective critical distance. Hence, the static quenching is more likely responsible for the fluorescence quenching rather than the mechanism of non-radiative. Docking study showed that BIM molecule forms three hydrogen bonds and several van der Waals contacts with β-casein.

Constrained Surface Complexation Modeling: Rutile in RbCl, NaCl, and NaCF 3SO 3 Media to 250 °C

DOE PAGES

Machesky, Michael L.; Předota, Milan; Ridley, Moira K.; ...

2015-06-01

In this paper, a comprehensive set of molecular-level results, primarily from classical molecular dynamics (CMD) simulations, are used to constrain CD-MUSIC surface complexation model (SCM) parameters describing rutile powder titrations conducted in RbCl, NaCl, and NaTr (Tr = triflate, CF 3SO 3 –) electrolyte media from 25 to 250 °C. Rb + primarily occupies the innermost tetradentate binding site on the rutile (110) surface at all temperatures (25, 150, 250 °C) and negative charge conditions (-0.1 and -0.2 C/m 2) probed via CMD simulations, reflecting the small hydration energy of this large, monovalent cation. Consequently, variable SCM parameters (Stern-layer capacitancemore » values and intrinsic Rb + binding constants) were adjusted relatively easily to satisfactorily match the CMD and titration data. The larger hydration energy of Na + results in a more complex inner-sphere distribution, which shifts from bidentate to tetradentate binding with increasing negative charge and temperature, and this distribution was not matched well for both negative charge conditions, which may reflect limitations in the CMD and/or SCM approaches. Finally, in particular, the CMD axial density profiles for Rb + and Na + reveal that peak binding distances shift toward the surface with increasing negative charge, suggesting that the CD-MUSIC framework may be improved by incorporating CD or Stern-layer capacitance values that vary with charge.« less

Constrained Surface Complexation Modeling: Rutile in RbCl, NaCl, and NaCF 3SO 3 Media to 250 °C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machesky, Michael L.; Předota, Milan; Ridley, Moira K.

In this paper, a comprehensive set of molecular-level results, primarily from classical molecular dynamics (CMD) simulations, are used to constrain CD-MUSIC surface complexation model (SCM) parameters describing rutile powder titrations conducted in RbCl, NaCl, and NaTr (Tr = triflate, CF 3SO 3 –) electrolyte media from 25 to 250 °C. Rb + primarily occupies the innermost tetradentate binding site on the rutile (110) surface at all temperatures (25, 150, 250 °C) and negative charge conditions (-0.1 and -0.2 C/m 2) probed via CMD simulations, reflecting the small hydration energy of this large, monovalent cation. Consequently, variable SCM parameters (Stern-layer capacitancemore » values and intrinsic Rb + binding constants) were adjusted relatively easily to satisfactorily match the CMD and titration data. The larger hydration energy of Na + results in a more complex inner-sphere distribution, which shifts from bidentate to tetradentate binding with increasing negative charge and temperature, and this distribution was not matched well for both negative charge conditions, which may reflect limitations in the CMD and/or SCM approaches. Finally, in particular, the CMD axial density profiles for Rb + and Na + reveal that peak binding distances shift toward the surface with increasing negative charge, suggesting that the CD-MUSIC framework may be improved by incorporating CD or Stern-layer capacitance values that vary with charge.« less

Ab-initio adsorption study of chitosan on functionalized graphene: critical role of van der Waals interactions.

PubMed

Rahman, R; Mazumdar, D

2012-03-01

We investigate the adsorption process of an organic biomolecule (chitosan) on epoxy-functionalized graphene using ab-initio density functional methods incorporating van-der-waals (vdW) interactions. The role of London dispersion force on the cohesive energy and conformal preference of the molecule is quantitatively elucidated. Functionalizing graphene with epoxy leads to weak hydrogen-bond interactions with chitosan. Binding energy values increase by over an order of magnitude after including vdW corrections, implying that dispersive interactions dominate the physisorption process. Conformal study show binding upto 30 kcal/mol when the molecule is oriented with the hydroxyl group approaching the functionalized graphene. Our study advances the promise of functionalized graphene for a variety of applications.

Flexible Acyclic Polyol-Chloride Anion Complexes and Their Characterization by Photoelectron Spectroscopy and Variable Temperature Binding Constant Determinations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shokri, Alireza; Wang, Xue B.; Wang, Yangping

2016-03-17

Flexible acyclic alcohols with 1–5 hydroxyl groups were bound to chloride anion and these complexes were interrogated by negative ion photoelectron spectroscopy and companion density functional theory computations. The resulting vertical detachment energies are reproduced on average to 0.10 eV by M06-2X/aug-cc-pVTZ predictions and range from 4.45 – 5.96 eV. These values are 0.84 – 2.35 eV larger than the adiabatic detachment energy of Cl– as a result of the larger hydrogen bond networks in the bigger polyols. Adiabatic detachment energies of the alcohol–Cl– clusters are more difficult to determine both experimentally and computationally. This is due to the largemore » geometry changes that occur upon photodetachment and the large bond dissociation energy of H–Cl which enables the resulting chlorine atom to abstract a hydrogen from any of the methylene (CH2) or methine (CH) positions. Both ionic and non-ionic hydrogen bonds (i.e., OH•••Cl– and OH•••OH•••Cl–) form in the larger polyols complexes, and are found to be energetically comparable. Subtle structural differences, consequently can lead to the formation of different types of hydrogen bonds and maximizing the ionic ones is not always preferred. Solution equilibrium binding constants between the alcohols and tetrrabuylammonium chloride (TBACl) in acetonitrile at -24.2, 22.0, and 53.6 °C were also determined. The free energies of association are nearly identical for all of the substrates (i.e., ΔG° = -2.8 ± 0.7 kcal mol–1). Compensating enthalpy and entropy values reveal, contrary to expectation and the intrinsic gas-phase preferences, that the bigger systems with more hydroxyl groups are entropically favored and enthalpically disfavored relative to the smaller species. This suggests that more solvent molecules are released upon binding TBACl to alcohols with more hydroxyl groups and is consistent with the measured negative heat capacities. These quantities increase with molecular complexity of the substrate, however, contrary to common interpretation of these values.« less

Constraining the surface properties of effective Skyrme interactions

NASA Astrophysics Data System (ADS)

Jodon, R.; Bender, M.; Bennaceur, K.; Meyer, J.

2016-08-01

Background: Deformation energy surfaces map how the total binding energy of a nuclear system depends on the geometrical properties of intrinsic configurations, thereby providing a powerful tool to interpret nuclear spectroscopy and large-amplitude collective-motion phenomena such as fission. The global behavior of the deformation energy is known to be directly connected to the surface properties of the effective interaction used for its calculation. Purpose: The precise control of surface properties during the parameter adjustment of an effective interaction is key to obtain a reliable and predictive description of nuclear properties. The most relevant indicator is the surface-energy coefficient asurf. There are several possibilities for its definition and estimation, which are not fully equivalent and require a computational effort that can differ by orders of magnitude. The purpose of this study is threefold: first, to identify a scheme for the determination of asurf that offers the best compromise between robustness, precision, and numerical efficiency; second, to analyze the correlation between values for asurf and the characteristic energies of the fission barrier of 240Pu; and third, to lay out an efficient and robust procedure for how the deformation properties of the Skyrme energy density functional (EDF) can be constrained during the parameter fit. Methods: There are several frequently used possibilities to define and calculate the surface energy coefficient asurf of effective interactions built for the purpose of self-consistent mean-field calculations. The most direct access is provided by the model system of semi-infinite nuclear matter, but asurf can also be extracted from the systematics of binding energies of finite nuclei. Calculations can be carried out either self-consistently [Hartree-Fock (HF)], which incorporates quantal shell effects, or in one of the semiclassical extended Thomas-Fermi (ETF) or modified Thomas-Fermi (MTF) approximations. The latter is of particular interest because it provides asurf as a numerical integral without the need to solve self-consistent equations. Results for semi-infinite nuclear matter obtained with the HF, ETF, and MTF methods will be compared with one another and with asurf, as deduced from ETF calculations of very heavy fictitious nuclei. Results: The surface energy coefficient of 76 parametrizations of the Skyrme EDF have been calculated. Values obtained with the HF, ETF, and MTF methods are not identical, but differ by fairly constant systematic offsets. By contrast, extracting asurf from the binding energy of semi-infinite matter or of very large nuclei within the same method gives the same result within the numerical uncertainties. Conclusions: Despite having some drawbacks compared to the other methods studied here, the MTF approach provides sufficiently precise values for asurf such that it can be used as a very robust constraint on surface properties during a parameter fit at negligible additional cost. While the excitation energy of superdeformed states and the height of fission barriers is obviously strongly correlated to asurf, the presence of shell effects prevents a one-to-one correspondence between them. As in addition the value of asurf providing realistic fission barriers depends on the choices made for corrections for spurious motion, its "best value" (within a given scheme to calculate it) depends on the fit protocol. Through the construction of a series of eight parametrizations SLy5s1-SLy5s8 of the standard Skyrme EDF with systematically varied asurf value, it is shown how to arrive at a fit with realistic deformation properties.

Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

PubMed Central

2015-01-01

In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

PubMed

Martínez-González, Eduardo; Frontana, Carlos

2014-05-07

In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

Characterization of the functional role of Asp141, Asp194, and Asp464 residues in the Mn2+-L-malate binding of pigeon liver malic enzyme.

PubMed

Chou, W Y; Chang, H P; Huang, C H; Kuo, C C; Tong, L; Chang, G G

2000-02-01

Pigeon liver malic enzyme was inactivated and cleaved at Asp141, Asp194, and Asp464 by the Cu2+-ascorbate system in acidic environment. Site-specific mutagenesis was performed at these putative metal-binding sites. Three point mutants, D141N, D194N, and D464N; three double mutants, D(141,194)N, D(194,464)N, and D(141,464)N; and a triple mutant, D(141,194,464)N; as well as the wild-type malic enzyme (WT) were successfully cloned and expressed in Escherichia coli cells. All recombinant enzymes, except the triple mutant, were purified to apparent homogeneity by successive Q-Sepharose and adenosine-2',5'-bisphosphate-agarose columns. The mutants showed similar apparent Km,NADP values to that of the WT. The Km,Mal value was increased in the D141N and D194N mutants. The Km,Mn value, on the other hand, was increased only in the D141N mutant by 14-fold, corresponding to approximately 1.6 kcal/mol for the Asp141-Mn2+ binding energy. Substrate inhibition by L-malate was only observed in WT, D464N, and D(141,464)N. Initial velocity experiments were performed to derive the various kinetic parameters. The possible interactions between Asp141, Asp194, and Asp464 were analyzed by the double-mutation cycles and triple-mutation box. There are synergistic weakening interactions between Asp141 and Asp194 in the metal binding that impel the D(141,194)N double mutant to an overall specificity constant [k(cat)/(Kd,Mn Km,Mal Km,NADP)] at least four orders of magnitude smaller than the WT value. This difference corresponds to an increase of 6.38 kcal/mol energy barrier for the catalytic efficiency. Mutation at Asp464, on the other hand, has partial additivity on the mutations at Asp141 and Asp194. The overall specificity constants for the double mutants D(194,464)N and D(141,464)N or the triple mutant D(141,194,464)N were decreased by only 10- to 100-fold compared to the WT. These results strongly suggest the involvement of Asp141 in the Mn2+-L-malate binding for the pigeon liver malic enzyme. The Asp194 and Asp464, which may be oxidized by nonspecific binding of Cu2+, are involved in the Mn2+-L-malate binding or catalysis indirectly by modulating the binding affinity of Asp141 with the Mn2+.

Competition Between Pairing and Ferromagnetic Instabilities in Ultracold Fermi Gases Near Feshbach Resonances

DTIC Science & Technology

2010-05-13

see the inset of Fig. 1). Thus, the two-body pairing process becomes for- bidden when the binding energy ∼ 1/ ma2 exceeds the maxi- mum energy that can...matrix in vacuum. For each value of the scattering length, the T-matrix has a line of poles on the BEC side located at ωq = Ωq+i∆q = −1/ ma2 + mq2/4

Native Hydrophobic Binding Interactions at the Transition State for Association between the TAZ1 Domain of CBP and the Disordered TAD-STAT2 Are Not a Requirement.

PubMed

Lindström, Ida; Dogan, Jakob

2017-08-15

A significant fraction of the eukaryotic proteome consists of proteins that are either partially or completely disordered under native-like conditions. Intrinsically disordered proteins (IDPs) are common in protein-protein interactions and are involved in numerous cellular processes. Although many proteins have been identified as disordered, much less is known about the binding mechanisms of the coupled binding and folding reactions involving IDPs. Here we have analyzed the rate-limiting transition state for binding between the TAZ1 domain of CREB binding protein and the intrinsically disordered transactivation domain of STAT2 (TAD-STAT2) by site-directed mutagenesis and kinetic experiments (Φ-value analysis) and found that the native protein-protein binding interface is not formed at the transition state for binding. Instead, native hydrophobic binding interactions form late, after the rate-limiting barrier has been crossed. The association rate constant in the absence of electrostatic enhancement was determined to be rather high. This is consistent with the Φ-value analysis, which showed that there are few or no obligatory native contacts. Also, linear free energy relationships clearly demonstrate that native interactions are cooperatively formed, a scenario that has usually been observed for proteins that fold according to the so-called nucleation-condensation mechanism. Thus, native hydrophobic binding interactions at the rate-limiting transition state for association between TAD-STAT2 and TAZ1 are not a requirement, which is generally in agreement with previous findings on other IDP systems and might be a common mechanism for IDPs.

Higher-order binding corrections to the Lamb shift

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pachucki, K.

1993-08-15

In this work a new analytical method for calculating the one-loop self-energy correction to the Lamb shift is presented in detail. The technique relies on division into the low and the high energy parts. The low energy part is calculated using the multipole expansion and the high energy part is calculated by expanding the Dirac-Coulomb propagator in powers of the Coulomb field. The obtained results are in agreement with those previously known, but are more accurate. A new theoretical value of the Lamb shift is also given. 47 refs., 2 figs., 1 tab.

Temperature and hydrostatic pressure effects on single dopant states in hollow cylindrical core-shell quantum dot

NASA Astrophysics Data System (ADS)

El-Yadri, M.; Aghoutane, N.; El Aouami, A.; Feddi, E.; Dujardin, F.; Duque, C. A.

2018-05-01

This work reports on theoretical investigation of the temperature and hydrostatic pressure effects on the confined donor impurity in a AlGaAs-GaAs hollow cylindrical core-shell quantum dot. The charges are assumed to be completely confined to the interior of the shell with approximately rigid walls. Within the framework of the effective-mass approximation and by using a variational approach, we have computed the donor binding energies as a function of the shell size in order to study the behavior of the electron-impurity attraction for a very small thickness under the influence of both temperature and hydrostatic pressure. Our results show that the temperature and hydrostatic pressure have a significant influence on the impurity binding energy for large shell quantum dots. It will be shown that the binding energy is more pronounced with increasing pressure and decreasing temperature for any impurity position and quantum dot size. The photoionization cross section is also analyzed by considering only the in-plane incident radiation polarization. Its behavior is investigated as a function of photon energy for different values of pressure and temperature. The opposite effects caused by temperature and hydrostatic pressure reveal a big practical interest and offer an alternative way to tuning of correlated electron-impurity transitions in optoelectronic devices.

Absolute binding free energy calculations of CBClip host–guest systems in the SAMPL5 blind challenge

PubMed Central

Tofoleanu, Florentina; Pickard, Frank C.; König, Gerhard; Huang, Jing; Damjanović, Ana; Baek, Minkyung; Seok, Chaok; Brooks, Bernard R.

2016-01-01

Herein, we report the absolute binding free energy calculations of CBClip complexes in the SAMPL5 blind challenge. Initial conformations of CBClip complexes were obtained using docking and molecular dynamics simulations. Free energy calculations were performed using thermodynamic integration (TI) with soft-core potentials and Bennett’s acceptance ratio (BAR) method based on a serial insertion scheme. We compared the results obtained with TI simulations with soft-core potentials and Hamiltonian replica exchange simulations with the serial insertion method combined with the BAR method. The results show that the difference between the two methods can be mainly attributed to the van der Waals free energies, suggesting that either the simulations used for TI or the simulations used for BAR, or both are not fully converged and the two sets of simulations may have sampled difference phase space regions. The penalty scores of force field parameters of the 10 guest molecules provided by CHARMM Generalized Force Field can be an indicator of the accuracy of binding free energy calculations. Among our submissions, the combination of docking and TI performed best, which yielded the root mean square deviation of 2.94 kcal/mol and an average unsigned error of 3.41 kcal/mol for the ten guest molecules. These values were best overall among all participants. However, our submissions had little correlation with experiments. PMID:27677749

Nucleosome stability and accessibility of its DNA to proteins.

PubMed

Prinsen, Peter; Schiessel, Helmut

2010-12-01

In this paper we present a theoretical description of the accessibility of nucleosomal DNA to proteins. We reassess the classical analysis of Polach and Widom (1995) who demonstrated that proteins (in their case restriction enzymes) gain access to buried binding sites inside a nucleosome through spontaneous unwrapping of DNA from the protein spool. We introduce a straightforward nucleosome model the predictions of which show good agreement with experimental data. By fitting the model to the data we obtain the values of two quantities: the adsorption energy to the histone octamer per length of DNA and the extra length that the DNA needs to unwrap beyond the binding site of an enzyme before the enzyme can act as effectively as on bare DNA. Our results indicate that the effective binding energy is surprisingly low which suggests that the nucleosomal parameters are tuned such that two large energies, the DNA bending energy and the pure adsorption energy, nearly cancel. This paper is based on a lecture presented at the summer school "DNA and Chromosomes 2009: Physical and Biological Applications". We follow the lecture as closely as possible which is why we spend more time than usual on issues that are already well-known in the field, and why we discuss some well-known results from a different perspective. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Biological evaluation, docking and molecular dynamic simulation of some novel diaryl urea derivatives bearing quinoxalindione moiety

PubMed Central

Sadeghian-Rizi, Sedighe; Khodarahmi, Ghadamali Ali; Sakhteman, Amirhossein; Jahanian-Najafabadi, Ali; Rostami, Mahboubeh; Mirzaei, Mahmoud; Hassanzadeh, Farshid

2017-01-01

In this study a series of diarylurea derivatives containing quinoxalindione group were biologically evaluated for their cytotoxic activities using MTT assay against MCF-7 and HepG2 cell lines. Antibacterial activities of these compounds were also evaluated by Microplate Alamar Blue Assay (MABA) against three Gram-negative (Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi), three Gram-positive (Staphylococcus aureus, Bacillus subtilis and Listeria monocitogenes) and one yeast-like fungus (Candida albicans) strain. Furthermore, molecular docking was carried out to study the binding pattern of the compounds to the active site of B-RAF kinase (PDB code: 1UWH). Molecular dynamics simulation was performed on the best ligand (16e) to investigate the ligand binding dynamics in the physiological environment. Cytotoxic evaluation revealed the most prominent cytotoxicity for 6 compounds with IC50 values of 10-18 μM against two mentioned cell lines. None of the synthesized compounds showed significant antimicrobial activity. The obtained results of the molecular docking study showed that all compounds fitted in the binding site of enzyme with binding energy range of -11.22 to -12.69 kcal/mol vs sorafenib binding energy -11.74 kcal/mol as the lead compound. Molecular dynamic simulation indicated that the binding of ligand (16e) was stable in the active site of B-RAF during the simulation. PMID:29204178

Biophysical study on the interaction of ceftriaxone sodium with bovine serum albumin using spectroscopic methods.

PubMed

Pan, Jiongwei; Ye, Zaiting; Cai, Xiaoping; Wang, Liangxing; Cao, Zhuo

2012-12-01

The interaction of ceftriaxone sodium (CS), a cephalosporin antibiotic, with the major transport protein, bovine serum albumin (BSA), was investigated using different spectroscopic techniques such as fluorescence, circular dichroism (CD), and UV-vis spectroscopy. Values of binding parameters for BSA-CS interaction in terms of binding constant and number of binding sides were found to be 9.00 × 10(3), 3.24 × 10(3), and 2.30 × 10(3) M(-1) at 281, 301, and 321 K, respectively. Thermodynamic analysis of the binding data obtained at different temperatures showed that the binding process was spontaneous and was primarily mediated by van der Waals force or hydrogen bonding. CS binding to BSA caused secondary structural alterations in the protein as revealed by CD results. The distance between CS and Trp of BSA was determined as 3.23 nm according to the Förster resonance energy transfer theory. © 2012 Wiley Periodicals, Inc.

Conformational Transitions and Convergence of Absolute Binding Free Energy Calculations

PubMed Central

Lapelosa, Mauro; Gallicchio, Emilio; Levy, Ronald M.

2011-01-01

The Binding Energy Distribution Analysis Method (BEDAM) is employed to compute the standard binding free energies of a series of ligands to a FK506 binding protein (FKBP12) with implicit solvation. Binding free energy estimates are in reasonably good agreement with experimental affinities. The conformations of the complexes identified by the simulations are in good agreement with crystallographic data, which was not used to restrain ligand orientations. The BEDAM method is based on λ -hopping Hamiltonian parallel Replica Exchange (HREM) molecular dynamics conformational sampling, the OPLS-AA/AGBNP2 effective potential, and multi-state free energy estimators (MBAR). Achieving converged and accurate results depends on all of these elements of the calculation. Convergence of the binding free energy is tied to the level of convergence of binding energy distributions at critical intermediate states where bound and unbound states are at equilibrium, and where the rate of binding/unbinding conformational transitions is maximal. This finding mirrors similar observations in the context of order/disorder transitions as for example in protein folding. Insights concerning the physical mechanism of ligand binding and unbinding are obtained. Convergence for the largest FK506 ligand is achieved only after imposing strict conformational restraints, which however require accurate prior structural knowledge of the structure of the complex. The analytical AGBNP2 model is found to underestimate the magnitude of the hydrophobic driving force towards binding in these systems characterized by loosely packed protein-ligand binding interfaces. Rescoring of the binding energies using a numerical surface area model corrects this deficiency. This study illustrates the complex interplay between energy models, exploration of conformational space, and free energy estimators needed to obtain robust estimates from binding free energy calculations. PMID:22368530

Elucidation of the binding mechanism of renin using a wide array of computational techniques and biological assays.

PubMed

Tzoupis, Haralambos; Leonis, Georgios; Avramopoulos, Aggelos; Reis, Heribert; Czyżnikowska, Żaneta; Zerva, Sofia; Vergadou, Niki; Peristeras, Loukas D; Papavasileiou, Konstantinos D; Alexis, Michael N; Mavromoustakos, Thomas; Papadopoulos, Manthos G

2015-11-01

We investigate the binding mechanism in renin complexes, involving three drugs (remikiren, zankiren and enalkiren) and one lead compound, which was selected after screening the ZINC database. For this purpose, we used ab initio methods (the effective fragment potential, the variational perturbation theory, the energy decomposition analysis, the atoms-in-molecules), docking, molecular dynamics, and the MM-PBSA method. A biological assay for the lead compound has been performed to validate the theoretical findings. Importantly, binding free energy calculations for the three drug complexes are within 3 kcal/mol of the experimental values, thus further justifying our computational protocol, which has been validated through previous studies on 11 drug-protein systems. The main elements of the discovered mechanism are: (i) minor changes are induced to renin upon drug binding, (ii) the three drugs form an extensive network of hydrogen bonds with renin, whilst the lead compound presented diminished interactions, (iii) ligand binding in all complexes is driven by favorable van der Waals interactions and the nonpolar contribution to solvation, while the lead compound is associated with diminished van der Waals interactions compared to the drug-bound forms of renin, and (iv) the environment (H2O/Na(+)) has a small effect on the renin-remikiren interaction. Copyright © 2015 Elsevier Inc. All rights reserved.

Inferring the microscopic surface energy of protein-protein interfaces from mutation data.

PubMed

Moal, Iain H; Dapkūnas, Justas; Fernández-Recio, Juan

2015-04-01

Mutations at protein-protein recognition sites alter binding strength by altering the chemical nature of the interacting surfaces. We present a simple surface energy model, parameterized with empirical ΔΔG values, yielding mean energies of -48 cal mol(-1) Å(-2) for interactions between hydrophobic surfaces, -51 to -80 cal mol(-1) Å(-2) for surfaces of complementary charge, and 66-83 cal mol(-1) Å(-2) for electrostatically repelling surfaces, relative to the aqueous phase. This places the mean energy of hydrophobic surface burial at -24 cal mol(-1) Å(-2) . Despite neglecting configurational entropy and intramolecular changes, the model correlates with empirical binding free energies of a functionally diverse set of rigid-body interactions (r = 0.66). When used to rerank docking poses, it can place near-native solutions in the top 10 for 37% of the complexes evaluated, and 82% in the top 100. The method shows that hydrophobic burial is the driving force for protein association, accounting for 50-95% of the cohesive energy. The model is available open-source from http://life.bsc.es/pid/web/surface_energy/ and via the CCharpPPI web server http://life.bsc.es/pid/ccharppi/. © 2015 Wiley Periodicals, Inc.

Molecular docking and dynamics simulation study on the influence of Zn2+ on the binding modes of aggrecanase with its inhibitors.

PubMed

Suganya, Panneer S R; Kalva, Sukesh; Saleena, Lilly M

2014-01-01

Zinc plays a vital role in structural organization, regulation of function and stabilization of the folded protein, which ultimately activates or inactivates the binding sites of the protein. Its transition makes a major change in the protein and its binding affinity. The ligand binding aggrecanases can be influenced by Zn2+ ions; therefore the study focuses on checking the binding mode in the presence and absence of zinc using Docking and Molecular dynamics simulation. The crystal structure with zinc was considered as wild type (ADAMTS-4-1Zn2+, ADAMTS-5-1Zn2+) and the crystal structure without zinc was considered as the mutant type (ADAMTS-4-0Zn2+, ADAMTS-5-0Zn2+). Mutations were made manually by deleting the zinc atom. ADAMTS-4-1Zn2+ had the best Glide score of -12.66 kcal·mol−1, whereas ADAMTS-4-0Zn2+ had -11.69 kcal·mol−1. ADAMTS-4-1Zn2+ had the best glide energy of -72.29 kcal·mol−1, whereas ADAMTS-4-0Zn2+ had-68.44 kcal·mol−1. ADAMTS-4-1Zn2+ had the best glide e-model of -116.34, whereas ADAMTS-4-0Zn2+ had -104.264. The RMSD value for ADAMTS-4-1Zn2+ and ADAMTS-4-0Zn2+ was 1.9. These results suggested that the absence of zinc decreases the binding affinity of ADAMTS-4 with its inhibitor. ADAMTS-5-1Zn2+ had the best Glide score of -8.32 kcal·mol−1, whereas ADAMTS-5-0Zn2+ had -6.62 kcal·mol−1. ADAMTS-5-1Zn2+ had the best glide energy of -70.28 kcal·mol−1, whereas ADAMTS-5-0Zn2+ had -66.02 kcal·mol−1. ADAMTS-5-1Zn2+ had the best glide e-model of-108.484, whereas ADAMTS-5-0Zn2+ had -93.81. The RMSD value for ADAMTS-5-1Zn2+ and ADAMTS-5-0Zn2+ was 0.48Å. These results confirmed that the absence of zinc decreased the binding affinity of ADAMTS-5 with its inhibitor whereas the presence extended the docking energy range and strengthened the binding affinity. Per-residue interaction study, MM-GBSA and Molecular Dynamics showed that all the four complexes underwent extensive structural changes whereas the complex with zinc was stable throughout the simulation period.

Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

First principles study of edge carboxylated graphene quantum dots

NASA Astrophysics Data System (ADS)

Abdelsalam, Hazem; Elhaes, Hanan; Ibrahim, Medhat A.

2018-05-01

The structure stability and electronic properties of edge carboxylated hexagonal and triangular graphene quantum dots are investigated using density functional theory. The calculated binding energies show that the hexagonal clusters with armchair edges have the highest stability among all the quantum dots. The binding energy of carboxylated graphene quantum dots increases by increasing the number of carboxyl groups. Our study shows that the total dipole moment significantly increases by adding COOH with the highest value observed in triangular clusters. The edge states in triangular graphene quantum dots with zigzag edges produce completely different energy spectrum from other dots: (a) the energy gap in triangular zigzag is very small as compared to other clusters and (b) the highest occupied molecular orbital is localized at the edges which is in contrast to other clusters where it is distributed over the cluster surface. The enhanced reactivity and the controllable energy gap by shape and edge termination make graphene quantum dots ideal for various nanodevice applications such as sensors. The infrared spectra are presented to confirm the stability of the quantum dots.

Isoelectronic bound-exciton photoluminescence in strained beryllium-doped Si0.92Ge0.08 epilayers and Si0.92Ge0.08/Si superlattices at ambient and elevated hydrostatic pressure

NASA Astrophysics Data System (ADS)

Kim, Sangsig; Chang, Ganlin; Herman, Irving P.; Bevk, Joze; Moore, Karen L.; Hall, Dennis G.

1997-03-01

Photoluminescence (PL) from a beryllium-doped Si0.92Ge0.08 epilayer and three different beryllium-doped Si0.92Ge0.08/Si superlattices (SL's) commensurately grown on Si(100) substrates is examined at 9 K at ambient pressure and, for the epilayer and one SL, as a function of hydrostatic pressure. In each structure, excitons bind to the isoelectronic Be pairs in the strained Si0.92Ge0.08 layers. The zero-phonon PL peaks of the epilayer and the in situ doped 50-Å Si0.92Ge0.08/100-Å Si SL shift linearly with pressure toward lower energy at the rate of 0.68+/-0.03 and 0.97+/-0.03 meV/kbar, respectively, which are near the 0.77-meV/kbar value for Si:Be. The PL energies at ambient and elevated pressure are analyzed by accounting for strain, quantum confinement, and exciton binding. A modified Hopfield-Thomas-Lynch model is used to model exciton binding to the Be pairs. This model, in which potential wells bind electrons to a site (that then trap holes), predicts a distribution of electron binding energies when an inhomogeneous distribution of potential-well depths is used. This accounts for the large PL linewidth and the decrease of linewidth with increasing pressure, among other observations. In SL's, the exciton binding energy is shown to depend on the width of the wells as well as the spatial distribution of Be dopants in the superlattice. Also, at and above 58 kbar a very unusual peak is observed in one of the SL's, which is associated with a free-exciton peak in Si, that shifts very fast with pressure (-6.02+/-0.03 meV/kbar).

Interaction of new kinase inhibitors cabozantinib and tofacitinib with human serum alpha-1 acid glycoprotein. A comprehensive spectroscopic and molecular Docking approach

NASA Astrophysics Data System (ADS)

Ajmal, Mohammad Rehan; Abdelhameed, Ali Saber; Alam, Parvez; Khan, Rizwan Hasan

2016-04-01

In the current study we have investigated the interaction of newly approved kinase inhibitors namely Cabozantinib (CBZ) and Tofacitinib (TFB) with human Alpha-1 acid glycoprotein (AAG) under simulated physiological conditions using fluorescence quenching measurements, circular dichroism, dynamic light scattering and molecular docking methods. CBZ and TFB binds to AAG with significant affinity and the calculated binding constant for the drugs lie in the order of 104. With the increase in temperature the binding constant values decreased for both CBZ and TFB. The fluorescence resonance energy transfer (FRET) from AAG to CBZ and TFB suggested the fluorescence intensity of AAG was quenched by the two studied drugs via the formation of a non-fluorescent complex in the static manner. The molecular distance r value calculated from FRET is around 2 nm for both drugs, fluorescence spectroscopy data was employed for the study of thermodynamic parameters, standard Gibbs free energy change at 300K was calculated as - 5.234 kcal mol- 1 for CBZ-AAG interaction and - 6.237 kcal mol- 1 for TFB-AAG interaction, standard enthalpy change and standard entropy change for CBZ-AAG interaction are - 9.553 kcal mol- 1 and - 14.618 cal mol- 1K- 1 respectively while for AAG-TFB interaction, standard enthalpy and standard entropy change was calculated as 4.019 kcal mol- 1 and 7.206 cal mol- 1K- 1 respectively. Protein binding of the two drugs caused the tertiary structure alterations. Dynamic light scattering measurements demonstrated the reduction in the hydrodynamic radii of the protein. Furthermore molecular docking results suggested the Hydrophobic interaction and hydrogen bonding were the interactive forces in the binding process of CBZ to AAG while in case of TFB only hydrophobic interactions were found to be involved, overlap of the binding site for two studied drugs on the AAG molecule was revealed by docking results.

Allosteric modulation model of the mu opioid receptor by herkinorin, a potent not alkaloidal agonist

NASA Astrophysics Data System (ADS)

Marmolejo-Valencia, A. F.; Martínez-Mayorga, K.

2017-05-01

Modulation of opioid receptors is the primary choice for pain management and structural information studies have gained new horizons with the recently available X-ray crystal structures. Herkinorin is one of the most remarkable salvinorin A derivative with high affinity for the mu opioid receptor, moderate selectivity and lack of nitrogen atoms on its structure. Surprisingly, binding models for herkinorin are lacking. In this work, we explore binding models of herkinorin using automated docking, molecular dynamics simulations, free energy calculations and available experimental information. Our herkinorin D-ICM-1 binding model predicted a binding free energy of -11.52 ± 1.14 kcal mol-1 by alchemical free energy estimations, which is close to the experimental values -10.91 ± 0.2 and -10.80 ± 0.05 kcal mol-1 and is in agreement with experimental structural information. Specifically, D-ICM-1 molecular dynamics simulations showed a water-mediated interaction between D-ICM-1 and the amino acid H2976.52, this interaction coincides with the co-crystallized ligands. Another relevant interaction, with N1272.63, allowed to rationalize herkinorin's selectivity to mu over delta opioid receptors. Our suggested binding model for herkinorin is in agreement with this and additional experimental data. The most remarkable observation derived from our D-ICM-1 model is that herkinorin reaches an allosteric sodium ion binding site near N1503.35. Key interactions in that region appear relevant for the lack of β-arrestin recruitment by herkinorin. This interaction is key for downstream signaling pathways involved in the development of side effects, such as tolerance. Future SAR studies and medicinal chemistry efforts will benefit from the structural information presented in this work.

Combined 3D-QSAR, molecular docking, molecular dynamics simulation, and binding free energy calculation studies on the 5-hydroxy-2H-pyridazin-3-one derivatives as HCV NS5B polymerase inhibitors.

PubMed

Yu, Haijing; Fang, Yu; Lu, Xia; Liu, Yongjuan; Zhang, Huabei

2014-01-01

The NS5B RNA-dependent RNA polymerase (RdRP) is a promising therapeutic target for developing novel anti-hepatitis C virus (HCV) drugs. In this work, a combined molecular modeling study was performed on a series of 193 5-hydroxy-2H-pyridazin-3-one derivatives as inhibitors of HCV NS5B Polymerase. The best 3D-QSAR models, including CoMFA and CoMSIA, are based on receptor (or docking). Furthermore, a 40-ns molecular dynamics (MD) simulation and binding free energy calculations using docked structures of NS5B with ten compounds, which have diverse structures and pIC50 values, were employed to determine the detailed binding process and to compare the binding modes of the inhibitors with different activities. On one side, the stability and rationality of molecular docking and 3D-QSAR results were validated by MD simulation. The binding free energies calculated by the MM-PBSA method gave a good correlation with the experimental biological activity. On the other side, by analyzing some differences between the molecular docking and the MD simulation results, we can find that the MD simulation could also remedy the defects of molecular docking. The analyses of the combined molecular modeling results have identified that Tyr448, Ser556, and Asp318 are the key amino acid residues in the NS5B binding pocket. The results from this study can provide some insights into the development of novel potent NS5B inhibitors. © 2013 John Wiley & Sons A/S.

In silico study of carvone derivatives as potential neuraminidase inhibitors.

PubMed

Jusoh, Noorakmar; Zainal, Hasanuddin; Abdul Hamid, Azzmer Azzar; Bunnori, Noraslinda M; Abd Halim, Khairul Bariyyah; Abd Hamid, Shafida

2018-03-15

Recent outbreaks of highly pathogenic influenza strains have highlighted the need to develop new anti-influenza drugs. Here, we report an in silico study of carvone derivatives to analyze their binding modes with neuraminidase (NA) active sites. Two proposed carvone analogues, CV(A) and CV(B), with 36 designed ligands were predicted to inhibit NA (PDB ID: 3TI6) using molecular docking. The design is based on structural resemblance with the commercial inhibitor, oseltamivir (OTV), ligand polarity, and amino acid residues in the NA active sites. Docking simulations revealed that ligand A18 has the lowest energy binding (∆G bind ) value of -8.30 kcal mol -1 , comparable to OTV with ∆G bind of -8.72 kcal mol -1 . A18 formed seven hydrogen bonds (H-bonds) at residues Arg292, Arg371, Asp151, Trp178, Glu227, and Tyr406, while eight H-bonds were formed by OTV with amino acids Arg118, Arg292, Arg371, Glu119, Asp151, and Arg152. Molecular dynamics (MD) simulation was conducted to compare the stability between ligand A18 and OTV with NA. Our simulation study showed that the A18-NA complex is as stable as the OTV-NA complex during the MD simulation of 50 ns through the analysis of RMSD, RMSF, total energy, hydrogen bonding, and MM/PBSA free energy calculations.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Quantum effects and anharmonicity in the H2-Li+-benzene complex: A model for hydrogen storage materials

NASA Astrophysics Data System (ADS)

Kolmann, Stephen J.; D'Arcy, Jordan H.; Jordan, Meredith J. T.

2013-12-01

Quantum and anharmonic effects are investigated in H2-Li+-benzene, a model for hydrogen adsorption in metal-organic frameworks and carbon-based materials. Three- and 8-dimensional quantum diffusion Monte Carlo (QDMC) and rigid-body diffusion Monte Carlo (RBDMC) simulations are performed on potential energy surfaces interpolated from electronic structure calculations at the M05-2X/6-31+G(d,p) and M05-2X/6-311+G(2df,p) levels of theory using a three-dimensional spline or a modified Shepard interpolation. These calculations investigate the intermolecular interactions in this system, with three- and 8-dimensional 0 K H2 binding enthalpy estimates, ΔHbind (0 K), being 16.5 kJ mol-1 and 12.4 kJ mol-1, respectively: 0.1 and 0.6 kJ mol-1 higher than harmonic values. Zero-point energy effects are 35% of the value of ΔHbind (0 K) at M05-2X/6-311+G(2df,p) and cannot be neglected; uncorrected electronic binding energies overestimate ΔHbind (0 K) by at least 6 kJ mol-1. Harmonic intermolecular binding enthalpies can be corrected by treating the H2 "helicopter" and "ferris wheel" rotations as free and hindered rotations, respectively. These simple corrections yield results within 2% of the 8-dimensional anharmonic calculations. Nuclear ground state probability density histograms obtained from the QDMC and RBDMC simulations indicate the H2 molecule is delocalized above the Li+-benzene system at 0 K.

Energy spectra of small bosonic clusters having a large two-body scattering length

NASA Astrophysics Data System (ADS)

Gattobigio, M.; Kievsky, A.; Viviani, M.

2012-10-01

In this work we investigate small clusters of bosons using the hyperspherical harmonic basis. We consider systems with A=2,3,4,5,6 particles interacting through a soft interparticle potential. In order to make contact with a real system, we use an attractive Gaussian potential that reproduces the values of the dimer binding energy and the atom-atom scattering length obtained with one of the most widely used 4He-4He interactions, the LM2M2 potential of Aziz and Slaman. The intensity of the potential is varied in order to explore the clusters’ spectra in different regions with large positive and large negative values of the two-body scattering length. In addition, we include a repulsive three-body force to reproduce the trimer binding energy. With this model, consisting in the sum of a two- and three-body potential, we have calculated the spectrum of the four-, five-, and six-particle systems. In all the regions explored, we have found that these systems present two states, one deep and one shallow close to the A-1 threshold. Some universal relations between the energy levels are extracted; in particular, we have estimated the universal ratios between thresholds of the three-, four-, and five-particle continua using the two-body Gaussian potential. They agree with recent measurements and theoretical predictions.

Hydration energies and structures of alkaline earth metal ions, M2+(H2O)n, n = 5-7, M = Mg, Ca, Sr, and Ba.

PubMed

Rodriguez-Cruz, S E; Jockusch, R A; Williams, E R

1999-09-29

The evaporation of water from hydrated alkaline earth metal ions, produced by electrospray ionization, was studied in a Fourier transform mass spectrometer. Zero-pressure-limit dissociation rate constants for loss of a single water molecule from the hydrated divalent metal ions, M(2+)(H(2)O)(n) (M = Mg, Ca, and Sr for n = 5-7, and M = Ba for n = 4-7), are measured as a function of temperature using blackbody infrared radiative dissociation. From these values, zero-pressure-limit Arrhenius parameters are obtained. By modeling the dissociation kinetics using a master equation formalism, threshold dissociation energies (E(o)) are determined. These reactions should have a negligible reverse activation barrier; therefore, E(o) values should be approximately equal to the binding energy or hydration enthalpy at 0 K. For the hepta- and hexahydrated ions at low temperature, binding energies follow the trend expected on the basis of ionic radii: Mg > Ca > Sr > Ba. For the hexahydrated ions at high temperature, binding energies follow the order Ca > Mg > Sr > Ba. The same order is observed for the pentahydrated ions. Collisional dissociation experiments on the tetrahydrated species result in relative dissociation rates that directly correlate with the size of the metals. These results indicate the presence of two isomers for hexahydrated magnesium ions: a low-temperature isomer in which the six water molecules are located in the first solvation shell, and a high-temperature isomer with the most likely structure corresponding to four water molecules in the inner shell and two water molecules in the second shell. These results also indicate that the pentahydrated magnesium ions have a structure with four water molecules in the first solvation shell and one in the outer shell. The dissociation kinetics for the hexa- and pentahydrated clusters of Ca(2+), Sr(2+), and Ba(2+) are consistent with structures in which all the water molecules are located in the first solvation shell.

High-level ab initio calculations for the four low-lying families of minima of (H2O)(20): 1. Estimates of MP2/CBS binding energies and comparison with empirical potentials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fanourgakis, Georgios S.; Apra, Edoardo; Xantheas, Sotiris S.

2004-08-08

We report estimates of complete basis set (CBS) limits at the second-order Møller-Plesset perturbation level of theory (MP2) for the binding energies of the lowest lying isomers within each of the four major families of minima of (H2O)20. These were obtained by performing MP2 calculations with the family of correlation-consistent basis sets up to quadruple zeta quality, augmented with additional diffuse functions (aug-cc-pVnZ, n=D, T, Q). The MP2/CBS estimates are: -200.1 kcal/mol (dodecahedron, 30 hydrogen bonds), -212.6 kcal/mol (fused cubes, 36 hydrogen bonds), -215.0 (face-sharing pentagonal prisms, 35 hydrogen bonds) and –217.9 kcal/mol (edge-sharing pentagonal prisms, 34 hydrogen bonds). Themore » energetic ordering of the various (H2O)20 isomers does not follow monotonically the number of hydrogen bonds as in the case of smaller clusters such as the different isomers of the water hexamer. The dodecahedron lies ca. 18 kcal/mol higher in energy than the most stable edge-sharing pentagonal prism isomer. The TIP4P, ASP-W4, TTM2-R, AMOEBA and TTM2-F empirical potentials also predict the energetic stabilization of the edge-sharing pentagonal prisms with respect to the dodecahedron, albeit they universally underestimate the cluster binding energies with respect to the MP2/CBS result. Among them, the TTM2-F potential was found to predict the absolute cluster binding energies to within < 1% from the corresponding MP2/CBS values, whereas the error for the rest of the potentials considered in this study ranges from 3-5%.« less

Structure-activity relationships of diphenyl-ether as protoporphyrinogen oxidase inhibitors: insights from computational simulations

NASA Astrophysics Data System (ADS)

Hao, Ge-Fei; Tan, Ying; Yu, Ning-Xi; Yang, Guang-Fu

2011-03-01

Protoporphyrinogen oxidase (PPO, EC 1.3.3.4), which has been identified as a significant target for a great family of herbicides with diverse chemical structures, is the last common enzyme responsible for the seventh step in the biosynthetic pathway to heme and chlorophyll. Among the existing PPO inhibitors, diphenyl-ether is the first commercial family of PPO inhibitors and used as agriculture herbicides for decades. Most importantly, diphenyl-ether inhibitors have been found recently to possess the potential in Photodynamic therapy (PDT) to treat cancer. Herein, molecular dynamics simulations, approximate free energy calculations and hydrogen bond energy calculations were integrated together to uncover the structure-activity relationships of this type of PPO inhibitors. The calculated binding free energies are correlated very well with the values derived from the experimental k i data. According to the established computational models and the results of approximate free energy calculation, the substitution effects at different position were rationalized from the view of binding free energy. Some outlier ( e.g. LS) in traditional QSAR study can also be explained reasonably. In addition, the hydrogen bond energy calculation and interaction analysis results indicated that the carbonyl oxygen on position-9 and the NO2 group at position-8 are both vital for the electrostatic interaction with Arg98, which made a great contribution to the binding free energy. These insights from computational simulations are not only helpful for understanding the molecular mechanism of PPO-inhibitor interactions, but also beneficial to the future rational design of novel promising PPO inhibitors.

Gold catalyzed double condensation reaction: Synthesis, antimicrobial and cytotoxicity of spirooxindole derivatives.

PubMed

Parthasarathy, K; Praveen, Chandrasekar; Jeyaveeran, J C; Prince, A A M

2016-09-01

Microwave assisted synthesis of spirooxindoles via tandem double condensation between isatins and 4-hydroxycoumarin under gold catalysis is reported. The reaction is practical to perform, since the products can be isolated by simple filtration without requiring tedious column chromatography. The scope of this chemistry is exemplified by preparing structurally diverse spirooxindoles (22 examples) in excellent yields. Antimicrobial evaluation of the synthesized compounds revealed that three compounds (3a, 3f and 3s) exhibited significant MIC values in comparison to the standard drugs. Molecular docking studies of these compounds with AmpC-β-lactamase receptor revealed that 3a exhibited minimum binding energy (-117.819kcal/mol) indicating its strong affinity towards amino acid residues via strong hydrogen bond interaction. All compounds were also evaluated for their in vitro cytotoxicity against COLO320 cancer cells. Biological assay and molecular docking studies demonstrated that 3g is the most active compound in terms of its low IC50 value (50.0μM) and least free energy of binding (-8.99kcal/mol) towards CHK1 receptor, respectively. Copyright © 2016 Elsevier Ltd. All rights reserved.

Microscopic study of spin cut-off factors of nuclear level densities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gholami, M.; Kildir, M.; Behkami, A. N.

Level densities and spin cut-off factors have been investigated within the microscopic approach based on the BCS Hamiltonian. In particular, the spin cut-off parameters have been calculated at neutron binding energies over a large range of nuclear mass using the BCS theory. The spin cut-off parameters {sigma}{sup 2}(E) have also been obtained from the Gilbert and Cameron expression and from rigid body calculations. The results were compared with their corresponding macroscopic values. It was found that the values of {sigma}{sup 2}(E) did not increase smoothly with A as expected based on macroscopic theory. Instead, the values of {sigma}{sup 2}(E) showmore » structure reflecting the angular momentum of the shell model orbitals near the Fermi energy.« less

A computational approach for predicting off-target toxicity of antiviral ribonucleoside analogues to mitochondrial RNA polymerase.

PubMed

Freedman, Holly; Winter, Philip; Tuszynski, Jack; Tyrrell, D Lorne; Houghton, Michael

2018-06-22

In the development of antiviral drugs that target viral RNA-dependent RNA polymerases, off-target toxicity caused by the inhibition of the human mitochondrial RNA polymerase (POLRMT) is a major liability. Therefore, it is essential that all new ribonucleoside analogue drugs be accurately screened for POLRMT inhibition. A computational tool that can accurately predict NTP binding to POLRMT could assist in evaluating any potential toxicity and in designing possible salvaging strategies. Using the available crystal structure of POLRMT bound to an RNA transcript, here we created a model of POLRMT with an NTP molecule bound in the active site. Furthermore, we implemented a computational screening procedure that determines the relative binding free energy of an NTP analogue to POLRMT by free energy perturbation (FEP), i.e. a simulation in which the natural NTP molecule is slowly transformed into the analogue and back. In each direction, the transformation was performed over 40 ns of simulation on our IBM Blue Gene Q supercomputer. This procedure was validated across a panel of drugs for which experimental dissociation constants were available, showing that NTP relative binding free energies could be predicted to within 0.97 kcal/mol of the experimental values on average. These results demonstrate for the first time that free-energy simulation can be a useful tool for predicting binding affinities of NTP analogues to a polymerase. We expect that our model, together with similar models of viral polymerases, will be very useful in the screening and future design of NTP inhibitors of viral polymerases that have no mitochondrial toxicity. © 2018 Freedman et al.

Effect of size on bulk and surface cohesion energy of metallic nano-particles

NASA Astrophysics Data System (ADS)

Yaghmaee, M. S.; Shokri, B.

2007-04-01

The knowledge of nano-material properties not only helps us to understand the extreme behaviour of small-scale materials better (expected to be different from what we observe from their bulk value) but also helps us to analyse and design new advanced functionalized materials through different nano technologies. Among these fundamental properties, the cohesion (binding) energy mainly describes most behaviours of materials in different environments. In this work, we discuss this fundamental property through a nano-thermodynamical approach using two algorithms, where in the first approach the size dependence of the inner (bulk) cohesion energy is studied, and in the second approach the surface cohesion energy is considered too. The results, which are presented through a computational demonstration (for four different metals: Al, Ga, W and Ag), can be compared with some experimental values for W metallic nano-particles.

Simultaneous effects of temperature and pressure on the donor binding energy in a V-groove quantum wire

NASA Astrophysics Data System (ADS)

Khordad, R.

2010-03-01

The influence of temperature and pressure, simultaneously, on the binding energy of a hydrogenic donor impurity in a ridge GaAs/Ga 1- xAl xAs quantum wire is studied using a variational procedure within the effective mass approximation. The subband energy and the binding energy of the donor impurity in its ground state as a function of the wire bend width and impurity location at different temperatures and pressures are calculated. The results show that, when the temperature increases, the donor binding energy decreases for a constant applied pressure for all wire bend widths. Also, the binding energy increases by increasing the pressure for a constant temperature for all wire bend widths. In addition, when the temperature and pressure are applied simultaneously the binding energy decreases as the quantum wire bend width increases. On the whole, it is deduced that the temperature and pressure have important effects on the donor binding energy in a V-groove quantum wire.

Estimating carbon cluster binding energies from measured Cn distributions, n <= 10

NASA Astrophysics Data System (ADS)

Pargellis, A. N.

1990-08-01

Experimental data are presented for the cluster distribution of sputtered negative carbon clusters, C-n, with n≤10. Additionally, clusters have been observed with masses indicating they are CsC-2n, with n≤4. The C-n data are compared with the data obtained by other groups, for neutral and charged clusters, using a variety of sources such as evaporation, sputtering, and laser ablation. The data are used to estimate the cluster binding energies En, using the universal relation, En=(n-1)ΔHn+RTe [ln(Jn/J1)+0.5 ln(n)-α-(ΔSn-ΔS1)/R], derived from basic kinetic and thermodynamic relations. The estimated values agree astonishingly well with values from the literature, varying from published values by at most a few percent. In this equation, Jn is the observed current of n-atom clusters, ΔHn is the heat of vaporization, ΔH1=7.41 eV, and Te ≊0.25 eV (2900 K) is the effective source temperature. The relative change in cluster entropy during sublimation from the solid to vapor phase is approximated to first order by the relation (ΔSn-ΔS1)/R =3.1+0.9(n-2), and is fit to published data for n between 2 and 5 and temperatures between 2000 and 4000 K. The parameter α is empirical, obtained by fitting the data to known binding energies for Cn≤5 clusters. For evaporation sources, α must be zero, but α˜7 when sputtering with Cs+ ions, indicating the sputtered clusters appear to be in thermodynamic equilibrium, but not the atoms. Several possible mechanisms for the formation of clusters during sputtering are examined. One plausible mechanism is that atoms diffuse on the graphite surface to form clusters which are then desorbed by energetic, recoil atoms created in subsequent sputtering events.

Rational Design, Synthesis, and Biological Evaluation of Third Generation α-Noscapine Analogues as Potent Tubulin Binding Anti-Cancer Agents

PubMed Central

Manchukonda, Naresh Kumar; Naik, Pradeep Kumar; Santoshi, Seneha; Lopus, Manu; Joseph, Silja; Sridhar, Balasubramanian; Kantevari, Srinivas

2013-01-01

Systematic screening based on structural similarity of drugs such as colchicine and podophyllotoxin led to identification of noscapine, a microtubule-targeted agent that attenuates the dynamic instability of microtubules without affecting the total polymer mass of microtubules. We report a new generation of noscapine derivatives as potential tubulin binding anti-cancer agents. Molecular modeling experiments of these derivatives 5a, 6a-j yielded better docking score (-7.252 to -5.402 kCal/mol) than the parent compound, noscapine (-5.505 kCal/mol) and its existing derivatives (-5.563 to -6.412 kCal/mol). Free energy (ΔG bind) calculations based on the linear interaction energy (LIE) empirical equation utilizing Surface Generalized Born (SGB) continuum solvent model predicted the tubulin-binding affinities for the derivatives 5a, 6a-j (ranging from -4.923 to -6.189 kCal/mol). Compound 6f showed highest binding affinity to tubulin (-6.189 kCal/mol). The experimental evaluation of these compounds corroborated with theoretical studies. N-(3-brormobenzyl) noscapine (6f) binds tubulin with highest binding affinity (KD, 38 ± 4.0 µM), which is ~ 4.0 times higher than that of the parent compound, noscapine (KD, 144 ± 1.0 µM) and is also more potent than that of the first generation clinical candidate EM011, 9-bromonoscapine (KD, 54 ± 9.1 µM). All these compounds exhibited substantial cytotoxicity toward cancer cells, with IC50 values ranging from 6.7 µM to 72.9 µM; compound 6f showed prominent anti-cancer efficacy with IC50 values ranging from 6.7 µM to 26.9 µM in cancer cells of different tissues of origin. These compounds perturbed DNA synthesis, delayed the cell cycle progression at G2/M phase, and induced apoptotic cell death in cancer cells. Collectively, the study reported here identified potent, third generation noscapinoids as new anti-cancer agents. PMID:24205049

Computing the binding affinity of a ligand buried deep inside a protein with the hybrid steered molecular dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Villarreal, Oscar D.; Yu, Lili; Department of Laboratory Medicine, Yancheng Vocational Institute of Health Sciences, Yancheng, Jiangsu 224006

Computing the ligand-protein binding affinity (or the Gibbs free energy) with chemical accuracy has long been a challenge for which many methods/approaches have been developed and refined with various successful applications. False positives and, even more harmful, false negatives have been and still are a common occurrence in practical applications. Inevitable in all approaches are the errors in the force field parameters we obtain from quantum mechanical computation and/or empirical fittings for the intra- and inter-molecular interactions. These errors propagate to the final results of the computed binding affinities even if we were able to perfectly implement the statistical mechanicsmore » of all the processes relevant to a given problem. And they are actually amplified to various degrees even in the mature, sophisticated computational approaches. In particular, the free energy perturbation (alchemical) approaches amplify the errors in the force field parameters because they rely on extracting the small differences between similarly large numbers. In this paper, we develop a hybrid steered molecular dynamics (hSMD) approach to the difficult binding problems of a ligand buried deep inside a protein. Sampling the transition along a physical (not alchemical) dissociation path of opening up the binding cavity- -pulling out the ligand- -closing back the cavity, we can avoid the problem of error amplifications by not relying on small differences between similar numbers. We tested this new form of hSMD on retinol inside cellular retinol-binding protein 1 and three cases of a ligand (a benzylacetate, a 2-nitrothiophene, and a benzene) inside a T4 lysozyme L99A/M102Q(H) double mutant. In all cases, we obtained binding free energies in close agreement with the experimentally measured values. This indicates that the force field parameters we employed are accurate and that hSMD (a brute force, unsophisticated approach) is free from the problem of error amplification suffered by many sophisticated approaches in the literature.« less

Universal noise and Efimov physics

NASA Astrophysics Data System (ADS)

Nicholson, Amy N.

2016-03-01

Probability distributions for correlation functions of particles interacting via random-valued fields are discussed as a novel tool for determining the spectrum of a theory. In particular, this method is used to determine the energies of universal N-body clusters tied to Efimov trimers, for even N, by investigating the distribution of a correlation function of two particles at unitarity. Using numerical evidence that this distribution is log-normal, an analytical prediction for the N-dependence of the N-body binding energies is made.

Properties of 83mKr conversion electrons and their use in the KATRIN experiment

NASA Astrophysics Data System (ADS)

Vénos, D.; Sentkerestiová, J.; Dragoun, O.; Slezák, M.; Ryšavý, M.; Špalek, A.

2018-02-01

The gaseous 83mKr will be used as a source of monoenergetic conversion electrons for systematic studies and calibration of the energy scale in the KArlsruhe TRItium Neutrino experiment (KATRIN). Using all existing experimental data the adopted values of the electron binding energies for free krypton were established and the basic conversion electron properties in 83mKr decay were compiled. Modes of the measurements with gaseous 83mKr were suggested for KATRIN.

ISICS2011, an updated version of ISICS: A program for calculation K-, L-, and M-shell cross sections from PWBA and ECPSSR theories using a personal computer

NASA Astrophysics Data System (ADS)

Cipolla, Sam J.

2011-11-01

In this new version of ISICS, called ISICS2011, a few omissions and incorrect entries in the built-in file of electron binding energies have been corrected; operational situations leading to un-physical behavior have been identified and flagged. New version program summaryProgram title: ISICS2011 Catalogue identifier: ADDS_v5_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADDS_v5_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 6011 No. of bytes in distributed program, including test data, etc.: 130 587 Distribution format: tar.gz Programming language: C Computer: 80486 or higher-level PCs Operating system: WINDOWS XP and all earlier operating systems Classification: 16.7 Catalogue identifier of previous version: ADDS_v4_0 Journal reference of previous version: Comput. Phys. Commun. 180 (2009) 1716. Does the new version supersede the previous version?: Yes Nature of problem: Ionization and X-ray production cross section calculations for ion-atom collisions. Solution method: Numerical integration of form factor using a logarithmic transform and Gaussian quadrature, plus exact integration limits. Reasons for new version: General need for higher precision in output format for projectile energies; some built-in binding energies needed correcting; some anomalous results occur due to faulty read-in data or calculated parameters becoming un-physical; erroneous calculations could result for the L and M shells when restricted K-shell options are inadvertently chosen; to achieve general compatibility with ISICSoo, a companion C++ version that is portable to Linux and MacOS platforms, has been submitted for publication in the CPC Program Library approximately at the same time as this present new standalone version of ISICS [1]. Summary of revisions: The format field for projectile energies in the output has been expanded from two to four decimal places in order to distinguish between closely spaced energy values. There were a few entries in the executable binding energy file that needed correcting; K shell of Eu, M shells of Zn, M1 shell of Kr. The corrected values were also entered in the ENERGY.DAT file. In addition, an alternate data file of binding energies is included, called ENERGY_GW.DAT, which is more up-to-date [2]. Likewise, an alternate atomic parameters data file is now included, called FLOURE_JC.DAT, which is more up-to-date [3] fluorescence yields for the K and L shells and Coster-Kronig parameters for the L shell. Both data files can be read in using the -f usage option. To do this, the original energy file should be renamed and saved (e.g., ENERGY_BB.DAT) and the new file (ENERGY_GW.DAT ) should be duplicated as ENERGY.DAT to be read in using the -f option. Similarly for reading in an alternate FLOURE.DAT file. As with previous versions, the user can also simply input different values of any input quantity by invoking the "specify your own parameters" option from the main menu. You can also use this option to simply check the values of the built-in values of the parameters. If it still happens that a zero binding energy for a particular sub-shell is read in, the program will not completely abort, but will calculate results for the other sub-shells while setting the affected sub-shell output to zero. In calculating the Coulomb deflection factor, if the quantity inside the radical sign of the parameter z z=√{(1} becomes zero or negative, to prevent the program from aborting, the PWBA cross sections are still calculated while the ECPSSR cross sections are set to zero. This situation can happen for very low energy collisions, such as were noticed for helium ions on copper at energies of E⩽11.2 keV. It was observed during the engineering of ISICSoo [1] that erroneous calculations could result for the L- and M-shell cases when restricted K-shell R or HSR scaling options were inappropriately chosen. The program has now been fixed so that these inappropriate options are ignored for the L and M shells. In the previous versions, the usage for inputting a batch data file was incorrectly stated in the Users Manual as -Bxxx; the correct designation is -Fxxx, or alternatively, -Ixxx, as indicated on the usage screen in running the program. A revised Users Manual is also available. Restrictions: The consumed CPU time increases with the atomic shell (K, L, M), but execution is still very fast. Running time: This depends on which shell and the number of different energies to be used in the calculation. The running time is not significantly changed from the previous version.

Comparing alchemical and physical pathway methods for computing the absolute binding free energy of charged ligands.

PubMed

Deng, Nanjie; Cui, Di; Zhang, Bin W; Xia, Junchao; Cruz, Jeffrey; Levy, Ronald

2018-06-13

Accurately predicting absolute binding free energies of protein-ligand complexes is important as a fundamental problem in both computational biophysics and pharmaceutical discovery. Calculating binding free energies for charged ligands is generally considered to be challenging because of the strong electrostatic interactions between the ligand and its environment in aqueous solution. In this work, we compare the performance of the potential of mean force (PMF) method and the double decoupling method (DDM) for computing absolute binding free energies for charged ligands. We first clarify an unresolved issue concerning the explicit use of the binding site volume to define the complexed state in DDM together with the use of harmonic restraints. We also provide an alternative derivation for the formula for absolute binding free energy using the PMF approach. We use these formulas to compute the binding free energy of charged ligands at an allosteric site of HIV-1 integrase, which has emerged in recent years as a promising target for developing antiviral therapy. As compared with the experimental results, the absolute binding free energies obtained by using the PMF approach show unsigned errors of 1.5-3.4 kcal mol-1, which are somewhat better than the results from DDM (unsigned errors of 1.6-4.3 kcal mol-1) using the same amount of CPU time. According to the DDM decomposition of the binding free energy, the ligand binding appears to be dominated by nonpolar interactions despite the presence of very large and favorable intermolecular ligand-receptor electrostatic interactions, which are almost completely cancelled out by the equally large free energy cost of desolvation of the charged moiety of the ligands in solution. We discuss the relative strengths of computing absolute binding free energies using the alchemical and physical pathway methods.

Discrete persistent-chain model for protein binding on DNA.

PubMed

Lam, Pui-Man; Zhen, Yi

2011-04-01

We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society

Generalized Jastrow variational method for liquid3He-4He mixtures at T=0 K

NASA Astrophysics Data System (ADS)

Mirabbaszadeh, K.

1989-07-01

The ground state energy of a dilute solution of mass-3 fermions in liquid4He is analyzed by a variational procedure based on the Jastrow many body theory. The antisymmetry of the wave function for fermions is incorporated following the procedure given by Lado, Inguva, and Smith. A set of coupled integrodifferential equations is solved in the hypernetted chain approximation yielding expressions for the binding energy of3He-4He mixtures; the radial distribution function is given together with the total energy for various values of density and the interparticle separation r s.

High Coverages of Hydrogen on a (10,0) Carbon Nanotube

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Arnold, James (Technical Monitor)

2001-01-01

The binding energy of H to a (10,0) carbon nanotube is calculated at 24, 50, and 100% coverage. Several different bonding configurations are considered for the 50% coverage case. Using the ONIOM (our own n-layered integrated molecular orbital and molecular mechanics) approach, the average C-H bond energy for the most stable 50% coverage and for the 100% coverage are 57.3 and 38.6 kcal/mol, respectively. Considering the size of the bond energy of H2, these values suggest that it will be difficult to achieve 100% atomic H coverage on a (10,0) nanotube.

Interaction of monovalent cations with acetonitrile

NASA Astrophysics Data System (ADS)

Černušák, Ivan; Aranyosiová, Monika; Vollárová, Ol'ga; Velič, Dušan; Kirdajová, Ol'ga; Benko, Ján

Solvation of monovalent cations (Me+) of alkali metals=Na+, K+, Rb+, and Cs+, coinage metals=Cu+, Ag+, Au+, and p-block elements Ga+, In+, and Tl+ with acetonitrile was studied by means of ab initio calculations and time-of-flight secondary ion mass spectrometry (TOF-SIMS). The intermolecular interactions in the complexes Me+···CH3CN were investigated using the coupled clusters theory including single, double, and noniterative triple substitutions (CCSD(T)) in conjunction with the Pol and Pol-dk basis sets. The binding energies of these donor-acceptor complexes were estimated; taking into account the basis set superposition error, zero-point vibrations, correlation contribution, and scalar relativistic corrections. The theoretical ΔG0298 K values based on CCSD(T)/Pol and/or CCSD(T)/Pol-dk binding energies correlated well with experimental transfer Gibbs energies (from water to acetonitrile) for the series of cations. In the case of Au monocation, relativistic correction turned out to be extremely important. Composition of the complex of Ag+ and Na+ with acetonitrile was determined by using SIMS supporting both theoretical and experimental transfer Gibbs energies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jain, Richa Naja, E-mail: ltprichanaja@gmail.com; Chakraborty, Brahmananda; Ramaniah, Lavanya M.

The electronic structure and hydrogen storage capability of Yttrium-doped BNNTs has been theoretically investigated using first principles density functional theory (DFT). Yttrium atom prefers the hollow site in the center of the hexagonal ring with a binding energy of 0.8048eV. Decorating by Y makes the system half-metallic and magnetic with a magnetic moment of 1.0µ{sub B}. Y decorated Boron-Nitride (8,0) nanotube can adsorb up to five hydrogen molecules whose average binding energy is computed as 0.5044eV. All the hydrogen molecules are adsorbed with an average desorption temperature of 644.708 K. Taking that the Y atoms can be placed only in alternatemore » hexagons, the implied wt% comes out to be 5.31%, a relatively acceptable value for hydrogen storage materials. Thus, this system can serve as potential hydrogen storage medium.« less

Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

Prediction of core level binding energies in density functional theory: Rigorous definition of initial and final state contributions and implications on the physical meaning of Kohn-Sham energies.

PubMed

Pueyo Bellafont, Noèlia; Bagus, Paul S; Illas, Francesc

2015-06-07

A systematic study of the N(1s) core level binding energies (BE's) in a broad series of molecules is presented employing Hartree-Fock (HF) and the B3LYP, PBE0, and LC-BPBE density functional theory (DFT) based methods with a near HF basis set. The results show that all these methods give reasonably accurate BE's with B3LYP being slightly better than HF but with both PBE0 and LCBPBE being poorer than HF. A rigorous and general decomposition of core level binding energy values into initial and final state contributions to the BE's is proposed that can be used within either HF or DFT methods. The results show that Koopmans' theorem does not hold for the Kohn-Sham eigenvalues. Consequently, Kohn-Sham orbital energies of core orbitals do not provide estimates of the initial state contribution to core level BE's; hence, they cannot be used to decompose initial and final state contributions to BE's. However, when the initial state contribution to DFT BE's is properly defined, the decompositions of initial and final state contributions given by DFT, with several different functionals, are very similar to those obtained with HF. Furthermore, it is shown that the differences of Kohn-Sham orbital energies taken with respect to a common reference do follow the trend of the properly calculated initial state contributions. These conclusions are especially important for condensed phase systems where our results validate the use of band structure calculations to determine initial state contributions to BE shifts.

Binding of naringin and naringenin with hen egg white lysozyme: A spectroscopic investigation and molecular docking study

NASA Astrophysics Data System (ADS)

Das, Sourav; Ghosh, Pooja; Koley, Sudipta; Singha Roy, Atanu

2018-03-01

The interactions of naringenin (NG) and naringin (NR) with Hen Egg White Lysozyme (HEWL) in aqueous medium have been investigated using UV-vis spectroscopy, steady-state fluorescence, circular dichroism (CD), Fourier Transform infrared spectroscopy (FT-IR) and molecular docking analyses. Both NG and NR can quench the intrinsic fluorescence of HEWL via static quenching mechanism. At 300 K, the value of binding constant (Kb) of HEWL-NG complex (5.596 ± 0.063 × 104 M- 1) was found to be greater than that of HEWL-NR complex (3.404 ± 0.407 × 104 M- 1). The negative ΔG° values in cases of both the complexes specify the spontaneous binding. The binding distance between the donor (HEWL) and acceptor (NG/NR) was estimated using the Försters theory and the possibility of non-radiative energy transfer from HEWL to NG/NR was observed. The presence of metal ions (Ca2 +, Cu2 + and Fe2 +) decreased the binding affinity of NG/NR towards HEWL. Synchronous fluorescence studies indicate the change in Trp micro-environment due to the incorporation of NG/NR into HEWL. CD and FT-IR studies indicated that the α-helicity of the HEWL was slightly enhanced due to ligand binding. NG and NR inhibited the enzymatic activity of HEWL and exhibited their affinity for the active site of HEWL. Molecular docking studies revealed that both NG and NR bind in the close vicinity of Trp 62 and Trp 63 residues which is vital for the catalytic activity.

The Strength of Hydrogen Bonds between Fluoro-Organics and Alcohols, a Theoretical Study.

PubMed

Rosenberg, Robert E

2018-05-10

Fluorinated organic compounds are ubiquitous in the pharmaceutical and agricultural industries. To better discern the mode of action of these compounds, it is critical to understand the strengths of hydrogen bonds involving fluorine. There are only a few published examples of the strengths of these bonds. This study provides a high level ab initio study of inter- and intramolecular hydrogen bonds between RF and R'OH, where R and R' are aryl, vinyl, alkyl, and cycloalkyl. Intermolecular binding energies average near 5 kcal/mol, while intramolecular binding energies average about 3 kcal/mol. Inclusion of zero-point energies and applying a counterpoise correction lessen the difference. In both series, modest increases in binding energies are seen with increased acidity of R'OH and increased electron donation of R in RF. In the intramolecular compounds, binding energy increases with the rigidity of the F-(C) n -OH ring. Inclusion of free energy corrections at 298 K results in exoergic binding energies for the intramolecular compounds and endoergic binding energies for the intermolecular compounds. Parameters such as bond lengths, vibrational frequencies, and atomic populations are consistent with formation of a hydrogen bond and with slightly stronger binding in the intermolecular cases over the intramolecular cases. However, these parameters correlated poorly with binding energies.

A thermodynamic approach to link self-organization, preferential flow and rainfall-runoff behaviour

NASA Astrophysics Data System (ADS)

Zehe, E.; Ehret, U.; Blume, T.; Kleidon, A.; Scherer, U.; Westhoff, M.

2013-11-01

This study investigates whether a thermodynamically optimal hillslope structure can, if existent, serve as a first guess for uncalibrated predictions of rainfall-runoff. To this end we propose a thermodynamic framework to link rainfall-runoff processes and dynamics of potential energy, kinetic energy and capillary binding energy in catchments and hillslopes. The starting point is that hydraulic equilibrium in soil corresponds to local thermodynamic equilibrium (LTE), characterized by a local maximum entropy/minimum of free energy of soil water. Deviations from LTE occur either due to evaporative losses, which increase absolute values of negative capillary binding energy of soil water and reduce its potential energy, or due to infiltration of rainfall, which increases potential energy of soil water and reduces the strength of capillary binding energy. The amplitude and relaxation time of these deviations depend on climate, vegetation, soil hydraulic functions, topography and density of macropores. Based on this framework we analysed the free energy balance of hillslopes within numerical experiments that perturbed model structures with respect to the surface density of macropores. These model structures have been previously shown to allow successful long-term simulations of the water balances of the Weiherbach and the Malalcahuello catchments, which are located in distinctly different pedological and climatic settings. Our findings offer a new perspective on different functions of preferential flow paths depending on the pedological setting. Free energy dynamics of soil water in the cohesive soils of the Weiherbach is dominated by dynamics of capillary binding energy. Macropores act as dissipative wetting structures by enlarging water flows against steep gradients in soil water potential after long dry spells. This implies accelerated depletion of these gradients and faster relaxation back towards LTE. We found two local optima in macropore density that maximize reduction rates of free energy of soil water during rainfall-driven conditions. These two optima exist because reduction rates of free energy are, in this case, a second-order polynomial of the wetting rate, which implicitly depends on macroporosity. An uncalibrated long-term simulation of the water balance of the Weiherbach catchment based on the first optimum macroporosity performed almost as well as the best fit when macroporosity was calibrated to match rainfall-runoff. In the Malalcahuello catchment we did not find an apparent optimum density of macropores, because free energy dynamics of soil water during rainfall-driven conditions is dominated by increases of potential energy. Macropores act as dissipative drainage structures by enhancing export of potential energy. No optimum macropore density exists in this case because potential energy change rates scale linearly with the wetting rate. We found, however, a distinguished macroporosity that assures steady-state conditions of the potential energy balance of the soil, in the sense that average storage of potential energy is compensated by average potential energy export. This distinguished macroporosity was close to the value that yielded the best fit of rainfall-runoff behaviour during a calibration exercise and allowed a robust estimate of the annual runoff coefficient. Our findings are promising for predictions in ungauged catchments (PUB) as the optimal/distinguished model structures can serve as a first guess for uncalibrated predictions of rainfall-runoff. They also offer an alternative for classifying catchments according to their similarity of the free energy balance components.

Identification of Novel Compounds against an R294K Substitution of Influenza A (H7N9) Virus Using Ensemble Based Drug Virtual Screening

PubMed Central

Tran, Nhut; Van, Thanh; Nguyen, Hieu; Le, Ly

2015-01-01

Influenza virus H7N9 foremost emerged in China in 2013 and killed hundreds of people in Asia since they possessed all mutations that enable them to resist to all existing influenza drugs, resulting in high mortality to human. In the effort to identify novel inhibitors combat resistant strains of influenza virus H7N9; we performed virtual screening targeting the Neuraminidase (NA) protein against natural compounds of traditional Chinese medicine database (TCM) and ZINC natural products. Compounds expressed high binding affinity to the target protein was then evaluated for molecular properties to determine drug-like molecules. 4 compounds showed their binding energy less than -11Kcal/mol were selected for molecular dynamics (MD) simulation to capture intermolecular interactions of ligand-protein complexes. The molecular mechanics/Poisson-Boltzmann surface area (MM/PBSA) method was utilized to estimate binding free energy of the complex. In term of stability, NA-7181 (IUPAC namely {9-Hydroxy-10-[3-(trifluoromrthyl) cyclohexyl]-4.8-diazatricyclo [6.4.0.02,6]dodec-4-yl}(perhydro-1H-inden-5-yl)formaldehyde) achieved stable conformation after 20ns and 27ns for ligand and protein root mean square deviation, respectively. In term of binding free energy, 7181 gave the negative value of -30.031 (KJ/mol) indicating the compound obtained a favourable state in the active site of the protein. PMID:25589893

[Energetics of complex formation of the DNA hairpin structure d(GCGAAGC) with aromatic ligands].

PubMed

Kostiukov, V V

2011-01-01

The energy contributions of various physical interactions to the total Gibbs energy of complex formation of the biologically important DNA hairpin d(GCGAAGC) with aromatic antitumor antibiotics daunomycin and novantron and the mutagens ethidium and proflavine have been calculated. It has been shown that the relatively small value of the total energy of binding of the ligands to the hairpin is the sum of components great in absolute value and different in sign. The contributions of van der Waals interactions and both intra- and intermolecular hydrogen bonds and bonds with aqueous environment have been studied. According to the calculations, the hydrophobic and van der Waals components are energetically favorable in complex formation of the ligands with the DNA pairpin d(GCGAAGC), whereas the electrostatic (with consideration of hydrogen bonds) and entropic components are unfavorable.

Influence of polarization and self-polarization charges on impurity binding energy in spherical quantum dot with parabolic confinement

NASA Astrophysics Data System (ADS)

Sarkar, Supratik; Sarkar, Samrat; Bose, Chayanika

2018-07-01

We present a general formulation of the ground state binding energy of a shallow hydrogenic impurity in spherical quantum dot with parabolic confinement, considering the effects of polarization and self energy. The variational approach within the effective mass approximation is employed here. The binding energy of an on-center impurity is computed for a GaAs/AlxGa1-xAs quantum dot as a function of the dot size with the dot barrier as parameter. The influence of polarization and self energy are also treated separately. Results indicate that the binding energy increases due to the presence of polarization charge, while decreases due to the self energy of the carrier. An overall enhancement in impurity binding energy, especially for small dots is noted.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. H.

1981-01-01

Scaling relations which map metallic adhesive binding energy onto a single universal binding energy curve are discussed in relation to adhesion, friction, and wear in metals. The scaling involved normalizing the energy to the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. The universal curve was found to be accurately represented by E*(A*)= -(1+beta A) exp (-Beta A*) where E* is the normalized binding energy, A* is the normalized separation, and beta is the normalized decay constant. The calculated cohesive energies of potassium, barium, copper, molybdenum, and samarium were also found to scale by similar relations, suggesting that the universal relation may be more general than for the simple free electron metals.

Prediction of Water Binding to Protein Hydration Sites with a Discrete, Semiexplicit Solvent Model.

PubMed

Setny, Piotr

2015-12-08

Buried water molecules are ubiquitous in protein structures and are found at the interface of most protein-ligand complexes. Determining their distribution and thermodynamic effect is a challenging yet important task, of great of practical value for the modeling of biomolecular structures and their interactions. In this study, we present a novel method aimed at the prediction of buried water molecules in protein structures and estimation of their binding free energies. It is based on a semiexplicit, discrete solvation model, which we previously introduced in the context of small molecule hydration. The method is applicable to all macromolecular structures described by a standard all-atom force field, and predicts complete solvent distribution within a single run with modest computational cost. We demonstrate that it indicates positions of buried hydration sites, including those filled by more than one water molecule, and accurately differentiates them from sterically accessible to water but void regions. The obtained estimates of water binding free energies are in fair agreement with reference results determined with the double decoupling method.

A computational study of the open and closed forms of the N-lobe human serum transferrin apoprotein.

PubMed

Rinaldo, David; Field, Martin J

2003-12-01

Human serum transferrin tightly binds ferric ions in the blood stream but is able to release them in cells by a process involving receptor-mediated endocytosis and decrease in pH. Iron binding and release are accompanied by a large conformation change. In this study, we investigate theoretically the open and closed forms of the N-lobe human serum transferrin apoprotein by performing pKa calculations and molecular dynamics and free-energy simulations. In agreement with the hypothesis based on the x-ray crystal structures, our calculations show that there is a shift in the pKa values of the lysines forming the dilysine trigger when the conformation changes. We argue, however, that simple electrostatic repulsion between the lysines is not sufficient to trigger domain opening and, instead, propose an alternative explanation for the dilysine-trigger effect. Analysis of the molecular dynamics and free-energy results indicate that the open form is more mobile than the closed form and is much more stable at pH 5.3, in large part due to entropic effects. Despite a lower free energy, the dynamics simulation of the open form shows that it is flexible enough to sample conformations that are consistent with iron binding.

Comprehensive and Automated Linear Interaction Energy Based Binding-Affinity Prediction for Multifarious Cytochrome P450 Aromatase Inhibitors

PubMed Central

2017-01-01

Cytochrome P450 aromatase (CYP19A1) plays a key role in the development of estrogen dependent breast cancer, and aromatase inhibitors have been at the front line of treatment for the past three decades. The development of potent, selective and safer inhibitors is ongoing with in silico screening methods playing a more prominent role in the search for promising lead compounds in bioactivity-relevant chemical space. Here we present a set of comprehensive binding affinity prediction models for CYP19A1 using our automated Linear Interaction Energy (LIE) based workflow on a set of 132 putative and structurally diverse aromatase inhibitors obtained from a typical industrial screening study. We extended the workflow with machine learning methods to automatically cluster training and test compounds in order to maximize the number of explained compounds in one or more predictive LIE models. The method uses protein–ligand interaction profiles obtained from Molecular Dynamics (MD) trajectories to help model search and define the applicability domain of the resolved models. Our method was successful in accounting for 86% of the data set in 3 robust models that show high correlation between calculated and observed values for ligand-binding free energies (RMSE < 2.5 kJ mol–1), with good cross-validation statistics. PMID:28776988

Probing the mechanism of interaction of metoprolol succinate with human serum albumin by spectroscopic and molecular docking analysis.

PubMed

Pawar, Suma K; Jaldappagari, Seetharamappa

2017-09-01

In the present work, the mechanism of the interaction between a β1 receptor blocker, metoprolol succinate (MS) and human serum albumin (HSA) under physiological conditions was investigated by spectroscopic techniques, namely fluorescence, Fourier transform infra-red spectroscopy (FT-IR), fluorescence lifetime decay and circular dichroism (CD) as well as molecular docking and cyclic voltammetric methods. The fluorescence and lifetime decay results indicated that MS quenched the intrinsic intensity of HSA through a static quenching mechanism. The Stern-Volmer quenching constants and binding constants for the MS-HSA system at 293, 298 and 303 K were obtained from the Stern-Volmer plot. Thermodynamic parameters for the interaction of MS with HSA were evaluated; negative values of entropy change (ΔG°) indicated the spontaneity of the MS and HSA interaction. Thermodynamic parameters such as negative ΔH° and positive ΔS° values revealed that hydrogen bonding and hydrophobic forces played a major role in MS-HSA interaction and stabilized the complex. The binding site for MS in HSA was identified by competitive site probe experiments and molecular docking studies. These results indicated that MS was bound to HSA at Sudlow's site I. The efficiency of energy transfer and the distance between the donor (HSA) and acceptor (MS) was calculated based on the theory of Fosters' resonance energy transfer (FRET). Three-dimensional fluorescence spectra and CD results revealed that the binding of MS to HSA resulted in an obvious change in the conformation of HSA. Cyclic voltammograms of the MS-HSA system also confirmed the interaction between MS and HSA. Furthermore, the effects of metal ions on the binding of MS to HSA were also studied. Copyright © 2017 John Wiley & Sons, Ltd.

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

PubMed

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Accelerated Adaptive Integration Method

PubMed Central

2015-01-01

Conformational changes that occur upon ligand binding may be too slow to observe on the time scales routinely accessible using molecular dynamics simulations. The adaptive integration method (AIM) leverages the notion that when a ligand is either fully coupled or decoupled, according to λ, barrier heights may change, making some conformational transitions more accessible at certain λ values. AIM adaptively changes the value of λ in a single simulation so that conformations sampled at one value of λ seed the conformational space sampled at another λ value. Adapting the value of λ throughout a simulation, however, does not resolve issues in sampling when barriers remain high regardless of the λ value. In this work, we introduce a new method, called Accelerated AIM (AcclAIM), in which the potential energy function is flattened at intermediate values of λ, promoting the exploration of conformational space as the ligand is decoupled from its receptor. We show, with both a simple model system (Bromocyclohexane) and the more complex biomolecule Thrombin, that AcclAIM is a promising approach to overcome high barriers in the calculation of free energies, without the need for any statistical reweighting or additional processors. PMID:24780083

Pnicogen bonded complexes of PO2X (X = F, Cl) with nitrogen bases.

PubMed

Alkorta, Ibon; Elguero, José; Del Bene, Janet E

2013-10-10

An ab initio MP2/aug'-cc-pVTZ study has been carried out on complexes formed between PO2X (X = F and Cl) as the Lewis acids and a series of nitrogen bases ZN, including NH3, H2C═NH, NH2F, NP, NCH, NCF, NF3, and N2. Binding energies of these complexes vary from -10 to -150 kJ/mol, and P-N distances from 1.88 to 2.72 Å. Complexes ZN:PO2F have stronger P(...)N bonds and shorter P-N distances than the corresponding complexes ZN:PO2Cl. Charge transfer from the N lone pair through the π-hole to the P-X and P-O σ* orbitals leads to stabilization of these complexes, although charge-transfer energies can be evaluated only for complexes with binding energies less than -71 kJ/mol. Complexation of PO2X with the strongest bases leads to P···N bonds with a significant degree of covalency, and P-N distances that approach the P-N distances in the molecules PO2NC and PO2NH2. In these complexes, the PO2X molecules distort from planarity. Changes in (31)P absolute chemical shieldings upon complexation do not correlate with changes in charges on P, although they do correlate with the binding energies of the complexes. EOM-CCSD spin-spin coupling constants (1p)J(P-N) are dominated by the Fermi-contact term, which is an excellent approximation to total J. (1p)J(P-N) values are small at long distances, increase as the distance decreases, but then decrease at short P-N distances. At the shortest distances, values of (1p)J(P-N) approach (1)J(P-N) for the molecules PO2NC and PO2NH2.

On the validity of the basis set superposition error and complete basis set limit extrapolations for the binding energy of the formic acid dimer

NASA Astrophysics Data System (ADS)

Miliordos, Evangelos; Xantheas, Sotiris S.

2015-03-01

We report the variation of the binding energy of the Formic Acid Dimer with the size of the basis set at the Coupled Cluster with iterative Singles, Doubles and perturbatively connected Triple replacements [CCSD(T)] level of theory, estimate the Complete Basis Set (CBS) limit, and examine the validity of the Basis Set Superposition Error (BSSE)-correction for this quantity that was previously challenged by Kalescky, Kraka, and Cremer (KKC) [J. Chem. Phys. 140, 084315 (2014)]. Our results indicate that the BSSE correction, including terms that account for the substantial geometry change of the monomers due to the formation of two strong hydrogen bonds in the dimer, is indeed valid for obtaining accurate estimates for the binding energy of this system as it exhibits the expected decrease with increasing basis set size. We attribute the discrepancy between our current results and those of KKC to their use of a valence basis set in conjunction with the correlation of all electrons (i.e., including the 1s of C and O). We further show that the use of a core-valence set in conjunction with all electron correlation converges faster to the CBS limit as the BSSE correction is less than half than the valence electron/valence basis set case. The uncorrected and BSSE-corrected binding energies were found to produce the same (within 0.1 kcal/mol) CBS limits. We obtain CCSD(T)/CBS best estimates for De = - 16.1 ± 0.1 kcal/mol and for D0 = - 14.3 ± 0.1 kcal/mol, the later in excellent agreement with the experimental value of -14.22 ± 0.12 kcal/mol.

Binding free energy calculations between bovine β-lactoglobulin and four fatty acids using the MMGBSA method.

PubMed

Bello, Martiniano

2014-10-01

The bovine dairy protein β-lactoglobulin (βlg) is a promiscuous protein that has the ability to bind several hydrophobic ligands. In this study, based on known experimental data, the dynamic interaction mechanism between bovine βlg and four fatty acids was investigated by a protocol combining molecular dynamics (MD) simulations and molecular mechanics generalized Born surface area (MMGBSA) binding free energy calculations. Energetic analyses revealed binding free energy trends that corroborated known experimental findings; larger ligand size corresponded to greater binding affinity. Finally, binding free energy decomposition provided detailed information about the key residues stabilizing the complex. © 2014 Wiley Periodicals, Inc.

Biophysical and physicochemical methods differentiate highly ligand-efficient human D-amino acid oxidase inhibitors.

PubMed

Lange, Jos H M; Venhorst, Jennifer; van Dongen, Maria J P; Frankena, Jurjen; Bassissi, Firas; de Bruin, Natasja M W J; den Besten, Cathaline; de Beer, Stephanie B A; Oostenbrink, Chris; Markova, Natalia; Kruse, Chris G

2011-10-01

Many early drug research efforts are too reductionist thereby not delivering key parameters such as kinetics and thermodynamics of target-ligand binding. A set of human D-Amino Acid Oxidase (DAAO) inhibitors 1-6 was applied to demonstrate the impact of key biophysical techniques and physicochemical methods in the differentiation of chemical entities that cannot be adequately distinguished on the basis of their normalized potency (ligand efficiency) values. The resulting biophysical and physicochemical data were related to relevant pharmacodynamic and pharmacokinetic properties. Surface Plasmon Resonance data indicated prolonged target-ligand residence times for 5 and 6 as compared to 1-4, based on the observed k(off) values. The Isothermal Titration Calorimetry-derived thermodynamic binding profiles of 1-6 to the DAAO enzyme revealed favorable contributions of both ΔH and ΔS to their ΔG values. Surprisingly, the thermodynamic binding profile of 3 elicited a substantially higher favorable contribution of ΔH to ΔG in comparison with the structurally closely related fused bicyclic acid 4. Molecular dynamics simulations and free energy calculations of 1, 3, and 4 led to novel insights into the thermodynamic properties of the binding process at an atomic level and in the different thermodynamic signatures of 3 and 4. The presented holistic approach is anticipated to facilitate the identification of compounds with best-in-class properties at an early research stage. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

A Prediction Method of Binding Free Energy of Protein and Ligand

NASA Astrophysics Data System (ADS)

Yang, Kun; Wang, Xicheng

2010-05-01

Predicting the binding free energy is an important problem in bimolecular simulation. Such prediction would be great benefit in understanding protein functions, and may be useful for computational prediction of ligand binding strengths, e.g., in discovering pharmaceutical drugs. Free energy perturbation (FEP)/thermodynamics integration (TI) is a classical method to explicitly predict free energy. However, this method need plenty of time to collect datum, and that attempts to deal with some simple systems and small changes of molecular structures. Another one for estimating ligand binding affinities is linear interaction energy (LIE) method. This method employs averages of interaction potential energy terms from molecular dynamics simulations or other thermal conformational sampling techniques. Incorporation of systematic deviations from electrostatic linear response, derived from free energy perturbation studies, into the absolute binding free energy expression significantly enhances the accuracy of the approach. However, it also is time-consuming work. In this paper, a new prediction method based on steered molecular dynamics (SMD) with direction optimization is developed to compute binding free energy. Jarzynski's equality is used to derive the PMF or free-energy. The results for two numerical examples are presented, showing that the method has good accuracy and efficiency. The novel method can also simulate whole binding proceeding and give some important structural information about development of new drugs.

What Is the Structure of the Naphthalene-Benzene Heterodimer Radical Cation? Binding Energy, Charge Delocalization, and Unexpected Charge-Transfer Interaction in Stacked Dimer and Trimer Radical Cations.

PubMed

Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin

2015-04-02

The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.

Study on the interaction of the toxic food additive carmoisine with serum albumins: a microcalorimetric investigation.

PubMed

Basu, Anirban; Kumar, Gopinatha Suresh

2014-05-30

The interaction of the synthetic azo dye and food colorant carmoisine with human and bovine serum albumins was studied by microcalorimetric techniques. A complete thermodynamic profile of the interaction was obtained from isothermal titration calorimetry studies. The equilibrium constant of the complexation process was of the order of 10(6)M(-1) and the binding stoichiometry was found to be 1:1 with both the serum albumins. The binding was driven by negative standard molar enthalpy and positive standard molar entropy contributions. The binding affinity was lower at higher salt concentrations in both cases but the same was dominated by mostly non-electrostatic forces at all salt concentrations. The polyelectrolytic forces contributed only 5-8% of the total standard molar Gibbs energy change. The standard molar enthalpy change enhanced whereas the standard molar entropic contribution decreased with rise in temperature but they compensated each other to keep the standard molar Gibbs energy change almost invariant. The negative standard molar heat capacity values suggested the involvement of a significant hydrophobic contribution in the complexation process. Besides, enthalpy-entropy compensation phenomenon was also observed in both the systems. The thermal stability of the serum proteins was found to be remarkably enhanced on binding to carmoisine. Copyright © 2014 Elsevier B.V. All rights reserved.

Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

NASA Astrophysics Data System (ADS)

Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

2017-10-01

A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

A study of planar anchor groups for graphene-based single-molecule electronics.

PubMed

Bailey, Steven; Visontai, David; Lambert, Colin J; Bryce, Martin R; Frampton, Harry; Chappell, David

2014-02-07

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

A study of planar anchor groups for graphene-based single-molecule electronics

NASA Astrophysics Data System (ADS)

Bailey, Steven; Visontai, David; Lambert, Colin J.; Bryce, Martin R.; Frampton, Harry; Chappell, David

2014-02-01

To identify families of stable planar anchor groups for use in single molecule electronics, we report detailed results for the binding energies of two families of anthracene and pyrene derivatives adsorbed onto graphene. We find that all the selected derivatives functionalized with either electron donating or electron accepting substituents bind more strongly to graphene than the parent non-functionalized anthracene or pyrene. The binding energy is sensitive to the detailed atomic alignment of substituent groups over the graphene substrate leading to larger than expected binding energies for -OH and -CN derivatives. Furthermore, the ordering of the binding energies within the anthracene and pyrene series does not simply follow the electron affinities of the substituents. Energy barriers to rotation or displacement on the graphene surface are much lower than binding energies for adsorption and therefore at room temperature, although the molecules are bound to the graphene, they are almost free to move along the graphene surface. Binding energies can be increased by incorporating electrically inert side chains and are sensitive to the conformation of such chains.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miliordos, Evangelos; Aprà, Edoardo; Xantheas, Sotiris S.

We establish a new estimate for the binding energy between two benzene molecules in the parallel-displaced (PD) conformation by systematically converging (i) the intra- and intermolecular geometry at the minimum, (ii) the expansion of the orbital basis set, and (iii) the level of electron correlation. The calculations were performed at the second-order Møller–Plesset perturbation (MP2) and the coupled cluster including singles, doubles, and a perturbative estimate of triples replacement [CCSD(T)] levels of electronic structure theory. At both levels of theory, by including results corrected for basis set superposition error (BSSE), we have estimated the complete basis set (CBS) limit bymore » employing the family of Dunning’s correlation-consistent polarized valence basis sets. The largest MP2 calculation was performed with the cc-pV6Z basis set (2772 basis functions), whereas the largest CCSD(T) calculation was with the cc-pV5Z basis set (1752 basis functions). The cluster geometries were optimized with basis sets up to quadruple-ζ quality, observing that both its intra- and intermolecular parts have practically converged with the triple-ζ quality sets. The use of converged geometries was found to play an important role for obtaining accurate estimates for the CBS limits. Our results demonstrate that the binding energies with the families of the plain (cc-pVnZ) and augmented (aug-cc-pVnZ) sets converge [within <0.01 kcal/mol for MP2 and <0.15 kcal/mol for CCSD(T)] to the same CBS limit. In addition, the average of the uncorrected and BSSE-corrected binding energies was found to converge to the same CBS limit much faster than either of the two constituents (uncorrected or BSSE-corrected binding energies). Due to the fact that the family of augmented basis sets (especially for the larger sets) causes serious linear dependency problems, the plain basis sets (for which no linear dependencies were found) are deemed as a more efficient and straightforward path for obtaining an accurate CBS limit. We considered extrapolations of the uncorrected (ΔE) and BSSE-corrected (ΔE cp) binding energies, their average value (ΔE ave), as well as the average of the latter over the plain and augmented sets (Δ~E ave) with the cardinal number of the basis set n. Our best estimate of the CCSD(T)/CBS limit for the π–π binding energy in the PD benzene dimer is D e = -2.65 ± 0.02 kcal/mol. The best CCSD(T)/cc-pV5Z calculated value is -2.62 kcal/mol, just 0.03 kcal/mol away from the CBS limit. For comparison, the MP2/CBS limit estimate is -5.00 ± 0.01 kcal/mol, demonstrating a 90% overbinding with respect to CCSD(T). Finally, the spin-component-scaled (SCS) MP2 variant was found to closely reproduce the CCSD(T) results for each basis set, while scaled opposite spin (SOS) MP2 yielded results that are too low when compared to CCSD(T).« less

Hardware device to physical structure binding and authentication

DOEpatents

Hamlet, Jason R.; Stein, David J.; Bauer, Todd M.

2013-08-20

Detection and deterrence of device tampering and subversion may be achieved by including a cryptographic fingerprint unit within a hardware device for authenticating a binding of the hardware device and a physical structure. The cryptographic fingerprint unit includes an internal physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generate an internal PUF value. Binding logic is coupled to receive the internal PUF value, as well as an external PUF value associated with the physical structure, and generates a binding PUF value, which represents the binding of the hardware device and the physical structure. The cryptographic fingerprint unit also includes a cryptographic unit that uses the binding PUF value to allow a challenger to authenticate the binding.

Theoretical study of transition-metal ions bound to benzene

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Partridge, Harry; Langhoff, Stephen R.

1992-01-01

Theoretical binding energies are reported for all first-row and selected second-row transition metal ions (M+) bound to benzene. The calculations employ basis sets of at least double-zeta plus polarization quality and account for electron correlation using the modified coupled-pair functional method. While the bending is predominantly electrostatic, the binding energies are significantly increased by electron correlation, because the donation from the metal d orbitals to the benzene pi* orbitals is not well described at the self-consistent-field level. The uncertainties in the computed binding energies are estimated to be about 5 kcal/mol. Although the calculated and experimental binding energies generally agree to within their combined uncertainties, it is likely that the true binding energies lie in the lower portion of the experimental range. This is supported by the very good agreement between the theoretical and recent experimental binding energies for AgC6H6(+).

Spectroscopic and theoretical investigation of oxali-palladium interactions with β-lactoglobulin.

PubMed

Ghalandari, Behafarid; Divsalar, Adeleh; Saboury, Ali Akbar; Haertlé, Thomas; Parivar, Kazem; Bazl, Roya; Eslami-Moghadam, Mahbube; Amanlou, Massoud

2014-01-24

The possibility of using a small cheap dairy protein, β-lactoglobulin (β-LG), as a carrier for oxali-palladium for drug delivery was studied. Their binding in an aqueous solution at two temperatures of 25 and 37°C was investigated using spectroscopic techniques in combination with a molecular docking study. Fluorescence intensity changes showed combined static and dynamic quenching during β-LG oxali-palladium binding, with the static mode being predominant in the quenching mechanism. The binding and thermodynamic parameters were determined by analyzing the results of quenching and those of the van't Hoff equation. According to obtained results the binding constants at two temperatures of 25 and 37°C are 3.3×10(9) M(-1) and 18.4×10(6) M(-1) respectively. Fluorescence resonance energy transfer (FRET) showed that the experimental results and the molecular docking results were coherent. An absence change of β-LG secondary structure was confirmed by the CD results. Molecular docking results agreed fully with the experimental results since the fluorescence studies also revealed the presence of two binding sites with a negative value for the Gibbs free energy of binding of oxali-palladium to β-LG. Furthermore, molecular docking and experimental results suggest that the hydrophobic effect plays a critical role in the formation of the oxali-palladium complex with β-LG. This agreement between molecular docking and experimental results implies that docking studies may be a suitable method for predicting and confirming experimental results, as shown in this study. Hence, the combination of molecular docking and spectroscopy methods is an effective innovative approach for binding studies, particularly for pharmacophores. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular modeling studies of HIV-1 reverse transcriptase nonnucleoside inhibitors: total energy of complexation as a predictor of drug placement and activity.

PubMed Central

Kroeger Smith, M. B.; Rouzer, C. A.; Taneyhill, L. A.; Smith, N. A.; Hughes, S. H.; Boyer, P. L.; Janssen, P. A.; Moereels, H.; Koymans, L.; Arnold, E.

1995-01-01

Computer modeling studies have been carried out on three nonnucleoside inhibitors complexed with human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT), using crystal coordinate data from a subset of the protein surrounding the binding pocket region. Results from the minimizations of solvated complexes of 2-cyclopropyl-4-methyl-5,11-dihydro-5H-dipyrido[3,2-b :2',3'-e][1,4] diazepin-6-one (nevirapine), alpha-anilino-2, 6-dibromophenylacetamide (alpha-APA), and 8-chloro-tetrahydro-imidazo(4,5,1-jk)(1,4)-benzodiazepin-2(1H)-thi one (TIBO) show that all three inhibitors maintain a very similar conformational shape, roughly overlay each other in the binding pocket, and appear to function as pi-electron donors to aromatic side-chain residues surrounding the pocket. However, side-chain residues adapt to each bound inhibitor in a highly specific manner, closing down around the surface of the drug to make tight van der Waals contacts. Consequently, the results from the calculated minimizations reveal that only when the inhibitors are modeled in a site constructed from coordinate data obtained from their particular RT complex can the calculated binding energies be relied upon to predict the correct orientation of the drug in the pocket. In the correct site, these binding energies correlate with EC50 values determined for all three inhibitors in our laboratory. Analysis of the components of the binding energy reveals that, for all three inhibitors, solvation of the drug is endothermic, but solvation of the protein is exothermic, and the sum favors complex formation. In general, the protein is energetically more stable and the drug less stable in their complexes as compared to the reactant conformations. For all three inhibitors, interaction with the protein in the complex is highly favorable. Interactions of the inhibitors with individual residues correlate with crystallographic and site-specific mutational data. pi-Stacking interactions are important in binding and correlate with drug HOMO RHF/6-31G* energies. Modeling results are discussed with respect to the mechanism of complex formation and the design of nonnucleoside inhibitors that will be more effective against mutants of HIV-1 RT that are resistant to the currently available drugs. PMID:8535257

Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy

NASA Astrophysics Data System (ADS)

Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.

2018-02-01

Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.

Simultaneous prediction of binding free energy and specificity for PDZ domain-peptide interactions

NASA Astrophysics Data System (ADS)

Crivelli, Joseph J.; Lemmon, Gordon; Kaufmann, Kristian W.; Meiler, Jens

2013-12-01

Interactions between protein domains and linear peptides underlie many biological processes. Among these interactions, the recognition of C-terminal peptides by PDZ domains is one of the most ubiquitous. In this work, we present a mathematical model for PDZ domain-peptide interactions capable of predicting both affinity and specificity of binding based on X-ray crystal structures and comparative modeling with R osetta. We developed our mathematical model using a large phage display dataset describing binding specificity for a wild type PDZ domain and 91 single mutants, as well as binding affinity data for a wild type PDZ domain binding to 28 different peptides. Structural refinement was carried out through several R osetta protocols, the most accurate of which included flexible peptide docking and several iterations of side chain repacking and backbone minimization. Our findings emphasize the importance of backbone flexibility and the energetic contributions of side chain-side chain hydrogen bonds in accurately predicting interactions. We also determined that predicting PDZ domain-peptide interactions became increasingly challenging as the length of the peptide increased in the N-terminal direction. In the training dataset, predicted binding energies correlated with those derived through calorimetry and specificity switches introduced through single mutations at interface positions were recapitulated. In independent tests, our best performing protocol was capable of predicting dissociation constants well within one order of magnitude of the experimental values and specificity profiles at the level of accuracy of previous studies. To our knowledge, this approach represents the first integrated protocol for predicting both affinity and specificity for PDZ domain-peptide interactions.

Energetics of lectin-carbohydrate binding. A microcalorimetric investigation of concanavalin A-oligomannoside complexation.

PubMed

Williams, B A; Chervenak, M C; Toone, E J

1992-11-15

Despite years of study, a comprehensive picture of the binding of the lectin from Canavalia ensiformis, concanavalin A, to carbohydrates remains elusive. We report here studies on the interaction of concanavalin A with methyl 3,6-di-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside, the minimum carbohydrate epitope that completely fills the oligosaccharide binding site, and the two conceptual disaccharide "halves" of the trisaccharide, methyl 3-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside and methyl 6-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside, using titration microcalorimetry. In all cases the interaction of protein and carbohydrate is enthalpically driven, with an unfavorable entropic contribution. The choice of concentration scales has an important impact on both the magnitude and, in some cases, the sign of the entropic component of the free energy of binding. The thermodynamic data suggest binding of the two disaccharides may take place in distinct sites, as opposed to binding in a single high affinity site. In contrast to carbohydrate-antibody binding, delta Cp values were small and negative, pointing to possible differences in the motifs used by the two groups of proteins to bind carbohydrates. The thermodynamic data are interpreted in terms of solvent reorganization. Cooperativity during lectin-carbohydrate binding was also investigated. Significant cooperativity was observed only for binding of the trisaccharide, and gave a Hill plot coefficient of 1.3 for dimeric protein.

Fractal dimension study of polaron effects in cylindrical GaAs/Al x Ga1- x As core-shell nanowires

NASA Astrophysics Data System (ADS)

Sun, Hui; Li, Hua; Tian, Qiang

2018-04-01

Polaron effects in cylindrical GaAs/Al x Ga1- x As core-shell nanowires are studied by applying the fractal dimension method. In this paper, the polaron properties of GaAs/Al x Ga1- x As core-shell nanowires with different core radii and aluminum concentrations are discussed. The polaron binding energy, polaron mass shift, and fractal dimension parameter are numerically determined as functions of shell width. The calculation results reveal that the binding energy and mass shift of the polaron first increase and then decrease as the shell width increases. A maximum value appears at a certain shell width for different aluminum concentrations and a given core radius. By using the fractal dimension method, polaron problems in cylindrical GaAs/Al x Ga1- x As core-shell nanowires are solved in a simple manner that avoids complex and lengthy calculations.

Emission of dimers from a free surface of heated water

NASA Astrophysics Data System (ADS)

Bochkarev, A. A.; Polyakova, V. I.

2014-09-01

The emission rate of water dimers from a free surface and a wetted solid surface in various cases was calculated by a simplified Monte Carlo method with the use of the binding energy of water molecules. The binding energy of water molecules obtained numerically assuming equilibrium between the free surface of water and vapor in the temperature range of 298-438 K corresponds to the coordination number for liquid water equal to 4.956 and is close to the reference value. The calculation results show that as the water temperature increases, the free surface of water and the wetted solid surface become sources of free water dimers. At a temperature of 438 K, the proportion of dimers in the total flow of water molecules on its surface reaches 1%. It is found that in the film boiling mode, the emission rate of dimers decreases with decreasing saturation vapor. Two mechanisms of the emission are described.

Naringenin and quercetin--potential anti-HCV agents for NS2 protease targets.

PubMed

Lulu, S Sajitha; Thabitha, A; Vino, S; Priya, A Mohana; Rout, Madhusmita

2016-01-01

Nonstructural proteins of hepatitis C virus had drawn much attention for the scientific fraternity in drug discovery due to its important role in the disease. 3D structure of the protein was predicted using molecular modelling protocol. Docking studies of 10 medicinal plant compounds and three drugs available in the market (control) with NS2 protease were employed by using rigid docking approach of AutoDock 4.2. Among the molecules tested for docking study, naringenin and quercetin revealed minimum binding energy of - 7.97 and - 7.95 kcal/mol with NS2 protease. All the ligands were docked deeply within the binding pocket region of the protein. The docking study results showed that these compounds are potential inhibitors of the target; and also all these docked compounds have good inhibition constant, vdW+Hbond+desolv energy with best RMSD value.

Two-Photon Absorption and Two-Photon-Induced Gain in Perovskite Quantum Dots.

PubMed

Nagamine, Gabriel; Rocha, Jaqueline O; Bonato, Luiz G; Nogueira, Ana F; Zaharieva, Zhanet; Watt, Andrew A R; de Brito Cruz, Carlos H; Padilha, Lazaro A

2018-06-21

Perovskite quantum dots (PQDs) emerged as a promising class of material for applications in lighting devices, including light emitting diodes and lasers. In this work, we explore nonlinear absorption properties of PQDs showing the spectral signatures and the size dependence of their two-photon absorption (2PA) cross-section, which can reach values higher than 10 6 GM. The large 2PA cross section allows for low threshold two-photon induced amplified spontaneous emission (ASE), which can be as low as 1.6 mJ/cm 2 . We also show that the ASE properties are strongly dependent on the nanomaterial size, and that the ASE threshold, in terms of the average number of excitons, decreases for smaller PQDs. Investigating the PQDs biexciton binding energy, we observe strong correlation between the increasing on the biexciton binding energy and the decreasing on the ASE threshold, suggesting that ASE in PQDs is a biexciton-assisted process.

Correlating hydrogen oxidation and evolution activity on platinum at different pH with measured hydrogen binding energy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, WC; Zhuang, ZB; Gao, MR

2015-01-08

The hydrogen oxidation/evolution reactions are two of the most fundamental reactions in distributed renewable electrochemical energy conversion and storage systems. The identification of the reaction descriptor is therefore of critical importance for the rational catalyst design and development. Here we report the correlation between hydrogen oxidation/evolution activity and experimentally measured hydrogen binding energy for polycrystalline platinum examined in several buffer solutions in a wide range of electrolyte pH from 0 to 13. The hydrogen oxidation/evolution activity obtained using the rotating disk electrode method is found to decrease with the pH, while the hydrogen binding energy, obtained from cyclic voltammograms, linearlymore » increases with the pH. Correlating the hydrogen oxidation/evolution activity to the hydrogen binding energy renders a monotonic decreasing hydrogen oxidation/evolution activity with the hydrogen binding energy, strongly supporting the hypothesis that hydrogen binding energy is the sole reaction descriptor for the hydrogen oxidation/evolution activity on monometallic platinum.« less

Anisotropic energy flow and allosteric ligand binding in albumin

NASA Astrophysics Data System (ADS)

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin.

PubMed

Li, Guifeng; Magana, Donny; Dyer, R Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

Anisotropic energy flow and allosteric ligand binding in albumin

PubMed Central

Li, Guifeng; Magana, Donny; Dyer, R. Brian

2014-01-01

Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

QSAR analyses of 3-(4-benzylpiperidin-1-yl)-N-phenylpropylamine derivatives as potent CCR5 antagonists.

PubMed

Roy, Kunal; Leonard, J Thomas

2005-01-01

CCR5 receptor binding affinity of a series of 3-(4-benzylpiperidin-1-yl)propylamine congeners was subjected to QSAR study using the linear free energy related (LFER) model of Hansch. Appropriate indicator variables encoding different group contributions and different physicochemical variables such as hydrophobicity (pi), electronic (Hammett sigma), and steric (molar refractivity, STERIMOL values) parameters of phenyl ring substituents of the compounds were used as predictor variables. The Hansch analysis explores the importance of the lipophilicity and electron-donating substituents for the binding affinity. However, this method could not give more insight into the structure-activity relationships because of the diverse molecular features in the data set. 3D-QSAR analyses of the same data set using Molecular Shape Analysis (MSA), Receptor Surface Analysis (RSA), and Molecular Field Analysis (MFA) techniques were also performed. The best model with acceptable statistical quality was derived from the MSA, which showed the importance of the relative negative charge (RNCG): substituents with a high RNCG value have more binding affinity than the unsubstituted piperidine and phenyl (R1 position) congeners. The relative negative charge surface area (RNCS) is detrimental (e.g. R2 = 3,4-Cl2) for the activity. An increase in the length of the molecule in the Z dimension (Lz) is conducive (e.g. R3 = sulfonylmorpholino), while an increase in the area of the molecular shadow in the XZ plane (Sxz) is detrimental (e.g. R1 = N-c-hexylmethyl-5-oxopyrrolidin-3-yl) for the binding affinity. The presence of a chiral center makes the molecule less active (e.g. R1 = N-methyl-5-oxopyrrolidin-3-yl). An increase in the van der Waals area, the molecular volume, and the difference between the volume of the individual molecule and the shape reference compound are conducive (e.g. R3 = (CH3)2NSO2-) for the binding affinity. Substituents with higher JursFPSA_2 values (fractional charged partial surface area) like the N-methylsulfonylpiperidin-4-yl (R1 position) group have better binding affinity than the substituents such as 4-chlorophenylamino (R1 position). Unsubstituted piperidines (R1 position) with less JursFNSA_1 values have lower binding affinity than the 4-chlorophenyl substituted compounds. The MFA derived equation shows interaction energies at different grid points, while the RSA model shows the importance of hydrophobicity and charge at different regions of the molecules. The models were validated through the leave-one-out, leave-15%-out, and leave-25%-out cross-validation techniques. The developed models were also subjected to a randomization test (99% confidence level). Although the MSA derived models had excellent statistical qualities both for the training as well as test sets, RSA and MFA results for the test sets are not comparable statistically with the MSA derived models.

The transition state structure for binding between TAZ1 of CBP and the disordered Hif-1α CAD.

PubMed

Lindström, Ida; Andersson, Eva; Dogan, Jakob

2018-05-18

Intrinsically disordered proteins (IDPs) are common in eukaryotes. However, relatively few experimental studies have addressed the nature of the rate-limiting transition state for the coupled binding and folding reactions involving IDPs. By using site-directed mutagenesis in combination with kinetics measurements we have here characterized the transition state for binding between the globular TAZ1 domain of CREB binding protein and the intrinsically disordered C-terminal activation domain of Hif-1α (Hif-1α CAD). A total of 17 Hif-1α CAD point-mutations were generated and a Φ-value binding analysis was carried out. We found that native hydrophobic binding interactions are not formed at the transition state. We also investigated the effect the biologically important Hif-1α CAD Asn-803 hydroxylation has on the binding kinetics, and found that the whole destabilization effect due the hydroxylation is within the dissociation rate constant. Thus, the rate-limiting transition state is "disordered-like", with native hydrophobic binding contacts being formed cooperatively after the rate-limiting barrier, which is clearly shown by linear free energy relationships. The same behavior was observed in a previously characterized TAZ1/IDP interaction, which may suggest common features for the rate-limiting transition state for TAZ1/IDP interactions.

Mechanistic insight into ligand binding to G-quadruplex DNA

PubMed Central

Di Leva, Francesco Saverio; Novellino, Ettore; Cavalli, Andrea; Parrinello, Michele; Limongelli, Vittorio

2014-01-01

Specific guanine-rich regions in human genome can form higher-order DNA structures called G-quadruplexes, which regulate many relevant biological processes. For instance, the formation of G-quadruplex at telomeres can alter cellular functions, inducing apoptosis. Thus, developing small molecules that are able to bind and stabilize the telomeric G-quadruplexes represents an attractive strategy for antitumor therapy. An example is 3-(benzo[d]thiazol-2-yl)-7-hydroxy-8-((4-(2-hydroxyethyl)piperazin-1-yl)methyl)-2H-chromen-2-one (compound 1), recently identified as potent ligand of the G-quadruplex [d(TGGGGT)]4 with promising in vitro antitumor activity. The experimental observations are suggestive of a complex binding mechanism that, despite efforts, has defied full characterization. Here, we provide through metadynamics simulations a comprehensive understanding of the binding mechanism of 1 to the G-quadruplex [d(TGGGGT)]4. In our calculations, the ligand explores all the available binding sites on the DNA structure and the free-energy landscape of the whole binding process is computed. We have thus disclosed a peculiar hopping binding mechanism whereas 1 is able to bind both to the groove and to the 3’ end of the G-quadruplex. Our results fully explain the available experimental data, rendering our approach of great value for further ligand/DNA studies. PMID:24753420

Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

Binding Energy and Enzymatic Catalysis.

ERIC Educational Resources Information Center

Hansen, David E.; Raines, Ronald T.

1990-01-01

Discussed is the fundamental role that the favorable free energy of binding of the rate-determining transition state plays in catalysis. The principle that all of the catalytic factors discussed are realized by the use of this binding energy is reviewed. (CW)

Determination of the absolute binding free energies of HIV-1 protease inhibitors using non-equilibrium molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ngo, Son Tung; Nguyen, Minh Tung; Nguyen, Minh Tho

2017-05-01

The absolute binding free energy of an inhibitor to HIV-1 Protease (PR) was determined throughout evaluation of the non-bonded interaction energy difference between the two bound and unbound states of the inhibitor and surrounding molecules by the fast pulling of ligand (FPL) process using non-equilibrium molecular dynamics (NEMD) simulations. The calculated free energy difference terms help clarifying the nature of the binding. Theoretical binding affinities are in good correlation with experimental data, with R = 0.89. The paradigm used is able to rank two inhibitors having the maximum difference of ∼1.5 kcal/mol in absolute binding free energies.

Simultaneous effects of pressure and temperature on donor binding energy in Pöschl-Teller quantum well

NASA Astrophysics Data System (ADS)

Hakimyfard, Alireza; Barseghyan, M. G.; Duque, C. A.; Kirakosyan, A. A.

2009-12-01

In the frame of the variational method and the effective-mass approximation, the effects of hydrostatic pressure and temperature on the binding energy for donor impurities in the Pöschl-Teller quantum well are studied. The binding energy dependencies on the width of the quantum well, the hydrostatic pressure, the impurity position, the temperature, and the parameters of the confining potential are reported. The results show that the binding energy increases (decreases) with the increasing of the hydrostatic pressure (temperature). It is also found that, associated with the symmetry breaking in the Pöschl-Teller quantum well, and depending on the impurity position, the binding energy can increase or decrease.

The nuclear size and mass effects on muonic hydrogen-like atoms embedded in Debye plasma

NASA Astrophysics Data System (ADS)

Poszwa, A.; Bahar, M. K.; Soylu, A.

2016-10-01

Effects of finite nuclear size and finite nuclear mass are investigated for muonic atoms and muonic ions embedded in the Debye plasma. Both nuclear charge radii and nuclear masses are taken into account with experimentally determined values. In particular, isotope shifts of bound state energies, radial probability densities, transition energies, and binding energies for several atoms are studied as functions of Debye length. The theoretical model based on semianalytical calculations, the Sturmian expansion method, and the perturbative approach has been constructed, in the nonrelativistic frame. For some limiting cases, the comparison with previous most accurate literature results has been made.

Using physics-based pose predictions and free energy perturbation calculations to predict binding poses and relative binding affinities for FXR ligands in the D3R Grand Challenge 2

NASA Astrophysics Data System (ADS)

Athanasiou, Christina; Vasilakaki, Sofia; Dellis, Dimitris; Cournia, Zoe

2018-01-01

Computer-aided drug design has become an integral part of drug discovery and development in the pharmaceutical and biotechnology industry, and is nowadays extensively used in the lead identification and lead optimization phases. The drug design data resource (D3R) organizes challenges against blinded experimental data to prospectively test computational methodologies as an opportunity for improved methods and algorithms to emerge. We participated in Grand Challenge 2 to predict the crystallographic poses of 36 Farnesoid X Receptor (FXR)-bound ligands and the relative binding affinities for two designated subsets of 18 and 15 FXR-bound ligands. Here, we present our methodology for pose and affinity predictions and its evaluation after the release of the experimental data. For predicting the crystallographic poses, we used docking and physics-based pose prediction methods guided by the binding poses of native ligands. For FXR ligands with known chemotypes in the PDB, we accurately predicted their binding modes, while for those with unknown chemotypes the predictions were more challenging. Our group ranked #1st (based on the median RMSD) out of 46 groups, which submitted complete entries for the binding pose prediction challenge. For the relative binding affinity prediction challenge, we performed free energy perturbation (FEP) calculations coupled with molecular dynamics (MD) simulations. FEP/MD calculations displayed a high success rate in identifying compounds with better or worse binding affinity than the reference (parent) compound. Our studies suggest that when ligands with chemical precedent are available in the literature, binding pose predictions using docking and physics-based methods are reliable; however, predictions are challenging for ligands with completely unknown chemotypes. We also show that FEP/MD calculations hold predictive value and can nowadays be used in a high throughput mode in a lead optimization project provided that crystal structures of sufficiently high quality are available.

Implicit ligand theory for relative binding free energies

NASA Astrophysics Data System (ADS)

Nguyen, Trung Hai; Minh, David D. L.

2018-03-01

Implicit ligand theory enables noncovalent binding free energies to be calculated based on an exponential average of the binding potential of mean force (BPMF)—the binding free energy between a flexible ligand and rigid receptor—over a precomputed ensemble of receptor configurations. In the original formalism, receptor configurations were drawn from or reweighted to the apo ensemble. Here we show that BPMFs averaged over a holo ensemble yield binding free energies relative to the reference ligand that specifies the ensemble. When using receptor snapshots from an alchemical simulation with a single ligand, the new statistical estimator outperforms the original.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Hydration Energies and Structures of Alkaline Earth Metal Ions, M2+ (H2O)n, n = 5–7, M = Mg, Ca, Sr, and Ba

PubMed Central

Rodriguez-Cruz, Sandra E.; Jockusch, Rebecca A.

2005-01-01

The evaporation of water from hydrated alkaline earth metal ions, produced by electrospray ionization, was studied in a Fourier transform mass spectrometer. Zero-pressure-limit dissociation rate constants for loss of a single water molecule from the hydrated divalent metal ions, M2+(H2O)n (M = Mg, Ca, and Sr for n = 5–7, and M = Ba for n = 4–7), are measured as a function of temperature using blackbody infrared radiative dissociation. From these values, zero-pressure-limit Arrhenius parameters are obtained. By modeling the dissociation kinetics using a master equation formalism, threshold dissociation energies (Eo) are determined. These reactions should have a negligible reverse activation barrier; therefore, Eo values should be approximately equal to the binding energy or hydration enthalpy at 0 K. For the hepta- and hexahydrated ions at low temperature, binding energies follow the trend expected on the basis of ionic radii: Mg > Ca > Sr > Ba. For the hexahydrated ions at high temperature, binding energies follow the order Ca > Mg > Sr > Ba. The same order is observed for the pentahydrated ions. Collisional dissociation experiments on the tetrahydrated species result in relative dissociation rates that directly correlate with the size of the metals. These results indicate the presence of two isomers for hexahydrated magnesium ions: a low-temperature isomer in which the six water molecules are located in the first solvation shell, and a high-temperature isomer with the most likely structure corresponding to four water molecules in the inner shell and two water molecules in the second shell. These results also indicate that the pentahydrated magnesium ions have a structure with four water molecules in the first solvation shell and one in the outer shell. The dissociation kinetics for the hexa- and pentahydrated clusters of Ca2+, Sr2+, and Ba2+ are consistent with structures in which all the water molecules are located in the first solvation shell. PMID:16429612

An investigation on the effect of impurity position on the binding energy of quantum box under electric field with pressure and temperature

NASA Astrophysics Data System (ADS)

Yilmaz, S.; Kirak, M.

2018-05-01

In the present study, we have studied theoretically the influences of donor impurity position on the binding energy of a GaAs cubic quantum box structure. The binding energy is calculated as functions of the position of impurity, electric field, temperature and hydrostatic pressure. The variational method is employed to obtain the energy eigenvalues of the structure in the framework of the effective mass approximation. It has been found that the impurity positions with electric field, pressure and temperature have an important effect on the binding energy of structure considered. The results can be used to manufacture semiconductor device application by manipulating the binding energy with the impurity positions, electric field, pressure and temperature.

Hydrology beyond closing the water balance: energy conservative scaling of gradient flux relations

NASA Astrophysics Data System (ADS)

Zehe, Erwin; Loritz, Ralf; Jackisch, Conrad

2017-04-01

The value of physically-based models has been doubted since their idea was introduced by Freeze and Harlan. Physically-based models like typically rely on the Darcy-Richards concept for soil water dynamics, the Penman-Monteith equation for soil-vegetation-atmosphere exchange processes and hydraulic approaches for overland and stream flow. Each of these concepts is subject to limitations arising from our imperfect understanding of the related processes and is afflicted by the restricted transferability of process descriptions from idealized laboratory conditions to heterogeneous natural systems. Particularly the non-linearity of soil water characteristics in concert with the baffling heterogeneity subsurface properties is usually seen as the dead end for a meaningful application of physically based models outside of well observed research catchments and, more importantly, for an upscaling of point scale flux - gradient relation-ships. This study provides evidence that an energy conservative scaling of topographic gradients and soil water retention curves allows derivation of useful effective catchment scale topography and retention curve from distributed data, which allow successful simulations of the catchment water balance in two distinctly different landscapes. The starting point of our approach is that subsurface water fluxes are driven by differences in potential energy and chemical/capillary binding energy. The relief of a single hillslope controls the potential energy gradients driving downslope flows of free water, while catchment scale variability in hillslope relief is associated with differences in driving potential energy. It is more important to note that the soil water retention curve characterises the density of capillary binding energy of soil water (usually named soil water potential) at a given soil water content. Spatially variable soil water characteristics hence reflect fluctuations in capillary binding energy of soil water at a given soil water content among different sites. Essentially we propose that a meaning full effective representation of the driving topographic gradient needs to represent the mean distribution of geo-potential energy in a catchment, which leads us to the hypsometric integral. Similarly, we postulate that effective soil water characteristics should characterise the average relation between soil water content and capillary binding energy of soil water. For a given set of soil water retention curve derived from a set of undisturbed soil samples this can be achieved by grouping the observation points of all soil samples, averaging the soil water content at a given matric potential/binding energy density and fitting a parametric relation. We demonstrate that a single hillslope with the proposed effective topography and soil water retention curve is sufficient to simulate the water balance and runoff formation of two distinctly different catchments in the Attert experimental watershed.

Pairwise additivity of energy components in protein-ligand binding: The HIV II protease-Indinavir case

NASA Astrophysics Data System (ADS)

Ucisik, Melek N.; Dashti, Danial S.; Faver, John C.; Merz, Kenneth M.

2011-08-01

An energy expansion (binding energy decomposition into n-body interaction terms for n ≥ 2) to express the receptor-ligand binding energy for the fragmented HIV II protease-Indinavir system is described to address the role of cooperativity in ligand binding. The outcome of this energy expansion is compared to the total receptor-ligand binding energy at the Hartree-Fock, density functional theory, and semiempirical levels of theory. We find that the sum of the pairwise interaction energies approximates the total binding energy to ˜82% for HF and to >95% for both the M06-L density functional and PM6-DH2 semiempirical method. The contribution of the three-body interactions amounts to 18.7%, 3.8%, and 1.4% for HF, M06-L, and PM6-DH2, respectively. We find that the expansion can be safely truncated after n = 3. That is, the contribution of the interactions involving more than three parties to the total binding energy of Indinavir to the HIV II protease receptor is negligible. Overall, we find that the two-body terms represent a good approximation to the total binding energy of the system, which points to pairwise additivity in the present case. This basic principle of pairwise additivity is utilized in fragment-based drug design approaches and our results support its continued use. The present results can also aid in the validation of non-bonded terms contained within common force fields and in the correction of systematic errors in physics-based score functions.

Electronic and optical properties of exciton, trions and biexciton in II-VI parabolic quantum dot

NASA Astrophysics Data System (ADS)

Sujanah, P.; John Peter, A.; Woo Lee, Chang

2015-08-01

Binding energies of exciton, trions and biexciton and their interband optical transition energies are studied in a CdTe/ZnTe quantum dot nanostructure taking into consideration the geometrical confinement effect. The radial spread of the wavefunctions, binding energies, optical transition energies, oscillator strength, radiative life time and the absorption coefficients of exciton, positively and negatively charged excitons and biexciton are carried out. It is found that the ratio of the radiative life time of exciton with the trions and biexciton enhances with the reduction of geometrical confinement. The results show that (i) the binding energies of exciton, positive and negative trions and the biexciton have strong influence on the reduction of geometrical confinement effect, (ii) the binding energy is found to decrease from the binding energies of exciton to positive trion through biexciton and negative trion binding energies, (iii) the oscillator strength of trions is found to be lesser than exciton and the biexciton and (iv) the electronic and optical properties of exciton, trions and the biexciton are considerably dependent on the spatial confinement, incident photon energy and the radiative life time. The obtained results are in good agreement with the other existing literature.

Calculation of Host-Guest Binding Affinities Using a Quantum-Mechanical Energy Model.

PubMed

Muddana, Hari S; Gilson, Michael K

2012-06-12

The prediction of protein-ligand binding affinities is of central interest in computer-aided drug discovery, but it is still difficult to achieve a high degree of accuracy. Recent studies suggesting that available force fields may be a key source of error motivate the present study, which reports the first mining minima (M2) binding affinity calculations based on a quantum mechanical energy model, rather than an empirical force field. We apply a semi-empirical quantum-mechanical energy function, PM6-DH+, coupled with the COSMO solvation model, to 29 host-guest systems with a wide range of measured binding affinities. After correction for a systematic error, which appears to derive from the treatment of polar solvation, the computed absolute binding affinities agree well with experimental measurements, with a mean error 1.6 kcal/mol and a correlation coefficient of 0.91. These calculations also delineate the contributions of various energy components, including solute energy, configurational entropy, and solvation free energy, to the binding free energies of these host-guest complexes. Comparison with our previous calculations, which used empirical force fields, point to significant differences in both the energetic and entropic components of the binding free energy. The present study demonstrates successful combination of a quantum mechanical Hamiltonian with the M2 affinity method.

Binding interaction of atorvastatin with bovine serum albumin: Spectroscopic methods and molecular docking

NASA Astrophysics Data System (ADS)

Wang, Qi; Huang, Chuan-ren; Jiang, Min; Zhu, Ying-yao; Wang, Jing; Chen, Jun; Shi, Jie-hua

2016-03-01

The interaction of atorvastatin with bovine serum albumin (BSA) was investigated using multi-spectroscopic methods and molecular docking technique for providing important insight into further elucidating the store and transport process of atorvastatin in the body and the mechanism of action and pharmacokinetics. The experimental results revealed that the fluorescence quenching mechanism of BSA induced atorvastatin was a combined dynamic and static quenching. The binding constant and number of binding site of atorvastatin with BSA under simulated physiological conditions (pH = 7.4) were 1.41 × 105 M- 1 and about 1 at 310 K, respectively. The values of the enthalpic change (ΔH0), entropic change (ΔS0) and Gibbs free energy (ΔG0) in the binding process of atorvastatin with BSA at 310 K were negative, suggesting that the binding process of atorvastatin and BSA was spontaneous and the main interaction forces were van der Waals force and hydrogen bonding interaction. Moreover, atorvastatin was bound into the subdomain IIA (site I) of BSA, resulting in a slight change of the conformation of BSA.

Interactions between antimicrobial polynorbornenes and phospholipid vesicles monitored by light scattering and microcalorimetry.

PubMed

Gabriel, Gregory J; Pool, Joanna G; Som, Abhigyan; Dabkowski, Jeffrey M; Coughlin, E Bryan; Muthukumar, M; Tew, Gregory N

2008-11-04

Antimicrobial polynorbornenes composed of facially amphiphilic monomers have been previously reported to accurately emulate the antimicrobial activity of natural host-defense peptides (HDPs). The lethal mechanism of most HDPs involves binding to the membrane surface of bacteria leading to compromised phospholipid bilayers. In this paper, the interactions between biomimetic vesicle membranes and these cationic antimicrobial polynorbornenes are reported. Vesicle dye-leakage experiments were consistent with previous biological assays and corroborated a mode of action involving membrane disruption. Dynamic light scattering (DLS) showed that these antimicrobial polymers cause extensive aggregation of vesicles without complete bilayer disintegration as observed with surfactants that efficiently solubilize the membrane. Fluorescence microscopy on vesicles and bacterial cells also showed polymer-induced aggregation of both synthetic vesicles and bacterial cells. Isothermal titration calorimetry (ITC) afforded free energy of binding values (Delta G) and polymer to lipid binding ratios, plus revealed that the interaction is entropically favorable (Delta S>0, Delta H>0). It was observed that the strength of vesicle binding was similar between the active polymers while the binding stoichiometries were dramatically different.

Estimation of the Binding Free Energy of AC1NX476 to HIV-1 Protease Wild Type and Mutations Using Free Energy Perturbation Method.

PubMed

Ngo, Son Tung; Mai, Binh Khanh; Hiep, Dinh Minh; Li, Mai Suan

2015-10-01

The binding mechanism of AC1NX476 to HIV-1 protease wild type and mutations was studied by the docking and molecular dynamics simulations. The binding free energy was calculated using the double-annihilation binding free energy method. It is shown that the binding affinity of AC1NX476 to wild type is higher than not only ritonavir but also darunavir, making AC1NX476 become attractive candidate for HIV treatment. Our theoretical results are in excellent agreement with the experimental data as the correlation coefficient between calculated and experimentally measured binding free energies R = 0.993. Residues Asp25-A, Asp29-A, Asp30-A, Ile47-A, Gly48-A, and Val50-A from chain A, and Asp25-B from chain B play a crucial role in the ligand binding. The mutations were found to reduce the receptor-ligand interaction by widening the binding cavity, and the binding propensity is mainly driven by the van der Waals interaction. Our finding may be useful for designing potential drugs to combat with HIV. © 2015 John Wiley & Sons A/S.

Discovery of non-peptidic small molecule inhibitors of cyclophilin D as neuroprotective agents in Aβ-induced mitochondrial dysfunction

NASA Astrophysics Data System (ADS)

Park, Insun; Londhe, Ashwini M.; Lim, Ji Woong; Park, Beoung-Geon; Jung, Seo Yun; Lee, Jae Yeol; Lim, Sang Min; No, Kyoung Tai; Lee, Jiyoun; Pae, Ae Nim

2017-10-01

Cyclophilin D (CypD) is a mitochondria-specific cyclophilin that is known to play a pivotal role in the formation of the mitochondrial permeability transition pore (mPTP).The formation and opening of the mPTP disrupt mitochondrial homeostasis, cause mitochondrial dysfunction and eventually lead to cell death. Several recent studies have found that CypD promotes the formation of the mPTP upon binding to β amyloid (Aβ) peptides inside brain mitochondria, suggesting that neuronal CypD has a potential to be a promising therapeutic target for Alzheimer's disease (AD). In this study, we generated an energy-based pharmacophore model by using the crystal structure of CypD—cyclosporine A (CsA) complex and performed virtual screening of ChemDiv database, which yielded forty-five potential hit compounds with novel scaffolds. We further tested those compounds using mitochondrial functional assays in neuronal cells and identified fifteen compounds with excellent protective effects against Aβ-induced mitochondrial dysfunction. To validate whether these effects derived from binding to CypD, we performed surface plasmon resonance (SPR)—based direct binding assays with selected compounds and discovered compound 29 was found to have the equilibrium dissociation constants (KD) value of 88.2 nM. This binding affinity value and biological activity correspond well with our predicted binding mode. We believe that this study offers new insights into the rational design of small molecule CypD inhibitors, and provides a promising lead for future therapeutic development.

Spectroscopic, molecular docking and structural activity studies of (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazide derivatives for DNA binding and their biological screening

NASA Astrophysics Data System (ADS)

Arshad, Nasima; Perveen, Fouzia; Saeed, Aamer; Channar, Pervaiz Ali; Farooqi, Shahid Iqbal; Larik, Fayaz Ali; Ismail, Hammad; Mirza, Bushra

2017-07-01

Acid catalyzed condensation of isoniazid with a number of suitably substituted aromatic and heterocyclic aldehydes was carried out in dry ethanol to afford the title (E)-N‧-(substituted benzylidene/methylene) isonicotinohydrazides (SF 1 - SF 4) in good yields. These compounds were characterized and further investigated for their binding with ds.DNA using UV- spectroscopy and molecular docking and for antitumor and antimicrobial potentials. A good correlation was found among spectroscopic, theoretical and biological results. UV- spectra in the presence of DNA concentrations and their data interpretation in terms binding constant "Kb" and free energy change (ΔG) provided evidences for the significant and spontaneous binding of the compounds with DNA. Molecular docking studies and structural analysis further supported the UV-findings and indicated that the modes of interactions between bromo- (SF 1) and flouro- (SF 4) substituted isonicotinohydrazides is intercalation while methoxy- (SF 2) and hydroxy- (SF 3) substituted isonicotinohydrazides interact with DNA helix via groove binding. SF 1 exhibited comparatively higher Kb value (UV-; 8.07 × 103 M-1, docking; 8.11 × 103 M-1) which inferred that the respective compound muddles to DNA most powerfully. SF 1 has shown the lowest IC50 (345.3 μg/mL) value among all the compounds indicating its comparatively highest activity towards tumor inhibition. None of the compound has shown perceptible antibacterial and antifungal activities.

High level theoretical study of benzene-halide adducts: the importance of C-H-anion hydrogen bonding.

PubMed

Coletti, Cecilia; Re, Nazzareno

2009-02-26

High level ab initio calculations were performed on the interaction of halide anions (F(-), Cl(-), Br(-), and I(-)) to benzene. For these systems recent experimental and theoretical data are rather scarce, in spite of their growingly acknowledged importance for binding in complex biological systems. We have thus explored the complete basis set limit and the effect of counterpoise basis set superposition error corrections on the minimum geometries and energies of benzene-halide adducts in their possible interaction modes. The binding energy and enthalpy values (ranging from -15.3 kcal/mol for fluoride to -6.1 kcal/mol for iodide) show that the hydrogen bonding occurring in these complexes cannot be described as a weak interaction. We have furthermore investigated the topology of the minima and of other selected sections of the potential energy surface, so to gain further insight on the nature of the halide-benzene interaction. In particular, the geometry corresponding to the C(6v) symmetry, although being overall repulsive, has displayed the unprecedented presence of a small flex (a minimum in C(6v) symmetry) with interaction energy close to zero or slightly attractive.

Heavy quarkonia in a potential model: binding energy, decay width, and survival probability

NASA Astrophysics Data System (ADS)

Srivastava, P. K.; Chaturvedi, O. S. K.; Thakur, Lata

2018-06-01

Recently a lot of progress has been made in deriving the heavy quark potential within a QCD medium. In this article we have considered heavy quarkonium in a hot quark gluon plasma phase. The heavy-quark potential has been modeled properly for short as well as long distances. The potential at long distances is modeled as a QCD string which is screened at the same scale as the Coulomb field. We have numerically solved the 1+1-dimensional Schrodinger equation for this potential and obtained the eigen wavefunction and binding energy for the 1 S and 2 S states of charmonium and bottomonium. Further, we have calculated the decay width and dissociation temperature of quarkonium states in the QCD plasma. Finally, we have used our recently proposed unified model with these new values of decay widths to calculate the survival probability of the various quarkonium states with respect to centrality at relativistic heavy ion collider and large hadron collider energies. This study provides a unified, consistent and comprehensive description of spectroscopic properties of various quarkonium states at finite temperatures along with their nuclear modification factor at different collision energies.

Computational studies of metal-metal and metal-ligand interactions

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.

1992-01-01

The geometric structure of Cr(CO)6 is optimized at the modified coupled-pair functional (MCPF), single and double excitation coupled-cluster (CCSD) and CCSD(T) levels of theory (including a perturbational estimate for connected triple excitations), and the force constants for the totally symmetric representation are determined. The geometry of Cr(CO)5 is partially optimized at the MCPF, CCSD and CCSD(T) levels of theory. Comparison with experimental data shows that the CCSD(T) method gives the best results for the structures and force constants, and that remaining errors are probably due to deficiencies in the one-particle basis sets used for CO. A detailed comparison of the properties of free CO is therefore given, at both the MCPF and CCSD/CCSD(T) levels of treatment, using a variety of basis sets. With very large one-particle basis sets, the SSCD(T) method gives excellent results for the bond distance, dipole moment and harmonic frequency of free CO. The total binding energies of Cr(CO)6 and Cr(CO)5 are also determined at the MCPF, CCSD and CCSD(T) levels of theory. The CCSD(T) method gives a much larger total binding energy than either the MCPF or CCSD methods. An analysis of the basis set superposition error (BSSE) at the MCPF level of treatment points out limitations in the one-particle basis used here and in a previous study. Calculations using larger basis sets reduced the BSSE, but the total binding energy of Cr(CO)6 is still significantly smaller than the experimental value, although the first CO bond dissociation energy of Cr(CO)6 is well described. An investigation of 3s3p correlation reveals only a small effect. The remaining discrepancy between the experimental and theoretical total binding energy of Cr(CO)6 is probably due to limitations in the one-particle basis, rather than limitations in the correlation treatment. In particular an additional d function and an f function on each C and O are needed to obtain quantitative results. This is underscored by the fact that even using a very large primitive se (1042 primitive functions contracted to 300 basis functions), the superposition error for the total binding energy of Cr(CO)6 is 22 kcal/mol at the MCPF level of treatment.

GMXPBSA 2.1: A GROMACS tool to perform MM/PBSA and computational alanine scanning

NASA Astrophysics Data System (ADS)

Paissoni, C.; Spiliotopoulos, D.; Musco, G.; Spitaleri, A.

2015-01-01

GMXPBSA 2.1 is a user-friendly suite of Bash/Perl scripts for streamlining MM/PBSA calculations on structural ensembles derived from GROMACS trajectories, to automatically calculate binding free energies for protein-protein or ligand-protein complexes [R.T. Bradshaw et al., Protein Eng. Des. Sel. 24 (2011) 197-207]. GMXPBSA 2.1 is flexible and can easily be customized to specific needs and it is an improvement of the previous GMXPBSA 2.0 [C. Paissoni et al., Comput. Phys. Commun. (2014), 185, 2920-2929]. Additionally, it performs computational alanine scanning (CAS) to study the effects of ligand and/or receptor alanine mutations on the free energy of binding. Calculations require only for protein-protein or protein-ligand MD simulations. GMXPBSA 2.1 performs different comparative analyses, including a posteriori generation of alanine mutants of the wild-type complex, calculation of the binding free energy values of the mutant complexes and comparison of the results with the wild-type system. Moreover, it compares the binding free energy of different complex trajectories, allowing the study of the effects of non-alanine mutations, post-translational modifications or unnatural amino acids on the binding free energy of the system under investigation. Finally, it can calculate and rank relative affinity to the same receptor utilizing MD simulations of proteins in complex with different ligands. In order to dissect the different MM/PBSA energy contributions, including molecular mechanic (MM), electrostatic contribution to solvation (PB) and nonpolar contribution to solvation (SA), the tool combines two freely available programs: the MD simulations software GROMACS [S. Pronk et al., Bioinformatics 29 (2013) 845-854] and the Poisson-Boltzmann equation solver APBS [N.A. Baker et al., Proc. Natl. Acad. Sci. U.S.A 98 (2001) 10037-10041]. All the calculations can be performed in single or distributed automatic fashion on a cluster facility in order to increase the calculation by dividing frames across the available processors. This new version with respect to our previously published GMXPBSA 2.0 fixes some problem and allows additional kind of calculations, such as CAS on single protein in order to individuate the hot-spots, more custom options to perform APBS calculations, improvements of speed calculation of APBS (precF set to 0), possibility to work with multichain systems (see Summary of revisions for more details). The program is freely available under the GPL license.

Prediction of Binding Energy of Keap1 Interaction Motifs in the Nrf2 Antioxidant Pathway and Design of Potential High-Affinity Peptides.

PubMed

Karttunen, Mikko; Choy, Wing-Yiu; Cino, Elio A

2018-06-07

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor and principal regulator of the antioxidant pathway. The Kelch domain of Kelch-like ECH-associated protein 1 (Keap1) binds to motifs in the N-terminal region of Nrf2, promoting its degradation. There is interest in developing ligands that can compete with Nrf2 for binding to Kelch, thereby activating its transcriptional activities and increasing antioxidant levels. Using experimental Δ G bind values of Kelch-binding motifs determined previously, a revised hydrophobicity-based model was developed for estimating Δ G bind from amino acid sequence and applied to rank potential uncharacterized Kelch-binding motifs identified from interaction databases and BLAST searches. Model predictions and molecular dynamics (MD) simulations suggested that full-length MAD2A binds Kelch more favorably than a high-affinity 20-mer Nrf2 E78P peptide, but that the motif in isolation is not a particularly strong binder. Endeavoring to develop shorter peptides for activating Nrf2, new designs were created based on the E78P peptide, some of which showed considerable propensity to form binding-competent structures in MD, and were predicted to interact with Kelch more favorably than the E78P peptide. The peptides could be promising new ligands for enhancing the oxidative stress response.

Docking Simulation of the Binding Interactions of Saxitoxin Analogs Produced by the Marine Dinoflagellate Gymnodinium catenatum to the Voltage-Gated Sodium Channel Nav1.4.

PubMed

Durán-Riveroll, Lorena M; Cembella, Allan D; Band-Schmidt, Christine J; Bustillos-Guzmán, José J; Correa-Basurto, José

2016-05-06

Saxitoxin (STX) and its analogs are paralytic alkaloid neurotoxins that block the voltage-gated sodium channel pore (Nav), impeding passage of Na⁺ ions into the intracellular space, and thereby preventing the action potential in the peripheral nervous system and skeletal muscle. The marine dinoflagellate Gymnodinium catenatum produces an array of such toxins, including the recently discovered benzoyl analogs, for which the mammalian toxicities are essentially unknown. We subjected STX and its analogs to a theoretical docking simulation based upon two alternative tri-dimensional models of the Nav1.4 to find a relationship between the binding properties and the known mammalian toxicity of selected STX analogs. We inferred hypothetical toxicities for the benzoyl analogs from the modeled values. We demonstrate that these toxins exhibit different binding modes with similar free binding energies and that these alternative binding modes are equally probable. We propose that the principal binding that governs ligand recognition is mediated by electrostatic interactions. Our simulation constitutes the first in silico modeling study on benzoyl-type paralytic toxins and provides an approach towards a better understanding of the mode of action of STX and its analogs.

Docking Simulation of the Binding Interactions of Saxitoxin Analogs Produced by the Marine Dinoflagellate Gymnodinium catenatum to the Voltage-Gated Sodium Channel Nav1.4

PubMed Central

Durán-Riveroll, Lorena M.; Cembella, Allan D.; Band-Schmidt, Christine J.; Bustillos-Guzmán, José J.; Correa-Basurto, José

2016-01-01

Saxitoxin (STX) and its analogs are paralytic alkaloid neurotoxins that block the voltage-gated sodium channel pore (Nav), impeding passage of Na+ ions into the intracellular space, and thereby preventing the action potential in the peripheral nervous system and skeletal muscle. The marine dinoflagellate Gymnodinium catenatum produces an array of such toxins, including the recently discovered benzoyl analogs, for which the mammalian toxicities are essentially unknown. We subjected STX and its analogs to a theoretical docking simulation based upon two alternative tri-dimensional models of the Nav1.4 to find a relationship between the binding properties and the known mammalian toxicity of selected STX analogs. We inferred hypothetical toxicities for the benzoyl analogs from the modeled values. We demonstrate that these toxins exhibit different binding modes with similar free binding energies and that these alternative binding modes are equally probable. We propose that the principal binding that governs ligand recognition is mediated by electrostatic interactions. Our simulation constitutes the first in silico modeling study on benzoyl-type paralytic toxins and provides an approach towards a better understanding of the mode of action of STX and its analogs. PMID:27164145

Large scale affinity calculations of cyclodextrin host-guest complexes: Understanding the role of reorganization in the molecular recognition process

PubMed Central

Wickstrom, Lauren; He, Peng; Gallicchio, Emilio; Levy, Ronald M.

2013-01-01

Host-guest inclusion complexes are useful models for understanding the structural and energetic aspects of molecular recognition. Due to their small size relative to much larger protein-ligand complexes, converged results can be obtained rapidly for these systems thus offering the opportunity to more reliably study fundamental aspects of the thermodynamics of binding. In this work, we have performed a large scale binding affinity survey of 57 β-cyclodextrin (CD) host guest systems using the binding energy distribution analysis method (BEDAM) with implicit solvation (OPLS-AA/AGBNP2). Converged estimates of the standard binding free energies are obtained for these systems by employing techniques such as parallel Hamitionian replica exchange molecular dynamics, conformational reservoirs and multistate free energy estimators. Good agreement with experimental measurements is obtained in terms of both numerical accuracy and affinity rankings. Overall, average effective binding energies reproduce affinity rank ordering better than the calculated binding affinities, even though calculated binding free energies, which account for effects such as conformational strain and entropy loss upon binding, provide lower root mean square errors when compared to measurements. Interestingly, we find that binding free energies are superior rank order predictors for a large subset containing the most flexible guests. The results indicate that, while challenging, accurate modeling of reorganization effects can lead to ligand design models of superior predictive power for rank ordering relative to models based only on ligand-receptor interaction energies. PMID:25147485

Binding, stability, and antioxidant activity of quercetin with soy protein isolate particles.

PubMed

Wang, Yufang; Wang, Xiaoyong

2015-12-01

This work is to study the potential of particles fabricated from soy protein isolate (SPI) as a protective carrier for quercetin. When the concentration of SPI particles increases from 0 to 0.35 g/L, quercetin gives a gradually increased fluorescence intensity and fluorescence anisotropy. The addition of quercetin can highly quench the intrinsic fluorescence of SPI particles. These results are explained in terms of the binding of quercetin to the hydrophobic pockets of SPI particles mainly through the hydrophobic force together with the hydrogen bonding. The small difference in the binding constants at 25 and 40 °C suggests the structural stability of SPI particles. The relative changes in values of Gibbs energy, enthalpy, and entropy indicate that the binding of quercetin with SPI particles is spontaneous and hydrophobic interaction is the major force. Furthermore, SPI particles are superior to native SPI for improving the stability and radical scavenging activity of quercetin. Copyright © 2015 Elsevier Ltd. All rights reserved.

Free energy decomposition of protein-protein interactions.

PubMed

Noskov, S Y; Lim, C

2001-08-01

A free energy decomposition scheme has been developed and tested on antibody-antigen and protease-inhibitor binding for which accurate experimental structures were available for both free and bound proteins. Using the x-ray coordinates of the free and bound proteins, the absolute binding free energy was computed assuming additivity of three well-defined, physical processes: desolvation of the x-ray structures, isomerization of the x-ray conformation to a nearby local minimum in the gas-phase, and subsequent noncovalent complex formation in the gas phase. This free energy scheme, together with the Generalized Born model for computing the electrostatic solvation free energy, yielded binding free energies in remarkable agreement with experimental data. Two assumptions commonly used in theoretical treatments; viz., the rigid-binding approximation (which assumes no conformational change upon complexation) and the neglect of vdW interactions, were found to yield large errors in the binding free energy. Protein-protein vdW and electrostatic interactions between complementary surfaces over a relatively large area (1400--1700 A(2)) were found to drive antibody-antigen and protease-inhibitor binding.

Effect of metal in M 3(btc) 2 and M 2(dobdc) MOFs for O 2/N 2 separations: A combined density functional theory and experimental study

DOE PAGES

Parkes, Marie V.; Sava Gallis, Dorina F.; Greathouse, Jeffery A.; ...

2015-03-02

Computational screening of metal-organic framework (MOF) materials for selective oxygen adsorption from air could lead to new sorbents for the oxyfuel combustion process feedstock streams. A comprehensive study on the effect of MOF metal chemistry on gas binding energies in two common but structurally disparate metal-organic frameworks has been undertaken. Dispersion-corrected density functional theory methods were used to calculate the oxygen and nitrogen binding energies with each of fourteen metals, respectively, substituted into two MOF series, M 2(dobdc) and M 3(btc) 2. The accuracy of DFT methods was validated by comparing trends in binding energy with experimental gas sorption measurements.more » A periodic trend in oxygen binding energies was found, with greater oxygen binding energies for early transition-metal-substituted MOFs compared to late transition metal MOFs; this was independent of MOF structural type. The larger binding energies were associated with oxygen binding in a side-on configuration to the metal, with concomitant lengthening of the O-O bond. In contrast, nitrogen binding energies were similar across the transition metal series, regardless of both MOF structural type and metal identity. Altogether, these findings suggest that early transition metal MOFs are best suited to separating oxygen from nitrogen, and that the MOF structural type is less important than the metal identity.« less

Infrared Dielectric Screening Determines the Low Exciton Binding Energy of Metal-Halide Perovskites.

PubMed

Umari, Paolo; Mosconi, Edoardo; De Angelis, Filippo

2018-02-01

The performance of lead-halide perovskites in optoelectronic devices is due to a unique combination of factors, including highly efficient generation, transport, and collection of photogenerated charge carriers. The mechanism behind efficient charge generation in lead-halide perovskites is still largely unknown. Here, we investigate the factors that influence the exciton binding energy (E b ) in a series of metal-halide perovskites using accurate first-principles calculations based on solution of the Bethe-Salpeter equation, coupled to ab initio molecular dynamics simulations. We find that E b is strongly modulated by screening from low-energy phonons, which account for a factor ∼2 E b reduction, while dynamic disorder and rotational motion of the organic cations play a minor role. We calculate E b = 15 meV for MAPbI 3 , in excellent agreement with recent experimental estimates. We then explore how different material combinations (e.g., replacing Pb → Pb:Sn→ Sn; and MA → FA → Cs) may lead to different E b values and highlight the mechanisms underlying E b tuning.

Thermodynamics of proton transport coupled ATP synthesis.

PubMed

Turina, Paola; Petersen, Jan; Gräber, Peter

2016-06-01

The thermodynamic H(+)/ATP ratio of the H(+)-ATP synthase from chloroplasts was measured in proteoliposomes after energization of the membrane by an acid base transition (Turina et al. 2003 [13], 418-422). The method is discussed, and all published data obtained with this system are combined and analyzed as a single dataset. This meta-analysis led to the following results. 1) At equilibrium, the transmembrane ΔpH is energetically equivalent to the transmembrane electric potential difference. 2) The standard free energy for ATP synthesis (reference reaction) is ΔG°(ref)=33.8±1.3kJ/mol. 3) The thermodynamic H(+)/ATP ratio, as obtained from the shift of the ATP synthesis equilibrium induced by changing the transmembrane ΔpH (varying either pH(in) or pH(out)) is 4.0±0.1. The structural H(+)/ATP ratio, calculated from the ratio of proton binding sites on the c-subunit-ring in F(0) to the catalytic nucleotide binding sites on the β-subunits in F(1), is c/β=14/3=4.7. We infer that the energy of 0.7 protons per ATP that flow through the enzyme, but do not contribute to shifting the ATP/(ADP·Pi) ratio, is used for additional processes within the enzyme, such as activation, and/or energy dissipation, due e.g. to internal uncoupling. The ratio between the thermodynamic and the structural H(+)/ATP values is 0.85, and we conclude that this value represents the efficiency of the chemiosmotic energy conversion within the chloroplast H(+)-ATP synthase. Copyright © 2016 Elsevier B.V. All rights reserved.

Binding free energies for nicotine analogs inhibiting cytochrome P450 2A6 by a combined use of molecular dynamics simulations and QM/MM-PBSA calculations.

PubMed

Lu, Haiting; Huang, Xiaoqin; AbdulHameed, Mohamed Diwan M; Zhan, Chang-Guo

2014-04-01

Molecular dynamics (MD) simulations and hybrid quantum mechanical/molecular mechanical (QM/MM) calculations have been performed to explore the dynamic behaviors of cytochrome P450 2A6 (CYP2A6) binding with nicotine analogs (that are typical inhibitors) and to calculate their binding free energies in combination with Poisson-Boltzmann surface area (PBSA) calculations. The combined MD simulations and QM/MM-PBSA calculations reveal that the most important structural parameters affecting the CYP2A6-inhibitor binding affinity are two crucial internuclear distances, that is, the distance between the heme iron atom of CYP2A6 and the coordinating atom of the inhibitor, and the hydrogen-bonding distance between the N297 side chain of CYP2A6 and the pyridine nitrogen of the inhibitor. The combined MD simulations and QM/MM-PBSA calculations have led to dynamic CYP2A6-inhibitor binding structures that are consistent with the observed dynamic behaviors and structural features of CYP2A6-inhibitor binding, and led to the binding free energies that are in good agreement with the experimentally-derived binding free energies. The agreement between the calculated binding free energies and the experimentally-derived binding free energies suggests that the combined MD and QM/MM-PBSA approach may be used as a valuable tool to accurately predict the CYP2A6-inhibitor binding affinities in future computational design of new, potent and selective CYP2A6 inhibitors. Copyright © 2014 Elsevier Ltd. All rights reserved.

Character of intermolecular interaction in pyridine-argon complex: Ab initio potential energy surface, internal dynamics, and interrelations between SAPT energy components.

PubMed

Makarewicz, Jan; Shirkov, Leonid

2016-05-28

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center of mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy De of 392 cm(-1) is close to that of 387 cm(-1) calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, De for PAr becomes slightly lower than De for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres

A systematic study of ethylene adsorption over δ-MoC(001), TiC(001), and ZrC(001) surfaces was conducted by means of calculations based on periodic density functional theory. The structure and electronic properties of each carbide pristine surface had a strong influence in the bonding of ethylene. It was found that the metal and carbon sites of the carbide could participate in the adsorption process. As a consequence of this, very different bonding mechanisms were seen on δ-MoC(001) and TiC(001). The bonding of the molecule on the TMC(001) systems showed only minor similarities to the type of bonding found on a typical metal likemore » Pt(111). In general, the ethylene binding energy follow the trend in stability: ZrC(001) < TiC(001) < δ-MoC(001) < Pt(111). The van der Waals correction to the energy produces large binding energy values, modifies the stability orders and drives the ethylene closer to the surface but the adsorbate geometry parameters remain unchanged. Ethylene was activated on clearly defined binding geometries, changing its hybridization from sp 2 to sp 3 with an elongation (0.16–0.31 Å) of the C=C bond. As a result, on the basis of this theoretical study, δ-MoC(001) is proposed as a potential catalyst for the hydrogenation of olefins, whereas TiC(001) could be useful for their hydrogenolysis.« less

CH3NH3PbI3 and CsPbI3 Supramolecular Clusters in 1D: Do They Evolve with the Same Principle of Cooperative Binding?

NASA Astrophysics Data System (ADS)

Varadwaj, Arpita; Varadwaj, Pradeep R.; Yamashita, Koichi

Development of novel semiconductor-based photo-catalytic and -voltaic systems is a major area of research in nanoscience and technologies, and engineering. The process can be either direct or indirect in converting the light energy into electricity. Some of the photovoltaics include the organic, dye-sensitized, and halide perovskite solar cells, among others. Methylammonium lead iodide (CH3NH3PbI3) inorganic-organic hybrid perovskite is one among the many highly valued semiconductors reported till date, comparable with the inorganic cesium lead iodide (CsPbI3) perovskite. These are competitive candidates in the solar energy race. Nevertheless, this study was concentrated on the fundamental understanding of the rational designs of the CH3NH3PbI3 and CsPbI3 supramolecular materials using first-principles calculations, emerged though the self-assembly of the respective building blocks. It therefore addresses the question whether the (CH3NH3PbI3)n and (CsPbI3)n (n =1-10) supramolecular clusters are the consequences of additivity, or non-additive cooperative binding? For addressing this question, the supramolecular properties such as the polarizability, the intermolecular charge transfer, and the binding energy, etc., all w.r.t the cluster size n, are exploited. CREST-JST, 7 Gobancho, Chiyoda-ku, Tokyo, Japan 102-0076.

Different kinetic pathways of the binding of two biphenyl analogues of colchicine to tubulin.

PubMed

Dumortier, C; Gorbunoff, M J; Andreu, J M; Engelborghs, Y

1996-04-09

The kinetics of the interaction of tubulin with two biphenyl analogues of colchicine were measured by fluorescence stopped flow. The ligands were 2,3,4-trimethoxy-4'-carbomethoxy-1,1'-biphenyl (TCB) and 2,3,4-trimethoxy-4'-acetyl-1,1'-biphenyl (TKB). The binding of both analogues is accompanied by a fluorescence increase with monophasic kinetics, which indicates that these drugs, unlike colchicine, do not discriminate between the isoforms of tubulin. The observed pseudo-first-order rate constant increases in a nonlinear way with the drug concentration, indicating that the binding of the biphenyl analogues to tubulin occurs, like colchicine, in two steps: a fast reversible equilibrium followed by an isomerization of the initial complex. Kinetic analysis shows that TCB and TKB exhibit differences in their K1 values. At 25 degrees C, these are 114,000 +/- 15,000 M(-1) for TCB and 8,300 +/- 900 M(-1) for TKB. Both molecules show a much higher affinity than colchicine for the initial binding site. Also at 25 degrees C, the k2 value is 0.66 +/- 0.04 s(-1) for TCB and 3.0 +/- 0.2 s(-1) for TKB. From the temperature dependence, a reaction enthalpy change for the initial binding (deltaH(zero)1) of 44 +/- 9 kJ x mol(-1) (TCB) and -40 +/- 14 kJ x mol(-1) (TKB) and an activation energy for the second forward step of 64 +/- 2 kJ x mol(-1) (TCB) and 101 +/- 10 kJ x mol(-1) (TKB) were calculated. The dissociation kinetics were studied by displacement experiments, in which podophyllotoxin was used as a displacing ligand. The rate constant for the second step in the off direction (k(-2)) is 0.25 +/- 0.05 s(-1) for TCB and 0.093 +/- 0.009 s(-1) for TKB at 25 degrees C. The activation energies for the backward isomerization of the complexes were found to be 86 +/- 20 kJ x mol(-1) (TCB) and 79 +/- 5 kJ x mol(-1) (TKB). Combination of these results with the kinetic parameters for association gives a full characterization of the enthalpy pathway for the binding of TCB and TKB. The pathway of TCB binding is shown to differ considerably from that of TKB binding. Since their structural difference is located in ring C', this result points to their use of the ring C' in the first binding step. The competitiveness of the binding of TCB and TKB with those of podophyllotoxin, MTC, and MDL 27048 indicates that the two biphenyls interact as well with the trimethoxyphenyl-specific subsite.

Reexamine structures and relative stability of medium-sized silicon clusters: Low-lying endohedral fullerene-like clusters Si 30-Si 38

NASA Astrophysics Data System (ADS)

Yoo, Soohaeng; Shao, Nan; Zeng, X. C.

2009-10-01

We report improved results of lowest-lying silicon clusters Si 30-Si 38. A large population of low-energy clusters are collected from previous searches by several research groups and the binding energies of these clusters are computed using density-functional theory (DFT) methods. Best candidates (isomers with high binding energies) are identified from the screening calculations. Additional constrained search is then performed for the best candidates using the basin-hopping method combined with DFT geometry optimization. The obtained low-lying clusters are classified according to binding energies computed using either the Perdew-Burke-Ernzerhof (PBE) functional or the Becke exchange and Lee-Yang-Parr correlation (BLYP) functional. We propose to rank low-lying clusters according to the mean PBE/BLYP binding energies in view that the PBE functional tends to give greater binding energies for more compact clusters whereas the BLYP functional tends to give greater binding energies for less compact clusters or clusters composed of small-sized magic-number clusters. Except for Si 30, the new search confirms again that medium-size silicon clusters Si 31-Si 38 constructed with proper fullerene cage motifs are most promising to be the lowest-energy structures.

Discovery of 12-mer peptides that bind to wood lignin

PubMed Central

Yamaguchi, Asako; Isozaki, Katsuhiro; Nakamura, Masaharu; Takaya, Hikaru; Watanabe, Takashi

2016-01-01

Lignin, an abundant terrestrial polymer, is the only large-volume renewable feedstock composed of an aromatic skeleton. Lignin has been used mostly as an energy source during paper production; however, recent interest in replacing fossil fuels with renewable resources has highlighted its potential value in providing aromatic chemicals. Highly selective degradation of lignin is pivotal for industrial production of paper, biofuels, chemicals, and materials. However, few studies have examined natural and synthetic molecular components recognizing the heterogeneous aromatic polymer. Here, we report the first identification of lignin-binding peptides possessing characteristic sequences using a phage display technique. The consensus sequence HFPSP was found in several lignin-binding peptides, and the outer amino acid sequence affected the binding affinity of the peptides. Substitution of phenylalanine7 with Ile in the lignin-binding peptide C416 (HFPSPIFQRHSH) decreased the affinity of the peptide for softwood lignin without changing its affinity for hardwood lignin, indicating that C416 recognised structural differences between the lignins. Circular dichroism spectroscopy demonstrated that this peptide adopted a highly flexible random coil structure, allowing key residues to be appropriately arranged in relation to the binding site in lignin. These results provide a useful platform for designing synthetic and biological catalysts selectively bind to lignin. PMID:26903196

Systematics of nn states with high spin: A study of the (α, 2He) reaction on fp shell nuclei

NASA Astrophysics Data System (ADS)

Jahn, R.; Wienands, U.; Wenzel, D.; von Neumann-Cosel, P.

1985-01-01

At 57 MeV bombarding energy the (α, 2He) reaction has been investigated on targets of 54,56Fe, 58,60,62,64Ni, 64,66Zn, and 70Ge. Selective excitation of the 2n configurations ( f{5}/{2}g{9}/{2}) 7-, ( g{9}/{2}) 8 +2, and ( g{9}/{2}2 d{5}/{2}) 6+ was observed in all final nuclei. A linear A and T dependence of the binding energies of these states was observed. This systematic behaviour is well described by the Bansal-French model. The values obtained for the strength of the isoscalar and the isovector parts of the particle-hole interaction are consistent with the average of the values describing the corresponding single-particle states.

Non-covalent binding analysis of sulfamethoxazole to human serum albumin: Fluorescence spectroscopy, UV-vis, FT-IR, voltammetric and molecular modeling.

PubMed

Naik, Praveen N; Nandibewoor, Sharanappa T; Chimatadar, Shivamurthi A

2015-06-01

This study was designed to examine the interaction of sulfamethoxazole (SMZ) with human serum albumin(HSA). Spectroscopic analysis of the emission quenching at different temperatures revealed that the quenching mechanism of human serum albumin by SMZ was static mechanism. The binding constant values for the SMZ-HSA system were obtained to be 22,500 L/mol at 288 K, 15,600 L/mol at 298 K, and 8500 L/mol at 308 K. The distance r between donor and acceptor was evaluated according to the theory of Föster energy transfer. The results of spectroscopic analysis and molecular modeling techniques showed that the conformation of human serum albumin had been changed in the presence of SMZ. The thermodynamic parameters, namely enthalpy change (∆ H 0 ) -36.0 kJ/mol, entropy change (∆ S 0 ) -41.3 J/mol K and free energy change (∆ G 0 ) -23.7 kJ/mol, were calculated by using van׳t Hoff equation. The effect of common ions on the binding of SMZ to HSA was tested.

Alterations of rings B and C of colchicine are cumulative in overall binding to tubulin but modify each kinetic step.

PubMed

Dumortier, C; Gorbunoff, M J; Andreu, J M; Engelborghs, Y

1996-12-10

The role of the elimination of ring B and/or the modification of ring C of colchicine in tubulin binding kinetics and thermodynamics has been characterized, using four different molecules. These ligands are colchicine (COL); 2-methoxy-5-(2',3',4'-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-on e (MTC), in which the central ring B has been reduced to one bond; allocolchicine (ALLO), in which ring C has been replaced by a six-membered ring; and 2,3,4-trimethoxy-4'-carbomethoxy-1,1'-biphenyl (TCB), where the same two modifications are made simultaneously. This paper describes the kinetics of association of ALLO with tubulin. The binding is accompanied by a fluorescence increase with slow biphasic kinetics, indicating binding to fast and slow tubulin isotypes. Binding to each of these isotypes occurs in two steps: a fast initial binding followed by a slower isomerization step. The K1 and k2 values for ALLO at 25 degrees C are 14,000 +/- 2,000 and 25,000 +/- 6,000 M-1 (fast and slow isotypes) and 0.055 +/- 0.003 s-1 and 0.013 +/- 0.001 s-1 (fast and slow isotype), respectively. For ALLO the reaction standard enthalpy change of the initial binding is 68 +/- 5 kJ.mol-1 (fast isotype) and 45 +/- 33 kJ.mol-1 (slow isotype) and the activation energy for the second forward step is 58 +/- 14 kJ.mol-1 (fast isotype) and 81 +/- 17 kJ.mol-1 (slow isotype). Displacement kinetics of bound ALLO by podophyllotoxin was monoexponential. The activation energy for the isomerization in the off direction is 107 +/- 7 kJ.mol-1. Comparison of the thermodynamic parameters for all four compounds shows that the modifications of both rings are cumulative with respect to overall binding. For the intermediate state there is a mutual influence of both modifications, suggesting an alteration of the reaction pathway.

Free Energy-Based Virtual Screening and Optimization of RNase H Inhibitors of HIV-1 Reverse Transcriptase.

PubMed

Zhang, Baofeng; D'Erasmo, Michael P; Murelli, Ryan P; Gallicchio, Emilio

2016-09-30

We report the results of a binding free energy-based virtual screening campaign of a library of 77 α-hydroxytropolone derivatives against the challenging RNase H active site of the reverse transcriptase (RT) enzyme of human immunodeficiency virus-1. Multiple protonation states, rotamer states, and binding modalities of each compound were individually evaluated. The work involved more than 300 individual absolute alchemical binding free energy parallel molecular dynamics calculations and over 1 million CPU hours on national computing clusters and a local campus computational grid. The thermodynamic and structural measures obtained in this work rationalize a series of characteristics of this system useful for guiding future synthetic and biochemical efforts. The free energy model identified key ligand-dependent entropic and conformational reorganization processes difficult to capture using standard docking and scoring approaches. Binding free energy-based optimization of the lead compounds emerging from the virtual screen has yielded four compounds with very favorable binding properties, which will be the subject of further experimental investigations. This work is one of the few reported applications of advanced-binding free energy models to large-scale virtual screening and optimization projects. It further demonstrates that, with suitable algorithms and automation, advanced-binding free energy models can have a useful role in early-stage drug-discovery programs.

Quantum mechanics/molecular mechanics modeling of photoelectron spectra: the carbon 1s core-electron binding energies of ethanol-water solutions.

PubMed

Löytynoja, T; Niskanen, J; Jänkälä, K; Vahtras, O; Rinkevicius, Z; Ågren, H

2014-11-20

Using ethanol-water solutions as illustration, we demonstrate the capability of the hybrid quantum mechanics/molecular mechanics (QM/MM) paradigm to simulate core photoelectron spectroscopy: the binding energies and the chemical shifts. An integrated approach with QM/MM binding energy calculations coupled to preceding molecular dynamics sampling is adopted to generate binding energies averaged over the solute-solvent configurations available at a particular temperature and pressure and thus allowing for a statistical assessment with confidence levels for the final binding energies. The results are analyzed in terms of the contributions in the molecular mechanics model-electrostatic, polarization, and van der Waals-with atom or bond granulation of the corresponding MM charge and polarizability force-fields. The role of extramolecular charge transfer screening of the core-hole and explicit hydrogen bonding is studied by extending the QM core to cover the first solvation shell. The results are compared to those obtained from pure electrostatic and polarizable continuum models. Particularly, the dependence of the carbon 1s binding energies with respect to the ethanol concentration is studied. Our results indicate that QM/MM can be used as an all-encompassing model to study photoelectron binding energies and chemical shifts in solvent environments.

Study on interaction between curcumin and pepsin by spectroscopic and docking methods.

PubMed

Ying, Ming; Huang, Fengwen; Ye, Haidong; Xu, Hong; Shen, Liangliang; Huan, Tianwen; Huang, Shitong; Xie, Jiangfeng; Tian, Shengli; Hu, Zhangli; He, Zhendan; Lu, Jun; Zhou, Kai

2015-08-01

The interaction between curcumin and pepsin was investigated by fluorescence, synchronous fluorescence, UV-vis absorption, circular dichroism (CD), and molecular docking. Under physiological pH value in stomach, the fluorescence of pepsin can be quenched effectively by curcumin via a combined quenching process. Binding constant (Ka) and binding site number (n) of curcumin to pepsin were obtained. According to the theory of Förster's non-radiation energy transfer, the distance r between pepsin and curcumin was found to be 2.45 nm within the curcumin-pepsin complex, which implies that the energy transfer occurs between curcumin and pepsin, leading to the quenching of pepsin fluorescence. Fluorescence experiments also suggest that curcumin is located more closely to tryptophan residues than tyrosine residues. CD spectra together with UV-vis absorbance studies show that binding of curcumin to pepsin results in the extension of peptide strands of pepsin with loss of some β-sheet structures. Thermodynamic parameters calculated from the binding constants at different temperatures reveal that hydrophobic force plays a major role in stabilizing the curcumin-pepsin complex. In addition, docking results support the above experimental findings and suggest the possible hydrogen bonds of curcumin with Thr-77, Thr-218, and Glu-287 of pepsin, which help further stabilize the curcumin-pepsin complex. Copyright © 2015 Elsevier B.V. All rights reserved.

Effect of Binding on Enantioselectivity of Epoxide Hydrolase.

PubMed

Zaugg, Julian; Gumulya, Yosephine; Bodén, Mikael; Mark, Alan E; Malde, Alpeshkumar K

2018-03-26

Molecular dynamics simulations and free energy calculations have been used to investigate the effect of ligand binding on the enantioselectivity of an epoxide hydrolase (EH) from Aspergillus niger. Despite sharing a common mechanism, a wide range of alternative mechanisms have been proposed to explain the origin of enantiomeric selectivity in EHs. By comparing the interactions of ( R)- and ( S)-glycidyl phenyl ether (GPE) with both the wild type (WT, E = 3) and a mutant showing enhanced enantioselectivity to GPE (LW202, E = 193), we have examined whether enantioselectivity is due to differences in the binding pose, the affinity for the ( R)- or ( S)- enantiomers, or a kinetic effect. The two enantiomers were easily accommodated within the binding pockets of the WT enzyme and LW202. Free energy calculations suggested that neither enzyme had a preference for a given enantiomer. The two substrates sampled a wide variety of conformations in the simulations with the sterically hindered and unhindered carbon atoms of the GPE epoxide ring both coming in close proximity to the nucleophilic aspartic acid residue. This suggests that alternative pathways could lead to the formation of a ( S)- and ( R)-diol product. Together, the calculations suggest that the enantioselectivity is due to kinetic rather than thermodynamic effects and that the assumption that one substrate results in one product when interpreting the available experimental data and deriving E-values may be inappropriate in the case of EHs.

Characterization of the interaction forces in a drug carrier complex of doxorubicin with a drug-binding peptide.

PubMed

Gocheva, Gergana; Ilieva, Nina; Peneva, Kalina; Ivanova, Anela

2018-04-01

Polypeptide-based materials are used as building blocks for drug delivery systems aimed at toxicity decrease in chemotherapeutics. A molecular-level approach is adopted for investigating the non-covalent interactions between doxorubicin and a recently synthesized drug-binging peptide as a key part of a system for delivery to neoplastic cells. Molecular dynamics simulations in aqueous solution at room and body temperature are applied to investigate the structure and the binding modes within the drug-peptide complex. The tryptophans are outlined as the main chemotherapeutic adsorption sites, and the importance of their placement in the peptide sequence is highlighted. The drug-peptide binging energy is evaluated by density functional theory calculations. Principal component analysis reveals comparable importance of several types of interaction for the binding strength. π-Stacking is dominant, but other factors are also significant: intercalation, peptide backbone stacking, electrostatics, dispersion, and solvation. Intra- and intermolecular H-bonding also stabilizes the complexes. The influence of solvent molecules on the binding energy is mild. The obtained data characterize the drug-to-peptide attachment as a mainly attractive collective process with interactions spanning a broad range of values. These results explain with atomistic detail the experimentally registered doxorubicin-binging ability of the peptide and outline the complex as a prospective carrying unit that can be employed in design of drug delivery systems. © 2017 John Wiley & Sons A/S.

Orthorhombic MoO3 nanobelts based NO2 gas sensor

NASA Astrophysics Data System (ADS)

Mane, A. A.; Moholkar, A. V.

2017-05-01

Molybdenum trioxide (MoO3) nanobelts have been deposited onto the glass substrates using chemical spray pyrolysis (CSP) deposition method. The XRD patterns reveal that films are polycrystalline having an orthorhombic crystal structure. Raman spectra confirm that the films are orthorhombic in phase. The XPS study shows the presence of two well resolved spectral lines of Mo-3d core levels appearing at the binding energy values of 232.82 eV and 235.95 eV corresponding to Mo-3d5/2 and Mo-3d3/2, respectively. These binding energy values are assigned to Mo6+ oxidation state of fully oxidized MoO3. The FE-SEM micrographs show the formation of nanobelts-like morphology. The AFM micrographs reveal that the RMS surface roughness increases from 16.5 nm to 17.5 nm with increase in film thickness from 470 nm to 612 nm and then decreases to 16 nm for 633 nm film thickness. The band gap energy is found to be decreased from 3.40 eV to 3.38 eV. To understand the electronic transport phenomenon in MoO3 thin films, dielectric properties are studied. For 612 nm film thickness, the highest NO2 gas response of 68% is obtained at an operating temperature of 200 °C for 100 ppm concentration with response and recovery times of 15 s and 150 s, respectively. The lower detection limit is found to be 10 ppm which is half of the immediately dangerous to life or health (IDLH) value of 20 ppm. Finally, NO2 gas sensing mechanism in an orthorhombic MoO3 crystal structure is discussed in detail.

Binding free energy analysis of protein-protein docking model structures by evERdock.

PubMed

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-14

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

Binding free energy analysis of protein-protein docking model structures by evERdock

NASA Astrophysics Data System (ADS)

Takemura, Kazuhiro; Matubayasi, Nobuyuki; Kitao, Akio

2018-03-01

To aid the evaluation of protein-protein complex model structures generated by protein docking prediction (decoys), we previously developed a method to calculate the binding free energies for complexes. The method combines a short (2 ns) all-atom molecular dynamics simulation with explicit solvent and solution theory in the energy representation (ER). We showed that this method successfully selected structures similar to the native complex structure (near-native decoys) as the lowest binding free energy structures. In our current work, we applied this method (evERdock) to 100 or 300 model structures of four protein-protein complexes. The crystal structures and the near-native decoys showed the lowest binding free energy of all the examined structures, indicating that evERdock can successfully evaluate decoys. Several decoys that show low interface root-mean-square distance but relatively high binding free energy were also identified. Analysis of the fraction of native contacts, hydrogen bonds, and salt bridges at the protein-protein interface indicated that these decoys were insufficiently optimized at the interface. After optimizing the interactions around the interface by including interfacial water molecules, the binding free energies of these decoys were improved. We also investigated the effect of solute entropy on binding free energy and found that consideration of the entropy term does not necessarily improve the evaluations of decoys using the normal model analysis for entropy calculation.

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE PAGES

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

2017-04-06

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

A Comprehensive Docking and MM/GBSA Rescoring Study of Ligand Recognition upon Binding Antithrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Xiaohua; Perez-Sanchez, Horacio; C. Lightstone, Felice

A high-throughput virtual screening pipeline has been extended from single energetically minimized structure Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) rescoring to ensemble-average MM/GBSA rescoring. The correlation coefficient (R2) of calculated and experimental binding free energies for a series of antithrombin ligands has been improved from 0.36 to 0.69 when switching from the single-structure MM/GBSA rescoring to ensemble-average one. The electrostatic interactions in both solute and solvent are identified to play an important role in determining the binding free energy after the decomposition of the calculated binding free energy. Furthermore, the increasing negative charge of the compounds provides a more favorablemore » electrostatic energy change but creates a higher penalty for the solvation free energy. Such a penalty is compensated by the electrostatic energy change, which results in a better binding affinity. A highly hydrophobic ligand is determined by the docking program to be a non-specific binder. Finally, these results have demonstrated that it is very important to keep a few top poses for rescoring, if the binding is non-specific or the binding mode is not well determined by the docking calculation.« less

On binding energy of trions in bulk materials

NASA Astrophysics Data System (ADS)

Filikhin, Igor; Kezerashvili, Roman Ya.; Vlahovic, Branislav

2018-03-01

We study the negatively T- and positively T+ charged trions in bulk materials in the effective mass approximation within the framework of a potential model. The binding energies of trions in various semiconductors are calculated by employing Faddeev equation in configuration space. Results of calculations of the binding energies for T- are consistent with previous computational studies and are in reasonable agreement with experimental measurements, while the T+ is unbound for all considered cases. The mechanism of formation of the binding energy of trions is analyzed by comparing contributions of a mass-polarization term related to kinetic energy operators and a term related to the Coulomb repulsion of identical particles.

Absolute binding free energies between T4 lysozyme and 141 small molecules: calculations based on multiple rigid receptor configurations

PubMed Central

Xie, Bing; Nguyen, Trung Hai; Minh, David D. L.

2017-01-01

We demonstrate the feasibility of estimating protein-ligand binding free energies using multiple rigid receptor configurations. Based on T4 lysozyme snapshots extracted from six alchemical binding free energy calculations with a flexible receptor, binding free energies were estimated for a total of 141 ligands. For 24 ligands, the calculations reproduced flexible-receptor estimates with a correlation coefficient of 0.90 and a root mean square error of 1.59 kcal/mol. The accuracy of calculations based on Poisson-Boltzmann/Surface Area implicit solvent was comparable to previously reported free energy calculations. PMID:28430432

The effect of defect types on the electronic and optical properties of graphene nanoflakes physisorbed by ionic liquids.

PubMed

Shakourian-Fard, Mehdi; Kamath, Ganesh

2017-02-08

Defect engineering and non-covalent interaction strategies allow for dramatically tuning the optoelectronic properties of graphene. Using ab initio density functional theory (M06-2X/cc-pVDZ), we find that the nature of defects on the graphene nanoflakes (GNFs) and the size of defective GNF (DGNF) surfaces affect the binding energy (ΔE b ) of ionic liquids (ILs) and the UV-Vis absorption spectra of DGNFIL complexes. Further, our results indicate that increasing the size of DGNFs affects the geometrical structure of the surfaces and increases the binding energy of ILs by about 10%. Analysis based on AIM and EDA shows that the interactions between ILs and DGNFs are non-covalent in nature (dispersion energy being dominant) and associated with charge transfer between the IL and nanoflakes. A comparison between the ΔE b values of ILs on DGNFs, GNFs, and h-BN nanoflakes (h-BNNF) shows that the presence of defects on the GNF surfaces increases the binding energy values as follows: DGNFIL > pristine GNFIL > h-BNNFIL. Our calculations indicate that increasing the size of DGNF surfaces leads to a decrease in the HOMO-LUMO energy gap (E g ) of the DGNF surfaces. Orbital energy and density of state calculations show that the E g of DV(SW)-GNFs decreases upon IL adsorption and their Fermi energy level is shifted depending on the type of IL, thus enabling better conductivity. Reactivity descriptors generally indicate that the chemical potential (μ) and chemical hardness (η) of nanoflakes decrease upon IL adsorption, whereas the electrophilicity index (ω) increases. The UV-Vis absorption spectrum of DV-GNF and SW-GNF shows four bands in the visible spectrum which correspond to π → π* transitions with the absorption bands of SW-GNF appearing at higher wavelengths than those of DV-GNF. The most intense absorption bands in DV-GNF (λ = 348 nm) and SW-GNF (λ = 375 nm) are associated with electronic transitions HOMO-1 → LUMO+2 and HOMO → LUMO+1, respectively. In addition, these absorption bands undergo a red-shift by both increasing the size of the DV(SW)-GNF surfaces and IL adsorption. We also observe that the energy gaps and absorption spectra can be altered by varying the defect types and the type of IL adsorbate, where the defect types affect the spectral shapes of the bands and adsorbates at the first absorption peak, thus having potential application for light-emitting devices.

Interactions of cephalexin with bovine serum albumin: displacement reaction and molecular docking.

PubMed

Hamishehkar, Hamed; Hosseini, Soheila; Naseri, Abdolhossein; Safarnejad, Azam; Rasoulzadeh, Farzaneh

2016-01-01

Introduction: The drug-plasma protein interaction is a fundamental issue in guessing and checking the serious drug side effects related with other drugs. The purpose of this research was to study the interaction of cephalexin with bovine serum albumin (BSA) and displacement reaction using site probes. Methods: The interaction mechanism concerning cephalexin (CPL) with BSA was investigated using various spectroscopic methods and molecular modeling method. The binding sites number, n, apparent binding constant, K, and thermodynamic parameters, ΔG 0 , ΔH 0 , and ΔS 0 were considered at different temperatures. To evaluate the experimental results, molecular docking modeling was calculated. Results: The distance, r=1.156 nm between BSA and CPL were found in accordance with the Forster theory of non-radiation energy transfer (FRET) indicating energy transfer occurs between BSA and CPL. According to the binding parameters and ΔG 0 = negative values and ΔS 0 = 28.275 j mol -1 K -1 , a static quenching process is effective in the CPL-BSA interaction spontaneously. ΔG 0 for the CPL-BSA complex obtained from the docking simulation is -28.99 kj mol -1 , which is close to experimental ΔG of binding, -21.349 kj mol -1 that indicates a good agreement between the results of docking methods and experimental data. Conclusion: The outcomes of spectroscopic methods revealed that the conformation of BSA changed during drug-BSA interaction. The results of FRET propose that CPL quenches the fluorescence of BSA by static quenching and FRET. The displacement study showed that phenylbutazon and ketoprofen displaced CPL, indicating that its binding site on albumin is site I and Gentamicin cannot be displaced from the binding site of CPL. All results of molecular docking method agreed with the results of experimental data.

Exploring the free-energy landscape of carbohydrate-protein complexes: development and validation of scoring functions considering the binding-site topology

NASA Astrophysics Data System (ADS)

Eid, Sameh; Saleh, Noureldin; Zalewski, Adam; Vedani, Angelo

2014-12-01

Carbohydrates play a key role in a variety of physiological and pathological processes and, hence, represent a rich source for the development of novel therapeutic agents. Being able to predict binding mode and binding affinity is an essential, yet lacking, aspect of the structure-based design of carbohydrate-based ligands. We assembled a diverse data set comprising 273 carbohydrate-protein crystal structures with known binding affinity and evaluated the prediction accuracy of a large collection of well-established scoring and free-energy functions, as well as combinations thereof. Unfortunately, the tested functions were not capable of reproducing binding affinities in the studied complexes. To simplify the complex free-energy surface of carbohydrate-protein systems, we classified the studied proteins according to the topology and solvent exposure of the carbohydrate-binding site into five distinct categories. A free-energy model based on the proposed classification scheme reproduced binding affinities in the carbohydrate data set with an r 2 of 0.71 and root-mean-squared-error of 1.25 kcal/mol ( N = 236). The improvement in model performance underlines the significance of the differences in the local micro-environments of carbohydrate-binding sites and demonstrates the usefulness of calibrating free-energy functions individually according to binding-site topology and solvent exposure.

Fluorescence spectroscopic study on the interaction of resveratrol with lipoxygenase

NASA Astrophysics Data System (ADS)

Pinto, María del Carmen; Duque, Antonio Luis; Macías, Pedro

2010-09-01

The interaction of lipoxygenase with (E)-resveratrol was investigated by fluorescence spectroscopy. The data obtained revealed that the quenching of intrinsic fluorescence of lipoxygenase is produced by the formation of a complex lipoxygenase-(E)-resveratrol. From the value obtained for the binding constant, according to the Stern-Volmer modified equation, was deduced the existence of static quenching mechanism and, as consequence, the existence of a strong interaction between (E)-resveratrol and lipoxygenase. The values obtained for the thermodynamic parameter Δ H (-3.58 kJ mol -1) and Δ S (87.97 J mol -1K -1) suggested the participation of hydrophobic interactions and hydrogen bonds in the stabilization of the complex ligand-protein. From the static quenching we determined that only exist one independent binding site. Based on the Förster energy transfer theory, the distance between the acceptor ((E)-resveratrol) and the donor (Trp residues of lipoxygenase) was calculated to be 3.42 nm. Finally, based on the information obtained from the evaluation of synchronous and three-dimensional fluorescence spectroscopy, we deduced that the interaction of (E)-resveratrol with lipoxygenase produces micro-environmental and conformational alterations of protein in the binding region.

Spectra of helium clusters with up to six atoms using soft-core potentials

NASA Astrophysics Data System (ADS)

Gattobigio, M.; Kievsky, A.; Viviani, M.

2011-11-01

In this paper, we investigate small clusters of helium atoms using the hyperspherical harmonic basis. We consider systems with A=2,3,4,5,6 atoms with an interparticle potential which does not present a strong repulsion at short distances. We use an attractive Gaussian potential that reproduces the values of the dimer binding energy, the atom-atom scattering length, and the effective range obtained with one of the widely used He-He interactions, the Aziz and Slaman potential, called LM2M2. In systems with more than two atoms, we consider a repulsive three-body force that, by construction, reproduces the trimer binding energy of the LM2M2 potential. With this model, consisting of the sum of a two- and three-body potential, we have calculated the spectrum of clusters formed by four, five, and six helium atoms. We have found that these systems present two bound states, one deep and one shallow, close to the threshold fixed by the energy of the (A-1)-atom system. Universal relations between the energies of the excited state of the A-atom system and the ground-state energy of the (A-1)-atom system are extracted, as well as the ratio between the ground state of the A-atom system and the ground-state energy of the trimer.

Affinity and Efficacy Studies of Tetrahydrocannabinolic Acid A at Cannabinoid Receptor Types One and Two.

PubMed

McPartland, John M; MacDonald, Christa; Young, Michelle; Grant, Phillip S; Furkert, Daniel P; Glass, Michelle

2017-01-01

Introduction: Cannabis biosynthesizes Δ 9 -tetrahydrocannabinolic acid (THCA-A), which decarboxylates into Δ 9 -tetrahydrocannabinol (THC). There is growing interest in the therapeutic use of THCA-A, but its clinical application may be hampered by instability. THCA-A lacks cannabimimetic effects; we hypothesize that it has little binding affinity at cannabinoid receptor 1 (CB 1 ). Materials and Methods: Purity of certified reference standards were tested with high performance liquid chromatography (HPLC). Binding affinity of THCA-A and THC at human (h) CB 1 and hCB 2 was measured in competition binding assays, using transfected HEK cells and [ 3 H]CP55,940. Efficacy at hCB 1 and hCB 2 was measured in a cyclic adenosine monophosphase (cAMP) assay, using a Bioluminescence Resonance Energy Transfer (BRET) biosensor. Results: The THCA-A reagent contained 2% THC. THCA-A displayed small but measurable binding at both hCB 1 and hCB 2 , equating to approximate K i values of 3.1μM and 12.5μM, respectively. THC showed 62-fold greater affinity at hCB 1 and 125-fold greater affinity at hCB 2 . In efficacy tests, THCA-A (10μM) slightly inhibited forskolin-stimulated cAMP at hCB 1 , suggestive of weak agonist activity, and no measurable efficacy at hCB 2 . Discussion: The presence of THC in our THCA-A certified standard agrees with decarboxylation kinetics (literature reviewed herein), which indicate contamination with THC is nearly unavoidable. THCA-A binding at 10μM approximated THC binding at 200nM. We therefore suspect some of our THCA-A binding curve was artifact-from its inevitable decarboxylation into THC-and the binding affinity of THCA-A is even weaker than our estimated values. We conclude that THCA-A has little affinity or efficacy at CB 1 or CB 2 .

Higher Throughput Calorimetry: Opportunities, Approaches and Challenges

PubMed Central

Recht, Michael I.; Coyle, Joseph E.; Bruce, Richard H.

2010-01-01

Higher throughput thermodynamic measurements can provide value in structure-based drug discovery during fragment screening, hit validation, and lead optimization. Enthalpy can be used to detect and characterize ligand binding, and changes that affect the interaction of protein and ligand can sometimes be detected more readily from changes in the enthalpy of binding than from the corresponding free-energy changes or from protein-ligand structures. Newer, higher throughput calorimeters are being incorporated into the drug discovery process. Improvements in titration calorimeters come from extensions of a mature technology and face limitations in scaling. Conversely, array calorimetry, an emerging technology, shows promise for substantial improvements in throughput and material utilization, but improved sensitivity is needed. PMID:20888754

Micro-Environmental Signature of The Interactions between Druggable Target Protein, Dipeptidyl Peptidase-IV, and Anti-Diabetic Drugs.

PubMed

Chakraborty, Chiranjib; Mallick, Bidyut; Sharma, Ashish Ranjan; Sharma, Garima; Jagga, Supriya; Doss, C George Priya; Nam, Ju-Suk; Lee, Sang-Soo

2017-01-01

Druggability of a target protein depends on the interacting micro-environment between the target protein and drugs. Therefore, a precise knowledge of the interacting micro-environment between the target protein and drugs is requisite for drug discovery process. To understand such micro-environment, we performed in silico interaction analysis between a human target protein, Dipeptidyl Peptidase-IV (DPP-4), and three anti-diabetic drugs (saxagliptin, linagliptin and vildagliptin). During the theoretical and bioinformatics analysis of micro-environmental properties, we performed drug-likeness study, protein active site predictions, docking analysis and residual interactions with the protein-drug interface. Micro-environmental landscape properties were evaluated through various parameters such as binding energy, intermolecular energy, electrostatic energy, van der Waals'+H-bond+desolvo energy (E VHD ) and ligand efficiency (LE) using different in silico methods. For this study, we have used several servers and software, such as Molsoft prediction server, CASTp server, AutoDock software and LIGPLOT server. Through micro-environmental study, highest log P value was observed for linagliptin (1.07). Lowest binding energy was also observed for linagliptin with DPP-4 in the binding plot. We also identified the number of H-bonds and residues involved in the hydrophobic interactions between the DPP-4 and the anti-diabetic drugs. During interaction, two H-bonds and nine residues, two H-bonds and eleven residues as well as four H-bonds and nine residues were found between the saxagliptin, linagliptin as well as vildagliptin cases and DPP-4, respectively. Our in silico data obtained for drug-target interactions and micro-environmental signature demonstrates linagliptin as the most stable interacting drug among the tested anti-diabetic medicines.

Optical properties of alkali halide crystals from all-electron hybrid TD-DFT calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webster, R., E-mail: ross.webster07@imperial.ac.uk; Harrison, N. M.; Bernasconi, L.

2015-06-07

We present a study of the electronic and optical properties of a series of alkali halide crystals AX, with A = Li, Na, K, Rb and X = F, Cl, Br based on a recent implementation of hybrid-exchange time-dependent density functional theory (TD-DFT) (TD-B3LYP) in the all-electron Gaussian basis set code CRYSTAL. We examine, in particular, the impact of basis set size and quality on the prediction of the optical gap and exciton binding energy. The formation of bound excitons by photoexcitation is observed in all the studied systems and this is shown to be correlated to specific features ofmore » the Hartree-Fock exchange component of the TD-DFT response kernel. All computed optical gaps and exciton binding energies are however markedly below estimated experimental and, where available, 2-particle Green’s function (GW-Bethe-Salpeter equation, GW-BSE) values. We attribute this reduced exciton binding to the incorrect asymptotics of the B3LYP exchange correlation ground state functional and of the TD-B3LYP response kernel, which lead to a large underestimation of the Coulomb interaction between the excited electron and hole wavefunctions. Considering LiF as an example, we correlate the asymptotic behaviour of the TD-B3LYP kernel to the fraction of Fock exchange admixed in the ground state functional c{sub HF} and show that there exists one value of c{sub HF} (∼0.32) that reproduces at least semi-quantitatively the optical gap of this material.« less

Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

NASA Astrophysics Data System (ADS)

Dyer, Brian

2014-03-01

Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

Funnel metadynamics as accurate binding free-energy method

PubMed Central

Limongelli, Vittorio; Bonomi, Massimiliano; Parrinello, Michele

2013-01-01

A detailed description of the events ruling ligand/protein interaction and an accurate estimation of the drug affinity to its target is of great help in speeding drug discovery strategies. We have developed a metadynamics-based approach, named funnel metadynamics, that allows the ligand to enhance the sampling of the target binding sites and its solvated states. This method leads to an efficient characterization of the binding free-energy surface and an accurate calculation of the absolute protein–ligand binding free energy. We illustrate our protocol in two systems, benzamidine/trypsin and SC-558/cyclooxygenase 2. In both cases, the X-ray conformation has been found as the lowest free-energy pose, and the computed protein–ligand binding free energy in good agreement with experiments. Furthermore, funnel metadynamics unveils important information about the binding process, such as the presence of alternative binding modes and the role of waters. The results achieved at an affordable computational cost make funnel metadynamics a valuable method for drug discovery and for dealing with a variety of problems in chemistry, physics, and material science. PMID:23553839

Molecular modeling and residue interaction network studies on the mechanism of binding and resistance of the HCV NS5B polymerase mutants to VX-222 and ANA598.

PubMed

Xue, Weiwei; Jiao, Pingzu; Liu, Huanxiang; Yao, Xiaojun

2014-04-01

Hepatitis C virus (HCV) NS5B protein is an RNA-dependent RNA polymerase (RdRp) with essential functions in viral genome replication and represents a promising therapeutic target to develop direct-acting antivirals (DAAs). Multiple nonnucleoside inhibitors (NNIs) binding sites have been identified within the polymerase. VX-222 and ANA598 are two NNIs targeting thumb II site and palm I site of HCV NS5B polymerase, respectively. These two molecules have been shown to be very effective in phase II clinical trials. However, the emergence of resistant HCV replicon variants (L419M, M423T, I482L mutants to VX-222 and M414T, M414L, G554D mutants to ANA598) has significantly decreased their efficacy. To elucidate the molecular mechanism about how these mutations influenced the drug binding mode and decreased drug efficacy, we studied the binding modes of VX-222 and ANA598 to wild-type and mutant polymerase by molecular modeling approach. Molecular dynamics (MD) simulations results combined with binding free energy calculations indicated that the mutations significantly altered the binding free energy and the interaction for the drugs to polymerase. The further per-residue binding free energy decomposition analysis revealed that the mutations decreased the interactions with several key residues, such as L419, M423, L474, S476, I482, L497, for VX-222 and L384, N411, M414, Y415, Q446, S556, G557 for ANA598. These were the major origins for the resistance to these two drugs. In addition, by analyzing the residue interaction network (RIN) of the complexes between the drugs with wild-type and the mutant polymerase, we found that the mutation residues in the networks involved in the drug resistance possessed a relatively lower size of topology centralities. The shift of betweenness and closeness values of binding site residues in the mutant polymerase is relevant to the mechanism of drug resistance of VX-222 and ANA598. These results can provide an atomic-level understanding about the mechanisms of drug resistance conferred by the studied mutations and will be helpful to design more potent inhibitors which could effectively overcome drug resistance of antivirus agents. Copyright © 2014 Elsevier B.V. All rights reserved.

Enzyme activation through the utilization of intrinsic dianion binding energy.

PubMed

Amyes, T L; Malabanan, M M; Zhai, X; Reyes, A C; Richard, J P

2017-03-01

We consider 'the proposition that the intrinsic binding energy that results from the noncovalent interaction of a specific substrate with the active site of the enzyme is considerably larger than is generally believed. An important part of this binding energy may be utilized to provide the driving force for catalysis, so that the observed binding energy represents only what is left over after this utilization' [Jencks,W.P. (1975) Adv. Enzymol. Relat. Areas. Mol. Biol. , , 219-410]. The large ~12 kcal/mol intrinsic substrate phosphodianion binding energy for reactions catalyzed by triosephosphate isomerase (TIM), orotidine 5'-monophosphate decarboxylase and glycerol-3-phosphate dehydrogenase is divided into 4-6 kcal/mol binding energy that is expressed on the formation of the Michaelis complex in anchoring substrates to the respective enzyme, and 6-8 kcal/mol binding energy that is specifically expressed at the transition state in activating the respective enzymes for catalysis. A structure-based mechanism is described where the dianion binding energy drives a conformational change that activates these enzymes for catalysis. Phosphite dianion plays the active role of holding TIM in a high-energy closed active form, but acts as passive spectator in showing no effect on transition-state structure. The result of studies on mutant enzymes is presented, which support the proposal that the dianion-driven enzyme conformational change plays a role in enhancing the basicity of side chain of E167, the catalytic base, by clamping the base between a pair of hydrophobic side chains. The insight these results provide into the architecture of enzyme active sites and the development of strategies for the de novo design of protein catalysts is discussed. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Synthesis, crystal structure and investigation of mononuclear copper(II) and zinc(II) complexes of a new carboxylate rich tripodal ligand and their interaction with carbohydrates in alkaline aqueous solution

PubMed Central

Stewart, Christopher D.; Pedraza, Mayra; Arman, Hadi; Fan, Hua-Jun; Schilling, Eduardo Luiz; Szpoganicz, Bruno; Musie, Ghezai T.

2016-01-01

A new carboxylate rich asymmetric tripodal ligand, N-[2-carboxybenzomethyl]-N-[carboxymethyl]-β-alanine (H3camb), and its di-copper(II), (NH4)2[1]2, and di-zinc(II), ((CH3)4 N)2[2]2, complexes have been synthesized as carbohydrate binding models in aqueous solutions. The ligand and complexes have been fully characterized using several techniques, including single crystal X-ray diffraction. The interactions of (NH4)2[1]2 and ((CH3)4 N)2[2]2 with D-glucose, D-mannose, D-xylose and xylitol in aqueous alkaline media were investigated using UV–Vis and 13C-NMR spectroscopic techniques, respectively. The molar conductance, NMR and ESI–MS studies indicate that the complexes dissociate in solution to produce the respective complex anions, 1− and 2−. Complexes 1− and 2− showed chelating ability towards the naturally abundant and biologically relevant sugars, D-glucose, D-mannose, D-xylose, and xylitol. The complex ions bind to one molar equivalent of the sugars, even in the presence of stoichiometric excess of the substrates, in solution. Experimentally obtained spectroscopic data and computational results suggest that the substrates bind to the metal center in a bidentate fashion. Apparent binding constant values, pKapp, between the complexes and the substrates were determined and a specific mode of substrate binding is proposed. The pKapp and relativistic density functional theory (DFT) calculated Gibbs free energy values indicate that D-mannose displayed the strongest interaction with the complexes. Syntheses, characterizations, detailed substrate binding studies using spectroscopic techniques, single crystal X-ray diffraction and geometry optimizations of the complex-substrates with DFT calculations are also reported. PMID:25969174

Role of Ligand Reorganization and Conformational Restraints on the Binding Free Energies of DAPY Non-Nucleoside Inhibitors to HIV Reverse Transcriptase

PubMed Central

Gallicchio, Emilio

2012-01-01

The results of computer simulations of the binding of etravirine (TMC125) and rilpivirine (TMC278) to HIV reverse transcriptase are reported. It is confirmed that consistent binding free energy estimates are obtained with or without the application of torsional restraints when the free energies of imposing the restraints are taken into account. The restraints have a smaller influence on the thermodynamics and apparent kinetics of binding of TMC125 compared to the more flexible TMC278 inhibitor. The concept of the reorganization free energy of binding is useful to understand and categorize these effects. Contrary to expectations, the use of conformational restraints did not consistently enhance convergence of binding free energy estimates due to suppression of binding/unbinding pathways and due to the influence of rotational degrees of freedom not directly controlled by the restraints. Physical insights concerning the thermodynamic driving forces for binding and the role of “jiggling” and “wiggling” motion of the ligands are discussed. Based on these insights we conclude that an ideal inhibitor, if chemically realizable, would possess the electrostatic charge distribution of TMC125, so as to form strong interactions with the receptor, and the larger and more flexible substituents of TMC278, so as to minimize reorganization free energy penalties and the effects of resistance mutations, suitably modified, as in TMC125, so as to disfavor the formation of non-binding competent extended conformations when free in solution. PMID:22708073

Isolation of anticancer drug TAXOL from Pestalotiopsis breviseta with apoptosis and B-Cell lymphoma protein docking studies.

PubMed

Kathiravan, G; Sureban, Sripathi M; Sree, Harsha N; Bhuvaneshwari, V; Kramony, Evelin

2012-12-01

Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. TAXOL PRODUCTION WAS CONFIRMED BY THE FOLLOWING METHODS: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of -13.0061 (KJ/Mol) with four hydrogen bonds.

Isolation of anticancer drug TAXOL from Pestalotiopsis breviseta with apoptosis and B-Cell lymphoma protein docking studies

PubMed Central

Kathiravan, G.; Sureban, Sripathi M.; Sree, Harsha N.; Bhuvaneshwari, V.; Kramony, Evelin

2012-01-01

Background: Extraction and investigation of TAXOL from Pestalotiopsis breviseta (Sacc.) using protein docking, which is a computational technique that samples conformations of small molecules in protein-binding sites. Scoring functions are used to assess which of these conformations best complements the protein binding site and active site prediction. Materials and Methods: Coelomycetous fungi P. breviseta (Sacc.) Steyaert was screened for the production of TAXOL, an anticancer drug. Results: TAXOL production was confirmed by the following methods: Ultraviolet (UV) spectroscopic analysis, Infrared analysis, High performance liquid chromatography analysis (HPLC), and Liquid chromatography mass spectrum (LC-MASS). TAXOL produced by the fungi was compared with authentic TAXOL, and protein docking studies were performed. Conclusion: The BCL2 protein of human origin showed a higher affinity toward the compound paclitaxel. It has the binding energy value of −13.0061 (KJ/Mol) with four hydrogen bonds. PMID:24808664

Integrating water exclusion theory into βcontacts to predict binding free energy changes and binding hot spots

PubMed Central

2014-01-01

Background Binding free energy and binding hot spots at protein-protein interfaces are two important research areas for understanding protein interactions. Computational methods have been developed previously for accurate prediction of binding free energy change upon mutation for interfacial residues. However, a large number of interrupted and unimportant atomic contacts are used in the training phase which caused accuracy loss. Results This work proposes a new method, βACV ASA , to predict the change of binding free energy after alanine mutations. βACV ASA integrates accessible surface area (ASA) and our newly defined β contacts together into an atomic contact vector (ACV). A β contact between two atoms is a direct contact without being interrupted by any other atom between them. A β contact’s potential contribution to protein binding is also supposed to be inversely proportional to its ASA to follow the water exclusion hypothesis of binding hot spots. Tested on a dataset of 396 alanine mutations, our method is found to be superior in classification performance to many other methods, including Robetta, FoldX, HotPOINT, an ACV method of β contacts without ASA integration, and ACV ASA methods (similar to βACV ASA but based on distance-cutoff contacts). Based on our data analysis and results, we can draw conclusions that: (i) our method is powerful in the prediction of binding free energy change after alanine mutation; (ii) β contacts are better than distance-cutoff contacts for modeling the well-organized protein-binding interfaces; (iii) β contacts usually are only a small fraction number of the distance-based contacts; and (iv) water exclusion is a necessary condition for a residue to become a binding hot spot. Conclusions βACV ASA is designed using the advantages of both β contacts and water exclusion. It is an excellent tool to predict binding free energy changes and binding hot spots after alanine mutation. PMID:24568581

Effects of the Hydroxyl Group on Phenyl Based Ligand/ERRγ Protein Binding

PubMed Central

2015-01-01

Bisphenol-A (4,4′-dihydroxy-2,2-diphenylpropane, BPA, or BPA-A) and its derivatives, when exposed to humans, may affect functions of multiple organs by specific binding to the human estrogen-related receptor γ (ERRγ). We carried out atomistic molecular dynamics (MD) simulations of three ligand compounds including BPA-A, 4-α-cumylphenol (BPA-C), and 2,2-diphenylpropane (BPA-D) binding to the ligand binding domain (LBD) of a human ERRγ to study the structures and energies associated with the binding. We used the implicit Molecular Mechanics/Poisson–Boltzmann Surface Area (MM/PBSA) method to estimate the free energies of binding for the phenyl based compound/ERRγ systems. The addition of hydroxyl groups to the aromatic ring had only a minor effect on binding structures and a significant effect on ligand/protein binding energy in an aqueous solution. Free binding energies of BPA-D to the ERRγ were found to be considerably less than those of BPA-A and BPA-C to the ERRγ. These results are well correlated with those from experiments where no binding affinities were determined in the BPA-D/ERRγ complex. No conformational change was observed for the helix 12 (H-12) of ERRγ upon binding of these compounds preserving an active transcriptional conformation state. PMID:25098505

Affinity and specificity of serine endopeptidase-protein inhibitor interactions. Empirical free energy calculations based on X-ray crystallographic structures.

PubMed

Krystek, S; Stouch, T; Novotny, J

1993-12-05

An empirical function was used to calculate free energy change (delta G) of complex formation between the following inhibitors and enzymes: Kunitz inhibitor (BPTI) with trypsin, trypsinogen and kallikrein; turkey ovomucoid 3rd domain (OMTKY3) with alpha-chymotrypsin and the Streptomyces griseus protease B; the potato chymotrypsin inhibitor with the protease B; and the barely chymotrypsin inhibitor and eglin-c with subtilisin and thermitase. Using X-ray coordinates of the nine complexes, we estimated the contributions that hydrophobic effect, electrostatic interactions and side-chain conformational entropy make towards the stability of the complexes. The calculated delta G values showed good agreement with the experimentally measured ones, the only exception being the kallikrein/BPTI complex whose X-ray structure was solved at an exceptionally low pH. In complexes with different enzymes, the same inhibitor residues contributed identically towards complex formation (delta G(residue) Spearman rank correlation coefficient 0.7 to 1.0). The most productive enzyme-contacting residues in OMTKY3, eglin-c, and the chymotrypsin inhibitors were found in analogous positions on their respective binding loops; thus, our calculations identified a functional (energetic) motif that parallels the well-known structural similarity of the binding loops. The delta G values calculated for BPTI complexed with trypsin (-21.7 kcal) and trypsinogen (-23.4 kcal) were similar and close to the experimental delta G value of the trypsin/BPTI complex (-18.1 kcal), lending support to the suggestion that the 10(7) difference in the observed stabilities (KA) of these two complexes reflects the energetic cost of conformational changes induced in trypsinogen during the pre-equilibrium stages of complex formation. In almost all of the complexes studied, the stabilization free energy contributed by the inhibitors was larger than that donated by the enzymes. In the trypsin-BPTI complex, the calculated delta G contribution of the amino group from the BPTI residue Lys15 (9.7 kcal) was somewhat higher than that arrived at in experiments with semisynthetic inhibitor analogs (7.5 kcal). In OMTKY3, different binding loop residues are known to affect differently the binding (delta delta G) to alpha-chymotrypsin and protease B; a good qualitative agreement was found between the calculated delta G(residue) estimates and the experimental delta delta G data (correlation coefficient 0.7). Large variations were observed in local surface complementarity and related interfacial volume in the two OMTKY3 complexes (by 20 to 60% for some side-chains).(ABSTRACT TRUNCATED AT 400 WORDS)

Fragmentation cross sections and binding energies of neutron-rich nuclei

NASA Astrophysics Data System (ADS)

Tsang, M. B.; Lynch, W. G.; Friedman, W. A.; Mocko, M.; Sun, Z. Y.; Aoi, N.; Cook, J. M.; Delaunay, F.; Famiano, M. A.; Hui, H.; Imai, N.; Iwasaki, H.; Motobayashi, T.; Niikura, M.; Onishi, T.; Rogers, A. M.; Sakurai, H.; Suzuki, H.; Takeshita, E.; Takeuchi, S.; Wallace, M. S.

2007-10-01

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of Cu76,77,78,79 have been extracted. They are 636.94±0.4,647.1±0.4,651.6±0.4, and 657.8±0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of Cu75 is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-line nuclei, Na39 and Mg40 from the fragmentation of Ca48 are discussed.

Water on BN doped benzene: A hard test for exchange-correlation functionals and the impact of exact exchange on weak binding

DOE PAGES

Al-Hamdani, Yasmine S.; Alfè, Dario; von Lilienfeld, O. Anatole; ...

2014-10-22

Density functional theory (DFT) studies of weakly interacting complexes have recently focused on the importance of van der Waals dispersion forces, whereas the role of exchange has received far less attention. Here, by exploiting the subtle binding between water and a boron and nitrogen doped benzene derivative (1,2-azaborine) we show how exact exchange can alter the binding conformation within a complex. Benchmark values have been calculated for three orientations of the water monomer on 1,2-azaborine from explicitly correlated quantum chemical methods, and we have also used diffusion quantum Monte Carlo. For a host of popular DFT exchange-correlation functionals we showmore » that the lack of exact exchange leads to the wrong lowest energy orientation of water on 1,2-azaborine. As such, we suggest that a high proportion of exact exchange and the associated improvement in the electronic structure could be needed for the accurate prediction of physisorption sites on doped surfaces and in complex organic molecules. Meanwhile to predict correct absolute interaction energies an accurate description of exchange needs to be augmented by dispersion inclusive functionals, and certain non-local van der Waals functionals (optB88- and optB86b-vdW) perform very well for absolute interaction energies. Through a comparison with water on benzene and borazine (B₃N₃H₆) we show that these results could have implications for the interaction of water with doped graphene surfaces, and suggest a possible way of tuning the interaction energy.« less

A scale of metal ion binding strengths correlating with ionic charge, Pauling electronegativity, toxicity, and other physiological effects.

PubMed

Kinraide, Thomas B; Yermiyahu, Uri

2007-09-01

Equilibrium constants for binding to plant plasma membranes have been reported for several metal ions, based upon adsorption studies and zeta-potential measurements. LogK values for the ions are these: Al(3+), 4.30; La(3+), 3.34; Cu(2+), 2.60; Ca(2+) and Mg(2+), 1.48; Na(+) and K(+), 0 M(-1). These values correlate well with logK values for ion binding to many organic and inorganic ligands. LogK values for metal ion binding to 12 ligands were normalized and averaged to produce a scale for the binding of 49 ions. The scale correlates well with the values presented above (R(2)=0.998) and with ion binding to cell walls and other biomass. The scale is closely related to the charge (Z) and Pauling electronegativity (PE) of 48 ions (all but Hg(2+)); R(2)=0.969 for the equation (Scale values)=-1.68+Z(1.22+0.444PE). Minimum rhizotoxicity of metal ions appears to be determined by binding strengths: log a(PM,M)=1.60-2.41exp[0.238(Scale values)] determines the value of ion activities at the plasma membrane surface (a(PM,M)) that will ensure inhibition of root elongation. Additional toxicity appears to be related to softness, accounting for the great toxicity of Ag(+), for example. These binding-strength values correlate with additional physiological effects and are suitable for the computation of cell-surface electrical potentials.

Exciton binding energy in GaAsBiN spherical quantum dot heterostructures

NASA Astrophysics Data System (ADS)

Das, Subhasis; Dhar, S.

2017-03-01

The ground state exciton binding energies (EBE) of heavy hole excitons in GaAs1-x-yBixNy - GaAs spherical quantum dots (QD) are calculated using a variational approach under 1s hydrogenic wavefunctions within the framework of effective mass approximation. Both the nitrogen and the bismuth content in the material are found to affect the binding energy, in particular for larger nitrogen content and lower dot radii. Calculations also show that the ground state exciton binding energies of heavy holes increase more at smaller dot sizes as compared to that for the light hole excitons.

Mechanistic study of manganese-substituted glycerol dehydrogenase using a kinetic and thermodynamic analysis.

PubMed

Fang, Baishan; Niu, Jin; Ren, Hong; Guo, Yingxia; Wang, Shizhen

2014-01-01

Mechanistic insights regarding the activity enhancement of dehydrogenase by metal ion substitution were investigated by a simple method using a kinetic and thermodynamic analysis. By profiling the binding energy of both the substrate and product, the metal ion's role in catalysis enhancement was revealed. Glycerol dehydrogenase (GDH) from Klebsiella pneumoniae sp., which demonstrated an improvement in activity by the substitution of a zinc ion with a manganese ion, was used as a model for the mechanistic study of metal ion substitution. A kinetic model based on an ordered Bi-Bi mechanism was proposed considering the noncompetitive product inhibition of dihydroxyacetone (DHA) and the competitive product inhibition of NADH. By obtaining preliminary kinetic parameters of substrate and product inhibition, the number of estimated parameters was reduced from 10 to 4 for a nonlinear regression-based kinetic parameter estimation. The simulated values of time-concentration curves fit the experimental values well, with an average relative error of 11.5% and 12.7% for Mn-GDH and GDH, respectively. A comparison of the binding energy of enzyme ternary complex for Mn-GDH and GDH derived from kinetic parameters indicated that metal ion substitution accelerated the release of dioxyacetone. The metal ion's role in catalysis enhancement was explicated.

Energetics of Glutamate Binding to an Ionotropic Glutamate Receptor.

PubMed

Yu, Alvin; Lau, Albert Y

2017-11-22

Ionotropic glutamate receptors (iGluRs) are ligand-gated ion channels that are responsible for the majority of excitatory transmission at the synaptic cleft. Mechanically speaking, agonist binding to the ligand binding domain (LBD) activates the receptor by triggering a conformational change that is transmitted to the transmembrane region, opening the ion channel pore. We use fully atomistic molecular dynamics simulations to investigate the binding process in the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, an iGluR subtype. The string method with swarms of trajectories was applied to calculate the possible pathways glutamate traverses during ligand binding. Residues peripheral to the binding cleft are found to metastably bind the ligand prior to ligand entry into the binding pocket. Umbrella sampling simulations were performed to compute the free energy barriers along the binding pathways. The calculated free energy profiles demonstrate that metastable interactions contribute substantially to the energetics of ligand binding and form local minima in the overall free energy landscape. Protein-ligand interactions at sites outside of the orthosteric agonist-binding site may serve to lower the transition barriers of the binding process.

On the contribution of vibrational anharmonicity to the binding energies of water clusters.

PubMed

Diri, Kadir; Myshakin, Evgeniy M; Jordan, Kenneth D

2005-05-05

The second-order vibrational perturbation theory method has been used together with the B3LYP and MP2 electronic structure methods to investigate the effects of anharmonicity on the vibrational zero-point energy (ZPE) contributions to the binding energies of (H2O)n, n = 2-6, clusters. For the low-lying isomers of (H2O)6, the anharmonicity correction to the binding energy is calculated to range from -248 to -355 cm(-1). It is also demonstrated that although high-order electron correlation effects are important for the individual vibrational frequencies, they are relatively unimportant for the net ZPE contributions to the binding energies of water clusters.

The positive binding energy envelopes of low-mass helium stars

NASA Astrophysics Data System (ADS)

Hall, Philip D.; Jeffery, C. Simon

2018-04-01

It has been hypothesized that stellar envelopes with positive binding energy may be ejected if the release of recombination energy can be triggered and the calculation of binding energy includes this contribution. The implications of this hypothesis for the evolution of normal hydrogen-rich stars have been investigated, but the implications for helium stars - which may represent mass-transfer or merger remnants in binary star systems - have not. Making a set of model helium stars, we find that those with masses between 0.9 and 2.4 M⊙ evolve to configurations with positive binding energy envelopes. We discuss consequences of the ejection hypothesis for such stars, and possible observational tests of these predictions.

The volume- and surface-binding energies of ice systems containing CO, CO2, and H2O

NASA Technical Reports Server (NTRS)

Sandford, Scott A.; Allamandola, Louis J.

1990-01-01

Laboratory-measured, temperature-dependent sticking efficiencies are presently used to derive the surface-binding energies of CO and CO2 on H2O-rich ices, with a view to determining the condensation and vaporization properties of these systems as well as to the measured energies' implications for both cometary behavior and the evolution of interstellar ices. The molecular volume and the surface binding energies are not found to be necessarily related on the basis of simple nearest-neighbor scaling in surface and bulk sites; this may be due to the physical constraints associated with matrix structure-associated physical constraints, which sometimes dominate the volume-binding energies.

EMQIT: a machine learning approach for energy based PWM matrix quality improvement.

PubMed

Smolinska, Karolina; Pacholczyk, Marcin

2017-08-01

Transcription factor binding affinities to DNA play a key role for the gene regulation. Learning the specificity of the mechanisms of binding TFs to DNA is important both to experimentalists and theoreticians. With the development of high-throughput methods such as, e.g., ChiP-seq the need to provide unbiased models of binding events has been made apparent. We present EMQIT a modification to the approach introduced by Alamanova et al. and later implemented as 3DTF server. We observed that tuning of Boltzmann factor weights, used for conversion of calculated energies to nucleotide probabilities, has a significant impact on the quality of the associated PWM matrix. Consequently, we proposed to use receiver operator characteristics curves and the 10-fold cross-validation to learn best weights using experimentally verified data from TRANSFAC database. We applied our method to data available for various TFs. We verified the efficiency of detecting TF binding sites by the 3DTF matrices improved with our technique using experimental data from the TRANSFAC database. The comparison showed a significant similarity and comparable performance between the improved and the experimental matrices (TRANSFAC). Improved 3DTF matrices achieved significantly higher AUC values than the original 3DTF matrices (at least by 0.1) and, at the same time, detected notably more experimentally verified TFBSs. The resulting new improved PWM matrices for analyzed factors show similarity to TRANSFAC matrices. Matrices had comparable predictive capabilities. Moreover, improved PWMs achieve better results than matrices downloaded from 3DTF server. Presented approach is general and applicable to any energy-based matrices. EMQIT is available online at http://biosolvers.polsl.pl:3838/emqit . This article was reviewed by Oliviero Carugo, Marek Kimmel and István Simon.

Experimental and theoretical investigation of topological and energetic characteristics of Sb complexes reversibly binding molecular oxygen.

PubMed

Fukin, Georgy K; Baranov, Evgenii V; Jelsch, Christian; Guillot, Benoît; Poddel'sky, Andrey I; Cherkasov, Vladimir K; Abakumov, Gleb A

2011-07-28

The experimental distribution of electron density in Ph(3)(4,5-OMe-3,6-Bu(t)-Cat)Sb·MeCN (1*) and Ph(3)(4,5-N(2)C(4)H(6)-3,6-Bu(t)-Cat)Sb·MeOH (2*) complexes was studied. According to atoms in molecules theory, the Sb-C(Ph), Sb-O(catecholate), and Sb···N(O) bonds are intermediate, whereas the O-C and C-C bonds are covalent, respectively. The energy of the Sb···N(MeCN) and Sb···O(MeOH) bonds are 7.0 and 11.3 kcal/mol according to the Espinosa equation. Density functional theory and Hartree-Fock calculations were carried out for a series of catecholate and amidophenolate complexes of antimony(V). It was shown that such calculations reliably reproduce geometrical and topological parameters and therefore can be used for a criterion search of dioxygen reversible binding by the catecholate and amidophenolate complexes of antimony(V). It was found that the "critical" value of the HOMO energy vary in the range from -5.197 to -5.061 eV for reversible binding of dioxygen complexes. This can serve as a thermodynamic criterion to predict the possibility of the dioxygen reversible binding by the catecholate and amidophenolate complexes of Sb(V). The HOMO energies correlate with the conversion of the catecholate and amidophenolate complexes in corresponding spiroendoperoxide derivatives as well. The contribution of the atom orbitals of the carbon atoms in the five-membered metallocycle to HOMO in complexes with different substitutes in the 4- and 5-positions of the catecholate ligand allows predicting the place of dioxygen addition. © 2011 American Chemical Society

Marine derived compounds as binders of the White spot syndrome virus VP28 envelope protein: In silico insights from molecular dynamics and binding free energy calculations.

PubMed

Sivakumar, K C; Sajeevan, T P; Bright Singh, I S

2016-10-01

White spot syndrome virus (WSSV) remains as one of the most dreadful pathogen of the shrimp aquaculture industry owing to its high virulence. The cumulative mortality reaches up to 100% within in 2-10days in a shrimp farm. Currently, no chemotherapeutics are available to control WSSV. The viral envelope protein, VP28, located on the surface of the virus particle acts as a vital virulence factor in the initial phases of inherent WSSV infection in shrimp. Hence, inhibition of envelope protein VP28 could be a novel way to deal with infection by inhibiting its interaction in the endocytic pathway. In this direction, a timely attempt was made to recognize a potential drug candidate of marine origin against WSSV using VP28 as a target by employing in silico docking and molecular dynamic simulations. A virtual library of 388 marine bioactive compounds was extracted from reports published in Marine Drugs. The top ranking compounds from docking studies were chosen from the flexible docking based on the binding affinities (ΔGb). In addition, the MD simulation and binding free energy analysis were implemented to validate and capture intermolecular interactions. The results suggested that the two compounds obtained a negative binding free energy with -40.453kJ/mol and -31.031kJ/mol for compounds with IDs 30797199 and 144162 respectively. The RMSD curve indicated that 30797199 moves into the hydrophobic core, while the position of 144162 atoms changes abruptly during simulation and is mostly stabilized by water bridges. The shift in RMSD values of VP28 corresponding to ligand RMSD gives an insight into the ligand induced conformational changes in the protein. This study is first of its kind to elucidate the explicit binding of chemical inhibitor to WSSV major structural protein VP28. Copyright © 2016 Elsevier Ltd. All rights reserved.

SAAMBE: Webserver to Predict the Charge of Binding Free Energy Caused by Amino Acids Mutations.

PubMed

Petukh, Marharyta; Dai, Luogeng; Alexov, Emil

2016-04-12

Predicting the effect of amino acid substitutions on protein-protein affinity (typically evaluated via the change of protein binding free energy) is important for both understanding the disease-causing mechanism of missense mutations and guiding protein engineering. In addition, researchers are also interested in understanding which energy components are mostly affected by the mutation and how the mutation affects the overall structure of the corresponding protein. Here we report a webserver, the Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) webserver, which addresses the demand for tools for predicting the change of protein binding free energy. SAAMBE is an easy to use webserver, which only requires that a coordinate file be inputted and the user is provided with various, but easy to navigate, options. The user specifies the mutation position, wild type residue and type of mutation to be made. The server predicts the binding free energy change, the changes of the corresponding energy components and provides the energy minimized 3D structure of the wild type and mutant proteins for download. The SAAMBE protocol performance was tested by benchmarking the predictions against over 1300 experimentally determined changes of binding free energy and a Pearson correlation coefficient of 0.62 was obtained. How the predictions can be used for discriminating disease-causing from harmless mutations is discussed. The webserver can be accessed via http://compbio.clemson.edu/saambe_webserver/.

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Interaction of Gramicidin S and its Aromatic Amino-Acid Analog with Phospholipid Membranes

PubMed Central

Jelokhani-Niaraki, Masoud; Hodges, Robert S.; Meissner, Joseph E.; Hassenstein, Una E.; Wheaton, Laura

2008-01-01

To investigate the mechanism of interaction of gramicidin S-like antimicrobial peptides with biological membranes, a series of five decameric cyclic cationic β-sheet-β-turn peptides with all possible combinations of aromatic D-amino acids, Cyclo(Val-Lys-Leu-D-Ar1-Pro-Val-Lys-Leu-D-Ar2-Pro) (Ar ≡ Phe, Tyr, Trp), were synthesized. Conformations of these cyclic peptides were comparable in aqueous solutions and lipid vesicles. Isothermal titration calorimetry measurements revealed entropy-driven binding of cyclic peptides to POPC and POPE/POPG lipid vesicles. Binding of peptides to both vesicle systems was endothermic—exceptions were peptides containing the Trp-Trp and Tyr-Trp pairs with exothermic binding to POPC vesicles. Application of one- and two-site binding (partitioning) models to binding isotherms of exothermic and endothermic binding processes, respectively, resulted in determination of peptide-lipid membrane binding constants (Kb). The Kb1 and Kb2 values for endothermic two-step binding processes corresponded to high and low binding affinities (Kb1 ≥ 100 Kb2). Conformational change of cyclic peptides in transferring from buffer to lipid bilayer surfaces was estimated using fluorescence resonance energy transfer between the Tyr-Trp pair in one of the peptide constructs. The cyclic peptide conformation expands upon adsorption on lipid bilayer surface and interacts more deeply with the outer monolayer causing bilayer deformation, which may lead to formation of nonspecific transient peptide-lipid porelike zones causing membrane lysis. PMID:18621820

Influences of Mutations on the Electrostatic Binding Free Energies of Chloride Ions in Escherichia Coli ClC

PubMed Central

Yu, Tao; Wang, Xiao-Qing; Sang, Jian-Ping; Pan, Chun-Xu; Zou, Xian-Wu; Chen, Tsung-Yu; Zou, Xiaoqin

2012-01-01

Mutations in ClC channel proteins may cause serious functional changes and even diseases. The function of ClC proteins mainly manifests as Cl− transport, which is related to the binding free energies of chloride ions. Therefore, the influence of a mutation on ClC function can be studied by investigating the mutational effect on the binding free energies of chloride ions. The present study provides quantitative and systematic investigations on the influences of residue mutations on the electrostatic binding free energies in Escherichia coli ClC (EcClC) proteins, using all-atom molecular dynamics simulations. It was found that the change of the electrostatic binding free energy decreases linearly with the increase of the residue-chloride ion distance for a mutation. This work reveals how changes in the charge of a mutated residue and in the distance between the mutated residue and the binding site govern the variations in the electrostatic binding free energies, and therefore influence the transport of chloride ions and conduction in EcClC. This work would facilitate our understanding of the mutational effects on transport of chloride ions and functions of ClC proteins, and provide a guideline to estimate which residue mutations will have great influences on ClC functions. PMID:22612693

A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure-activity relationships using comparative binding energy (COMBINE) analysis.

PubMed

Coderch, Claire; Tang, Yong; Klett, Javier; Zhang, Shu-En; Ma, Yun-Tao; Shaorong, Wang; Matesanz, Ruth; Pera, Benet; Canales, Angeles; Jiménez-Barbero, Jesús; Morreale, Antonio; Díaz, J Fernando; Fang, Wei-Shuo; Gago, Federico

2013-05-14

Ten novel taxanes bearing modifications at the C2 and C13 positions of the baccatin core have been synthesized and their binding affinities for mammalian tubulin have been experimentally measured. The design strategy was guided by (i) calculation of interaction energy maps with carbon, nitrogen and oxygen probes within the taxane-binding site of β-tubulin, and (ii) the prospective use of a structure-based QSAR (COMBINE) model derived from an earlier series comprising 47 congeneric taxanes. The tubulin-binding affinity displayed by one of the new compounds (CTX63) proved to be higher than that of docetaxel, and an updated COMBINE model provided a good correlation between the experimental binding free energies and a set of weighted residue-based ligand-receptor interaction energies for 54 out of the 57 compounds studied. The remaining three outliers from the original training series have in common a large unfavourable entropic contribution to the binding free energy that we attribute to taxane preorganization in aqueous solution in a conformation different from that compatible with tubulin binding. Support for this proposal was obtained from solution NMR experiments and molecular dynamics simulations in explicit water. Our results shed additional light on the determinants of tubulin-binding affinity for this important class of antitumour agents and pave the way for further rational structural modifications.

Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

NASA Astrophysics Data System (ADS)

Pang, Yuan-Ping; Kozikowski, Alan P.

1994-12-01

We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

Role of Desolvation in Thermodynamics and Kinetics of Ligand Binding to a Kinase

PubMed Central

2015-01-01

Computer simulations are used to determine the free energy landscape for the binding of the anticancer drug Dasatinib to its src kinase receptor and show that before settling into a free energy basin the ligand must surmount a free energy barrier. An analysis based on using both the ligand-pocket separation and the pocket-water occupancy as reaction coordinates shows that the free energy barrier is a result of the free energy cost for almost complete desolvation of the binding pocket. The simulations further show that the barrier is not a result of the reorganization free energy of the binding pocket. Although a continuum solvent model gives the location of free energy minima, it is not able to reproduce the intermediate free energy barrier. Finally, it is shown that a kinetic model for the on rate constant in which the ligand diffuses up to a doorway state and then surmounts the desolvation free energy barrier is consistent with published microsecond time-scale simulations of the ligand binding kinetics for this system [Shaw, D. E. et al. J. Am. Chem. Soc.2011, 133, 9181−918321545110]. PMID:25516727

Noncovalent Interactions of Tiopronin-Protected Gold Nanoparticles with DNA: Two Methods to Quantify Free Energy of Binding

PubMed Central

Prado-Gotor, R.; Grueso, E.

2014-01-01

The binding of gold nanoparticles capped with N-(2-mercaptopropionyl)glycine (Au@tiopronin) with double-stranded DNA has been investigated and quantified in terms of free energies by using two different approaches. The first approach follows the DNA conformational changes induced by gold nanoparticles using the CD technique. The second methodology consists in the use of pyrene-1-carboxaldehyde as a fluorescent probe. This second procedure implies the determination of the “true” free energy of binding of the probe with DNA, after corrections through solubility measurements. Working at different salt concentrations, the nonelectrostatic and electrostatic components of the binding free energy have been separated. The results obtained revealed that the binding is of nonelectrostatic character, fundamentally. The procedure used in this work could be extended to quantify the binding affinity of other AuNPs/DNA systems. PMID:24587710

Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

PubMed Central

Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

2017-01-01

AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

On the origin of donor O–H bond weakening in phenol-water complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Pujarini; Mukhopadhyay, Deb Pratim; Chakraborty, Tapas, E-mail: pctc@iacs.res.in

2015-11-28

Matrix isolation infrared spectroscopy has been used to investigate intermolecular interactions in a series of binary O–H⋯O hydrogen bonded phenol-water complexes where water is the common acceptor. The interaction at the binding site has been tuned by incorporating multiple fluorine substitutions at different aromatic ring sites of the phenol moiety. The spectral effects for the aforesaid chemical changes are manifested in the infrared spectra of the complexes as systematic increase in spectral shift of the phenolic O–H stretching fundamental (Δν{sub O–H}). While ν{sub O–H} bands of the monomers of all the fluorophenols appear within a very narrow frequency range, themore » increase in Δν{sub O–H} of the complexes from phenol to pentafluorophenol is very large, nearly 90%. The observed values of Δν{sub O–H} do not show a linear correlation with the total binding energies (ΔE{sub b}) of the complexes, expected according to Badger-Bauer rule. However, in the same Δν{sub O–H} vs ΔE{sub b} plot, nice linear correlations are revealed if the complexes of ortho-fluorophenols are treated separately from their meta/para-substituted analogues. The observations imply that in spite of having the same binding site (O–H⋯O) and the same chemical identities (phenolic), the complexes of ortho and non-ortho fluorophenols do not belong, from the viewpoint of detailed molecular interactions, to a homologous series. Linear correlations of Δν{sub O–H} are, however, observed with respect to the electrostatic component of ΔE{sub b} as well as the quantum mechanical charge transfer interaction energy (E{sub CT}). From quantitative viewpoint, the latter correlation along with the associated electronic structure parameters appears more satisfactory. It has also been noted that the observed Δν{sub O–H} values of the complexes display a linear relationship with the aqueous phase pK{sub a} values of the respective phenol derivatives.« less

Probing the importance of hydrogen bonds in the active site of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation

PubMed Central

Zheng, Zhong-liang; Ye, Mao-qing; Zuo, Zhen-yu; Liu, Zhi-gang; Tai, Keng-chang; Zou, Guo-lin

2006-01-01

Hydrogen bonds occurring in the catalytic triad (Asp32, His64 and Ser221) and the oxyanion hole (Asn155) are very important to the catalysis of peptide bond hydrolysis by serine proteases. For the subtilisin NK (nattokinase), a bacterial serine protease, construction and analysis of a three-dimensional structural model suggested that several hydrogen bonds formed by four residues function to stabilize the transition state of the hydrolysis reaction. These four residues are Ser33, Asp60, Ser62 and Thr220. In order to remove the effect of these hydrogen bonds, four mutants (Ser33→Ala33, Asp60→Ala60, Ser62→Ala62, and Thr220→Ala220) were constructed by site-directed mutagenesis. The results of enzyme kinetics indicated that removal of these hydrogen bonds increases the free-energy of the transition state (ΔΔGT). We concluded that these hydrogen bonds are more important for catalysis than for binding the substrate, because removal of these bonds mainly affects the kcat but not the Km values. A substrate, SUB1 (succinyl-Ala-Ala-Pro-Phe-p-nitroanilide), was used during enzyme kinetics experiments. In the present study we have also shown the results of FEP (free-energy perturbation) calculations with regard to the binding and catalysis reactions for these mutant subtilisins. The calculated difference in FEP also suggested that these four residues are more important for catalysis than binding of the substrate, and the simulated values compared well with the experimental values from enzyme kinetics. The results of MD (molecular dynamics) simulations further demonstrated that removal of these hydrogen bonds partially releases Asp32, His64 and Asn155 so that the stability of the transition state decreases. Another substrate, SUB2 (H-D-Val-Leu-Lys-p-nitroanilide), was used for FEP calculations and MD simulations. PMID:16411898

Probing the importance of hydrogen bonds in the active site of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation.

PubMed

Zheng, Zhong-liang; Ye, Mao-qing; Zuo, Zhen-yu; Liu, Zhi-gang; Tai, Keng-chang; Zou, Guo-lin

2006-05-01

Hydrogen bonds occurring in the catalytic triad (Asp32, His64 and Ser221) and the oxyanion hole (Asn155) are very important to the catalysis of peptide bond hydrolysis by serine proteases. For the subtilisin NK (nattokinase), a bacterial serine protease, construction and analysis of a three-dimensional structural model suggested that several hydrogen bonds formed by four residues function to stabilize the transition state of the hydrolysis reaction. These four residues are Ser33, Asp60, Ser62 and Thr220. In order to remove the effect of these hydrogen bonds, four mutants (Ser33-->Ala33, Asp60-->Ala60, Ser62-->Ala62, and Thr220-->Ala220) were constructed by site-directed mutagenesis. The results of enzyme kinetics indicated that removal of these hydrogen bonds increases the free-energy of the transition state (DeltaDeltaG(T)). We concluded that these hydrogen bonds are more important for catalysis than for binding the substrate, because removal of these bonds mainly affects the kcat but not the K(m) values. A substrate, SUB1 (succinyl-Ala-Ala-Pro-Phe-p-nitroanilide), was used during enzyme kinetics experiments. In the present study we have also shown the results of FEP (free-energy perturbation) calculations with regard to the binding and catalysis reactions for these mutant subtilisins. The calculated difference in FEP also suggested that these four residues are more important for catalysis than binding of the substrate, and the simulated values compared well with the experimental values from enzyme kinetics. The results of MD (molecular dynamics) simulations further demonstrated that removal of these hydrogen bonds partially releases Asp32, His64 and Asn155 so that the stability of the transition state decreases. Another substrate, SUB2 (H-D-Val-Leu-Lys-p-nitroanilide), was used for FEP calculations and MD simulations.

Fragmentation cross sections and binding energies of neutron-rich nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsang, M. B.; Lynch, W. G.; Mocko, M.

An exponential dependence of the fragmentation cross section on the average binding energy is observed and reproduced with a statistical model. The observed functional dependence is robust and allows the extraction of binding energies from measured cross sections. From the systematics of Cu isotope cross sections, the binding energies of {sup 76,77,78,79}Cu have been extracted. They are 636.94{+-}0.4,647.1{+-}0.4,651.6{+-}0.4, and 657.8{+-}0.5 MeV, respectively. Specifically, the uncertainty of the binding energy of {sup 75}Cu is reduced from 980 keV, as listed in the 2003 mass table of Audi, Wapstra, and Thibault to 400 keV. The predicted cross sections of two near drip-linemore » nuclei, {sup 39}Na and {sup 40}Mg from the fragmentation of {sup 48}Ca are discussed.« less

Using the fast fourier transform in binding free energy calculations.

PubMed

Nguyen, Trung Hai; Zhou, Huan-Xiang; Minh, David D L

2018-04-30

According to implicit ligand theory, the standard binding free energy is an exponential average of the binding potential of mean force (BPMF), an exponential average of the interaction energy between the unbound ligand ensemble and a rigid receptor. Here, we use the fast Fourier transform (FFT) to efficiently evaluate BPMFs by calculating interaction energies when rigid ligand configurations from the unbound ensemble are discretely translated across rigid receptor conformations. Results for standard binding free energies between T4 lysozyme and 141 small organic molecules are in good agreement with previous alchemical calculations based on (1) a flexible complex ( R≈0.9 for 24 systems) and (2) flexible ligand with multiple rigid receptor configurations ( R≈0.8 for 141 systems). While the FFT is routinely used for molecular docking, to our knowledge this is the first time that the algorithm has been used for rigorous binding free energy calculations. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Stable biexcitons in two-dimensional metal-halide perovskites with strong dynamic lattice disorder

NASA Astrophysics Data System (ADS)

Thouin, Félix; Neutzner, Stefanie; Cortecchia, Daniele; Dragomir, Vlad Alexandru; Soci, Cesare; Salim, Teddy; Lam, Yeng Ming; Leonelli, Richard; Petrozza, Annamaria; Kandada, Ajay Ram Srimath; Silva, Carlos

2018-03-01

With strongly bound and stable excitons at room temperature, single-layer, two-dimensional organic-inorganic hybrid perovskites are viable semiconductors for light-emitting quantum optoelectronics applications. In such a technological context, it is imperative to comprehensively explore all the factors—chemical, electronic, and structural—that govern strong multiexciton correlations. Here, by means of two-dimensional coherent spectroscopy, we examine excitonic many-body effects in pure, single-layer (PEA) 2PbI4 (PEA = phenylethylammonium). We determine the binding energy of biexcitons—correlated two-electron, two-hole quasiparticles—to be 44 ±5 meV at room temperature. The extraordinarily high values are similar to those reported in other strongly excitonic two-dimensional materials such as transition-metal dichalcogenides. Importantly, we show that this binding energy increases by ˜25 % upon cooling to 5 K. Our work highlights the importance of multiexciton correlations in this class of technologically promising, solution-processable materials, in spite of the strong effects of lattice fluctuations and dynamic disorder.

First Principles Electronic Structure of Mn doped GaAs, GaP, and GaN Semiconductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schulthess, Thomas C; Temmerman, Walter M; Szotek, Zdzislawa

We present first-principles electronic structure calculations of Mn doped III-V semiconductors based on the local spin-density approximation (LSDA) as well as the self-interaction corrected local spin density method (SIC-LSD). We find that it is crucial to use a self-interaction free approach to properly describe the electronic ground state. The SIC-LSD calculations predict the proper electronic ground state configuration for Mn in GaAs, GaP, and GaN. Excellent quantitative agreement with experiment is found for magnetic moment and p-d exchange in (GaMn)As. These results allow us to validate commonly used models for magnetic semiconductors. Furthermore, we discuss the delicate problem of extractingmore » binding energies of localized levels from density functional theory calculations. We propose three approaches to take into account final state effects to estimate the binding energies of the Mn-d levels in GaAs. We find good agreement between computed values and estimates from photoemisison experiments.« less

Electronic Structure Calculations of Ammonia Adsorption on Graphene and Graphene Oxide with Epoxide and Hydroxyl Groups

NASA Astrophysics Data System (ADS)

Nancy Anna Anasthasiya, A.; Khaneja, Mamta; Jeyaprakash, B. G.

2017-10-01

Ammonia adsorption on graphene (G) and graphene oxide (GO) was investigated through density functional theory calculations. In the GO system, the obtained binding energy, band gap, charge transfer and electronic structure revealed that the epoxide (GO-O) and hydroxyl groups (GO-OH) in GO enhance the NH3 adsorption, which leads to the chemisorption of NH3 on GO. The dissociation of NH3 to NH2 and formation of OH was also observed when the O and H atoms were separated at 0.985 Å, 1.019 Å, 1.035 Å, and 1.044 Å for various GO systems. The maximum charge transfer value was found to be 0.054 |e| with the binding energy of 1.143 eV for GO with a single epoxide (GO-1O) group. The charge transfer from NH3 to G or GO and the bond formation in this study agree with the reported experimental results.

Molecular dynamics simulations of AP/HMX composite with a modified force field.

PubMed

Zhu, Wei; Wang, Xijun; Xiao, Jijun; Zhu, Weihua; Sun, Huai; Xiao, Heming

2009-08-15

An all-atom force field for ammonium perchlorate (AP) is developed with the framework of pcff force field. The structural parameters of AP obtained with the modified force field are in good agreement with experimental values. Molecular dynamics (MD) simulations have been performed to investigate AP/HMX (1,3,5,7-tetranitro-1,3,5,7-tetrazocane) composite at different temperatures. The binding energies, thermal expansion coefficient, and the trigger bond lengths of HMX in the AP/HMX composite have been obtained. The binding energies of the system increase slightly with temperature increasing, peak at 245K, and then gradually decrease. The volume thermal expansion coefficient of the AP/HMX composite has been derived from the volume variation with temperature. As the temperature rises, the maximal lengths of the trigger bond N-NO(2) of HMX increase gradually. The simulated results indicate that the maximal length of trigger bond can be used as a criterion for judging the sensitivity of energetic composite.

DFT STUDY OF HYDROGEN STORAGE ON Li- AND Na-DOPED C59B HETEROFULLERENE

NASA Astrophysics Data System (ADS)

Zahedi, Ehsan; Mozaffari, Majid

2014-05-01

Effect of light alkali metal (Li and Na) decorated on the C59B heterofullerene for hydrogen storage is considered using DFT-MPW1PW91 method. Results show that Li and Na atoms strongly prefer to adsorb on top of five-member and six-member ring where a carbon atom is replaced by a boron atom. Significant charge transfer from the alkali metal to the C59B compensates for the electron deficiency of C59B and makes the latter aromatic in nature. Corrected binding energies of hydrogen molecule on the alkali-doped C59B using counterpoise method, structural properties and NBO analysis indicate that first hydrogen molecule is adsorbed physically and does not support minimal conditions of DOE requirement. Finally, positive values of binding energies for the adsorption of a second hydrogen molecule show that alkali doped C59B are capable of storing a maximum of one hydrogen molecule.

Structure and energetics of Cr(CO)6 and Cr(CO)5

NASA Technical Reports Server (NTRS)

Barnes, Leslie A.; Liu, Bowen; Lindh, Roland

1993-01-01

The geometric structures and energetics of Cr(CO)6 and Cr(CO)5 are determined at the modified coupled-pair functional, single and double excitation coupled-cluster (CCSD), and CCSD(T) levels of theory. For Cr(CO)6, the structure and force constants for the totally symmetric representation are in good agreement with experimental data once basis set constants are taken into account. In the largest basis set at the CCSD(T) level of theory, the total binding energy of CR(CO)6 is estimated at around 140 kcal/mol, or about 86 percent of the experimental value. In contrast, the first bond energy of Cr(CO)6 is very well described at the CCSD(T) level of theory, with the best estimated value of 38 kcal/mol being within the experimental uncertainty.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Planck-Benzinger thermal work function: Monoclonal antibody-DNA duplex binding interactions

NASA Astrophysics Data System (ADS)

Chun, Paul W.

We have reexamined the van't Hoff plots and delineation of thermodynamic data of the monoclonal antibodies of Jel 274 and Jel 241 binding to DNA duplex at high ionic strength using fluorescein-labeled oligonucleotide titration with increasing concentrations of the antibody as reported by Tanha and Lee (Nucleic Acid Res, 1997, 25, 1442). To compare the thermodynamic parameters from data over the experimental temperature range of 277-312.5 K, the binding constant from van't Hoff plots is used to evaluate ΔGo(T) from 0 to 400 K using our general linear T3 model, ΔGo(T) = α +βT2+γT3. The limited information provided by the van't Hoff plots and their extensions is not sufficient to describe the variations in the Gibbs free energy change as a function of temperature and other thermodynamic functions observed in these and other biological interactions. Rather, it is necessary to determine a number of thermodynamic parameters, including the heat of reaction, (Th), (Tm), and (TCp), and the thermal set point, (TS), all of which can be precisely assessed using our general linear T3 model. To date, no experimental measurement offers this degree of accuracy. In evaluating the thermodynamic parameters in the binding interaction of monoclonal IgG Jel 241-d[AT]20DNA duplex, it is apparent that at a high NaCl concentration, the range of the compensatory temperatures, (Th) = 155 K and (Tm) = 450 K, is much broader than observed in any other sample, whereas the thermal set points, (TS) = 330 K, is 20-30 K higher. The inherent chemical bond energy ΔHo(T0) is much lower in this sample. The values of thermal agitation energy (heat capacity integrals) are of similar magnitude for all the samples tested. It appears that increasing the NaCl concentration to 130 mM will greatly enhance the binding interaction between the monoclonal antibody and DNA duplex. It is not clear, however, from the limited data available, whether the binding interaction is sequence specific, although logic would suggest it is.

[Binding interaction of harpagoside and bovine serum albumin: spectroscopic methodologies and molecular docking].

PubMed

Cao, Tuan-Wu; Huang, Wen-Bing; Shi, Jian-Wei; He, Wei

2018-03-01

Scrophularia ningpoensis has exhibited a variety of biological activities and been used as a pharmaceutical product for the treatment of inflammatory ailment, rheumatoid arthritis, osteoarthritis and so on. Harpagoside (HAR) is considerer as a main bioactive compound in this plant. Serum albumin has important physiological roles in transportation, distribution and metabolism of many endogenous and exogenous substances in body. It is of great significance to study the interaction mechanism between HAR and bovine serum albumin (BSA). The mechanism of interaction between HAR and BSA was investigated using 2D and 3D fluorescence, synchronous florescence, ultraviolet spectroscopy and molecular docking. According to the analysis of fluorescence spectra, HAR could strongly quench the fluorescence of BSA, and the static quenching process indicated that the decrease in the quenching constant was observed with the increase in temperature. The magnitude of binding constants (KA) was more than 1×10⁵ L·mol⁻¹, and the number of binding sites(n) was approximate to 1. The thermodynamic parameters were calculated through analysis of fluorescence data with Stern-Volmer and Van't Hoff equation. The calculated enthalpy change (ΔH) and entropy change (ΔS) implied that the main interaction forces of HAR with BSA were the bonding interaction between van der Waals forces and hydrogen. The negative values of energy (ΔG) demonstrated that the binding of HAR with BSA was a spontaneous and exothermic process. The binding distance(r) between HAR and BSA was calculated to be about 2.80 nm based on the theory of Frster's non-radiation energy transfer, which indicated that energy is likely to be transfer from BSA to HAR. Both synchronous and 3D florescence spectroscopy clearly revealed that the microenvironment and conformation of BSA changed during the binding interaction between HAR and BSA. The molecular docking analysis revealed HAR is more inclined to BSA and human serum albumin (HSA) in subdomain ⅡA (Sudlow's site I). This study will provide valuable information for understanding the action mechanism of HAR. Copyright© by the Chinese Pharmaceutical Association.

Structural, electronic and vibrational properties of small GaxNy (x+y = 2 5) nanoclusters: a B3LYP-DFT study

NASA Astrophysics Data System (ADS)

Yadav, P. S.; Yadav, R. K.; Agrawal, B. K.

2007-02-01

An ab initio study of the stability, structural and electronic properties has been made for 49 gallium nitride nanoclusters, GaxNy (x+y = 2-5). Among the various configurations corresponding to a fixed x+y = n value, the configuration possessing the maximum value of binding energy (BE) is named as the most stable structure. The vibrational and optical properties have been investigated only for the most stable structures. A B3LYP-DFT/6-311G(3df) method has been employed to optimize the geometries of the nanoclusters fully. The binding energies (BEs), highest-occupied and lowest-unoccupied molecular orbital (HOMO-LUMO) gaps and the bond lengths have been obtained for all the clusters. We have considered the zero-point energy (ZPE) corrections ignored by the earlier workers. The adiabatic and vertical ionization potentials (IPs) and electron affinities (EAs), charge on atoms, dipole moments, vibrational frequencies, infrared intensities (IR Int.), relative infrared intensities (Rel. IR Int.) and Raman scattering activities have been investigated for the most stable structures. The configurations containing the N atoms in majority are seen to be the most stable structures. The strong N-N bond has an important role in stabilizing the clusters. For clusters containing one Ga atom and all the others as N atoms, the BE increases monotonically with the number of the N atoms. The HOMO-LUMO gap and IP fluctuate with the cluster size n, having larger values for the clusters containing odd number of N atoms. On the other hand, the EA decreases with the cluster size up to n = 3, and shows slow fluctuations thereafter for the larger clusters. In general, the adiabatic IP (EA) is smaller (greater) than the vertical IP (EA) because of the lower energies of the most stable ground state of the cationic (anionic) clusters. The optical absorption spectrum or electron energy loss spectrum (EELS) is unique for every cluster, and may be used to characterize a specific cluster. All the predicted physical quantities are in good agreement with the experimental data wherever available. The growth of these most stable structures should be possible in experiments.

The cmc-value of a bolalipid with two phosphocholine headgroups and a C24 alkyl chain: Unusual binding properties of fluorescence probes to bolalipid aggregates.

PubMed

Kordts, Martin; Kerth, Andreas; Drescher, Simon; Ott, Maria; Blume, Alfred

2017-09-01

Bolalipids with a long alkyl chain and two phosphocholine polar groups self-assemble in water into two different types of aggregate structures, namely helical nanofibers at low temperature and two types of micellar aggregates at higher temperature. We tried to determine the critical aggregation concentration (cac) or critical micellar concentration (cmc) of the bolalipid tetracosane-1,24-bis(phosphocholine) (PC-C24-PC) by using different fluorescent probes. The use of pyrene or pyrene derivatives as fluorophores failed, whereas the probes 1,8-ANS and particularly bis-ANS gave consistent results. The structure of the bolalipid aggregates obviously hinders partitioning or binding of pyrene derivatives into the micellar interior, whereas 1,8-ANS and bis-ANS can bind to the surface of the aggregate structures. The observed large increase in fluorescence intensity of bis-ANS indicates that binding to the hydrophobic surface of the aggregates leads to a reduction of the dye mobility. However, binding of bis-ANS is relatively weak, so that the determination of a cac/cmc-value is difficult. Simulations of the intensity curves for PC-C24-PC lead to estimates of the cac/cmc-value of 0.3-1.0×10 -6 M, depending on the structure of the aggregates. Single molecule fluorescence correlation spectroscopy was used to determine the mobility of bis-ANS as a function of concentration of PC-C24-PC. The dye diffusion time and the molecular brightness are lower at low bolalipid concentration, when only free dye is present, and increase at higher concentration when bis-ANS is bound to the aggregates. The experimental cac/cmc-values are higher than those estimated, using an incremental method for the change in Gibbs free energy for micellization with n-alkyl-phosphocholines with only one polar group as a comparison. Apparently, for PC-C24-PC in micellar or fibrous aggregates, more CH 2 groups are exposed to water than in a conventional micelle of an n-alkyl-phosphocholine. Copyright © 2017 Elsevier Inc. All rights reserved.

New Kohn-Sham density functional based on microscopic nuclear and neutron matter equations of state

NASA Astrophysics Data System (ADS)

Baldo, M.; Robledo, L. M.; Schuck, P.; Viñas, X.

2013-06-01

A new version of the Barcelona-Catania-Paris energy functional is applied to a study of nuclear masses and other properties. The functional is largely based on calculated ab initio nuclear and neutron matter equations of state. Compared to typical Skyrme functionals having 10-12 parameters apart from spin-orbit and pairing terms, the new functional has only 2 or 3 adjusted parameters, fine tuning the nuclear matter binding energy and fixing the surface energy of finite nuclei. An energy rms value of 1.58 MeV is obtained from a fit of these three parameters to the 579 measured masses reported in the Audi and Wapstra [Nucl. Phys. ANUPABL0375-947410.1016/j.nuclphysa.2003.11.003 729, 337 (2003)] compilation. This rms value compares favorably with the one obtained using other successful mean field theories, which range from 1.5 to 3.0 MeV for optimized Skyrme functionals and 0.7 to 3.0 for the Gogny functionals. The other properties that have been calculated and compared to experiment are nuclear radii, the giant monopole resonance, and spontaneous fission lifetimes.

Universal binding energy relations in metallic adhesion

NASA Technical Reports Server (NTRS)

Ferrante, J.; Smith, J. R.; Rose, J. J.

1984-01-01

Rose, Smith, and Ferrante have discovered scaling relations which map the adhesive binding energy calculated by Ferrante and Smith onto a single universal binding energy curve. These binding energies are calculated for all combinations of Al(111), Zn(0001), Mg(0001), and Na(110) in contact. The scaling involves normalizing the energy by the maximum binding energy and normalizing distances by a suitable combination of Thomas-Fermi screening lengths. Rose et al. have also found that the calculated cohesive energies of K, Ba, Cu, Mo, and Sm scale by similar simple relations, suggesting the universal relation may be more general than for the simple free electron metals for which it was derived. In addition, the scaling length was defined more generally in order to relate it to measurable physical properties. Further this universality can be extended to chemisorption. A simple and yet quite accurate prediction of a zero temperature equation of state (volume as a function of pressure for metals and alloys) is presented. Thermal expansion coefficients and melting temperatures are predicted by simple, analytic expressions, and results compare favorably with experiment for a broad range of metals.

Optimal Low Energy Earth-Moon Transfers

NASA Technical Reports Server (NTRS)

Griesemer, Paul Ricord; Ocampo, Cesar; Cooley, D. S.

2010-01-01

The optimality of a low-energy Earth-Moon transfer is examined for the first time using primer vector theory. An optimal control problem is formed with the following free variables: the location, time, and magnitude of the transfer insertion burn, and the transfer time. A constraint is placed on the initial state of the spacecraft to bind it to a given initial orbit around a first body, and on the final state of the spacecraft to limit its Keplerian energy with respect to a second body. Optimal transfers in the system are shown to meet certain conditions placed on the primer vector and its time derivative. A two point boundary value problem containing these necessary conditions is created for use in targeting optimal transfers. The two point boundary value problem is then applied to the ballistic lunar capture problem, and an optimal trajectory is shown. Additionally, the ballistic lunar capture trajectory is examined to determine whether one or more additional impulses may improve on the cost of the transfer.

Computation of energy interaction parameters as well as electric dipole intensity parameters for the absorption spectral study of the interaction of Pr(III) with L-phenylalanine, L-glycine, L-alanine and L-aspartic acid in the presence and absence of Ca 2+ in organic solvents

NASA Astrophysics Data System (ADS)

Moaienla, T.; Singh, Th. David; Singh, N. Rajmuhon; Devi, M. Indira

2009-10-01

Studying the absorption difference and comparative absorption spectra of the interaction of Pr(III) and Nd(III) with L-phenylalanine, L-glycine, L-alanine and L-aspartic acid in the presence and absence of Ca 2+ in organic solvents, various energy interaction parameters like Slater-Condon ( FK), Racah ( Ek), Lande factor ( ξ4f), nephelauxetic ratio ( β), bonding ( b1/2), percentage-covalency ( δ) have been evaluated applying partial and multiple regression analysis. The values of oscillator strength ( P) and Judd-Ofelt electric dipole intensity parameter Tλ ( λ = 2, 4, 6) for different 4f-4f transitions have been computed. On analysis of the variation of the various energy interaction parameters as well as the changes in the oscillator strength ( P) and Tλ values reveal the mode of binding with different ligands.

Cross section measurements of radiative KL2,3 RRS in 24Cr and L3M4,5 RRS in 59Pr for Mn Kα1,2 X-rays

NASA Astrophysics Data System (ADS)

Sharma, Veena; Upmanyu, Arun; Singh, Ranjit; Singh, Gurjot; Sharma, Hitesh; Kumar, Sanjeev; Mehta, D.

2017-06-01

The KL2,3 and L3M4,5 radiative resonant Raman scattering (RRS) cross sections have been measured for the quasimonochromatic Mn Kα1,2 X-rays (5.895 keV) in 24Cr (K-shell level width (ΓK) =1.08 eV) and 59 Pr (L3-subshell level width (ΓL3) =3.60 eV), respectively, using targets in metallic and various chemical forms. The incident Mn Kα1,2 X-ray energy is lower than the K-shell binding energy of 24Cr and L3-subshell binding energy of 59Pr by 94 ΓK (Cr) and 94 ΓL3 (Pr), respectively. The experimental measurements were performed with a low energy Ge detector (LEGe) and a radioactive 55Fe annular source in conjunction with 24Cr absorber. The measured cross section values for the 24Cr and 59 Pr elements in their various oxidation states are found to be same within experimental errors. The measurements were further extended to investigate alignment of the intermediate L3-subshell (J =3/2) virtual vacancy states in 59Pr through angular distribution measurements for RRS photon emission, which is found to be isotropic within experimental errors.

On the binding energy and the charge symmetry breaking in A ≤ 16 Λ-hypernuclei

NASA Astrophysics Data System (ADS)

Botta, E.; Bressani, T.; Feliciello, A.

2017-04-01

In recent years, several experiments using magnetic spectrometers provided high precision results in the field of Hypernuclear Physics. In particular, the accurate determination of the Λ-binding energy, BΛ, contributed to stimulate considerably the discussion about the Charge Symmetry Breaking effect in Λ-hypernuclei isomultiplets. We have reorganized the results from the FINUDA experiment and we have obtained a series of BΛ values for Λ-hypernuclei with A≤ 16 by taking into account data only from magnetic spectrometers implementing an absolute calibration of the energy scale (FINUDA at DAΦNE and electroproduction experiments at JLab and at MaMi). We have then critically revisited the results obtained at KEK by the SKS Collaboration in order to make possible a direct comparison between data from experiments with and without such an absolute energy scale. A synopsis of recent spectrometric measurements of BΛ is presented, including also emulsion experiment results. Several interesting conclusions are drawn, among which the equality within the errors of BΛ for the A = 7 , 12 , 16 isomultiplets, based only on recent spectrometric data. This observation is in nice agreement with a recent theoretical prediction. Ideas for possible new measurements which should improve the present experimental knowledge are finally put forward.

Calculations of the free energy of interaction of the c-Fos-c-Jun coiled coil: effects of the solvation model and the inclusion of polarization effects.

PubMed

Zuo, Zhili; Gandhi, Neha S; Mancera, Ricardo L

2010-12-27

The leucine zipper region of activator protein-1 (AP-1) comprises the c-Jun and c-Fos proteins and constitutes a well-known coiled coil protein-protein interaction motif. We have used molecular dynamics (MD) simulations in conjunction with the molecular mechanics/Poisson-Boltzmann generalized-Born surface area [MM/PB(GB)SA] methods to predict the free energy of interaction of these proteins. In particular, the influence of the choice of solvation model, protein force field, and water potential on the stability and dynamic properties of the c-Fos-c-Jun complex were investigated. Use of the AMBER polarizable force field ff02 in combination with the polarizable POL3 water potential was found to result in increased stability of the c-Fos-c-Jun complex. MM/PB(GB)SA calculations revealed that MD simulations using the POL3 water potential give the lowest predicted free energies of interaction compared to other nonpolarizable water potentials. In addition, the calculated absolute free energy of binding was predicted to be closest to the experimental value using the MM/GBSA method with independent MD simulation trajectories using the POL3 water potential and the polarizable ff02 force field, while all other binding affinities were overestimated.

Donor impurity binding energies of coaxial GaAs / Alx Ga1 - x As cylindrical quantum wires in a parallel applied magnetic field

NASA Astrophysics Data System (ADS)

Tshipa, M.; Winkoun, D. P.; Nijegorodov, N.; Masale, M.

2018-04-01

Theoretical investigations are carried out of binding energies of a donor charge assumed to be located exactly at the center of symmetry of two concentric cylindrical quantum wires. The intrinsic confinement potential in the region of the inner cylinder is modeled in any one of the three profiles: simple parabolic, shifted parabolic or the polynomial potential. The potential inside the shell is taken to be a potential step or potential barrier of a finite height. Additional confinement of the charge carriers is due to the vector potential of the axial applied magnetic field. It is found that the binding energies attain maxima in their variations with the radius of the inner cylinder irrespective of the particular intrinsic confinement of the inner cylinder. As the radius of the inner cylinder is increased further, the binding energies corresponding to either the parabolic or the polynomial potentials attain minima at some critical core-radius. Finally, as anticipated, the binding energies increase with the increase of the parallel applied magnetic field. This behaviour of the binding energies is irrespective of the particular electric potential of the nanostructure or its specific dimensions.

BFEE: A User-Friendly Graphical Interface Facilitating Absolute Binding Free-Energy Calculations.

PubMed

Fu, Haohao; Gumbart, James C; Chen, Haochuan; Shao, Xueguang; Cai, Wensheng; Chipot, Christophe

2018-03-26

Quantifying protein-ligand binding has attracted the attention of both theorists and experimentalists for decades. Many methods for estimating binding free energies in silico have been reported in recent years. Proper use of the proposed strategies requires, however, adequate knowledge of the protein-ligand complex, the mathematical background for deriving the underlying theory, and time for setting up the simulations, bookkeeping, and postprocessing. Here, to minimize human intervention, we propose a toolkit aimed at facilitating the accurate estimation of standard binding free energies using a geometrical route, coined the binding free-energy estimator (BFEE), and introduced it as a plug-in of the popular visualization program VMD. Benefitting from recent developments in new collective variables, BFEE can be used to generate the simulation input files, based solely on the structure of the complex. Once the simulations are completed, BFEE can also be utilized to perform the post-treatment of the free-energy calculations, allowing the absolute binding free energy to be estimated directly from the one-dimensional potentials of mean force in simulation outputs. The minimal amount of human intervention required during the whole process combined with the ergonomic graphical interface makes BFEE a very effective and practical tool for the end-user.

First-principles study of the binding energy between nanostructures and its scaling with system size

NASA Astrophysics Data System (ADS)

Tao, Jianmin; Jiao, Yang; Mo, Yuxiang; Yang, Zeng-Hui; Zhu, Jian-Xin; Hyldgaard, Per; Perdew, John P.

2018-04-01

The equilibrium van der Waals binding energy is an important factor in the design of materials and devices. However, it presents great computational challenges for materials built up from nanostructures. Here we investigate the binding-energy scaling behavior from first-principles calculations. We show that the equilibrium binding energy per atom between identical nanostructures can scale up or down with nanostructure size, but can be parametrized for large N with an analytical formula (in meV/atom), Eb/N =a +b /N +c /N2+d /N3 , where N is the number of atoms in a nanostructure and a , b , c , and d are fitting parameters, depending on the properties of a nanostructure. The formula is consistent with a finite large-size limit of binding energy per atom. We find that there are two competing factors in the determination of the binding energy: Nonadditivities of van der Waals coefficients and center-to-center distance between nanostructures. To decode the detail, the nonadditivity of the static multipole polarizability is investigated from an accurate spherical-shell model. We find that the higher-order multipole polarizability displays ultrastrong intrinsic nonadditivity, no matter if the dipole polarizability is additive or not.

Toward an Experimental Quantum Chemistry: Exploring a New Energy Partitioning.

PubMed

Rahm, Martin; Hoffmann, Roald

2015-08-19

Following the work of L. C. Allen, this work begins by relating the central chemical concept of electronegativity with the average binding energy of electrons in a system. The average electron binding energy, χ̅, is in principle accessible from experiment, through photoelectron and X-ray spectroscopy. It can also be estimated theoretically. χ̅ has a rigorous and understandable connection to the total energy. That connection defines a new kind of energy decomposition scheme. The changing total energy in a reaction has three primary contributions to it: the average electron binding energy, the nuclear-nuclear repulsion, and multielectron interactions. This partitioning allows one to gain insight into the predominant factors behind a particular energetic preference. We can conclude whether an energy change in a transformation is favored or resisted by collective changes to the binding energy of electrons, the movement of nuclei, or multielectron interactions. For example, in the classical formation of H2 from atoms, orbital interactions dominate nearly canceling nuclear-nuclear repulsion and two-electron interactions. While in electron attachment to an H atom, the multielectron interactions drive the reaction. Looking at the balance of average electron binding energy, multielectron, and nuclear-nuclear contributions one can judge when more traditional electronegativity arguments can be justifiably invoked in the rationalization of a particular chemical event.

Phytonutrients for controlling starch digestion: evaluation of grape skin extract.

PubMed

Miao, Ming; Jiang, Huan; Jiang, Bo; Zhang, Tao; Cui, Steve W; Jin, Zhengyu

2014-02-15

The objective of this work was to evaluate the structure-function relationship between grape skin extract and human α-amylase. The grape skin extract was characterised as resveratrol-3-O-glucoside by RP-HPLC-ESI-MS, which showed strong inhibition towards α-amylase and the IC50 value was 1.35 mg/ml. The kinetic results demonstrated grape skin extract obeyed the non-competitive mode against amylase. Fluorescence data revealed the ability of grape skin binding to amylase belonged to static quenching mechanism with a complex formation and there was only one binding site in α-amylase for grape skin extract. Docking study showed a best pose with total energy value of -118.3 kJ/mol and grape skin extract interacted with side chain of Asp300 with hydrogen bonds and Van der Waals forces. This preliminary observation provides the basis for further evaluation of the suitability of grape skin extract as natural inhibitor with potential health benefits. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Negatively charged excitons and photoluminescence in asymmetric quantum wells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szlufarska, Izabela; Wojs, Arkadiusz; Quinn, John J.

2001-02-15

We study photoluminescence (PL) of charged excitons (X{sup -}) in narrow asymmetric quantum wells in high magnetic fields B. The binding of all X{sup -} states strongly depends on the separation {delta} of electron and hole layers. The most sensitive is the ''bright'' singlet, whose binding energy decreases quickly with increasing {delta} even at relatively small B. As a result, the value of B at which the singlet-triplet crossing occurs in the X{sup -} spectrum also depends on {delta}, and decreases from 35 T in a symmetric 10 nm GaAs well to 16 T for {delta}=0.5 nm. Since the criticalmore » values of {delta} at which different X{sup -} states unbind are surprisingly small compared to the well width, the observation of strongly bound X{sup -} states in an experimental PL spectrum implies virtually no layer displacement in the sample. This casts doubt on the interpretation of PL spectra of heterojunctions in terms of X{sup -} recombination.« less

Evidence of bovine serum albumin-viologen herbicide binding interaction and associated structural modifications

NASA Astrophysics Data System (ADS)

Roy, Swarup; Saxena, Shailendra K.; Mishra, Suryakant; Yogi, Priyanka; Sagdeo, P. R.; Kumar, Rajesh

2017-07-01

The binding ability of viologen herbicide with bovine serum albumin (BSA) has been investigated to understand viologen associated hazards by investigating ethyl viologen's (EV) binding using various spectroscopies and in-silico molecular docking approaches. Apparent association constant (1.3 × 104 L/mol), calculated using UV-Vis spectra indicating a moderate complex formation between BSA and EV. A static mode of fluorescence quenching has been observed as evident from inverse temperature dependence of Stern-Volmer quenching constant which also confirms an EV-BSA complex formation. Emission and time resolved fluorescence studies reveal that the emission quenching of BSA with EV is initiated by static quenching mechanism. A moderately strong binding affinity between EV and BSA has been observed (binding constant value of 7.58 × 104 L/Mol) using fluorescence quenching titration, obtained at 298 K. Quantitative measurements of thermodynamic parameters like enthalpy and entropy changes clearly indicates hydrophobic force responsible for EV-BSA complex formation. The binding distance between EV and BSA was found to be 4.48 nm are involved in non-radiative energy transfer process. Furthermore, from the circular dichroism spectra it was observed that addition of EV is also found to change the secondary structure of BSA which leads to decrease in α-helix. Above mentioned results are found to be in consonance with molecular docking simulations and supports the EV-BSA binding.

From clusters to bulk: A relativistic density functional investigation on a series of gold clusters Aun, n=6,…,147

NASA Astrophysics Data System (ADS)

Häberlen, Oliver D.; Chung, Sai-Cheong; Stener, Mauro; Rösch, Notker

1997-03-01

A series of gold clusters spanning the size range from Au6 through Au147 (with diameters from 0.7 to 1.7 nm) in icosahedral, octahedral, and cuboctahedral structure has been theoretically investigated by means of a scalar relativistic all-electron density functional method. One of the main objectives of this work was to analyze the convergence of cluster properties toward the corresponding bulk metal values and to compare the results obtained for the local density approximation (LDA) to those for a generalized gradient approximation (GGA) to the exchange-correlation functional. The average gold-gold distance in the clusters increases with their nuclearity and correlates essentially linearly with the average coordination number in the clusters. An extrapolation to the bulk coordination of 12 yields a gold-gold distance of 289 pm in LDA, very close to the experimental bulk value of 288 pm, while the extrapolated GGA gold-gold distance is 297 pm. The cluster cohesive energy varies linearly with the inverse of the calculated cluster radius, indicating that the surface-to-volume ratio is the primary determinant of the convergence of this quantity toward bulk. The extrapolated LDA binding energy per atom, 4.7 eV, overestimates the experimental bulk value of 3.8 eV, while the GGA value, 3.2 eV, underestimates the experiment by almost the same amount. The calculated ionization potentials and electron affinities of the clusters may be related to the metallic droplet model, although deviations due to the electronic shell structure are noticeable. The GGA extrapolation to bulk values yields 4.8 and 4.9 eV for the ionization potential and the electron affinity, respectively, remarkably close to the experimental polycrystalline work function of bulk gold, 5.1 eV. Gold 4f core level binding energies were calculated for sites with bulk coordination and for different surface sites. The core level shifts for the surface sites are all positive and distinguish among the corner, edge, and face-centered sites; sites in the first subsurface layer show still small positive shifts.

Predicting relative binding affinities of non-peptide HIV protease inhibitors with free energy perturbation calculations

NASA Astrophysics Data System (ADS)

McCarrick, Margaret A.; Kollman, Peter A.

1999-03-01

The relative binding free energies in HIV protease of haloperidol thioketal (THK) and three of its derivatives were examined with free energy calculations. THK is a weak inhibitor (IC50 = 15 μM) for which two cocrystal structures with HIV type 1 proteases have been solved [Rutenber, E. et al., J. Biol. Chem., 268 (1993) 15343]. A THK derivative with a phenyl group on C2 of the piperidine ring was expected to be a poor inhibitor based on experiments with haloperidol ketal and its 2- phenyl derivative (Caldera, P., personal communication). Our calculations predict that a 5-phenyl THK derivative, suggested based on examination of the crystal structure, will bind significantly better than THK. Although there are large error bars as estimated from hysteresis, the calculations predict that the 5-phenyl substituent is clearly favored over the 2-phenyl derivative as well as the parent compound. The unfavorable free energies of solvation of both phenyl THK derivatives relative to the parent compound contributed to their predicted binding free energies. In a third simulation, the change in binding free energy for 5-benzyl THK relative to THK was calculated. Although this derivative has a lower free energy in the protein, its decreased free energy of solvation increases the predicted ΔΔG(bind) to the same range as that of the 2-phenyl derivative.

Orientation-dependent structural and photocatalytic properties of LaCoO3 epitaxial nano-thin films

NASA Astrophysics Data System (ADS)

Zhang, Yan-ping; Liu, Hai-feng; Hu, Hai-long; Xie, Rui-shi; Ma, Guo-hua; Huo, Ji-chuan; Wang, Hai-bin

2018-02-01

LaCoO3 epitaxial films were grown on (100), (110) and (111) oriented LaAlO3 substrates by the polymer-assisted deposition method. Crystal structure measurement and cross-section observation indicate that all the LaCoO3 films are epitaxially grown in accordance with the orientation of LaAlO3 substrates, with biaxial compressive strain in the ab plane. Owing to the different strain directions of CoO6 octahedron, the mean Co-O bond length increases by different amounts in (100), (110) and (111) oriented films compared with that of bulk LaCoO3, and the (100) oriented LaCoO3 has the largest increase. Photocatalytic degradation of methyl orange indicates that the order of photocatalytic activity of the three oriented films is (100) > (111) > (110). Combined with analysis of electronic nature and band structure for LaCoO3 films, it is found that the change of the photocatalytic activity is closely related to the crystal field splitting energy of Co3+ and Co-O binding energy. The increase in the mean Co-O bond length will decrease the crystal field splitting energy of Co3+ and Co-O binding energy and further reduce the value of band gap energy, thus improving the photocatalytic activity. This may also provide a clue for expanding the visible-light-induced photocatalytic application of LaCoO3.

Systematic theoretical study of ethylene adsorption on δ-MoC(001), TiC(001), and ZrC(001) surfaces

DOE PAGES

Jimenez-Orozco, Carlos; Florez, Elizabeth; Moreno, Andres; ...

2016-05-31

A systematic study of ethylene adsorption over δ-MoC(001), TiC(001), and ZrC(001) surfaces was conducted by means of calculations based on periodic density functional theory. The structure and electronic properties of each carbide pristine surface had a strong influence in the bonding of ethylene. It was found that the metal and carbon sites of the carbide could participate in the adsorption process. As a consequence of this, very different bonding mechanisms were seen on δ-MoC(001) and TiC(001). The bonding of the molecule on the TMC(001) systems showed only minor similarities to the type of bonding found on a typical metal likemore » Pt(111). In general, the ethylene binding energy follow the trend in stability: ZrC(001) < TiC(001) < δ-MoC(001) < Pt(111). The van der Waals correction to the energy produces large binding energy values, modifies the stability orders and drives the ethylene closer to the surface but the adsorbate geometry parameters remain unchanged. Ethylene was activated on clearly defined binding geometries, changing its hybridization from sp 2 to sp 3 with an elongation (0.16–0.31 Å) of the C=C bond. As a result, on the basis of this theoretical study, δ-MoC(001) is proposed as a potential catalyst for the hydrogenation of olefins, whereas TiC(001) could be useful for their hydrogenolysis.« less

Faddeev calculation for ^9_ΛBe hypernucleus

NASA Astrophysics Data System (ADS)

Suslov, Vladimir; Filikhin, Igor; Vlahovic, Branislav

2003-04-01

Faddeev calculations are performed for the ^9_ΛBe hypernucleus in terms of α's and Λ clusters using various Λα potential models. The main goal of our calculations is to estimate higher partial waves contribution in binding energy of ^9_ΛBe ground state (1/2^+) and particularly contribution from the high partial waves of the Λα pair. Phenomenological Ali-Bodmer potential is employed for description of the αα interaction. This potential has s, d and g - waves components. For a Λα potential both form and parameters are uncertain, because Λα interaction data are limited by the experimental value of binding energy of the ^5_ΛHe hypernucleus, which is considered as the bound s-wave state of the Λα system. The binding energy of the ^9_ΛBe is calculated for two different cases. First the s-wave Λα potential acting in all partial waves in the Λα subsystem is used. Second, a recent more realistic Λα potential model including the s and p-partial components from work [1] is employed. We compared these models and discussed validity of the s-wave approximation for calculation of ^9_ΛBe hypernucleus. This work was partially supported by Department of Defenses through the grant No.DAAD 19-01-1-0795. The work of V.M.S and I.N.F was supported by the RFFI under Grant No. 02-02-16562. References: [1] K.S. Myint, S. Shinmura and Y. Akaishi, nucl-th/0209090.

Interaction of ions, atoms, and small molecules with quantized vortex lines in superfluid (4)He.

PubMed

Mateo, David; Eloranta, Jussi; Williams, Gary A

2015-02-14

The interaction of a number of impurities (H2, Ag, Cu, Ag2, Cu2, Li, He3 (+), He(*) ((3)S), He2 (∗) ((3)Σu), and e(-)) with quantized rectilinear vortex lines in superfluid (4)He is calculated by using the Orsay-Trento density functional theory (DFT) method at 0 K. The Donnelly-Parks (DP) potential function binding ions to the vortex is combined with DFT data, yielding the impurity radius as well as the vortex line core parameter. The vortex core parameter at 0 K (0.74 Å) obtained either directly from the vortex line geometry or through the DP potential fitting is smaller than previously suggested but is compatible with the value obtained from re-analysis of the Rayfield-Reif experiment. All of the impurities have significantly higher binding energies to vortex lines below 1 K than the available thermal energy, where the thermally assisted escape process becomes exponentially negligible. Even at higher temperatures 1.5-2.0 K, the trapping times for larger metal clusters are sufficiently long that the previously observed metal nanowire assembly in superfluid helium can take place at vortex lines. The binding energy of the electron bubble is predicted to decrease as a function of both temperature and pressure, which allows adjusting the trap depth for either permanent trapping or to allow thermally assisted escape. Finally, a new scheme for determining the trapping of impurities on vortex lines by optical absorption spectroscopy is outlined and demonstrated for He(*).

Interaction of ions, atoms, and small molecules with quantized vortex lines in superfluid 4He

NASA Astrophysics Data System (ADS)

Mateo, David; Eloranta, Jussi; Williams, Gary A.

2015-02-01

The interaction of a number of impurities (H2, Ag, Cu, Ag2, Cu2, Li, He3 + , He* (3S), He2∗ (3Σu), and e-) with quantized rectilinear vortex lines in superfluid 4He is calculated by using the Orsay-Trento density functional theory (DFT) method at 0 K. The Donnelly-Parks (DP) potential function binding ions to the vortex is combined with DFT data, yielding the impurity radius as well as the vortex line core parameter. The vortex core parameter at 0 K (0.74 Å) obtained either directly from the vortex line geometry or through the DP potential fitting is smaller than previously suggested but is compatible with the value obtained from re-analysis of the Rayfield-Reif experiment. All of the impurities have significantly higher binding energies to vortex lines below 1 K than the available thermal energy, where the thermally assisted escape process becomes exponentially negligible. Even at higher temperatures 1.5-2.0 K, the trapping times for larger metal clusters are sufficiently long that the previously observed metal nanowire assembly in superfluid helium can take place at vortex lines. The binding energy of the electron bubble is predicted to decrease as a function of both temperature and pressure, which allows adjusting the trap depth for either permanent trapping or to allow thermally assisted escape. Finally, a new scheme for determining the trapping of impurities on vortex lines by optical absorption spectroscopy is outlined and demonstrated for He*.

In Silico Molecular Modeling and Docking Studies on Novel Mutants (E229V, H225P and D230C) of the Nucleotide-Binding Domain of Homo sapiens Hsp70.

PubMed

Elengoe, Asita; Hamdan, Salehhuddin

2017-12-01

In this study, we explored the possibility of determining the synergistic interactions between nucleotide-binding domain (NBD) of Homo sapiens heat-shock 70 kDa protein (Hsp70) and E1A 32 kDa of adenovirus serotype 5 motif (PNLVP) in the efficiency of killing of tumor cells in cancer treatment. At present, the protein interaction between NBD and PNLVP motif is still unknown, but believed to enhance the rate of virus replication in tumor cells. Three mutant models (E229V, H225P and D230C) were built and simulated, and their interactions with PNLVP motif were studied. The PNLVP motif showed the binding energy and intermolecular energy values with the novel E229V mutant at -7.32 and -11.2 kcal/mol. The E229V mutant had the highest number of hydrogen bonds (7). Based on the root mean square deviation, root mean square fluctuation, hydrogen bonds, salt bridge, secondary structure, surface-accessible solvent area, potential energy and distance matrices analyses, it was proved that the E229V had the strongest and most stable interaction with the PNLVP motif among all the four protein-ligand complex structures. The knowledge of this protein-ligand complex model would help in designing Hsp70 structure-based drug for cancer therapy.

Virtual screening of integrase inhibitors by large scale binding free energy calculations: the SAMPL4 challenge

PubMed Central

Gallicchio, Emilio; Deng, Nanjie; He, Peng; Wickstrom, Lauren; Perryman, Alexander L.; Santiago, Daniel N.; Forli, Stefano; Olson, Arthur J.; Levy, Ronald M.

2014-01-01

As part of the SAMPL4 blind challenge, filtered AutoDock Vina ligand docking predictions and large scale binding energy distribution analysis method binding free energy calculations have been applied to the virtual screening of a focused library of candidate binders to the LEDGF site of the HIV integrase protein. The computational protocol leveraged docking and high level atomistic models to improve enrichment. The enrichment factor of our blind predictions ranked best among all of the computational submissions, and second best overall. This work represents to our knowledge the first example of the application of an all-atom physics-based binding free energy model to large scale virtual screening. A total of 285 parallel Hamiltonian replica exchange molecular dynamics absolute protein-ligand binding free energy simulations were conducted starting from docked poses. The setup of the simulations was fully automated, calculations were distributed on multiple computing resources and were completed in a 6-weeks period. The accuracy of the docked poses and the inclusion of intramolecular strain and entropic losses in the binding free energy estimates were the major factors behind the success of the method. Lack of sufficient time and computing resources to investigate additional protonation states of the ligands was a major cause of mispredictions. The experiment demonstrated the applicability of binding free energy modeling to improve hit rates in challenging virtual screening of focused ligand libraries during lead optimization. PMID:24504704

The effects of value on context-item associative memory in younger and older adults.

PubMed

Hennessee, Joseph P; Knowlton, Barbara J; Castel, Alan D

2018-02-01

Valuable items are often remembered better than items that are less valuable by both older and younger adults, but older adults typically show deficits in binding. Here, we examine whether value affects the quality of recognition memory and the binding of incidental details to valuable items. In Experiment 1, participants learned English words each associated with a point-value they earned for correct recognition with the goal of maximizing their score. In Experiment 2, value was manipulated by presenting items that were either congruent or incongruent with an imagined state of physiological need (e.g., hunger). In Experiment 1, point-value was associated with enhanced recollection in both age groups. Memory for the color associated with the word was in fact reduced for high-value recollected items compared with low-value recollected items, suggesting value selectively enhances binding of task-relevant details. In Experiment 2, memory for learned images was enhanced by value in both age groups. However, value differentially enhanced binding of an imagined context to the item in younger and older adults, with a strong trend for increased binding in younger adults only. These findings suggest that value enhances episodic encoding in both older and younger adults but that binding of associated details may be reduced for valuable items compared to less valuable items, particularly in older adults. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Theoretical Studies of Hydrogen Storage Alloys.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jonsson, Hannes

Theoretical calculations were carried out to search for lightweight alloys that can be used to reversibly store hydrogen in mobile applications, such as automobiles. Our primary focus was on magnesium based alloys. While MgH{sub 2} is in many respects a promising hydrogen storage material, there are two serious problems which need to be solved in order to make it useful: (i) the binding energy of the hydrogen atoms in the hydride is too large, causing the release temperature to be too high, and (ii) the diffusion of hydrogen through the hydride is so slow that loading of hydrogen into themore » metal takes much too long. In the first year of the project, we found that the addition of ca. 15% of aluminum decreases the binding energy to the hydrogen to the target value of 0.25 eV which corresponds to release of 1 bar hydrogen gas at 100 degrees C. Also, the addition of ca. 15% of transition metal atoms, such as Ti or V, reduces the formation energy of interstitial H-atoms making the diffusion of H-atoms through the hydride more than ten orders of magnitude faster at room temperature. In the second year of the project, several calculations of alloys of magnesium with various other transition metals were carried out and systematic trends in stability, hydrogen binding energy and diffusivity established. Some calculations of ternary alloys and their hydrides were also carried out, for example of Mg{sub 6}AlTiH{sub 16}. It was found that the binding energy reduction due to the addition of aluminum and increased diffusivity due to the addition of a transition metal are both effective at the same time. This material would in principle work well for hydrogen storage but it is, unfortunately, unstable with respect to phase separation. A search was made for a ternary alloy of this type where both the alloy and the corresponding hydride are stable. Promising results were obtained by including Zn in the alloy.« less

Tight-binding molecular-dynamics study of point defects in GaAs

NASA Astrophysics Data System (ADS)

Seong, Hyangsuk; Lewis, Laurent J.

1995-08-01

Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.

Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

PubMed

Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

2015-11-01

The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

One-pot synthesis via 1, 3-dipolar cycloaddition reaction to piperazinyl-quinolinyl dispiro heterocyclic derivatives and spectrofluorometric and molecular docking studies on their binding with human serum albumin

NASA Astrophysics Data System (ADS)

Murugesan, Arul; Gengan, Robert Moonsamy; Rajamanikandan, Ramar; Ilanchelian, Malaichamy

2017-12-01

A series of novel dispiro piperazinyl-quinolinyl-thioxothiazolidin-2, 4-dione derivatives were synthesised and characterised by FT-IR 1H, 13C, 2D NMR and HRMS spectroscopic techniques. A representative compound 1'-(2-(4-methylpiperazin-1-yl)quinolin-3-yl)-2″-thioxo-5‧,6‧,7‧,7a'-tetrahydro-1‧H,2H-dispiro[acenaphthylene-1,3‧-pyrrolizine-2‧,5″-thiazolidine]-2,4″-dione was studied for its binding ability with human serum albumin (HSA) using the fluorescence quench titration method. Addition of the compound to HSA produced slight fluorescence quenching and red shift. The free energy change for the complexation process was evaluated as -29.98 kJ mol-1 thereby indicating a spontaneous and highly favourable reaction. Molecular docking analyses revealed the binding as -20.79 kJ mol-1 which was analogous with the experimental value obtained from emission data. It was concluded that TYR-263 is the moiety responsible for the binding in the complex.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Makarewicz, Jan, E-mail: jama@amu.edu.pl; Shirkov, Leonid

The pyridine-Ar (PAr) van der Waals (vdW) complex is studied using a high level ab initio method. Its structure, binding energy, and intermolecular vibrational states are determined from the analytical potential energy surface constructed from interaction energy (IE) values computed at the coupled cluster level of theory with single, double, and perturbatively included triple excitations with the augmented correlation consistent polarized valence double-ζ (aug-cc-pVDZ) basis set complemented by midbond functions. The structure of the complex at its global minimum with Ar at a distance of 3.509 Å from the pyridine plane and shifted by 0.218 Å from the center ofmore » mass towards nitrogen agrees well with the corresponding equilibrium structure derived previously from the rotational spectrum of PAr. The PAr binding energy D{sub e} of 392 cm{sup −1} is close to that of 387 cm{sup −1} calculated earlier at the same ab initio level for the prototypical benzene-Ar (BAr) complex. However, under an extension of the basis set, D{sub e} for PAr becomes slightly lower than D{sub e} for BAr. The ab initio vdW vibrational energy levels allow us to estimate the reliability of the methods for the determination of the vdW fundamentals from the rotational spectra. To disclose the character of the intermolecular interaction in PAr, the symmetry-adapted perturbation theory (SAPT) is employed for the analysis of different physical contributions to IE. It is found that SAPT components of IE can be approximately expressed in the binding region by only two of them: the exchange repulsion and dispersion energy. The total induction effect is negligible. The interrelations between various SAPT components found for PAr are fulfilled for a few other complexes involving aromatic molecules and Ar or Ne, which indicates that they are valid for all rare gas (Rg) atoms and aromatics.« less

Novel Automatic Electrochemical-mechanical Polishing (ECMP) of Metals for Scanning Electron Microscopy (Postprint)

DTIC Science & Technology

2010-03-23

Micron 41 (2010) 615–621 619 Fig. 4 . XPS binding energy (eV) versus sputtering time (s) results for the Ti 2p peaks for the titanium samples: (a...improved the IQ values. 4 . Conclusions The electrochemical–mechanical polishing system (ECMP) removed material from titanium and nickel alloys at a...March 2014 4 . TITLE AND SUBTITLE NOVEL AUTOMATIC ELECTROCHEMICAL-MECHANICAL POLISHING (ECMP) OF METALS FOR SCANNING ELECTRON MICROSCOPY

A general and fast scoring function for protein-ligand interactions: a simplified potential approach.

PubMed

Muegge, I; Martin, Y C

1999-03-11

A fast, simplified potential-based approach is presented that estimates the protein-ligand binding affinity based on the given 3D structure of a protein-ligand complex. This general, knowledge-based approach exploits structural information of known protein-ligand complexes extracted from the Brookhaven Protein Data Bank and converts it into distance-dependent Helmholtz free interaction energies of protein-ligand atom pairs (potentials of mean force, PMF). The definition of an appropriate reference state and the introduction of a correction term accounting for the volume taken by the ligand were found to be crucial for deriving the relevant interaction potentials that treat solvation and entropic contributions implicitly. A significant correlation between experimental binding affinities and computed score was found for sets of diverse protein-ligand complexes and for sets of different ligands bound to the same target. For 77 protein-ligand complexes taken from the Brookhaven Protein Data Bank, the calculated score showed a standard deviation from observed binding affinities of 1.8 log Ki units and an R2 value of 0.61. The best results were obtained for the subset of 16 serine protease complexes with a standard deviation of 1.0 log Ki unit and an R2 value of 0.86. A set of 33 inhibitors modeled into a crystal structure of HIV-1 protease yielded a standard deviation of 0.8 log Ki units from measured inhibition constants and an R2 value of 0.74. In contrast to empirical scoring functions that show similar or sometimes better correlation with observed binding affinities, our method does not involve deriving specific parameters that fit the observed binding affinities of protein-ligand complexes of a given training set. We compared the performance of the PMF score, Böhm's score (LUDI), and the SMOG score for eight different test sets of protein-ligand complexes. It was found that for the majority of test sets the PMF score performs best. The strength of the new approach presented here lies in its generality as no knowledge about measured binding affinities is needed to derive atomic interaction potentials. The use of the new scoring function in docking studies is outlined.

The Universal Statistical Distributions of the Affinity, Equilibrium Constants, Kinetics and Specificity in Biomolecular Recognition

PubMed Central

Zheng, Xiliang; Wang, Jin

2015-01-01

We uncovered the universal statistical laws for the biomolecular recognition/binding process. We quantified the statistical energy landscapes for binding, from which we can characterize the distributions of the binding free energy (affinity), the equilibrium constants, the kinetics and the specificity by exploring the different ligands binding with a particular receptor. The results of the analytical studies are confirmed by the microscopic flexible docking simulations. The distribution of binding affinity is Gaussian around the mean and becomes exponential near the tail. The equilibrium constants of the binding follow a log-normal distribution around the mean and a power law distribution in the tail. The intrinsic specificity for biomolecular recognition measures the degree of discrimination of native versus non-native binding and the optimization of which becomes the maximization of the ratio of the free energy gap between the native state and the average of non-native states versus the roughness measured by the variance of the free energy landscape around its mean. The intrinsic specificity obeys a Gaussian distribution near the mean and an exponential distribution near the tail. Furthermore, the kinetics of binding follows a log-normal distribution near the mean and a power law distribution at the tail. Our study provides new insights into the statistical nature of thermodynamics, kinetics and function from different ligands binding with a specific receptor or equivalently specific ligand binding with different receptors. The elucidation of distributions of the kinetics and free energy has guiding roles in studying biomolecular recognition and function through small-molecule evolution and chemical genetics. PMID:25885453

Review of MEMS differential scanning calorimetry for biomolecular study

NASA Astrophysics Data System (ADS)

Yu, Shifeng; Wang, Shuyu; Lu, Ming; Zuo, Lei

2017-12-01

Differential scanning calorimetry (DSC) is one of the few techniques that allow direct determination of enthalpy values for binding reactions and conformational transitions in biomolecules. It provides the thermodynamics information of the biomolecules which consists of Gibbs free energy, enthalpy and entropy in a straightforward manner that enables deep understanding of the structure function relationship in biomolecules such as the folding/unfolding of protein and DNA, and ligand bindings. This review provides an up to date overview of the applications of DSC in biomolecular study such as the bovine serum albumin denaturation study, the relationship between the melting point of lysozyme and the scanning rate. We also introduce the recent advances of the development of micro-electro-mechanic-system (MEMS) based DSCs.

Exhaustive search and solvated interaction energy (SIE) for virtual screening and affinity prediction

NASA Astrophysics Data System (ADS)

Sulea, Traian; Hogues, Hervé; Purisima, Enrico O.

2012-05-01

We carried out a prospective evaluation of the utility of the SIE (solvation interaction energy) scoring function for virtual screening and binding affinity prediction. Since experimental structures of the complexes were not provided, this was an exercise in virtual docking as well. We used our exhaustive docking program, Wilma, to provide high-quality poses that were rescored using SIE to provide binding affinity predictions. We also tested the combination of SIE with our latest solvation model, first shell of hydration (FiSH), which captures some of the discrete properties of water within a continuum model. We achieved good enrichment in virtual screening of fragments against trypsin, with an area under the curve of about 0.7 for the receiver operating characteristic curve. Moreover, the early enrichment performance was quite good with 50% of true actives recovered with a 15% false positive rate in a prospective calculation and with a 3% false positive rate in a retrospective application of SIE with FiSH. Binding affinity predictions for both trypsin and host-guest complexes were generally within 2 kcal/mol of the experimental values. However, the rank ordering of affinities differing by 2 kcal/mol or less was not well predicted. On the other hand, it was encouraging that the incorporation of a more sophisticated solvation model into SIE resulted in better discrimination of true binders from binders. This suggests that the inclusion of proper Physics in our models is a fruitful strategy for improving the reliability of our binding affinity predictions.

Discrete structural features among interface residue-level classes.

PubMed

Sowmya, Gopichandran; Ranganathan, Shoba

2015-01-01

Protein-protein interaction (PPI) is essential for molecular functions in biological cells. Investigation on protein interfaces of known complexes is an important step towards deciphering the driving forces of PPIs. Each PPI complex is specific, sensitive and selective to binding. Therefore, we have estimated the relative difference in percentage of polar residues between surface and the interface for each complex in a non-redundant heterodimer dataset of 278 complexes to understand the predominant forces driving binding. Our analysis showed ~60% of protein complexes with surface polarity greater than interface polarity (designated as class A). However, a considerable number of complexes (~40%) have interface polarity greater than surface polarity, (designated as class B), with a significantly different p-value of 1.66E-45 from class A. Comprehensive analyses of protein complexes show that interface features such as interface area, interface polarity abundance, solvation free energy gain upon interface formation, binding energy and the percentage of interface charged residue abundance distinguish among class A and class B complexes, while electrostatic visualization maps also help differentiate interface classes among complexes. Class A complexes are classical with abundant non-polar interactions at the interface; however class B complexes have abundant polar interactions at the interface, similar to protein surface characteristics. Five physicochemical interface features analyzed from the protein heterodimer dataset are discriminatory among the interface residue-level classes. These novel observations find application in developing residue-level models for protein-protein binding prediction, protein-protein docking studies and interface inhibitor design as drugs.

Discrete structural features among interface residue-level classes

PubMed Central

2015-01-01

Background Protein-protein interaction (PPI) is essential for molecular functions in biological cells. Investigation on protein interfaces of known complexes is an important step towards deciphering the driving forces of PPIs. Each PPI complex is specific, sensitive and selective to binding. Therefore, we have estimated the relative difference in percentage of polar residues between surface and the interface for each complex in a non-redundant heterodimer dataset of 278 complexes to understand the predominant forces driving binding. Results Our analysis showed ~60% of protein complexes with surface polarity greater than interface polarity (designated as class A). However, a considerable number of complexes (~40%) have interface polarity greater than surface polarity, (designated as class B), with a significantly different p-value of 1.66E-45 from class A. Comprehensive analyses of protein complexes show that interface features such as interface area, interface polarity abundance, solvation free energy gain upon interface formation, binding energy and the percentage of interface charged residue abundance distinguish among class A and class B complexes, while electrostatic visualization maps also help differentiate interface classes among complexes. Conclusions Class A complexes are classical with abundant non-polar interactions at the interface; however class B complexes have abundant polar interactions at the interface, similar to protein surface characteristics. Five physicochemical interface features analyzed from the protein heterodimer dataset are discriminatory among the interface residue-level classes. These novel observations find application in developing residue-level models for protein-protein binding prediction, protein-protein docking studies and interface inhibitor design as drugs. PMID:26679043

Determining the folding and binding free energy of DNA-based nanodevices and nanoswitches using urea titration curves

PubMed Central

Idili, Andrea

2017-01-01

Abstract DNA nanotechnology takes advantage of the predictability of DNA interactions to build complex DNA-based functional nanoscale structures. However, when DNA functional and responsive units that are based on non-canonical DNA interactions are employed it becomes quite challenging to predict, understand and control their thermodynamics. In response to this limitation, here we demonstrate the use of isothermal urea titration experiments to estimate the free energy involved in a set of DNA-based systems ranging from unimolecular DNA-based nanoswitches to more complex DNA folds (e.g. aptamers) and nanodevices. We propose here a set of fitting equations that allow to analyze the urea titration curves of these DNA responsive units based on Watson–Crick and non-canonical interactions (stem-loop, G-quadruplex, triplex structures) and to correctly estimate their relative folding and binding free energy values under different experimental conditions. The results described herein will pave the way toward the use of urea titration experiments in the field of DNA nanotechnology to achieve easier and more reliable thermodynamic characterization of DNA-based functional responsive units. More generally, our results will be of general utility to characterize other complex supramolecular systems based on different biopolymers. PMID:28605461

Model of directed lines for square ice with second-neighbor and third-neighbor interactions

NASA Astrophysics Data System (ADS)

Kirov, Mikhail V.

2018-02-01

The investigation of the properties of nanoconfined systems is one of the most rapidly developing scientific fields. Recently it has been established that water monolayer between two graphene sheets forms square ice. Because of the energetic disadvantage, in the structure of the square ice there are no longitudinally arranged molecules. The result is that the structure is formed by unidirectional straight-lines of hydrogen bonds only. A simple but accurate discrete model of square ice with second-neighbor and third-neighbor interactions is proposed. According to this model, the ground state includes all configurations which do not contain three neighboring unidirectional chains of hydrogen bonds. Each triplet increases the energy by the same value. This new model differs from an analogous model with long-range interactions where in the ground state all neighboring chains are antiparallel. The new model is suitable for the corresponding system of point electric (and magnetic) dipoles on the square lattice. It allows separately estimating the different contributions to the total binding energy and helps to understand the properties of infinite monolayers and finite nanostructures. Calculations of the binding energy for square ice and for point dipole system are performed using the packages TINKER and LAMMPS.

Specific intermolecular interactions of conserved water molecules with amino acids in the Galectin-1 carbohydrate recognition domain

NASA Astrophysics Data System (ADS)

Di Lella, Santiago; Petruk, Ariel A.; Armiño, Diego J. Alonso de; Álvarez, Rosa M. S.

2010-08-01

Water molecules, rigidly associated to protein surfaces, play a key role in stabilizing biomolecules and participating in their biological functions. Recent studies on the solvation properties of the carbohydrate recognition domain of Galectin-1 by means of molecular dynamic simulations have revealed the existence of several water sites which were well correlated to both the bound water molecules observed in the crystal structure of the protein in the free state and to some of the hydroxyl groups of the carbohydrate ligand observed in the crystal structure of the complexed protein. In this work, we present a study using quantum mechanical methods (B3LYP/6-311++G(3df,3dp)//B3LYP/6-31+G(d)) to determine the energy involved in the binding of these water molecules to specific amino acids in the carbohydrate recognition domain of the protein. By modeling the hydroxyl groups of the carbohydrate by methanol, the energies associated to the local interactions between the ligand and the protein have been evaluated by replacing specific water molecules with methanol. The values of the binding energies have been compared to those previously obtained by the molecular dynamic method.

Exploring the Origin of Differential Binding Affinities of Human Tubulin Isotypes αβII, αβIII and αβIV for DAMA-Colchicine Using Homology Modelling, Molecular Docking and Molecular Dynamics Simulations

PubMed Central

Panda, Dulal; Kunwar, Ambarish

2016-01-01

Tubulin isotypes are found to play an important role in regulating microtubule dynamics. The isotype composition is also thought to contribute in the development of drug resistance as tubulin isotypes show differential binding affinities for various anti-cancer agents. Tubulin isotypes αβII, αβIII and αβIV show differential binding affinity for colchicine. However, the origin of differential binding affinity is not well understood at the molecular level. Here, we investigate the origin of differential binding affinity of a colchicine analogue N-deacetyl-N-(2-mercaptoacetyl)-colchicine (DAMA-colchicine) for human αβII, αβIII and αβIV isotypes, employing sequence analysis, homology modeling, molecular docking, molecular dynamics simulation and MM-GBSA binding free energy calculations. The sequence analysis study shows that the residue compositions are different in the colchicine binding pocket of αβII and αβIII, whereas no such difference is present in αβIV tubulin isotypes. Further, the molecular docking and molecular dynamics simulations results show that residue differences present at the colchicine binding pocket weaken the bonding interactions and the correct binding of DAMA-colchicine at the interface of αβII and αβIII tubulin isotypes. Post molecular dynamics simulation analysis suggests that these residue variations affect the structure and dynamics of αβII and αβIII tubulin isotypes, which in turn affect the binding of DAMA-colchicine. Further, the binding free-energy calculation shows that αβIV tubulin isotype has the highest binding free-energy and αβIII has the lowest binding free-energy for DAMA-colchicine. The order of binding free-energy for DAMA-colchicine is αβIV ≃ αβII >> αβIII. Thus, our computational approaches provide an insight into the effect of residue variations on differential binding of αβII, αβIII and αβIV tubulin isotypes with DAMA-colchicine and may help to design new analogues with higher binding affinities for tubulin isotypes. PMID:27227832

Exciton Binding Energy of Monolayer WS2

PubMed Central

Zhu, Bairen; Chen, Xi; Cui, Xiaodong

2015-01-01

The optical properties of monolayer transition metal dichalcogenides (TMDC) feature prominent excitonic natures. Here we report an experimental approach to measuring the exciton binding energy of monolayer WS2 with linear differential transmission spectroscopy and two-photon photoluminescence excitation spectroscopy (TP-PLE). TP-PLE measurements show the exciton binding energy of 0.71 ± 0.01 eV around K valley in the Brillouin zone. PMID:25783023

A computational analysis of the binding model of MDM2 with inhibitors

NASA Astrophysics Data System (ADS)

Hu, Guodong; Wang, Dunyou; Liu, Xinguo; Zhang, Qinggang

2010-08-01

It is a new and promising strategy for anticancer drug design to block the MDM2-p53 interaction using a non-peptide small-molecule inhibitor. We carry out molecular dynamics simulations to study the binding of a set of six non-peptide small-molecule inhibitors with the MDM2. The relative binding free energies calculated using molecular mechanics Poisson-Boltzmann surface area method produce a good correlation with experimentally determined results. The study shows that the van der Waals energies are the largest component of the binding free energy for each complex, which indicates that the affinities of these inhibitors for MDM2 are dominated by shape complementarity. The A-ligands and the B-ligands are the same except for the conformation of 2,2-dimethylbutane group. The quantum mechanics and the binding free energies calculation also show the B-ligands are the more possible conformation of ligands. Detailed binding free energies between inhibitors and individual protein residues are calculated to provide insights into the inhibitor-protein binding model through interpretation of the structural and energetic results from the simulations. The study shows that G1, G2 and G3 group mimic the Phe19, Trp23 and Leu26 residues in p53 and their interactions with MDM2, but the binding model of G4 group differs from the original design strategy to mimic Leu22 residue in p53.

Stretched proton-neutron configurations in fp-shell nuclei (II). Systematics

NASA Astrophysics Data System (ADS)

von Neumann-Cosel, P.; Fister, U.; Jahn, R.; Schenk, P.; Trelle, T. K.; Wenzel, D.; Wienands, U.

1994-03-01

The systematics of the binding energies of stretched proton-neutron configurations ( f{7}/{2}, g{9}/{2}) 8 -, ( p{3}/{2}, g{9}/{2}) 6 -, ( g{9}/{2}, p{3}/{2}) 6- and ( g{9}/{2}) 29 + are studied over a wide range of f p-shell nuclei. The effective proton-neutron interaction energies deduced from the data are nearly constant for ( p{3}/{2}, g{9}/{2}) 6 -and ( g{9}/{2}) 29 + states while the ( f{7}/{2}, g{9}/{2}) 8 - configuration reveals an additional repulsive term proportional to the partial filling of the f{7}/{2} orbit in the target ground state. Two-body matrix elements are extracted. A crude shell model, which predicts that the excitation energy of a stretched state is equal to the sum of the single-particle energies, works well for the 6 - and 9 + states, but fails for the 8 - levels due to neglect of the additional interactions described above. The physics underlying the empirically introduced basic assumptions of the crude shell model is discussed. The binding energies are found to be linearly dependent on the mass number A and the isospin Tz component and are well described by the weak-coupling model of Bansal and French. The derived parameters agree with averaged values of a similar analysis for the single-particle states in the corresponding odd-even neighbours. The data indicate a significant change of the particle-hole energies with closure of the proton f{7}/{2} shell.

In silico studies and fluorescence binding assays of potential anti-prion compounds reveal an important binding site for prion inhibition from PrP(C) to PrP(Sc).

PubMed

Pagadala, Nataraj S; Perez-Pineiro, Rolando; Wishart, David S; Tuszynski, Jack A

2015-02-16

To understand the pharmacophore properties of 2-aminothiazoles and design novel inhibitors against the prion protein, a highly predictive 3D quantitative structure-activity relationship (QSAR) has been developed by performing comparative molecular field analysis (CoMFA) and comparative similarity analysis (CoMSIA). Both CoMFA and CoMSIA maps reveal the presence of the oxymethyl groups in meta and para positions on the phenyl ring of compound 17 (N-[4-(3,4-dimethoxyphenyl)-1,3-thiazol-2-yl]quinolin-2-amine), is necessary for activity while electro-negative nitrogen of quinoline is highly favorable to enhance activity. The blind docking results for these compounds show that the compound with quinoline binds with higher affinity than isoquinoline and naphthalene groups. Out of 150 novel compounds retrieved using finger print analysis by pharmacophoric model predicted based on five test sets of compounds, five compounds with diverse scaffolds were selected for biological evaluation as possible PrP inhibitors. Molecular docking combined with fluorescence quenching studies show that these compounds bind to pocket-D of SHaPrP near Trp145. The new antiprion compounds 3 and 6, which bind with the interaction energies of -12.1 and -13.2 kcal/mol, respectively, show fluorescence quenching with binding constant (Kd) values of 15.5 and 44.14 μM, respectively. Further fluorescence binding assays with compound 5, which is similar to 2-aminothiazole as a positive control, also show that the molecule binds to the pocket-D with the binding constant (Kd) value of 84.7 μM. Finally, both molecular docking and a fluorescence binding assay of noscapine as a negative control reveals the same binding site on the surface of pocket-A near a rigid loop between β2 and α2 interacting with Arg164. This high level of correlation between molecular docking and fluorescence quenching studies confirm that these five compounds are likely to act as inhibitors for prion propagation while noscapine might act as a prion accelerator from PrP(C) to PrP(Sc). Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Resolving the problem of trapped water in binding cavities: prediction of host-guest binding free energies in the SAMPL5 challenge by funnel metadynamics

NASA Astrophysics Data System (ADS)

Bhakat, Soumendranath; Söderhjelm, Pär

2017-01-01

The funnel metadynamics method enables rigorous calculation of the potential of mean force along an arbitrary binding path and thereby evaluation of the absolute binding free energy. A problem of such physical paths is that the mechanism characterizing the binding process is not always obvious. In particular, it might involve reorganization of the solvent in the binding site, which is not easily captured with a few geometrically defined collective variables that can be used for biasing. In this paper, we propose and test a simple method to resolve this trapped-water problem by dividing the process into an artificial host-desolvation step and an actual binding step. We show that, under certain circumstances, the contribution from the desolvation step can be calculated without introducing further statistical errors. We apply the method to the problem of predicting host-guest binding free energies in the SAMPL5 blind challenge, using two octa-acid hosts and six guest molecules. For one of the hosts, well-converged results are obtained and the prediction of relative binding free energies is the best among all the SAMPL5 submissions. For the other host, which has a narrower binding pocket, the statistical uncertainties are slightly higher; longer simulations would therefore be needed to obtain conclusive results.

Energy Fluctuations Shape Free Energy of Nonspecific Biomolecular Interactions

NASA Astrophysics Data System (ADS)

Elkin, Michael; Andre, Ingemar; Lukatsky, David B.

2012-01-01

Understanding design principles of biomolecular recognition is a key question of molecular biology. Yet the enormous complexity and diversity of biological molecules hamper the efforts to gain a predictive ability for the free energy of protein-protein, protein-DNA, and protein-RNA binding. Here, using a variant of the Derrida model, we predict that for a large class of biomolecular interactions, it is possible to accurately estimate the relative free energy of binding based on the fluctuation properties of their energy spectra, even if a finite number of the energy levels is known. We show that the free energy of the system possessing a wider binding energy spectrum is almost surely lower compared with the system possessing a narrower energy spectrum. Our predictions imply that low-affinity binding scores, usually wasted in protein-protein and protein-DNA docking algorithms, can be efficiently utilized to compute the free energy. Using the results of Rosetta docking simulations of protein-protein interactions from Andre et al. (Proc. Natl. Acad. Sci. USA 105:16148, 2008), we demonstrate the power of our predictions.

Deconstructing thermodynamic parameters of a coupled system from site-specific observables.

PubMed

Chowdhury, Sandipan; Chanda, Baron

2010-11-02

Cooperative interactions mediate information transfer between structural domains of a protein molecule and are major determinants of protein function and modulation. The prevalent theories to understand the thermodynamic origins of cooperativity have been developed to reproduce the complex behavior of a global thermodynamic observable such as ligand binding or enzyme activity. However, in most cases the measurement of a single global observable cannot uniquely define all the terms that fully describe the energetics of the system. Here we establish a theoretical groundwork for analyzing protein thermodynamics using site-specific information. Our treatment involves extracting a site-specific parameter (defined as χ value) associated with a structural unit. We demonstrate that, under limiting conditions, the χ value is related to the direct interaction terms associated with the structural unit under observation and its intrinsic activation energy. We also introduce a site-specific interaction energy term (χ(diff)) that is a function of the direct interaction energy of that site with every other site in the system. When combined with site-directed mutagenesis and other molecular level perturbations, analyses of χ values of site-specific observables may provide valuable insights into protein thermodynamics and structure.

Spectro Analytical, Computational and In Vitro Biological Studies of Novel Substituted Quinolone Hydrazone and it's Metal Complexes.

PubMed

Nagula, Narsimha; Kunche, Sudeepa; Jaheer, Mohmed; Mudavath, Ravi; Sivan, Sreekanth; Ch, Sarala Devi

2018-01-01

Some novel transition metal [Cu (II), Ni (II) and Co (II)] complexes of nalidixic acid hydrazone have been prepared and characterized by employing spectro-analytical techniques viz: elemental analysis, 1 H-NMR, Mass, UV-Vis, IR, TGA-DTA, SEM-EDX, ESR and Spectrophotometry studies. The HyperChem 7.5 software was used for geometry optimization of title compound in its molecular and ionic forms. Quantum mechanical parameters, contour maps of highest occupied molecular orbitals (HOMO) and lowest unoccupied molecular orbitals (LUMO) and corresponding binding energy values were computed using semi empirical single point PM3 method. The stoichiometric equilibrium studies of metal complexes carried out spectrophotometrically using Job's continuous variation and mole ratio methods inferred formation of 1:2 (ML 2 ) metal complexes in respective systems. The title compound and its metal complexes screened for antibacterial and antifungal properties, exemplified improved activity in metal complexes. The studies of nuclease activity for the cleavage of CT- DNA and MTT assay for in vitro cytotoxic properties involving metal complexes exhibited high activity. In addition, the DNA binding properties of Cu (II), Ni (II) and Co (II) complexes investigated by electronic absorption and fluorescence measurements revealed their good binding ability and commended agreement of K b values obtained from both the techniques. Molecular docking studies were also performed to find the binding affinity of synthesized compounds with DNA (PDB ID: 1N37) and "Thymidine phosphorylase from E.coli" (PDB ID: 4EAF) protein targets.

Bovine serum albumin binding study to erlotinib using surface plasmon resonance and molecular docking methods.

PubMed

Taghipour, Parvin; Zakariazadeh, Mostafa; Sharifi, Maryam; Ezzati Nazhad Dolatabadi, Jafar; Barzegar, Abolfazl

2018-06-01

Bovine serum albumin (BSA) is the most abundant protein in the blood circulation and it is commonly used for drug delivery in blood. Therefore, we aim to study BSA interaction with erlotinib as an anticancer drug using surface plasmon resonance (SPR) and molecular modeling methods under physiological conditions (pH = 7.4). BSA immobilized on carboxymethyl dextran hydrogel Au chip (CMD) after activation with N-hydroxysuccinimide and N-ethyl-N-(3-diethylaminopropyl) carbodiimide and then the erlotinib binding to BSA at different concentrations was evaluated. Increasing of erlotinib concentration led to dose-response sensorgrams of BSA. The amount of equilibrium constant (K D ) at 25 °C (4.25 × 10 -9 ) showed the high affinity of erlotinib to BSA. Thermodynamic parameters were attained at four different temperatures. The positive value of enthalpy and entropy showed that hydrophobic forces play major role in the interaction of erlotinib with BSA. Besides, the positive value of Gibbs free energy demonstrated that the interaction of erlotinib with BSA was nonspontaneous and enthalpy driven and the complexion of drug were dependent on endothermic process. According to the molecular docking study, the most favorable binding sites of erlotinib on the BSA were subdomain IIIA and IB. Moreover, molecular docking study results showed that hydrogen binding has a role in intermolecular force that stabilize erlotinib-BSA complex. Copyright © 2018 Elsevier B.V. All rights reserved.

Molecular rationale delineating the role of lycopene as a potent HMG-CoA reductase inhibitor: in vitro and in silico study.

PubMed

Alvi, Sahir Sultan; Iqbal, Danish; Ahmad, Saheem; Khan, M Salman

2016-09-01

This study initially aimed to depict the molecular rationale evolving the role of lycopene in inhibiting the enzymatic activity of β-hydroxy-β-methylglutaryl-CoA (HMG-CoA) reductase via in vitro and in silico analysis. Our results illustrated that lycopene exhibited strong HMG-CoA reductase inhibitory activity (IC50 value of 36 ng/ml) quite better than pravastatin (IC50 = 42 ng/ml) and strong DPPH free radical scavenging activity (IC50 value = 4.57 ± 0.23 μg/ml) as compared to ascorbic acid (IC50 value = 9.82 ± 0.42 μg/ml). Moreover, the Ki value of lycopene (36 ng/ml) depicted via Dixon plot was well concurred with an IC50 value of 36 ± 1.8 ng/ml. Moreover, molecular informatics study showed that lycopene exhibited binding energy of -5.62 kcal/mol indicating high affinity for HMG-CoA reductase than HMG-CoA (ΔG: -5.34 kcal/mol). Thus, in silico data clearly demonstrate and support the in vitro results that lycopene competitively inhibit HMG-CoA reductase activity by binding at the hydrophobic portion of HMG-CoA reductase.

The feasibility of an efficient drug design method with high-performance computers.

PubMed

Yamashita, Takefumi; Ueda, Akihiko; Mitsui, Takashi; Tomonaga, Atsushi; Matsumoto, Shunji; Kodama, Tatsuhiko; Fujitani, Hideaki

2015-01-01

In this study, we propose a supercomputer-assisted drug design approach involving all-atom molecular dynamics (MD)-based binding free energy prediction after the traditional design/selection step. Because this prediction is more accurate than the empirical binding affinity scoring of the traditional approach, the compounds selected by the MD-based prediction should be better drug candidates. In this study, we discuss the applicability of the new approach using two examples. Although the MD-based binding free energy prediction has a huge computational cost, it is feasible with the latest 10 petaflop-scale computer. The supercomputer-assisted drug design approach also involves two important feedback procedures: The first feedback is generated from the MD-based binding free energy prediction step to the drug design step. While the experimental feedback usually provides binding affinities of tens of compounds at one time, the supercomputer allows us to simultaneously obtain the binding free energies of hundreds of compounds. Because the number of calculated binding free energies is sufficiently large, the compounds can be classified into different categories whose properties will aid in the design of the next generation of drug candidates. The second feedback, which occurs from the experiments to the MD simulations, is important to validate the simulation parameters. To demonstrate this, we compare the binding free energies calculated with various force fields to the experimental ones. The results indicate that the prediction will not be very successful, if we use an inaccurate force field. By improving/validating such simulation parameters, the next prediction can be made more accurate.

Bichromophoric dyes for wavelength shifting of dye-protein fluoromodules.

PubMed

Pham, Ha H; Szent-Gyorgyi, Christopher; Brotherton, Wendy L; Schmidt, Brigitte F; Zanotti, Kimberly J; Waggoner, Alan S; Armitage, Bruce A

2015-03-28

Dye-protein fluoromodules consist of fluorogenic dyes and single chain antibody fragments that form brightly fluorescent noncovalent complexes. This report describes two new bichromophoric dyes that extend the range of wavelengths of excitation or emission of existing fluoromodules. In one case, a fluorogenic thiazole orange (TO) was attached to an energy acceptor dye, Cy5. Upon binding to a protein that recognizes TO, red emission due to efficient energy transfer from TO to Cy5 replaces the green emission observed for monochromophoric TO bound to the same protein. Separately, TO was attached to a coumarin that serves as an energy donor. The same green emission is observed for coumarin-TO and TO bound to a protein, but efficient energy transfer allows violet excitation of coumarin-TO, versus longer wavelength, blue excitation of monochromophoric TO. Both bichromophores exhibit low nanomolar KD values for their respective proteins, >95% energy transfer efficiency and high fluorescence quantum yields.

Bichromophoric Dyes for Wavelength Shifting of Dye-Protein Fluoromodules

PubMed Central

Pham, Ha H.; Szent-Gyorgyi, Christopher; Brotherton, Wendy L.; Schmidt, Brigitte F.; Zanotti, Kimberly J.; Waggoner, Alan S.

2015-01-01

Dye-protein fluoromodules consist of fluorogenic dyes and single chain antibody fragments that form brightly fluorescent noncovalent complexes. This report describes two new bichromophoric dyes that extend the range of wavelengths of excitation or emission of existing fluoromodules. In one case, a fluorogenic thiazole orange (TO) was attached to an energy acceptor dye, Cy5. Upon binding to a protein that recognizes TO, red emission due to efficient energy transfer from TO to Cy5 replaces the green emission observed for monochromophoric TO bound to the same protein. Separately, TO was attached to a coumarin that serves as an energy donor. The same green emission is observed for coumarin-TO and TO bound to a protein, but efficient energy transfer allows violet excitation of coumarin-TO, versus longer wavelength, blue excitation of monochromophoric TO. Both bichromophores exhibit low nanomolar KD values for their respective proteins, >95% energy transfer efficiency and high fluorescence quantum yields. PMID:25679477

X-ray production cross sections at incident photon energies across the M{sub i} (i=1-5) edges of {sub 90}Th

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaur, Rajnish; Shehla,; Kumar, Anil

2015-08-28

The X-ray production cross sections for the M{sub k} (k= ξ, δ, α, β, ζ, γ, m{sub 1}, m{sub 2}) groups of X-rays have been evaluated at incident photon energies across the M{sub i} (i =1-5) edges of {sub 90}Th using the relativistic Hartree-Fock-Slater model based photoionisation cross sections and recently reported values of the M-shell X-ray emission rates, fluorescence and Coster Kronig yields. Further, the energies of the prominent (M{sub i}-S{sub j}) (S{sub j}=N{sub j}, O{sub j} and i =1-3, j =1-7) resonant Raman scattered (RRS) peaks at different incident photon energies have also been evaluated using the neutral-atommore » electron binding energies (E{sub sj}) based on the relaxed orbital relativistic Hartree-Fock-Slater model.« less

Solution of the Dirac Coulomb equation for helium-like ions in the Poet-Temkin model

NASA Astrophysics Data System (ADS)

Tang, Li-Yan; Tang, Yong-Bo; Shi, Ting-Yun; Mitroy, J.

2013-10-01

The Dirac-Coulomb equation for the helium atom is studied under the restrictions of the Poet-Temkin model which replaces the 1/r12 interaction by the simplified 1/r> form. The effective reduction in the dimensionality made it possible to obtain binding energies for the singlet and triplet states in this model problem with a relative precision from 10-8 to 10-10. The energies for the singlet state were consistent with a previous configuration interaction calculation [H. Tatewaki and Y. Watanabe, Chem. Phys. 389, 58 (2011)]. Manifestations of Brown-Ravenhall disease were noted at higher values of nuclear charge and ultimately limited the accuracy of the Poet-Temkin model energy. The energies from a no-pair configuration interaction (CI) calculation (the negative-energy states for the appropriate hydrogen-like ion were excluded from the CI expansion) were found to be different from the unrestricted B-spline calculation.

Solution of the Dirac Coulomb equation for helium-like ions in the Poet-Temkin model.

PubMed

Tang, Li-Yan; Tang, Yong-Bo; Shi, Ting-Yun; Mitroy, J

2013-10-07

The Dirac-Coulomb equation for the helium atom is studied under the restrictions of the Poet-Temkin model which replaces the 1/r12 interaction by the simplified 1/r> form. The effective reduction in the dimensionality made it possible to obtain binding energies for the singlet and triplet states in this model problem with a relative precision from 10(-8) to 10(-10). The energies for the singlet state were consistent with a previous configuration interaction calculation [H. Tatewaki and Y. Watanabe, Chem. Phys. 389, 58 (2011)]. Manifestations of Brown-Ravenhall disease were noted at higher values of nuclear charge and ultimately limited the accuracy of the Poet-Temkin model energy. The energies from a no-pair configuration interaction (CI) calculation (the negative-energy states for the appropriate hydrogen-like ion were excluded from the CI expansion) were found to be different from the unrestricted B-spline calculation.

The P K-near edge absorption spectra of phosphates

NASA Astrophysics Data System (ADS)

Franke, R.; Hormes, J.

1995-12-01

The X-ray absorption near edge structure (XANES) at the P K-edge in several orthophosphates with various cations, in condensed, and in substituted sodium phosphates have been measured using synchrotron radiation from the ELSA storage ring at the University of Bonn. The measured spectra demonstrate that chemical changes beyond the PO 4- tetrahedra are reflected by energy shifts of the pre-edge and continuum resonances, by the presence of characteristic shoulders and new peaks and by differences in the intensity of the white line. We discuss the energy differences between the white line positions and the corresponding P ls binding energies as a measure of half of the energy gap. The corresponding values correlate with the valence of the cations and the intensity of the white lines. The energy positions of the continuum resonances are discussed on the basis of an empirical bond-length correlation supporting a 1/ r2 - dependence.

Carbon monoxide poisoning is prevented by the energy costs of conformational changes in gas-binding haemproteins.

PubMed

Antonyuk, Svetlana V; Rustage, Neil; Petersen, Christine A; Arnst, Jamie L; Heyes, Derren J; Sharma, Raman; Berry, Neil G; Scrutton, Nigel S; Eady, Robert R; Andrew, Colin R; Hasnain, S Samar

2011-09-20

Carbon monoxide (CO) is a product of haem metabolism and organisms must evolve strategies to prevent endogenous CO poisoning of haemoproteins. We show that energy costs associated with conformational changes play a key role in preventing irreversible CO binding. AxCYTcp is a member of a family of haem proteins that form stable 5c-NO and 6c-CO complexes but do not form O(2) complexes. Structure of the AxCYTcp-CO complex at 1.25 Å resolution shows that CO binds in two conformations moderated by the extent of displacement of the distal residue Leu16 toward the haem 7-propionate. The presence of two CO conformations is confirmed by cryogenic resonance Raman data. The preferred linear Fe-C-O arrangement (170 ± 8°) is accompanied by a flip of the propionate from the distal to proximal face of the haem. In the second conformation, the Fe-C-O unit is bent (158 ± 8°) with no flip of propionate. The energetic cost of the CO-induced Leu-propionate movements is reflected in a 600 mV (57.9 kJ mol(-1)) decrease in haem potential, a value in good agreement with density functional theory calculations. Substitution of Leu by Ala or Gly (structures determined at 1.03 and 1.04 Å resolutions) resulted in a haem site that binds CO in the linear mode only and where no significant change in redox potential is observed. Remarkably, these variants were isolated as ferrous 6c-CO complexes, attributable to the observed eight orders of magnitude increase in affinity for CO, including an approximately 10,000-fold decrease in the rate of dissociation. These new findings have wide implications for preventing CO poisoning of gas-binding haem proteins.

Accurate ab initio binding energies of the benzene dimer.

PubMed

Park, Young Choon; Lee, Jae Shin

2006-04-20

Accurate binding energies of the benzene dimer at the T and parallel displaced (PD) configurations were determined using the single- and double-coupled cluster method with perturbative triple correction (CCSD(T)) with correlation-consistent basis sets and an effective basis set extrapolation scheme recently devised. The difference between the estimated CCSD(T) basis set limit electronic binding energies for the T and PD shapes appears to amount to more than 0.3 kcal/mol, indicating the PD shape is a more stable configuration than the T shape for this dimer in the gas phase. This conclusion is further strengthened when a vibrational zero-point correction to the electronic binding energies of this dimer is made, which increases the difference between the two configurations to 0.4-0.5 kcal/mol. The binding energies of 2.4 and 2.8 kcal/mol for the T and PD configurations are in good accord with the previous experimental result from ionization potential measurement.

Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

PubMed

Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

2015-08-01

Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

Novel tacrine/acridine anticholinesterase inhibitors with piperazine and thiourea linkers.

PubMed

Hamulakova, Slavka; Imrich, Jan; Janovec, Ladislav; Kristian, Pavol; Danihel, Ivan; Holas, Ondrej; Pohanka, Miroslav; Böhm, Stanislav; Kozurkova, Maria; Kuca, Kamil

2014-09-01

A new series of substituted tacrine/acridine and tacrine/tacrine dimers with aliphatic or alkylene-thiourea linkers was synthesized and the potential of these compounds as novel human acetylcholinesterase (hAChE) and human butyrylcholinesterase (hBChE) inhibitors with nanomolar inhibition activity was evaluated. The most potent AChE inhibitor was found to be homodimeric tacrine derivative 14a, which demonstrated an IC50 value of 2 nM; this value indicates an activity rate which is 250-times higher than that of tacrine 1 and 7500-times higher than 7-MEOTA 15, the compounds which were used as standards in the study. IC50 values of derivatives 1, 9, 10, 14b and 15 were compared with the dissociation constants of the enzyme-inhibitor complex, Ki1, and the enzyme-substrate-inhibitor complex, Ki2, for. A dual binding site is presumed for the synthesized compounds which possess two tacrines or tacrine and acridine as terminal moieties show evidence of dual site binding. DFT calculations of theoretical desolvation free energies, ΔΔGtheor, and docking studies elucidate these suggestions in more detail. Copyright © 2014 Elsevier B.V. All rights reserved.

A binding energy study of the Atomic Mass Evaluation 2012 and an updated beta-decay study of neutron-rich 74Cu

NASA Astrophysics Data System (ADS)

Tracy, James L., Jr.

A study of ground state binding energy values listed in the Atomic Mass Evaluation 2012 (AME2012) using an interpretive approach, as opposed to the exploratory methods of previous models, is presented. This model is based on a postulate requiring all protons to pair with available neutrons to form bound alpha clusters as the ground state for an N = Z core upon which excess neutrons are added. For each core, the trend of the binding energy as a function of excess neutrons in the isotopic chain can be fit with a three-term quadratic function. The quadratic parameter reveals a smooth decaying exponential function. By re-envisioning the determination of mass excess, the constant-term fit parameters, representing N = Z nuclei, reveal a near-symmetry around Z = 50. The linear fit parameters exhibit trends which are linear functions of core size. A neutron drip-line prediction is compared against current models. By considering the possibility of an alpha-cluster core, a new ground-state structure grouping scheme is presented; nucleon-nucleon pairing is shown to have a greater role in level filling. This model, referred to as the Alpha-Deuteron-Neutron Model, yields promising first results when considering root-mean-square variances from the AME2012. The beta-decay of the neutron-rich isotope 74Cu has been studied using three high-purity Germanium clover detectors at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory. A high-resolution mass separator greatly improved the purity of the 74Cu beam by removing isobaric contaminants, thus allowing decay through its isobar chain to the stable 74Ge at the center of the LeRIBSS detector array without any decay chain member dominating. Using coincidence gating techniques, 121 gamma-rays associated with 74Cu were isolated from the collective singles spectrum. Eighty-seven of these were placed in an expanded level scheme, and updated beta-feeding level intensities and log( ft) values are presented based on multiple newly-placed excited states up to 6.8 MeV. The progression of simulated Total Absorption gamma-ray Spectroscopy (TAGS) based on known levels and beta feeding values from previous measurements to this evaluation are presented and demonstrate the need for a TAGS measurement of this isotope to gain a more complete understanding of its decay scheme.

Symmetry Energy and Its Components in Finite Nuclei

NASA Astrophysics Data System (ADS)

Antonov, A. N.; Gaidarov, M. K.; Kadrev, D. N.; Sarriguren, P.; Moya de Guerra, E.

2018-05-01

We derive the volume and surface components of the nuclear symmetry energy (NSE) and their ratio within the coherent density fluctuation model. The estimations use the results of the model for the NSE in finite nuclei based on the Brueckner and Skyrme energy-density functionals for nuclear matter. The obtained values of the volume and surface contributions to the NSE and their ratio for the Ni, Sn, and Pb isotopic chains are compared with estimations of other approaches which have used available experimental data on binding energies, neutron-skin thicknesses, and excitation energies to isobaric analog states (IAS). Apart from the density dependence investigated in our previous works, we study also the temperature dependence of the symmetry energy in finite nuclei in the framework of the local density approximation combining it with the self-consistent Skyrme-HFB method using the cylindrical transformed deformed harmonic-oscillator basis. The results for the thermal evolution of the NSE in the interval T = 0–4 MeV show that its values decrease with temperature. The investigations of the T-dependence of the neutron and proton root-mean-square radii and the corresponding neutron skin thickness point out that the effect of temperature leads mainly to a substantial increase of the neutron radii and skins, especially in nuclei which are more rich of neutrons.

Investigation of naphthofuran moiety as potential dual inhibitor against BACE-1 and GSK-3β: molecular dynamics simulations, binding energy, and network analysis to identify first-in-class dual inhibitors against Alzheimer's disease.

PubMed

Kumar, Akhil; Srivastava, Gaurava; Srivastava, Swati; Verma, Seema; Negi, Arvind S; Sharma, Ashok

2017-08-01

BACE-1 and GSK-3β are potential therapeutic drug targets for Alzheimer's disease. Recently, both the targets received attention for designing dual inhibitors for Alzheimer's disease. Until now, only two-scaffold triazinone and curcumin have been reported as BACE-1 and GSK-3β dual inhibitors. Docking, molecular dynamics, clustering, binding energy, and network analysis of triazinone derivatives with BACE-1 and GSK-3β was performed to get molecular insight into the first reported dual inhibitor. Further, we designed and evaluated a naphthofuran series for its ability to inhibit BACE-1 and GSK-3β with the computational approaches. Docking study of naphthofuran series showed a good binding affinity towards both the targets. Molecular dynamics, binding energy, and network analysis were performed to compare their binding with the targets and amino acids responsible for binding. Naphthofuran series derivatives showed good interaction within the active site residues of both of the targets. Hydrogen bond occupancy and binding energy suggested strong binding with the targets. Dual-inhibitor binding was mostly governed by the hydrophobic interactions for both of the targets. Per residue energy decomposition and network analysis identified the key residues involved in the binding and inhibiting BACE-1 and GSK-3β. The results indicated that naphthofuran series derivative 11 may be a promising first-in-class dual inhibitor against BACE-1 and GSK-3β. This naphthofuran series may be further explored to design better dual inhibitors. Graphical abstract Naphthofuran derivative as a dual inhibitor for BACE-1 and GSK-3β.

Thermal desorption of formamide and methylamine from graphite and amorphous water ice surfaces

NASA Astrophysics Data System (ADS)

Chaabouni, H.; Diana, S.; Nguyen, T.; Dulieu, F.

2018-04-01

Context. Formamide (NH2CHO) and methylamine (CH3NH2) are known to be the most abundant amine-containing molecules in many astrophysical environments. The presence of these molecules in the gas phase may result from thermal desorption of interstellar ices. Aims: The aim of this work is to determine the values of the desorption energies of formamide and methylamine from analogues of interstellar dust grain surfaces and to understand their interaction with water ice. Methods: Temperature programmed desorption (TPD) experiments of formamide and methylamine ices were performed in the sub-monolayer and monolayer regimes on graphite (HOPG) and non-porous amorphous solid water (np-ASW) ice surfaces at temperatures 40-240 K. The desorption energy distributions of these two molecules were calculated from TPD measurements using a set of independent Polanyi-Wigner equations. Results: The maximum of the desorption of formamide from both graphite and ASW ice surfaces occurs at 176 K after the desorption of H2O molecules, whereas the desorption profile of methylamine depends strongly on the substrate. Solid methylamine starts to desorb below 100 K from the graphite surface. Its desorption from the water ice surface occurs after 120 K and stops during the water ice sublimation around 150 K. It continues to desorb from the graphite surface at temperatures higher than160 K. Conclusions: More than 95% of solid NH2CHO diffuses through the np-ASW ice surface towards the graphitic substrate and is released into the gas phase with a desorption energy distribution Edes = 7460-9380 K, which is measured with the best-fit pre-exponential factor A = 1018 s-1. However, the desorption energy distribution of methylamine from the np-ASW ice surface (Edes = 3850-8420 K) is measured with the best-fit pre-exponential factor A = 1012 s-1. A fraction of solid methylamine monolayer of roughly 0.15 diffuses through the water ice surface towards the HOPG substrate. This small amount of methylamine desorbs later with higher binding energies (5050-8420 K) that exceed that of the crystalline water ice (Edes = 4930 K), which is calculated with the same pre-exponential factor A = 1012 s-1. The best wetting ability of methylamine compared to H2O molecules makes CH3NH2 molecules a refractory species for low coverage. Other binding energies of astrophysical relevant molecules are gathered and compared, but we could not link the chemical functional groups (amino, methyl, hydroxyl, and carbonyl) with the binding energy properties. Implications of these high binding energies are discussed.

Synthesis, kinetic mechanism and docking studies of vanillin derivatives as inhibitors of mushroom tyrosinase.

PubMed

Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf

2015-09-01

The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

NASA Astrophysics Data System (ADS)

Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

2017-06-01

In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

[Importance of binding of 2,3-diphosphoglycerate and ATP to hemoglobin for erythrocyte glycolysis: activation by 2,3-diphosphoglycerate of hexokinase at intracellular conditions].

PubMed

Geier, T; Glende, M; Reich, J G

1978-01-01

In a theoretical study the influence of hemoglobin and Mg-ions as binding partners of red cell 2,3-diphosphoglycerate and ATP was investigated. Free hemoglobin may be an efficient competitor of Mg2+ for the ligand ATP. At conditions which favour hemoglobin as binding partner (i.e. desoxygenation, low medium pH and incubation temperature, as in blood preservation) up to 95% of the whole cellular ATP (ca. 2mM in cell water) may be bound to hemoglobin (ca. 7 mM). This binding is largely prevented in the presence of physiological amounts of diphosphoglycerate (ca. 7 mM) which is in excess and has a higher binding affinity to hemoglobin. Therefore, diphosphoglycerate keeps ATP (MgATP) in cell water solution at conditions in which Hb would trop it in the presence of Mg2+ (ca. 3mM). It can be calculated that, by lack of free MgATP, the activity of hexokinase within the cell drops by a factor of greater than 10 when diphosphoglycerate is metabolized. This indirect activation by diphosphoglycerate of hexokinase is operative at free concentrations of DPG far below those which exert the well known excess inhibitory effect on hexokinase and phosphofructokinase. In a model study, the activation by diphosphoglycerate of the initial two-kinase stage was introduced into a simplified kinetic model of glycolysis. A pronounced hysteresis loop of the stationary concentrations of ATP and diphosphoglycerate was produced indicating the existence of several stationary states, one with high ATP and high diphosphoglycerate, the other one with low values. It is demonstrated that diphosphoglycerate, being a protector of glycolysis at physiological concentrations, triggers an autocatalytic breakdown of the energy state when permitted to drop to low values.

Number of Hydroxyl Groups on the B-Ring of Flavonoids Affects Their Antioxidant Activity and Interaction with Phorbol Ester Binding Site of PKCδ C1B Domain: In Vitro and in Silico Studies.

PubMed

Kongpichitchoke, Teeradate; Hsu, Jue-Liang; Huang, Tzou-Chi

2015-05-13

Although flavonoids have been reported for their benefits and nutraceutical potential use, the importance of their structure on their beneficial effects, especially on signal transduction mechanisms, has not been well clarified. In this study, three flavonoids, pinocembrin, naringenin, and eriodictyol, were chosen to determine the effect of hydroxyl groups on the B-ring of flavonoid structure on their antioxidant activity. In vitro assays, including DPPH scavenging activity, ROS quantification by flow cytometer, and proteins immunoblotting, and in silico analysis by molecular docking between the flavonoids and C1B domain of PKCδ phorbol ester binding site were both used to complete this study. Eriodictyol (10 μM), containing two hydroxyl groups on the B-ring, exhibited significantly higher (p < 0.05) antioxidant activity than pinocembrin and naringenin. The IC50 values of eriodictyol, naringenin, and pinocembrin were 17.4 ± 0.40, 30.2 ± 0.61, and 44.9 ± 0.57 μM, respectively. In addition, eriodictyol at 10 μM remarkably inhibited the phosphorylation of PKCδ at 63.4% compared with PMA-activated RAW264.7, whereas pinocembrin and naringenin performed inhibition activity at 76.8 and 72.6%, respectively. According to the molecular docking analysis, pinocembrin, naringenin, and eriodictyol showed -CDOCKER_energy values of 15.22, 16.95, and 21.49, respectively, reflecting that eriodictyol could bind with the binding site better than the other two flavonoids. Interestingly, eriodictyol had a remarkably different pose to bind with the kinase as a result of the two hydroxyl groups on its B-ring, which consequently contributed to greater antioxidant activity over pinocembrin and naringenin.

Polypeptide Translocation Through the Mitochondrial TOM Channel: Temperature-Dependent Rates at the Single-Molecule Level.

PubMed

Mahendran, Kozhinjampara R; Lamichhane, Usha; Romero-Ruiz, Mercedes; Nussberger, Stephan; Winterhalter, Mathias

2013-01-03

The TOM protein complex facilitates the transfer of nearly all mitochondrial preproteins across outer mitochondrial membranes. Here we characterized the effect of temperature on facilitated translocation of a mitochondrial presequence peptide pF1β. Ion current fluctuations analysis through single TOM channels revealed thermodynamic and kinetic parameters of substrate binding and allowed determining the energy profile of peptide translocation. The activation energy for the on-rate and off-rate of the presequence peptide into the TOM complex was symmetric with respect to the electric field and estimated to be about 15 and 22 kT per peptide. These values are above that expected for free diffusion of ions in water (6 kT) and reflect the stronger interaction in the channel. Both values are in the range for typical enzyme kinetics and suggest one process without involving large conformational changes within the channel protein.

Comparative studies on structures, mechanical properties, sensitivity, stabilities and detonation performance of CL-20/TNT cocrystal and composite explosives by molecular dynamics simulation.

PubMed

Hang, Gui-Yun; Yu, Wen-Li; Wang, Tao; Wang, Jin-Tao; Li, Zhen

2017-09-19

To investigate and compare the differences of structures and properties of CL-20/TNT cocrystal and composite explosives, the CL-20/TNT cocrystal and composite models were established. Molecular dynamics simulations were performed to investigate the structures, mechanical properties, sensitivity, stabilities and detonation performance of cocrystal and composite models with COMPASS force field in NPT ensemble. The lattice parameters, mechanical properties, binding energies, interaction energy of trigger bond, cohesive energy density and detonation parameters were determined and compared. The results show that, compared with pure CL-20, the rigidity and stiffness of cocrystal and composite models decreased, while plastic properties and ductility increased, so mechanical properties can be effectively improved by adding TNT into CL-20 and the cocrystal model has better mechanical properties. The interaction energy of the trigger bond and the cohesive energy density is in the order of CL-20/TNT cocrystal > CL-20/TNT composite > pure CL-20, i.e., cocrystal model is less sensitive than CL-20 and the composite model, and has the best safety parameters. Binding energies show that the cocrystal model has higher intermolecular interaction energy values than the composite model, thus illustrating the better stability of the cocrystal model. Detonation parameters vary as CL-20 > cocrystal > composite, namely, the energy density and power of cocrystal and composite model are weakened; however, the CL-20/TNT cocrystal explosive still has desirable energy density and detonation performance. This results presented in this paper help offer some helpful guidance to better understand the mechanism of CL-20/TNT cocrystal explosives and provide some theoretical assistance for cocrystal explosive design.

Adenine nucleotide transport in sonic submitochondrial particles. Kinetic properties and binding of specific inhibitors.

PubMed

Lauquin, G J; Villiers, C; Michejda, J W; Hryniewiecka, L V; Vignais, P V

1977-05-11

1. A procedure for preparation of sonic submitochondrial particles competent for adenine nucleotide transport is described. ADP or ATP transport was assayed, in the presence of oligomycin, in a saline medium made of 0.125 M KCl, 1 mM EDTA, 10 mM 4-morpholinopropane sulfonic acid buffer, pH 6.5. 2. Sonic particles transport ADP and ATP by an exchange diffusion process. Externally added ADP (or ATP) is exchanged with internal ADP and ATP with a stoichiometry of one to one. The V value for ADP transport 5 degrees C was between 2 and 3 nmol/min per mg protein. 3. The transport system in sonic particles is specific for ADP and ATP. It is strongly dependent on temperature. The activation energy between 0 and 9 degrees C is approx. 35 kcal/mol. The optimum pH is 6.5, 4, Like in intact mitochondria, externally added ADP is transported into sonic particles faster at a given concentration than externally added ATP. The V value for ADP transport is 1.5-2 times higher than the V value for ATP transport. 5. The transition from the energized to the deenergized state in sonic particles results in a decrease of the pH gradient across the membrane (internal pH less than external pH) and in a 2-4 fold increase in the Km value for ATP. This latter effect is opposite that found for transport of added ATP in intact mitochondria (Souverijn, J.H.M., Huisman, L.A., Rosing J. and Kemp, Jr., A. (1973) Biochim. Biophys. Acta 305, 185-198). Energization has no effect on the V value of ATP transport in sonic particles. 6. In contrast to intact mitochondria, inhibition of ADP transport in sonic particles by bongkrekic acid does not have any lag-time and does not depend on pH. The inhibition caused by bongkrekic acid is a mixed type inhibition with a Ki value of 1.2 micronM. Atractyloside and carboxyatractyloside do not inhibit ADP transport in sonic particles, unless the particles have been preloaded with these inhibitors during the sonication. 7. Palmityl-CoA added to sonic particles inhibits efficiently ADP transport. The mixed type inhibition found with palmityl-CoA has a Ki value of 1.6 micronM. 8. [3H]Bongkrekic acid binds to sonic particles readily and with high affinity. Bongkrekic acic binding to sonic particles does not depend on pH and it has a saturation plateau, corresponding approximately to 1.3 mol of site per mol of cytochrome a. The number of [3H]atracytloside binding sites is much lower (one-fifth of the bongkrekic acid). External carboxyatractyloside does not compete with [3H]bongkrekic acid for binding to sonic particles. However, when carboxyatractyloside is present inside the particles, it inhibits the binding of [3H]bongkrekic acid.

Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

PubMed Central

Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

1991-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

Specificity and Affinity Quantification of Flexible Recognition from Underlying Energy Landscape Topography

PubMed Central

Chu, Xiakun; Wang, Jin

2014-01-01

Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition. PMID:25144525

Specificity and affinity quantification of flexible recognition from underlying energy landscape topography.

PubMed

Chu, Xiakun; Wang, Jin

2014-08-01

Flexibility in biomolecular recognition is essential and critical for many cellular activities. Flexible recognition often leads to moderate affinity but high specificity, in contradiction with the conventional wisdom that high affinity and high specificity are coupled. Furthermore, quantitative understanding of the role of flexibility in biomolecular recognition is still challenging. Here, we meet the challenge by quantifying the intrinsic biomolecular recognition energy landscapes with and without flexibility through the underlying density of states. We quantified the thermodynamic intrinsic specificity by the topography of the intrinsic binding energy landscape and the kinetic specificity by association rate. We found that the thermodynamic and kinetic specificity are strongly correlated. Furthermore, we found that flexibility decreases binding affinity on one hand, but increases binding specificity on the other hand, and the decreasing or increasing proportion of affinity and specificity are strongly correlated with the degree of flexibility. This shows more (less) flexibility leads to weaker (stronger) coupling between affinity and specificity. Our work provides a theoretical foundation and quantitative explanation of the previous qualitative studies on the relationship among flexibility, affinity and specificity. In addition, we found that the folding energy landscapes are more funneled with binding, indicating that binding helps folding during the recognition. Finally, we demonstrated that the whole binding-folding energy landscapes can be integrated by the rigid binding and isolated folding energy landscapes under weak flexibility. Our results provide a novel way to quantify the affinity and specificity in flexible biomolecular recognition.

Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

PubMed Central

Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

1993-01-01

1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

Free energy simulations and MM-PBSA analyses on the affinity and specificity of steroid binding to antiestradiol antibody.

PubMed

Laitinen, Tuomo; Kankare, Jussi A; Peräkylä, Mikael

2004-04-01

Antiestradiol antibody 57-2 binds 17beta-estradiol (E2) with moderately high affinity (K(a) = 5 x 10(8) M(-1)). The structurally related natural estrogens estrone and estriol as well synthetic 17-deoxy-estradiol and 17alpha-estradiol are bound to the antibody with 3.7-4.9 kcal mol(-1) lower binding free energies than E2. Free energy perturbation (FEP) simulations and the molecular mechanics-Poisson-Boltzmann surface area (MM-PBSA) method were applied to investigate the factors responsible for the relatively low cross-reactivity of the antibody with these four steroids, differing from E2 by the substituents of the steroid D-ring. In addition, computational alanine scanning of the binding site residues was carried out with the MM-PBSA method. Both the FEP and MM-PBSA methods reproduced the experimental relative affinities of the five steroids in good agreement with experiment. On the basis of FEP simulations, the number of hydrogen bonds formed between the antibody and steroids, which varied from 0 to 3 in the steroids studied, determined directly the magnitude of the steroid-antibody interaction free energies. One hydrogen bond was calculated to contribute about 3 kcal mol(-1) to the interaction energy. Because the relative binding free energies of estrone (two antibody-steroid hydrogen bonds), estriol (three hydrogen bonds), 17-deoxy-estradiol (no hydrogen bonds), and 17alpha-estradiol (two hydrogen bonds) are close to each other and clearly lower than that of E2 (three hydrogen bonds), the water-steroid interactions lost upon binding to the antibody make an important contribution to the binding free energies. The MM-PBSA calculations showed that the binding of steroids to the antiestradiol antibody is driven by van der Waals interactions, whereas specificity is solely due to electrostatic interactions. In addition, binding of steroids to the antiestradiol antibody 57-2 was compared to the binding to the antiprogesterone antibody DB3 and antitestosterone antibody 3-C4F5, studied earlier with the MM-PBSA method. Copyright 2004 Wiley-Liss, Inc.

Binding Energies of Proton-Bound Dimers of Imidazole and n-Acetylalanine Methyl Ester Obtained by Blackbody Infrared Radiative Dissociation

PubMed Central

Jockusch, Rebecca A.; Williams*, Evan R.

2005-01-01

The dissociation kinetics of protonated n-acetyl-L-alanine methyl ester dimer (AcAlaMEd), imidazole dimer, and their cross dimer were measured using blackbody infrared radiative dissociation (BIRD). Master equation modeling of these data was used to extract threshold dissociation energies (Eo) for the dimers. Values of 1.18 ± 0.06, 1.11 ± 0.04, and 1.12 ± 0.08 eV were obtained for AcAlaMEd, imidazole dimer, and the cross dimer, respectively. Assuming that the reverse activation barrier for dissociation of the ion–molecule complex is negligible, the value of Eo can be compared to the dissociation enthalpy (ΔHd°) from HPMS data. The Eo values obtained for the imidazole dimer and the cross dimer are in agreement with HPMS values; the value for AcAlaMEd is somewhat lower. Radiative rate constants used in the master equation modeling were determined using transition dipole moments calculated at the semiempirical (AM1) level for all dimers and compared to ab initio (RHF/3-21G*) calculations where possible. To reproduce the experimentally measured dissociation rates using master equation modeling, it was necessary to multiply semiempirical transition dipole moments by a factor between 2 and 3. Values for transition dipole moments from the ab initio calculations could be used for two of the dimers but appear to be too low for AcAlaMEd. These results demonstrate that BIRD, in combination with master equation modeling, can be used to determine threshold dissociation energies for intermediate size ions that are in neither the truncated Boltzmann nor the rapid energy exchange limit. PMID:16604163

Hydrogenic impurity bound polaron in an anisotropic quantum dot

NASA Astrophysics Data System (ADS)

Chen, Shi-Hua

2018-01-01

The effect of the electron-phonon interaction on an electron bound to a hydrogenic impurity in a three-dimensional (3D) anisotropic quantum dot (QD) is studied theoretically. We use the Landau-Pekar variational approach to calculate the binding energy of ground state (GS) and first-excited state (ES) with considering electron-phonon interaction. The expressions of the GS and ES energies under investigation depict a rich variety of dependent relationship with the variational parameters in three different limiting cases. Numerical calculations were performed for ZnSe QDs with different confinement lengths in the xy-plane and the z-direction, respectively. It is illustrated that binding energies of impurity polarons corresponding to each level are larger in small QDs. Furthermore, the contribution to binding energy from phonon is about 15% of the total binding energy.

Interaction Entropy: A New Paradigm for Highly Efficient and Reliable Computation of Protein-Ligand Binding Free Energy.

PubMed

Duan, Lili; Liu, Xiao; Zhang, John Z H

2016-05-04

Efficient and reliable calculation of protein-ligand binding free energy is a grand challenge in computational biology and is of critical importance in drug design and many other molecular recognition problems. The main challenge lies in the calculation of entropic contribution to protein-ligand binding or interaction systems. In this report, we present a new interaction entropy method which is theoretically rigorous, computationally efficient, and numerically reliable for calculating entropic contribution to free energy in protein-ligand binding and other interaction processes. Drastically different from the widely employed but extremely expensive normal mode method for calculating entropy change in protein-ligand binding, the new method calculates the entropic component (interaction entropy or -TΔS) of the binding free energy directly from molecular dynamics simulation without any extra computational cost. Extensive study of over a dozen randomly selected protein-ligand binding systems demonstrated that this interaction entropy method is both computationally efficient and numerically reliable and is vastly superior to the standard normal mode approach. This interaction entropy paradigm introduces a novel and intuitive conceptual understanding of the entropic effect in protein-ligand binding and other general interaction systems as well as a practical method for highly efficient calculation of this effect.

On the atomic-number similarity of the binding energies of electrons in filled shells of elements of the periodic table

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karpov, V. Ya.; Shpatakovskaya, G. V., E-mail: shpagalya@yandex.ru

An expression for the binding energies of electrons in the ground state of an atom is derived on the basis of the Bohr–Sommerfeld quantization rule within the Thomas–Fermi model. The validity of this relation for all elements from neon to uranium is tested within a more perfect quantum-mechanical model with and without the inclusion of relativistic effects, as well as with experimental binding energies. As a result, the ordering of electronic levels in filled atomic shells is established, manifested in an approximate atomic-number similarity. It is proposed to use this scaling property to analytically estimate the binding energies of electronsmore » in an arbitrary atom.« less

Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

PubMed

Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

2015-05-19

Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

Conformational Entropy of FK506 Binding to FKBP12 Determined by Nuclear Magnetic Resonance Relaxation and Molecular Dynamics Simulations.

PubMed

Solomentsev, Gleb; Diehl, Carl; Akke, Mikael

2018-03-06

FKBP12 (FK506 binding protein 12 kDa) is an important drug target. Nuclear magnetic resonance (NMR) order parameters, describing amplitudes of motion on the pico- to nanosecond time scale, can provide estimates of changes in conformational entropy upon ligand binding. Here we report backbone and methyl-axis order parameters of the apo and FK506-bound forms of FKBP12, based on 15 N and 2 H NMR relaxation. Binding of FK506 to FKBP12 results in localized changes in order parameters, notably for the backbone of residues E54 and I56 and the side chains of I56, I90, and I91, all positioned in the binding site. The order parameters increase slightly upon FK506 binding, indicating an unfavorable entropic contribution to binding of TΔ S = -18 ± 2 kJ/mol at 293 K. Molecular dynamics simulations indicate a change in conformational entropy, associated with all dihedral angles, of TΔ S = -26 ± 9 kJ/mol. Both these values are significant compared to the total entropy of binding determined by isothermal titration calorimetry and referenced to a reactant concentration of 1 mM ( TΔ S = -29 ± 1 kJ/mol). Our results reveal subtle differences in the response to ligand binding compared to that of the previously studied rapamycin-FKBP12 complex, despite the high degree of structural homology between the two complexes and their nearly identical ligand-FKBP12 interactions. These results highlight the delicate dependence of protein dynamics on drug interactions, which goes beyond the view provided by static structures, and reinforce the notion that protein conformational entropy can make important contributions to the free energy of ligand binding.

The mechanism of tubulin-colchicine recognition--a kinetic study of the binding of a bicyclic colchicine analogue with a minor modification of the A ring.

PubMed

Dumortier, C; Potenziano, J L; Bane, S; Engelborghs, Y

1997-10-01

2-Methoxy-5-(2',3',4'-trimethoxy)-2,4,6-cycloheptatrien-1-one (MTC) is a colchicine analogue that lacks the B ring. 2-Methoxy-5-(2',4'-dimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MD) is an A-ring analogue of MTC, in which one methoxy group is replaced by a hydrogen atom. This paper describes the kinetic features of MDC binding to tubulin, and compares its behaviour with MTC to analyse the effect of the A-ring modification on the recognition process by tubulin. Binding is accompanied by a strong enhancement of MDC fluorescence and quenching of protein fluorescence. The kinetic and thermodynamic parameters were obtained from fluorescence stopped-flow measurements. The kinetics are described by a single exponential, indicating that this drug does not discriminate between the different tubulin isotypes. The observed pseudo-first-order rate constant of the fluorescence increase upon binding increases in a non-linear way, indicating that this ligand binds with a similar overall mechanism as colchicine and MTC, consisting of a fast initial binding of low affinity followed by a slower isomerisation step leading to full affinity. The K1 and k2 values for MDC at 25 degrees C were 540 +/- 65 M(-1) and 70 +/- 6 s(-1) respectively. From the temperature dependence, a reaction enthalpy change (deltaH(o)1) of the initial binding of 49 +/- 11 kJ/mol(-1) and an activation energy for the second step of 28 +/- 9 kJ/mol(-1) were calculated. Displacement experiments of bound MDC by MTC allowed the determination of a rate constant of reverse isomerisation of 0.60 +/- 0.07 s(-1) at 25 degrees C and the activation energy of 81 +/- 6 kJ/mol(-1). The overall binding constant was (6.3 +/- 0.2) x 10(4) M(-1) at 25 degrees C. Combination of these results with the kinetic parameters for association gives a full characterisation of the enthalpy pathway for the binding of MDC. The pathway of MDC is shown to differ considerably from that of MTC binding. Since its structural difference is located in ring A, this result indicates the use of ring A in the first step. The kinetics of the binding of MDC in the presence of some A-ring colchicine analogues (podophyllotoxin, 3',4',5'-trimethoxyacetophenone and N-acetylmescaline) and a C-ring analogue (tropolone methyl ether) suggest that the A and C rings are involved in the binding of MDC.

The application of quantum mechanics in structure-based drug design.

PubMed

Mucs, Daniel; Bryce, Richard A

2013-03-01

Computational chemistry has become an established and valuable component in structure-based drug design. However the chemical complexity of many ligands and active sites challenges the accuracy of the empirical potentials commonly used to describe these systems. Consequently, there is a growing interest in utilizing electronic structure methods for addressing problems in protein-ligand recognition. In this review, the authors discuss recent progress in the development and application of quantum chemical approaches to modeling protein-ligand interactions. The authors specifically consider the development of quantum mechanics (QM) approaches for studying large molecular systems pertinent to biology, focusing on protein-ligand docking, protein-ligand binding affinities and ligand strain on binding. Although computation of binding energies remains a challenging and evolving area, current QM methods can underpin improved docking approaches and offer detailed insights into ligand strain and into the nature and relative strengths of complex active site interactions. The authors envisage that QM will become an increasingly routine and valued tool of the computational medicinal chemist.

Interaction of Lysozyme with Rhodamine B: A combined analysis of spectroscopic & molecular docking.

PubMed

Millan, Sabera; Satish, Lakkoji; Kesh, Sandeep; Chaudhary, Yatendra S; Sahoo, Harekrushna

2016-09-01

The interaction of Rhodamine B (RB) with Lysozyme (Lys) was investigated by different optical spectroscopic techniques such as absorption, fluorescence, and circular-dichroism (CD), along with molecular docking studies. The fluorescence results (including steady-state and time-resolved mode) revealed that the addition of RB effectively causes strong quenching of intrinsic fluorescence in Lysozyme and mostly, by the static quenching mechanism. Different binding and thermodynamic parameters were calculated at different temperatures and the binding constant value was found to be 2963.54Lmol(-1) at 25°C. The average distance (r0) was found to be 3.31nm according to Förster's theory of non-radiative energy transfer between Lysozyme and RB. The conformational change in Lysozyme during interaction with RB was confirmed from absorbance, synchronous fluorescence, and circular dichroism measurements. Finally, molecular docking studies were done to confirm that the dye binds with Lysozyme. Copyright © 2016 Elsevier B.V. All rights reserved.

Novel N-allyl/propargyl tetrahydroquinolines: Synthesis via Three-component Cationic Imino Diels-Alder Reaction, Binding Prediction, and Evaluation as Cholinesterase Inhibitors.

PubMed

Rodríguez, Yeray A; Gutiérrez, Margarita; Ramírez, David; Alzate-Morales, Jans; Bernal, Cristian C; Güiza, Fausto M; Romero Bohórquez, Arnold R

2016-10-01

New N-allyl/propargyl 4-substituted 1,2,3,4-tetrahydroquinolines derivatives were efficiently synthesized using acid-catalyzed three components cationic imino Diels-Alder reaction (70-95%). All compounds were tested in vitro as dual acetylcholinesterase and butyryl-cholinesterase inhibitors and their potential binding modes, and affinity, were predicted by molecular docking and binding free energy calculations (∆G) respectively. The compound 4af (IC50 = 72 μm) presented the most effective inhibition against acetylcholinesterase despite its poor selectivity (SI = 2), while the best inhibitory activity on butyryl-cholinesterase was exhibited by compound 4ae (IC50 = 25.58 μm) with considerable selectivity (SI = 0.15). Molecular docking studies indicated that the most active compounds fit in the reported acetylcholinesterase and butyryl-cholinesterase active sites. Moreover, our computational data indicated a high correlation between the calculated ∆G and the experimental activity values in both targets. © 2016 The Authors Chemical Biology & Drug Design Published by John Wiley & Sons Ltd.

Differential Cationization of Fatty Acids with Monovalent Cations Studied by ESI-MS/MS and Computational Approach.

PubMed

Sudarshana Reddy, B; Pavankumar, P; Sridhar, L; Saha, Soumen; Narahari Sastry, G; Prabhakar, S

2018-04-24

The intercellular and intracellular transport of charged species (Na + /K + ) entail interaction of the ions with neutral organic molecules and formation of adduct ions. The rate of transport of the ions across the cell membrane(s) may depend on the stability of the adduct ions, which in turn rely on structural aspects of the organic molecules that interact with the ions. Positive ion ESI mass spectra were recorded for the solutions containing fatty acids (FAs) and monovalent cations (X=Li + , Na + , K + , Rb + and Cs + ). Product ion spectra of the [FA+X] + ions were recorded at different collision energies. Theoretical studies were exploited under both gas phase and solvent phase to investigate the structural effects of the fatty acids during cationization. Stability of [FA+X] + adduct ions were further estimated by means of AIM topological analyses and interaction energy (IE) values. Positive ion ESI-MS analyses of the solution of FAs and X + ions showed preferential binding of the K + ions to FAs. The K + ion binding increased with the increase in number of double bonds of FAs, while decreased with increase in the number of carbons of FAs. Dissociation curves of [FA+X] + ions indicated the relative stability order of the [FA+X] + ions and it was in line with the observed trends in ESI-MS. The solvent phase computational studies divulged the mode of binding and the binding efficiencies of different FAs with monovalent cations. Among the studied monovalent cations, the cationization of FAs follow the order K + >Na + >Li + >Rb + >Cs + . The docosahexaenoic acid showed high efficiency in binding with K + ion. The K + ion binding efficiency of FAs depends on the number of double bonds in unsaturated FAs and the carbon chain length in saturated FAs. The cationization trends of FAs obtained from the ESI-MS, ESI-MS/MS analyses were in good agreement with solvent phase computational studies. This article is protected by copyright. All rights reserved.

Assessing the performance of the MM/PBSA and MM/GBSA methods. 1. The accuracy of binding free energy calculations based on molecular dynamics simulations.

PubMed

Hou, Tingjun; Wang, Junmei; Li, Youyong; Wang, Wei

2011-01-24

The Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) and the Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) methods calculate binding free energies for macromolecules by combining molecular mechanics calculations and continuum solvation models. To systematically evaluate the performance of these methods, we report here an extensive study of 59 ligands interacting with six different proteins. First, we explored the effects of the length of the molecular dynamics (MD) simulation, ranging from 400 to 4800 ps, and the solute dielectric constant (1, 2, or 4) on the binding free energies predicted by MM/PBSA. The following three important conclusions could be observed: (1) MD simulation length has an obvious impact on the predictions, and longer MD simulation is not always necessary to achieve better predictions. (2) The predictions are quite sensitive to the solute dielectric constant, and this parameter should be carefully determined according to the characteristics of the protein/ligand binding interface. (3) Conformational entropy often show large fluctuations in MD trajectories, and a large number of snapshots are necessary to achieve stable predictions. Next, we evaluated the accuracy of the binding free energies calculated by three Generalized Born (GB) models. We found that the GB model developed by Onufriev and Case was the most successful model in ranking the binding affinities of the studied inhibitors. Finally, we evaluated the performance of MM/GBSA and MM/PBSA in predicting binding free energies. Our results showed that MM/PBSA performed better in calculating absolute, but not necessarily relative, binding free energies than MM/GBSA. Considering its computational efficiency, MM/GBSA can serve as a powerful tool in drug design, where correct ranking of inhibitors is often emphasized.

Application of a continuous distribution model for proton binding by humic acids extracted from acidic lake sediments

NASA Astrophysics Data System (ADS)

Rhea, James R.; Young, Thomas C.

1987-10-01

The proton binding characteristics of humic acids extracted from the sediments of Cranberry Pond, an acidic water body located in the Adirondack Mountain region of New York State, were explored by the application of a multiligand distribution model. The model characterizes a class of proton binding sites by mean log K values and the standard deviations of log K values about the mean. Mean log K values and their relative abundances were determined directly from experimental titration data. The model accurately predicts the binding of protons by the humic acids for pH values in the range 3.5 to 10.0.

Application of a continuous distribution model for proton binding by humic acids extracted from acidic lake sediments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rhea, J.R.; Young, T.C.

1987-01-01

The proton binding characteristics of humic acids extracted from the sediments of Cranberry Pond, an acidic water body located in the Adirondack Mountain region of New York State, were explored by the application of a nultiligand distribution model. The model characterizes a class of proton binding sites by mean log K values and the standard deviations of log K values and the mean. Mean log K values and their relative abundances were determined directly from experimental titration data. The model accurately predicts the binding of protons by the humic acids for pH values in the range 3.5 to 10.0.

Nonbonded interactions in membrane active cyclic biopolymers. IV - Cation dependence

NASA Technical Reports Server (NTRS)

Radhakrishnan, R.; Srinivasan, S.; Prasad, C. V.; Brinda, S. R.; Macelroy, R. D.; Sundaram, K.

1980-01-01

Interactions of valinomycin and form of its analogs in several conformations with the central ions Li(+), Na(+), K(+), Rb(+) and Cs(+) are investigated as part of a study of the specific preference of valinomycin for potassium and the mechanisms of carrier-mediated ion transport across membranes. Ion binding energies and conformational potential energies are calculated taking into account polarization energy formulas and repulsive energy between the central ion and the ligand atoms for conformations representing various stages in ion capture and release for each of the two ring chiralities of valinomycin and its analogs. Results allow the prediction of the chirality and conformation most likely to be observed for a given analog, and may be used to synthesize analogs with a desired rigidity or flexibility. The binding energies with the alkali metal cations are found to decrease with increasing ion size, and to be smaller than the corresponding ion hydration energies. It is pointed out that the observed potassium preference may be explainable in terms of differences between binding and hydration energies. Binding energies are also noted to depend on ligand conformation.

Precise identification and manipulation of adsorption geometry of donor-π-acceptor dye on nanocrystalline TiO₂ films for improved photovoltaics.

PubMed

Zhang, Fan; Ma, Wei; Jiao, Yang; Wang, Jingchuan; Shan, Xinyan; Li, Hui; Lu, Xinghua; Meng, Sheng

2014-12-24

Adsorption geometry of dye molecules on nanocrystalline TiO2 plays a central role in dye-sensitized solar cells, enabling effective sunlight absorption, fast electron injection, optimized interface band offsets, and stable photovoltaic performance. However, precise determination of dye binding geometry and proportion has been challenging due to complexity and sensitivity at interfaces. Here employing combined vibrational spectrometry and density functional calculations, we identify typical adsorption configurations of widely adopted cyanoacrylic donor-π bridge-acceptor dyes on nanocrystalline TiO2. Binding mode switching from bidentate bridging to hydrogen-bonded monodentate configuration with Ti-N bonding has been observed when dye-sensitizing solution becomes more basic. Raman and infrared spectroscopy measurements confirm this configuration switch and determine quantitatively the proportion of competing binding geometries, with vibration peaks assigned using density functional theory calculations. We further found that the proportion of dye-binding configurations can be manipulated by adjusting pH value of dye-sensitizing solutions. Controlling molecular adsorption density and configurations led to enhanced energy conversion efficiency from 2.4% to 6.1% for the fabricated dye-sensitized solar cells, providing a simple method to improve photovoltaic performance by suppressing unfavorable binding configurations in solar cell applications.

Sampling protein motion and solvent effect during ligand binding

PubMed Central

Limongelli, Vittorio; Marinelli, Luciana; Cosconati, Sandro; La Motta, Concettina; Sartini, Stefania; Mugnaini, Laura; Da Settimo, Federico; Novellino, Ettore; Parrinello, Michele

2012-01-01

An exhaustive description of the molecular recognition mechanism between a ligand and its biological target is of great value because it provides the opportunity for an exogenous control of the related process. Very often this aim can be pursued using high resolution structures of the complex in combination with inexpensive computational protocols such as docking algorithms. Unfortunately, in many other cases a number of factors, like protein flexibility or solvent effects, increase the degree of complexity of ligand/protein interaction and these standard techniques are no longer sufficient to describe the binding event. We have experienced and tested these limits in the present study in which we have developed and revealed the mechanism of binding of a new series of potent inhibitors of Adenosine Deaminase. We have first performed a large number of docking calculations, which unfortunately failed to yield reliable results due to the dynamical character of the enzyme and the complex role of the solvent. Thus, we have stepped up the computational strategy using a protocol based on metadynamics. Our approach has allowed dealing with protein motion and solvation during ligand binding and finally identifying the lowest energy binding modes of the most potent compound of the series, 4-decyl-pyrazolo[1,5-a]pyrimidin-7-one. PMID:22238423

Predicting Binding Free Energy Change Caused by Point Mutations with Knowledge-Modified MM/PBSA Method.

PubMed

Petukh, Marharyta; Li, Minghui; Alexov, Emil

2015-07-01

A new methodology termed Single Amino Acid Mutation based change in Binding free Energy (SAAMBE) was developed to predict the changes of the binding free energy caused by mutations. The method utilizes 3D structures of the corresponding protein-protein complexes and takes advantage of both approaches: sequence- and structure-based methods. The method has two components: a MM/PBSA-based component, and an additional set of statistical terms delivered from statistical investigation of physico-chemical properties of protein complexes. While the approach is rigid body approach and does not explicitly consider plausible conformational changes caused by the binding, the effect of conformational changes, including changes away from binding interface, on electrostatics are mimicked with amino acid specific dielectric constants. This provides significant improvement of SAAMBE predictions as indicated by better match against experimentally determined binding free energy changes over 1300 mutations in 43 proteins. The final benchmarking resulted in a very good agreement with experimental data (correlation coefficient 0.624) while the algorithm being fast enough to allow for large-scale calculations (the average time is less than a minute per mutation).

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

A Direct Comparison of the MM-GB/SA Scoring Procedure and Free-Energy Perturbation Calculations Using Carbonic Anhydrase as a Test Case: Strengths and Pitfalls of Each Approach.

PubMed

Guimarães, Cristiano R W

2011-07-12

MM-GB/SA scoring and free energy perturbation (FEP) calculations have emerged as reliable methodologies to understand structural and energetic relationships to binding. In spite of successful applications to elucidate the structure-activity relationships for few pairs of ligands, the reality is that the performance of FEP calculations has rarely been tested for more than a handful of compounds. In this work, a series of 13 benzene sulfonamide inhibitors of carbonic anhydrase with binding free energies determined by isothermal titration calorimetry was selected as a test case. R(2) values of 0.70, 0.71, and 0.49 with the experiment were obtained with MM-GB/SA and FEP simulations run with MCPRO+ and Desmond, respectively. All methods work well, but the results obtained with Desmond are inferior to MM-GB/SA and MCPRO+. The main contrast between the methods is the level of sampling, ranging from full to restricted flexibility to single conformation for the complexes in Desmond, MCPRO+, and MM-GB/SA, respectively. The current and historical results obtained with MM-GB/SA qualify this approach as a more attractive alternative for rank-ordering; it can achieve equivalent or superior predictive accuracy and handle more structurally dissimilar ligands at a fraction of the computational cost of the rigorous free-energy methods. As for the large theoretical dynamic range for the binding energies, that seems to be a direct result of the degree of sampling in the simulations since MCPRO+ as well as MM-GB/SA are plagued by this. Van't Hoff analysis for selected pairs of ligands suggests that the wider scoring spread is not only affected by missing entropic contributions due to restricted sampling but also exaggerated enthalpic separation between the weak and potent compounds caused by diminished shielding of electrostatic interactions, thermal effects, and protein relaxation/strain.

Can HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, or HN[double bond, length as m-dash]CHOH bridge the σ-hole and the lone pair at P in binary complexes with H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H?

PubMed

Del Bene, Janet E; Alkorta, Ibon; Elguero, José

2015-11-11

Ab initio MP2/aug'-cc-pVTZ calculations have been carried out to investigate the properties of complexes formed between H2XP, for X = F, Cl, NC, OH, CN, CCH, CH3, and H, and the possible bridging molecules HN[double bond, length as m-dash]NH, FN[double bond, length as m-dash]NH, and HN[double bond, length as m-dash]CHOH. H2XP:HNNH and H2XP:FNNH complexes are stabilized by PN pnicogen bonds, except for H2(CH3)P:FNNH and H3P:FNNH which are stabilized by N-HP hydrogen bonds. H2XP:HNCHOH complexes are stabilized by PN pnicogen bonds and nonlinear O-HP hydrogen bonds. For a fixed H2XP molecule, binding energies decrease in the order HNCHOH > HNNH > FNNH, except for the binding energies of H2(CH3)P and H3P with HNNH and FNNH. Binding energies of complexes with HNCHOH and HNNH increase as the P-N1 distance decreases, but binding energies of complexes with FNNH show little dependence on this distance. The large binding energies of H2XP:HNCHOH complexes arise from a cooperative effect involving electron-pair acceptance by P to form a pnicogen bond, and electron-pair donation by P to form a hydrogen bond. The dominant charge-transfer interaction in these complexes involves electron-pair donation by N across the pnicogen bond, except for complexes in which X is one of the more electropositive substituents, CCH, CH3, and H. For these, lone-pair donation by P across the hydrogen bond dominates. AIM and NBO data for these complexes are consistent with their bonding characteristics, showing molecular graphs with bond critical points and charge-transfer interactions associated with hydrogen and pnicogen bonds. EOM-CCSD spin-spin coupling constants (1p)J(P-N) across the pnicogen bond for each series of complexes correlate with the P-N distance. In contrast, (2h)J(O-P) values for complexes H2XP:HNCHOH do not correlate with the O-P distance, a consequence of the nonlinearity of these hydrogen bonds.

The HSP90 binding mode of a radicicol-like E-oxime from docking, binding free energy estimations, and NMR 15N chemical shifts

PubMed Central

Spichty, Martin; Taly, Antoine; Hagn, Franz; Kessler, Horst; Barluenga, Sofia; Winssinger, Nicolas; Karplus, Martin

2009-01-01

We determine the binding mode of a macrocyclic radicicol-like oxime to yeast HSP90 by combining computer simulations and experimental measurements. We sample the macrocyclic scaffold of the unbound ligand by parallel tempering simulations and dock the most populated conformations to yeast HSP90. Docking poses are then evaluated by the use of binding free energy estimations with the linear interaction energy method. Comparison of QM/MM-calculated NMR chemical shifts with experimental shift data for a selective subset of back-bone 15N provides an additional evaluation criteria. As a last test we check the binding modes against available structure-activity-relationships. We find that the most likely binding mode of the oxime to yeast HSP90 is very similar to the known structure of the radicicol-HSP90 complex. PMID:19482409

Free energy changes and components implicit in the MWC allosteric model for the cooperative oxygen binding of hemoglobin.#

PubMed Central

Bucci, Enrico

2013-01-01

Hill’s plots of oxygen binding isotherms reveal the presence of a transition between two different oxygen affinities at the beginning and end of the isotherm. They correspond to the two conformations anticipated by the MWC model, namely the T and R conformations at the beginning and end of oxygen binding, when the lower affinity of the T form develops into the higher affinity of the R form. The difference between the binding Gibbs free energies changes of the two affinities (ΔGL) is the free energy of binding cooperativity. Notably ΔGL is positive in favor of the T form, that moves to a higher energy level upon oxygen release. Osmotic stress reveals a higher volume/surface ratio of deoxyHb, with a positive ΔGW also in favor of the T form . Increasing protein concentration shifts the isotherms to the right indicating the formation of intermediate polymeric forms. Enthalpy of the intermediates show a strong absorption of heat at the third oxygenation step due to polymers formation with quinary, and above, structures. The disassembly of intermediate polymers releases energy with a negative ΔG that compensates and allow the positivity of ΔGL. High energy polymers are the barrier preventing the relaxation of the T and R conformations into one another. The MWC allosteric model is the best justification of oxygen binding cooperativity . PMID:23710673

Factors driving stable growth of He clusters in W: first-principles study

NASA Astrophysics Data System (ADS)

Feng, Y. J.; Xin, T. Y.; Xu, Q.; Wang, Y. X.

2018-07-01

The evolution of helium (He) bubbles is responsible for the surface morphology variation and subsequent degradation of the properties of plasma-facing materials (PFMs) in nuclear fusion reactors. These severe problems unquestionably trace back to the behavior of He in PFMs, which is closely associated with the interaction between He and the matrix. In this paper, we decomposed the binding energy of the He cluster into three parts, those from W–W, W–He, and He–He interactions, using density functional theory. As a result, we clearly identified the main factors that determine a steplike decrease in the binding energy with increasing number of He atoms, which explains the process of self-trapping and athermal vacancy generation during He cluster growth in the PFM tungsten. The three interactions were found to synergetically shape the features of the steplike decrease in the binding energy. Fairly strong He–He repulsive forces at a short distance, which stem from antibonding states between He atoms, need to be released when additional He atoms are continuously bonded to the He cluster. This causes the steplike feature in the binding energy. The bonding states between W and He atoms in principle facilitate the decreasing trend of the binding energy. The decrease in binding energy with increasing number of He atoms implies that He clusters can grow stably.

Formation of the prebiotic molecule NH2CHO on astronomical amorphous solid water surfaces: accurate tunneling rate calculations.

PubMed

Song, Lei; Kästner, Johannes

2016-10-26

Investigating how formamide forms in the interstellar medium is a hot topic in astrochemistry, which can contribute to our understanding of the origin of life on Earth. We have constructed a QM/MM model to simulate the hydrogenation of isocyanic acid on amorphous solid water surfaces to form formamide. The binding energy of HNCO on the ASW surface varies significantly between different binding sites, we found values between ∼0 and 100 kJ mol -1 . The barrier for the hydrogenation reaction is almost independent of the binding energy, though. We calculated tunneling rate constants of H + HNCO → NH 2 CO at temperatures down to 103 K combining QM/MM with instanton theory. Tunneling dominates the reaction at such low temperatures. The tunneling reaction is hardly accelerated by the amorphous solid water surface compared to the gas phase for this system, even though the activation energy of the surface reaction is lower than the one of the gas-phase reaction. Both the height and width of the barrier affect the tunneling rate in practice. Strong kinetic isotope effects were observed by comparing to rate constants of D + HNCO → NHDCO. At 103 K we found a KIE of 231 on the surface and 146 in the gas phase. Furthermore, we investigated the gas-phase reaction NH 2 + H 2 CO → NH 2 CHO + H and found it unlikely to occur at cryogenic temperatures. The data of our tunneling rate constants are expected to significantly influence astrochemical models.

Spatial Analysis and Quantification of the Thermodynamic Driving Forces in Protein-Ligand Binding: Binding Site Variability

PubMed Central

Raman, E. Prabhu; MacKerell, Alexander D.

2015-01-01

The thermodynamic driving forces behind small molecule-protein binding are still not well understood, including the variability of those forces associated with different types of ligands in different binding pockets. To better understand these phenomena we calculate spatially resolved thermodynamic contributions of the different molecular degrees of freedom for the binding of propane and methanol to multiple pockets on the proteins Factor Xa and p38 MAP kinase. Binding thermodynamics are computed using a statistical thermodynamics based end-point method applied on a canonical ensemble comprising the protein-ligand complexes and the corresponding free states in an explicit solvent environment. Energetic and entropic contributions of water and ligand degrees of freedom computed from the configurational ensemble provides an unprecedented level of detail into the mechanisms of binding. Direct protein-ligand interaction energies play a significant role in both non-polar and polar binding, which is comparable to water reorganization energy. Loss of interactions with water upon binding strongly compensates these contributions leading to relatively small binding enthalpies. For both solutes, the entropy of water reorganization is found to favor binding in agreement with the classical view of the “hydrophobic effect”. Depending on the specifics of the binding pocket, both energy-entropy compensation and reinforcement mechanisms are observed. Notable is the ability to visualize the spatial distribution of the thermodynamic contributions to binding at atomic resolution showing significant differences in the thermodynamic contributions of water to the binding of propane versus methanol. PMID:25625202

Effective homogeneity of the exchange-correlation and non-interacting kinetic energy functionals under density scaling.

PubMed

Borgoo, Alex; Teale, Andrew M; Tozer, David J

2012-01-21

Correlated electron densities, experimental ionisation potentials, and experimental electron affinities are used to investigate the homogeneity of the exchange-correlation and non-interacting kinetic energy functionals of Kohn-Sham density functional theory under density scaling. Results are presented for atoms and small molecules, paying attention to the influence of the integer discontinuity and the choice of the electron affinity. For the exchange-correlation functional, effective homogeneities are highly system-dependent on either side of the integer discontinuity. By contrast, the average homogeneity-associated with the potential that averages over the discontinuity-is generally close to 4/3 when the discontinuity is computed using positive affinities for systems that do bind an excess electron and negative affinities for those that do not. The proximity to 4/3 becomes increasingly pronounced with increasing atomic number. Evaluating the discontinuity using a zero affinity in systems that do not bind an excess electron instead leads to effective homogeneities on the electron abundant side that are close to 4/3. For the non-interacting kinetic energy functional, the effective homogeneities are less system-dependent and the effect of the integer discontinuity is less pronounced. Average values are uniformly below 5/3. The study provides information that may aid the development of improved exchange-correlation and non-interacting kinetic energy functionals. © 2012 American Institute of Physics

Orientation-dependent structural and photocatalytic properties of LaCoO3 epitaxial nano-thin films

PubMed Central

Zhang, Yan-ping; Hu, Hai-long; Xie, Rui-shi; Ma, Guo-hua; Huo, Ji-chuan; Wang, Hai-bin

2018-01-01

LaCoO3 epitaxial films were grown on (100), (110) and (111) oriented LaAlO3 substrates by the polymer-assisted deposition method. Crystal structure measurement and cross-section observation indicate that all the LaCoO3 films are epitaxially grown in accordance with the orientation of LaAlO3 substrates, with biaxial compressive strain in the ab plane. Owing to the different strain directions of CoO6 octahedron, the mean Co–O bond length increases by different amounts in (100), (110) and (111) oriented films compared with that of bulk LaCoO3, and the (100) oriented LaCoO3 has the largest increase. Photocatalytic degradation of methyl orange indicates that the order of photocatalytic activity of the three oriented films is (100) > (111) > (110). Combined with analysis of electronic nature and band structure for LaCoO3 films, it is found that the change of the photocatalytic activity is closely related to the crystal field splitting energy of Co3+ and Co–O binding energy. The increase in the mean Co–O bond length will decrease the crystal field splitting energy of Co3+ and Co–O binding energy and further reduce the value of band gap energy, thus improving the photocatalytic activity. This may also provide a clue for expanding the visible-light-induced photocatalytic application of LaCoO3. PMID:29515854

Orientation-dependent structural and photocatalytic properties of LaCoO3 epitaxial nano-thin films.

PubMed

Zhang, Yan-Ping; Liu, Hai-Feng; Hu, Hai-Long; Xie, Rui-Shi; Ma, Guo-Hua; Huo, Ji-Chuan; Wang, Hai-Bin

2018-02-01

LaCoO 3 epitaxial films were grown on (100), (110) and (111) oriented LaAlO 3 substrates by the polymer-assisted deposition method. Crystal structure measurement and cross-section observation indicate that all the LaCoO 3 films are epitaxially grown in accordance with the orientation of LaAlO 3 substrates, with biaxial compressive strain in the ab plane. Owing to the different strain directions of CoO 6 octahedron, the mean Co-O bond length increases by different amounts in (100), (110) and (111) oriented films compared with that of bulk LaCoO 3 , and the (100) oriented LaCoO 3 has the largest increase. Photocatalytic degradation of methyl orange indicates that the order of photocatalytic activity of the three oriented films is (100) > (111) > (110). Combined with analysis of electronic nature and band structure for LaCoO 3 films, it is found that the change of the photocatalytic activity is closely related to the crystal field splitting energy of Co 3+ and Co-O binding energy. The increase in the mean Co-O bond length will decrease the crystal field splitting energy of Co 3+ and Co-O binding energy and further reduce the value of band gap energy, thus improving the photocatalytic activity. This may also provide a clue for expanding the visible-light-induced photocatalytic application of LaCoO 3 .

Relativistic excited state binding energies and RMS radii of Λ-hypernuclei

NASA Astrophysics Data System (ADS)

Nejad, S. Mohammad Moosavi; Armat, A.

2018-02-01

Using an analytical solution for the relativistic equation of single Λ-hypernuclei in the presence of Woods-Saxon (WS) potential we present, for the first time, an analytical form for the excited state binding energies of 1p, 1d, 1f and 1g shells of a number of hypernuclei. Based on phenomenological analysis of the Λ binding energies in a set of Λ-hypernuclei, the WS potential parameters are obtained phenomenologically for the set of Λ-hypernuclei. Systematic study of the energy levels of single Λ-hypernuclei enables us to extract more detailed information about the Λ-nucleon interaction. We also study the root mean square (RMS) radii of the Λ orbits in the hypernuclear ground states. Our results are presented for several hypernuclei and it is shown that our results for the binding energies are in good agreement with experimental data.

Relation between heat of vaporization, ion transport, molar volume, and cation-anion binding energy for ionic liquids.

PubMed

Borodin, Oleg

2009-09-10

A number of correlations between heat of vaporization (H(vap)), cation-anion binding energy (E(+/-)), molar volume (V(m)), self-diffusion coefficient (D), and ionic conductivity for 29 ionic liquids have been investigated using molecular dynamics (MD) simulations that employed accurate and validated many-body polarizable force fields. A significant correlation between D and H(vap) has been found, while the best correlation was found for -log(DV(m)) vs H(vap) + 0.28E(+/-). A combination of enthalpy of vaporization and a fraction of the cation-anion binding energy was suggested as a measure of the effective cohesive energy for ionic liquids. A deviation of some ILs from the reported master curve is explained based upon ion packing and proposed diffusion pathways. No general correlations were found between the ion diffusion coefficient and molecular volume or the diffusion coefficient and cation/anion binding energy.

Theoretical study of the BeLi, BeNa, MgLi, MgNa, and AlBe molecules and their negative ions

NASA Technical Reports Server (NTRS)

Bauschlicher, Charles W., Jr.; Langhoff, Stephen R.; Partridge, Harry

1992-01-01

The alkaline earth-alkali diatomics are found to have weak bonds, because the diffuse alkali valence s orbitals cannot form a bond of sufficient strength to pay the promotion energy of the alkaline-earth atoms. This leads to van der Waals bonding in the neutrals as well as the negative ions. In fact, the negative ions have larger binding energies than the neutrals as a result of the much larger polarizability of the negative ion. The binding energy of AlBe is significantly larger than the Be-alkali molecules, due to a covalent contribution to the bonding. The binding energy in AlBe(-) is considerably larger than AlBe; the binding energy of the X 3Sigma(-) state of AlBe(-) is computed to be 1.36 eV, as compared with 0.57 eV for the X 2Pi state of AlBe.

Binding energies and modelling of nuclei in semiclassical simulations

NASA Astrophysics Data System (ADS)

Pérez-García, M. Ángeles; Tsushima, K.; Valcarce, A.

2008-03-01

We study the binding energies of spin isospin saturated nuclei with nucleon number 8⩽A⩽100 in semiclassical Monte Carlo many-body simulations. The model Hamiltonian consists of (i) nucleon kinetic energy, (ii) a nucleon nucleon interaction potential, and (iii) an effective Pauli potential which depends on density. The basic ingredients of the nucleon nucleon potential are a short-range repulsion, and a medium-range attraction. Our results demonstrate that one can always expect to obtain the empirical binding energies for a set of nuclei by introducing a proper density dependent Pauli potential in terms of a single variable, the nucleon number, A. The present work shows that in the suggested procedure there is a delicate counterbalance of kinetic and potential energetic contributions allowing a good reproduction of the experimental nuclear binding energies. This type of calculations may be of interest in further reproduction of other properties of nuclei such as radii and also exotic nuclei.

Biophysical Fitness Landscapes for Transcription Factor Binding Sites

PubMed Central

Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

2014-01-01

Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

Seeking potential anticonvulsant agents that target GABAA receptors using experimental and theoretical procedures

NASA Astrophysics Data System (ADS)

Saavedra-Vélez, Margarita Virginia; Correa-Basurto, José; Matus, Myrna H.; Gasca-Pérez, Eloy; Bello, Martiniano; Cuevas-Hernández, Roberto; García-Rodríguez, Rosa Virginia; Trujillo-Ferrara, José; Ramos-Morales, Fernando Rafael

2014-12-01

The aim of this study was to identify compounds that possess anticonvulsant activity by using a pentylenetetrazol (PTZ)-induced seizure model. Theoretical studies of a set of ligands, explored the binding affinities of the ligands for the GABAA receptor (GABAAR), including some benzodiazepines. The ligands satisfy the Lipinski rules and contain a pharmacophore core that has been previously reported to be a GABAAR activator. To select the ligands with the best physicochemical properties, all of the compounds were analyzed by quantum mechanics and the energies of the highest occupied molecular orbital and lowest unoccupied molecular orbital were determined. Docking calculations between the ligands and the GABAAR were used to identify the complexes with the highest Gibbs binding energies. The identified compound D1 (dibenzo( b,f)(1,4)diazocine-6,11(5H,12H)-dione) was synthesized, experimentally tested, and the GABAAR-D1 complex was submitted to 12-ns-long molecular dynamics (MD) simulations to corroborate the binding conformation obtained by docking techniques. MD simulations were also used to analyze the decomposition of the Gibbs binding energy of the residues involved in the stabilization of the complex. To validate our theoretical results, molecular docking and MD simulations were also performed for three reference compounds that are currently in commercial use: clonazepam (CLZ), zolpidem and eszopiclone. The theoretical results show that the GABAAR-D1, and GABAAR-CLZ complexes bind to the benzodiazepine binding site, share a similar map of binding residues, and have similar Gibbs binding energies and entropic components. Experimental studies using a PTZ-induced seizure model showed that D1 possesses similar activity to CLZ, which corroborates the predicted binding free energy identified by theoretical calculations.

Calculating binding free energies for protein-carbohydrate complexes.

PubMed

Hadden, Jodi A; Tessier, Matthew B; Fadda, Elisa; Woods, Robert J

2015-01-01

A variety of computational techniques may be applied to compute theoretical binding free energies for protein-carbohydrate complexes. Elucidation of the intermolecular interactions, as well as the thermodynamic effects, that contribute to the relative strength of receptor binding can shed light on biomolecular recognition, and the resulting initiation or inhibition of a biological process. Three types of free energy methods are discussed here, including MM-PB/GBSA, thermodynamic integration, and a non-equilibrium alternative utilizing SMD. Throughout this chapter, the well-known concanavalin A lectin is employed as a model system to demonstrate the application of these methods to the special case of carbohydrate binding.

Protein-ligand binding free energy estimation using molecular mechanics and continuum electrostatics. Application to HIV-1 protease inhibitors

NASA Astrophysics Data System (ADS)

Zoete, V.; Michielin, O.; Karplus, M.

2003-12-01

A method is proposed for the estimation of absolute binding free energy of interaction between proteins and ligands. Conformational sampling of the protein-ligand complex is performed by molecular dynamics (MD) in vacuo and the solvent effect is calculated a posteriori by solving the Poisson or the Poisson-Boltzmann equation for selected frames of the trajectory. The binding free energy is written as a linear combination of the buried surface upon complexation, SAS bur, the electrostatic interaction energy between the ligand and the protein, Eelec, and the difference of the solvation free energies of the complex and the isolated ligand and protein, ΔGsolv. The method uses the buried surface upon complexation to account for the non-polar contribution to the binding free energy because it is less sensitive to the details of the structure than the van der Waals interaction energy. The parameters of the method are developed for a training set of 16 HIV-1 protease-inhibitor complexes of known 3D structure. A correlation coefficient of 0.91 was obtained with an unsigned mean error of 0.8 kcal/mol. When applied to a set of 25 HIV-1 protease-inhibitor complexes of unknown 3D structures, the method provides a satisfactory correlation between the calculated binding free energy and the experimental pIC 50 without reparametrization.

Effect of binding in cyclic phosphorylation-dephosphorylation process and in energy transformation.

PubMed

Sarkar, A; Beard, D A; Franza, B R

2006-07-01

The effects of binding on the phosphorylation-dephosphorylation cycle (PDPC) - one of the key components of the signal transduction processes - is analyzed based on a mathematical model. The model shows that binding of proteins, forming a complex, diminishes the ultrasensitivity of the PDPC to the differences in activity between kinase and phosphatase in the cycle. It is also found that signal amplification depends upon the strength of the binding affinity of the protein (phosphorylated or dephosphorylated) to other proteins . It is also observed that the amplification of signal is not only dependent on phosphorylation potential but also on binding properties and resulting adjustments in binding energies.