On the interaction of luminol with human serum albumin: Nature and thermodynamics of ligand binding
NASA Astrophysics Data System (ADS)
Moyon, N. Shaemningwar; Mitra, Sivaprasad
2010-09-01
The mechanism and thermodynamic parameters for the binding of luminol (LH 2) with human serum albumin was explored by steady state and picosecond time-resolved fluorescence spectroscopy. It was shown that out of two possible LH 2 conformers present is solution, only one is accessible for binding with HSA. The thermodynamic parameters like enthalpy (Δ H) and entropy (Δ S) change corresponding to the ligand binding process were also estimated by performing the experiment at different temperatures. The ligand replacement experiment with bilirubin confirms that LH 2 binds into the sub-domain IIA of the protein.
Shamsi, Anas; Ahmed, Azaj; Bano, Bilqees
2018-05-01
The binding interaction between temsirolimus, an important antirenal cancer drug, and HSA, an important carrier protein was scrutinized making use of UV and fluorescence spectroscopy. Hyper chromaticity observed in UV spectroscopy in the presence of temsirolimus as compared to free HSA suggests the formation of complex between HSA and temsirolimus. Fluorescence quenching experiments clearly showed quenching in the fluorescence of HSA in the presence of temsirolimus confirming the complex formation and also confirmed that static mode of interaction is operative for this binding process. Binding constant values obtained through UV and fluorescence spectroscopy reveal strong interaction; temsirolimus binds to HSA at 298 K with a binding constant of 2.9 × 10 4 M -1 implying the strength of interaction. The negative Gibbs free energy obtained through Isothermal titration calorimetry as well as quenching experiments suggests that binding process is spontaneous. Molecular docking further provides an insight of various residues that are involved in this binding process; showing the binding energy to be -12.9 kcal/mol. CD spectroscopy was retorted to analyze changes in secondary structure of HSA; increased intensity in presence of temsirolimus showing changes in secondary structure of HSA induced by temsirolimus. This study is of importance as it provides an insight into the binding mechanism of an important antirenal cancer drug with an important carrier protein. Once temsirolimus binds to HSA, it changes conformation of HSA which in turn can alter the functionality of this important carrier protein and this altered functionality of HSA can be highlighted in variety of diseases.
Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi
2017-08-01
The binding interaction between quinapril (QNPL) and bovine serum albumin (BSA) in vitro has been investigated using UV absorption spectroscopy, steady-state fluorescence spectroscopic, synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy, circular dichroism, and molecular docking methods for obtaining the binding information of QNPL with BSA. The experimental results confirm that the quenching mechanism of the intrinsic fluorescence of BSA induced by QNPL is static quenching based on the decrease in the quenching constants of BSA in the presence of QNPL with the increase in temperature and the quenching rates of BSA larger than 10 10 L mol -1 s -1 , indicating forming QNPL-BSA complex through the intermolecular binding interaction. The binding constant for the QNPL-BSA complex is in the order of 10 5 M -1 , indicating there is stronger binding interaction of QNPL with BSA. The analysis of thermodynamic parameters together with molecular docking study reveal that the main binding forces in the binding process of QNPL with BSA are van der Waal's forces and hydrogen bonding interaction. And, the binding interaction of BSA with QNPL is an enthalpy-driven process. Based on Förster resonance energy transfer, the binding distance between QNPL and BSA is calculated to be 2.76 nm. The results of the competitive binding experiments and molecular docking confirm that QNPL binds to sub-domain IIA (site I) of BSA. It is confirmed there is a slight change in the conformation of BSA after binding QNPL, but BSA still retains its secondary structure α-helicity.
An eye tracking investigation of color-location binding in infants' visual short-term memory.
Oakes, Lisa M; Baumgartner, Heidi A; Kanjlia, Shipra; Luck, Steven J
2017-01-01
Two experiments examined 8- and 10-month-old infants' ( N = 71) binding of object identity (color) and location information in visual short-term memory (VSTM) using a one-shot change detection task . Building on previous work using the simultaneous streams change detection task, we confirmed that 8- and 10-month-old infants are sensitive to changes in binding between identity and location in VSTM. Further, we demonstrated that infants recognize specifically what changed in these events. Thus, infants' VSTM for binding is robust and can be observed in different procedures and with different stimuli.
Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh
Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar
2011-01-01
Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736
McCormack, Patrick; Han, Fei; Yan, Zijie
2018-02-01
Light-driven self-organization of metal nanoparticles (NPs) can lead to unique optical matter systems, yet simulation of such self-organization (i.e., optical binding) is a complex computational problem that increases nonlinearly with system size. Here we show that a combined electrodynamics-molecular dynamics simulation technique can simulate the trajectories and predict stable configurations of silver NPs in optical fields. The simulated dynamic equilibrium of a two-NP system matches the probability density of oscillations for two optically bound NPs obtained experimentally. The predicted stable configurations for up to eight NPs are further compared to experimental observations of silver NP clusters formed by optical binding in a Bessel beam. All configurations are confirmed to form in real systems, including pentagonal clusters with five-fold symmetry. Our combined simulations and experiments have revealed a diverse optical matter system formed by anisotropic optical binding interactions, providing a new strategy to discover artificial materials.
Sartori, C; Stefanini, S; Bernardo, A; Augusti-Tocco, G
1992-08-01
Insulin function in the nervous system is still poorly understood. Possible roles as a neuromodulator and as a growth factor have been proposed (Baskin et al., 1987, Ann. Rev. Physiol. 49, 335-347). Stable cell lines may provide an appropriate experimental system for the analysis of insulin action on the various cellular components of the central nervous system. We report here a study to investigate the presence and the properties of insulin specific binding sites in the murine neuroblastoma line, N18TG2, together with insulin action on cell growth and metabolism. Also, receptor internalization has been studied. Binding experiments, carried out in standard conditions at 20 degrees C, enabled us to demonstrate that these cells bind insulin in a specific manner, thus confirming previous findings on other cell lines. Saturation curves showed the presence of two binding sites with Kd 0.3 and 9.7 nM. Competition experiments with porcine and bovine insulin showed an IC50 of 1 and 10 nM, respectively. Competition did not occur in the presence of the unrelated hormones ACTH and FSH. Dissociation experiments indicated the existence of an internalization process of the ligand-receptor complex; this was confirmed by an ultrastructural study using gold conjugated insulin. As far as the insulin action in N18TG2 cells is concerned, physiological concentrations stimulate cell proliferation, whereas no stimulation of glucose uptake was observed, indicating that insulin action in these cells is not mediated by general metabolic effects. On the basis of these data, N18TG2 line appears to be a very suitable model for further studies of the neuronal type insulin receptors, and possibly insulin specific action on the nervous system.
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
The Role of Pectin in Pb Binding by Carrot Peel Biosorbents: Isoterm Adsorption Study
NASA Astrophysics Data System (ADS)
Hastuti, B.; Totiana, F.; Winiasih, R.
2018-04-01
Cheaply and abundantly biosorption available materials such as carrot peels can be a cost-efficient method for removing heavy metals from wastewater. To investigate the role pectin plays in metal binding by carrot peels, commerce pectin was compared. FTIR spectra confirmed the presence of carboxyl and hydroxyl groups in commerce pectin and carrot pectin. Isoterm experiments showed that all materials could remove Pb (II) ion. All of materials binding Pb (II) follow Freundlich models adsorption. The commerce pectin bindsPb (II) by involving energy 16.6 KJ/mole whereas pectin from carrot peel involves energy 21.09 KJ/mole. It indicates that commerce pectin binds the Pb (II) by physics adsorption whereas pectin from carrot peel by physics and chemical adsorption.
Roy, Snigdha; Das, Suman
2014-01-01
Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na+] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure. PMID:24498422
Pradhan, Ankur Bikash; Haque, Lucy; Roy, Snigdha; Das, Suman
2014-01-01
Here, we report results from experiments designed to explore the association of the phenazinium dye safranin T (ST, 3,7-diamino-2,8-dimethyl-5-phenylphenazinium chloride) with single and double stranded form of polyriboadenylic acid (hereafter poly-A) using several spectroscopic techniques. We demonstrate that the dye binds to single stranded polyriboadenylic acid (hereafter ss poly-A) with high affinity while it does not interact at all with the double stranded (ds) form of the polynucleotide. Fluorescence and absorption spectral studies reveal the molecular aspects of binding of ST to single stranded form of the polynucleotide. This observation is also supported by the circular dichroism study. Thermodynamic data obtained from temperature dependence of binding constant reveals that association is driven by negative enthalpy change and opposed by negative entropy change. Ferrocyanide quenching studies have shown intercalative binding of ST to ss poly-A. Experiments on viscosity measurements confirm the binding mode of the dye to be intercalative. The effect of [Na⁺] ion concentration on the binding process suggests the role of electrostatic forces in the complexation. Present studies reveal the utility of the dye in probing nucleic acid structure.
Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh
2017-02-15
A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
NASA Astrophysics Data System (ADS)
Okuno, Keisuke; Inamura, Tetsunari
A robotic coaching system can improve humans' learning performance of motions by intelligent usage of emphatic motions and adverbial expressions according to user reactions. In robotics, however, method to control both the motions and the expressions and how to bind them had not been adequately discussed from an engineering point of view. In this paper, we propose a method for controlling and binding emphatic motions and adverbial expressions by using two scalar parameters in a phase space. In the phase space, variety of motion patterns and verbal expressions are connected and can be expressed as static points. We show the feasibility of the proposing method through experiments of actual sport coaching tasks for beginners. From the results of participants' improvements in motion learning, we confirmed the feasibility of the methods to control and bind emphatic motions and adverbial expressions, as well as confirmed contribution of the emphatic motions and positive correlation of adverbial expressions for participants' improvements in motion learning. Based on the results, we introduce a hypothesis that individually optimized method for binding adverbial expression is required.
Computational design of a pH-sensitive IgG binding protein.
Strauch, Eva-Maria; Fleishman, Sarel J; Baker, David
2014-01-14
Computational design provides the opportunity to program protein-protein interactions for desired applications. We used de novo protein interface design to generate a pH-dependent Fc domain binding protein that buries immunoglobulin G (IgG) His-433. Using next-generation sequencing of naïve and selected pools of a library of design variants, we generated a molecular footprint of the designed binding surface, confirming the binding mode and guiding further optimization of the balance between affinity and pH sensitivity. In biolayer interferometry experiments, the optimized design binds IgG with a Kd of ∼ 4 nM at pH 8.2, and approximately 500-fold more weakly at pH 5.5. The protein is extremely stable, heat-resistant and highly expressed in bacteria, and allows pH-based control of binding for IgG affinity purification and diagnostic devices.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connelly, P.R.; Gill, S.J.; Miller, K.I.
1989-02-21
Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less
NASA Astrophysics Data System (ADS)
Afrin, Shumaila; Rahman, Yusra; Sarwar, Tarique; Husain, Mohammed Amir; Ali, Abad; Shamsuzzaman; Tabish, Mohammad
2017-11-01
Ticlopidine is an anti-platelet drug which belongs to the thienopyridine structural family and exerts its effect by functioning as an ADP receptor inhibitor. Ticlopidine inhibits the expression of TarO gene in S. aureus and may provide protection against MRSA. Groove binding agents are known to disrupt the transcription factor DNA complex and consequently inhibit gene expression. Understanding the mechanism of interaction of ticlopidine with DNA can prove useful in the development of a rational drug designing system. At present, there is no such study on the interaction of anti-platelet drugs with nucleic acids. A series of biophysical experiments were performed to ascertain the binding mode between ticlopidine and calf thymus DNA. UV-visible and fluorescence spectroscopic experiments confirmed the formation of a complex between ticlopidine and calf thymus DNA. Moreover, the values of binding constant were found to be in the range of 103 M- 1, which is indicative of groove binding between ticlopidine and calf thymus DNA. These results were further confirmed by studying the effect of denaturation on double stranded DNA, iodide quenching, viscometric studies, thermal melting profile as well as CD spectral analysis. The thermodynamic profile of the interaction was also determined using isothermal titration calorimetric studies. The reaction was found to be endothermic and the parameters obtained were found to be consistent with those of known groove binders. In silico molecular docking studies further corroborated well with the experimental results.
[Study on the interaction of doxycycline with human serum albumin].
Hu, Tao-Ying; Chen, Lin; Liu, Ying
2014-05-01
The present study was designed to investigate the interaction of doxycycline (DC) with human serum albumin (HSA) by the inner filter effects, displacement experiments and molecular docking methods, based on classic multi-spectroscopy. With fluorescence quenching method at 298 and 310 K, the binding constants Ka, were determined to be 2. 73 X 10(5) and 0. 74X 10(5) L mol-1, respectively, and there was one binding site between DC and HSA, indicating that the binding of DC to HSA was strong, and the quenching mechanism was a static quenching. The thermodynamic parameters (enthalpy change, AH and enthropy change, delta S) were calculated to be -83. 55 kJ mol-1 and -176. 31 J mol-1 K-1 via the Vant' Hoff equation, which indicated that the interaction of DC with HSA was driven mainly by hydrogen bonding and van der Waals forces. Based on the Föster's theory of non-radiation energy transfer, the specific binding distance between Trp-214 (acceptor) and DC (donor) was 4. 98 nm, which was similar to the result confirmed by molecular docking. Through displacement experiments, sub-domain IIA of HSA was assigned to possess the high-affinity binding site of DC. Three-dimensional fluorescence spectra indicated that the binding of DC to HSA induced the conformation change of HSA and increased the disclosure of some part of hydrophobic regions that had been buried before. The results of FTIR spectroscopy showed that DC bound to HSA led to the slight unfolding of the polypeptide chain of HSA. Furthermore, the binding details between DC and HSA were further confirmed by molecular docking methods, which revealed that DC was bound at sub-domain IIA through multiple interactions, such as hydrophobic effect, polar forces and pi-pi interactions. The experimental results provide theoretical basis and reliable data for the study of the interaction between small drug molecule and human serum albumin
Chung, Wai Keen; Freed, Alexander S.; Holstein, Melissa A.; McCallum, Scott A.; Cramer, Steven M.
2010-01-01
NMR titration experiments with labeled human ubiquitin were employed in concert with chromatographic data obtained with a library of ubiquitin mutants to study the nature of protein adsorption in multimodal (MM) chromatography. The elution order of the mutants on the MM resin was significantly different from that obtained by ion-exchange chromatography. Further, the chromatographic results with the protein library indicated that mutations in a defined region induced greater changes in protein affinity to the solid support. Chemical shift mapping and determination of dissociation constants from NMR titration experiments with the MM ligand and isotopically enriched ubiquitin were used to determine and rank the relative binding affinities of interaction sites on the protein surface. The results with NMR confirmed that the protein possessed a distinct preferred binding region for the MM ligand in agreement with the chromatographic results. Finally, coarse-grained ligand docking simulations were employed to study the modes of interaction between the MM ligand and ubiquitin. The use of NMR titration experiments in concert with chromatographic data obtained with protein libraries represents a previously undescribed approach for elucidating the structural basis of protein binding affinity in MM chromatographic systems. PMID:20837551
Deciphering the mechanism of interaction of edifenphos with calf thymus DNA
NASA Astrophysics Data System (ADS)
Ahmad, Ajaz; Ahmad, Masood
2018-01-01
Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.
NASA Astrophysics Data System (ADS)
Pragna Lakshmi, T.; Mondal, Moumita; Ramadas, Krishna; Natarajan, Sakthivel
2017-08-01
Drug molecule interaction with human serum albumin (HSA) affects the distribution and elimination of the drug. The compound, 2,4-diacetylphloroglucinol (DAPG) has been known for its antimicrobial, antiviral, antihelminthic and anticancer properties. However, its interaction with HSA is not yet reported. In this study, the interaction between HSA and DAPG was investigated through steady-state fluorescence, time-resolved fluorescence (TRF), circular dichroism (CD), Fourier transform infrared (FT-IR) spectroscopy, isothermal titration calorimetry (ITC), molecular docking and molecular dynamics simulation (MDS). Fluorescence spectroscopy results showed the strong quenching of intrinsic fluorescence of HSA due to interaction with DAPG, through dynamic quenching mechanism. The compound bound to HSA with reversible and moderate affinity which explained its easy diffusion from circulatory system to target tissue. The thermodynamic parameters from fluorescence spectroscopic data clearly revealed the contribution of hydrophobic forces but, the role of hydrogen bonds was not negligible according to the ITC studies. The interaction was exothermic and spontaneous in nature. Binding with DAPG reduced the helical content of protein suggesting the unfolding of HSA. Site marker fluorescence experiments revealed the change in binding constant of DAPG in the presence of site I (warfarin) but not site II marker (ibuprofen) which confirmed that the DAPG bound to site I. ITC experiments also supported this as site I marker could not bind to HSA-DAPG complex while site II marker was accommodated in the complex. In silico studies further showed the lowest binding affinity and more stability of DAPG in site I than in site II. Thus the data presented in this study confirms the binding of DAPG to the site I of HSA which may help in further understanding of pharmacokinetic properties of DAPG.
Jungheim, L N; Boyd, D B; Indelicato, J M; Pasini, C E; Preston, D A; Alborn, W E
1991-05-01
Bicyclic tetrahydropyridazinones, such as 13, where X are strongly electron-withdrawing groups, were synthesized to investigate their antibacterial activity. These delta-lactams are homologues of bicyclic pyrazolidinones 15, which were the first non-beta-lactam containing compounds reported to bind to penicillin-binding proteins (PBPs). The delta-lactam compounds exhibit poor antibacterial activity despite having reactivity comparable to the gamma-lactams. Molecular modeling based on semiempirical molecular orbital calculations on a Cray X-MP supercomputer, predicted that the reason for the inactivity is steric bulk hindering high affinity of the compounds to PBPs, as well as high conformational flexibility of the tetrahydropyridazinone ring hampering effective alignment of the molecule in the active site. Subsequent PBP binding experiments confirmed that this class of compound does not bind to PBPs.
Takemura, Kazuhiro; Hanawa-Suetsugu, Kyoko; Suetsugu, Shiro; Kitao, Akio
2017-07-28
The BAR domain superfamily proteins sense or induce curvature in membranes. The inverse-BAR domain (I-BAR) is a BAR domain that forms a straight "zeppelin-shaped" dimer. The mechanisms by which IRSp53 I-BAR binds to and deforms a lipid membrane are investigated here by all-atom molecular dynamics simulation (MD), binding energy analysis, and the effects of mutation experiments on filopodia on HeLa cells. I-BAR adopts a curved structure when crystallized, but adopts a flatter shape in MD. The binding of I-BAR to membrane was stabilized by ~30 salt bridges, consistent with experiments showing that point mutations of the interface residues have little effect on the binding affinity whereas multiple mutations have considerable effect. Salt bridge formation increases the local density of lipids and deforms the membrane into a concave shape. In addition, the point mutations that break key intra-molecular salt bridges within I-BAR reduce the binding affinity; this was confirmed by expressing these mutants in HeLa cells and observing their effects. The results indicate that the stiffness of I-BAR is important for membrane deformation, although I-BAR does not act as a completely rigid template.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gribenko, Alexey; Mosyak, Lidia; Ghosh, Sharmistha
MntC is a metal-binding protein component of the Mn 2 +-specific mntABC transporter from the pathogen Staphylococcus aureus. The protein is expressed during the early stages of infection and was proven to be effective at reducing both S. aureus and Staphylococcus epidermidis infections in a murine animal model when used as a vaccine antigen. MntC is currently being tested in human clinical trials as a component of a multiantigen vaccine for the prevention of S. aureus infections. To better understand the biological function of MntC, we are providing structural and biophysical characterization of the protein in this work. The three-dimensionalmore » structure of the protein was solved by X-ray crystallography at 2.2 Å resolution and suggests two potential metal binding modes, which may lead to reversible as well as irreversible metal binding. Precise Mn 2 +-binding affinity of the protein was determined from the isothermal titration calorimetry experiments using a competition approach. Differential scanning calorimetry experiments confirmed that divalent metals can indeed bind to MntC reversibly as well as irreversibly. Finally, Mn 2 +-induced structural and dynamics changes have been characterized using spectroscopic methods and deuterium–hydrogen exchange mass spectroscopy. Results of the experiments show that these changes are minimal and are largely restricted to the structural elements involved in metal coordination. Therefore, it is unlikely that antibody binding to this antigen will be affected by the occupancy of the metal-binding site by Mn 2 +.« less
Shi, Jie-Hua; Pan, Dong-Qi; Wang, Xiou-Xiou; Liu, Ting-Ting; Jiang, Min; Wang, Qi
2016-09-01
Artemether (AMT), a peroxide sesquiterpenoides, has been widely used as an antimalarial for the treatment of multiple drug-resistant strains of plasmodium falciparum malaria. In this work, the binding interaction of AMT with bovine serum albumin (BSA) under the imitated physiological conditions (pH7.4) was investigated by UV spectroscopy, fluorescence emission spectroscopy, synchronous fluorescence spectroscopy, Fourier transform infrared spectroscopy (FT-IR), circular dichroism (CD), three-dimensional fluorescence spectroscopy and molecular docking methods. The experimental results indicated that there was a change in UV absorption of BSA along with a slight red shift of absorption wavelength, indicating that the interaction of AMT with BSA occurred. The intrinsic fluorescence of BSA was quenched by AMT due to the formation of AMT-BSA complex. The number of binding sites (n) and binding constant of AMT-BSA complex were about 1 and 2.63×10(3)M(-1) at 298K, respectively, suggesting that there was stronger binding interaction of AMT with BSA. Based on the analysis of the signs and magnitudes of the free energy change (ΔG(0)), enthalpic change (ΔH(0)) and entropic change (ΔS(0)) in the binding process, it can be concluded that the binding of AMT with BSA was enthalpy-driven process due to |ΔH°|>|TΔS°|. The results of experiment and molecular docking confirmed the main interaction forces between AMT and BSA were van der Waals force. And, there was a slight change in the BSA conformation after binding AMT but BSA still retains its secondary structure α-helicity. However, it had been confirmed that AMT binds on the interface between sub-domain IIA and IIB of BSA. Copyright © 2016 Elsevier B.V. All rights reserved.
A model of high-affinity antibody binding to type III group B Streptococcus capsular polysaccharide.
Wessels, M R; Muñoz, A; Kasper, D L
1987-12-01
We recently reported that the single repeating-unit pentasaccharide of type III group B Streptococcus (GBS) capsular polysaccharide is only weakly reactive with type III GBS antiserum. To further elucidate the relationship between antigen-chain length and antigenicity, tritiated oligosaccharides derived from type III capsular polysaccharide were used to generate detailed saturation binding curves with a fixed concentration of rabbit antiserum in a radioactive antigen-binding assay. A graded increase in affinity of antigen-antibody binding was seen as oligosaccharide size increased from 2.6 repeating units to 92 repeating units. These differences in affinity of antibody binding to oligosaccharides of different molecular size were confirmed by immunoprecipitation and competitive ELISA, two independent assays of antigen-antibody binding. Analysis of the saturation binding experiment indicated a difference of 300-fold in antibody-binding affinity for the largest versus the smallest tested oligosaccharides. Unexpectedly, the saturation binding values approached by the individual curves were inversely related to oligosaccharide chain length on a molar basis but equivalent on a weight basis. This observation is compatible with a model in which binding of an immunoglobulin molecule to an antigenic site on the polysaccharide facilitates subsequent binding of antibody to that antigen.
Superoxide dismutase activity of Cu-bound prion protein
NASA Astrophysics Data System (ADS)
Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry
2009-03-01
Misfolding of the prion protein, PrP, has been linked to a group of neurodegenerative diseases, including the mad cow disease in cattle and the Creutzfeldt-Jakob disease in humans. The normal function of PrP is still unknown, but it was found that the PrP can efficiently bind Cu(II) ions. Early experiments suggested that Cu-PrP complex possesses significant superoxide dismutase (SOD) activity, but later experiments failed to confirm it and at present this issue remains unresolved. Using a recently developed hybrid DFT/DFT method, which combines Kohn-Sham DFT for the solute and its first solvation shells with orbital-free DFT for the remainder of the solvent, we have investigated SOD activity of PrP. The PrP is capable of incorporating Cu(II) ions in several binding modes and our calculations find that each mode has a different SOD activity. The highest activity found is comparable to those of well-known SOD proteins, suggesting that the conflicting experimental results may be due to different bindings of Cu(II) in those experiments.
Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah
2017-11-21
The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.
Graphene-Based Liquid-Gated Field Effect Transistor for Biosensing: Theory and Experiments
Reiner-Rozman, Ciril; Larisika, Melanie; Nowak, Christoph; Knoll, Wolfgang
2015-01-01
We present an experimental and theoretical characterization for reduced Graphene-Oxide (rGO) based FETs used for biosensing applications. The presented approach shows a complete result analysis and theoretically predictable electrical properties. The formulation was tested for the analysis of the device performance in the liquid gate mode of operation with variation of the ionic strength and pH-values of the electrolytes in contact with the FET. The dependence on the Debye length was confirmed experimentally and theoretically, utilizing the Debye length as a working parameter and thus defining the limits of applicability for the presented rGO-FETs. Furthermore, the FETs were tested for the sensing of biomolecules (bovine serum albumin (BSA) as reference) binding to gate-immobilized anti-BSA antibodies and analyzed using the Langmuir binding theory for the description of the equilibrium surface coverage as a function of the bulk (analyte) concentration. The obtained binding coefficients for BSA are found to be same as in results from literature, hence confirming the applicability of the devices. The FETs used in the experiments were fabricated using wet-chemically synthesized graphene, displaying high electron and hole mobility (μ) and provide the strong sensitivity also for low potential changes (by change of pH, ion concentration, or molecule adsorption). The binding coefficient for BSA-anti-BSA interaction shows a behavior corresponding to the Langmuir adsorption theory with a Limit of Detection (LOD) in the picomolar concentration range. The presented approach shows high reproducibility and sensitivity and a good agreement of the experimental results with the calculated data. PMID:25791463
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Structure of AadA from Salmonella enterica: a monomeric aminoglycoside (3′′)(9) adenyltransferase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Yang; Näsvall, Joakim; Wu, Shiying
The crystal structure of the aminoglycoside-adenylating enzyme AadA is reported together with functional experiments providing insights into its oligomeric state, ligand binding and catalysis. Aminoglycoside resistance is commonly conferred by enzymatic modification of drugs by aminoglycoside-modifying enzymes such as aminoglycoside nucleotidyltransferases (ANTs). Here, the first crystal structure of an ANT(3′′)(9) adenyltransferase, AadA from Salmonella enterica, is presented. AadA catalyses the magnesium-dependent transfer of adenosine monophosphate from ATP to the two chemically dissimilar drugs streptomycin and spectinomycin. The structure was solved using selenium SAD phasing and refined to 2.5 Å resolution. AadA consists of a nucleotidyltransferase domain and an α-helical bundlemore » domain. AadA crystallizes as a monomer and is a monomer in solution as confirmed by small-angle X-ray scattering, in contrast to structurally similar homodimeric adenylating enzymes such as kanamycin nucleotidyltransferase. Isothermal titration calorimetry experiments show that ATP binding has to occur before binding of the aminoglycoside substrate, and structure analysis suggests that ATP binding repositions the two domains for aminoglycoside binding in the interdomain cleft. Candidate residues for ligand binding and catalysis were subjected to site-directed mutagenesis. In vivo resistance and in vitro binding assays support the role of Glu87 as the catalytic base in adenylation, while Arg192 and Lys205 are shown to be critical for ATP binding.« less
González De León, Joenice; González Méndez, Ricardo; Cadilla, Carmen L; Rivera-Mariani, Félix E; Bolaños-Rosero, Benjamín
2018-01-01
Aspergillus penicillioides is a very common indoor xerophilic fungus and potential causative agent of respiratory conditions. Although people are constantly exposed to A. penicillioides, no proteins with allergenic potential have been described. Therefore, we aim to confirm allergic sensitization to A. penicillioides through reactivity in serological assays and detect immunoglobulin E (IgE)-binding proteins. In an indirect ELISA, we compared the serological reactivity to A. penicillioides between subjects with specific IgE (sIgE) (group 1, n = 54) and no sIgE reactivity (group 2, n = 15) against commercial allergens. Correlations and principal component analysis were performed to identify associations between reactivity to commercial allergens and A. penicillioides. IgE-binding proteins in A. penicillioides were visualized using Western blotting (WB) in group 1. The IgE-binding proteins with the highest reactivity were analyzed by mass spectrometry and confirmed by transcript matching. There was no statistical significance (p = 0.1656) between the study groups in serological reactivity. Correlations between reactivity to A. penicillioides, dog epithelia, Aspergillus fumigatus, and Penicillium chrysogenum were observed. WB experiments showed 6 IgE-binding proteins with molecular weights ranging from 45 to 145 kDa. Proteins of 108, 83, and 56 kDa showed higher reactivity. Mass spectrometry analysis of these 3 proteins led to the putative identification of NADP-specific glutamate dehydrogenase and catalase B. This was confirmed with transcriptome analysis. These results provide evidence of the presence of potential allergenic components in A. penicillioides. Further analysis of the putatively identified proteins should reveal their allergenic potential. © 2018 S. Karger AG, Basel.
Aptamer Based Microsphere Biosensor for Thrombin Detection
Zhu, Hongying; Suter, Jonathan D.; White, Ian M.; Fan, Xudong
2006-01-01
We have developed an optical microsphere resonator biosensor using aptamer as receptor for the measurement of the important biomolecule thrombin. The sphere surface is modified with anti-thrombin aptamer, which has excellent binding affinity and selectivity for thrombin. Binding of the thrombin at the sphere surface is monitored by the spectral position of the microsphere's whispering gallery mode resonances. A detection limit on the order of 1 NIH Unit/mL is demonstrated. Control experiments with non-aptamer oligonucleotide and BSA are also carried out to confirm the specific binding between aptamer and thrombin. We expect that this demonstration will lead to the development of highly sensitive biomarker sensors based on aptamer with lower cost and higher throughput than current technology.
A semisynthetic Atg3 reveals that acetylation promotes Atg3 membrane binding and Atg8 lipidation
NASA Astrophysics Data System (ADS)
Li, Yi-Tong; Yi, Cong; Chen, Chen-Chen; Lan, Huan; Pan, Man; Zhang, Shao-Jin; Huang, Yi-Chao; Guan, Chao-Jian; Li, Yi-Ming; Yu, Li; Liu, Lei
2017-03-01
Acetylation of Atg3 regulates the lipidation of the protein Atg8 in autophagy. The molecular mechanism behind this important biochemical event remains to be elucidated. We describe the first semi-synthesis of homogeneous K19/K48-diacetylated Atg3 through sequential hydrazide-based native chemical ligation. In vitro reconstitution experiments with the semi-synthetic proteins confirm that Atg3 acetylation can promote the lipidation of Atg8. We find that acetylation of Atg3 enhances its binding to phosphatidylethanolamine-containing liposomes and to endoplasmic reticulum, through which it promotes the lipidation process.
Lectins discriminate between pathogenic and nonpathogenic South American trypanosomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Miranda Santos, I.K.; Pereira, M.E.
1984-09-01
Cell surface carbohydrates of Trypanosoma cruzi, Trypanosoma rangeli, and Trypanosoma conorhini were analyzed by a micro-agglutination assay employing 27 highly purified lectins and by binding assays using various /sup 125/I-labeled lectins. The following seven lectins discriminated between the trypanosomes: 1) tomato lectin (an N-acetyl-D-glucosamine-binding protein), both in purified form and as crude tomato juice; 2) Bauhinea purpurea and Sophora japonica lectins (both N-acetyl-D-galactosamine-binding proteins), which selectively agglutinated T. cruzi; 3) Vicia villosa (an N-acetyl-D-galactosamine-binding protein) which was specific for T. rangeli; 4) peanut lectin (a D-galactose-binding protein) both in purified form and as crude saline extract; and 5) Ulex europaeusmore » and Lotus tetragonolobus (both L-fucose-binding proteins) lectins which reacted only with T. conorhini. Binding studies with 125I-labeled lectins were performed to find whether unagglutinated cells of the three different species of trypanosomes might have receptors for these lectins, in which case absence of agglutination could be due to a peculiar arrangement of the receptors. These assays essentially confirmed the agglutination experiments.« less
Ham, Byung-Kook; Brandom, Jeri L.; Xoconostle-Cázares, Beatriz; Ringgold, Vanessa; Lough, Tony J.; Lucas, William J.
2009-01-01
RNA binding proteins (RBPs) are integral components of ribonucleoprotein (RNP) complexes and play a central role in RNA processing. In plants, some RBPs function in a non-cell-autonomous manner. The angiosperm phloem translocation stream contains a unique population of RBPs, but little is known regarding the nature of the proteins and mRNA species that constitute phloem-mobile RNP complexes. Here, we identified and characterized a 50-kD pumpkin (Cucurbita maxima cv Big Max) phloem RNA binding protein (RBP50) that is evolutionarily related to animal polypyrimidine tract binding proteins. In situ hybridization studies indicated a high level of RBP50 transcripts in companion cells, while immunolocalization experiments detected RBP50 in both companion cells and sieve elements. A comparison of the levels of RBP50 present in vascular bundles and phloem sap indicated that this protein is highly enriched in the phloem sap. Heterografting experiments confirmed that RBP50 is translocated from source to sink tissues. Collectively, these findings established that RBP50 functions as a non-cell-autonomous RBP. Protein overlay, coimmunoprecipitation, and cross-linking experiments identified the phloem proteins and mRNA species that constitute RBP50-based RNP complexes. Gel mobility-shift assays demonstrated that specificity, with respect to the bound mRNA, is established by the polypyrimidine tract binding motifs within such transcripts. We present a model for RBP50-based RNP complexes within the pumpkin phloem translocation stream. PMID:19122103
2013-01-01
Background PQS (PseudomonasQuinolone Signal) and its precursor HHQ are signal molecules of the P. aeruginosa quorum sensing system. They explicate their role in mammalian pathogenicity by binding to the receptor PqsR that induces virulence factor production and biofilm formation. The enzyme PqsD catalyses the biosynthesis of HHQ. Results Enzyme kinetic analysis and surface plasmon resonance (SPR) biosensor experiments were used to determine mechanism and substrate order of the biosynthesis. Comparative analysis led to the identification of domains involved in functionality of PqsD. A kinetic cycle was set up and molecular dynamics (MD) simulations were used to study the molecular bases of the kinetics of PqsD. Trajectory analysis, pocket volume measurements, binding energy estimations and decompositions ensured insights into the binding mode of the substrates anthraniloyl-CoA and β-ketodecanoic acid. Conclusions Enzyme kinetics and SPR experiments hint at a ping-pong mechanism for PqsD with ACoA as first substrate. Trajectory analysis of different PqsD complexes evidenced ligand-dependent induced-fit motions affecting the modified ACoA funnel access to the exposure of a secondary channel. A tunnel-network is formed in which Ser317 plays an important role by binding to both substrates. Mutagenesis experiments resulting in the inactive S317F mutant confirmed the importance of this residue. Two binding modes for β-ketodecanoic acid were identified with distinct catalytic mechanism preferences. PMID:23916145
Short term memory for single surface features and bindings in ageing: A replication study.
Isella, Valeria; Molteni, Federica; Mapelli, Cristina; Ferrarese, Carlo
2015-06-01
In the present study we replicated a previous experiment investigating visuo-spatial short term memory binding in young and older healthy individuals, in the attempt to verify the pattern of impairment that can be observed in normal elderly for short term memory for single items vs short term memory for bindings. Assessing a larger sample size (25 young and 25 older subjects), using a more appropriate measure of accuracy for a change detection task (A'), and adding the evaluation of speed of performance, we confirmed that old normals show a decline in short term memory for bindings of shape and colour that is of comparable extent, and not major, to the decline in memory for single shapes and single colours. The absence of a specific deficit of short term memory for conjunctions of surface features seems to distinguish cognitive ageing from Alzheimer's Disease. Copyright © 2015 Elsevier Inc. All rights reserved.
A dynamically coupled allosteric network underlies binding cooperativity in Src kinase
Foda, Zachariah H.; Shan, Yibing; Kim, Eric T.; Shaw, David E.; Seeliger, Markus A.
2015-01-01
Protein tyrosine kinases are attractive drug targets because many human diseases are associated with the deregulation of kinase activity. However, how the catalytic kinase domain integrates different signals and switches from an active to an inactive conformation remains incompletely understood. Here we identify an allosteric network of dynamically coupled amino acids in Src kinase that connects regulatory sites to the ATP- and substrate-binding sites. Surprisingly, reactants (ATP and peptide substrates) bind with negative cooperativity to Src kinase while products (ADP and phosphopeptide) bind with positive cooperativity. We confirm the molecular details of the signal relay through the allosteric network by biochemical studies. Experiments on two additional protein tyrosine kinases indicate that the allosteric network may be largely conserved among these enzymes. Our work provides new insights into the regulation of protein tyrosine kinases and establishes a potential conduit by which resistance mutations to ATP-competitive kinase inhibitors can affect their activity. PMID:25600932
T cell specific adaptor protein (TSAd) promotes interaction of Nck with Lck and SLP-76 in T cells.
Hem, Cecilie Dahl; Sundvold-Gjerstad, Vibeke; Granum, Stine; Koll, Lise; Abrahamsen, Greger; Buday, Laszlo; Spurkland, Anne
2015-07-11
The Lck and Src binding adaptor protein TSAd (T cell specific adaptor) regulates actin polymerization in T cells and endothelial cells. The molecular details as to how TSAd regulates this process remain to be elucidated. To identify novel interaction partners for TSAd, we used a scoring matrix-assisted ligand algorithm (SMALI), and found that the Src homology 2 (SH2) domain of the actin regulator Non-catalytic region of tyrosine kinase adaptor protein (Nck) potentially binds to TSAd phosphorylated on Tyr(280) (pTyr(280)) and pTyr(305). These predictions were confirmed by peptide array analysis, showing direct binding of recombinant Nck SH2 to both pTyr(280) and pTyr(305) on TSAd. In addition, the SH3 domains of Nck interacted with the proline rich region (PRR) of TSAd. Pull-down and immunoprecipitation experiments further confirmed the Nck-TSAd interactions through Nck SH2 and SH3 domains. In line with this Nck and TSAd co-localized in Jurkat cells as assessed by confocal microscopy and imaging flow cytometry. Co-immunoprecipitation experiments in Jurkat TAg cells lacking TSAd revealed that TSAd promotes interaction of Nck with Lck and SLP-76, but not Vav1. TSAd expressing Jurkat cells contained more polymerized actin, an effect dependent on TSAd exon 7, which includes interactions sites for both Nck and Lck. TSAd binds to and co-localizes with Nck. Expression of TSAd increases both Nck-Lck and Nck-SLP-76 interaction in T cells. Recruitment of Lck and SLP-76 to Nck by TSAd could be one mechanism by which TSAd promotes actin polymerization in activated T cells.
Ao, Junjie; Gao, Li; Yuan, Tao; Jiang, Gaofeng
2015-01-01
Organic UV filters are a group of emerging PPCP (pharmaceuticals and personal care products) contaminants. Current information is insufficient to understand the in vivo processes and health risks of organic UV filters in humans. The interaction mechanism of UV filters with serum albumin provides critical information for the health risk assessment of these active ingredients in sunscreen products. This study investigates the interaction mechanisms of five commonly used UV filters (2-hydroxy-4-methoxybenzophenone, BP-3; 2-ethylhexyl 4-methoxycinnamate, EHMC; 4-methylbenzylidene camphor, 4-MBC; methoxydibenzoylmethane, BDM; homosalate, HMS) with bovine serum albumin (BSA) by spectroscopic measurements of fluorescence, circular dichroism (CD), competitive binding experiments and molecular docking. Our results indicated that the fluorescence of BSA was quenched by these UV filters through a static quenching mechanism. The values of the binding constant (Ka) ranged from (0.78±0.02)×10(3) to (1.29±0.01)×10(5) L mol(-1). Further exploration by synchronous fluorescence and CD showed that the conformation of BSA was demonstrably changed in the presence of these organic UV filters. It was confirmed that the UV filters can disrupt the α-helical stability of BSA. Moreover, the results of molecular docking revealed that the UV filter molecule is located in site II (sub-domain IIIA) of BSA, which was further confirmed by the results of competitive binding experiments. In addition, binding occurred mainly through hydrogen bonding and hydrophobic interaction. This study raises critical concerns regarding the transportation, distribution and toxicity effects of organic UV filters in human body. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barhanin, J.; Meiri, H.; Romey, G.
1985-03-01
The authors describe the properties of a monoclonal antibody against the Na/sup +/ channel. The antibody, 72.38, competitively inhibited the binding of an /sup 125/I-labeled toxin from the Brazilian scorpion Tityus serrulatus (/sup 125/I-TiTX..gamma..) to Na/sup +/ channels of rat brain membranes. The inhibition of /sup 125/I-TiTX..gamma.. binding also was observed with the solubilized Na/sup +/ channel from rat brain membranes. Antibody 72.38 antagonized /sup 125/I-TiTX..gamma.. binding to Na/sup +/ channels from different animal species (fish, avian, and mammalian) and from different tissues (electroplax, brain, heart, and muscle). Moreover, 72.38 has been used for immunofluorescence labeling of Na/sup +/ channelsmore » in rat sciatic nodes of Ranvier and cultured dorsal root ganglion cells. Electrophysiological experiments on rat muscle cells fully confirmed the similarity between TiTX..gamma.. and 72.38 seen in binding experiments. TiTX..gamma.. and 72.38 are without effect on the ion selectivity of the Na/sup +/ channel, but they both drastically change the voltage-dependence of activation and inactivation of the Na/sup +/ channel.« less
Feature binding and attention in working memory: a resolution of previous contradictory findings.
Allen, Richard J; Hitch, Graham J; Mate, Judit; Baddeley, Alan D
2012-01-01
We aimed to resolve an apparent contradiction between previous experiments from different laboratories, using dual-task methodology to compare effects of a concurrent executive load on immediate recognition memory for colours or shapes of items or their colour-shape combinations. Results of two experiments confirmed previous evidence that an irrelevant attentional load interferes equally with memory for features and memory for feature bindings. Detailed analyses suggested that previous contradictory evidence arose from limitations in the way recognition memory was measured. The present findings are inconsistent with an earlier suggestion that feature binding takes place within a multimodal episodic buffer Baddeley, ( 2000 ) and support a subsequent account in which binding takes place automatically prior to information entering the episodic buffer Baddeley, Allen, & Hitch, ( 2011 ). Methodologically, the results suggest that different measures of recognition memory performance (A', d', corrected recognition) give a converging picture of main effects, but are less consistent in detecting interactions. We suggest that this limitation on the reliability of measuring recognition should be taken into account in future research so as to avoid problems of replication that turn out to be more apparent than real.
Expression and purification of RHC-EGFP fusion protein and its application in hyaluronic acid assay.
Duan, Ningjun; Lv, Wansheng; Zhu, Lingli; Zheng, Weijuan; Hua, Zichun
2017-03-16
Hyaluronan is a widely distributed glycosaminoglycan which has multiple functions. Hyaluronic acid (HA) accumulation has been reported in many human diseases. Understanding the role of hyaluronan and its binding proteins in the pathobiology of disease will facilitate the development of novel therapeutics for many critical diseases. Current techniques described for the analysis of HA are mainly for HA quantification in solutions, not for the direct detection of HA in tissues or on cell surfaces. In our study, a fusion protein, named C-terminal domain of RHAMM-enhanced green fluorescence protein (RHC-EGFP), combined the HA-binding domain, C-terminal of receptor for hyaluronan-mediated motility, with EGFP, a widely used enhanced green fluorescence protein, was expressed and purified from Escherichia coli with high purity. Based on the sensitivity and convenience of fluorescence detection, methods for direct assay of HA in solutions, on cell surface or in tissues were established using RHC-EGFP. The binding specificity was also confirmed by competitive binding experiment and hyaluronidase degradation experiment. Our results provide an alternative choice for the specific and convenient assay of HA in various samples, and maybe helpful for further understanding of the fundamental and comprehensive functions of HA.
Pedò, Massimo; Löhr, Frank; D'Onofrio, Mariapina; Assfalg, Michael; Dötsch, Volker; Molinari, Henriette
2009-12-18
Bile acid molecules are transferred vectorially between basolateral and apical membranes of hepatocytes and enterocytes in the context of the enterohepatic circulation, a process regulating whole body lipid homeostasis. This work addresses the role of the cytosolic lipid binding proteins in the intracellular transfer of bile acids between different membrane compartments. We present nuclear magnetic resonance (NMR) data describing the ternary system composed of the bile acid binding protein, bile acids, and membrane mimetic systems, such as anionic liposomes. This work provides evidence that the investigated liver bile acid binding protein undergoes association with the anionic membrane and binding-induced partial unfolding. The addition of the physiological ligand to the protein-liposome mixture is capable of modulating this interaction, shifting the equilibrium towards the free folded holo protein. An ensemble of NMR titration experiments, based on nitrogen-15 protein and ligand observation, confirm that the membrane and the ligand establish competing binding equilibria, modulating the cytoplasmic permeability of bile acids. These results support a mechanism of ligand binding and release controlled by the onset of a bile salt concentration gradient within the polarized cell. The location of a specific protein region interacting with liposomes is highlighted.
NASA Astrophysics Data System (ADS)
Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya
2017-05-01
Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.
Analysis of the Binding Sites of Porcine Sialoadhesin Receptor with PRRSV
Jiang, Yibo; Khan, Faheem Ahmed; Pandupuspitasari, Nuruliarizki Shinta; Kadariya, Ishwari; Cheng, Zhangrui; Ren, Yuwei; Chen, Xing; Zhou, Ao; Yang, Liguo; Kong, Dexin; Zhang, Shujun
2013-01-01
Porcine reproductive and respiratory syndrome virus (PRRSV) can infect pigs and cause enormous economic losses to the pig industry worldwide. Porcine sialoadhesin (pSN) and CD163 have been identified as key viral receptors on porcine alveolar macrophages (PAM), a main target cell infected by PRRSV. In this study, the protein structures of amino acids 1–119 from the pSN and cSN (cattle sialoadhesin) N-termini (excluding the 19-amino acid signal peptide) were modeled via homology modeling based on mSN (mouse sialoadhesin) template structures using bioinformatics tools. Subsequently, pSN and cSN homology structures were superposed onto the mSN protein structure to predict the binding sites of pSN. As a validation experiment, the SN N-terminus (including the wild-type and site-directed-mutant-types of pSN and cSN) was cloned and expressed as a SN-GFP chimera protein. The binding activity between SN and PRRSV was confirmed by WB (Western blotting), FAR-WB (far Western blotting), ELISA (enzyme-linked immunosorbent assay) and immunofluorescence assay. We found that the S107 amino acid residue in the pSN N-terminal played a crucial role in forming a special cavity, as well as a hydrogen bond for enhancing PRRSV binding during PRRSV infection. S107 may be glycosylated during PRRSV infection and may also be involved in forming the cavity for binding PRRSV along with other sites, including W2, Y44, S45, R97, R105, W106 and V109. Additionally, S107 might also be important for pSN binding with PRRSV. However, the function of these binding sites must be confirmed by further studies. PMID:24351868
Kulp, John L.; Cloudsdale, Ian S.; Kulp, John L.
2017-01-01
Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition. PMID:28837642
Kulp, John L; Cloudsdale, Ian S; Kulp, John L; Guarnieri, Frank
2017-01-01
Chemically diverse fragments tend to collectively bind at localized sites on proteins, which is a cornerstone of fragment-based techniques. A central question is how general are these strategies for predicting a wide variety of molecular interactions such as small molecule-protein, protein-protein and protein-nucleic acid for both experimental and computational methods. To address this issue, we recently proposed three governing principles, (1) accurate prediction of fragment-macromolecule binding free energy, (2) accurate prediction of water-macromolecule binding free energy, and (3) locating sites on a macromolecule that have high affinity for a diversity of fragments and low affinity for water. To test the generality of these concepts we used the computational technique of Simulated Annealing of Chemical Potential to design one small fragment to break the RecA-RecA protein-protein interaction and three fragments that inhibit peptide-deformylase via water-mediated multi-body interactions. Experiments confirm the predictions that 6-hydroxydopamine potently inhibits RecA and that PDF inhibition quantitatively tracks the water-mediated binding predictions. Additionally, the principles correctly predict the essential bound waters in HIV Protease, the surprisingly extensive binding site of elastase, the pinpoint location of electron transfer in dihydrofolate reductase, the HIV TAT-TAR protein-RNA interactions, and the MDM2-MDM4 differential binding to p53. The experimental confirmations of highly non-obvious predictions combined with the precise characterization of a broad range of known phenomena lend strong support to the generality of fragment-based methods for characterizing molecular recognition.
Gattuso, Hugo; Besancenot, Vanessa; Grandemange, Stéphanie; Marazzi, Marco; Monari, Antonio
2016-01-01
We report a molecular modeling study, coupled with spectroscopy experiments, on the behavior of two well known organic dyes, nile blue and nile red, when interacting with B-DNA. In particular, we evidence the presence of two competitive binding modes, for both drugs. However their subsequent photophysical behavior is different and only nile blue is able to induce DNA photosensitization via an electron transfer mechanism. Most notably, even in the case of nile blue, its sensitization capabilities strongly depend on the environment resulting in a single active binding mode: the minor groove. Fluorescence spectroscopy confirms the presence of competitive interaction modes for both sensitizers, while the sensitization via electron transfer, is possible only in the case of nile blue. PMID:27329409
Structural insights into a StART-like domain in Lam4 and its interaction with sterol ligands.
Gatta, Alberto T; Sauerwein, Andrea C; Zhuravleva, Anastasia; Levine, Tim P; Matthews, Stephen
2018-01-15
Sterols are essential components of cellular membranes and shape their biophysical properties. The recently discovered family of Lipid transfer proteins Anchored at Membrane contact sites (LAMs) has been suggested to carry out intracellular sterol traffic using StART-like domains. Here, we studied the second StART-like domain of Lam4p from S. cerevisiae by NMR. We show that NMR data are consistent with the StART-like domain structure, and that several functionally important regions within the domain exhibit significant conformational dynamics. NMR titration experiments confirm sterol binding to the canonical sterol-binding site and suggest a role of membrane interactions on the thermodynamics and kinetics of sterol binding. Copyright © 2017 Elsevier Inc. All rights reserved.
Komori, S; Sakata, K; Kasumi, H; Tsuji, Y; Hamada, K; Koyama, K
1999-10-01
DNA analysis of the androgen receptor gene in a patient with complete androgen insensitivity syndrome identified a substitutional mutation (tyrosine converted to cysteine at position 571) in the DNA binding domain. In vitro transfection experiments with the patients' androgen receptor gene, indicated normal expression of the androgen receptor in transfected COS-7 cells compared to the wild type gene. There was also no evidence of impaired thermal stability of the 5 alpha-dihydrotestosterone-androgen receptor complex. However, the capacity of the androgen receptor to activate target gene transcription was found to be completely disrupted in a luciferase assay. These results confirmed that only one substitutional mutation in the DNA binding domain was related to the pathogenesis of the complete androgen insensitivity syndrome.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Change of the binding mode of the DNA/proflavine system induced by ethanol.
García, Begoña; Leal, José M; Ruiz, Rebeca; Biver, Tarita; Secco, Fernando; Venturini, M
2010-07-01
The equilibria and kinetics of the binding of proflavine to poly(dG-dC).poly(dG-dC) and poly(dA-dT).poly(dA-dT) were investigated in ethanol/water mixtures using spectrophotometric, circular dichroism, viscometric, and T-jump methods. All methods concur in showing that two modes of interaction are operative: intercalation and surface binding. The latter mode is favored by increasing ethanol and/or the proflavine content. Both static and kinetic experiments show that, concerning the poly(dG-dC).poly(dG-dC)/proflavine system, intercalation largely prevails up to 20% EtOH. For higher EtOH levels surface binding becomes dominant. Concerning the poly(dA-dT).poly(dA-dT)/proflavine system, melting experiments show that addition of proflavine stabilizes the double stranded structure, but the effect is reduced in the presence of EtOH. The DeltaH degrees and DeltaS degrees values of the melting process, measured at different concentrations of added proflavine, are linearly correlated, revealing the presence of the enthalpy-entropy compensation phenomenon (EEC). The nonmonotonicity of the "entropic term" of the EEC reveals the transition between the two binding modes. T-jump experiments show two relaxation effects, but at the highest levels of EtOH (>25%) the kinetic curves become monophasic, confirming the prevalence of the surface complex. A branched mechanism is proposed where diffusion controlled formation of a precursor complex occurs in the early stage of the binding process. This evolves toward the surface and/or the intercalated complex according to two rate-determining parallel steps. CD spectra suggest that, in the surface complex, proflavine is bound to DNA in the form of an aggregate.
Fluorenone based fluorescent probe for selective "turn-on" detection of pyrophosphate and alanine
NASA Astrophysics Data System (ADS)
Daniel Thangadurai, T.; Nithya, I.; Manjubaashini, N.; Bhuvanesh, N.; Bharathi, G.; Nandhakumar, R.; Nataraj, D.
2018-06-01
To sense biologically important entities with different size and dimensions, a fluorenone based fluorescent receptor was designed and synthesized. Probe 1 displayed a distinct fluorescence enhancement emission at 565 nm for pyrophosphate and 530 nm for alanine in polar solvent. The fluorescence titration experiments confirm 1:1 stoichiometric ratio with high-binding constant and very low limit of detection (LoD) values. Receptor 1 showed a highly selective and sensitive recognition to HP2O73 - and to alanine over other competitive anions and amino acids. In addition, the fluorescence lifetime measurement and reversible binding study results support the practical importance of 1.
Sengupta, Abhigyan; Sasikala, Wilbee D; Mukherjee, Arnab; Hazra, Partha
2012-06-04
Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) are derivatives of riboflavin (RF), a water-soluble vitamin, more commonly known as vitamin B(2). Flavins have attracted special attention in the last few years because of the recent discovery of a large number of flavoproteins. In this work, these flavins are used as extrinsic fluorescence markers for probing the microheterogeneous environment of a well-known transport protein, human serum albumin (HSA). Steady-state and time-resolved fluorescence experiments confirm that both FMN and FAD bind to the Sudlow's site-1 (SS1) binding pocket of HSA, where Trp214 resides. In the case of RF, a fraction of RF molecules binds at the SS1, whereas the major fraction of RF molecules remains unbound or surface bound to the protein. Moreover, flavin(s)-HSA interactions are monitored with the help of isothermal titration calorimetry, which provides free energy, enthalpy, and entropy changes of binding along with the binding constants. The molecular picture of binding interaction between flavins and HSA is well explored by docking and molecular dynamics studies. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allescher, H.D.; Ahmad, S.; Classen, M.
Receptor binding of the opioid receptor antagonist, ({sup 3}H)diprenorphine, which has a similar affinity to the various opioid receptor subtypes, was characterized in subcellular fractions derived from either longitudinal or circular smooth muscle of the canine small intestine with their plexuses (myenteric plexus and deep muscular plexus, respectively) attached. The distribution of opioid binding activity showed a good correlation in the different fractions with the binding of the neuronal marker ({sup 3}H)saxitoxin but no correlation to the smooth muscle plasma membrane marker 5'-nucleotidase. The saturation data (Kd = 0.12 +/- 0.04 nM and maximum binding = 400 +/- 20 fmol/mg)more » and the data from kinetic experiments (Kd = 0.08 nmol) in the myenteric plexus were in good agreement with results obtained previously from the circular muscle/deep muscular plexus preparation. Competition experiments using selective drugs for mu (morphiceptin-analog (N-MePhe3-D-Pro4)-morphiceptin), delta (D-Pen2,5-enkephalin) and kappa (dynorphin 1-13, U50488-H) ligands showed the existence of all three receptor subtypes. The existence of kappa receptors was confirmed in saturation experiments using ({sup 3}H) ethylketocycloazocine as labeled ligand. Two putative opioid agonists, with effects on gastrointestinal motility, trimebutine and JO-1196 (fedotozin), were also examined. Trimebutine (Ki = 0.18 microM), Des-Met-trimebutine (Ki = 0.72 microM) and Jo-1196 (Ki = 0.19 microM) displaced specific opiate binding. The relative affinity for the opioid receptor subtypes was mu = 0.44, delta = 0.30 and kappa = 0.26 for trimebutine and mu = 0.25, delta = 0.22 and kappa = 0.52 for Jo-1196.« less
Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.
Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S
2008-01-01
Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.
Manna, Anamika; Chakravorti, Sankar
2013-02-02
The role of a nanocomposite (NC), composed of intercalation of the diblock copolymer polyethylene-b-polyethylene glycol (PE-b-PEG) with the anionic surfactant sodium dodecyl sulphate (SDS), on the binding characteristics of bovine serum albumin (BSA) with a dye (1,8-naphthalimide, NAPMD) compared to the interaction between the same players in aqueous solution has been examined comprehensively in this paper. Static quenching due to complex formation in both NC medium and in buffer solution has been inferred on the basis of considerable changes in the absorption spectra of BSA on addition of NAPMD, of which the interaction is found to be stronger in NC medium. Temperature dependent fluorescence data also confirm an effective static quenching and stronger binding of NAPMD with BSA in NC medium. Peptide chain unfolding and denaturing of BSA in NC medium have been confirmed from steady state and time-resolved emission and circular dichroism data. This exposes both the tyrosine and tryptophan moieties as a unique case. Increased energy transfer between NAPMD and the tryptophan residue in the unfolded form of BSA helps in the appearance of tyrosine fluorescence in NC medium by quenching the tryptophan band. Ionization of the hydroxyl group in the aromatic ring of the tyrosine residue by the PEG group present in the NC medium produces a downshift of the tyrosine fluorescence band. The use of site selective markers confirms that NAPMD is near tryptophan in Sudlow's site I in NC medium and in buffer solution it is away from tryptophan in Sudlow's site II. The theoretical docking studies also vindicate the results of binding of NAPMD with BSA in site I or site II in NC and buffer media, as observed from different emission experiments including the site selective markers study.
Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J
1992-01-01
Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821
DOE Office of Scientific and Technical Information (OSTI.GOV)
Glaum, S.R.
1988-01-01
The project consisted of two related studies: (1) the characterization of serotonin binding sites in crude and purified synaptic membranes prepared from the rat spinal cord, and (2) the association of serotonin binding sites with functional 5-HT receptor responses in the modulation of nociceptive information at the level of the spinal cord. The first series of experiments involved the preparation of membranes from the dorsal and ventral halves of the rat spinal cord and the demonstration of specific ({sup 3}H)serotonin binding to these membranes. High affinity binding sites which conformed to the 5-HT{sub 3} subtype were identified in dorsal, butmore » not ventral spinal cord synaptic membranes. These experiments also confirmed the presence of high affinity ({sup 3}H)5-HT binding sites in dorsal spinal cord synaptic membranes of the 5-HT{sub 1} subtype. The second group of studies demonstrated the ability of selective 5-HT{sub 3} antagonists to inhibit the antinociceptive response to intrathecally administered 5-HT, as measured by a change in tail flick and hot plate latencies. Intrathecal pretreatment with the selective 5-HT{sub 3} antagonists ICS 205-930 or MDL 72222 abolished the antinociceptive effects of 5-HT. Furthermore, the selective 5-HT{sub 3} agonist 2-methyl-5-HT mimicked the antinociceptive effects of 5-HT.« less
NASA Astrophysics Data System (ADS)
Hamed, Mazen Y.
2018-05-01
Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔGlinkers, otherstructuralfactors = ΔGzif268 - (ΔGF1+F2+F3) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition, specificity and anchoring of the zinc finger protein to DNA.
Hamed, Mazen Y
2018-05-03
Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔG linkers, otherstructuralfactors = ΔG zif268 - (ΔG F1+F2+F3 ) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition, specificity and anchoring of the zinc finger protein to DNA.
Calvo, E J; Danilowicz, C; Lagier, C M; Manrique, J; Otero, M
2004-05-15
Multilayer immobilization of antibody and redox polymer molecules on a gold electrode was achieved, as a strategy for the potential development of an amperometric immunosensor. The step-by-step assembly of antibiotin IgG on Os(bpy)(2)ClPyCH(2)NH poly(allylamine) redox polymer (PAH-Os) adsorbed on thiolated gold electrodes was proved by quartz crystal microbalance (QCM) and atomic force microscopy (AFM) experiments, confirming the electrochemical evidence. The increase of redox charge during the layer-by-layer deposition demonstrated that charge propagation within the layers is feasible. The multilayer structure proved to be effective for the molecular recognition of horseradish peroxidase-biotin conjugate (HRP-biotin), as confirmed by the QCM measurements and the electrocatalytic reduction current obtained upon H(2)O(2) addition. The catalytic current resulting from PAH-Os mediation was shown to increase with the number of assembled layers. Furthermore, the inventory of IgG molecules on the supramolecular self-assembled structure and the specific and non-specific binding of HRP-biotin conjugate were confirmed by the QCM transient studies, giving information on the kinetics of IgG deposition and HRP-biotin conjugate binding to the IgG.
Ibrutinib targets mutant-EGFR kinase with a distinct binding conformation.
Wang, Aoli; Yan, Xiao-E; Wu, Hong; Wang, Wenchao; Hu, Chen; Chen, Cheng; Zhao, Zheng; Zhao, Peng; Li, Xixiang; Wang, Li; Wang, Beilei; Ye, Zi; Wang, Jinhua; Wang, Chu; Zhang, Wei; Gray, Nathanael S; Weisberg, Ellen L; Chen, Liang; Liu, Jing; Yun, Cai-Hong; Liu, Qingsong
2016-10-25
Ibrutinib, a clinically approved irreversible BTK kinase inhibitor for Mantle Cell Lymphoma (MCL) and Chronic Lymphocytic Leukemia (CLL) etc, has been reported to be potent against EGFR mutant kinase and currently being evaluated in clinic for Non Small Cell Lung Cancer (NSCLC). Through EGFR wt/mutant engineered isogenic BaF3 cell lines we confirmed the irreversible binding mode of Ibrutinib with EGFR wt/mutant kinase via Cys797. However, comparing to typical irreversible EGFR inhibitor, such as WZ4002, the washing-out experiments revealed a much less efficient covalent binding for Ibrutinib. The biochemical binding affinity examination in the EGFR L858R/T790M kinase revealed that, comparing to more efficient irreversible inhibitor WZ4002 (Kd: 0.074 μM), Ibrutinib exhibited less efficient binding (Kd: 0.18 μM). An X-ray crystal structure of EGFR (T790M) in complex with Ibrutinib exhibited a unique DFG-in/c-Helix-out inactive binding conformation, which partially explained the less efficiency of covalent binding and provided insight for further development of highly efficient irreversible binding inhibitor for the EGFR mutant kinase. These results also imply that, unlike the canonical irreversible inhibitor, sustained effective concentration might be required for Ibrutinib in order to achieve the maximal efficacy in the clinic application against EGFR driven NSCLC.
Weißenstein, Annike; Saha-Möller, Chantu R; Würthner, Frank
2018-06-04
The host-guest binding properties of a fluorescent perylene bisimide (PBI) receptor equipped with crown ether were studied in detail with a series of aromatic amino acids and dipeptides by UV/Vis, fluorescence and NMR spectroscopy. Fluorescence titration experiments showed that electron-rich aromatic amino acids and dipeptides strongly quench the fluorescence of the electron-poor PBI host molecule. Benesi-Hildebrand plots of fluorescence titration data confirmed the formation of host-guest complexes with 1:2 stoichiometry. Binding constants determined by global analysis of UV/Vis and fluorescence titration experiments revealed values between 10 3 m -1 and 10 5 m -1 in acetonitrile/methanol (9:1) at 23 °C. These data showed that amino acid l-Trp having an indole group and dipeptides containing this amino acid bind to the PBI receptor more strongly than other amino acids and dipeptides investigated here. For dipeptides containing l-Trp or l-Tyr, the binding strength is dependent on the distance between the ammonium group and the aromatic unit of the amino acids and dipeptides leading to a strong sensitivity for Ala-Trp dipeptide. 1D and 2D NMR experiments also corroborated 1:2 host-guest complexation and indicated formation of two diastereomeric species of host-guest complexes. The studies have shown that a properly functionalized PBI fluorophore functions as a molecular probe for the optical sensing of aromatic amino acids and dipeptides. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A
2007-11-01
BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.
Solution structure and interactions of the Escherichia coli cell division activator protein CedA.
Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen
2005-05-10
CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.
NASA Astrophysics Data System (ADS)
Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.
2017-01-01
The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.
2018-01-01
New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus. In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of KD = 20 ± 1 nM. PMID:29495282
Stoltenburg, Regina; Strehlitz, Beate
2018-02-24
New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus . In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of K D = 20 ± 1 nM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gencoglu, Maria F.; Spurri, Amanda; Franko, Mitchell
We report that soft-templated mesoporous carbon is morphologically a non-nano type of carbon. It is a relatively newer variety of biomaterial, which has already demonstrated its successful role in drug delivery applications. To investigate the toxicity and biocompatibility, we introduced three types of mesoporous carbons with varying synthesis conditions and pore textural properties. We compared the Brunauer–Emmett–Teller (BET) surface area and pore width and performed cytotoxicity experiments with HeLa cells, cell viability studies with fibroblast cells and hemocomapatibility studies. Cytotoxicity tests reveal that two of the carbons are not cytotoxic, with cell survival over 90%. The mesoporous carbon with themore » highest surface area showed slight toxicity (~70% cell survival) at the highest carbon concentration of 500 μg/mL. Fibroblast cell viability assays suggested high and constant viability of over 98% after 3 days with no apparent relation with materials property and good visible cell-carbon compatibility. No hemolysis (<1%) was confirmed for all the carbon materials. Protein adsorption experiments with bovine serum albumin (BSA) and fibrinogen revealed a lower protein binding capacity of 0.2–0.6 mg/m 2 and 2–4 mg/m 2 for BSA and fibrinogen, respectively, with lower binding associated with an increase in surface area. The results of this study confirm the biocompatibility of soft-templated mesoporous carbons.« less
Ortiz de Orué Lucana, Darío; Fedosov, Sergey N.; Wedderhoff, Ina; Che, Edith N.; Torda, Andrew E.
2014-01-01
The extracellular protein HbpS from Streptomyces reticuli interacts with iron ions and heme. It also acts in concert with the two-component sensing system SenS-SenR in response to oxidative stress. Sequence comparisons suggested that the protein may bind a cobalamin. UV-visible spectroscopy confirmed binding (Kd = 34 μm) to aquo-cobalamin (H2OCbl+) but not to other cobalamins. Competition experiments with the H2OCbl+-coordinating ligand CN− and comparison of mutants identified a histidine residue (His-156) that coordinates the cobalt ion of H2OCbl+ and substitutes for water. HbpS·Cobalamin lacks the Asp-X-His-X-X-Gly motif seen in some cobalamin binding enzymes. Preliminary tests showed that a related HbpS protein from a different species also binds H2OCbl+. Furthermore, analyses of HbpS-heme binding kinetics are consistent with the role of HbpS as a heme-sensor and suggested a role in heme transport. Given the high occurrence of HbpS-like sequences among Gram-positive and Gram-negative bacteria, our findings suggest a great functional versatility among these proteins. PMID:25342754
Mariller, C; Haendler, B; Allain, F; Denys, A; Spik, G
1996-07-15
Cyclophilin B (CyPB) is secreted in biological fluids such as blood or milk and binds to a specific receptor present on the human lymphoblastic cell line Jurkat and on human peripheral blood lymphocytes. This study was intended to specify the areas of CyPB that are involved in the interaction with the receptor. A synthetic peptide corresponding to the first 24 N-terminal amino acid residues of CyPB was shown to specifically recognize the receptor. Moreover, modification of Arg18 of CyPB by p-hydroxyphenlglyoxal led to a dramatic loss of affinity for the receptor. However, when this residue was replaced by an alanine residue using site-directed mutagenesis, no modification of the binding properties was found, suggesting that Arg18 is not directly involved but is sufficiently close to the interaction site to interfere with the binding when modified. Competitive binding experiments using a chimaeric protein made up of the 24 N-terminal amino acid residues of CyPB fused to the cyclophilin A core sequence confirmed the involvement of this region of CyPB in receptor binding.
Deterrent activity of plant lectins on cowpea weevil Callosobruchus maculatus (F.) oviposition.
Sadeghi, Amin; Van Damme, Els J M; Peumans, Willy J; Smagghe, Guy
2006-09-01
A set of 14 plant lectins was screened in a binary choice bioassay for inhibitory activity on cowpea weevil Callosobruchus maculatus (F.) oviposition. Coating of chickpea seeds (Cicer arietinum L.) with a 0.05% (w/v) solution of plant lectins caused a significant reduction in egg laying. Control experiments with heat inactivated lectin and BSA indicated that the observed deterrent effects are specific and require carbohydrate-binding activity. However, no clear correlation could be established between deterrent activity and sugar-binding specificity/molecular structure of the lectins. Increasing the insect density reduced the inhibitory effect of the lectins confirming that female insects are capable of adjusting their oviposition rates as a function of host availability.
Different effects of color-based and location-based selection on visual working memory.
Li, Qi; Saiki, Jun
2015-02-01
In the present study, we investigated how feature- and location-based selection influences visual working memory (VWM) encoding and maintenance. In Experiment 1, cue type (color, location) and cue timing (precue, retro-cue) were manipulated in a change detection task. The stimuli were color-location conjunction objects, and binding memory was tested. We found a significantly greater effect for color precues than for either color retro-cues or location precues, but no difference between location pre- and retro-cues, consistent with previous studies (e.g., Griffin & Nobre in Journal of Cognitive Neuroscience, 15, 1176-1194, 2003). We also found no difference between location and color retro-cues. Experiment 2 replicated the color precue advantage with more complex color-shape-location conjunction objects. Only one retro-cue effect was different from that in Experiment 1: Color retro-cues were significantly less effective than location retro-cues in Experiment 2, which may relate to a structural property of multidimensional VWM representations. In Experiment 3, a visual search task was used, and the result of a greater location than color precue effect suggests that the color precue advantage in a memory task is related to the modulation of VWM encoding rather than of sensation and perception. Experiment 4, using a task that required only memory for individual features but not for feature bindings, further confirmed that the color precue advantage is specific to binding memory. Together, these findings reveal new aspects of the interaction between attention and VWM and provide potentially important implications for the structural properties of VWM representations.
Nucleotide binding properties of bovine brain uncoating ATPase.
Gao, B; Emoto, Y; Greene, L; Eisenberg, E
1993-04-25
Many functions of the 70-kDa heat-shock proteins (hsp70s) appear to be regulated by bound nucleotide. In this study we examined the nucleotide binding properties of purified bovine brain uncoating ATPase, one of the constitutively expressed members of the hsp70 family. We found that uncoating ATPase purified by ATP-agarose column chromatography retained one ADP molecule bound per enzyme molecule which could not be removed by extensive dialysis. Since this bound ADP exchanged rapidly with free ADP or ATP, the inability to remove the bound nucleotide was not due to slow dissociation but rather to strong binding of the nucleotide to the uncoating ATPase. In confirmation of this view, equilibrium dialysis experiments suggested that the dissociation constants for both ADP and ATP were less than 0.1 microM. Schmid et al. (Schmid, S. L., Braell, W. A., and Rothman, J. E. (1985) J. Biol. Chem 260, 10057-10062) suggested that the uncoating ATPase had two sites for bound nucleotide, one specific for ATP and one binding both ATP and ATP analogues but not ADP. In contrast, we found that enzyme with bound ADP did not bind further adenosine 5'-(beta,gamma-imino)triphosphate or dATP, nor did more than one ATP molecule bind per enzyme even in 200 microM free ATP. These results strongly suggest that the enzyme has only one binding site for nucleotide. During steady-state ATP hydrolysis, 85% of the bound nucleotide at this site was determined to be ATP and 15% ADP; this is consistent with the rate of ADP release determined in the exchange experiments noted above, where ADP release was found to be six times faster than the overall rate of ATP hydrolysis.
Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing.
Morozov, Giora I; Zhao, Huaying; Mage, Michael G; Boyd, Lisa F; Jiang, Jiansheng; Dolan, Michael A; Venna, Ramesh; Norcross, Michael A; McMurtrey, Curtis P; Hildebrand, William; Schuck, Peter; Natarajan, Kannan; Margulies, David H
2016-02-23
Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8(+) T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities of TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.
Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morozov, Giora I.; Zhao, Huaying; Mage, Michael G.
Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8 + T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities ofmore » TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.« less
Synthesis of native-like crosslinked duplex RNA and study of its properties.
Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi
2017-04-01
A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.
Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing
Morozov, Giora I.; Zhao, Huaying; Mage, Michael G.; ...
2016-02-11
Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8 + T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities ofmore » TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.« less
Wani, Tanveer A; Bakheit, Ahmed H; Zargar, Seema; Hamidaddin, Mohammed A; Darwish, Ibrahim A
2017-01-01
Linifanib (LNF) possess antitumor activity and acts by inhibiting receptor tyrosine kinase VEGF and PDGF. The interaction of BSA with the drug can provide valuable information regarding the pharmacokinetic and pharmacodynamics behavior of drug. In our study the spectrophotometric methods and molecular docking studies were executed to understand the interaction behavior of BSA and LNF. BSA has an intrinsic fluorescence and that fluorescence was quenched by LNF. This quenching process was studied at three different temperatures of 288, 300and 308 K. The interaction between LNF and BSA was due to static quenching because the Ksv (Stern-Volmer constant) at 288 K was higher than at 300 and 308 K. Kq (quenching rate constant) behaved in a similar fashion as the Ksv. Several other parameters like binding constants, number of binding sites and binding energy in addition to molecular docking studies were also used to evaluate the interaction process. A decrease in the binding constants was observed with increasing temperatures and the binding site number approximated unity. The decreasing binding constant indicates LNF-BSA complex stability. The site mark competition experiment confirmed the binding site for LNF was located on site II of BSA. UV-visible studies along with synchronous fluorescence confirm a small change in the conformation of BSA upon interaction with LNF. The thermodynamic analysis provided the values for free energy ΔG0, ΔH0 and ΔS0. The ΔG0 at the 288, 300 and 308 K ranged in between -21.5 to -23.3 kJ mol-1, whereas the calculated values of ΔH (-55.91 kJ mol-1) and ΔS0 (-111.74 J mol-1·K-1). The experimental and molecular docking results suggest that the interaction between LNF and BSA was spontaneous and they exhibited hydrogen bonding and van der Waals force between them.
Maurya, Neha; Maurya, Jitendra Kumar; Kumari, Meena; Khan, Abbul Bashar; Dohare, Ravins; Patel, Rajan
2017-05-01
Herein, we have explored the interaction between amitriptyline hydrochloride (AMT) and hemoglobin (Hb), using steady-state and time-resolved fluorescence spectroscopy, UV-visible spectroscopy, and circular dichroism spectroscopy, in combination with molecular docking and molecular dynamic (MD) simulation methods. The steady-state fluorescence reveals the static quenching mechanism in the interaction system, which was further confirmed by UV-visible and time-resolved fluorescence spectroscopy. The binding constant, number of binding sites, and thermodynamic parameters viz. ΔG, ΔH, ΔS are also considered; result confirms that the binding of the AMT with Hb is a spontaneous process, involving hydrogen bonding and van der Waals interactions with a single binding site, as also confirmed by molecular docking study. Synchronous fluorescence, CD data, and MD simulation results contribute toward understanding the effect of AMT on Hb to interpret the conformational change in Hb upon binding in aqueous solution.
Taban, Ismail M; Zhu, Jinge; DeLuca, Hector F; Simons, Claire
2017-10-15
A homology model of human CYP27B1 was built using MOE and was further optimised by molecular dynamics simulations of the hCYP27B1 homology model and a hCYP27B1-SDZ-88357 complex. Docking results from the hCYP27B1-SDZ-88357 complex showed amino acids Arg107, Asn387 and Asp320 have an important role in binding interaction, with Asp320 part of the important acid-alcohol pair situated in the I-helix with the conserved sequence (A/G) GX (E/D) (T/S), which assumes an essential role in the binding of an oxygen molecule for catalysis. Additional docking experiments with selective hCYP27B1 or hCYP24A1 inhibitors using both the hCYP27B1 model and a triple mutant hCYP24A1 model provided further support for the importance of H-bonding interactions with the three identified active site amino acids. To confirm the role of Arg107, Asn387 and Asp320 in the active site of hCYP27B1 compounds were designed that would form H-bonding interactions, as determined from docking experiments with the hCYP27B1 model. Subsequent synthesis and CYP24A1 and CYP27B1 enzyme assays of the designed compounds 1a and 1b showed a∼5-fold selectivity for CYP27B1 confirming the importance of Asp320 in particular and also Asn387 and Arg107 as important amino acids for CYP27B1 inhibitory activity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vida, András; Bardoel, Bart; Milder, Fin; Majoros, László; Sümegi, Andrea; Bácsi, Attila; Vereb, György; van Kessel, Kok P M; van Strijp, Jos A G; Antal-Szalmás, Péter
2012-08-30
Microbial resistance to antimicrobial drugs is promoting a search for new antimicrobial agents that target highly conservative structures of pathogens. Human CD14 - a known pattern recognition receptor (PRR) which recognizes multiple ligands from different microbes might be a worthy candidate. The aim of our work was to create a CD14/Fc dimer protein and evaluate its whole bacteria binding and opsonizing capabilities. Fusion of CD14 with the fragment crystallisable (Fc) part of human IgG1 could not only lead to an artificial opsonin but the dimerization through the Fc part might also increase its affinity to different ligands. Human CD14 and the Fc part of human IgG1 was fused and expressed in HEK293 cells. A histidine tagged CD14 (CD14/His) was also expressed as control. Using flow cytometry we could prove that CD14/Fc bound to whole Gram-negative bacteria, especially to short lipopolysaccharide (Ra and Re) mutants, and weak interaction was observed between the fusion protein and Listeria monocytogenes. Other Gram-positive bacteria and fungi did not show any association with CD14/Fc. CD14/His showed about 50-times less potent binding to Gram-negative bacteria. CD14/Fc acted as an opsonin and enhanced phagocytosis of these bacteria by neutrophil granulocytes, monocyte-derived macrophages and dendritic cells. Internalization of bacteria was confirmed by trypan blue quenching and confocal microscopy. On neutrophils the Fc part of the fusion protein was recognized by Fc receptors (CD16, CD32), as determined by blocking experiments. CD14/Fc enhanced the killing of bacteria in an ex vivo whole blood assay. Our experiments confirm that PRR/Fc fusion proteins can give a boost to FcR dependent phagocytosis and killing provided the antimicrobial part binds efficiently to microbes. Copyright © 2012 Elsevier B.V. All rights reserved.
Trusch, Franziska; Matena, Anja; Vuk, Maja; Koerver, Lisa; Knævelsrud, Helene; Freemont, Paul S.; Meyer, Hemmo; Bayer, Peter
2015-01-01
Valosin-containing protein/p97 is an ATP-driven protein segregase that cooperates with distinct protein cofactors to control various aspects of cellular homeostasis. Mutations at the interface between the regulatory N-domain and the first of two ATPase domains (D1 and D2) deregulate the ATPase activity and cause a multisystem degenerative disorder, inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia/amyotrophic lateral sclerosis. Intriguingly, the mutations affect only a subset of p97-mediated pathways correlating with unbalanced cofactor interactions and most prominently compromised binding of the ubiquitin regulatory X domain-containing protein 1 (UBXD1) cofactor during endolysosomal sorting of caveolin-1. However, how the mutations impinge on the p97-cofactor interplay is unclear so far. In cell-based endosomal localization studies, we identified a critical role of the N-terminal region of UBXD1 (UBXD1-N). Biophysical studies using NMR and CD spectroscopy revealed that UBXD1-N can be classified as intrinsically disordered. NMR titration experiments confirmed a valosin-containing protein/p97 interaction motif and identified a second binding site at helices 1 and 2 of UBXD1-N as binding interfaces for p97. In reverse titration experiments, we identified two distant epitopes on the p97 N-domain that include disease-associated residues and an additional interaction between UBXD1-N and the D1D2 barrel of p97 that was confirmed by fluorescence anisotropy. Functionally, binding of UBXD1-N to p97 led to a reduction of ATPase activity and partial protection from proteolysis. These findings indicate that UBXD1-N intercalates into the p97-ND1 interface, thereby modulating interdomain communication of p97 domains and its activity with relevance for disease pathogenesis. We propose that the polyvalent binding mode characterized for UBXD1-N is a more general principle that defines a subset of p97 cofactors. PMID:26475856
Lessons learned about [F-18]-AV-1451 off-target binding from an autopsy-confirmed Parkinson's case.
Marquié, Marta; Verwer, Eline E; Meltzer, Avery C; Kim, Sally Ji Who; Agüero, Cinthya; Gonzalez, Jose; Makaretz, Sara J; Siao Tick Chong, Michael; Ramanan, Prianca; Amaral, Ana C; Normandin, Marc D; Vanderburg, Charles R; Gomperts, Stephen N; Johnson, Keith A; Frosch, Matthew P; Gómez-Isla, Teresa
2017-10-19
[F-18]-AV-1451 is a novel positron emission tomography (PET) tracer with high affinity to neurofibrillary tau pathology in Alzheimer's disease (AD). PET studies have shown increased tracer retention in patients clinically diagnosed with dementia of AD type and mild cognitive impairment in regions that are known to contain tau lesions. In vivo uptake has also consistently been observed in midbrain, basal ganglia and choroid plexus in elderly individuals regardless of their clinical diagnosis, including clinically normal whose brains are not expected to harbor tau pathology in those areas. We and others have shown that [F-18]-AV-1451 exhibits off-target binding to neuromelanin, melanin and blood products on postmortem material; and this is important for the correct interpretation of PET images. In the present study, we further investigated [F-18]-AV-1451 off-target binding in the first autopsy-confirmed Parkinson's disease (PD) subject who underwent antemortem PET imaging. The PET scan showed elevated [F-18]-AV-1451 retention predominantly in inferior temporal cortex, basal ganglia, midbrain and choroid plexus. Neuropathologic examination confirmed the PD diagnosis. Phosphor screen and high resolution autoradiography failed to show detectable [F-18]-AV-1451 binding in multiple brain regions examined with the exception of neuromelanin-containing neurons in the substantia nigra, leptomeningeal melanocytes adjacent to ventricles and midbrain, and microhemorrhages in the occipital cortex (all reflecting off-target binding), in addition to incidental age-related neurofibrillary tangles in the entorhinal cortex. Additional legacy postmortem brain samples containing basal ganglia, choroid plexus, and parenchymal hemorrhages from 20 subjects with various neuropathologic diagnoses were also included in the autoradiography experiments to better understand what [F-18]-AV-1451 in vivo positivity in those regions means. No detectable [F-18]-AV-1451 autoradiographic binding was present in the basal ganglia of the PD case or any of the other subjects. Off-target binding in postmortem choroid plexus samples was only observed in subjects harboring leptomeningeal melanocytes within the choroidal stroma. Off-target binding to parenchymal hemorrhages was noticed in postmortem material from subjects with cerebral amyloid angiopathy. The imaging-postmortem correlation analysis in this PD case reinforces the notion that [F-18]-AV-1451 has strong affinity for neurofibrillary tau pathology but also exhibits off-target binding to neuromelanin, melanin and blood components. The robust off-target in vivo retention in basal ganglia and choroid plexus, in the absence of tau deposits, meningeal melanocytes or any other identifiable binding substrate by autoradiography in the PD case reported here, also suggests that the PET signal in those regions may be influenced, at least in part, by biological or technical factors that occur in vivo and are not captured by autoradiography.
Computer-aided design of peptide near infrared fluorescent probe for tumor diagnosis
NASA Astrophysics Data System (ADS)
Zhang, Congying; Gu, Yueqing
2014-09-01
Integrin αvβ3 receptors are expressed on activated endothelial cells during neovascularization to maintain tumor growth, so they become hot research tagets in cancer diagnosis. Peptides possess several attractive features when compared to protein and small molecule, such as small size and high structural compatibility with target proteins. Efficient design of high-affinity peptide ligands to Integrin αvβ3 receptors has been an important problem. Designed peptides in silico provide a valuable and high-selectivity peptide, meanwhile decrease the time of drug screening. In this study, we design peptide which can bind with integrin αvβ3 via computer, and then synthesis near infrared fluorescent probe. The characterization of this near infrared fluorescent probe was detected by UV. To investigate the tumor cell targeting of this probe, it was labeled with visible fluorescent dye Rhodamine B (RhB) for microscopy. To evaluate the targeting capability of this near infrared fluorescent probe, mice bearing integrin αvβ3 positive tumor xenografts were used. In vitro cellular experiments indicated that this probe have a clear binding affinity to αvβ3-positive tumor cells. In vivo experiments confirmed the receptor binding specificity of this probe. The peptide of computational design can bind with integrin αvβ3. Combined peptide near-infrared fluorescent probe with imaging technology use for clinical and tumor diagnosis have a greater development in future.
Identification of protein–protein interfaces by decreased amide proton solvent accessibility
Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.
1998-01-01
Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953
Bagheri, Salman; Yousefi, Mehdi; Safaie Qamsari, Elmira; Riazi-Rad, Farhad; Abolhassani, Mohsen; Younesi, Vahid; Dorostkar, Ruhollah; Movassaghpour, Ali Akbar; Sharifzadeh, Zahra
2017-03-01
The 4-1BB is a surface glycoprotein that pertains to the tumor necrosis factor-receptor family. There is compelling evidence suggesting important roles for 4-1BB in the immune response, including cell activation and proliferation and also cytokine induction. Because of encouraging results of different agonistic monoclonal antibodies against 4-1BB in the treatment of cancer, infectious, and autoimmune diseases, 4-1BB has been suggested as an attractive target for immunotherapy. In this study, single chain variable fragment phage display libraries, Tomlinson I+J, were screened against specific synthetic oligopeptides (peptides I and II) designed from 4-1BB extracellular domain. Five rounds of panning led to selection of four 4-1BB specific single chain variable fragments (PI.12, PI.42, PII.16, and PII.29) which showed specific reaction to relevant peptides in phage enzyme-linked immunosorbent assay. The selected clones were successfully expressed in Escherichia coli Rosetta-gami 2, and their expression was confirmed by western blot analysis. Enzyme-linked immunosorbent assay experiments indicated that these antibodies were able to specifically recognize 4-1BB without any cross-reactivity with other antigens. Flow cytometry analysis demonstrated an acceptable specific binding of the single chain variable fragments to 4-1BB expressed on CCRF-CEM cells, while no binding was observed with an irrelevant antibody. Anti-4-1BB single chain variable fragments enhanced surface CD69 expression and interleukin-2 production in stimulated CCRF-CEM cells which confirmed the agonistic effect of the selected single chain variable fragments. The data from this study have provided a rationale for further experiments involving the biological functions of anti-4-1BB single chain variable fragments in future studies.
Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge
2009-01-01
OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435
Both endothelin-A and endothelin-B receptors are present on adult rat cardiac ventricular myocytes.
Allen, Bruce G; Phuong, Luu Lien; Farhat, Hala; Chevalier, Dominique
2003-02-01
Endothelin-A (ET(A)) and endothelin-B (ET(B)) receptors have been demonstrated in intact heart and cardiac membranes. ET(A) receptors have been demonstrated on adult ventricular myocytes. The aim of the present study was to determine the presence of ET(B) and the relative contribution of this receptor subtype to total endothelin-1 (ET-1) binding on adult ventricular myocytes. Saturation binding experiments indicated that ET-1 bound to a single population of receptors (Kd = 0.52 +/- 0.13 nM, n = 4) with an apparent maximum binding (Bmax) of 2.10 +/- 0.25 sites (x 10(5))/cell (n = 4). Competition experiments using 40 pM [125I]ET-1 and nonradioactive ET-1 revealed a Ki of 660 +/- 71 pM (n = 10) and a Hill coefficient (nH) of 0.99 +/- 0.10 (n = 10). A selective ET(A) antagonist, BQ610, displaced 80% of the bound [125I]ET-1. No displacement was observed by concentrations of an ET(B)-selective antagonist, BQ788, up to 1.0 microM. However, in the presence of 1.0 microM BQ610, BQ788 inhibited the remaining [125I]ET-1 binding. Similarly, in the presence of 1.0 microM BQ788, BQ610 inhibited the remaining specific [125I]ET-1 binding. Binding of an ET(B1)-selective agonist, [125I]IRL-1620, confirmed the presence of ET(B). ET(B) bound to ET-1 irreversibly, whereas binding to ET(A) demonstrated both reversible and irreversible components, and BQ610 and BQ788 bound reversibly. Reducing the incubation temperature to 0 degrees C did not alter the irreversible component of ET-1 binding. Hence, both ET(A) and ET(B) receptors are present on intact adult rat ventricular myocytes, and the ratio of ET(A):ET(B) binding sites is 4:1. Both receptor subtypes bind to ET-1 by a two-step association involving the formation of a tight receptor-ligand complex; however, the kinetics of ET-1 binding to ET(A) versus ET(B) differ.
Miyata, Yoshihiko; Shibata, Takeshi; Aoshima, Masato; Tsubata, Takuichi; Nishida, Eisuke
2014-01-01
Trp-Asp (WD) repeat protein 68 (WDR68) is an evolutionarily conserved WD40 repeat protein that binds to several proteins, including dual specificity tyrosine phosphorylation-regulated protein kinase (DYRK1A), MAPK/ERK kinase kinase 1 (MEKK1), and Cullin4-damage-specific DNA-binding protein 1 (CUL4-DDB1). WDR68 affects multiple and diverse physiological functions, such as controlling anthocyanin synthesis in plants, tissue growth in insects, and craniofacial development in vertebrates. However, the biochemical basis and the regulatory mechanism of WDR68 activity remain largely unknown. To better understand the cellular function of WDR68, here we have isolated and identified cellular WDR68 binding partners using a phosphoproteomic approach. More than 200 cellular proteins with wide varieties of biochemical functions were identified as WDR68-binding protein candidates. Eight T-complex protein 1 (TCP1) subunits comprising the molecular chaperone TCP1 ring complex/chaperonin-containing TCP1 (TRiC/CCT) were identified as major WDR68-binding proteins, and phosphorylation sites in both WDR68 and TRiC/CCT were identified. Co-immunoprecipitation experiments confirmed the binding between TRiC/CCT and WDR68. Computer-aided structural analysis suggested that WDR68 forms a seven-bladed β-propeller ring. Experiments with a series of deletion mutants in combination with the structural modeling showed that three of the seven β-propeller blades of WDR68 are essential and sufficient for TRiC/CCT binding. Knockdown of cellular TRiC/CCT by siRNA caused an abnormal WDR68 structure and led to reduction of its DYRK1A-binding activity. Concomitantly, nuclear accumulation of WDR68 was suppressed by the knockdown of TRiC/CCT, and WDR68 formed cellular aggregates when overexpressed in the TRiC/CCT-deficient cells. Altogether, our results demonstrate that the molecular chaperone TRiC/CCT is essential for correct protein folding, DYRK1A binding, and nuclear accumulation of WDR68. PMID:25342745
Galectins are human milk glycan receptors
Noll, Alexander J; Gourdine, Jean-Philippe; Yu, Ying; Lasanajak, Yi; Smith, David F; Cummings, Richard D
2016-01-01
The biological recognition of human milk glycans (HMGs) is poorly understood. Because HMGs are rich in galactose we explored whether they might interact with human galectins, which bind galactose-containing glycans and are highly expressed in epithelial cells and other cell types. We screened a number of human galectins for their binding to HMGs on a shotgun glycan microarray consisting of 247 HMGs derived from human milk, as well as to a defined HMG microarray. Recombinant human galectins (hGal)-1, -3, -4, -7, -8 and -9 bound selectively to glycans, with each galectin recognizing a relatively unique binding motif; by contrast hGal-2 did not recognize HMGs, but did bind to the human blood group A Type 2 determinants on other microarrays. Unlike other galectins, hGal-7 preferentially bound to glycans expressing a terminal Type 1 (Galβ1-3GlcNAc) sequence, a motif that had eluded detection on non-HMG glycan microarrays. Interactions with HMGs were confirmed in a solution setting by isothermal titration microcalorimetry and hapten inhibition experiments. These results demonstrate that galectins selectively bind to HMGs and suggest the possibility that galectin–HMG interactions may play a role in infant immunity. PMID:26747425
Tanwar, Neetu; Munde, Manoj
2018-06-01
Studying interaction of IgG with bacterial proteins such as proA (Protein A) and proG is essential for development in the areas of drug discovery and biotechnology. Some solution studies in the past have hinted at the possibility of variable binding ratios for IgG with proA and proG. Since earlier crystallographic studies focussed mostly on monomeric complexes, the knowledge about the binding interfaces and protein conformational changes involved in multimeric complexes is scarce. In this paper, we observed that single proA molecule was able to bind to three IgG molecules (1:3, proA:IgG) in ITC accentuating the presence of conformational flexibility in proA, corroborated also by CD results. By contrast, proG binds with 1:1 stoichiometry to IgG, which also involves key structural rearrangement within the binding interface of IgG-proG complex, confirmed by fluorescence KI quenching study. It is implicit from CD and fluorescence results that IgG does not undergo any significant conformational changes, which further suggests that proA and proG dictate the phenomenon of recognition in antibody complexes. ANS as a hydrophobic probe helped in revealing the distinctive antibody binding mechanism of proA and proG. Additionally, the binding competition experiments using ITC established that proA and proG cannot bind IgG concurrently. Copyright © 2018. Published by Elsevier B.V.
The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.
Wang, Jinling; de Montellano, Paul R Ortiz
2003-05-30
Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Contacts between the factor TUF and RPG sequences.
Vignais, M L; Huet, J; Buhler, J M; Sentenac, A
1990-08-25
The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.
Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua
Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less
Functional and Selective Bacterial Interfaces Using Cross-Scaffold Gold Binding Peptides
NASA Astrophysics Data System (ADS)
Adams, Bryn L.; Hurley, Margaret M.; Jahnke, Justin P.; Stratis-Cullum, Dimitra N.
2015-11-01
We investigated the functional and selective activity of three phage-derived gold-binding peptides on the Escherichia coli ( E. coli) bacterial cell surface display scaffold (eCPX) for the first time. Gold-binding peptides, p3-Au12 (LKAHLPPSRLPS), p8#9 (VSGSSPDS), and Midas-2 (TGTSVLIATPYV), were compared side-by-side through experiment and simulation. All exhibited strong binding to an evaporated gold film, with approximately a 4-log difference in binding between each peptide and the control sample. The increased affinity for gold was also confirmed by direct visualization of samples using Scanning Electron Microscopy (SEM). Peptide dynamics in solution were performed to analyze innate structure, and all three were found to have a high degree of flexibility. Preferential binding to gold over silicon for all three peptides was demonstrated, with up to four orders of magnitude selectivity exhibited by p3-Au12. The selectivity was also clearly evident through SEM analysis of the boundary between the gold film and silicon substrate. Functional activity of bound E. coli cells was further demonstrated by stimulating filamentation and all three peptides were characterized as prolific relative to control samples. This work shows great promise towards functional and active bacterial-hybrid gold surfaces and the potential to enable the next generation living material interfaces.
Role of Crk Adaptor Proteins in Cellular Migration and Invasion in Human Breast Cancer
2007-03-01
nucleus. To confirm the staining is indeed specific, another antibody specific for CrkII is being tested. Furthermore, cytoplasmic and nuclear...the endogenous CrkL binding partner, Gab1 , which is enhanced upon HGF stimulation (Appendix 16). One final experiment, showing that the CrkLV5 tag...receptor tyrosine kinases, and a docking protein Gab1 , involved in epithelial dispersal and morphogenesis (5, 11, 12). The NH2-terminal SH3 domain of
NASA Astrophysics Data System (ADS)
Movahedi, Elaheh; Rezvani, Ali Reza
2018-05-01
A novel mixed-ligand Ag(I) complex, , has been synthesized and characterized by the elemental analysis, IR spectroscopy and 1HNMR. In the formula, dian and phen are N-(4,5-diazafluoren-9-ylidene)aniline and 1,10-phenanthroline, respectively. This complex also has been prepared at nano size by sonochemical technique and characterized by the FTIR and scanning electron microscopy (SEM). To evaluate the biological preferences of the Ag(I) complex and nanocomplex and verify the relationships between the structure and biological function, in vitro DNA binding and antibacterial experiments have been carried out. DNA-complex interaction has been pursued by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation and circular dichroism spectroscopy in the physiological pH. Each compound displays significant binding trend to the CT-DNA. The mode of binding to the CT-DNA probably is a moderate intercalation mode with the partial insertion of the planar ligands between the base stacks of double-stranded DNA. The relative viscosities and circular dichroism spectra of the CT-DNA with the complex solutions, confirm the intense interactions of the Ag(I) complex and nanocomplex with DNA. An in vitro antibacterial test of the complex and nanocomplex on a series of the Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and the Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) shows a remarkable antibacterial feature of the Ag(I) complex. The MIC values (minimum inhibitory concentration) of the compounds compare with silver nitrate and silver sulfadiazine. The bacterial inhibitions of the Ag(I) complex and nanocomplex are agreed to their DNA binding affinities.
Corcóstegui, Reyes; Labeaga, Luis; Innerárity, Ana; Berisa, Agustin; Orjales, Aurelio
2005-01-01
This study aimed to establish the receptor selectivity and antihistaminic activity of bilastine, a new selective antihistamine receptor antagonist. In vitro experiments were conducted using a receptor binding screening panel and guinea-pig and rat tissues. Antihistaminic activity was determined using H1 receptor binding studies and in vitro H1 antagonism studies conducted in guinea-pig tissues and human cell lines. Receptor selectivity was established using a receptor binding screening panel and a receptor antagonism screening conducted in guinea-pig, rat and rabbit tissues. Inhibition of inflammatory mediators was determined through the Schultz-Dale reaction in sensitised guinea-pig ileum. Bilastine binds to histamine H1-receptors as indicated by its displacement of [3H]-pyrilamine from H1-receptors expressed in guinea-pig cerebellum and human embryonic kidney (HEK) cell lines. The studies conducted on guinea-pig smooth muscle demonstrated the capability of bilastine to antagonise H1-receptors. Bilastine is selective for histamine H1-receptors as shown in receptor-binding screening conducted to determine the binding capacity of bilastine to 30 different receptors. The specificity of its H1-receptor antagonistic activity was also demonstrated in a series of in vitro experiments conducted on guinea-pig and rat tissues. The results of these studies confirmed the lack of significant antagonism against serotonin, bradykinin, leukotriene D4, calcium, muscarinic M3-receptors, alpha1-adrenoceptors, beta2-adrenoceptors, and H2- and H3-receptors. The results of the in vitro Schultz-Dale reaction demonstrated that bilastine also has anti-inflammatory activity. These preclinical studies provide evidence that bilastine has H1- antihistamine activity, with high specificity for H1-receptors, and poor or no affinity for other receptors. Bilastine has also been shown to have anti-inflammatory properties.
Investigation on potential enzyme toxicity of clenbuterol to trypsin
NASA Astrophysics Data System (ADS)
Chai, Jun; Xu, Qifei; Dai, Jinping; Liu, Rutao
2013-03-01
Clenbuterol (CLB) is a kind of β2-adrenergic agonists which was illegally used as feed additives nowadays. The toxic interaction of CLB with trypsin, an important digestive enzyme, was studied in vitro using multi-spectroscopic methods and molecular modeling methods. CLB was proved to bind with trypsin in S1 pocket, forming a complex driven by the dominant force of H-bond. The binding constant was calculated to be 1.79887 × 105 L mol-1 at 289 K and 0.32584 × 105 L mol-1 at 310 K, respectively. The skeleton of trypsin became loosened and unfolded with the amino residues microenvironment changed. The secondary and tertiary structure of trypsin also varied. Molecular modeling studies illustrated specific display of the binding information and explained most of the experiment phenomena. The binding site of CLB induced the fluorescence quenching as well as inhibition of enzyme activity of trypsin. The study confirmed that CLB had potential toxicity on both the structure and function of trypsin and the effects enhanced with the increasing concentration of CLB.
Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D
2014-04-18
We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.
2015-01-01
We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pioszak, Augen A.; Harikumar, Kaleeckal G.; Parker, Naomi R.
2010-06-25
The parathyroid hormone receptor (PTH1R) is a class B G protein-coupled receptor that is activated by parathyroid hormone (PTH) and PTH-related protein (PTHrP). Little is known about the oligomeric state of the receptor and its regulation by hormone. The crystal structure of the ligand-free PTH1R extracellular domain (ECD) reveals an unexpected dimer in which the C-terminal segment of both ECD protomers forms an {alpha}-helix that mimics PTH/PTHrP by occupying the peptide binding groove of the opposing protomer. ECD-mediated oligomerization of intact PTH1R was confirmed in living cells by bioluminescence and fluorescence resonance energy transfer experiments. As predicted by the structure,more » PTH binding disrupted receptor oligomerization. A receptor rendered monomeric by mutations in the ECD retained wild-type PTH binding and cAMP signaling ability. Our results are consistent with the hypothesis that PTH1R forms constitutive dimers that are dissociated by ligand binding and that monomeric PTH1R is capable of activating G protein.« less
Structure and DNA-binding of meiosis-specific protein Hop2
NASA Astrophysics Data System (ADS)
Zhou, Donghua; Moktan, Hem; Pezza, Roberto
2014-03-01
Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.
NASA Astrophysics Data System (ADS)
Shahabadi, Nahid; Hadidi, Saba
2014-03-01
This study was designed to examine the interaction of racemic antidepressant drug "S,R-venlafaxine hydrochloride (VEN)" with bovine serum albumin (BSA) under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques combination with molecular modeling. Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The thermodynamic parameters indicated that the hydrogen bonding and weak van der Waals interactions are the predominant intermolecular forces stabilizing the complex. The number of binding sites (n) was calculated. Through the site marker competitive experiment, VEN was confirmed to be located in subdomain IIIA of BSA. The binding distance (r = 4.93 nm) between the donor BSA and acceptor VEN was obtained according to Förster's non-radiative energy transfer theory. According to UV-vis spectra and CD data binding of VEN leaded to conformational changes of BSA. Molecular docking simulations of S and R-VEN revealed that both isomers have similar interaction and the same binding sites, from this point of view S and R isomers are equal.
Huang, Po-Kai; Chan, Po-Ting; Chen, Lih-Jen
2016-01-01
Three stromal chaperone ATPases, cpHsc70, Hsp90C, and Hsp93, are present in the chloroplast translocon, but none has been shown to directly bind preproteins in vivo during import, so it remains unclear whether any function as a preprotein-translocating motor and whether they have different functions during the import process. Here, using protein crosslinking followed by ionic detergent solubilization, we show that Hsp93 directly binds to the transit peptides of various preproteins undergoing active import into chloroplasts. Hsp93 also binds to the mature region of a preprotein. A time course study of import, followed by coimmunoprecipitation experiments, confirmed that Hsp93 is present in the same complexes as preproteins at an early stage when preproteins are being processed to the mature size. In contrast, cpHsc70 is present in the same complexes as preproteins at both the early stage and a later stage after the transit peptide has been removed, suggesting that cpHsc70, but not Hsp93, is important in translocating processed mature proteins across the envelope. PMID:26676256
Honegr, Jan; Dolezal, Rafael; Malinak, David; Benkova, Marketa; Soukup, Ondrej; Almeida, Joyce S F D de; Franca, Tanos C C; Kuca, Kamil; Prymula, Roman
2018-01-04
In order to identify novel lead structures for human toll-like receptor 4 ( h TLR4) modulation virtual high throughput screening by a peta-flops-scale supercomputer has been performed. Based on the in silico studies, a series of 12 compounds related to tryptamine was rationally designed to retain suitable molecular geometry for interaction with the h TLR4 binding site as well as to satisfy general principles of drug-likeness. The proposed compounds were synthesized, and tested by in vitro and ex vivo experiments, which revealed that several of them are capable to stimulate h TLR4 in vitro up to 25% activity of Monophosphoryl lipid A. The specific affinity of the in vitro most potent substance was confirmed by surface plasmon resonance direct-binding experiments. Moreover, two compounds from the series show also significant ability to elicit production of interleukin 6.
Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2
Vogel, Simon M.; Bauer, Matthias R.; Joerger, Andreas C.; Wilcken, Rainer; Brandt, Tobias; Veprintsev, Dmitry B.; Rutherford, Trevor J.; Fersht, Alan R.; Boeckler, Frank M.
2012-01-01
The proteins MDM2 and MDM4 are key negative regulators of the tumor suppressor protein p53, which are frequently upregulated in cancer cells. They inhibit the transactivation activity of p53 by binding separately or in concert to its transactivation domain. MDM2 is also a ubiquitin ligase that leads to the degradation of p53. Accordingly, MDM2 and MDM4 are important targets for drugs to inhibit their binding to p53. We found from in silico screening and confirmed by experiment that lithocholic acid (LCA) binds to the p53 binding sites of both MDM2 and MDM4 with a fivefold preference for MDM4. LCA is an endogenous steroidal bile acid, variously reported to have both carcinogenic and apoptotic activities. The comparison of LCA effects on apoptosis in HCT116 p53+/+ vs. p53-/- cells shows a predominantly p53-mediated induction of caspase-3/7. The dissociation constants are in the μM region, but only modest inhibition of binding of MDM2 and MDM4 is required to negate their upregulation because they have to compete with transcriptional coactivator p300 for binding to p53. Binding was weakened by structural changes in LCA, and so it may be a natural ligand of MDM2 and MDM4, raising the possibility that MDM proteins may be sensors for specific steroids. PMID:23035244
A kinetic and thermodynamic framework for the Azoarcus group I ribozyme reaction
Gleitsman, Kristin R.
2014-01-01
Determination of quantitative thermodynamic and kinetic frameworks for ribozymes derived from the Azoarcus group I intron and comparisons to their well-studied analogs from the Tetrahymena group I intron reveal similarities and differences between these RNAs. The guanosine (G) substrate binds to the Azoarcus and Tetrahymena ribozymes with similar equilibrium binding constants and similar very slow association rate constants. These and additional literature observations support a model in which the free ribozyme is not conformationally competent to bind G and in which the probability of assuming the binding-competent state is determined by tertiary interactions of peripheral elements. As proposed previously, the slow binding of guanosine may play a role in the specificity of group I intron self-splicing, and slow binding may be used analogously in other biological processes. The internal equilibrium between ribozyme-bound substrates and products is similar for these ribozymes, but the Azoarcus ribozyme does not display the coupling in the binding of substrates that is observed with the Tetrahymena ribozyme, suggesting that local preorganization of the active site and rearrangements within the active site upon substrate binding are different for these ribozymes. Our results also confirm the much greater tertiary binding energy of the 5′-splice site analog with the Azoarcus ribozyme, binding energy that presumably compensates for the fewer base-pairing interactions to allow the 5′-exon intermediate in self splicing to remain bound subsequent to 5′-exon cleavage and prior to exon ligation. Most generally, these frameworks provide a foundation for design and interpretation of experiments investigating fundamental properties of these and other structured RNAs. PMID:25246656
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Metal-binding proteins as metal pollution indicators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hennig, H.F.
1986-03-01
The fact that metal-binding proteins are a consequence of elevated metal concentration in organisms is well known. What has been overlooked is that the presence of these proteins provides a unique opportunity to reformulate the criteria of metal pollution. The detoxification effect of metal-binding proteins in animals from polluted areas has been cited, but there have been only very few studies relating metal-binding proteins to pollution. This lack is due partly to the design of most experiments, which were aimed at isolation of metal-binding proteins and hence were of too short duration to allow for correlation to adverse physiological effectsmore » on the organism. In this study metal-binding proteins were isolated and characterized from five different marine animals (rock lobster, Jasus lalandii; hermit crab, Diogenes brevirostris; sandshrimp, Palaemon pacificus; black mussel, Choromytilus meridionalis; and limpet, Patella granularis). These animals were kept under identical metal-enriched conditions, hence eliminating differences in method and seasons. The study animals belonged to different phyla; varied in size, mass, age, behavior, food requirements and life stages; and accumulated metals at different rates. It is possible to link unseasonal moulting in crustacea, a known physiological effect due to a metal-enriched environment, to the production of the metal-binding protein without evidence of obvious metal body burden. Thus a new concept of pollution is defined: the presence of metal-binding proteins confirms toxic metal pollution. This concept was then tested under field conditions in the whelk Bullia digitalis and in metal-enriched grass.« less
Capuani, Fabrizio; Conte, Alexia; Argenzio, Elisabetta; Marchetti, Luca; Priami, Corrado; Polo, Simona; Di Fiore, Pier Paolo; Sigismund, Sara; Ciliberto, Andrea
2015-01-01
Ubiquitination of the epidermal growth factor receptor (EGFR) that occurs when Cbl and Grb2 bind to three phosphotyrosine residues (pY1045, pY1068 and pY1086) on the receptor displays a sharp threshold effect as a function of EGF concentration. Here we use a simple modelling approach together with experiments to show that the establishment of the threshold requires both the multiplicity of binding sites and cooperative binding of Cbl and Grb2 to the EGFR. While the threshold is remarkably robust, a more sophisticated model predicted that it could be modulated as a function of EGFR levels on the cell surface. We confirmed experimentally that the system has evolved to perform optimally at physiological levels of EGFR. As a consequence, this system displays an intrinsic weakness that causes—at the supraphysiological levels of receptor and/or ligand associated with cancer—uncoupling of the mechanisms leading to signalling through phosphorylation and attenuation through ubiquitination. PMID:26264748
Snapshot of the equilibrium dynamics of a drug bound to HIV-1 reverse transcriptase
NASA Astrophysics Data System (ADS)
Kuroda, Daniel G.; Bauman, Joseph D.; Challa, J. Reddy; Patel, Disha; Troxler, Thomas; Das, Kalyan; Arnold, Eddy; Hochstrasser, Robin M.
2013-03-01
The anti-AIDS drug rilpivirine undergoes conformational changes to bind HIV-1 reverse transcriptase (RT), which is an essential enzyme for the replication of HIV. These changes allow it to retain potency against mutations that otherwise would render the enzyme resistant. Here we report that water molecules play an essential role in this binding process. Femtosecond experiments and theory expose the molecular level dynamics of rilpivirine bound to HIV-1 RT. Two nitrile substituents, one on each arm of the drug, are used as vibrational probes of the structural dynamics within the binding pocket. Two-dimensional vibrational echo spectroscopy reveals that one nitrile group is unexpectedly hydrogen-bonded to a mobile water molecule, not identified in previous X-ray structures. Ultrafast nitrile-water dynamics are confirmed by simulations. A higher (1.51 Å) resolution X-ray structure also reveals a water-drug interaction network. Maintenance of a crucial anchoring hydrogen bond may help retain the potency of rilpivirine against pocket mutations despite the structural variations they cause.
Wang, Y; Gupta, R; Huang, L; Lown, J W
1993-12-24
Antitumor agent CC-1065 functional analogues possessing different electron-withdrawing substituents and leaving groups have been synthesized. The extent and the relative rates of DNA cleavage following alkylation by these CPI structures and thermal treatment were determined independently by an ethidium binding assay and by agarose gel electrophoresis experiments. The anticipated preferential covalent binding to adenine sites within the minor groove was confirmed by sequencing determination of selected agents on high-resolution gels. Certain of the synthetic agents, unlike CC-1065, also bind covalently to G sites with weaker intensity. The cytotoxicities of these compounds were also determined against KB cells in vitro. Compounds bearing a bromo or nitro group in the benzene ring and a methylsulfonyl as a leaving group are 10 and 5 times more potent than their unsubstituted counterparts, respectively. Compounds bearing a methylsulfonyl as a leaving group are more potent than those bearing a chlorine.
Mora-Gutierrez, A; Attaie, R; Núñez de González, M T; Jung, Y; Woldesenbet, S; Marquez, S A
2018-01-01
Lutein is an important xanthophyll carotenoid with many benefits to human health. Factors affecting the application of lutein as a functional ingredient in low-fat dairy-like beverages (pH 6.0-7.0) are not well understood. The interactions of bovine and caprine caseins with hydrophobic lutein were studied using UV/visible spectroscopy as well as fluorescence. Our studies confirmed that the aqueous solubility of lutein is improved after binding with bovine and caprine caseins. The rates of lutein solubilization by the binding to bovine and caprine caseins were as follows: caprine α S1 -II-casein 34%, caprine α S1 -I-casein 10%, and bovine casein 7% at 100 μM lutein. Fluorescence of the protein was quenched on binding supporting complex formation. The fluorescence experiments showed that the binding involves tryptophan residues and some nonspecific interactions. Scatchard plots of lutein binding to the caseins demonstrated competitive binding between the caseins and their sites of interaction with lutein. Competition experiments suggest that caprine α S1 -II casein will bind a larger number of lutein molecules with higher affinity than other caseins. The chemical stability of lutein was largely dependent on casein type and significant increases occurred in the chemical stability of lutein with the following pattern: caprine α S1 -II-casein > caprine α S1 -I-casein > bovine casein. Addition of arabinogalactan to lutein-enriched emulsions increases the chemical stability of lutein-casein complexes during storage under accelerated photo-oxidation conditions at 25°C. Therefore, caprine α S1 -II-casein alone and in combination with arabinogalactan can have important applications in the beverage industry as carrier of this xanthophyll carotenoid (lutein). Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ahmad, Furkan; Misra, Laxminarain; Gupta, Vivek Kumar; Darokar, Mahendra Pandurang; Prakash, Om; Khan, Feroz; Shukla, Rakesh
2016-01-01
Saraca asoca bark has been used in the Ayurvedic system of medicine for female urino-genital disorders. We have recently reported the isolation and characterization of several compounds as markers to develop HPLC profiling of its methanol and aqueous methanol extracts. Now, a HPLC-PDA inactive compound, (+)-pinitol has been isolated and characterized from the bark of this medicinally important tree. Pinitol is a well known bioactive compound for a variety of biological activities, including hypoglycemic and anti-inflammatory activities. A process for the isolation of relatively good concentration of (+)-pinitol from S. asoca bark has been developed and its in vitro anti TNF-α and anti-inflammatory activities against carragenan-induced edema confirmed. While conducting experiments on the possible agonistic activity, it was found that (+)-pinitol showed up to eight fold reduction in the doses of β-lactam antibiotics. The mechanism of its agonistic activity was studied by docking experiments which showed that different conformations of (+)-pinitol and antibiotics were actually in the same binding site with no significant change in the binding energy. These docking simulations, thus predict the possible binding mode of studied compounds and probable reason behind the synergistic effect of (+)-pinitol along with β-lactam antibiotics.
Mozafari, Mona; El Deeb, Sami; Krull, Friederike; Wildgruber, Robert; Weber, Gerhard; Reiter, Christian G; Wätzig, Hermann
2018-02-01
A fast and precise affinity capillary electrophoresis (ACE) method has been applied to investigate the interactions between two serum albumins (HSA and BSA) and heparinoids. Furthermore, different free flow electrophoresis methods were developed to separate the species which appears owing to interaction of albumins with pentosan polysulfate sodium (PPS) under different experimental conditions. For ACE experiments, the normalized mobility ratios (∆R/R f ), which provided information about the binding strength and the overall charge of the protein-ligand complex, were used to evaluate the binding affinities. ACE experiments were performed at two different temperatures (23 and 37°C). Both BSA and HSA interact more strongly with PPS than with unfractionated and low molecular weight heparins. For PPS, the interactions can already be observed at low mg/L concentrations (3 mg/L), and saturation is already obtained at approximately 20 mg/L. Unfractionated heparin showed almost no interactions with BSA at 23°C, but weak interactions at 37°C at higher heparin concentrations. The additional signals also appeared at higher concentrations at 37°C. Nevertheless, in most cases the binding data were similar at both temperatures. Furthermore, HSA showed a characteristic splitting in two peaks especially after interacting with PPS, which is probably attributable to the formation of two species or conformational change of HSA after interacting with PPS. The free flow electrophoresis methods have confirmed and completed the ACE experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visual feature binding in younger and older adults: encoding and suffix interference effects.
Brown, Louise A; Niven, Elaine H; Logie, Robert H; Rhodes, Stephen; Allen, Richard J
2017-02-01
Three experiments investigated younger (18-25 yrs) and older (70-88 yrs) adults' temporary memory for colour-shape combinations (binding). We focused upon estimating the magnitude of the binding cost for each age group across encoding time (Experiment 1; 900/1500 ms), presentation format (Experiment 2; simultaneous/sequential), and interference (Experiment 3; control/suffix) conditions. In Experiment 1, encoding time did not differentially influence binding in the two age groups. In Experiment 2, younger adults exhibited poorer binding performance with sequential relative to simultaneous presentation, and serial position analyses highlighted a particular age-related difficulty remembering the middle item of a series (for all memory conditions). Experiments 1-3 demonstrated small to medium binding effect sizes in older adults across all encoding conditions, with binding less accurate than shape memory. However, younger adults also displayed negative effects of binding (small to large) in two of the experiments. Even when older adults exhibited a greater suffix interference effect in Experiment 3, this was for all memory types, not just binding. We therefore conclude that there is no consistent evidence for a visual binding deficit in healthy older adults. This relative preservation contrasts with the specific and substantial deficits in visual feature binding found in several recent studies of Alzheimer's disease.
Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui
2017-03-30
Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5 M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.
Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui
2017-01-01
Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124
Interactions of vitamin K3 with herring-sperm DNA using spectroscopy and electrochemistry.
Huang, Jianhang; Wang, Xingming; Fei, Dan; Ding, Lisheng
2010-10-01
By means of ultraviolet-visible (UV-Vis) and fluorescence spectra, the binding ratio between vitamin K(3) and herring-sperm DNA in a physiological pH environment (pH = 7.40) was determined as n(K3):n(DNA) = 2:1, and the binding constants of vitamin K(3) binding to DNA at different temperatures were determined as K(θ)(298K) = 1.28 × 10(5) L·mol(-1) and K(θ)(310K) = 7.19 × 10(4) L·mol(-1), which were confirmed using the double reciprocal method are Δ(r)H(m)(θ) = -3.57 × 10(4) J·mol(-1), Δ(r)G(m)(θ) = -2.92 × 10(4) J·mol(-1), and Δ(r)S(m)(θ) = 217.67 J·mol(-1)K(-1). The driving power of this process was enthalpy. An intercalation binding of the vitamin K(3) with DNA was supported by a competitive experiment using acridine orange (AO) as a spectral probe. By combination analysis of the Scatchard method and cyclic voltammetry, we suggested that the interaction mode between vitamin K(3) and herring-sperm DNA would be a mixed mode. The quinonoid, duality fused-ring of vitamin K(3) can intercalate into the base pairs of DNA, and there is an electrostatic binding along with intercalation binding.
NASA Astrophysics Data System (ADS)
Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui
2017-03-01
Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.
Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.
Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L
2016-06-17
Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.
Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S
2017-10-03
Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.
NASA Astrophysics Data System (ADS)
Abdelhameed, Ali S.; Alanazi, Amer M.; Bakheit, Ahmed H.; Darwish, Hany W.; Ghabbour, Hazem A.; Darwish, Ibrahim A.
2017-01-01
Binding of the recently introduced anti-cancer drug, crizotinib (CRB) with the bovine serum albumin (BSA) was comprehensively studied with the aid of fluorescence and UV-Vis spectroscopic as well as molecular docking techniques. The collective results of the study under the simulated physiological conditions proposed a static type of binding occurring between the CRB and BSA with binding constants of 104 L mol- 1. BSA conformational changes were investigated using three dimensional (3D) and synchronous fluorescence measurements. Moreover, the results of site marker competitive experiments and molecular docking, it could be deduced that CRB was inserted into the subdomain IIA (site I) of BSA yielding a more stabilized system. This was further confirmed with the molecular docking results which revealed that CRB is located in the active site residues Try149, Glu152, Ser191, Arg194, Arg198, Trp213, Arg217, Arg256, His287, Ala290, Glu291, Ser343, Asp450 within a radius of 6 Å. Combining the molecular docking studies and the computed thermodynamic parameters, it can be inferred that hydrophobic and electrostatic interactions are the major binding forces involved in formation of the CRB-BSA complex.
Götz, Frank; Roske, Yvette; Schulz, Maike Svenja; Autenrieth, Karolin; Bertinetti, Daniela; Faelber, Katja; Zühlke, Kerstin; Kreuchwig, Annika; Kennedy, Eileen J.; Krause, Gerd; Daumke, Oliver; Herberg, Friedrich W.; Heinemann, Udo; Klussmann, Enno
2016-01-01
A-kinase anchoring proteins (AKAPs) interact with the dimerization/docking (D/D) domains of regulatory subunits of the ubiquitous protein kinase A (PKA). AKAPs tether PKA to defined cellular compartments establishing distinct pools to increase the specificity of PKA signalling. Here, we elucidated the structure of an extended PKA-binding domain of AKAP18β bound to the D/D domain of the regulatory RIIα subunits of PKA. We identified three hydrophilic anchor points in AKAP18β outside the core PKA-binding domain, which mediate contacts with the D/D domain. Such anchor points are conserved within AKAPs that bind regulatory RII subunits of PKA. We derived a different set of anchor points in AKAPs binding regulatory RI subunits of PKA. In vitro and cell-based experiments confirm the relevance of these sites for the interaction of RII subunits with AKAP18 and of RI subunits with the RI-specific smAKAP. Thus we report a novel mechanism governing interactions of AKAPs with PKA. The sequence specificity of each AKAP around the anchor points and the requirement of these points for the tight binding of PKA allow the development of selective inhibitors to unequivocally ascribe cellular functions to the AKAP18-PKA and other AKAP-PKA interactions. PMID:27102985
NASA Astrophysics Data System (ADS)
Guo, Xingjia; Han, Xiaowei; Tong, Jian; Guo, Chuang; Yang, Wenfeng; Zhu, Jifen; Fu, Bing
2010-03-01
The interaction between piracetam (OPA) with bovine serum albumin (BSA) has been thoroughly studied by fluorescence quenching technique in combination with UV-vis absorption, Fourier transform infrared (FT-IR), and circular dichroism (CD) spectroscopies under the simulative physiological conditions. The quenching of BSA fluorescence by OPA was found to be a static quenching process. The binding constants ( K a) are 3.014, 2.926, and 2.503 × 10 3 M -1 at 292, 298, and 309 K, respectively. According to the van't Hoff equation, the thermodynamic functions standard enthalpy (Δ H) and standard entropy (Δ S) for the reaction were calculated to be -74.560 kJ mol -1 and -159.380 J mol -1 K -1, which indicated that OPA binds to BSA mainly by hydrogen bonds and van der Waals interactions. The binding distance between BSA and OPA was calculated to be 4.10 nm according to the theory of FÖrster's non-radiation energy transfer. The displacement experiments confirmed that OPA could bind to the site I of BSA. Furthermore, the effects of pH and some common ions on the binding constant were also examined. And the alterations of protein secondary structure in the presence of OPA were observed by the CD and FT-IR spectra.
Margreitter, Christian; Mayrhofer, Patrick; Kunert, Renate; Oostenbrink, Chris
2016-06-01
Monoclonal antibodies represent the fastest growing class of biotherapeutic proteins. However, as they are often initially derived from rodent organisms, there is a severe risk of immunogenic reactions, hampering their applicability. The humanization of these antibodies remains a challenging task in the context of rational drug design. "Superhumanization" describes the direct transfer of the complementarity determining regions to a human germline framework, but this humanization approach often results in loss of binding affinity. In this study, we present a new approach for predicting promising backmutation sites using molecular dynamics simulations of the model antibody Ab2/3H6. The simulation method was developed in close conjunction with novel specificity experiments. Binding properties of mAb variants were evaluated directly from crude supernatants and confirmed using established binding affinity assays for purified antibodies. Our approach provides access to the dynamical features of the actual binding sites of an antibody, based solely on the antibody sequence. Thus we do not need structural data on the antibody-antigen complex and circumvent cumbersome methods to assess binding affinities. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd. © 2016 The Authors Journal of Molecular Recognition Published by John Wiley & Sons Ltd.
Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.
Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O
2013-02-01
The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.
Structural and Histone Binding Ability Characterizations of Human PWWP Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Hong; Zeng, Hong; Lam, Robert
2013-09-25
The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less
Frequency of the first feature in action sequences influences feature binding.
Mattson, Paul S; Fournier, Lisa R; Behmer, Lawrence P
2012-10-01
We investigated whether binding among perception and action feature codes is a preliminary step toward creating a more durable memory trace of an action event. If so, increasing the frequency of a particular event (e.g., a stimulus requiring a movement with the left or right hand in an up or down direction) should increase the strength and speed of feature binding for this event. The results from two experiments, using a partial-repetition paradigm, confirmed that feature binding increased in strength and/or occurred earlier for a high-frequency (e.g., left hand moving up) than for a low-frequency (e.g., right hand moving down) event. Moreover, increasing the frequency of the first-specified feature in the action sequence alone (e.g., "left" hand) increased the strength and/or speed of action feature binding (e.g., between the "left" hand and movement in an "up" or "down" direction). The latter finding suggests an update to the theory of event coding, as not all features in the action sequence equally determine binding strength. We conclude that action planning involves serial binding of features in the order of action feature execution (i.e., associations among features are not bidirectional but are directional), which can lead to a more durable memory trace. This is consistent with physiological evidence suggesting that serial order is preserved in an action plan executed from memory and that the first feature in the action sequence may be critical in preserving this serial order.
Zhou, Weihua; Zhang, Yibin; Zeng, Yayue; Peng, Minyuan; Li, Hui; Sun, Shuming; Ma, Bianying; Wang, Yanpeng; Ye, Mao; Liu, Jing
2018-06-12
Multiple myeloma (MM) is a malignant plasma cell disease and is considered incurable. Annexin A2 (ANXA2) is closely related to the proliferation and adhesion of MM. Using protein-SELEX, we performed a screen for aptamers that bind GST-ANXA2 from a library, and GST protein was used for negative selection. The enrichment of the ssDNA pool was monitored by filter-binding assay during selection. After nine rounds of screening and high-throughput sequencing, we obtained six candidate aptamers that bind to the ANXA2 protein. The affinities of the candidate aptamers for ANXA2 were determined by ELONA. Binding of aptamer wh6 to the ANXA2 protein and to the MM cell was verified by aptamer pulldown experiment and flow cytometry, respectively. Aptamer wh6 binds the ANXA2 protein with good stability and has a dissociation constant in the nanomolar range. The binding specificity of aptamer wh6 was confirmed in vivo in nude mouse xenografts with MM cells and with MM bone marrow aspirates. Furthermore, aptamer wh6 can block MM cell adhesion to ANXA2 and block the proliferation of MM cells induced by ANXA2. In summary, wh6 can be considered a promising candidate tool for MM diagnosis and treatment. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene
2004-02-13
The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
C Kantar; H Demiray; N Dogan
2011-12-31
Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kantar, C.; Dodge, C.; Demiray, H.
2011-01-26
Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Deniaud, Aurélien; Panwar, Pankaj; Frelet-Barrand, Annie; Bernaudat, Florent; Juillan-Binard, Céline; Ebel, Christine; Rolland, Norbert; Pebay-Peyroula, Eva
2012-01-01
Background Chloroplast ATP/ADP transporters are essential to energy homeostasis in plant cells. However, their molecular mechanism remains poorly understood, primarily due to the difficulty of producing and purifying functional recombinant forms of these transporters. Methodology/Principal Findings In this work, we describe an expression and purification protocol providing good yields and efficient solubilization of NTT1 protein from Arabidopsis thaliana. By biochemical and biophysical analyses, we identified the best detergent for solubilization and purification of functional proteins, LAPAO. Purified NTT1 was found to accumulate as two independent pools of well folded, stable monomers and dimers. ATP and ADP binding properties were determined, and Pi, a co-substrate of ADP, was confirmed to be essential for nucleotide steady-state transport. Nucleotide binding studies and analysis of NTT1 mutants lead us to suggest the existence of two distinct and probably inter-dependent binding sites. Finally, fusion and deletion experiments demonstrated that the C-terminus of NTT1 is not essential for multimerization, but probably plays a regulatory role, controlling the nucleotide exchange rate. Conclusions/Significance Taken together, these data provide a comprehensive molecular characterization of a chloroplast ATP/ADP transporter. PMID:22438876
Wéber, Edit; Hetényi, Anasztázia; Váczi, Balázs; Szolnoki, Eva; Fajka-Boja, Roberta; Tubak, Vilmos; Monostori, Eva; Martinek, Tamás A
2010-01-25
Galectin-1 (Gal-1), a ubiquitous beta-galactoside-binding protein expressed by various normal and pathological tissues, has been implicated in cancer and autoimmune/inflammatory diseases in consequence of its regulatory role in adhesion, cell viability, proliferation, and angiogenesis. The functions of Gal-1 depend on its affinity for beta-galactoside-containing glycoconjugates; accordingly, the inhibition of sugar binding blocks its functions, hence promising potential therapeutic tools. The Tyr-Xxx-Tyr peptide motifs have been reported to be glycomimetic sequences, mainly on the basis of their inhibitory effect on the Gal-1-asialofetuin (ASF) interaction. However, the results regarding the efficacy of the Tyr-Xxx-Tyr motif as a glycomimetic inhibitor are still controversial. The present STD and trNOE NMR experiments reveal that the Tyr-Xxx-Tyr peptides studied do not bind to Gal-1, whereas their binding to ASF is clearly detected. (15)N,(1)H HSQC titrations with (15)N-labeled Gal-1 confirm the absence of any peptide-Gal-1 interaction. These data indicate that the Tyr-Xxx-Tyr peptides tested in this work are not glycomimetics as they interact with ASF via an unrevealed molecular linkage.
Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia
2017-06-17
The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(ʟ-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4.
Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia
2017-01-01
The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(l-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4. PMID:28629130
Investigation of the interaction between naringin and human serum albumin
NASA Astrophysics Data System (ADS)
Zhang, Yaheng; Li, Ying; Dong, Lijun; Li, Jiazhong; He, Wenying; Chen, Xingguo; Hu, Zhide
2008-03-01
The interaction between naringin and human serum albumin (HSA) has been thoroughly studied by fluorescence quenching technique in combination with UV absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, circular dichroism (CD) spectroscopy and molecular modeling method. Under the simulative physiological conditions, fluorescence data revealed the presence of the binding site on HSA and its binding constants ( K) are 1.62 × 10 4, 1.68 × 10 4, 1.72 × 10 4, and 1.79 × 10 4 M -1 at 289, 296, 303, and 310 K, respectively. The alterations of protein secondary structure in the presence of naringin aqueous solution were qualitative and quantitative calculated by the evidence from CD and FT-IR spectroscopes. In addition, according to the Van't Hoff equation, the thermodynamic functions standard enthalpy (Δ H0) and standard entropy (Δ S0) for the reaction were calculated to be 3.45 kJ mol -1 and 92.52 J mol -1 K -1. These results indicated that naringin binds to HSA mainly by a hydrophobic interaction. Furthermore, the displacement experiments confirmed that naringin could bind to the site I of HSA, which was also in agreement with the result of the molecular modeling study.
Binding of the bioactive component Aloe dihydroisocoumarin with human serum albumin
NASA Astrophysics Data System (ADS)
Zhang, Xiu-Feng; Xie, Ling; Liu, Yang; Xiang, Jun-Feng; Tang, Ya-Lin
2008-11-01
Aloe dihydroisocoumarin, one of new components isolated from Aloe vera, can scavenge reactive oxygen species. In order to explore the mechanism of drug action at a molecular level, the binding of Aloe dihydroisocoumarin with human serum albumin (HSA) has been investigated by using fluorescence, ultraviolet (UV), circular dichroism (CD) and Fourier transform infrared (FT-IR) spectroscopy, fluorescence dynamics, and molecular dynamic docking for the first time. We observed a quenching of fluorescence of HSA in the presence of Aloe dihydroisocoumarin and also analyzed the quenching results using the Stern-Volmer equation and obtained high affinity binding to HSA. An isoemissive point at 414 nm is seen, indicating that the quenching of HSA fluorescence depends on the formation of Aloe dihydroisocoumarin-HSA complex, which is further confirmed by fluorescence dynamic result. From the CD and FT-IR results, it is apparent that the interaction of Aloe dihydroisocoumarin with HSA causes a conformational change of the protein, with the gain of α-helix, β-sheet and random coil stability and the loss of β-turn content. Data obtained by fluorescence spectroscopy, fluorescence dynamics, CD, and FTIR experiments along with the docking studies suggest that Aloe dihydroisocoumarin binds to residues located in subdomain IIA of HSA.
NASA Astrophysics Data System (ADS)
Shahabadi, Nahid; Hadidi, Saba; Feizi, Foroozan
2015-03-01
This study was designed to examine the interaction of Tenofovir (Ten) with human serum albumin (HSA) under physiological conditions. The binding of drugs with human serum albumin is a crucial factor influencing the distribution and bioactivity of drugs in the body. To understand the action mechanisms between Ten and HSA, the binding of Ten with HSA was investigated by a combined experimental and computational approach. UV-vis results confirmed that Ten interacted with HSA to form a ground-state complex and values of the Stern-Volmer quenching constant indicate the presence of a static component in the quenching mechanism. As indicated by the thermodynamic parameters (positive ΔH and ΔS values), hydrophobic interaction plays a major role in the Ten-HSA complex. Through the site marker competitive experiment, Ten was confirmed to be located in site I of HSA. Furthermore, UV-vis absorption spectra, synchronous fluorescence spectrum and CD data were used to investigate the structural change of HSA molecules with addition of Ten, the results indicate that the secondary structure of HSA molecules was changed in the presence of Ten. The experimental results were in agreement with the results obtained via molecular docking study.
Baaklini, Sabrina; Afridi, Sarwat; Nguyen, Thy Ngoc; Koukouikila-Koussounda, Felix; Ndounga, Mathieu; Imbert, Jean; Torres, Magali; Pradel, Lydie; Ntoumi, Francine; Rihet, Pascal
2017-01-01
Linkage studies have revealed a linkage of mild malaria to chromosome 6p21 that contains the NCR3 gene encoding a natural killer cell receptor, whereas NCR3-412G>C (rs2736191) located in its promoter region was found to be associated with malaria in Burkina Faso. Here we confirmed the association of rs2736191 with mild malaria in a Congolese cohort and investigated its potential cis-regulatory effect. Luciferase assay results indicated that rs2736191-G allele had a significantly increased promoter activity compared to rs2736191-C allele. Furthermore, EMSAs demonstrated an altered binding of two nuclear protein complexes to the rs2736191-C allele in comparison to rs2736191-G allele. Finally, after in silico identification of transcription factor candidates, pull-down western blot experiments confirmed that both STAT4 and RUNX3 bind the region encompassing rs2736191 with a higher affinity for the G allele. To our knowledge, this is the first report that explored the functional role of rs2736191. These results support the hypothesis that genetic variation within natural killer cell receptors alters malaria resistance in humans.
2-Styrylindolium based fluorescent probes visualize neurofibrillary tangles in Alzheimer's disease.
Gu, Jiamin; Anumala, Upendra Rao; Lo Monte, Fabio; Kramer, Thomas; Heyny von Haußen, Roland; Hölzer, Jana; Goetschy-Meyer, Valérie; Mall, Gerhard; Hilger, Ingrid; Czech, Christian; Schmidt, Boris
2012-12-15
We evaluated 2-styrylindolium derivatives (6-11) as novel and selective probes for neurofibrillary tangles (NFTs) on brain sections of AD patients. The staining experiments indicated that these compounds may bind selectively to NFTs in the presence of ß-amyloid (Aß) plaques. Cell free binding assays confirmed that 2-[2-[4-(1-pyrrolidinyl)phenyl]ethenyl]-1,3,3-trimethyl-3H-indolium iodide (9) and 2-[2-[4-(diethylamino)phenyl]ethenyl]-1-butyl-3,3-dimethyl-3H-indolium iodide (11) display excellent affinities to Tau-aggregates (IC(50) values of 5.1 and 1.4 nM, respectively) in the displacement of Thiazin Red R. These probes have good solubility in distilled water and low or no cytotoxicity in zebrafish embryo and liver hepatocellular carcinoma cell assays. Copyright © 2012 Elsevier Ltd. All rights reserved.
Dadashev, S Ia; Gorach, G G; Kolomiets, O L
1994-01-01
Male mice were immunized with the suspension of synaptonemal complexes (SC) isolated from mouse spermatocytes nuclei. The indirect immunofluorescent analysis showed the active binding of sera obtained from immunized mice to SC of mouse spermatocyte spreads. At early and mid-pachytene, SC can be clearly identified in 19 autosome bivalents and in sex chromosome bivalent. According to the electron microscopic analysis, all structural elements of SC bind antibodies. Metaphase chromosomes were not stained with the immune sera. Specificity of interaction between SC components and antibodies was confirmed in a series of control experiments. Analysis of sera obtained from mice after their syngeneic immunization with isolated SC fraction suggested that certain mouse SC components induce the formation of autoantibodies. This, in turn, suggests that these SC components are meiosis-specific.
Enantioselective binding of L, D-phenylalanine to ct DNA
NASA Astrophysics Data System (ADS)
Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng
2009-10-01
The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.
Enantioselective binding of L,D-phenylalanine to ct DNA.
Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng
2009-10-15
The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.
Zhong, Huailing; Hansen, Kasper B; Boyle, Noel J; Han, Kiho; Muske, Galina; Huang, Xinyan; Egebjerg, Jan; Sánchez, Connie
2009-10-25
The human serotonin transporter (hSERT) has primary and allosteric binding sites for escitalopram and R-citalopram. Previous studies have established that the interaction of these two compounds at a low affinity allosteric binding site of hSERT can affect the dissociation of [(3)H]escitalopram from hSERT. The allosteric binding site involves a series of residues in the 10th, 11th, and 12th trans-membrane domains of hSERT. The low affinity allosteric activities of escitalopram and R-citalopram are essentially eliminated in a mutant hSERT with changes in some of these residues, namely A505V, L506F, I507L, S574T, I575T, as measured in dissociation binding studies. We confirm that in association binding experiments, R-citalopram at clinically relevant concentrations reduces the association rate of [(3)H]escitalopram as a ligand to wild type hSERT. We demonstrate that the ability of R-citalopram to reduce the association rate of escitalopram is also abolished in the mutant hSERT (A505V, L506F, I507L, S574T, I575T), along with the expected disruption the low affinity allosteric function on dissociation binding. This suggests that the allosteric binding site mediates both the low affinity and higher affinity interactions between R-citalopram, escitalopram, and hSERT. Our data add an additional structural basis for the different efficacies of escitalopram compared to racemic citalopram reported in animal studies and clinical trials, and substantiate the hypothesis that hSERT has complex allosteric mechanisms underlying the unexplained in vivo activities of its inhibitors.
Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.
Ataci, Nese; Ozcelik, Elif; Arsu, Nergis
2018-06-02
Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3 L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3 L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.
Microbiology neutralization of zearalenone using Lactococcus lactis and Bifidobacterium sp.
Król, A; Pomastowski, P; Rafińska, K; Railean-Plugaru, V; Walczak, J; Buszewski, B
2018-01-01
The aim of the study was to neutralize zearalenone by lactic acid bacteria (LAB) such as Lactococcus lactis and Bifidobacterium sp. and investigate the mechanism of zearalenone (ZEA) binding. Neutralization of ZEA by LAB was confirmed by identification of binding kinetics and spectroscopic studies such as Fourier transform infrared spectroscopy (FT-IR) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). The obtained results showed that the kinetic process of zearalenone binding to L. lactis is not homogeneous but is expressed with an initial rapid stage with about 90% of ZEA biosorption and with a much slower second step. In case of Bifidobacterium sp., the neutralization process is homogeneous; the main stage can be described with about 88% of ZEA biosorption. MALDI-TOF-MS measurements and FTIR analysis confirmed the uptake of zearalenone molecules by bacterial species. Moreover, the assessment of dead and live lactic acid bacteria cells after zearalenone treatment was performed using fluorescence microscopy. Graphical abstract Microbiology neutralization of zearalenone using Lactococcus lactis and Bifidobacterium sp. was confirmed by identification of binding kinetics and spectroscopic studies such as FT-IR spectroscopy and MALDI-TOF-MS spectrometry. The mechanism of ZEA binding was also investigated.
Hamrick, Terri S.; Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Horton, John R.; Russell, Perry W.; Orndorff, Paul E.
2000-01-01
Five Escherichia coli type 1 pilus mutants that had point mutations in fimH, the gene encoding the type 1 pilus adhesin FimH, were characterized. FimH is a minor component of type 1 pili that is required for the pili to bind and agglutinate guinea pig erythrocytes in a mannose-inhibitable manner. Point mutations were located by DNA sequencing and deletion mapping. All mutations mapped within the signal sequence or in the first 28% of the predicted mature protein. All mutations were missense mutations except for one, a frameshift lesion that was predicted to cause the loss of approximately 60% of the mature FimH protein. Bacterial agglutination tests with polyclonal antiserum raised to a LacZ-FimH fusion protein failed to confirm that parental amounts of FimH cross-reacting material were expressed in four of the five mutants. The remaining mutant, a temperature-sensitive (ts) fimH mutant that agglutinated guinea pig erythrocytes after growth at 31°C but not at 42°C, reacted with antiserum at both temperatures in a manner similar to the parent. Consequently, this mutant was chosen for further study. Temperature shift experiments revealed that new FimH biosynthesis was required for the phenotypic change. Guinea pig erythrocyte and mouse macrophage binding experiments using the ts mutant grown at the restrictive and permissive temperatures revealed that whereas erythrocyte binding was reduced to a level comparable to that of a fimH insertion mutant at the restrictive temperature, mouse peritoneal macrophages were bound with parental efficiency at both the permissive and restrictive temperatures. Also, macrophage binding by the ts mutant was insensitive to mannose inhibition after growth at 42°C but sensitive after growth at 31°C. The ts mutant thus binds macrophages with one receptor specificity at 31°C and another at 42°C. PMID:10869080
[Hemoglobin oxygen transport capacity in surgical endotoxicosis ].
Poryadin, G V; Vlasov, A P; Trofimov, V A; Vlasova, T I; Kamkina, O V; Grigoryev, A G; Vlasov, P A
2016-01-01
In surgical endointoxication hemoglobin oxygen transport capacity of red blood cells (hemoglobin affinity ligands: the ability to bind and release ligands) is reduced and is associated with the severity of endogenous intoxication. Violation of oxygen transport function of hemoglobin at endogenous intoxication is associated with conformational changes of a biomolecule, and its possible influence on reactive oxygen species, which confirmed in experiments in vitro: under the influence of oxygen-iron ascorbate ability of hemoglobin deteriorates. Largely similar structural and functional changes in hemoglobin occur in patients with surgical endotoxicosis.
Pursuit of the Kramers-Henneberger atom
NASA Astrophysics Data System (ADS)
Wei, Qi; Wang, Pingxiao; Kais, Sabre; Herschbach, Dudley
2017-09-01
Superstrong femtosecond pulsed lasers can profoundly alter electronic structure of atoms and molecules. The oscillating laser field drives one or more electrons almost free. When averaged over, the rapid oscillations combine with the static Coulomb potential to create an effective binding potential. The consequent array of bound states comprises the ;Kramers-Henneberger Atom;. Theorists have brought forth many properties of KH atoms, yet convincing experimental evidence is meager. We examine a remarkable experiment accelerating atoms (Eichmann et al., 2009). It offers tantalizing evidence for the KH atom, with prospects for firm confirmation by adjustment of laser parameters.
Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len
2005-03-01
We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.
Kedar, Vishram P; Darby, Martyn K; Williams, Jason G; Blackshear, Perry J
2010-03-08
Tristetraprolin (TTP) is the prototype member of a family of CCCH tandem zinc finger proteins and is considered to be an anti-inflammatory protein in mammals. TTP plays a critical role in the decay of tumor necrosis factor alpha (TNF) mRNA, among others, by binding AU-rich RNA elements in the 3'-untranslated regions of this transcript and promoting its deadenylation and degradation. We used yeast two-hybrid analysis to identify potential protein binding partners for human TTP (hTTP). Various regions of hTTP recovered 31 proteins that fell into 12 categories based on sequence similarities. Among these, the interactions between hTTP and CIN85, cytoplasmic poly (A) binding protein (PABP), nucleolin and heat shock protein 70 were confirmed by co-immunoprecipitation experiments. CIN85 and hTTP co-localized in the cytoplasm of cells as determined by confocal microscopy. CIN85 contains three SH3 domains that specifically bind a unique proline-arginine motif (PXXXPR) found in several CIN85 effectors. We found that the SH3 domains of CIN85 bound to a PXXXPR motif located near the C-terminus of hTTP. Co-expression of CIN85 with hTTP resulted in the increased phosphorylation of hTTP at serine residues in positions 66 and 93, possibly due in part to the demonstrated association of mitogen-activated protein kinase kinase kinase 4 (MEKK4) to both proteins. The presence of CIN85 did not appear to alter hTTP's binding to RNA probes or its stimulated breakdown of TNF mRNA. These studies describe interactions between hTTP and nucleolin, cytoplasmic PABP, heat shock protein 70 and CIN85; these interactions were initially discovered by two-hybrid analysis, and confirmed by co-immunoprecipitation. We found that CIN85 binding to a C-terminal motif within hTTP led to the increased phosphorylation of hTTP, possibly through enhanced association with MEKK4. The functional consequences to each of the members of this putative complex remain to be determined.
Rao, Marie Luise; Rao, Govind S.
1982-01-01
1. Binding of l-tri-[125I]iodothyronine to the cytosol fraction of normal human female breast adipose tissue was investigated by the charcoal adsorption method. Equilibrium of binding was reached after 120s at 25°C. 2. The l-tri-[125I]iodothyronine-binding component is a protein; this was confirmed by experiments in which binding was totally lost after heating the cytosol fraction for 10min at 100°C and in which binding was diminished after treatment with proteolytic enzymes and with thiol-group-blocking reagents. The binding protein was stable at −38°C for several months. 3. It displayed saturability, high affinity (apparent Kd 3.28nm) and a single class of binding sites. 4. High specificity for l-tri-iodothyronine and l-3,5-di-iodo-3′-isopropylthyronine was observed, whereas other iodothyronines were less effective in displacing l-tri-[125I]-iodothyronine from its binding site. 5. The binding of the hormone by the cytosol fraction did not show a pH optimum. 6. When cytosol fractions of adipose tissue from different females were subjected to radioimmunoassay for the determination of thyroxine-binding globulin a value of 0.304±0.11μg/mg of cytosol protein (mean±s.d., n=4) was obtained; the mean concentration in plasma was 0.309±0.07μg/mg of plasma protein (mean±s.d., n=3). 7. The Ka value of 6.3×108m−1 of l-tri-[125I]iodothyronine for binding to plasma, the similar thermalinactivation profiles of binding and the reactivity to thiol-group-blocking reagents were some properties common between the binding components from the cytosol fraction and plasma. 8. These results suggest that the cytosol fraction of human female breast adipose tissue contains thyroxine-binding globulin; the protein that binds l-tri-[125I]iodothyronine with high affinity and specificity appears to be similar to thyroxine-binding globulin. PMID:6289813
A comprehensive approach to ascertain the binding mode of curcumin with DNA
NASA Astrophysics Data System (ADS)
Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.
2017-03-01
Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.
On the role of humic acids' carboxyl groups in the binding of charged organic compounds.
Smilek, Jiří; Sedláček, Petr; Kalina, Michal; Klučáková, Martina
2015-11-01
Interactions of humic acids (HAs) with two cationic dyes (methylene blue and rhodamine 6G) were studied using a unique combination of diffusion and partitioning studies in HAs, containing hydrogels and batch sorption experiments. In order to investigate the involvement of carboxyl groups of HAs in these interactions, all experiments were performed for both, the original lignite HAs and HAs with selectively methylated carboxyls. The results of the diffusion experiments confirm that the interactions between the solute and humic substances have a strong impact on the rate of diffusion process. Surprisingly, the effect is almost equally approved for original and methylated HAs. On the other hand, the results of batch sorption experiments show strong improvement of the sorption capacity (methylated HAs), which is explained by changed morphology of alkylated HAs. The comparison of the results of diffusion and adsorption experiments shows that the diffusion experiments simulate the transport of solutes in natural humics containing environment more reasonably. Copyright © 2015 Elsevier Ltd. All rights reserved.
Blatter, Markus; Cléry, Antoine; Damberger, Fred F.
2017-01-01
Abstract The Fox-1 RNA recognition motif (RRM) domain is an important member of the RRM protein family. We report a 1.8 Å X-ray structure of the free Fox-1 containing six distinct monomers. We use this and the nuclear magnetic resonance (NMR) structure of the Fox-1 protein/RNA complex for molecular dynamics (MD) analyses of the structured hydration. The individual monomers of the X-ray structure show diverse hydration patterns, however, MD excellently reproduces the most occupied hydration sites. Simulations of the protein/RNA complex show hydration consistent with the isolated protein complemented by hydration sites specific to the protein/RNA interface. MD predicts intricate hydration sites with water-binding times extending up to hundreds of nanoseconds. We characterize two of them using NMR spectroscopy, RNA binding with switchSENSE and free-energy calculations of mutant proteins. Both hydration sites are experimentally confirmed and their abolishment reduces the binding free-energy. A quantitative agreement between theory and experiment is achieved for the S155A substitution but not for the S122A mutant. The S155 hydration site is evolutionarily conserved within the RRM domains. In conclusion, MD is an effective tool for predicting and interpreting the hydration patterns of protein/RNA complexes. Hydration is not easily detectable in NMR experiments but can affect stability of protein/RNA complexes. PMID:28505313
NASA Astrophysics Data System (ADS)
Li, Q. Q.; Xu, R.; Hunt, A. G.; Falcone, D. L.
Plants are constantly challenged by numerous environmental stresses both biotic and abiotic It is clear that plants have evolved to counter these stresses using all but limited means We recently discovered the potential role of a messenger RNA processing factor namely the Arabidopsis cleavage and polyadenylation specificity factor 30 kDa subunit AtCPSF30 when a mutant deficient in this factor displayed altered responses to an array of abiotic stresses This AtCPSF30 mutant named oxt6 exhibited an elevated tolerance to oxidative stress Microarray experiments of oxt6 and its complemented lines revealed an altered gene expression profile among which were antioxidative defense genes Interestingly the same gene encoding AtCPSF30 can also be transcribed into a large transcript that codes for a potential splicing factor Both protein products have a domain for RNA binding and a calmodulin binding domain activities of which have been confirmed by biochemical assays Surprisingly binding of AtCPSF30 to calmodulin inhibits the RNA-binding activity of the protein Mutational analysis shows that a small part of the protein is responsible for calmodulin binding and point mutations in this region abolished both RNA binding activity and the inhibition of this activity by calmodulin Analyses of the potential splicing factor are on going and the results will be presented The interesting possibilities for both the interplay between splicing and polyadenylation and the regulation of these processes by stimuli that act through
Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi; Shi, Jie-Hua
2017-06-01
The binding interaction between bovine serum albumin (BSA) and enalapril (ENPL) at the imitated physiological conditions (pH = 7.4) was investigated using UV-vis absorption spectroscopy (UV-vis), fluorescence emission spectroscopy (FES), synchronous fluorescence spectroscopy (SFS), Fourier transform infrared spectroscopy (FT-IR), circular dichroism (CD) and molecular docking methods. It can be deduced from the experimental results from the steady-state fluorescence spectroscopic titration that the intrinsic BSA fluorescence quenching mechanism induced by ENPL is static quenching, based on the decrease in the BSA quenching constants in the presence of ENPL with increase in temperature and BSA quenching rates >10 10 L mol -1 sec -1 . This result indicates that the ENPL-BSA complex is formed through an intermolecular interaction of ENPL with BSA. The main bonding forces for interaction of BSA and ENPL are van der Waal's forces and hydrogen bonding interaction based on negative values of Gibbs free energy change (ΔG 0 ), enthalpic change (ΔH 0 ) and entropic change (ΔS 0 ). The binding of ENPL with BSA is an enthalpy-driven process due to |ΔH°| > |TΔS°| in the binding process. The results of competitive binding experiments and molecular docking confirm that ENPL binds in BSA sub-domain IIA (site I) and results in a slight change in BSA conformation, but BSA still retains its α-helical secondary structure. Copyright © 2016 John Wiley & Sons, Ltd.
Barykina, Natalia V.; Subach, Oksana M.; Doronin, Danila A.; Sotskov, Vladimir P.; Roshchina, Marina A.; Kunitsyna, Tatiana A.; Malyshev, Aleksey Y.; Smirnov, Ivan V.; Azieva, Asya M.; Sokolov, Ilya S.; Piatkevich, Kiryl D.; Burtsev, Mikhail S.; Varizhuk, Anna M.; Pozmogova, Galina E.; Anokhin, Konstantin V.; Subach, Fedor V.; Enikolopov, Grigori N.
2016-01-01
Genetically encoded calcium indicators (GECIs) are mainly represented by two- or one-fluorophore-based sensors. One type of two-fluorophore-based sensor, carrying Opsanus troponin C (TnC) as the Ca2+-binding moiety, has two binding sites for calcium ions, providing a linear response to calcium ions. One-fluorophore-based sensors have four Ca2+-binding sites but are better suited for in vivo experiments. Herein, we describe a novel design for a one-fluorophore-based GECI with two Ca2+-binding sites. The engineered sensor, called NTnC, uses TnC as the Ca2+-binding moiety, inserted in the mNeonGreen fluorescent protein. Monomeric NTnC has higher brightness and pH-stability in vitro compared with the standard GECI GCaMP6s. In addition, NTnC shows an inverted fluorescence response to Ca2+. Using NTnC, we have visualized Ca2+ dynamics during spontaneous activity of neuronal cultures as confirmed by control NTnC and its mutant, in which the affinity to Ca2+ is eliminated. Using whole-cell patch clamp, we have demonstrated that NTnC dynamics in neurons are similar to those of GCaMP6s and allow robust detection of single action potentials. Finally, we have used NTnC to visualize Ca2+ neuronal activity in vivo in the V1 cortical area in awake and freely moving mice using two-photon microscopy or an nVista miniaturized microscope. PMID:27677952
Structural basis of nSH2 regulation and lipid binding in PI3Kα.
Miller, Michelle S; Schmidt-Kittler, Oleg; Bolduc, David M; Brower, Evan T; Chaves-Moreira, Daniele; Allaire, Marc; Kinzler, Kenneth W; Jennings, Ian G; Thompson, Philip E; Cole, Philip A; Amzel, L Mario; Vogelstein, Bert; Gabelli, Sandra B
2014-07-30
We report two crystal structures of the wild-type phosphatidylinositol 3-kinase α (PI3Kα) heterodimer refined to 2.9 Å and 3.4 Å resolution: the first as the free enzyme, the second in complex with the lipid substrate, diC4-PIP₂, respectively. The first structure shows key interactions of the N-terminal SH2 domain (nSH2) and iSH2 with the activation loop that suggest a mechanism by which the enzyme is inhibited in its basal state. In the second structure, the lipid substrate binds in a positively charged pocket adjacent to the ATP-binding site, bordered by the P-loop, the activation loop and the iSH2 domain. An additional lipid-binding site was identified at the interface of the ABD, iSH2 and kinase domains. The ability of PI3Kα to bind an additional PIP₂ molecule was confirmed in vitro by fluorescence quenching experiments. The crystal structures reveal key differences in the way the nSH2 domain interacts with wild-type p110α and with the oncogenic mutant p110αH1047R. Increased buried surface area and two unique salt-bridges observed only in the wild-type structure suggest tighter inhibition in the wild-type PI3Kα than in the oncogenic mutant. These differences may be partially responsible for the increased basal lipid kinase activity and increased membrane binding of the oncogenic mutant.
Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J
2004-10-07
The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM < or = K(D) < or = 120 microM) and five inhibited the growth of primary malignant melanoma cells (C8146A) at comparable concentrations (1.0 microM < or = IC(50) < or = 50 microM). Additionally, saturation transfer difference (STD) NMR experiments confirmed binding and qualitatively identified protons from the small molecule at the small molecule-S100B interface. Heteronuclear single quantum coherence (HSQC) NMR titrations indicate that these compounds interact with the p53 binding site on S100B. An NMR-docked model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).
Interaction of Berberine derivative with protein POT1 affect telomere function in cancer cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiao, Nannan; Chen, Siqi; Ma, Yan
Highlights: Black-Right-Pointing-Pointer The protein POT1 plays an important role in telomere protection. Black-Right-Pointing-Pointer Functional POT1 was overexpressed in Escherichia coli for the first time, and purified. Black-Right-Pointing-Pointer Compound Sysu-00692 was found to be the first POT1-binding ligand. Black-Right-Pointing-Pointer Sysu-00692 could interfere with the binding activity of POT1 in vivo. Black-Right-Pointing-Pointer Sysu-00692 had inhibition on telomerase and cell proliferation. -- Abstract: The protein POT1 plays an important role in telomere protection, which is related with telomere elongation and cell immortality. The protein has been recognized as a promising drug target for cancer treatment. In the present study, we cloned, overexpressed inmore » Escherichia coli for the first time, and purified recombinant human POT1. The protein was proved to be active through filter binding assay, FRET and CD experiments. In the initial screening for protein binding ligands using SPR, compound Sysu-00692 was found to bind well with the POT1, which was confirmed with EMSA. Its in vivo activity study showed that compound Sysu-00692 could interfere with the binding between human POT1 and the telomeric DNA through chromatin immunoprecipitation. Besides, the compound showed mild inhibition on telomerase and cell proliferation. As we know, compound Sysu-00692 is the first reported POT1-binding ligand, which could serve as a lead compound for further improvement. This work offered a potentially new approach for drug design for the treatment of cancers.« less
NASA Astrophysics Data System (ADS)
Zhang, Yaheng; Li, Jiazhong; Dong, Lijun; Li, Ying; Chen, Xingguo
2008-10-01
In this study the interaction between esculin and human serum albumin (HSA) in AOT/isooctane/water microemulsions was studied for the first time using fluorescence quenching technique in combination with UV absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, circular dichroism (CD) spectroscopy and dynamic light scattering (DLS) technique. Fluorescence data in ω o 20 microemulsions revealed the presence of the binding site of esculin on HSA and its binding constants at four different temperatures were obtained. The affinities in microemulsions are similar to that in buffer solution. The alterations of protein secondary structure in the microemulsions in the absence and presence of esculin compared with the free form of HSA in buffer were qualitatively and quantitatively analyzed by the evidence from CD and FT-IR spectroscopes. The displacement experiments confirmed that esculin could bind to the site I of HSA, which was in agreement with the result of the molecular modeling study. Furthermore, the DLS data suggested that HSA may locate at the interface of the microemulsion and esculin could interact with them.
DNA conformational change induced by the bacteriophage phi 29 connector.
Valpuesta, J M; Serrano, M; Donate, L E; Herranz, L; Carrascosa, J L
1992-01-01
Translocation of viral DNA inwards and outwards of the capsid of double-stranded DNA bacteriophages occurs through the connector, a key viral structure that is known to interact with DNA. It is shown here that phage phi 29 connector binds both linear and circular double-stranded DNA. However, DNA-mediated protection of phi 29 connectors against Staphylococcus aureus endoprotease V8 digestion suggests that binding to linear DNA is more stable than to circular DNA. Endoprotease V8-protection assays also suggest that the length of the linear DNA required to produce a stable phi 29 connector-DNA interaction is, at least, twice longer than the phi 29 connector channel. This result is confirmed by experiments of phi 29 connector-protection of DNA against DNase I digestion. Furthermore, DNA circularization assays indicate that phi 29 connectors restrain negative supercoiling when bound to linear DNA. This DNA conformational change is not observed upon binding to circular DNA and it could reflect the existence of some left-handed DNA coiling or DNA untwisting inside of the phi 29 connector channel. Images PMID:1454519
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C
2000-06-01
Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.
Shi, Jie-Hua; Lou, Yan-Yue; Zhou, Kai-Li; Pan, Dong-Qi
2018-03-01
Fenhexamid, as a hydroxyanilide, is widely applied to control Botrytis cinerea for protecting crops and fruits. But it could adversely affect human and animals health due to accumulation of residues in food production. Here, the affinity characteristics of fenhexamid on bovine serum albumin (BSA) was studied via a series of spectroscopic methods such as steady-state fluorescence spectroscopy, ultraviolet spectroscopy (UV), synchronous fluorescence spectroscopy (SFS), 3D fluorescence spectroscopy, and fourier transform infrared spectroscopy (FT-IR). The experimental results illustrated that the fluorescence quenching mechanism of BSA induced by fenhexamid was a static quenching. The binding constant (K b ) of fenhexamid with BSA was 2.399 × 10 4 M -1 at 298 K and the combination ratio was about 1:1. The competitive experiment demonstrated that fenhexamid was binding on the BSA at site II (subdomain IIIA), which was confirmed by the molecular docking studies. The negative values of thermodynamic parameter (ΔH 0 , ΔS 0 and ΔG 0 ) revealed that the reaction of fenhexamid with BSA could proceed spontaneously, the van der Waals force and hydrogen bonding interaction conducted the main effect, and the binding process was enthalpy-driven. What's more, the 8-Anilino-1-naphthalenesulfonate (ANS) and sucrose binding studies were also performed and further verified the binding force between BSA and fenhexamid. Copyright © 2018 Elsevier B.V. All rights reserved.
footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.
Sebastian, Alvaro; Contreras-Moreira, Bruno
2014-01-15
Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.
Diao, Jianxiong; Yu, Xiaolu; Ma, Lin; Li, Yuanqing; Sun, Ying
2018-05-16
This work reported a new method of design for the immobilization of acetylcholinesterase (AChE) based on its molecular structure to improve its sensitivity and stability. The immobilization binding site on the surface of AChE was determined using MOLCAD's multi-channel functionality. Then, 11 molecules ((+)-catechin, (-)-epicatechin, (-)-gallocatechin, hesperetin, naringenin, quercetin, taxifolin, (-)-epicatechin gallate, flupirtine, atropine, and hyoscyamine) were selected from the ZINC database (about 50 000 molecules) as candidate affinity ligands for AChE. The fluorescence results showed that the binding constant K b between AChE and the ligands ranged from 0.01344 × 10 4 to 4.689 × 10 4 M -1 and there was one independent class of binding site for the ligands on AChE. The AChE-ligand binding free energy ranged from -12.14 to -26.65 kJ mol -1 . Naringenin, hesperetin, and quercetin were the three most potent immobilized affinity ligands. In addition, it was confirmed that the binding between the immobilized ligands only occurred at a single site, located in an inactive area on the surface of AChE, and did not affect the enzymatic activity as shown through a competition experiment and enzyme assay. This method based on protein surface structural recognition with high sensitivity and stability can be used as a generic approach for design of the enzyme immobilization and biosensor development.
Zhang, Xue; Wang, Ying; Ge, Hui-Ya; Gu, Yi-Jun; Cao, Fan-Fan; Yang, Chun-Xin; Uzan, Georges; Peng, Bin; Zhang, Deng-Hai
2018-04-18
Elevated plasma statured fatty acids (FFAs) cause TLR4/MD2 activation-dependent inflammation and insulin tolerance, which account for the occurrence and development of obesity. It has been confirmed that statured palmitic acid (PA) (the most abundant FFA) could bind MD2 to cause cellular inflammation. The natural compound celastrol could improve obesity, which is suggested via inhibiting inflammation, yet the detailed mechanism for celastrol is still unclear. As celastrol is reported to directly target MD2, we thought disrupting the binding between FFAs and MD2 might be one of the ways for celastrol to inhibit FFAs-caused inflammation and insulin resistance. In this study, we found evidence to support our hypothesis: celastrol could reverse PA-caused TLR4/MD2 activation-dependent insulin resistance, as determined by glucose-lowering ability, cellular glucose uptake, insulin action-related proteins and TLR4/MD2/NF-κB activation. Bioinformatics and cellular experiments showed that both celastrol and PA could bind MD2, and that celastrol could expel PA from cells. Finally, celastrol could reverse high fat diet caused hyperglycemia and obesity, and liver NF-kB activations. Taking together, we proved that celastrol could reverses PA-caused TLR4-MD2 activation-dependent insulin resistance via disrupting PA binding to MD2. © 2018 Wiley Periodicals, Inc.
Jiang, Yanjuan; Yu, Diqiu
2016-08-01
Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. © 2016 American Society of Plant Biologists. All Rights Reserved.
Dash, Hirak R; Basu, Subham; Das, Surajit
2017-04-01
Biofilm-forming mercury-resistant marine bacterium Bacillus cereus BW-201B has been explored to evident that the bacterial biofilm-EPS (exopolymers) trap inorganic mercury but subsequently release EPS-bound mercury for induction of mer operon-mediated volatilization of inorganic mercury. The isolate was able to tolerate 50 ppm of mercury and forms biofilm in presence of mercury. mer operon-mediated volatilization was confirmed, and -SH was found to be the key functional group of bacterial EPS responsible for mercury binding. Biofilm-EPS-bound mercury was found to be internalized to the bacterial system as confirmed by reversible conformational change of -SH group and increased expression level of merA gene in a timescale experiment. Biofilm-EPS trapped Hg after 24 h of incubation, and by 96 h, the volatilization process reaches to its optimum confirming the internalization of EPS-bound mercury to the bacterial cells. Biofilm disintegration at the same time corroborates the results.
Englerin A Agonizes the TRPC4/C5 Cation Channels to Inhibit Tumor Cell Line Proliferation
Carson, Cheryl; Raman, Pichai; Tullai, Jennifer; Xu, Lei; Henault, Martin; Thomas, Emily; Yeola, Sarita; Lao, Jianmin; McPate, Mark; Verkuyl, J. Martin; Marsh, George; Sarber, Jason; Amaral, Adam; Bailey, Scott; Lubicka, Danuta; Pham, Helen; Miranda, Nicolette; Ding, Jian; Tang, Hai-Ming; Ju, Haisong; Tranter, Pamela; Ji, Nan; Krastel, Philipp; Jain, Rishi K.; Schumacher, Andrew M.; Loureiro, Joseph J.; George, Elizabeth; Berellini, Giuliano; Ross, Nathan T.; Bushell, Simon M.; Erdemli, Gül; Solomon, Jonathan M.
2015-01-01
Englerin A is a structurally unique natural product reported to selectively inhibit growth of renal cell carcinoma cell lines. A large scale phenotypic cell profiling experiment (CLiP) of englerin A on ¬over 500 well characterized cancer cell lines showed that englerin A inhibits growth of a subset of tumor cell lines from many lineages, not just renal cell carcinomas. Expression of the TRPC4 cation channel was the cell line feature that best correlated with sensitivity to englerin A, suggesting the hypothesis that TRPC4 is the efficacy target for englerin A. Genetic experiments demonstrate that TRPC4 expression is both necessary and sufficient for englerin A induced growth inhibition. Englerin A induces calcium influx and membrane depolarization in cells expressing high levels of TRPC4 or its close ortholog TRPC5. Electrophysiology experiments confirmed that englerin A is a TRPC4 agonist. Both the englerin A induced current and the englerin A induced growth inhibition can be blocked by the TRPC4/C5 inhibitor ML204. These experiments confirm that activation of TRPC4/C5 channels inhibits tumor cell line proliferation and confirms the TRPC4 target hypothesis generated by the cell line profiling. In selectivity assays englerin A weakly inhibits TRPA1, TRPV3/V4, and TRPM8 which suggests that englerin A may bind a common feature of TRP ion channels. In vivo experiments show that englerin A is lethal in rodents near doses needed to activate the TRPC4 channel. This toxicity suggests that englerin A itself is probably unsuitable for further drug development. However, since englerin A can be synthesized in the laboratory, it may be a useful chemical starting point to identify novel modulators of other TRP family channels. PMID:26098886
Peluso, John J; Romak, Jonathan; Liu, Xiufang
2008-02-01
Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.
Kaluarachchi, Harini; Altenstein, Matthias; Sugumar, Sonia R; Balbach, Jochen; Zamble, Deborah B; Haupt, Caroline
2012-03-16
SlyD (sensitive to lysis D) is a nickel metallochaperone involved in the maturation of [NiFe]-hydrogenases in Escherichia coli (E. coli) and specifically contributes to the nickel delivery step during enzyme biosynthesis. This protein contains a C-terminal metal-binding domain that is rich in potential metal-binding residues that enable SlyD to bind multiple nickel ions with high affinity. The SlyD homolog from Thermus thermophilus does not contain the extended cysteine- and histidine-rich C-terminal tail of the E. coli protein, yet it binds a single Ni(II) ion tightly. To investigate whether a single metal-binding motif can functionally replace the full-length domain, we generated a truncation of E. coli SlyD, SlyD155. Ni(II) binding to SlyD155 was investigated by using isothermal titration calorimetry, NMR and electrospray ionization mass spectrometry measurements. This in vitro characterization revealed that SlyD155 contains a single metal-binding motif with high affinity for nickel. Structural characterization by X-ray absorption spectroscopy and NMR indicated that nickel was coordinated in an octahedral geometry with at least two histidines as ligands. Heterodimerization between SlyD and another hydrogenase accessory protein, HypB, is essential for optimal hydrogenase maturation and was confirmed for SlyD155 via cross-linking experiments and NMR titrations, as were conserved chaperone and peptidyl-prolyl isomerase activities. Although these properties of SlyD are preserved in the truncated version, it does not modulate nickel binding to HypB in vitro or contribute to the maturation of [NiFe]-hydrogenases in vivo, unlike the full-length protein. This study highlights the importance of the unusual metal-binding domain of E. coli SlyD in hydrogenase biogenesis. Copyright © 2012 Elsevier Ltd. All rights reserved.
Martínez-González, Eduardo; Frontana, Carlos
2014-05-07
In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.
Free energy of solvated salt bridges: a simulation and experimental study.
White, Andrew D; Keefe, Andrew J; Ella-Menye, Jean-Rene; Nowinski, Ann K; Shao, Qing; Pfaendtner, Jim; Jiang, Shaoyi
2013-06-20
Charged amino acids are the most common on surfaces of proteins and understanding the interactions between these charged amino acids, salt bridging, is crucial for understanding protein-protein interactions. Previous simulations have been limited to implicit solvent or fixed binding geometry due to the sampling required for converged free energies. Using well-tempered metadynamics, we have calculated salt bridge free energy surfaces in water and confirmed the results with NMR experiments. The simulations give binding free energies, quantitative ranking of salt bridging strength, and insights into the hydration of the salt bridges. The arginine-aspartate salt bridge was found to be the weakest and arginine-glutamate the strongest, showing that arginine can discriminate between aspartate and glutamate, whereas the salt bridges with lysine are indistinguishable in their free energy. The salt bridging hydration is found to be complementary to salt bridge orientation with arginine having specific orientations.
NASA Astrophysics Data System (ADS)
Ikhlas, Shoeb; Ahmad, Masood
2018-02-01
Guggulsterone, a sterol found in plants is used as an ayurvedic medicine for many diseases such as obesity, internal tumors, ulcers etc. E and Z are two isoforms of guggulsterone, wherein guggulsterone-E (GUGE) has also been shown to have anticancer potential. Most of the anticancer drugs target nucleic acids. Therefore, we studied the mode of interaction between ctDNA and GUGE using UV-Vis, fluorescence and CD spectroscopy, isothermal calorimetry along with molecular docking studies. Hoechst 3325, ethidium bromide and rhodamine-B displacement experiments confirms that GUGE binds in the minor groove of DNA. ITC results further suggest these interactions to be feasible and spontaneous with hydrogen bond formation and van der waals interactions. Lastly, molecular docking also suggests GUGE to be a minor groove binder interacting through a single hydrogen bond formation between OH group of GUGE and nitrogen (N3) of adenosine (A6).
Identification of a Cholesterol-Binding Pocket in Inward Rectifier K+ (Kir) Channels
Fürst, Oliver; Nichols, Colin G.; Lamoureux, Guillaume; D’Avanzo, Nazzareno
2014-01-01
Cholesterol is the major sterol component of all mammalian plasma membranes. Recent studies have shown that cholesterol inhibits both bacterial (KirBac1.1 and KirBac3.1) and eukaryotic (Kir2.1) inward rectifier K+ (Kir) channels. Lipid-sterol interactions are not enantioselective, and the enantiomer of cholesterol (ent-cholesterol) does not inhibit Kir channel activity, suggesting that inhibition results from direct enantiospecific binding to the channel, and not indirect effects of changes to the bilayer. Furthermore, conservation of the effect of cholesterol among prokaryotic and eukaryotic Kir channels suggests an evolutionary conserved cholesterol-binding pocket, which we aimed to identify. Computational experiments were performed by docking cholesterol to the atomic structures of Kir2.2 (PDB: 3SPI) and KirBac1.1 (PDB: 2WLL) using Autodock 4.2. Poses were assessed to ensure biologically relevant orientation and then clustered according to location and orientation. The stability of cholesterol in each of these poses was then confirmed by molecular dynamics simulations. Finally, mutation of key residues (S95H and I171L) in this putative binding pocket found within the transmembrane domain of Kir2.1 channels were shown to lead to a loss of inhibition by cholesterol. Together, these data provide support for this location as a biologically relevant pocket. PMID:25517146
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larson, Matthew R.; Rajashankar, Kanagalaghatta R.; Crowley, Paula J.
2012-05-29
The Streptococcus mutans antigen I/II (AgI/II) is a cell surface-localized protein that adheres to salivary components and extracellular matrix molecules. Here we report the 2.5 {angstrom} resolution crystal structure of the complete C-terminal region of AgI/II. The C-terminal region is comprised of three major domains: C{sub 1}, C{sub 2}, and C{sub 3}. Each domain adopts a DE-variant IgG fold, with two {beta}-sheets whose A and F strands are linked through an intramolecular isopeptide bond. The adherence of the C-terminal AgI/II fragments to the putative tooth surface receptor salivary agglutinin (SAG), as monitored by surface plasmon resonance, indicated that the minimalmore » region of binding was contained within the first and second DE-variant-IgG domains (C{sub 1} and C{sub 2}) of the C terminus. The minimal C-terminal region that could inhibit S. mutans adherence to SAG was also confirmed to be within the C{sub 1} and C{sub 2} domains. Competition experiments demonstrated that the C- and N-terminal regions of AgI/II adhere to distinct sites on SAG. A cleft formed at the intersection between these C{sub 1} and C{sub 2} domains bound glucose molecules from the cryo-protectant solution, revealing a putative binding site for its highly glycosylated receptor SAG. Finally, electron microscopy images confirmed the elongated structure of AgI/II and enabled building a composite tertiary model that encompasses its two distinct binding regions.« less
Sankaran, Shrikrishnan; Kiren, Mustafa Can; Jonkheijm, Pascal
2015-01-01
Supramolecular assemblies, formed through noncovalent interactions, has become particularly attractive to develop dynamic and responsive architectures to address living systems at the nanoscale. Cucurbit[8]uril (CB[8]), a pumpkin shaped macrocylic host molecule, has been successfully used to construct various self-assembled architectures for biomedical applications since it can simultaneously bind two aromatic guest molecules within its cavity. Such architectures can also be designed to respond to external stimuli. Integrating living organisms as an active component into such supramolecular architectures would add a new dimension to the capabilities of such systems. To achieve this, we have incorporated supramolecular functionality at the bacterial surface by genetically modifying a transmembrane protein to display a CB[8]-binding motif as part of a cystine-stabilized miniprotein. We were able to confirm that this supramolecular motif on the bacterial surface specifically binds CB[8] and forms multiple intercellular ternary complexes leading to aggregation of the bacterial solution. We performed various aggregation experiments to understand how CB[8] interacts with this bacterial strain and also demonstrate that it can be chemically reversed using a competitor. To confirm that this strain can be incorporated with a CB[8] based architecture, we show that the bacterial cells were able to adhere to CB[8] self-assembled monolayers (SAMs) on gold and still retain considerable motility for several hours, indicating that the system can potentially be used to develop supramolecular bacterial biomotors. The bacterial strain also has the potential to be combined with other CB[8] based architectures like nanoparticles, vesicles and hydrogels.
ING2 is upregulated in colon cancer and increases invasion by enhanced MMP13 expression
Kumamoto, Kensuke; Fujita, Kaori; Kurotani, Reiko; Saito, Motonobu; Unoki, Motoko; Hagiwara, Nobutoshi; Shiga, Hideaki; Bowman, Elise D.; Yanaihara, Nozomu; Okamura, Shu; Nagashima, Makoto; Miyamoto, Kotaro; Takenoshita, Seiichi; Yokota, Jun; Harris, Curtis C.
2009-01-01
Inhibitor of growth 2 (ING2) is associated with chromatin remodeling and regulation of gene expression by binding to a methylated histone H3K4 residue and recruiting HDAC complexes to the region. The aim of our study is to investigate the regulation of ING2 expression and the clinical significance of upregulated ING2 in colon cancer. Here, we show that the ING2 mRNA level in colon cancer tissue increased to more than twice than that in normal mucosa in the 45% of colorectal cancer cases that we examined. A putative NF-κB binding site was found in the ING2 promoter region. We confirmed that NF-κB could bind to the ING2 promoter by EMSA and luciferase assays. Subsequent microarray analyses revealed that ING2 upregulates expression of matrix metalloproteinase 13 (MMP13), which enhances cancer invasion and metastasis. ING2 regulation of MMP13 expression was confirmed in both ING2 overexpression and knock down experiments. MMP13 expression was further induced by coexpression of ING2 with HDAC1 or with mSin3A, suggesting that the ING2-HDAC1-mSin3A complex members regulates expression of MMP13. In vitro invasion assay was performed to determine functional significance of ING2 upregulation. ING2 overexpressed cells exhibited greater invasive potential. Taken together, upregulation of ING2 was associated with colon cancer and MMP13-dependent cellular invasion, indicating that ING2 expression might be involved with cancer invasion and metastasis. PMID:19437536
Ncube, Somandla; Kunene, Phumlile; Tavengwa, Nikita T; Tutu, Hlanganani; Richards, Heidi; Cukrowska, Ewa; Chimuka, Luke
2017-09-01
A smart sorbent consisting of benzo[k]fluoranthene-imprinted and indeno[1 2 3-cd]pyrene-imprinted polymers mixed at 1:1 (w/w) was successfully screened from several cavity-tuning experiments and used in the isolation of polycyclic aromatic hydrocarbons from spiked solution. The polymer mixture showed high cross selectivity and affinity towards all the 16 US-EPA priority polycyclic aromatic hydrocarbons. The average extraction efficiency from a cyclohexane solution was 65 ± 13.3% (n = 16, SD). Batch adsorption and kinetic studies confirmed that the binding of polycyclic aromatic hydrocarbons onto the polymer particles resulted in formation of a monolayer and that the binding process was the rate limiting step. The imprinted polymer performance studies confirmed that the synthesized polymer had an imprinting efficiency of 103.9 ± 3.91% (n = 3, SD). A comparison of the theoretical number of cavities and the experimental binding capacity showed that the overall extent of occupation of the imprinted cavities in the presence of excess polycyclic aromatic hydrocarbons was 128 ± 6.45% (n = 3, SD). The loss of selectivity was estimated at 2.9% with every elution cycle indicating that the polymer can be re-used several times with limited loss of selectivity and sensitivity. The polymer combination has shown to be an effective adsorbent that can be used to isolate all the 16 US-EPA priority polycyclic aromatic hydrocarbons in solution. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yi, Shengze; Sun, Yuanyuan; Hu, Xin; Xu, Hongxia; Gao, Bin; Wu, Jichun
2017-01-14
The adsorption removal of levofloxacin (LEV), a widely used fluoroquinolone antibiotic, by using the biochars derived from the pyrolysis of pine wood chip pretreated with cerium trichloride was investigated through batch sorption experiments and multiple characterization techniques. The differences in the basic physicochemical properties between Ce-impregnated biochars and the pristine biochars were confirmed by the analysis of elemental compositions, specific surface areas, energy dispersive spectrometry, X-ray diffraction, and thermo-gravimetry. FT-IR spectra of the pre- and post-sorption biochars confirmed the chemical adsorption for LEV sorption onto the biochars. Large shifts in the binding energy of Ce 3d , O 1s , C 1s , and N 1s regions on the pre- and post-sorption biochars indicated the surface complexation of LEV molecule onto the biochars. The binding species of Ce 4+ and Ce 3+ identified by X-ray photoelectron spectroscopy reflect the role of Ce oxides during sorption. Batch adsorption showed the significant enhancement of adsorption capacity for LEV after the Ce modification. Batch adsorption kinetic data fitted well with the pseudo-second-order model. Both the Langmuir and the Freundlich models reproduced the isotherm data well. Findings from this work indicated that Ce-impregnated biochars can be effective for the removal of aqueous LEV.
An immunoblotting analysis of cross-reactivity between melon, and plantago and grass pollens.
García Ortiz, J C; Ventas, P; Cosmes, P; López-Asunsolo, A
1996-01-01
It is known that most patients with type I allergy to pollens also suffer intolerance to fruits. Recently, an epidemiological and CAP-inhibition study has shown a new clustering of allergy between melon and Plantago and grass pollens. The aim of the present study was to confirm these results by immunoblotting analysis and inhibition of immunoblotting. Sera from 3 patients with confirmed allergy to melon, and Dactylis glomerata and Plantago lanceolata pollens were used for the in vitro studies. SDS-PAGE and immunoblotting analysis with a pool of sera revealed that several distinct protein bands were shared by the three extracts at 14, 31, and a spectrum between 40 and 70 kDa, approximately. Immunoblotting inhibition experiments, performed with extracts of melon, Plantago and Dactylis, showed that all allergens of melon blotting were almost completely inhibited by grass and Plantago pollen extracts. Inversely, the melon extract was capable of inhibiting IgE-binding to various allergens of Dactylis at high mol mass and partially to the band at 14 kDa. Moreover, the melon almost totally inhibited the IgE-binding capacity to the proteins of Plantago extract. Taken together, the results support the presence of structurally similar allergens in melon, Plantago and grass pollens, and that all allergenic epitopes of the melon are present in these pollens.
Object-based attention underlies the rehearsal of feature binding in visual working memory.
Shen, Mowei; Huang, Xiang; Gao, Zaifeng
2015-04-01
Feature binding is a core concept in many research fields, including the study of working memory (WM). Over the past decade, it has been debated whether keeping the feature binding in visual WM consumes more visual attention than the constituent single features. Previous studies have only explored the contribution of domain-general attention or space-based attention in the binding process; no study so far has explored the role of object-based attention in retaining binding in visual WM. We hypothesized that object-based attention underlay the mechanism of rehearsing feature binding in visual WM. Therefore, during the maintenance phase of a visual WM task, we inserted a secondary mental rotation (Experiments 1-3), transparent motion (Experiment 4), or an object-based feature report task (Experiment 5) to consume the object-based attention available for binding. In line with the prediction of the object-based attention hypothesis, Experiments 1-5 revealed a more significant impairment for binding than for constituent single features. However, this selective binding impairment was not observed when inserting a space-based visual search task (Experiment 6). We conclude that object-based attention underlies the rehearsal of binding representation in visual WM. (c) 2015 APA, all rights reserved.
Johnson, Kenneth A.; Ve, Thomas; Larsen, Øivind; Pedersen, Rolf B.; Lillehaug, Johan R.; Jensen, Harald B.; Helland, Ronny; Karlsen, Odd A.
2014-01-01
CorA is a copper repressible protein previously identified in the methanotrophic bacterium Methylomicrobium album BG8. In this work, we demonstrate that CorA is located on the cell surface and binds one copper ion per protein molecule, which, based on X-ray Absorption Near Edge Structure analysis, is in the reduced state (Cu(I)). The structure of endogenously expressed CorA was solved using X-ray crystallography. The 1.6 Å three-dimensional structure confirmed the binding of copper and revealed that the copper atom was coordinated in a mononuclear binding site defined by two histidines, one water molecule, and the tryptophan metabolite, kynurenine. This arrangement of the copper-binding site is similar to that of its homologous protein MopE* from Metylococcus capsulatus Bath, confirming the importance of kynurenine for copper binding in these proteins. Our findings show that CorA has an overall fold similar to MopE, including the unique copper(I)-binding site and most of the secondary structure elements. We suggest that CorA plays a role in the M. album BG8 copper acquisition. PMID:24498370
Bozzi, Manuela; Bianchi, Marzia; Sciandra, Francesca; Paci, Maurizio; Giardina, Bruno; Brancaccio, Andrea; Cicero, Daniel O
2003-11-25
Dystroglycan (DG) is an adhesion molecule playing a crucial role for tissue stability during both early embriogenesis and adulthood and is composed by two tightly interacting subunits: alpha-DG, membrane-associated and highly glycosylated, and the transmembrane beta-DG. Recently, by solid-phase binding assays and NMR experiments, we have shown that the C-terminal domain of alpha-DG interacts with a recombinant extracellular fragment of beta-DG (positions 654-750) independently from glycosylation and that the linear binding epitope is located between residues 550 and 565 of alpha-DG. In order to elucidate which moieties of beta-DG are specifically involved in the complex with alpha-DG, the ectodomain has been recombinantly expressed and purified in a labeled ((13)C,(15)N) form and studied by multidimensional NMR. Although it represents a natively unfolded protein domain, we obtained an almost complete backbone assignment. Chemical shift index, (1)H-(15)N heteronuclear single-quantum coherence and nuclear Overhauser effect (HSQC-NOESY) spectra and (3)J(HN,H)(alpha) coupling constant values confirm that this protein is highly disordered, but (1)H-(15)N steady-state NOE experiments indicate that the protein presents two regions of different mobility. The first one, between residues 659 and 722, is characterized by a limited degree of mobility, whereas the C-terminal portion, containing about 30 amino acids, is highly flexible. The binding of beta-DG(654-750) to the C-terminal region of the alpha subunit, alpha-DG(485-620), has been investigated, showing that the region of beta-DG(654-750) between residues 691 and 719 is involved in the interaction.
Enantioselective complexation of chiral propylene oxide by an enantiopure water-soluble cryptophane.
Bouchet, Aude; Brotin, Thierry; Linares, Mathieu; Ågren, Hans; Cavagnat, Dominique; Buffeteau, Thierry
2011-05-20
ECD and NMR experiments show that the complexation of propylene oxide (PrO) within the cavity of an enantiopure water-soluble cryptophane 1 in NaOH solution is enantioselective and that the (R)-PrO@PP-1 diastereomer is more stable than the (S)-PrO@PP-1 diastereomer with a free energy difference of 1.7 kJ/mol. This result has been confirmed by molecular dynamics (MD) and ab initio calculations. The enantioselectivity is preserved in LiOH and KOH solutions even though the binding constants decrease, whereas PrO is not complexed in CsOH solution.
Bindings in working memory: The role of object-based attention.
Gao, Zaifeng; Wu, Fan; Qiu, Fangfang; He, Kaifeng; Yang, Yue; Shen, Mowei
2017-02-01
Over the past decade, it has been debated whether retaining bindings in working memory (WM) requires more attention than retaining constituent features, focusing on domain-general attention and space-based attention. Recently, we proposed that retaining bindings in WM needs more object-based attention than retaining constituent features (Shen, Huang, & Gao, 2015, Journal of Experimental Psychology: Human Perception and Performance, doi: 10.1037/xhp0000018 ). However, only unitized visual bindings were examined; to establish the role of object-based attention in retaining bindings in WM, more emperical evidence is required. We tested 4 new bindings that had been suggested requiring no more attention than the constituent features in the WM maintenance phase: The two constituent features of binding were stored in different WM modules (cross-module binding, Experiment 1), from auditory and visual modalities (cross-modal binding, Experiment 2), or temporally (cross-time binding, Experiments 3) or spatially (cross-space binding, Experiments 4-6) separated. In the critical condition, we added a secondary object feature-report task during the delay interval of the change-detection task, such that the secondary task competed for object-based attention with the to-be-memorized stimuli. If more object-based attention is required for retaining bindings than for retaining constituent features, the secondary task should impair the binding performance to a larger degree relative to the performance of constituent features. Indeed, Experiments 1-6 consistently revealed a significantly larger impairment for bindings than for the constituent features, suggesting that object-based attention plays a pivotal role in retaining bindings in WM.
Role of GABA-active neurosteroids in the efficacy of metyrapone against cocaine addiction.
Schmoutz, Christopher D; Guerin, Glenn F; Goeders, Nicholas E
2014-09-01
Previous research has demonstrated a complicated role for stress and HPA axis activation in potentiating various cocaine-related behaviors in preclinical models of drug dependence. However, the investigation of several antiglucocorticoid therapies has yielded equivocal results in reducing cocaine-related behaviors, possibly because of varying mechanisms of actions. Specifically, research suggests that metyrapone (a corticosterone synthesis inhibitor) may reduce cocaine self-administration in rats via a nongenomic, extra-adrenal mechanism without altering plasma corticosterone. In the current experiments, male rats were trained to self-administer cocaine infusions and food pellets in a multiple, alternating schedule of reinforcement. Metyrapone pretreatment dose-dependently decreased cocaine self-administration as demonstrated previously. Pharmacological inhibition of neurosteroid production by finasteride had significant effects on cocaine self-administration, regardless of metyrapone pretreatment. However, metyrapone's effects on cocaine self-administration were significantly attenuated with bicuculline pretreatment, suggesting a role for GABA-active neurosteroids in cocaine-reinforced behaviors. In vitro binding data also confirmed that metyrapone does not selectively bind to GABA-related proteins. The results of these experiments support the hypothesis that metyrapone may increase neurosteroidogenesis to produce effects on cocaine-related behaviors. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong
2016-04-01
Thrombin-binding aptamer (TBA) with the sequence 5‧GGTTGGTGTGGTTGG3‧ could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.
Goffin, Eric; Drapier, Thomas; Larsen, Anja Probst; Geubelle, Pierre; Ptak, Christopher P; Laulumaa, Saara; Rovinskaja, Karoline; Gilissen, Julie; Tullio, Pascal de; Olsen, Lars; Frydenvang, Karla; Pirotte, Bernard; Hanson, Julien; Oswald, Robert E; Kastrup, Jette Sandholm; Francotte, Pierre
2018-01-11
We report here the synthesis of 7-phenoxy-substituted 3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxides and their evaluation as AMPA receptor positive allosteric modulators (AMPApams). The impact of substitution on the phenoxy ring and on the nitrogen atom at the 4-position was examined. At GluA2(Q) expressed in HEK293 cells (calcium flux experiment), the most potent compound was 11m (4-cyclopropyl-7-(3-methoxyphenoxy)-3,4-dihydro-2H-1,2,4-benzothiadiazine 1,1-dioxide, EC 50 = 2.0 nM). The Hill coefficient in the screening and the shape of the dimerization curve in small-angle X-ray scattering (SAXS) experiments using isolated GluA2 ligand-binding domain (GluA2-LBD) are consistent with binding of one molecule of 11m per dimer interface, contrary to most benzothiadiazine dioxides developed to date. This observation was confirmed by the X-ray structure of 11m bound to GluA2-LBD and by NMR. This is the first benzothiadiazine dioxide AMPApam to reach the nanomolar range.
Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A
2016-07-15
Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.
Identification of key residues involved in adrenomedullin binding to the AM1 receptor
Watkins, HA; Au, M; Bobby, R; Archbold, JK; Abdul-Manan, N; Moore, JM; Middleditch, MJ; Williams, GM; Brimble, MA; Dingley, AJ; Hay, DL
2013-01-01
Background and Purpose Adrenomedullin (AM) is a peptide hormone whose receptors are members of the class B GPCR family. They comprise a heteromer between the GPCR, the calcitonin receptor-like receptor and one of the receptor activity-modifying proteins 1–3. AM plays a significant role in angiogenesis and its antagonist fragment AM22–52 can inhibit blood vessel and tumour growth. The mechanism by which AM interacts with its receptors is unknown. Experimental Approach We determined the AM22–52 binding epitope for the AM1 receptor extracellular domain using biophysical techniques, heteronuclear magnetic resonance spectroscopy and alanine scanning. Key Results Chemical shift perturbation experiments located the main binding epitope for AM22–52 at the AM1 receptor to the C-terminal 8 amino acids. Isothermal titration calorimetry of AM22–52 alanine-substituted peptides indicated that Y52, G51 and I47 are essential for AM1 receptor binding and that K46 and P49 and R44 have a smaller role to play. Characterization of these peptides at the full-length AM receptors was assessed in Cos7 cells by cAMP assay. This confirmed the essential role of Y52, G51 and I47 in binding to the AM1 receptor, with their substitution resulting in ≥100-fold reduction in antagonist potency compared with AM22–52. R44A, K46A, S48A and P49A AM22–52 decreased antagonist potency by approximately 10-fold. Conclusions and Implications This study localizes the main binding epitope of AM22–52 to its C-terminal amino acids and distinguishes essential residues involved in this binding. This will inform the development of improved AM receptor antagonists. PMID:23351143
Yuan, Ji; Chow, Dar-Chone; Huang, Wanzhi; Palzkill, Timothy
2011-01-01
The β-lactamase inhibitory protein (BLIP) binds and inhibits a diverse collection of class A β-lactamases. Widespread resistance to β-lactam antibiotics currently limits treatment strategies for Staphylococcus infections. The goal of this study was to determine the binding affinity of BLIP for S. aureus PC1 β-lactamase and to identify mutants that alter binding affinity. The BLIP inhibition constant (Ki) for the PC1 β-lactamase was measured at 350 nM and isothermal titration calorimetry (ITC) experiments indicated a binding constant (Kd) of 380 nM. A total of 23 residue positions in BLIP that contact β-lactamase were randomized and phage display was used to sort the libraries for tight binders to immobilized PC1 β-lactamase. The BLIP K74G mutant was the dominant clone selected and it was found to inhibit the PC1 β-lactamase with a Ki of 42 nM while calorimetry indicated a Kd of 26 nM. Molecular modeling studies suggested BLIP binds weakly to the PC1 β-lactamase due to the presence of alanine at position 104 of PC1. This position is occupied by glutamate in the TEM-1 enzyme where it forms a salt bridge with BLIP residue Lys74 that is important for the stability of the complex. This hypothesis was confirmed by showing that the A104E PC1 enzyme binds BLIP with 15-fold greater affinity than wild type PC1 β-lactamase. Kinetic measurements indicated similar association rates for all complexes with the variation in affinity due to altered dissociation rate constants suggesting changes in short-range interactions are responsible for the altered binding properties of the mutants. PMID:21238457
Annexin A5 Binds to Lipopolysaccharide and Reduces Its Endotoxin Activity
Rand, Jacob H.; Wu, Xiao-Xuan; Lin, Elaine Y.; Griffel, Alexander; Gialanella, Philip; McKitrick, John C.
2012-01-01
ABSTRACT Annexin A5 (AnxA5) has a high affinity for phosphatidylserine. The protein is widely used to detect apoptotic cells because phosphatidylserine, a phospholipid that is normally present in the inner leaflets of cytoplasmic membranes, becomes translocated to the outer leaflets during programmed cell death. Here we report the novel observation that AnxA5 binds to Gram-negative bacteria via the lipid A domain of lipopolysaccharide (LPS). Binding of AnxA5 to bacteria was measured quantitatively, confirmed by fluorescence microscopy, and found to be inhibited by antibodies against lipid A. AnxA5 also bound to purified dot-blotted LPS and lipid A. Through ellipsometry, we found that the binding of AnxA5 to purified LPS was calcium dependent and rapid and showed a high affinity—characteristics similar to those of AnxA5 binding to phosphatidylserine. Initial functional studies indicated that AnxA5 can affect LPS activities. AnxA5 inhibited LPS-mediated gelation in the Limulus amebocyte lysate assay. Incubation of LPS with the protein reduced the quantity of tumor necrosis factor alpha (TNF-α) released by cultured monocytes compared to that released upon incubation with LPS alone. Initial in vivo experiments indicated that injection of mice with LPS preincubated with AnxA5 produced serum TNF-α levels lower than those seen after injection of LPS alone. These data demonstrate that AnxA5 binds to LPS and open paths to investigation of the potential biological and therapeutic implications of this interaction. PMID:22415004
Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi
2016-11-01
The binding interaction between a typical angiotensin-converting enzyme inhibitor (ACEI), ramipril, and a transport protein, bovine serum albumin (BSA), was studied in vitro using UV-vis absorption spectroscopy, steady-state fluorescence spectroscopic titration, synchronous fluorescence spectroscopy, three dimensional fluorescence spectroscopy, circular dichroism and molecular docking under the imitated physiological conditions (pH=7.4). The experimental results suggested that the intrinsic fluorescence of BSA was quenched by ramipril thought a static quenching mechanism, indicating that the stable ramipril-BSA complex was formed by the intermolecular interaction. The number of binding sites (n) and binding constant of ramipril-BSA complex were about 1 and 3.50×10 4 M -1 at 298K, respectively, suggesting that there was stronger binding interaction of ramipril with BSA. The thermodynamic parameters together with molecular docking study revealed that both van der Waal's forces and hydrogen bonding interaction dominated the formation of the ramipril-BSA complex and the binding interaction of BSA with ramipril is enthalpy-driven processes due to |ΔH°|>|TΔS°| and ΔG°<0. The spatial distance between ramipril and BSA was calculated to be 3.56nm based on Förster's non-radiative energy transfer theory. The results of the competitive displacement experiments and molecular docking confirmed that ramipril inserted into the subdomain IIA (site I) of BSA, resulting in a slight change in the conformation of BSA but BSA still retained its secondary structure α-helicity. Copyright © 2016 Elsevier B.V. All rights reserved.
Wang, Qin; Wei, Yang; Mottamal, Madhusoodanan; Roberts, Mary F.; Krilov, Goran
2011-01-01
PTEN is an important control element of PI3K/AKT signaling involved in controlling the processes of embryonic development, cell migration and apoptosis. While its dysfunction is implicated in a large fraction of cancers, PTEN activity in the same pathway may also contribute to metabolic syndromes such as diabetes. In those cases, selective inhibitors of PTEN may be useful. A new class of chiral PTEN inhibitors based on the 3-deoxy-phosphatidylinositol derivatives was recently identified [Wang et al. (2008) J. Am. Chem. Soc. 130, 7746]. However, lack of detailed understanding of protein-ligand interactions has hampered efforts to develop effective agonists or antagonists of PTEN. Here, we use computational modeling to characterize the interactions of the diverse 3-deoxyphosphatidylinositol inhibitors with the PTEN protein. We show that, while each of the compounds binds with the inositol headgroup inserting into the proposed active site of the PTEN phosphatase domain, hydrogen bonding restrictions lead to distinct binding geometries for ligand pairs of opposite chirality. We furthermore demonstrate that the binding modes differ primarily in the orientation of acyl tails of the ligands and that the activity of the compounds is primarily controlled by the effectiveness of tail-protein contacts. These findings are confirmed by binding affinity calculations which are in good agreement with experiment. Finally, we show that while more potent D-series ligands bind in a manner similar to that of the native substrate, an alternate hydrophobic pocket suitable for binding the opposite chirality L-series inhibitors exists, offering the possibility of designing highly selective PTEN- targeting compounds. PMID:20538496
Photoaffinity Labeling Studies on a Promoter of Dendritic Spine Formation
NASA Astrophysics Data System (ADS)
Sibucao, Kevin Carlo Abril
The small molecule BTA-EG4 has been shown to be a promoter of dendritic spine formation. The mechanism behind this phenomenon, however, is not well understood. The work in this dissertation is motivated by this gap in knowledge. The first part of this dissertation focuses on photoaffinity labeling studies to identify the cellular targets of BTA-EG4. Chapter 1 provides a summary of Alzheimer's disease, the rational design of BTA-EG 4, and methods to determine targets of small molecules. In Chapter 2, the synthesis of a BTA-EG4-based photoaffinity labeling probe and photodegradation studies are presented. Kinetic studies demonstrate that the probe photolyzes rapidly under UV light. In Chapter 3, photoaffinity labeling studies and subsequent protein identification experiments are reported. Competition experiments with the photoaffinity labeling probe and BTA-EG4 demonstrate that the probe labels a 55-kDa protein specifically. Tandem mass spectrometry revealed that the 55-kDa protein is the actin binding protein fascin 1. The second part of this dissertation focuses on the major protein identified from photoaffinity labeling studies, fascin 1. Chapter 4 provides a brief survey of the structure and function of fascin 1. In Chapter 5, characterizations of the interaction between BTA-EG4 and fascin 1 are reported. Isothermal titration calorimetry confirms the physical binding between fascin 1 and BTA-EG6, a BTA-EG4 analog. Slow speed sedimentation assays reveal that BTA-EG4 does not affect the actin-bundling activity of fascin 1. However, GST pull-down experiments show that BTA-EG4 inhibits the binding of fascin 1 with the GTPase Rab35. In addition, this work demonstrates that BTA-EG4 may be mechanistically distinct from the known fascin inhibitor G2.
Surface expression and CEA binding of hnRNP M4 protein in HT29 colon cancer cells.
Laguinge, Luciana; Bajenova, Olga; Bowden, Emma; Sayyah, Jacqueline; Thomas, Peter; Juhl, Hartmut
2005-01-01
Carcinoembryonic antigen (CEA) has been shown to participate in the progression and metastatic growth of colorectal cancer. However, its biological function remains elusive. Recently, we found that CEA protects colon cancer cells from undergoing apoptosis, suggesting a complex role that includes signal transduction activity. Additionally, it was reported that CEA binds to Kupffer cells and macrophages to a membrane-anchored homolog of heterogeneous nuclear protein M4 (hnRNP M4), which subsequently was named CEA-receptor (CEAR). Cytoplasmatic and membranous expression of CEAR in CEA-positive colon cancer tissues prompted us to analyze the CEA-CEAR interaction in HT29 colon cancer cells. Both, CEA and CEAR were found on the cell surface of HT29 cells, as demonstrated by confocal microscopy. Imaging analysis suggested co-localization and, thus, interaction of both molecules. To confirm this observation, immunoprecipitation experiments and Western blot analysis were performed and indicated binding of CEA and CEAR. Immunoprecipitation of CEA resulted in a pull down of CEAR. The pull down of CEAR correlated with the amount of CEA as demonstrated by ribozyme targeting of CEA. Finally, external treatment of HT29 cells with soluble CEA induced tyrosine phosphorylation of CEAR, suggesting a CEA-dependent role of CEAR in signal transduction. Future experiments will elucidate whether the CEA-CEAR interaction is involved in CEA's antiapoptotic role and mediates the prometastatic properties of CEA in colon cancer cells.
Cloning of a heavy-metal-binding protein derived from activated-sludge microorganisms.
Sano, Daisuke; Myojo, Ken; Omura, Tatsuo
2006-09-01
A gene of the heavy-metal-binding protein (HMBP) was newly isolated from a genetic DNA library of activated-sludge microorganisms. HMBP was produced by transformed Escherichia coli, and the copper-binding ability of HMBP was confirmed. HMBP derived from activated sludge could be available as heavy metal adsorbents in water and wastewater treatments.
Korenjak, Michael; Kwon, Eunjeong; Morris, Robert T.; Anderssen, Endre; Amzallag, Arnaud; Ramaswamy, Sridhar; Dyson, Nicholas J.
2014-01-01
dREAM complexes represent the predominant form of E2F/RBF repressor complexes in Drosophila. dREAM associates with thousands of sites in the fly genome but its mechanism of action is unknown. To understand the genomic context in which dREAM acts we examined the distribution and localization of Drosophila E2F and dREAM proteins. Here we report a striking and unexpected overlap between dE2F2/dREAM sites and binding sites for the insulator-binding proteins CP190 and Beaf-32. Genetic assays show that these components functionally co-operate and chromatin immunoprecipitation experiments on mutant animals demonstrate that dE2F2 is important for association of CP190 with chromatin. dE2F2/dREAM binding sites are enriched at divergently transcribed genes, and the majority of genes upregulated by dE2F2 depletion represent the repressed half of a differentially expressed, divergently transcribed pair of genes. Analysis of mutant animals confirms that dREAM and CP190 are similarly required for transcriptional integrity at these gene pairs and suggest that dREAM functions in concert with CP190 to establish boundaries between repressed/activated genes. Consistent with the idea that dREAM co-operates with insulator-binding proteins, genomic regions bound by dREAM possess enhancer-blocking activity that depends on multiple dREAM components. These findings suggest that dREAM functions in the organization of transcriptional domains. PMID:25053843
NASA Astrophysics Data System (ADS)
Wang, Xiaoqiang; Chen, Han; Lu, Xinwei; Chi, Haixia; Li, Shixin; Huang, Fang
2018-04-01
Proper translocation, membrane insertion and folding are crucial biophysical steps in the biogenesis of functional transmembrane peptides/proteins (TMPs). ATP-dependent chaperonins are able to regulate each of these processes, but the underlying mechanisms remain unclear. In this work, interaction between the bacterial chaperonin GroEL and a synthetic fluorescent transmembrane peptide was investigated by fluorescence anisotropy. Binding of the peptide with GroEL resulted in increased fluorescence anisotropy and intensity. The dissociation constant and binding stoichiometry, as assessed by titration of the peptide with GroEL, were estimated to be 0.6 ± 0.2 μM and 2.96 ± 0.35, respectively. Complementary study with the single-ring version of GroEL confirmed the high-affinity peptide binding, and indicates that the two GroEL rings may function alternatively in binding the peptides. The co-chaperonin GroES was found to be effective at releasing the peptides initially bound to GroEL with the help of ATP. Moreover, our observation with the single-ring GroEL mutant demonstrated that during the encapsulation of GroEL by GroES, the bound peptides may either be confined in the cage thus formed, or escape outside. Competitive binding experiments indicated that the peptides studied interact with GroEL through the paired helices H and I on its apical domain. Our spectroscopic studies revealed some basic mechanisms of interaction between transmembrane peptides and GroEL, which would be instrumental for deciphering the chaperonin-mediated TMP biogenesis.
Identification of a unique IgG Fc binding site in human intestinal epithelium.
Kobayashi, K; Blaser, M J; Brown, W R
1989-10-15
In experiments to determine whether serum antibodies in patients with Crohn's disease could be used as probes for detecting potentially etiologic Ag in the patients' tissues, we found that peroxidase (HRP)-labeled IgG from healthy persons, as well as from the patients, bound to normal colonic and small intestinal epithelium, mostly or entirely to goblet cells. The binding was due to a reaction involving the Fc region of IgG because HRP-labeled Fc fragments of IgG bound, but HRP-Fab, HRP-IgA, and HRP-bovine albumin did not, and because binding of HRP-IgG was inhibited competitively by unlabeled IgG or Fc fragments but not by IgG Fab fragments or IgA. These immunohistochemical results were confirmed by ELISA with microtiter wells coated with a sonicated homogenate from human colonocytes. The epithelial IgG Fc binding site was characterized by SDS-PAGE as consisting of a high Mr (greater than 200,000 Da) and a 78,000-Da component. It bound all four subclasses of human IgG and bound aggregated as well as monomeric IgG. It is distinct from known human Fc-gamma R by lack of recognition by mAb to those receptors and differences in affinity for various subclasses of human and murine IgG. This unique IgG Fc binding site might be involved in immunologic defense of the gut, perhaps by mediating reactions between foreign Ag and the contents of goblet cells.
Shenkarev, Zakhar O; Melnikova, Daria N; Finkina, Ekaterina I; Sukhanov, Stanislav V; Boldyrev, Ivan A; Gizatullina, Albina K; Mineev, Konstantin S; Arseniev, Alexander S; Ovchinnikova, Tatiana V
2017-03-28
The lentil lipid transfer protein, designated as Lc-LTP2, was isolated from Lens culinaris seeds. The protein belongs to the LTP1 subfamily and consists of 93 amino acid residues. Its spatial structure includes four α-helices (H1-H4) and a long C-terminal tail. Here, we report the ligand binding properties of Lc-LTP2. The fluorescent 2-p-toluidinonaphthalene-6-sulfonate binding assay revealed that the affinity of Lc-LTP2 for saturated and unsaturated fatty acids was enhanced with a decrease in acyl-chain length. Measurements of boundary potential in planar lipid bilayers and calcein dye leakage in vesicular systems revealed preferential interaction of Lc-LTP2 with the negatively charged membranes. Lc-LTP2 more efficiently transferred anionic dimyristoylphosphatidylglycerol (DMPG) than zwitterionic dimyristoylphosphatidylcholine. Nuclear magnetic resonance experiments confirmed the higher affinity of Lc-LTP2 for anionic lipids and those with smaller volumes of hydrophobic chains. The acyl chains of the bound lysopalmitoylphosphatidylglycerol (LPPG), DMPG, or dihexanoylphosphatidylcholine molecules occupied the internal hydrophobic cavity, while their headgroups protruded into the aqueous environment between helices H1 and H3. The spatial structure and backbone dynamics of the Lc-LTP2-LPPG complex were determined. The internal cavity was expanded from ∼600 to ∼1000 Å 3 upon the ligand binding. Another entrance into the internal cavity, restricted by the H2-H3 interhelical loop and C-terminal tail, appeared to be responsible for the attachment of Lc-LTP2 to the membrane or micelle surface and probably played an important role in the lipid uptake determining the ligand specificity. Our results confirmed the previous assumption regarding the membrane-mediated antimicrobial action of Lc-LTP2 and afforded molecular insight into its biological role in the plant.
Lessmann, Eva; Ngo, Mike; Leitges, Michael; Minguet, Susana; Ridgway, Neale D; Huber, Michael
2007-02-01
The oxysterol-binding protein and oxysterol-binding protein-related protein family has been implicated in lipid transport and metabolism, vesicle trafficking and cell signaling. While investigating the phosphorylation of Akt/protein kinase B in stimulated bone marrow-derived mast cells, we observed that a monoclonal antibody directed against phospho-S473 Akt cross-reacted with oxysterol-binding protein-related protein 9 (ORP9). Further analysis revealed that mast cells exclusively express ORP9S, an N-terminal truncated version of full-length ORP9L. A PDK-2 consensus phosphorylation site in ORP9L and OPR9S at S287 (VPEFS(287)Y) was confirmed by site-directed mutagenesis. In contrast to Akt, increased phosphorylation of ORP9S S287 in stimulated mast cells was independent of phosphatidylinositol 3-kinase but sensitive to inhibition of conventional PKC isotypes. PKC-beta dependence was confirmed by lack of ORP9S phosphorylation at S287 in PKC-beta-deficient, but not PKC-alpha-deficient, mast cells. Moreover, co-immunoprecipitation of PKC-beta and ORP9S, and in vitro phosphorylation of ORP9S in this complex, argued for direct phosphorylation of ORP9S by PKC-beta, introducing ORP9S as a novel PKC-beta substrate. Akt was also detected in a PKC-beta/ORP9S immune complex and phosphorylation of Akt on S473 was delayed in PKC-deficient mast cells. In HEK293 cells, RNAi experiments showed that depletion of ORP9L increased Akt S473 phosphorylation 3-fold without affecting T308 phosphorylation in the activation loop. Furthermore, mammalian target of rapamycin was implicated in ORP9L phosphorylation in HEK293 cells. These studies identify ORP9 as a PDK-2 substrate and negative regulator of Akt phosphorylation at the PDK-2 site.
Chinta, Gopichand; Ramya Chandar Charles, Mariasoosai; Klopčič, Ivana; Sollner Dolenc, Marija; Periyasamy, Latha; Selvaraj Coumar, Mohane
2015-07-01
Understanding the molecular mechanism of action of traditional medicines is an important step towards developing marketable drugs from them. Piperine, an active constituent present in the Piper species, is used extensively in Ayurvedic medicines (practiced on the Indian subcontinent). Among others, piperine is known to possess a male contraceptive effect; however, the molecular mechanism of action for this effect is not very clear. In this regard, detailed docking and molecular dynamics simulation studies of piperine with the androgen-binding protein and androgen receptors were carried out. Androgen receptors control male sexual behavior and fertility, while the androgen-binding protein binds testosterone and maintains its concentration at optimal levels to stimulate spermatogenesis in the testis. It was found that piperine docks to the androgen-binding protein, similar to dihydrotestosterone, and to androgen receptors, similar to cyproterone acetate (antagonist). Also, the piperine-androgen-binding protein and piperine-androgen receptors interactions were found to be stable throughout 30 ns of molecular dynamics simulation. Further, two independent simulations for 10 ns each also confirmed the stability of these interactions. Detailed analysis of the piperine-androgen-binding protein interactions shows that piperine interacts with Ser42 of the androgen-binding protein and could block the binding with its natural ligands dihydrotestosterone/testosterone. Moreover, piperine interacts with Thr577 of the androgen receptors in a manner similar to the antagonist cyproterone acetate. Based on the in silico results, piperine was tested in the MDA-kb2 cell line using the luciferase reporter gene assay and was found to antagonize the effect of dihydrotestosterone at nanomolar concentrations. Further detailed biochemical experiments could help to develop piperine as an effective male contraceptive agent in the future. Georg Thieme Verlag KG Stuttgart · New York.
Willjes, Gesche; Mahrhold, Stefan; Strotmeier, Jasmin; Eichner, Timo; Rummel, Andreas; Binz, Thomas
2013-06-04
Botulinum neurotoxins (BoNTs) block neurotransmitter release by proteolyzing SNARE proteins in peripheral nerve terminals. Entry into neurons occurs subsequent to interaction with gangliosides and a synaptic vesicle protein. Isoforms I and II of synaptotagmin were shown to act as protein receptors for two of the seven BoNT serotypes, BoNT/B and BoNT/G, and for mosaic-type BoNT/DC. BoNT/B and BoNT/G exhibit a homologous binding site for synaptotagmin whose interacting part adopts helical structure upon binding to BoNT/B. Whereas the BoNT/B-synaptotagmin-II interaction has been elucidated in molecular detail, corresponding information about BoNT/G is lacking. Here we systematically mutated the synaptotagmin binding site in BoNT/G and performed a comparative binding analysis with mutants of the cell binding subunit of BoNT/B. The results suggest that synaptotagmin takes the same overall orientation in BoNT/B and BoNT/G governed by the strictly conserved central parts of the toxins' binding site. The surrounding nonconserved areas differently contribute to receptor binding. Reciprocal mutations Y1186W and L1191Y increased the level of binding of BoNT/G approximately to the level of BoNT/B affinity, suggesting a similar synaptotagmin-bound state. The effects of the mutations were confirmed by studying the activity of correspondingly mutated full-length BoNTs. On the basis of these data, molecular modeling experiments were employed to reveal an atomistic model of BoNT/G-synaptotagmin recognition. These data suggest a reduced length and/or a bend in the C-terminal part of the synaptotagmin helix that forms upon contact with BoNT/G as compared with BoNT/B and are in agreement with the data of the mutational analyses.
Lectin binding assays for in-process monitoring of sialylation in protein production.
Xu, Weiduan; Chen, Jianmin; Yamasaki, Glenn; Murphy, John E; Mei, Baisong
2010-07-01
Many therapeutic proteins require appropriate glycosylation for their biological activities and plasma half life. Coagulation factor VIII (FVIII) is a glycoprotein which has extensive post-translational modification by N-linked glycosylation. The terminal sialic acid in the N-linked glycans of FVIII is required for maximal circulatory half life. The extent of FVIII sialylation can be determined by high pH anion-exchange chromatography coupled with a pulse electrochemical detector (HPAEC-PED), but this requires a large amount of purified protein. Using FVIII as a model, the objective of the present study was to develop assays that enable detection and prediction of sialylation deficiency at an early stage in the process and thus prevent downstream product quality excursions. Lectin ECA (Erythrina Cristagalli) binds to unsialylated Galbeta1-4 GlcNAc and the ECA-binding level (i.e., terminal Gal(beta1-4) exposure) is inversely proportional to the level of sialylation. By using ECA, a cell-based assay was developed to measure the global sialylation profile in FVIII producing cells. To examine the Galbeta1-4 exposure on the FVIII molecule in bioreactor tissue culture fluid (TCF), an ELISA-based ECA-FVIII binding assay was developed. The ECA-binding specificity in both assays was assessed by ECA-specific sugar inhibitors and neuraminidase digestion. The ECA-binding specificity was also independently confirmed by a ST3GAL4 siRNA knockdown experiment. To establish the correlation between Galbeta1-4 exposure and the HPAEC-PED determined FVIII sialylation value, the FVIII containing bioreactor TCF and the purified FVIII samples were tested with ECA ELISA binding assay. The results indicated an inverse correlation between ECA binding and the corresponding HPAEC-PED sialylation value. The ECA-binding assays are cost effective and can be rapidly performed, thereby making them effective for in-process monitoring of protein sialylation.
Macrophage activation by glycoprotein isolated from Dioscorea batatas
Huong, Pham Thi Thu
2011-01-01
We demonstrate that glycoprotein isolated from Dioscorea batatas (GDB) activates macrophage function. Analysis of the infiltration of macrophages into peritoneal cavity showed GDB treatment significantly increased the recruitment of macrophages into the peritoneal cavity. In order to further confirm and investigate the mechanism of GDB on macrophage activation, we analyzed the effects of GDB on the cytokine expression including IL-1β, TNF-α, and IL-6 in mouse peritoneal macrophages. GDB increased the expression of IL-1β, TNF-α, and IL-6. Cytokine induction by GDB was further confirmed by RT-PCR and ELISA in mouse macrophage cell line, RAW264.7 cells. Treatment of RAW264.7 cells with GDB produced strong induction of NF-κB DNA binding and MAPK phosphorylation, markers for macrophage activation and important factors for cytokine gene expression. Collectively, this series of experiments indicates that GDB stimulates macrophage activation. PMID:24278568
Rossi, Daniela; Bencini, Cristina; Maritati, Marina; Benini, Francesca; Lorenzini, Stefania; Pierantozzi, Enrico; Scarcella, Angela Maria; Paolini, Cecilia; Protasi, Feliciano; Sorrentino, Vincenzo
2014-03-01
Ca2+ release, which is necessary for muscle contraction, occurs at the j-SR (junctional domain of the sarcoplasmic reticulum). It requires the assembly of a large multiprotein complex containing the RyR (ryanodine receptor) and additional proteins, including triadin and calsequestrin. The signals which drive these proteins to the j-SR and how they assemble to form this multiprotein complex are poorly understood. To address aspects of these questions we studied the localization, dynamic properties and molecular interactions of triadin. We identified three regions, named TR1 (targeting region 1), TR2 and TR3, that contribute to the localization of triadin at the j-SR. FRAP experiments showed that triadin is stably associated with the j-SR and that this association is mediated by TR3. Protein pull-down experiments indicated that TR3 contains binding sites for calsequestrin-1 and that triadin clustering can be enhanced by binding to calsequestrin-1. These findings were confirmed by FRET experiments. Interestingly, the stable association of triadin to the j-SR was significantly decreased in myotubes from calsequestrin-1 knockout mice. Taken together, these results identify three regions in triadin that mediate targeting to the j-SR and reveal a role for calsequestrin-1 in promoting the stable association of triadin to the multiprotein complex associated with RyR.
Velikyan, Irina; Lindhe, Örjan
2018-01-01
Monitoring general disease marker such as angiogenesis may contribute to the development of personalized medicine and improve therapy outcome. Readily availability of positron emitter based imaging agents providing quantification would expand clinical positron emission tomography (PET) applications. Generator produced 68Ga provides PET images of high resolution and the half-life time frame is compatible with the pharmacokinetics of small peptides comprising arginine-glycine-aspartic acid (RGD) sequence specific to αvβ3 integrin receptors. The main objective of this study was to develop a method for 68Ga-labeling of RGD containing bicyclic octapeptide ([68Ga]Ga-DOTA-RGD) with high specific radioactivity and preclinically assess its imaging potential. DOTA-RGD was labeled using generator eluate preconcentration technique and microwave heating. The binding and organ distribution properties of [68Ga]Ga-DOTA-RGD were tested in vitro by autoradiography of frozen tumor sections, and in vivo in mice carrying a Lewis Lung carcinoma graft (LL2), and in non-human primate (NHP). Another peptide with aspartic acid-glycine-phenylalanine sequence was used as a negative control. The full 68Ga radioactivity eluted from two generators was quantitatively incorporated into 3-8 nanomoles of the peptide conjugates. The target binding specificity was confirmed by blocking experiments. The specific uptake in the LL2 mice model was observed in vivo and confirmed in the corresponding ex vivo biodistribution experiments. Increased accumulation of the radioactivity was detected in the wall of the uterus of the female NHP probably indicating neovascularization. [68Ga]Ga-DOTA-RGD demonstrated potential for the imaging of angiogenesis. PMID:29531858
Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...
2016-07-01
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
Menezes, Maira Maria; Nobre, Leonardo Thiago Duarte Barreto; Rossi, Gustavo Rodrigues; Almeida-Lima, Jailma; Melo-Silveira, Raniere Fagundes; Franco, Celia Regina Cavichiolo; Trindade, Edvaldo Silva; Nader, Helena Bonciani; Rocha, Hugo Alexandre Oliveira
2018-05-01
A low-molecular-weight (LMW) heterofucan (designated fucan B) was obtained from the brown seaweed, Spatoglossum schröederi, and its activity as an inhibitor of capillary-like tube formation by endothelial cells (ECs) was analyzed. Chemical, infrared and electrophoretic analyses confirmed the identity of fucan B. In contrast to other LMW fucans, fucan B (0.012-0.1 mg/mL) inhibited ECs capillary-like tube formation in a concentration-dependent manner. In addition, fucan B (0.01-0.05 mg/mL) did not affect ECs proliferation. Fucan B also inhibited ECs migration on a fibronectin-coated surface, but not on laminin- or collagen-coated surfaces. Biotinylated fucan B was used as a probe to identify its localization. Confocal microscopy experiments revealed that biotinylated fucan did not bind to the cell surface, but rather only to fibronectin. Our findings suggest that fucan B inhibits ECs capillary-like tube formation and migration by binding directly to fibronectin and blocking fibronectin sites recognized by cell surface ligands. However, further studies are needed to evaluate the in vivo effects of fucan B. Copyright © 2018 Elsevier B.V. All rights reserved.
Carosati, Emanuele; Budriesi, Roberta; Ioan, Pierfranco; Ugenti, Maria P; Frosini, Maria; Fusi, Fabio; Corda, Gaetano; Cosimelli, Barbara; Spinelli, Domenico; Chiarini, Alberto; Cruciani, Gabriele
2008-09-25
With the effort to discover new chemotypes blocking L-type calcium channels (LTCCs), ligand-based virtual screening was applied with a specific interest toward the diltiazem binding site. Roughly 50000 commercially available compounds served as a database for screening. The filtering through predicted pharmacokinetic properties and structural requirements reduced the initial database to a few compounds for which the similarity was calculated toward two template molecules, diltiazem and 4-chloro-Ncyclopropyl- N-(4-piperidinyl)benzene-sulfonamide, the most interesting hit of a previous screening experiment. For 18 compounds, inotropic and chronotropic activity as well as the vasorelaxant effect on guinea pig were studied "in vitro", and for the most promising, binding studies to the diltiazem site were carried out. The procedure yielded several hits, confirming in silico techniques to be useful for finding new chemotypes. In particular, N-[2-(dimethylamino)ethyl]-3-hydroxy-2-naphthamide, N,Ndimethyl- N'-(2-pyridin-3-ylquinolin-4-yl)ethane-1,2-diamine, 2-[(4-chlorophenyl)(pyridin-2-yl)methoxy]- N,N-dimethylethanamine (carbinoxamine), and 7-[2-(diethylamino)ethoxy]-2H-chromen-2-one revealed interesting activity and binding to the benzothiazepine site.
Lin, Zheng-zhong; Zhang, Hong-yuan; Peng, Ai-hong; Lin, Yi-dong; Li, Lu; Huang, Zhi-yong
2016-06-01
Magnetic molecularly imprinted polymers (MMIPs) were synthesized through precipitation polymerization using malachite green (MG) as template, methacrylic acid as monomer, ethylene dimethacrylate as crosslinker, and Fe3O4 magnetite as magnetic component. MMIPs were characterized by scanning electron microscopy, Fourier transform infrared spectrometry, and vibrating sample magnetometry. Under the optimum condition, the MMIPs obtained exhibited quick binding kinetics and high affinity to MG in the solution. Scatchard plot analysis revealed that the MMIPs contained only one type of binding site with dissociation constant of 24.0 μg mL(-1). The selectivity experiment confirmed that the MMIPs exhibited higher selective binding capacity for MG than its structurally related compound (e.g., crystal violet). As a sorbent for the extraction of MG in sample preparation, MMIPs together with the absorbed analytes could easily be separated from the sample matrix with an external magnet. After elution with methanol/acetic acid (9:1, v/v), MG in the eluent was determined by high-performance liquid chromatography coupled with UV detector with recoveries of 94.0-115%. Results indicated that the as-prepared MMIPs are promising materials for MG analysis in aquatic products. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
Li, Guangwei; Chen, Xiulin; Li, Boliao; Zhang, Guohui; Li, Yiping; Wu, Junxiang
2016-01-01
Background The oriental fruit moth Grapholita molesta is a host-switching pest species. The adults highly depend on olfactory cues in locating optimal host plants and oviposition sites. Odorant binding proteins (OBPs) are thought to be responsible for recognizing and transporting hydrophobic odorants across the aqueous sensillum lymph to stimulate the odorant receptors (ORs) within the antennal sensilla and activate the olfactory signal transduction pathway. Exploring the physiological function of these OBPs could facilitate understanding insect chemical communications. Methodology/Principal Finding Two antennae-specific general OBPs (GOBPs) of G. molesta were expressed and purified in vitro. The binding affinities of G. molesta GOBP1 and 2 (GmolGOBP1 and 2) for sex pheromone components and host plant volatiles were measured by fluorescence ligand-binding assays. The distribution of GmolGOBP1 and 2 in the antennal sensillum were defined by whole mount fluorescence immunohistochemistry (WM-FIHC) experiments. The binding sites of GmolGOBP2 were predicted using homology modeling, molecular docking and site-directed mutagenesis. Both GmolGOBP1 and 2 are housing in sensilla basiconica and with no differences in male and female antennae. Recombinant GmolGOBP1 (rGmolGOBP1) exhibited broad binding properties towards host plant volatiles and sex pheromone components; rGmolGOBP2 could not effectively bind host plant volatiles but showed specific binding affinity with a minor sex pheromone component dodecanol. We chose GmolGOBP2 and dodecanol for further homology modeling, molecular docking, and site-directed mutagenesis. Binding affinities of mutants demonstrated that Thr9 was the key binding site and confirmed dodecanol bonding to protein involves a hydrogen bond. Combined with the pH effect on binding affinities of rGmolGOBP2, ligand binding and release of GmolGOBP2 were related to a pH-dependent conformational transition. Conclusion Two rGmolGOBPs exhibit different binding characteristics for tested ligands. rGmolGOBP1 has dual functions in recognition of host plant volatiles and sex pheromone components, while rGmolGOBP2 is mainly involved in minor sex pheromone component dodecanol perception. This study also provides empirical evidence for the predicted functions of key amino acids in recombinant protein ligand-binding characteristics. PMID:27152703
Structure and mechanism of the phage T4 recombination mediator protein UvsY
Gajewski, Stefan; Waddell, Michael Brett; Vaithiyalingam, Sivaraja; ...
2016-03-07
The UvsY recombination mediator protein is critical for efficient homologous recombination in bacteriophage T4 and is the functional analog of the eukaryotic Rad52 protein. During T4 homologous recombination, the UvsX recombinase has to compete with the prebound gp32 single-stranded binding protein for DNA-binding sites and UvsY stimulates this filament nucleation event. We report here the crystal structure of UvsY in four similar open-barrel heptameric assemblies and provide structural and biophysical insights into its function. The UvsY heptamer was confirmed in solution by centrifugation and light scattering, and thermodynamic analyses revealed that the UvsY–ssDNA interaction occurs within the assembly via twomore » distinct binding modes. Using surface plasmon resonance, we also examined the binding of UvsY to both ssDNA and the ssDNA–gp32 complex. These analyses confirmed that ssDNA can bind UvsY and gp32 independently and also as a ternary complex. They also showed that residues located on the rim of the heptamer are required for optimal binding to ssDNA, thus identifying the putative ssDNA-binding surface. We propose a model in which UvsY promotes a helical ssDNA conformation that disfavors the binding of gp32 and initiates the assembly of the ssDNA–UvsX filament.« less
Theis, Thomas; Mishra, Bibhudatta; von der Ohe, Maren; Loers, Gabriele; Prondzynski, Maksymilian; Pless, Ole; Blackshear, Perry J.; Schachner, Melitta; Kleene, Ralf
2013-01-01
Polysialic acid (PSA) is a homopolymeric glycan that plays crucial roles in the developing and adult nervous system. So far only a few PSA-binding proteins have been identified. Here, we identify myristoylated alanine-rich C kinase substrate (MARCKS) as novel PSA binding partner. Binding assays showed a direct interaction between PSA and a peptide comprising the effector domain of MARCKS (MARCKS-ED). Co-immunoprecipitation of PSA-carrying neural cell adhesion molecule (PSA-NCAM) with MARCKS and co-immunostaining of MARCKS and PSA at the cell membrane of hippocampal neurons confirm the interaction between PSA and MARCKS. Co-localization and an intimate interaction of PSA and MARCKS at the cell surface was seen by confocal microscopy and fluorescence resonance energy transfer (FRET) analysis after the addition of fluorescently labeled PSA or PSA-NCAM to live CHO cells or hippocampal neurons expressing MARCKS as a fusion protein with green fluorescent protein (GFP). Cross-linking experiments showed that extracellularly applied PSA or PSA-NCAM and intracellularly expressed MARCKS-GFP are in close contact, suggesting that PSA and MARCKS interact with each other at the plasma membrane from opposite sides. Insertion of PSA and MARCKS-ED peptide into lipid bilayers from opposite sides alters the electric properties of the bilayer confirming the notion that PSA and the effector domain of MARCKS interact at and/or within the plane of the membrane. The MARCKS-ED peptide abolished PSA-induced enhancement of neurite outgrowth from cultured hippocampal neurons indicating an important functional role for the interaction between MARCKS and PSA in the developing and adult nervous system. PMID:23329829
Fiedler, L; Kellner, M; Gosewisch, A; Oos, R; Böning, G; Lindner, S; Albert, N; Bartenstein, P; Reulen, H-J; Zeidler, R; Gildehaus, F J
2018-05-01
Due to their infiltrative growth behavior, gliomas have, even after surgical resection, a high recurrence tendency. The approach of intracavitary radioimmunotherapy (RIT) is aimed at inhibiting tumor re-growth by directly administering drugs into the resection cavity (RC). Direct application of the radioconjugate into the RC has the advantage of bypassing the blood-brain barrier, which allows the administration of higher radiation doses than systemic application. Carbonic anhydrase XII (CA XII) is highly expressed on glioma cells while being absent from normal brain and thus an attractive target molecule for RIT. We evaluated a CA XII-specific 6A10 Fab (fragment antigen binding) labelled with 177 Lu as an agent for RIT. 6A10 Fab fragment was modified and radiolabelled with 177 Lu and characterized by MALDI-TOF, flow cytometry and radio-TLC. In vitro stability was determined under physiological conditions. Biodistribution studies, autoradiography tumor examinations and planar scintigraphy imaging were performed on SCID-mice bearing human glioma xenografts. The in vitro CA XII binding capacity of the modified Fab was confirmed. Radiochemical purity was determined to be >90% after 72 h of incubation under physiological conditions. Autoradiography experiments proved the specific binding of the Fab to CA XII on tumor cells. Biodistribution studies revealed a tumor uptake of 3.0%ID/g after 6 h and no detectable brain uptake. The tumor-to-contralateral ratio of 10/1 was confirmed by quantitative planar scintigraphy. The radiochemical stability in combination with a successful in vivo tumor uptake shows the potential suitability for future RIT applications with the 6A10 Fab. Copyright © 2018 Elsevier Inc. All rights reserved.
Doppler, Kathrin; Appeltshauser, Luise; Wilhelmi, Kai; Villmann, Carmen; Dib-Hajj, Sulayman D; Waxman, Stephen G; Mäurer, Mathias; Weishaupt, Andreas; Sommer, Claudia
2015-07-01
Autoantibodies against paranodal proteins have been described in patients with inflammatory neuropathies, but their association with pathology of nodes of Ranvier is unclear. We describe the clinical phenotype and histopathological changes of paranodal architecture of patients with autoantibodies against contactin-1, identified from a cohort with chronic inflammatory demyelinating polyradiculoneuropathy (n=53) and Guillain-Barré syndrome (n=21). We used ELISA to detect autoantibodies against contactin-1. Specificity of the autoantibodies was confirmed by immunoblot assay, binding to contactin-1-transfected human embryonic kidney cells, binding to paranodes of murine teased fibres and preabsorption experiments. Paranodal pathology was investigated by immunofluorescence labelling of dermal myelinated fibres. High reactivity to contactin-1 by ELISA was found in four patients with chronic inflammatory demyelinating polyradiculoneuropathy and in none of the patients with Guillain-Barré syndrome, which was confirmed by cell binding assays in all four patients. The four patients presented with a typical clinical picture, namely acute onset of disease and severe motor symptoms, with three patients manifesting action tremor. Immunofluorescence-labelling of paranodal proteins of dermal myelinated fibres revealed disruption of paranodal architecture. Semithin sections showed axonal damage but no classical signs of demyelination. We conclude that anti-contactin-1-related neuropathy constitutes a presumably autoantibody-mediated form of inflammatory neuropathy with distinct clinical symptoms and disruption of paranodal architecture as a pathological correlate. Anti-contactin-1-associated neuropathy does not meet morphological criteria of demyelinating neuropathy and therefore, might rather be termed a 'paranodopathy' rather than a subtype of demyelinating inflammatory neuropathy. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Blocking CLEC14A-MMRN2 binding inhibits sprouting angiogenesis and tumour growth
PJ, Noy; P, Lodhia; K, Khan; X, Zhuang; DG, Ward; AR, Verissimo; A, Bacon; R, Bicknell
2015-01-01
We previously identified CLEC14A as a tumour endothelial marker. Here we show CLEC14A is a regulator of sprouting angiogenesis in vitro and in vivo. Using a HUVEC spheroid sprouting assay we found CLEC14A to be a regulator of sprout initiation. Analysis of endothelial sprouting in aortic ring and in vivo subcutaneous sponge assays from clec14a+/+ and clec14a−/− mice revealed defects in sprouting angiogenesis in CLEC14A deficient animals. Tumour growth was retarded and vascularity reduced in clec14a−/− mice. Pulldown and co-immunoprecipitation experiments confirmed MMRN2 binds to the extracellular region of CLEC14A. The CLEC14A-MMRN2 interaction was interrogated using mouse monoclonal antibodies. Monoclonal antibodies were screened for their ability to block this interaction. Clone C4 but not C2 blocked CLEC14A-MMRN2 binding. C4 antibody perturbed tube formation and endothelial sprouting in vitro and in vivo, with a similar phenotype to loss of CLEC14A. Significantly, tumour growth was impaired in C4 treated animals and vascular density was also reduced in the C4 treated group. We conclude that CLEC14A-MMRN2 binding has a role in inducing sprouting angiogenesis during tumour growth, that has the potential to be manipulated in future anti-angiogenic therapy design. PMID:25745997
The neurocognitive basis of borrowed context information.
O'Neill, Meagan; Diana, Rachel A
2017-06-01
Falsely remembered items can be accompanied by episodic context retrieval. This finding is difficult to explain because there is no episode that binds the remembered item to the experimenter-controlled context features. The current study examines the neural correlates of false context retrieval when the context features can be traced to encoding episodes of semantically-similar items. Our neuroimaging results support a "dissociated source" mechanism for context borrowing in false memory. We found that parahippocampal cortex (PHc) activation, thought to indicate context retrieval, was greater during trials that involved context borrowing (an incorrect, but plausible source decision) than during baseline correct context retrieval. In contrast, hippocampal activation, thought to indicate retrieval of an episodic binding, was stronger during correct source retrieval than during context borrowing. Vivid context retrieval during false recollection experiences was also indicated by increased activation in visual perceptual regions for context borrowing as compared to other incorrect source judgments. The pattern of findings suggests that context borrowing can arise when unusually strong activation of a semantically-related item's contextual features drives relatively weak retrieval of the associated episodic binding with failure to confirm the item information within that binding. This dissociated source retrieval mechanism suggests that context-driven episodic retrieval does not necessarily lead to retrieval of specific item details. That is, source information can be retrieved in the absence of item memory. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Monroe, Jacob I.; Shirts, Michael R.
2014-04-01
Molecular containers such as cucurbit[7]uril (CB7) and the octa-acid (OA) host are ideal simplified model test systems for optimizing and analyzing methods for computing free energies of binding intended for use with biologically relevant protein-ligand complexes. To this end, we have performed initially blind free energy calculations to determine the free energies of binding for ligands of both the CB7 and OA hosts. A subset of the selected guest molecules were those included in the SAMPL4 prediction challenge. Using expanded ensemble simulations in the dimension of coupling host-guest intermolecular interactions, we are able to show that our estimates in most cases can be demonstrated to fully converge and that the errors in our estimates are due almost entirely to the assigned force field parameters and the choice of environmental conditions used to model experiment. We confirm the convergence through the use of alternative simulation methodologies and thermodynamic pathways, analyzing sampled conformations, and directly observing changes of the free energy with respect to simulation time. Our results demonstrate the benefits of enhanced sampling of multiple local free energy minima made possible by the use of expanded ensemble molecular dynamics and may indicate the presence of significant problems with current transferable force fields for organic molecules when used for calculating binding affinities, especially in non-protein chemistries.
Monroe, Jacob I; Shirts, Michael R
2014-04-01
Molecular containers such as cucurbit[7]uril (CB7) and the octa-acid (OA) host are ideal simplified model test systems for optimizing and analyzing methods for computing free energies of binding intended for use with biologically relevant protein-ligand complexes. To this end, we have performed initially blind free energy calculations to determine the free energies of binding for ligands of both the CB7 and OA hosts. A subset of the selected guest molecules were those included in the SAMPL4 prediction challenge. Using expanded ensemble simulations in the dimension of coupling host-guest intermolecular interactions, we are able to show that our estimates in most cases can be demonstrated to fully converge and that the errors in our estimates are due almost entirely to the assigned force field parameters and the choice of environmental conditions used to model experiment. We confirm the convergence through the use of alternative simulation methodologies and thermodynamic pathways, analyzing sampled conformations, and directly observing changes of the free energy with respect to simulation time. Our results demonstrate the benefits of enhanced sampling of multiple local free energy minima made possible by the use of expanded ensemble molecular dynamics and may indicate the presence of significant problems with current transferable force fields for organic molecules when used for calculating binding affinities, especially in non-protein chemistries.
The role of attention in binding visual features in working memory: evidence from cognitive ageing.
Brown, Louise A; Brockmole, James R
2010-10-01
Two experiments were conducted to assess the costs of attentional load during a feature (colour-shape) binding task in younger and older adults. Experiment 1 showed that a demanding backwards counting task, which draws upon central executive/general attentional resources, reduced binding to a greater extent than individual feature memory, but the effect was no greater in older than in younger adults. Experiment 2 showed that presenting memory items sequentially rather than simultaneously, such that items are required to be maintained while new representations are created, selectively affects binding performance in both age groups. Although this experiment exhibited an age-related binding deficit overall, both age groups were affected by the attention manipulation to an equal extent. While a role for attentional processes in colour-shape binding was apparent across both experiments, manipulations of attention exerted equal effects in both age groups. We therefore conclude that age-related binding deficits neither emerge nor are exacerbated under conditions of high attentional load. Implications for theories of visual working memory and cognitive ageing are discussed.
2014-01-01
The tyrosine kinase A (TrkA) receptor is a validated therapeutic intervention point for a wide range of conditions. TrkA activation by nerve growth factor (NGF) binding the second extracellular immunoglobulin (TrkAIg2) domain triggers intracellular signaling cascades. In the periphery, this promotes the pain phenotype and, in the brain, cell survival or differentiation. Reproducible structural information and detailed validation of protein–ligand interactions aid drug discovery. However, the isolated TrkAIg2 domain crystallizes as a β-strand-swapped dimer in the absence of NGF, occluding the binding surface. Here we report the design and structural validation by nuclear magnetic resonance spectroscopy of the first stable, biologically active construct of the TrkAIg2 domain for binding site confirmation. Our structure closely mimics the wild-type fold of TrkAIg2 in complex with NGF (1WWW.pdb), and the 1H–15N correlation spectra confirm that both NGF and a competing small molecule interact at the known binding interface in solution. PMID:25454499
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui; Xiao, Yi
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples.
Deligny, Audrey; Denys, Agnès; Marcant, Adeline; Melchior, Aurélie; Mazurier, Joël; van Kuppevelt, Toin H; Allain, Fabrice
2010-01-15
Cyclophilin B (CyPB) induces migration and adhesion of T lymphocytes via a mechanism that requires interaction with 3-O-sulfated heparan sulfate (HS). HS biosynthesis is a complex process with many sulfotransferases involved. N-Deacetylases/N-sulfotransferases are responsible for N-sulfation, which is essential for subsequent modification steps, whereas 3-O-sulfotransferases (3-OSTs) catalyze the least abundant modification. These enzymes are represented by several isoforms, which differ in term of distribution pattern, suggesting their involvement in making tissue-specific HS. To elucidate how the specificity of CyPB binding is determined, we explored the relationships between the expression of these sulfotransferases and the generation of HS motifs with CyPB-binding properties. We demonstrated that high N-sulfate density and the presence of 2-O- and 3-O-sulfates determine binding of CyPB, as evidenced by competitive experiments with heparin derivatives, soluble HS, and anti-HS antibodies. We then showed that target cells, i.e. CD4+ lymphocyte subsets, monocytes/macrophages, and related cell lines, specifically expressed high levels of NDST2 and 3-OST3 isoforms. Silencing the expression of NDST1, NDST2, 2-OST, and 3-OST3 by RNA interference efficiently decreased binding and activity of CyPB, thus confirming their involvement in the biosynthesis of binding sequences for CyPB. Moreover, we demonstrated that NDST1 was able to partially sulfate exogenous substrate in the absence of NDST2 but not vice versa, suggesting that both isoenzymes do not have redundant activities but do have rather complementary activities in making N-sulfated sequences with CyPB-binding properties. Altogether, these results suggest a regulatory mechanism in which cell type-specific expression of certain HS sulfotransferases determines the specific binding of CyPB to target cells.
Deligny, Audrey; Denys, Agnès; Marcant, Adeline; Melchior, Aurélie; Mazurier, Joël; van Kuppevelt, Toin H.; Allain, Fabrice
2010-01-01
Cyclophilin B (CyPB) induces migration and adhesion of T lymphocytes via a mechanism that requires interaction with 3-O-sulfated heparan sulfate (HS). HS biosynthesis is a complex process with many sulfotransferases involved. N-Deacetylases/N-sulfotransferases are responsible for N-sulfation, which is essential for subsequent modification steps, whereas 3-O-sulfotransferases (3-OSTs) catalyze the least abundant modification. These enzymes are represented by several isoforms, which differ in term of distribution pattern, suggesting their involvement in making tissue-specific HS. To elucidate how the specificity of CyPB binding is determined, we explored the relationships between the expression of these sulfotransferases and the generation of HS motifs with CyPB-binding properties. We demonstrated that high N-sulfate density and the presence of 2-O- and 3-O-sulfates determine binding of CyPB, as evidenced by competitive experiments with heparin derivatives, soluble HS, and anti-HS antibodies. We then showed that target cells, i.e. CD4+ lymphocyte subsets, monocytes/macrophages, and related cell lines, specifically expressed high levels of NDST2 and 3-OST3 isoforms. Silencing the expression of NDST1, NDST2, 2-OST, and 3-OST3 by RNA interference efficiently decreased binding and activity of CyPB, thus confirming their involvement in the biosynthesis of binding sequences for CyPB. Moreover, we demonstrated that NDST1 was able to partially sulfate exogenous substrate in the absence of NDST2 but not vice versa, suggesting that both isoenzymes do not have redundant activities but do have rather complementary activities in making N-sulfated sequences with CyPB-binding properties. Altogether, these results suggest a regulatory mechanism in which cell type-specific expression of certain HS sulfotransferases determines the specific binding of CyPB to target cells. PMID:19940140
Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana
2010-01-01
Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581
Monslow, James; Sato, Nobuyuki; Mack, Judith A; Maytin, Edward V
2009-08-01
Hyaluronic acid (HA), a glycosaminoglycan located between keratinocytes in the epidermis, accumulates dramatically following skin wounding. To study inductive mechanisms, a rat keratinocyte organotypic culture model that faithfully mimics HA metabolism was used. Organotypic cultures were needle-punctured 100 times, incubated for up to 24 hours, and HA analyzed by histochemical and biochemical methods. Within 15 minutes post-injury, HA levels had elevated two-fold, increasing to four-fold by 24 hours. HA elevations far from the site of injury suggested the possible involvement of a soluble HA-inductive factor. Media transfer experiments (from wounded cultures to unwounded cultures) confirmed the existence of a soluble factor. From earlier evidence, we hypothesized that an EGF-like growth factor might be responsible. This was confirmed as follows: (1) EGFR kinase inhibitor (AG1478) completely prevented wounding-induced HA accumulation. (2) Rapid tyrosine-phosphorylation of EGFR correlated well with the onset of increased HA synthesis. (3) A neutralizing antibody that recognizes heparin binding EGF-like growth factor (HB-EGF) blocked wounding-induced HA synthesis by > or =50%. (4) Western analyses showed that release of activated HB-EGF (but neither amphiregulin nor EGF) occured after wounding. In summary, rapid HA accumulation after epidermal wounding occurs through a mechanism requiring cleavage of HB-EGF and activation of EGFR signaling.
Drout, Riki J.; Otake, Kenichi; Howarth, Ashlee J.; ...
2018-01-10
At the Hanford Site in southeastern Washington state, the U.S. Department of Energy intends to treat 56 million gallons of legacy nuclear waste by encasing it in borosilicate glass via vitrification. This process ineffectively captures radioactive pertechnetate (TcO 4–) because of the ion’s volatility, thereby requiring a different remediation method for this long-lived (t 1/2 = 2.1 × 10 5 years), environmentally mobile species. Currently available sorbents lack the desired combination of high uptake capacity, fast kinetics, and selectivity. Here, we evaluate the ability of the chemically and thermally robust Zr 6-based metal–organic framework (MOF), NU-1000, to capture perrhenate (ReOmore » 4–), a pertechnetate simulant, and pertechnetate. Our material exhibits an excellent perrhenate uptake capacity of 210 mg/g, reaches saturation within 5 min, and maintains perrhenate uptake in the presence of competing anions. Additionally, experiments with pertechnetate confirm perrhenate is a suitable surrogate. Single-crystal X-ray diffraction indicates both chelating and nonchelating perrhenate binding motifs are present in both the small pore and the mesopore of NU-1000. Postadsorption diffuse reflectance infrared Fourier transform spectroscopy (DRIFTS) further elucidates the uptake mechanism and powder X-ray diffraction (PXRD) and Brunauer–Emmett–Teller (BET) surface area analysis confirm the retention of crystallinity and porosity of NU-1000 throughout adsorption.« less
Dilly, Sébastien; Scuvée-Moreau, Jacqueline; Wouters, Johan; Liégeois, Jean-François
2011-11-28
In a series of carboxamide and sulphonamide alkyl (ethyl to hexyl) piperazine analogues, although the size of the linker is very different, ethyl and hexyl derivatives possess a high affinity for 5-HT(1A) receptors. Docking studies clearly show that hexyl and ethyl compounds favorably interact with the binding site of the active conformation of 5-HT(1A) receptors, thus confirming a possible agonist profile. This activity is effectively detected in electrophysiological experiments in which all four compounds inhibit the activity of rat dorsal raphe serotonergic neurons.
NASA Astrophysics Data System (ADS)
Abbasi, Mahboube; Amiri, Razieh; Bordbar, Abdol-Kalegh; Ranjbakhsh, Elnaz; Khosropour, Ahmad-Reza
2016-02-01
Immobilized proteins and enzymes are widely investigated in the medical field as well as the food and environmental fields. In this study, glucose oxidase (GOX) was covalently immobilized on the surface of modified iron oxide magnetic nanoparticles (MIMNs) to produce a bioconjugate complex. Transmission electron microscopy (TEM) and X-ray diffraction (XRD) were used to the size, shape and structure characterization of the MIMNs. Binding of GOX to these MIMNs was confirmed by using FT-IR spectroscopy. The stability of the immobilized and free enzyme at different temperature and pH values was investigated by measuring the enzymatic activity. These studies reveal that the enzyme's stability is enhanced by immobilization. Further experiments showed that the storage stability of the enzyme is improved upon binding to the MIMNs. The results of kinetic measurements suggest that the effect of the immobilization process on substrate and product diffusion is small. Such bioconjugates can be considered as a catalytic nanodevice for accelerating the glucose oxidation reaction for biotechnological purposes.
Mazzini, Stefania; Ferreira, Ruben; Gargallo, Raimundo; Marquez, Victor E.
2012-01-01
Modified thrombin-binding aptamers (TBAs) carrying uridine (U), 2′-deoxy-2′-fluorouridine (FU) and North-methanocarbathymidine (NT) residues in the loop regions were synthesized and analyzed by UV thermal denaturation experiments and CD spectroscopy. The replacement of thymidines in the TGT loop by U and FU results in an increased stability of the antiparallel quadruplex structure described for the TBA while the presence of NT residues in the same positions destabilizes the antiparallel structure. The substitution of the thymidines in the TT loops for U, FU and NT induce a destabilization of the antiparallel quadruplex, indicating the crucial role of these positions. NMR studies on TBAs modified with uridines at the TGT loop also confirm the presence of the antiparallel quadruplex structure. Nevertheless, replacement of two Ts in the TT loops by uridine gives a more complex scenario in which the antiparallel quadruplex structure is present along with other partially unfolded species or aggregates. PMID:22727781
Chen, Charles H; Wiedman, Gregory; Khan, Ayesha; Ulmschneider, Martin B
2014-09-01
Unbiased molecular simulation is a powerful tool to study the atomic details driving functional structural changes or folding pathways of highly fluid systems, which present great challenges experimentally. Here we apply unbiased long-timescale molecular dynamics simulation to study the ab initio folding and partitioning of melittin, a template amphiphilic membrane active peptide. The simulations reveal that the peptide binds strongly to the lipid bilayer in an unstructured configuration. Interfacial folding results in a localized bilayer deformation. Akin to purely hydrophobic transmembrane segments the surface bound native helical conformer is highly resistant against thermal denaturation. Circular dichroism spectroscopy experiments confirm the strong binding and thermostability of the peptide. The study highlights the utility of molecular dynamics simulations for studying transient mechanisms in fluid lipid bilayer systems. This article is part of a Special Issue entitled: Interfacially Active Peptides and Proteins. Guest Editors: William C. Wimley and Kalina Hristova. Copyright © 2014. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nuemket, Nipawan; Tanaka, Yoshikazu; Faculty of Advanced Life Science, Hokkaido University, Sapporo 060-0810
2011-07-29
Highlights: {yields} We determined the crystal structure of the receptor binding domain of BoNT in complex with 3'-sialyllactose. {yields} An electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. {yields} Alanine site-directed mutagenesis showed that GBS and GBL are important for ganglioside binding. {yields} A cell binding mechanism, which involves cooperative contribution of two sites, was proposed. -- Abstract: Clostridium botulinum type D strain OFD05, which produces the D/C mosaic neurotoxin, was isolated from cattle killed by the recent botulism outbreak in Japan. The D/C mosaic neurotoxin is the most toxic of the botulinummore » neurotoxins (BoNT) characterized to date. Here, we determined the crystal structure of the receptor binding domain of BoNT from strain OFD05 in complex with 3'-sialyllactose at a resolution of 3.0 A. In the structure, an electron density derived from the 3'-sialyllactose was confirmed at the cleft in the C-terminal subdomain. Alanine site-directed mutagenesis showed the significant contribution of the residues surrounding the cleft to ganglioside recognition. In addition, a loop adjoining the cleft also plays an important role in ganglioside recognition. In contrast, little effect was observed when the residues located around the surface previously identified as the protein receptor binding site in other BoNTs were substituted. The results of cell binding analysis of the mutants were significantly correlated with the ganglioside binding properties. Based on these observations, a cell binding mechanism of BoNT from strain OFD05 is proposed, which involves cooperative contribution of two ganglioside binding sites.« less
A general mechanism for competitor-induced dissociation of molecular complexes
Paramanathan, Thayaparan; Reeves, Daniel; Friedman, Larry J.; Kondev, Jane; Gelles, Jeff
2014-01-01
The kinetic stability of non-covalent macromolecular complexes controls many biological phenomena. Here we find that physical models of complex dissociation predict that competitor molecules will in general accelerate the breakdown of isolated bimolecular complexes by occluding rapid rebinding of the two binding partners. This prediction is largely independent of molecular details. We confirm the prediction with single-molecule fluorescence experiments on a well-characterized DNA strand dissociation reaction. Contrary to common assumptions, competitor–induced acceleration of dissociation can occur in biologically relevant competitor concentration ranges and does not necessarily implyternary association of competitor with the bimolecular complex. Thus, occlusion of complex rebinding may play a significant role in a variety of biomolecular processes. The results also show that single-molecule colocalization experiments can accurately measure dissociation rates despite their limited spatio temporal resolution. PMID:25342513
ERIC Educational Resources Information Center
Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.
2010-01-01
We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…
Chemical Proteomics Reveals Ferrochelatase as a Common Off-target of Kinase Inhibitors.
Klaeger, Susan; Gohlke, Bjoern; Perrin, Jessica; Gupta, Vipul; Heinzlmeir, Stephanie; Helm, Dominic; Qiao, Huichao; Bergamini, Giovanna; Handa, Hiroshi; Savitski, Mikhail M; Bantscheff, Marcus; Médard, Guillaume; Preissner, Robert; Kuster, Bernhard
2016-05-20
Many protein kinases are valid drug targets in oncology because they are key components of signal transduction pathways. The number of clinical kinase inhibitors is on the rise, but these molecules often exhibit polypharmacology, potentially eliciting desired and toxic effects. Therefore, a comprehensive assessment of a compound's target space is desirable for a better understanding of its biological effects. The enzyme ferrochelatase (FECH) catalyzes the conversion of protoporphyrin IX into heme and was recently found to be an off-target of the BRAF inhibitor Vemurafenib, likely explaining the phototoxicity associated with this drug in melanoma patients. This raises the question of whether FECH binding is a more general feature of kinase inhibitors. To address this, we applied a chemical proteomics approach using kinobeads to evaluate 226 clinical kinase inhibitors for their ability to bind FECH. Surprisingly, low or submicromolar FECH binding was detected for 29 of all compounds tested and isothermal dose response measurements confirmed target engagement in cells. We also show that Vemurafenib, Linsitinib, Neratinib, and MK-2461 reduce heme levels in K562 cells, verifying that drug binding leads to a loss of FECH activity. Further biochemical and docking experiments identified the protoporphyrin pocket in FECH as one major drug binding site. Since the genetic loss of FECH activity leads to photosensitivity in humans, our data strongly suggest that FECH inhibition by kinase inhibitors is the molecular mechanism triggering photosensitivity in patients. We therefore suggest that a FECH assay should generally be part of the preclinical molecular toxicology package for the development of kinase inhibitors.
Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles.
LeVine, Michael V; Khelashvili, George; Shi, Lei; Quick, Matthias; Javitch, Jonathan A; Weinstein, Harel
2016-02-16
Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins.
Role of Annular Lipids in the Functional Properties of Leucine Transporter LeuT Proteomicelles
2016-01-01
Recent work has shown that the choice of the type and concentration of detergent used for the solubilization of membrane proteins can strongly influence the results of functional experiments. In particular, the amino acid transporter LeuT can bind two substrate molecules in low concentrations of n-dodecyl β-d-maltopyranoside (DDM), whereas high concentrations reduce the molar binding stoichiometry to 1:1. Subsequent molecular dynamics (MD) simulations of LeuT in DDM proteomicelles revealed that DDM can penetrate to the extracellular vestibule and make stable contacts in the functionally important secondary substrate binding site (S2), suggesting a potential competitive mechanism for the reduction in binding stoichiometry. Because annular lipids can be retained during solubilization, we performed MD simulations of LeuT proteomicelles at various stages of the solubilization process. We find that at low DDM concentrations, lipids are retained around the protein and penetration of detergent into the S2 site does not occur, whereas at high concentrations, lipids are displaced and the probability of DDM binding in the S2 site is increased. This behavior is dependent on the type of detergent, however, as we find in the simulations that the detergent lauryl maltose-neopentyl glycol, which is approximately twice the size of DDM and structurally more closely resembles lipids, does not penetrate the protein even at very high concentrations. We present functional studies that confirm the computational findings, emphasizing the need for careful consideration of experimental conditions, and for cautious interpretation of data in gathering mechanistic information about membrane proteins. PMID:26811944
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seeman, P.; Niznik, H.B.; Guan, H.C.
1989-12-01
Dopamine receptor types D{sub 1} and D{sub 2} can oppose enhance each other's actions for electrical, biochemical, and psychomotor effects. The authors report a D{sub 1}-D{sub 2} interaction in homogenized tissue as revealed by ligand binding. D{sub 2} agonists lowered the binding of ({sup 3}H)raclopride to D{sub 2} receptors in striatal and anterior pituitary tissues. Pretreating the tissue with the D{sub 1}-selective antagonist SCH 23390 prevented the agonist-induced decrease in ({sup 3}H)raclopride binding to D{sub 2} sites in the striatum but not in the anterior pituitary, which has no D{sub 1} receptors. Conversely, a dopamine-induced reduction in the binding ofmore » ({sup 3}H)SCH 23390 to D{sub 1} receptors could be prevented by the D{sub 2}-selective antagonist eticlopride. Receptor photolabeling experiments confirmed both these D{sub 1}-D{sub 2} interactions. The blocking effect by SCH 23390 was similar to that produced by a nonhydrolyzable guanine nucleotide analogue, and SCH 23390 reduced the number of agonist-labeled D{sub 2} receptors in the high-affinity state. Thus, the D{sub 1}-D{sub 2} link may be mediated by guanine nucleotide-binding protein components. The link may underlie D{sub 1}-D{sub 2} interactions influencing behavior, since the link was missing in over half the postmortem striata from patients with schizophrenia and Huntington disease (both diseases that show some hyperdopamine signs) but was present in human control, Alzheimer, and Parkinson striata.« less
In vivo antibody-mediated modulation of aminopeptidase A in mouse proximal tubular epithelial cells.
Mentzel, S; Dijkman, H B; van Son, J P; Wetzels, J F; Assmann, K J
1999-07-01
Aminopeptidase A (APA) is one of the many renal hydrolases. In mouse kidney, APA is predominantly expressed on the brush borders and sparsely on the basolateral membranes of proximal tubular epithelial cells. However, when large amounts of monoclonal antibodies (MAbs) against APA were injected into mice, we observed strong binding of the MAbs to the basolateral membranes, whereas the MAbs bound only transiently to the brush borders of the proximal tubular epithelial cells. In parallel, APA itself disappeared from the brush borders by both endocytosis and shedding, whereas it was increasingly expressed on the basolateral sides. Using ultrastructural immunohistology, we found no evidence for transcellular transport of endocytosed APA to the basolateral side of the proximal tubular epithelial cells. The absence of transcellular transport was confirmed by experiments in which we used a low dose of the MAbs. Such a low dose did not result in binding of the MAbs to the brush borders and had no effect on the presence of APA in the brush borders of the proximal tubular epithelial cells. In these experiments we still could observe binding of the MAbs to the basolateral membranes in parallel with the local appearance of APA. In addition, treatment of mice with chlorpromazine, a calmodulin antagonist that interferes with cytoskeletal function, largely inhibited the MAb-induced modulation of APA. Our studies suggest that injection of MAbs to APA specifically interrupts the normal intracellular traffic of this enzyme in proximal tubular epithelial cells. This intracellular transport is dependent on the action of cytoskeletal proteins.
Regulation of Nuclear Import and Export of Negative Cofactor 2*S⃞
Kahle, Joerg; Piaia, Elisa; Neimanis, Sonja; Meisterernst, Michael; Doenecke, Detlef
2009-01-01
The negative cofactor 2 (NC2) is a protein complex composed of two subunits, NC2α and NC2β, and plays a key role in transcription regulation. Here we investigate whether each subunit contains a nuclear localization signal (NLS) that permits individual crossing of the nuclear membrane or whether nuclear import of NC2α and NC2β depends on heterodimerization. Our results from in vitro binding studies and transfection experiments in cultured cells show that each subunit contains a classical NLS (cNLS) that is recognized by the importin α/β heterodimer. Regardless of the individual cNLSs the two NC2 subunits are translocated as a preassembled complex as co-transfection experiments with wild-type and cNLS-deficient NC2 subunits demonstrate. Ran-dependent binding of the nuclear export receptor Crm1/exportin 1 confirmed the presence of a leucine-rich nuclear export signal (NES) in NC2β. In contrast, NC2α does not exhibit a NES. Our results from interspecies heterokaryon assays suggest that heterodimerization with NC2α masks the NES in NC2β, which prevents nuclear export of the NC2 complex. A mutation in either one of the two cNLSs decreases the extent of importin α/β-mediated nuclear import of the NC2 complex. In addition, the NC2 complex can enter the nucleus via a second pathway, facilitated by importin 13. Because importin 13 binds exclusively to the NC2 complex but not to the individual subunits this alternative import pathway depends on sequence elements distributed among the two subunits. PMID:19204005
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Paul, Stephanie; Alegre, Kamela O; Holdsworth, Scarlett R; Rice, Matthew; Brown, James A; McVeigh, Paul; Kelly, Sharon M; Law, Christopher J
2014-01-01
Resistance to high concentrations of bile salts in the human intestinal tract is vital for the survival of enteric bacteria such as E scherichia coli. Although the tripartite AcrAB–TolC efflux system plays a significant role in this resistance, it is purported that other efflux pumps must also be involved. We provide evidence from a comprehensive suite of experiments performed at two different pH values (7.2 and 6.0) that reflect pH conditions that E . coli may encounter in human gut that MdtM, a single-component multidrug resistance transporter of the major facilitator superfamily, functions in bile salt resistance in E . coli by catalysing secondary active transport of bile salts out of the cell cytoplasm. Furthermore, assays performed on a chromosomal ΔacrB mutant transformed with multicopy plasmid encoding MdtM suggested a functional synergism between the single-component MdtM transporter and the tripartite AcrAB–TolC system that results in a multiplicative effect on resistance. Substrate binding experiments performed on purified MdtM demonstrated that the transporter binds to cholate and deoxycholate with micromolar affinity, and transport assays performed on inverted vesicles confirmed the capacity of MdtM to catalyse electrogenic bile salt/H+ antiport. PMID:24684269
Xylella fastidiosa Afimbrial Adhesins Mediate Cell Transmission to Plants by Leafhopper Vectors▿
Killiny, Nabil; Almeida, Rodrigo P. P.
2009-01-01
The interactions between the economically important plant-pathogenic bacterium Xylella fastidiosa and its leafhopper vectors are poorly characterized. We used different approaches to determine how X. fastidiosa cells interact with the cuticular surface of the foreguts of vectors. We demonstrate that X. fastidiosa binds to different polysaccharides with various affinities and that these interactions are mediated by cell surface carbohydrate-binding proteins. In addition, competition assays showed that N-acetylglucosamine inhibits bacterial adhesion to vector foregut extracts and intact wings, demonstrating that attachment to leafhopper surfaces is affected in the presence of specific polysaccharides. In vitro experiments with several X. fastidiosa knockout mutants indicated that hemagglutinin-like proteins are associated with cell adhesion to polysaccharides. These results were confirmed with biological experiments in which hemagglutinin-like protein mutants were transmitted to plants by vectors at lower rates than that of the wild type. Furthermore, although these mutants were defective in adhesion to the cuticle of vectors, their growth rate once attached to leafhoppers was similar to that of the wild type, suggesting that these proteins are important for initial adhesion of X. fastidiosa to leafhoppers. We propose that X. fastidiosa colonization of leafhopper vectors is a complex, stepwise process similar to the formation of biofilms on surfaces. PMID:19011051
Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P
2010-07-06
Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of 2 with poly(dA).2poly(dT) was the highest, almost 1000-fold greater than that of neomycin. The binding of compounds 1-4 with poly(dA).2poly(dT) was mostly enthalpy-driven and gave negative DeltaC(p) values. The results described here suggest that the binding affinity of intercalator-neomycin conjugates for poly(dA).2poly(dT) increases as a function of the surface area of the intercalator moiety.
Bead-based microfluidic immunoassay for diagnosis of Johne's disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wadhwa, Ashutosh; Foote, Robert; Shaw, Robert W
2012-01-01
Microfluidics technology offers a platform for development of point-of-care diagnostic devices for various infectious diseases. In this study, we examined whether serodiagnosis of Johne s disease (JD) can be conducted in a bead-based microfluidic assay system. Magnetic micro-beads were coated with antigens of the causative agent of JD, Mycobacterium avium subsp. paratuberculosis. The antigen-coated beads were incubated with serum samples of JD-positive or negative serum samples and then with a fluorescently-labeled secondary antibody (SAB). To confirm binding of serum antibodies to the antigen, the beads were subjected to flow cytometric analysis. Different conditions (dilutions of serum and SAB, types ofmore » SAB, and types of magnetic beads) were optimized for a great degree of differentiation between the JD-negative and JD-positive samples. Using the optimized conditions, we tested a well-classified set of 155 serum samples from JD negative and JD-positive cattle by using the bead-based flow cytometric assay. Of 105 JD-positive samples, 63 samples (60%) showed higher antibody binding levels than a cut-off value determined by using antibody binding levels of JD-negative samples. In contrast, only 43-49 JD-positive samples showed higher antibody binding levels than the cut-off value when the samples were tested by commercially-available immunoassays. Microfluidic assays were performed by magnetically immobilizing a number of beads within a microchannel of a glass microchip and detecting antibody on the collected beads by laser-induced fluorescence. Antigen-coated magnetic beads treated with bovine serum sample and fluorescently-labeled SAB were loaded into a microchannel to measure the fluorescence (reflecting level of antibody binding) on the beads in the microfluidic system. When the results of five bovine serum samples obtained with the system were compared to those obtained with the flow cytometer, a high level of correlation (linear regression, r2 = 0.994) was observed. In a further experiment, we magnetically immobilized antigen-coated beads in a microchannel, reacted the beads with serum and SAB in the channel, and detected antibody binding to the beads in the microfluidic system. A strong antibody binding in JD-positive serum was detected, whereas there was only negligible binding in negative control experiments. Our data suggest that the bead-based microfluidic system may form a basis for development of an on-site serodiagnosis of JD. Key Words: Mycobacterium avium ssp. paratuberculosis, Johne s disease, microfluidics, lab-on-a-chip.« less
Anbarasu, K; Jayanthi, S
2018-05-01
Human lemur tyrosine kinase-3 (LMTK3) is primarily involved in regulation of estrogen receptor-α (ERα) by phosphorylation activity. LMTK3 acts as key biomarker for ERα positive breast cancer and identified as novel drug target for breast cancer. Due to the absence of experimental reports, the computational approach has been followed to screen LMTK3 inhibitors from natural product curcumin derivatives based on rational inhibitor design. The initial virtual screening and re-docking resulted in identification of top three leads with favorable binding energy and strong interactions in critical residues of ATP-binding cavity. ADME prediction confirmed the pharmacological activity of the leads with various properties. The stability and binding affinity of leads were well refined in dynamic system from 25 ns MD simulations. The behavior of protein motion towards closure of ATP-binding cavity was evaluated based on eigenvectors by PCA. In addition, MM/PBSA calculations also confirmed the relative binding free energy of LMTK3-lead complexes in favor of the effective binding. From our study, novel LMTK3 inhibitors tetrahydrocurcumin, curcumin 4,4'-diacetate, and demethoxycurcumin have been proposed with inhibition mechanism. Further experimental evaluation on reported lead candidates might prove its role in breast cancer therapeutics.
Logie, Robert H; Brockmole, James R; Jaswal, Snehlata
2011-01-01
Three experiments used a change detection paradigm across a range of study-test intervals to address the respective contributions of location, shape, and color to the formation of bindings of features in sensory memory and visual short-term memory (VSTM). In Experiment 1, location was designated task irrelevant and was randomized between study and test displays. The task was to detect changes in the bindings between shape and color. In Experiments 2 and 3, shape and color, respectively, were task irrelevant and randomized, with bindings tested between location and color (Experiment 2) and location and shape (Experiment 3). At shorter study-test intervals, randomizing location was most disruptive, followed by shape and then color. At longer intervals, randomizing any task-irrelevant feature had no impact on change detection for bindings between features, and location had no special role. Results suggest that location is crucial for initial perceptual binding but loses that special status once representations are formed in VSTM, which operates according to different principles, than do visual attention and perception.
Volkán-Kacsó, Sándor; Marcus, Rudolph A
2016-10-25
A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Middleton, R.E.; Cohen, J.B.
1991-07-16
The agonist ({sup 3}H)nicotine was used as a photoaffinity label for the acetylcholine binding sties on the Torpedo nicotinic acetylcholine receptor (AChR). ({sup 3}H)Nicotine binds at equilibrium with K{sub eq} = 0.6 {mu}M to the agonist binding sites. Irradiation with 254-nm light of AChR-rich membranes equilibrated with ({sup 3}H)nicotine resulted in covalent incorporation into the {alpha}- and {gamma}-subunits, which was inhibited by agonists and competitive antagonists but not by noncompetitive antagonists. Inhibition of labeling by d-tubocurarine demonstrated that the {alpha}-subunit was labeled via both agonist sites but the {gamma}-subunit was labeled only via the site that binds d-tubocurarine with highmore » affinity. Chymotryptic digestion of the {alpha}-subunit confirmed that Try-198 was the principal amino acid labeled by ({sup 3}H)nicotine. This confirmation required a novel radiosequencing strategy employing o-phthalaldehyde ({sup 3}H)Nicotine, which is the first photoaffinity agonist used, labels primarily Tyr-198 in contrast to competitive antagonist affinity labels, which label primarily Tyr-190 and Cys-192/Cys-193.« less
p53 Specifically Binds Triplex DNA In Vitro and in Cells
Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej
2016-01-01
Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daoust, M.; Boucly, P.; Ernouf, D.
1991-01-01
The kinetic parameters of {sup 3}H-paroxetine binding and {sup 3}H-serotonin uptake were studied in platelets of alcoholic patients. There was no difference between alcoholic and non alcoholic subjects in {sup 3}H-paroxetine binding. When binding and {sup 3}H-serotonin uptake were studied, in the same plasma of the same subjects, the Vmax of serotonin uptake was increased in alcoholics. The data confirm the involvement of serotonin uptake system in alcohol dependance and suggest that serotonin uptake and paroxetine binding sites may be regulated independently in this pathology.
Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu
2017-01-19
A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.
Prugh, Amber M; Cole, Stephanie D; Glaros, Trevor; Angelini, Daniel J
2017-03-25
Mesenchymal stem cells (MSCs) are multipotent cells located within various adult tissues. Recent literature has reported that human bone marrow-derived MSCs express active acetylcholinesterase (AChE) and that disruption of AChE activity by organophosphate (OP) chemicals decreases the ability of MSCs to differentiate into osteoblasts. The potential role of AChE in regulating MSC proliferation and differentiation is currently unknown. In the present study, we demonstrate that MSCs exposed to OPs have both decreased AChE activity and abundance. In addition, exposure to these OPs induced cellular death while decreasing cellular proliferation. Exposures to these compounds also reduced the adipogenic/osteogenic differentiation potentials of the MSCs. To elucidate the possible role of AChE in MSCs signaling following OP exposure, we captured potential AChE binding partners by performing polyhistidine (His 8 )-tagged AChE pulldowns, followed by protein identification using liquid chromatography mass spectrometry (LC-MS). Using this method, we determined that the focal adhesion protein, vinculin, is a potential binding partner with AChE in MSCs and these initial findings were confirmed with follow-up co-immunoprecipitation experiments. Identifying AChE binding partners helps to determine potential pathways associated with MSC proliferation and differentiation, and this understanding could lead to the development of future MSC-based tissue repair therapies. Published by Elsevier B.V.
Ghosh, Sajal Kumar; Rathee, Vikram; Krishnaswamy, Rema; Raghunathan, V A; Sood, A K
2009-08-04
The phase behavior of the anionic surfactant sodium dodecyl sulfate (SDS) in the presence of the strongly binding counterion p-toluidine hydrochloride (PTHC) has been examined using small-angle X-ray diffraction and polarizing microscopy. A hexagonal-to-lamellar transition on varying the PTHC to SDS molar ratio (alpha) occurs through a nematic phase of rodlike micelles (Nc) --> isotropic (I) --> nematic of disklike micelles (N(D)) at a fixed surfactant concentration (phi). The lamellar phase is found to coexist with an isotropic phase (I') over a large region of the phase diagram. Deuterium nuclear magnetic resonance investigations of the phase behavior at phi = 0.4 confirm the transition from N(C) to N(D) on varying alpha. The viscoelastic and flow behaviors of the different phases were examined. A decrease in the steady shear viscosity across the different phases with increasing alpha suggests a decrease in the aspect ratio of the micellar aggregates. From the transient shear stress response of the N() and N(D) nematic phases in step shear experiments, they were characterized to be tumbling and flow aligning, respectively. Our studies reveal that by tuning the morphology of the surfactant micelles strongly binding counterions modify the phase behavior and rheological properties of concentrated surfactant solutions.
Prostatic origin of a zinc binding high molecular weight protein complex in human seminal plasma.
Siciliano, L; De Stefano, C; Petroni, M F; Vivacqua, A; Rago, V; Carpino, A
2000-03-01
The profile of the zinc ligand high molecular weight proteins was investigated in the seminal plasma of 55 normozoospermic subjects by size exclusion high performance liquid chromatography (HPLC). The proteins were recovered from Sephadex G-75 gel filtration of seminal plasma in three zinc-containing fractions which were then submitted to HPLC analysis. The results were, that in all the samples, the protein profiles showed two peaks with apparent molecular weight of approximately 660 and approximately 250 kDa. Dialysis experiments revealed that both approximately 660 and approximately 250 kDa proteins were able to uptake zinc against gradient indicating their zinc binding capacity. The HPLC analysis of the whole seminal plasma evidenced only the approximately 660 kDa protein complex as a single well quantifying peak, furthermore a positive correlation between its peak area and the seminal zinc values (P < 0.001) was observed. This suggested a prostatic origin of the approximately 660 kDa protein complex which was then confirmed by the seminal plasma HPLC analysis of a subject with agenesis of the Wolffian ducts. Finally the study demonstrated the presence of two zinc binding proteins, approximately 660 and approximately 250 kDa respectively, in human seminal plasma and the prostatic origin of the approximately 660 kDa.
Cofactor-dependent specificity of a DEAD-box protein.
Young, Crystal L; Khoshnevis, Sohail; Karbstein, Katrin
2013-07-16
DEAD-box proteins, a large class of RNA-dependent ATPases, regulate all aspects of gene expression and RNA metabolism. They can facilitate dissociation of RNA duplexes and remodeling of RNA-protein complexes, serve as ATP-dependent RNA-binding proteins, or even anneal duplexes. These proteins have highly conserved sequence elements that are contained within two RecA-like domains; consequently, their structures are nearly identical. Furthermore, crystal structures of DEAD-box proteins with bound RNA reveal interactions exclusively between the protein and the RNA backbone. Together, these findings suggest that DEAD-box proteins interact with their substrates in a nonspecific manner, which is confirmed in biochemical experiments. Nevertheless, this contrasts with the need to target these enzymes to specific substrates in vivo. Using the DEAD-box protein Rok1 and its cofactor Rrp5, which both function during maturation of the small ribosomal subunit, we show here that Rrp5 provides specificity to the otherwise nonspecific biochemical activities of the Rok1 DEAD-domain. This finding could reconcile the need for specific substrate binding of some DEAD-box proteins with their nonspecific binding surface and expands the potential roles of cofactors to specificity factors. Identification of helicase cofactors and their RNA substrates could therefore help define the undescribed roles of the 19 DEAD-box proteins that function in ribosome assembly.
Characterization of MRP RNA–protein interactions within the perinucleolar compartment
Pollock, Callie; Daily, Kelly; Nguyen, Van Trung; Wang, Chen; Lewandowska, Marzena Anna; Bensaude, Olivier; Huang, Sui
2011-01-01
The perinucleolar compartment (PNC) forms in cancer cells and is highly enriched with a subset of polymerase III RNAs and RNA-binding proteins. Here we report that PNC components mitochondrial RNA–processing (MRP) RNA, pyrimidine tract–binding protein (PTB), and CUG-binding protein (CUGBP) interact in vivo, as demonstrated by coimmunoprecipitation and RNA pull-down experiments. Glycerol gradient analyses show that this complex is large and sediments at a different fraction from known MRP RNA–containing complexes, the MRP ribonucleoprotein ribozyme and human telomerase reverse transcriptase. Tethering PNC components to a LacO locus recruits other PNC components, further confirming the in vivo interactions. These interactions are present both in PNC-containing and -lacking cells. High-resolution localization analyses demonstrate that MRP RNA, CUGBP, and PTB colocalize at the PNC as a reticulated network, intertwining with newly synthesized RNA. Furthermore, green fluorescent protein (GFP)–PTB and GFP-CUGBP show a slower rate of fluorescence recovery after photobleaching at the PNC than in the nucleoplasm, illustrating the different molecular interaction of the complexes associated with the PNC. These findings support a working model in which the MRP RNA–protein complex becomes nucleated at the PNC in cancer cells and may play a role in gene expression regulation at the DNA locus that associates with the PNC. PMID:21233287
Characterization of MRP RNA-protein interactions within the perinucleolar compartment.
Pollock, Callie; Daily, Kelly; Nguyen, Van Trung; Wang, Chen; Lewandowska, Marzena Anna; Bensaude, Olivier; Huang, Sui
2011-03-15
The perinucleolar compartment (PNC) forms in cancer cells and is highly enriched with a subset of polymerase III RNAs and RNA-binding proteins. Here we report that PNC components mitochondrial RNA-processing (MRP) RNA, pyrimidine tract-binding protein (PTB), and CUG-binding protein (CUGBP) interact in vivo, as demonstrated by coimmunoprecipitation and RNA pull-down experiments. Glycerol gradient analyses show that this complex is large and sediments at a different fraction from known MRP RNA-containing complexes, the MRP ribonucleoprotein ribozyme and human telomerase reverse transcriptase. Tethering PNC components to a LacO locus recruits other PNC components, further confirming the in vivo interactions. These interactions are present both in PNC-containing and -lacking cells. High-resolution localization analyses demonstrate that MRP RNA, CUGBP, and PTB colocalize at the PNC as a reticulated network, intertwining with newly synthesized RNA. Furthermore, green fluorescent protein (GFP)-PTB and GFP-CUGBP show a slower rate of fluorescence recovery after photobleaching at the PNC than in the nucleoplasm, illustrating the different molecular interaction of the complexes associated with the PNC. These findings support a working model in which the MRP RNA-protein complex becomes nucleated at the PNC in cancer cells and may play a role in gene expression regulation at the DNA locus that associates with the PNC.
The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.
García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana
2018-03-29
Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.
NASA Astrophysics Data System (ADS)
Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu
2017-01-01
A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer.
Waris, Muhammad I.; Younas, Aneela; ul Qamar, Muhammad T.; Hao, Liu; Ameen, Asif; Ali, Saqib; Abdelnabby, Hazem Elewa; Zeng, Fang-Fang; Wang, Man-Qun
2018-01-01
Chemosensory proteins (CSPs) play imperative functions in chemical and biochemical signaling of insects, as they distinguish and transfer ecological chemical indications to a sensory system in order to initiate behavioral responses. The brown planthopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), has emerged as the most destructive pest, causing serious damage to rice in extensive areas throughout Asia. Biotic characteristics like monophagy, dual wing forms, and annual long-distance migration imply a critical role of chemoreception in N. lugens. In this study, we cloned the full-length CSP8 gene from N. lugens. Protein sequence analysis indicated that NlugCSP8 shared high sequence resemblance with the CSPs of other insect family members and had the typical four-cysteine signature. Analysis of gene expression indicated that NlugCSP8 mRNA was specifically expressed in the wings of mated 3-day brachypterous females with a 175-fold difference compare to unmated 3-day brachypterous females. The NlugCSP8 mRNA was also highly expressed in the abdomen of unmated 5-day brachypterous males and correlated to the age, gender, adult wing form, and mating status. A competitive ligand-binding assay demonstrated that ligands with long chain carbon atoms, nerolidol, hexanal, and trans-2-hexenal were able to bind to NlugCSP8 in declining order of affinity. By using bioinformatics techniques, three-dimensional protein structure modeling and molecular docking, the binding sites of NlugCSP8 to the volatiles which had high binding affinity were predicted. In addition, behavioral experiments using the compounds displaying the high binding affinity for the NlugCSP8, revealed four compounds able to elicit significant behavioral responses from N. lugens. The in vivo functions of NlugCSP8 were further confirmed through the testing of RNAi and post-RNAi behavioral experiments. The results revealed that reduction in NlugCSP8 transcript abundance caused a decrease in behavioral response to representative attractants. An enhanced understanding of the NlugCSP8 is expected to contribute in the improvement of more effective and eco-friendly control strategies of BPH. PMID:29706901
NASA Astrophysics Data System (ADS)
Fong-Ngern, Kedsarin; Thongboonkerd, Visith
2016-10-01
To search for a strategy to prevent kidney stone formation/recurrence, this study addressed the role of α-enolase on apical membrane of renal tubular cells in mediating calcium oxalate monohydrate (COM) crystal adhesion. Its presence on apical membrane and in COM crystal-bound fraction was confirmed by Western blotting and immunofluorescence staining. Pretreating MDCK cells with anti-α-enolase antibody, not isotype-controlled IgG, dramatically reduced cell-crystal adhesion. Immunofluorescence staining also confirmed the direct binding of purified α-enolase to COM crystals at {121} > {100} > {010} crystal faces. Coating COM crystals with urinary proteins diminished the crystal binding capacity to cells and purified α-enolase. Moreover, α-enolase selectively bound to COM, not other crystals. Chemico-protein interactions analysis revealed that α-enolase interacted directly with Ca2+ and Mg2+. Incubating the cells with Mg2+ prior to cell-crystal adhesion assay significantly reduced crystal binding on the cell surface, whereas preincubation with EDTA, a divalent cation chelator, completely abolished Mg2+ effect, indicating that COM and Mg2+ competitively bind to α-enolase. Taken together, we successfully confirmed the role of α-enolase as a COM crystal receptor to mediate COM crystal adhesion at apical membrane of renal tubular cells. It may also serve as a target for stone prevention by blocking cell-crystal adhesion and stone nidus formation.
Probing the interaction of the phytochemical 6-gingerol from the spice ginger with DNA.
Haris, Poovvathingal; Mary, Varughese; Sudarsanakumar, Chellappanpillai
2018-07-01
6-Gingerol [5-hydroxy-1-(4-hydroxy-3-methoxyphenyl) decan-3-one], the bio-active ingredient of the popular Indian spice ginger (Zingiber officinale Roscoe), is well-known for its pharmacological and physiological actions. The potent antioxidant, antiemetic, antiulcer, antimicrobial, analgesic, hypoglycemic, antihypertensive, antihyperlipidemic, immunostimulant, anti-inflammatory, cardiotonic, and cancer prevention activities of 6-Gingerol has been investigated and explored. 6-Gingerol is a good candidate for the treatment of various cancers including prostrate, pancreatic, breast, skin, gastrointestinal, pulmonary, and renal cancer. In this study we report for the first time the molecular recognition of 6-Gingerol with calf thymus DNA (ctDNA) through experimental and molecular modeling techniques confirming a minor groove binding mode of 6-Gingerol with ctDNA. Fluorescence and UV-vis spectroscopic studies confirm the complex formation of 6-gingerol with ctDNA. The energetics and thermodynamics of the interaction of 6-Gingerol with ctDNA was explored by Isothermal Titration Calorimetry (ITC) and Differential Scanning Calorimetry (DSC). The ctDNA helix melting upon 6-Gingerol binding was examined by melting temperature T m analysis. Further the electrophoretic mobility shift assay confirms a possible groove binding of 6-Gingerol with ctDNA. Molecular docking and Molecular dynamics (MD) studies provide a detailed understanding on the interaction of 6-Gingerol binding in the minor groove of DNA which supports experimental results. Copyright © 2018. Published by Elsevier B.V.
Chan, Marion M; Gray, Brian D; Pak, Koon Y; Fong, Dunne
2015-03-09
Development of non-invasive molecular imaging techniques that are based on cellular changes in inflammation has been of active interest for arthritis diagnosis. This technology will allow real-time detection of tissue damage and facilitate earlier treatment of the disease, thus representing an improvement over X-rays, which detect bone damage at the advanced stage. Tracing apoptosis, an event occurring in inflammation, has been a strategy used. PSVue 794 is a low-molecular-weight, near-infrared (NIR)-emitting complex of bis(zinc2+-dipicolylamine) (Zn-DPA) that binds to phosphatidylserine (PS), a plasma membrane anionic phospholipid that becomes flipped externally upon cell death by apoptosis. In this study, we evaluated the capacity of PSVue 794 to act as an in vivo probe for non-invasive molecular imaging assessment of rheumatoid arthritis (RA) via metabolic function in murine collagen-induced arthritis, a widely adopted animal model for RA. Male DBA/1 strain mice were treated twice with chicken collagen type II in Freund's adjuvant. Their arthritis development was determined by measuring footpad thickness and confirmed with X-ray analysis and histology. In vivo imaging was performed with the NIR dye and the LI-COR Odyssey Image System. The level of emission was compared among mice with different disease severity, non-arthritic mice and arthritic mice injected with a control dye without the Zn-DPA targeting moiety. Fluorescent emission correlated reliably with the degree of footpad swelling and the manifestation of arthritis. Ex vivo examination showed emission was from the joint. Specificity of binding was confirmed by the lack of emission when arthritic mice were given the control dye. Furthermore, the PS-binding protein annexin V displaced the NIR dye from binding, and the difference in emission was numerically measurable on a scale. This report introduces an economical alternative method for assessing arthritis non-invasively in murine models. Inflammation in feet and ankles can be measured longitudinally using the PSVue 794 probe for cell death and with a commonly available multipurpose imager. This technique provides metabolic and functional information that anatomical measurement of footpad swelling or visual determination of arthritic index cannot. It also may decrease the number of animals required per experiment because tissue damage will not necessarily require evaluation by harvesting joints for histology.
How much does emotional valence of action outcomes affect temporal binding?
Moreton, Joshua; Callan, Mitchell J; Hughes, Gethin
2017-03-01
Temporal binding refers to the compression of the perceived time interval between voluntary actions and their sensory consequences. Research suggests that the emotional content of an action outcome can modulate the effects of temporal binding. We attempted to conceptually replicate these findings using a time interval estimation task and different emotionally-valenced action outcomes (Experiments 1 and 2) than used in previous research. Contrary to previous findings, we found no evidence that temporal binding was affected by the emotional valence of action outcomes. After validating our stimuli for equivalence of perceived emotional valence and arousal (Experiment 3), in Experiment 4 we directly replicated Yoshie and Haggard's (2013) original experiment using sound vocalizations as action outcomes and failed to detect a significant effect of emotion on temporal binding. These studies suggest that the emotional valence of action outcomes exerts little influence on temporal binding. The potential implications of these findings are discussed. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Patsalo, Vadim; Raleigh, Daniel P.; Green, David F.
2011-01-01
Cyanovirin-N (CVN) is an 11-kDa pseudo-symmetric cyanobacterial lectin that has been shown to inhibit infection by the Human Immunodeficiency Virus (HIV) by binding to high-mannose oligosaccharides on the surface of the viral envelope glycoprotein gp120. In this work we describe rationally-designed CVN variants that stabilize the protein fold while maintaining high affinity and selectivity for their glycan targets. Poisson–Boltzmann calculations and protein repacking algorithms were used to select stabilizing mutations in the protein core. By substituting the buried polar side chains of Ser11, Ser20, and Thr61 with aliphatic groups, we stabilized CVN by nearly 12 °C against thermal denaturation, and by 1 m of GuaHCl against chemical denaturation, relative to a previously-characterized stabilized mutant. Glycan microarray binding experiments confirmed that the specificity profile of carbohydrate binding is unperturbed by the mutations, and is identical for all variants. In particular, the variants selectively bound glycans containing the Manα(1→2)Man linkage, which is the known minimal binding unit of CVN. We also report the slow denaturation kinetics of CVN and show that they can complicate thermodynamic analysis; in particular, the unfolding of CVN cannot be described as a fixed two-state transition. Accurate thermodynamic parameters are needed to describe the complicated free energy landscape of CVN, and we provide updated values for CVN unfolding. PMID:22032696
Stochastic steps in secondary active sugar transport
Adelman, Joshua L.; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D. F.; Choe, Seungho; Abramson, Jeff; Rosenberg, John M.; Wright, Ernest M.; Grabe, Michael
2016-01-01
Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state. PMID:27325773
Stochastic steps in secondary active sugar transport.
Adelman, Joshua L; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D F; Choe, Seungho; Abramson, Jeff; Rosenberg, John M; Wright, Ernest M; Grabe, Michael
2016-07-05
Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state.
Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R
1992-01-01
A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484
Jurewicz, Anna; Domowicz, Malgorzata; Galazka, Grazyna; Raine, Cedric S; Selmaj, Krzysztof
2017-10-01
A lot of available data on lipid immunology in multiple sclerosis (MS) have been derived from studies using synthetic lipids, therefore the role of lipids in the immunopathogenesis of MS remains poorly defined. The present study on the lipid response in MS was performed on native lipids from autopsied brain tissue. For this, lipid fractions (n = 9) were prepared from MS (n = 3) and control (n = 2) white matter according to the Folch procedure and were characterized depending on their solubility in chloroform/methanol. TLC showed that, in brain from MS cases, neutral lipids were rich in cholesterol and cholesterol esters while lipids from control brains displayed a predominance of phospholipids. MS serum IgG and IgM were found to bind to MS brain lipid fractions with a higher efficacy (p < 0.05) than the control serum. F(ab) 2 fractionation revealed that MS serum IgG binding depended on a specific antibody-type of recognition. Pre-adsorption of serum with cholesterol, galactocerebrosides, sulfitides, and phosphatidylinositol prior to ELISA with MS brain lipids, showed that cholesterol diminished IgG and IgM binding up to 70%. Experiments with synthetic lipids confirmed the predominance of cholesterol binding by MS serum. Our results demonstrate that IgG and IgM fractions from MS serum specifically and predominantly recognize native cholesterol and cholesterol esters isolated from the brain tissue of patients with MS. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Cell cycle-dependent transcription factors control the expression of yeast telomerase RNA.
Dionne, Isabelle; Larose, Stéphanie; Dandjinou, Alain T; Abou Elela, Sherif; Wellinger, Raymund J
2013-07-01
Telomerase is a specialized ribonucleoprotein that adds repeated DNA sequences to the ends of eukaryotic chromosomes to preserve genome integrity. Some secondary structure features of the telomerase RNA are very well conserved, and it serves as a central scaffold for the binding of associated proteins. The Saccharomyces cerevisiae telomerase RNA, TLC1, is found in very low copy number in the cell and is the limiting component of the known telomerase holoenzyme constituents. The reasons for this low abundance are unclear, but given that the RNA is very stable, transcriptional control mechanisms must be extremely important. Here we define the sequences forming the TLC1 promoter and identify the elements required for its low expression level, including enhancer and repressor elements. Within an enhancer element, we found consensus sites for Mbp1/Swi4 association, and chromatin immunoprecipitation (ChIP) assays confirmed the binding of Mbp1 and Swi4 to these sites of the TLC1 promoter. Furthermore, the enhancer element conferred cell cycle-dependent regulation to a reporter gene, and mutations in the Mbp1/Swi4 binding sites affected the levels of telomerase RNA and telomere length. Finally, ChIP experiments using a TLC1 RNA-binding protein as target showed cell cycle-dependent transcription of the TLC1 gene. These results indicate that the budding yeast TLC1 RNA is transcribed in a cell cycle-dependent fashion late in G1 and may be part of the S phase-regulated group of genes involved in DNA replication.
Krieger, Miriam; Felder, Stefan
2013-06-19
Rather than conforming to the assumption of perfect rationality in neoclassical economic theory, decision behavior has been shown to display a host of systematic biases. Properly understood, these patterns can be instrumentalized to improve outcomes in the public realm. We conducted a laboratory experiment to study whether decisions over health insurance policies are subject to status quo bias and, if so, whether experience mitigates this framing effect. Choices in two treatment groups with status quo defaults are compared to choices in a neutrally framed control group. A two-step design features sorting of subjects into the groups, allowing us to control for selection effects due to risk preferences. The results confirm the presence of a status quo bias in consumer choices over health insurance policies. However, this effect of the default framing does not persist as subjects repeat this decision in later periods of the experiment. Our results have implications for health care policy, for example suggesting that the use of non-binding defaults in health insurance can facilitate the spread of co-insurance policies and thereby help contain health care expenditure.
Artificial intelligence systems based on texture descriptors for vaccine development.
Nanni, Loris; Brahnam, Sheryl; Lumini, Alessandra
2011-02-01
The aim of this work is to analyze and compare several feature extraction methods for peptide classification that are based on the calculation of texture descriptors starting from a matrix representation of the peptide. This texture-based representation of the peptide is then used to train a support vector machine classifier. In our experiments, the best results are obtained using local binary patterns variants and the discrete cosine transform with selected coefficients. These results are better than those previously reported that employed texture descriptors for peptide representation. In addition, we perform experiments that combine standard approaches based on amino acid sequence. The experimental section reports several tests performed on a vaccine dataset for the prediction of peptides that bind human leukocyte antigens and on a human immunodeficiency virus (HIV-1). Experimental results confirm the usefulness of our novel descriptors. The matlab implementation of our approaches is available at http://bias.csr.unibo.it/nanni/TexturePeptide.zip.
Profilin as a regulator of the membrane-actin cytoskeleton interface in plant cells
Sun, Tiantian; Li, Shanwei; Ren, Haiyun
2013-01-01
Membrane structures and cytoskeleton dynamics are intimately inter-connected in the eukaryotic cell. Recently, the molecular mechanisms operating at this interface have been progressively addressed. Many experiments have revealed that the actin cytoskeleton can interact with membranes through various discrete membrane domains. The actin-binding protein, profilin has been proven to inhibit actin polymerization and to promote F-actin elongation. This is dependent on many factors, such as the profilin/G-actin ratio and the ionic environment of the cell. Additionally, profilin has specific domains that interact with phosphoinositides and poly-L-proline rich proteins; theoretically, this gives profilin the opportunity to interact with membranes, and a large number of experiments have confirmed this possibility. In this article, we summarize recent findings in plant cells, and discuss the evidence of the connections among actin cytoskeleton, profilin and biomembranes through direct or indirect relationships. PMID:24391654
Staphylococcus aureus adherence to Candida albicans hyphae is mediated by the hyphal adhesin Als3p.
Peters, Brian M; Ovchinnikova, Ekaterina S; Krom, Bastiaan P; Schlecht, Lisa Marie; Zhou, Han; Hoyer, Lois L; Busscher, Henk J; van der Mei, Henny C; Jabra-Rizk, Mary Ann; Shirtliff, Mark E
2012-12-01
The bacterium Staphylococcus (St.) aureus and the opportunistic fungus Candida albicans are currently among the leading nosocomial pathogens, often co-infecting critically ill patients, with high morbidity and mortality. Previous investigations have demonstrated preferential adherence of St. aureus to C. albicans hyphae during mixed biofilm growth. In this study, we aimed to characterize the mechanism behind this observed interaction. C. albicans adhesin-deficient mutant strains were screened by microscopy to identify the specific receptor on C. albicans hyphae recognized by St. aureus. Furthermore, an immunoassay was developed to validate and quantify staphylococcal binding to fungal biofilms. The findings from these experiments implicated the C. albicans adhesin agglutinin-like sequence 3 (Als3p) in playing a major role in the adherence process. This association was quantitatively established using atomic force microscopy, in which the adhesion force between single cells of the two species was significantly reduced for a C. albicans mutant strain lacking als3. Confocal microscopy further confirmed these observations, as St. aureus overlaid with a purified recombinant Als3 N-terminal domain fragment (rAls3p) exhibited robust binding. Importantly, a strain of Saccharomyces cerevisiae heterologously expressing Als3p was utilized to further confirm this adhesin as a receptor for St. aureus. Although the parental strain does not bind bacteria, expression of Als3p on the cell surface conferred upon the yeast the ability to strongly bind St. aureus. To elucidate the implications of these in vitro findings in a clinically relevant setting, an ex vivo murine model of co-infection was designed using murine tongue explants. Fluorescent microscopic images revealed extensive hyphal penetration of the epithelium typical of C. albicans mucosal infection. Interestingly, St. aureus bacterial cells were only seen within the epithelial tissue when associated with the invasive hyphae. This differed from tongues infected with St. aureus alone or in conjunction with the als3 mutant strain of C. albicans, where bacterial presence was limited to the outer layers of the oral tissue. Collectively, the findings generated from this study identified a key role for C. albicans Als3p in mediating this clinically relevant fungal-bacterial interaction.
Ayoub, Ahmed Taha; Abou El-Magd, Rabab M; Xiao, Jack; Lewis, Cody Wayne; Tilli, Tatiana Martins; Arakawa, Kenji; Nindita, Yosi; Chan, Gordon; Sun, Luxin; Glover, Mark; Klobukowski, Mariusz; Tuszynski, Jack
2016-10-27
Lankacidin group antibiotics show strong antimicrobial activity against various Gram-positive bacteria. In addition, they were shown to have considerable antitumor activity against certain cell line models. For decades, the antitumor activity of lankacidin was associated with the mechanism of its antimicrobial action, which is interference with peptide bond formation during protein synthesis. This, however, was never confirmed experimentally. Due to significant similarity to paclitaxel-like hits in a previous computational virtual screening study, we suggested that the cytotoxic effect of lankacidin is due to a paclitaxel-like action. In this study, we tested this hypothesis computationally and experimentally and confirmed that lankacidin is a microtubule stabilizer that enhances tubulin assembly and displaces taxoids from their binding site. This study serves as a starting point for optimization of lankacidin derivatives for better antitumor activities. It also highlights the power of computational predictions and their aid in guiding experiments and formulating rigorous hypotheses.
Zhang, Bo; Wang, Jingnan; Ning, Shuqing; Yuan, Quan; Chen, Xiangning; Zhang, Yanyan; Fan, Junfeng
2018-01-15
This study confirmed the anti-fungal effect of trypsin-treated Bacillus subtilis culture (BC) (tryptic hydrolysate, TH) on mold growth on Kyoho grapes. We examined the anti-fungal activity of TH by identifying TH peptides and performing a computational docking analysis. TH was more potent than untreated BC in suppressing fungal growth on grapes. Specifically, TH maintained grape freshness by inhibiting respiration and rachis browning, maintaining firmness, and preventing weight loss. Thirty-six inhibitory peptides against β-1,3-glucan synthase (GS) were screened from 126 TH peptides identified through proteomic analysis. Among them, 13 peptides bound tightly to GS active pockets with lower binding energies than that of GppNHp. The most potent peptides, LFEIDEELNEK and FATSDLNDLYR, were synthesized, and further experiments showed that these peptides had a highly suppressive effect on GS activity and Aspergillus niger and Penicillium chrysogenum growth. Our results confirm that tryptic treatment is effective for improving the anti-fungal activity of BC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.
Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F
1995-12-01
Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.
Caseoperoxidase, mixed β-casein-SDS-hemin-imidazole complex: a nano artificial enzyme.
Moosavi-Movahedi, Zainab; Gharibi, Hussein; Hadi-Alijanvand, Hamid; Akbarzadeh, Mohammad; Esmaili, Mansoore; Atri, Maliheh S; Sefidbakht, Yahya; Bohlooli, Mousa; Nazari, Khodadad; Javadian, Soheila; Hong, Jun; Saboury, Ali A; Sheibani, Nader; Moosavi-Movahedi, Ali A
2015-01-01
A novel peroxidase-like artificial enzyme, named "caseoperoxidase", was biomimetically designed using a nano artificial amino acid apo-protein hydrophobic pocket. This four-component nano artificial enzyme containing heme-imidazole-β-casein-SDS exhibited high activity growth and k(cat) performance toward the native horseradish peroxidase demonstrated by the steady state kinetics using UV-vis spectrophotometry. The hydrophobicity and secondary structure of the caseoperoxidase were studied by ANS fluorescence and circular dichroism spectroscopy. Camel β-casein (Cβ-casein) was selected as an appropriate apo-protein for the heme active site because of its innate flexibility and exalted hydrophobicity. This selection was confirmed by homology modeling method. Heme docking into the newly obtained Cβ-casein structure indicated one heme was mainly incorporated with Cβ-casein. The presence of a main electrostatic site for the active site in the Cβ-casein was also confirmed by experimental methods through Wyman binding potential and isothermal titration calorimetry. The existence of Cβ-casein protein in this biocatalyst lowered the suicide inactivation and provided a suitable protective role for the heme active-site. Additional experiments confirmed the retention of caseoperoxidase structure and function as an artificial enzyme.
Umari, P; Petrenko, O; Taioli, S; De Souza, M M
2012-05-14
Electronic band gaps for optically allowed transitions are calculated for a series of semiconducting single-walled zig-zag carbon nanotubes of increasing diameter within the many-body perturbation theory GW method. The dependence of the evaluated gaps with respect to tube diameters is then compared with those found from previous experimental data for optical gaps combined with theoretical estimations of exciton binding energies. We find that our GW gaps confirm the behavior inferred from experiment. The relationship between the electronic gap and the diameter extrapolated from the GW values is also in excellent agreement with a direct measurement recently performed through scanning tunneling spectroscopy.
Analyzing Ligand Depletion in a Saturation Equilibrium Binding Experiment
ERIC Educational Resources Information Center
Claro, Enrique
2006-01-01
I present a proposal for a laboratory practice to generate and analyze data from a saturation equilibrium binding experiment addressed to advanced undergraduate students. [[superscript 3]H]Quinuclidinyl benzilate is a nonselective muscarinic ligand with very high affinity and very low nonspecific binding to brain membranes, which contain a high…
Nallapareddy, Sreedhar R; Weinstock, George M; Murray, Barbara E
2003-03-01
A collagen-binding adhesin of Enterococcus faecium, Acm, was identified. Acm shows 62% similarity to the Staphylococcus aureus collagen adhesin Cna over the entire protein and is more similar to Cna (60% and 75% similarity with Cna A and B domains respectively) than to the Enterococcus faecalis collagen-binding adhesin, Ace, which shares homology with Acm only in the A domain. Despite the detection of acm in 32 out of 32 E. faecium isolates, only 11 of these (all clinical isolates, including four vancomycin-resistant endocarditis isolates and seven other isolates) exhibited binding to collagen type I (CI). Although acm from three CI-binding vancomycin-resistant E. faecium clinical isolates showed 100% identity, analysis of acm genes and their promoter regions from six non-CI-binding strains identified deletions or mutations that introduced stop codons and/or IS elements within the gene or the promoter region in five out of six strains, suggesting that the presence of an intact functional acm gene is necessary for binding of E. faecium strains to CI. Recombinant Acm A domain showed specific and concentration-dependent binding to collagen, and this protein competed with E. faecium binding to immobilized CI. Consistent with the adherence phenotype and sequence data, probing with Acm-specific IgGs purified from anti-recombinant Acm A polyclonal rabbit serum confirmed the surface expression of Acm in three out of three collagen-binding clinical isolates of E. faecium tested, but in none of the strains with a non-functional pseudo acm gene. Introduction of a functional acm gene into two non-CI-binding natural acm mutant strains conferred a CI-binding phenotype, further confirming that native Acm is sufficient for the binding of E. faecium to CI. These results demonstrate that acm, which encodes a potential virulence factor, is functional only in certain infection-derived clinical isolates of E. faecium, and suggest that Acm is the primary adhesin responsible for the ability of E. faecium to bind collagen.
Walsh, Adrian A
2017-01-01
Gold nanoparticles have been available for many years as a research tool in the life sciences due to their electron density and optical properties. New applications are continually being developed, particularly in nanomedicine. One drawback is the need for an easy, real-time quantitation method for gold nanoparticles so that the effects observed in in vitro cell toxicity assays and cell uptake studies can be interpreted quantitatively in terms of nanoparticle loading. One potential method of quantifying gold nanoparticles in real time is by chemisorption of iodine-125, a gamma emitter, to the nanoparticles. This paper revisits the labelling of gold nanoparticles with iodine-125, first described 30 years ago and never fully exploited since. We explore the chemical properties and usefulness in quantifying bio-functionalised gold nanoparticle binding in a quick and simple manner. The gold particles were labelled specifically and quantitatively simply by mixing the two items. The nature of the labelling is chemisorption and is robust, remaining bound over several weeks in a variety of cell culture media. Chemisorption was confirmed as potassium iodide can remove the label whereas sodium chloride and many other buffers had no effect. Particles precoated in polymers or proteins can be labelled just as efficiently allowing for post-labelling experiments in situ rather than using radioactive gold atoms in the production process. We also demonstrate that interparticle exchange of I-125 between different size particles does not appear to take place confirming the affinity of the binding.
The sodium chloride cotransporter (NCC) and epithelial sodium channel (ENaC) associate.
Mistry, Abinash C; Wynne, Brandi M; Yu, Ling; Tomilin, Viktor; Yue, Qiang; Zhou, Yiqun; Al-Khalili, Otor; Mallick, Rickta; Cai, Hui; Alli, Abdel A; Ko, Benjamin; Mattheyses, Alexa; Bao, Hui-Fang; Pochynyuk, Oleh; Theilig, Franziska; Eaton, Douglas C; Hoover, Robert S
2016-10-01
The thiazide-sensitive sodium chloride cotransporter (NCC) and the epithelial sodium channel (ENaC) are two of the most important determinants of salt balance and thus systemic blood pressure. Abnormalities in either result in profound changes in blood pressure. There is one segment of the nephron where these two sodium transporters are coexpressed, the second part of the distal convoluted tubule. This is a key part of the aldosterone-sensitive distal nephron, the final regulator of salt handling in the kidney. Aldosterone is the key hormonal regulator for both of these proteins. Despite these shared regulators and coexpression in a key nephron segment, associations between these proteins have not been investigated. After confirming apical localization of these proteins, we demonstrated the presence of functional transport proteins and native association by blue native PAGE. Extensive coimmunoprecipitation experiments demonstrated a consistent interaction of NCC with α- and γ-ENaC. Mammalian two-hybrid studies demonstrated direct binding of NCC to ENaC subunits. Fluorescence resonance energy transfer and immunogold EM studies confirmed that these transport proteins are within appropriate proximity for direct binding. Additionally, we demonstrate that there are functional consequences of this interaction, with inhibition of NCC affecting the function of ENaC. This novel finding of an association between ENaC and NCC could alter our understanding of salt transport in the distal tubule. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Loimaranta, Vuokko; Hytönen, Jukka; Pulliainen, Arto T.; Sharma, Ashu; Tenovuo, Jorma; Strömberg, Nicklas; Finne, Jukka
2009-01-01
Scavenger receptors are innate immune molecules recognizing and inducing the clearance of non-host as well as modified host molecules. To recognize a wide pattern of invading microbes, many scavenger receptors bind to common pathogen-associated molecular patterns, such as lipopolysaccharides and lipoteichoic acids. Similarly, the gp340/DMBT1 protein, a member of the human scavenger receptor cysteine-rich protein family, displays a wide ligand repertoire. The peptide motif VEVLXXXXW derived from its scavenger receptor cysteine-rich domains is involved in some of these interactions, but most of the recognition mechanisms are unknown. In this study, we used mass spectrometry sequencing, gene inactivation, and recombinant proteins to identify Streptococcus pyogenes protein Spy0843 as a recognition receptor of gp340. Antibodies against Spy0843 are shown to protect against S. pyogenes infection, but no function or host receptor have been identified for the protein. Spy0843 belongs to the leucine-rich repeat (Lrr) family of eukaryotic and prokaryotic proteins. Experiments with truncated forms of the recombinant proteins confirmed that the Lrr region is needed in the binding of Spy0843 to gp340. The same motif of two other Lrr proteins, LrrG from the Gram-positive S. agalactiae and BspA from the Gram-negative Tannerella forsythia, also mediated binding to gp340. Moreover, inhibition of Spy0843 binding occurred with peptides containing the VEVLXXXXW motif, but also peptides devoid of the XXXXW motif inhibited binding of Lrr proteins. These results thus suggest that the conserved Lrr motif in bacterial proteins serves as a novel pattern recognition motif for unique core peptides of human scavenger receptor gp340. PMID:19465482
Ho, Chien; Baldassare, Joseph J.; Charache, Samuel
1970-01-01
The spin label technique has been used to study human hemoglobins A, F, Zürich, and Chesapeake as a function of carbon monoxide saturation. The experimental results suggest that the changes in the electron paramagnetic resonance spectra of hemoglobin labeled with N-(1-oxyl-2,2,6,6-tetramethyl-4-piperidinyl)iodoacetamide depend on the state of ligation of more than one heme group. For those hemoglobins with full or large cooperative ligand binding (such as A, F, and Zürich), there is a lack of isosbestic points in the spectra as a function of CO saturation. However, for those hemoglobins with little or no cooperative ligand binding (such as Chesapeake and methemoglobins), there is a sharp set of isosbestic points. These findings confirm and extend the early work of McConnell and co-workers. The absence of a set of isosbestic points in those hemoglobins with full cooperative ligand binding is consistent with the sequential model of Koshland, Némethy, and Filmer for cooperative oxygen binding to hemoglobin. The present results, with hemoglobin variants having known amino acid substitutions, also focus on the importance of the interactions among the amino acid residues located at α1-β2 or α2-β1 subunit contacts for the functioning of hemoglobin as an oxygen carrier. In addition, the resonance spectra of the spin label are very sensitive to small structural variations around the heme groups in the β- or γ-chains where the labels are attached. The results of the spin label experiment are discussed in relation to recent findings on the mechanism of oxygenation of hemoglobin from the nuclear magnetic resonance studies of this laboratory and the x-ray crystallographic analysis of Perutz and co-workers. PMID:4316679
Anklesaria, Jenifer H.; Jagtap, Dhanashree D.; Pathak, Bhakti R.; Kadam, Kaushiki M.; Joseph, Shaini; Mahale, Smita D.
2013-01-01
Prostate Secretory Protein of 94 amino acids (PSP94) is one of the major proteins present in the human seminal plasma. Though several functions have been predicted for this protein, its exact role either in sperm function or in prostate pathophysiology has not been clearly defined. Attempts to understand the mechanism of action of PSP94 has led to the search for its probable binding partners. This has resulted in the identification of PSP94 binding proteins in plasma and seminal plasma from human. During the chromatographic separation step of proteins from human seminal plasma by reversed phase HPLC, we had observed that in addition to the main fraction of PSP94, other fractions containing higher molecular weight proteins also showed the presence of detectable amounts of PSP94. This prompted us to hypothesize that PSP94 could be present in the seminal plasma complexed with other protein/s of higher molecular weight. One such fraction containing a major protein of ∼47 kDa, on characterization by mass spectrometric analysis, was identified to be Prostatic Acid Phosphatase (PAP). The ability of PAP present in this fraction to bind to PSP94 was demonstrated by affinity chromatography. Co-immunoprecipitation experiments confirmed the presence of PSP94-PAP complex both in the fraction studied and in the fresh seminal plasma. In silico molecular modeling of the PSP94-PAP complex suggests that β-strands 1 and 6 of PSP94 appear to interact with domain 2 of PAP, while β-strands 7 and 10 with domain 1 of PAP. This is the first report which suggests that PSP94 can bind to PAP and the PAP-bound PSP94 is present in human seminal plasma. PMID:23469287
CYP2E1 hydroxylation of aniline involves negative cooperativity.
Hartman, Jessica H; Knott, Katie; Miller, Grover P
2014-02-01
CYP2E1 plays a role in the metabolic activation and elimination of aniline, yet there are conflicting reports on its mechanism of action, and hence relevance, in aniline metabolism. Based on our work with similar compounds, we hypothesized that aniline binds two CYP2E1 sites during metabolism resulting in cooperative reaction kinetics and tested this hypothesis through rigorous in vitro studies. The kinetic profile for recombinant CYP2E1 demonstrated significant negative cooperativity based on a fit of data to the Hill equation (n=0.56). Mechanistically, the data were best explained through a two-binding site cooperative model in which aniline binds with high affinity (K(s)=30 μM) followed by a second weaker binding event (K(ss)=1100 uM) resulting in a threefold increase in the oxidation rate. Binding sites for aniline were confirmed by inhibition studies with 4-methylpyrazole. Inhibitor phenotyping experiments with human liver microsomes validated the central role for CYP2E1 in aniline hydroxylation and indicated minor roles for CYP2A6 and CYP2C9. Importantly, inhibition of minor metabolic pathways resulted in a kinetic profile for microsomal CYP2E1 that replicated the preferred mechanism and parameters observed with the recombinant enzyme. Scaled modeling of in vitro CYP2E1 metabolism of aniline to in vivo clearance, especially at low aniline levels, led to significant deviations from the traditional model based on non-cooperative, Michaelis-Menten kinetics. These findings provide a critical mechanistic perspective on the potential importance of CYP2E1 in the metabolic activation and elimination of aniline as well as the first experimental evidence of a negatively cooperative metabolic reaction catalyzed by CYP2E1. Copyright © 2013 Elsevier Inc. All rights reserved.
Herbert, Kristina M; Sarkar, Susanta K; Mills, Maria; Delgado De la Herran, Hilda C; Neuman, Keir C; Steitz, Joan A
2016-02-01
During microRNA (miRNA) biogenesis, the Microprocessor complex (MC), composed minimally of Drosha, an RNaseIII enzyme, and DGCR8, a double-stranded RNA-binding protein, cleaves the primary-miRNA (pri-miRNA) to release the pre-miRNA stem-loop structure. Size-exclusion chromatography of the MC, isolated from mammalian cells, suggested multiple copies of one or both proteins in the complex. However, the exact stoichiometry was unknown. Initial experiments suggested that DGCR8 bound pri-miRNA substrates specifically, and given that Drosha could not be bound or cross-linked to RNA, a sequential model for binding was established in which DGCR8 bound first and recruited Drosha. Therefore, many laboratories have studied DGCR8 binding to RNA in the absence of Drosha and have shown that deletion constructs of DGCR8 can multimerize in the presence of RNA. More recently, it was demonstrated that Drosha can bind pri-miRNA substrates in the absence of DGCR8, casting doubt on the sequential model of binding. In the same study, using a single-molecule photobleaching assay, fluorescent protein-tagged deletion constructs of DGCR8 and Drosha assembled into a heterotrimeric complex on RNA, comprising two DGCR8 molecules and one Drosha molecule. To determine the stoichiometry of Drosha and DGCR8 within the MC in the absence of added RNA, we also used a single-molecule photobleaching assay and confirmed the heterotrimeric model of the human MC. We demonstrate that a heterotrimeric complex is likely preformed in the absence of RNA and exists even when full-length proteins are expressed and purified from human cells, and when hAGT-derived tags are used rather than fluorescent proteins. © 2016 Herbert et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Prokopowicz, Małgorzata; Greń, Bartosz; Cieśla, Joanna; Kierdaszuk, Borys
2017-11-01
The aim of this study is threefold: (1) augmentation of the knowledge of the E. coli PNP binding mechanism; (2) explanation of the previously observed 'lack of FRET' phenomenon and (3) an introduction of the correction (modified method) for FRET efficiency calculation in the PNP-FA complexes. We present fluorescence studies of the two E. coli PNP mutants (F159Y and F159A) with formycin A (FA), that indicate that the aromatic amino acid is indispensable in the nucleotide binding, additional hydroxyl group at position 159 probably enhances the strength of binding and that the amino acids pair 159-160 has a great impact on the spectroscopic properties of the enzyme. The experiments were carried out in hepes and phosphate buffers, at pH7 and 8.3. Two methods, a conventional and a modified one, that utilizes the dissociation constant, for calculations of the energy transfer efficiency (E) and the acceptor-to-donor distance (r) between FA and the Tyr (energy donor) were employed. Total difference spectra were calculated for emission spectra (λ ex 280nm, 295nm, 305nm and 313nm) for all studied systems. Time-resolved techniques allowed to conclude the existence of a specific structure formed by amino acids at positions 159 and 160. The results showed an unexpected pattern change of FRET in the mutants, when compared to the wild type enzyme and a probable presence of a structure created between 159 and 160 residue, that might influence the binding efficiency. Additionally, we confirmed the indispensable role of the modification of the FRET efficiency (E) calculation on the fraction of enzyme saturation in PNP-FA systems. Copyright © 2017 Elsevier B.V. All rights reserved.
Saleem, Muhammad; Prince, Stephen M.; Rigby, Stephen E. J.; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C. J.; Feavers, Ian M.; Derrick, Jeremy P.
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe3+ with high affinity. EPR spectra of the bound Fe3+ ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe3+ binding was reduced or abolished on mutation of the Fe3+-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe3+. The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a ‘molecular decoy’ to distract immune surveillance. PMID:23457610
Saleem, Muhammad; Prince, Stephen M; Rigby, Stephen E J; Imran, Muhammad; Patel, Hema; Chan, Hannah; Sanders, Holly; Maiden, Martin C J; Feavers, Ian M; Derrick, Jeremy P
2013-01-01
FrpB is an outer membrane transporter from Neisseria meningitidis, the causative agent of meningococcal meningitis. It is a member of the TonB-dependent transporter (TBDT) family and is responsible for iron uptake into the periplasm. FrpB is subject to a high degree of antigenic variation, principally through a region of hypervariable sequence exposed at the cell surface. From the crystal structures of two FrpB antigenic variants, we identify a bound ferric ion within the structure which induces structural changes on binding which are consistent with it being the transported substrate. Binding experiments, followed by elemental analysis, verified that FrpB binds Fe(3+) with high affinity. EPR spectra of the bound Fe(3+) ion confirmed that its chemical environment was consistent with that observed in the crystal structure. Fe(3+) binding was reduced or abolished on mutation of the Fe(3+)-chelating residues. FrpB orthologs were identified in other Gram-negative bacteria which showed absolute conservation of the coordinating residues, suggesting the existence of a specific TBDT sub-family dedicated to the transport of Fe(3+). The region of antigenic hypervariability lies in a separate, external sub-domain, whose structure is conserved in both the F3-3 and F5-1 variants, despite their sequence divergence. We conclude that the antigenic sub-domain has arisen separately as a result of immune selection pressure to distract the immune response from the primary transport function. This would enable FrpB to function as a transporter independently of antibody binding, by using the antigenic sub-domain as a 'molecular decoy' to distract immune surveillance.
Intrinsically-disordered N-termini in human parechovirus 1 capsid proteins bind encapsidated RNA.
Shakeel, Shabih; Evans, James D; Hazelbaker, Mark; Kao, C Cheng; Vaughan, Robert C; Butcher, Sarah J
2018-04-11
Human parechoviruses (HPeV) are picornaviruses with a highly-ordered RNA genome contained within icosahedrally-symmetric capsids. Ordered RNA structures have recently been shown to interact with capsid proteins VP1 and VP3 and facilitate virus assembly in HPeV1. Using an assay that combines reversible cross-linking, RNA affinity purification and peptide mass fingerprinting (RCAP), we mapped the RNA-interacting regions of the capsid proteins from the whole HPeV1 virion in solution. The intrinsically-disordered N-termini of capsid proteins VP1 and VP3, and unexpectedly, VP0, were identified to interact with RNA. Comparing these results to those obtained using recombinantly-expressed VP0 and VP1 confirmed the virion binding regions, and revealed unique RNA binding regions in the isolated VP0 not previously observed in the crystal structure of HPeV1. We used RNA fluorescence anisotropy to confirm the RNA-binding competency of each of the capsid proteins' N-termini. These findings suggests that dynamic interactions between the viral RNA and the capsid proteins modulate virus assembly, and suggest a novel role for VP0.
Li, Qianqian; Wang, Dapeng; Yang, David; Shan, Lei; Tian, Peng
2017-01-01
Histo-blood group antigens (HBGAs) are considered as receptors/co-receptors for human norovirus (HuNoV). It has been reported that binding of HuNoV-derived virus-like particles (VLPs) to HBGA-like molecules-expressing bacteria increased the stability of VLPs to heat-denaturation (HD). In this study, we tested for HBGA-like-binding-conveyed protection against HD on viral replication using Tulane virus (TV) and Escherichia coli O86:H2 (O86:H2), with E. coli K-12 (K-12) used as a control. Expression of HBGA type B was confirmed by ELISA in O86:H2 but not in K-12. Binding of TV was confirmed by ELISA in O86:H2 (P/N = 2.23) but not in K-12 (P/N = 1.90). Pre-incubation of TV with free HBGA could completely inhibit its ability to bind to O86:H2 (p = 0.004), while producing no significant change in its ability to bind K-12 (p = 0.635). We utilized a bacterial-capture-RT-qPCR procedure to confirm that both bacterial strains were capable of binding TV, and that O86:H2 exhibited fivefold greater binding capacity than K-12. Pre-incubation of TV with free HBGA would partially inhibit the binding of TV to O86:H2 (p = 0.047). In contrast, not only did pre-incubation of TV with free HBGA not inhibit the binding of TV to K-12, binding was slightly enhanced (p = 0.13). The viral infectivity assay allowed us to conduct a direct evaluation of the ability of HBGA-like-bound bacteria to confer HD protection to TV. Prior to inoculate to LLC-MK2 cells, TV was incubated with each bacterial strain at ratios of 1:0, 1:1 and 100:1, then both partially and fully HD. The viral amplification was quantitated by RT-qPCR 48 h later. The binding of bacteria to TV reduced viral replication in a dose-dependent matter. We found that neither bound O86:H2 nor K-12 conferred protection of TV against partial or full HD conditions. Partial HD reduction of viral replication was not significantly impacted by the binding of either bacterial strain, with infectivity losses of 99.03, 99.42, 96.32, 96.10, and 98.88% for TV w/o bacteria, TV w/O86:H2 (1:1), TV w/O86:H2 (100:1), TV w/K-12 (1:1), and TV w/K-12 (100:1), respectively. Full HD reduction of viral replication was not impacted by the binding of either bacterial strain, as full loss of infectivity was observed in all cases. PMID:28983282
NASA Astrophysics Data System (ADS)
Gaudio, Anderson Coser; Takahata, Yuji; Richards, William Graham
1998-01-01
The probable binding mode of the herpes simplex virus thymidine kinase (HSV1 TK) N2-[substituted]-phenylguanine inhibitors is proposed. A computational experiment was designed to check some qualitative binding parameters and to calculate the interaction binding energies of alternative binding modes of N2-phenylguanines. The known binding modes of the HSV1 TK natural substrate deoxythymidine and one of its competitive inhibitors ganciclovir were used as templates. Both the qualitative and quantitative parts of the computational experiment indicated that the N2-phenylguanine derivatives bind to the HSV1 TK active site in the deoxythymidine-like binding mode. An experimental observation that N2-phenylguanosine derivatives are not phosphorylated during the interaction with the HSV1 TK gives support to the proposed binding mode.
Liu, Zhihong; García-Díaz, Beatriz; Catacchio, Bruno; Chiancone, Emilia; Vogel, Hans J
2015-11-01
Lysozymes play an important role in host defense by degrading peptidoglycan in the cell envelopes of pathogenic bacteria. Several Gram-negative bacteria can evade this mechanism by producing periplasmic proteins that inhibit the enzymatic activity of lysozyme. The Escherichia coli inhibitor of vertebrate lysozyme, Ivyc and its Pseudomonas aeruginosa homolog, Ivyp1 have been shown to be potent inhibitors of hen egg white lysozyme (HEWL). Since human lysozyme (HL) plays an important role in the innate immune response, we have examined the binding of HL to Ivyc and Ivyp1. Our results show that Ivyp1 is a weaker inhibitor of HL than Ivyc even though they inhibit HEWL with similar potency. Calorimetry experiments confirm that Ivyp1 interacts more weakly with HL than HEWL. Analytical ultracentrifugation studies revealed that Ivyp1 in solution is a monomer and forms a 30kDa heterodimer with both HL and HEWL, while Ivyc is a homodimer that forms a tetramer with both enzymes. The interaction of Ivyp1 with HL was further characterized by NMR chemical shift perturbation experiments. In addition to the characteristic His-containing Ivy inhibitory loop that binds into the active site of lysozyme, an extended loop (P2) between the final two beta-strands also participates in forming protein-protein interactions. The P2 loop is not conserved in Ivyc and it constitutes a flexible region in Ivyp1 that becomes more rigid in the complex with HL. We conclude that differences in the electrostatic interactions at the binding interface between Ivy inhibitors and distinct lysozymes determine the strength of this interaction. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides. Copyright © 2015 Elsevier B.V. All rights reserved.
Hosokawa, Hiroyuki; Dip, Phat Vinh; Merkulova, Maria; Bakulina, Anastasia; Zhuang, Zhenjie; Khatri, Ashok; Jian, Xiaoying; Keating, Shawn M.; Bueler, Stephanie A.; Rubinstein, John L.; Randazzo, Paul A.; Ausiello, Dennis A.; Grüber, Gerhard; Marshansky, Vladimir
2013-01-01
Previously, we reported an acidification-dependent interaction of the endosomal vacuolar H+-ATPase (V-ATPase) with cytohesin-2, a GDP/GTP exchange factor (GEF), suggesting that it functions as a pH-sensing receptor. Here, we have studied the molecular mechanism of signaling between the V-ATPase, cytohesin-2, and Arf GTP-binding proteins. We found that part of the N-terminal cytosolic tail of the V-ATPase a2-subunit (a2N), corresponding to its first 17 amino acids (a2N(1–17)), potently modulates the enzymatic GDP/GTP exchange activity of cytohesin-2. Moreover, this peptide strongly inhibits GEF activity via direct interaction with the Sec7 domain of cytohesin-2. The structure of a2N(1–17) and its amino acids Phe5, Met10, and Gln14 involved in interaction with Sec7 domain were determined by NMR spectroscopy analysis. In silico docking experiments revealed that part of the V-ATPase formed by its a2N(1–17) epitope competes with the switch 2 region of Arf1 and Arf6 for binding to the Sec7 domain of cytohesin-2. The amino acid sequence alignment and GEF activity studies also uncovered the conserved character of signaling between all four (a1–a4) a-subunit isoforms of mammalian V-ATPase and cytohesin-2. Moreover, the conserved character of this phenomenon was also confirmed in experiments showing binding of mammalian cytohesin-2 to the intact yeast V-ATPase holo-complex. Thus, here we have uncovered an evolutionarily conserved function of the V-ATPase as a novel cytohesin-signaling receptor. PMID:23288846
Density functional theory determination of structural and electronic properties of struvite.
Romanowski, Zbigniew; Kempisty, Paweł; Prywer, Jolanta; Krukowski, Stanisław; Torzewska, Agnieszka
2010-07-29
Crystallographic structure, total energy, electronic structure, and the most important elastic properties of struvite, NH(4)MgPO(4).6H(2)O, the main component of infectious urinary stones, are presented. The calculations were performed using ab initio full-electron calculations within the density functional theory-generalized gradient approximation (DFT-GGA) framework. The obtained crystallographic symmetry and the calculated lattice parameters and also the elastic constants are in good agreement with the experimental data. The elastic properties are essential for establishing an optimal response of urinary stones during shock-wave lithotripsy. The calculated electronic charge distribution confirms the layered structure of the struvite crystals. The polar character of the crystal, well-known from crystal growth experiments, was also confirmed by the magnitude of spontaneous polarization which was obtained from direct determination of the electrical dipole density. The calculated value of spontaneous polarization is equal to -8.8 microC cm(-2). This feature may play a key role in struvite crystallization, electrically binding the charged active impurities and other active species, and consequently determining urinary stone formation. We also present the results of our own experiment of the mineralization of struvite induced to growth by Proteus bacteria which are mainly isolated from infectious urinary stones.
Reproduction-associated immunoreactive peptides in the nervous systems of prosobranch gastropods.
Ram, J L; Gallardo, C S; Ram, M L; Croll, R P
1998-12-01
Antibodies against reproductive peptides of Aplysia and Lymnaea were used to localize homologous immunoreactive peptides in the nervous systems of three prosobranch species: Busycon canaliculatum, Concholepas concholepas, and Tegula atra. Positive control experiments in L. stagnalis demonstrated the broad species range of the anti-egg-laying hormone (anti-ELH) antibody used in this study, and showed binding of anti-alpha-caudodorsal-cell peptide (anti-alpha-CDCP) to the same cells in cerebral and buccal ganglia. Dot immunoassays with synthetic ELH confirmed the reactivity and sensitivity (< 0.1 microgram) of the anti-ELH antibody. Experiments with preadsorbed antibody or no primary antibody confirmed its specificity. In B. canaliculatum, clusters of more than 300 neuronal cell bodies immunoreactive to both anti-ELH and anti-alpha-CDCP were observed along the medial margins of left and right cerebral ganglia. Anti-alpha-CDCP reacted with additional small populations of cerebral ganglion neurons not stained by anti-ELH. Anti-ELH and anti-alpha-CDCP also reacted with overlapping but different small populations of neurons in buccal ganglia. In C. concholepas and T atra, ELH-like immunoreactivity was found in cerebral ganglia, and in T. atra in fibers in the cerebral ganglia and cerebral-pedal connectives. Thus, cerebral ganglia are the major locus of the ELH-like immunoreactivity in prosobranchs.
Bathaie, S Zahra; Ajloo, Davood; Daraie, Marzieh; Ghadamgahi, Maryam
2015-01-01
Interaction between a cationic porphyrin and its ferric derivative with oligo(dA.dT)15 and oligo(dG.dC)15 was studied by UV-vis spectroscopy, resonance light scattering (RLS), and circular dichroism (CD) at different ionic strengths; molecular docking and molecular dynamics simulation were also used for completion. Followings are the observed changes in the spectral properties of meso-tetrakis (N-para-trimethyl-anilium) porphyrin (TMAP), as a free-base porphyrin with no axial ligand, and its Fe derivative (FeTMAP) upon interaction with oligo(dA.dT)15 and oligo(dG.dC)15: (1) the substantial red shift and hypochromicity at the Soret maximum in the UV-vis spectra; (2) the increased RLS intensity by increasing the ionic strength; and (3) an intense bisignate excitonic CD signal. All of them are the reasons for TMAP and FeTMAP binding to oligo(dA.dT)15 and oligo(dG.dC)15 with the outside binding mode, accompanied by the self-stacking of the ligands along the oligonucleotide helix. The CD results demonstrated a drastic change from excitonic in monomeric behavior at higher ionic strengths, which indicates the groove binding of the ligands with oligonucleotides. Molecular docking also confirmed the groove binding mode of the ligands and estimated the binding constants and energies of the interactions. Their interaction trend was further confirmed by molecular dynamics technique and structure parameters obtained from simulation. It showed that TMAP reduced the number of intermolecular hydrogen bonds and increased the solvent accessible surface area in the oligonucleotide. The self-aggregation of ligands at lower concentrations was also confirmed.
The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase
NASA Astrophysics Data System (ADS)
Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy
2016-04-01
Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.
Functional display of platelet-binding VWF fragments on filamentous bacteriophage.
Yee, Andrew; Tan, Fen-Lai; Ginsburg, David
2013-01-01
von Willebrand factor (VWF) tethers platelets to sites of vascular injury via interaction with the platelet surface receptor, GPIb. To further define the VWF sequences required for VWF-platelet interaction, a phage library displaying random VWF protein fragments was screened against formalin-fixed platelets. After 3 rounds of affinity selection, DNA sequencing of platelet-bound clones identified VWF peptides mapping exclusively to the A1 domain. Aligning these sequences defined a minimal, overlapping segment spanning P1254-A1461, which encompasses the C1272-C1458 cystine loop. Analysis of phage carrying a mutated A1 segment (C1272/1458A) confirmed the requirement of the cystine loop for optimal binding. Four rounds of affinity maturation of a randomly mutagenized A1 phage library identified 10 and 14 unique mutants associated with enhanced platelet binding in the presence and absence of botrocetin, respectively, with 2 mutants (S1370G and I1372V) common to both conditions. These results demonstrate the utility of filamentous phage for studying VWF protein structure-function and identify a minimal, contiguous peptide that bind to formalin-fixed platelets, confirming the importance of the VWF A1 domain with no evidence for another independently platelet-binding segment within VWF. These findings also point to key structural elements within the A1 domain that regulate VWF-platelet adhesion.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pazehoski, Kristina O., E-mail: pazehosk@pitt.edu; Cobine, Paul A., E-mail: pac0006@auburn.edu; Winzor, Donald J.
2011-03-11
Research highlights: {yields} A metal-binding protein domain is directly involved in protein dimerization. {yields} Fusing the metal-binding domain to a monomeric protein induces dimerization. {yields} Frontal size-exclusion chromatography measures the strength of dimer interaction. {yields} Ultracentrifugation studies confirm the influence of metal binding on dimerization. -- Abstract: Metal binding to the C-terminal region of the copper-responsive repressor protein CopY is responsible for homodimerization and the regulation of the copper homeostasis pathway in Enterococcus hirae. Specific involvement of the 38 C-terminal residues of CopY in dimerization is indicated by zonal and frontal (large zone) size-exclusion chromatography studies. The studies demonstrate thatmore » the attachment of these CopY residues to the immunoglobulin-binding domain of streptococcal protein G (GB1) promotes dimerization of the monomeric protein. Although sensitivity of dimerization to removal of metal from the fusion protein is smaller than that found for CopY (as measured by ultracentrifugation studies), the demonstration that an unrelated protein (GB1) can be induced to dimerize by extending its sequence with the C-terminal portion of CopY confirms the involvement of this region in CopY homodimerization.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Selamat, Norhidayah; Heng, Lee Yook; Hassan, Nurul Izzaty
2015-09-25
The tetradentate ligand with four donor atoms OONN was synthesized. Bis(phenoxy)bipyridine ligand was prepared by Suzuki coupling reaction between 6,6’-dibromo-2,2’-bipyridyl and 2-hydroxyphenylboronic acid with presence of palladium (II) acetate. Bis(phenoxy)bipyridine ligand was also synthesized by demethylating of 6,6’-bis(2-methoxyphenyl)-2,2’-bipyridyl ligand through solvent free reaction using pyridine hydrocloride. The formation of both phenoxy and methoxy ligands was confirmed by {sup 1}H, 2D cosy and {sup 13}C NMR spectroscopy, ESI-MS spectrometry, FTIR spectroscopy. The purity of the ligand was confirmed by melting point. Binding studies of small molecules with DNA are useful to understand the reaction mechanism and to provide guidance for themore » application and design of new and more efficient drugs targeted to DNA. In this study, the binding interaction between the synthesized ligand with calf thymus-DNA (ct-DNA) has been investigated by UV/Vis DNA titration study. From the UV/Vis DNA study, it shows that bis(phenoxy)bipyridine ligand bind with ct-DNA via outside binding with binding contant K{sub b} = 1.19 × 10{sup 3} ± 0.08 M{sup −1}.« less
Interfacial phenomena in high-kappa dielectrics
NASA Astrophysics Data System (ADS)
Mathew, Anoop
The introduction of novel high-kappa dielectric materials to replace the traditional SiO2 insulating layer in CMOS transistors is a watershed event in the history of transistor development. Further, replacement of the traditional highly-doped polycrystalline silicon gate electrode with a new set of materials for metal gates complicates the transition and introduces further integration challenges. A whole variety of new material surfaces and interfaces are thus introduced that merit close investigation to determine parameters for optimal device performance. Nitrogen is a key component that improves the performance of a variety of materials for the next generation of these CMOS transistors. Nitrogen is introduced into new gate dielectric materials such as hafnium silicates as well as in potential metal gate materials such as hafnium nitride. A photoemission study of the binding energies of the various atoms in these systems using photoemission reveals the nature of the atomic bonding. The current study compares hafnium silicates of various compositions which were thermally nitrided at different temperatures in ammonia, hafnium nitrides, and thin HfO2 films using photoelectron spectroscopy. A recurring theme that is explored is the competition between oxygen and nitrogen atoms in bonding with hafnium and other atoms. The N 1s photoemission peak is seen to have contributions from its bonding with hafnium, oxygen, and silicon atoms. The Hf 4f and O 1s spectra similarly exhibit signatures of their bonding environment with their neighboring atoms. Angle resolved photoemission and in-situ annealing/argon sputtering experiments are used to elucidate the nature of the bonding and its evolution with processing. A nondestructive profilitng of nitrogen distribution as a function of composition in nitrided hafnium silicates is also constructed using angle resolved photoemission as a function of the take-off angle. These results are corroborated with depth reconstruction obtained using medium energy ion scattering (MEIS). A comparison of samples nitrided at progressively increasing temperatures in an ammonia environment shows substitution of oxygen with nitrogen atoms and increasing penetration of nitrogen into the gate stack. Trends in the binding energy of the the as-prepared hafnium silicates suggest that they are non-phase separated, and the binding energy of the hafnium and silicon track the relative composition. Upon being subject to rapid thermal annealing, the samples are observed to show behavior consistent with phase separation. There is also the evidence of charges at the oxide/Si interface that modify the expected behavior of the shifts in binding energy. In another set of experiments, a one-cycle atomic layer deposition (ALD) growth reaction on the water terminated Si(100) -- (2x1) surface is shown to lead to successful nucleation, high metal oxide coverage, and an abrupt metal-oxide/silicon interface as confirmed by photoemission, reflection high energy electron diffraction (RHEED), and Rutherford back scattering (RBS) measurements. Photoemission results confirm the coordination states of the hafnium and oxygen atoms. A Hf 4f core level shift is observed and assigned to the presence of the Si-O-Hf bonding environment with the more electronegative Si atom inducing the binding energy shift. This Hf 4f shift is smaller than that reported previously for silicates because of the difference of the semiconductor bonding environment. The subspecies *(O)2HfCl2 and *OHfCl3 are seen to be the predominant intermediate species in these reactions and photoemission results provide corroborative evidence for their presence. Experiments indicate that the hydroxyl sites bound to Si(100) are active for adsorption. The abrupt interface could be useful for aggressive Effective Oxide Thickness (EOT) scaling.
Fik, Marta A; Gorczyński, Adam; Kubicki, Maciej; Hnatejko, Zbigniew; Fedoruk-Wyszomirska, Agnieszka; Wyszko, Eliza; Giel-Pietraszuk, Małgorzata; Patroniak, Violetta
2014-10-30
6,6″-Dimethyl-2,2':6',2″-terpyridine ligand (L) reacts in equimolar ratio with Ag(I) ions what results in formation of dinuclear double helicates, which differ in terms of framework and complexity in accordance to counterions and solvent applied. Obtained complexes were thoroughly studied in terms of their biological activity, with the positive antiproliferative outcome on three human cancer cell lines: human breast cancer (T47D), human cervical carcinoma (HeLa) and human lung cancer (A-549). Performed DNA binding experiments showed that given Ag(I) species specifically interact with DNA double helix via intercalation and were visualized by confocal microscopy to specifically bind to the nuclei. All newly synthesized helical systems exhibit promising antimicrobial activity against Gram-negative Escherichia coli and Gram-positive Staphylococcus aureus bacterial strains. Spectrophotometric properties were described as fulfilment of structural studies of newly presented complexes confirming their helical structure in solution. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Heidari, Amir; Yoon, Yong-Jin; Park, Woo-Tae; Su, Pei-Chen; Miao, Jianmin; Lin, Julius Tsai Ming; Park, Mi Kyoung
2014-01-01
Sensor performance of a dielectric filled silicon bulk acoustic resonator type label-free biosensor is verified with biotin-streptavidin binding interactions as a model system. The mass sensor is a micromachined silicon square plate with a dielectric filled capacitive excitation mechanism. The resonance frequency of the biotin modified resonator decreased 315 ppm when exposed to streptavidin solution for 15 min with a concentration of 10−7 M, corresponding to an added mass of 3.43 ng on the resonator surface. An additional control is added by exposing a bovine serum albumin (BSA)-covered device to streptavidin in the absence of the attached biotin. No resonance frequency shift was observed in the control experiment, which confirms the specificity of the detection. The sensor-to-sensor variability is also measured to be 4.3%. Consequently, the developed sensor can be used to observe in biotin-streptavidin interaction without the use of labelling or molecular tags. In addition, biosensor can be used in a variety of different immunoassay tests. PMID:24608003
Regulation of FOXO1-mediated transcription and cell proliferation by PARP-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakamaki, Jun-ichi; Daitoku, Hiroaki; Yoshimochi, Kenji
2009-05-08
Forkhead box O (FOXO) transcription factors play an important role in a wide range of biological processes, including cell cycle control, apoptosis, detoxification of reactive oxygen species, and gluconeogenesis through regulation of gene expression. In this study, we demonstrated that PARP-1 functions as a negative regulator of FOXO1. We showed that PARP-1 directly binds to and poly(ADP-ribosyl)ates FOXO1 protein. PARP-1 represses FOXO1-mediated expression of cell cycle inhibitor p27{sup Kip1} gene. Notably, poly(ADP-ribosyl)ation activity was not required for the repressive effect of PARP-1 on FOXO1 function. Furthermore, knockdown of PARP-1 led to a decrease in cell proliferation in a manner dependentmore » on FOXO1 function. Chromatin immunoprecipitation experiments confirmed that PARP-1 is recruited to the p27{sup Kip1} gene promoter through a binding to FOXO1. These results suggest that PARP-1 acts as a corepressor for FOXO1, which could play an important role in proper cell proliferation by regulating p27{sup Kip1} gene expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ciomperlik, Jessica J.; Basta, Holly A.; Palmenberg, Ann C., E-mail: acpalmen@wisc.edu
2016-01-15
Cardiovirus Leader proteins (L{sub X}) inhibit cellular nucleocytoplasmic trafficking by directing host kinases to phosphorylate Phe/Gly-containing nuclear pore proteins (Nups). Resolution of the Mengovirus L{sub M} structure bound to Ran GTPase, suggested this complex would further recruit specific exportins (karyopherins), which in turn mediate kinase selection. Pull-down experiments and recombinant complex reconstitution now confirm that Crm1 and CAS exportins form stable dimeric complexes with encephalomyocarditis virus L{sub E}, and also larger complexes with L{sub E}:Ran. shRNA knockdown studies support this idea. Similar activities could be demonstrated for recombinant L{sub S} and L{sub T} from Theiloviruses. When mutations were introduced tomore » alter the L{sub E} zinc finger domain, acidic domain, or dual phosphorylation sites, there was reduced exportin selection. These regions are not involved in Ran interactions, so the Ran and Crm1 binding sites on L{sub E} must be non-overlapping. The involvement of exportins in this mechanism is important to viral replication and the observation of trafficking inhibition by L{sub E}.« less
Zou, Zhiran; Wang, Dan; Lu, Yapeng; Dong, Zhangji; Zhu, Li
2017-01-01
Male fertility disorders play a key role in half of all infertility cases. Reduction in testosterone induced by hypoxia might cause diseases in reproductive system and other organs. Hypoxic exposure caused a significant decrease of NRF1. Software analysis reported that the promoter region of steroidogenic acute regulatory protein (StAR) contained NRF1 binding sites, indicating NRF1 promoted testicular steroidogenesis. The purpose of this study is to determine NRF1 is involved in testosterone synthesis; and under hypoxia, the decrease of testosterone synthesis is caused by lower expression of NRF1. We designed both in vivo and in vitro experiments. Under hypoxia, the expressions of NRF1 in Leydig cells and testosterone level were significantly decreased both in vivo and in vitro. Overexpression and interference NRF1 could induced StAR and testosterone increased and decreased respectively. ChIP results confirmed the binding of NRF1 to StAR promoter region. In conclusion, decline of NRF1 expression downregulated the level of StAR, which ultimately resulted in a reduction in testosterone synthesis. PMID:28146428
Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco
2014-12-18
Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Wallgren, Marcus; Lidman, Martin; Pedersen, Anders; Brännström, Kristoffer; Karlsson, B Göran; Gröbner, Gerhard
2013-01-01
The anti-apoptotic B-cell CLL/lymphoma-2 (Bcl-2) protein and its counterpart, the pro-apoptotic Bcl-2-associated X protein (Bax), are key players in the regulation of the mitochondrial pathway of apoptosis. However, how they interact at the mitochondrial outer membrane (MOM) and there determine whether the cell will live or be sentenced to death remains unknown. Competing models have been presented that describe how Bcl-2 inhibits the cell-killing activity of Bax, which is common in treatment-resistant tumors where Bcl-2 is overexpressed. Some studies suggest that Bcl-2 binds directly to and sequesters Bax, while others suggest an indirect process whereby Bcl-2 blocks BH3-only proteins and prevents them from activating Bax. Here we present the results of a biophysical study in which we investigated the putative interaction of solubilized full-length human Bcl-2 with Bax and the scope for incorporating the former into a native-like lipid environment. Far-UV circular dichroism (CD) spectroscopy was used to detect direct Bcl-2-Bax-interactions in the presence of polyoxyethylene-(23)-lauryl-ether (Brij-35) detergent at a level below its critical micelle concentration (CMC). Additional surface plasmon resonance (SPR) measurements confirmed this observation and revealed a high affinity between the Bax and Bcl-2 proteins. Upon formation of this protein-protein complex, Bax also prevented the binding of antimycin A2 (a known inhibitory ligand of Bcl-2) to the Bcl-2 protein, as fluorescence spectroscopy experiments showed. In addition, Bcl-2 was able to form mixed micelles with Triton X-100 solubilized neutral phospholipids in the presence of high concentrations of Brij-35 (above its CMC). Following detergent removal, the integral membrane protein was found to have been fully reconstituted into a native-like membrane environment, as confirmed by ultracentrifugation and subsequent SDS-PAGE experiments.
Dickenson, Nicholas E.; Zhang, Lingling; Epler, Chelsea R.; Adam, Philip R.; Picking, Wendy L.; Picking, William D.
2011-01-01
Shigella flexneri uses its type III secretion apparatus (TTSA) to inject host-altering proteins into targeted eukaryotic cells. The TTSA is composed of a basal body and an exposed needle with invasion plasmid antigen D (IpaD) forming a tip complex that controls secretion. The bile salt deoxycholate (DOC) stimulates recruitment of the translocator protein IpaB into the maturing TTSA needle tip complex. This process appears to be triggered by a direct interaction between DOC and IpaD. Fluorescence spectroscopy and NMR spectroscopy are used here to confirm the DOC-IpaD interaction and to reveal that IpaD conformational changes upon DOC binding trigger the appearance of IpaB at the needle tip. Förster resonance energy transfer between specific sites on IpaD was used here to identify changes in distances between IpaD domains as a result of DOC binding. To further explore the effects of DOC binding on IpaD structure, NMR chemical shift mapping was employed. The environments of residues within the proposed DOC binding site and additional residues within the “distal” globular domain were perturbed upon DOC binding, further indicating that conformational changes occur within IpaD upon DOC binding. These events are proposed to be responsible for the recruitment of IpaB at the TTSA needle tip. Mutation analyses combined with additional spectroscopic analyses confirms that conformational changes in IpaD induced by DOC binding contribute to the recruitment of IpaB to the S. flexneri TTSA needle tip. These findings lay the foundation for determining how environmental factors promote TTSA needle tip maturation prior to host cell contact. PMID:21126091
Odoh, Samuel O; Bondarevsky, Gary D; Karpus, Jason; Cui, Qiang; He, Chuan; Spezia, Riccardo; Gagliardi, Laura
2014-12-17
The capture of uranyl, UO2(2+), by a recently engineered protein (Zhou et al. Nat. Chem. 2014, 6, 236) with high selectivity and femtomolar sensitivity has been examined by a combination of density functional theory, molecular dynamics, and free-energy simulations. It was found that UO2(2+) is coordinated to five carboxylate oxygen atoms from four amino acid residues of the super uranyl binding protein (SUP). A network of hydrogen bonds between the amino acid residues coordinated to UO2(2+) and residues in its second coordination sphere also affects the protein's uranyl binding affinity. Free-energy simulations show how UO2(2+) capture is governed by the nature of the amino acid residues in the binding site, the integrity and strength of the second-sphere hydrogen bond network, and the number of water molecules in the first coordination sphere. Alteration of any of these three factors through mutations generally results in a reduction of the binding free energy of UO2(2+) to the aqueous protein as well as of the difference between the binding free energies of UO2(2+) and other ions (Ca(2+), Cu(2+), Mg(2+), and Zn(2+)), a proxy for the protein's selectivity over these ions. The results of our free-energy simulations confirmed the previously reported experimental results and allowed us to discover a mutant of SUP, specifically the GLU64ASP mutant, that not only binds UO2(2+) more strongly than SUP but that is also more selective for UO2(2+) over other ions. The predictions from the computations were confirmed experimentally.
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Doshi, Urmi; Holliday, Michael J.; Eisenmesser, Elan Z.; Hamelberg, Donald
2016-01-01
Detailed understanding of how conformational dynamics orchestrates function in allosteric regulation of recognition and catalysis remains ambiguous. Here, we simulate CypA using multiple-microsecond-long atomistic molecular dynamics in explicit solvent and carry out NMR experiments. We analyze a large amount of time-dependent multidimensional data with a coarse-grained approach and map key dynamical features within individual macrostates by defining dynamics in terms of residue–residue contacts. The effects of substrate binding are observed to be largely sensed at a location over 15 Å from the active site, implying its importance in allostery. Using NMR experiments, we confirm that a dynamic cluster of residues in this distal region is directly coupled to the active site. Furthermore, the dynamical network of interresidue contacts is found to be coupled and temporally dispersed, ranging over 4 to 5 orders of magnitude. Finally, using network centrality measures we demonstrate the changes in the communication network, connectivity, and influence of CypA residues upon substrate binding, mutation, and during catalysis. We identify key residues that potentially act as a bottleneck in the communication flow through the distinct regions in CypA and, therefore, as targets for future mutational studies. Mapping these dynamical features and the coupling of dynamics to function has crucial ramifications in understanding allosteric regulation in enzymes and proteins, in general. PMID:27071107
Nakamura, Shigeki; Hirano, Takahiro; Onogawa, Toshiyuki; Itoh, Shuji; Hashimoto, Ayako; Yamamura, Yoshitaka; Kondo, Kazumi; Mori, Toyoki; Kambe, Toshimi
2004-04-01
We elucidated the pharmacological properties of a novel nonpeptide vasopressin V(2)-receptor agonist, OPC-51803 ((5R)-2-[1-(2-chloro-4-(1-pyrrolidinyl)benzoyl-2,3,4,5-tetrahydro-1H-1-benzazepine-5-yl]-N-isopropylacetamide), via both in vitro binding experiments incorporating canine kidney and platelet membrane fractions and in vivo experiments that would determine the compound's antidiuretic effects after oral administration to water-loaded dogs. OPC-51803 displaced [(3)H]arginine vasopressin (AVP) binding to canine V(2) and V(1a) receptors, as determined by resulting K(i) values of 15.2 +/- 0.6 nM (n = 4) and 653 +/- 146 nM (n = 4), respectively. These data indicate that OPC-51803 was about 43 times more selective for V(2) receptors than for V(1a) receptors. Antidiuretic studies showed that orally administered doses of OPC-51803 (0.03 to 0.3 mg x kg(-1)) decreased urine volume and increased urinary osmolality in a dose-dependent manner in water-loaded dogs. Intravenous OPC-51803 infusions (0.3 and 3 microg x kg(-1) x min(-1)) did not affect renal or systemic hemodynamics in anesthetized dogs. Since these results confirm that OPC-51803 shows antidiuretic action in dogs, the compound may be useful for treating AVP-deficient pathophysiological states.
Zupančič, Daša; Kreft, Mateja Erdani; Romih, Rok
2014-01-01
Bladder cancer adjuvant intravesical therapy could be optimized by more selective targeting of neoplastic tissue via specific binding of lectins to plasma membrane carbohydrates. Our aim was to establish rat and mouse models of bladder carcinogenesis to investigate in vivo and ex vivo binding of selected lectins to the luminal surface of normal and neoplastic urothelium. Male rats and mice were treated with 0.05 % N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) in drinking water and used for ex vivo and in vivo lectin binding experiments. Urinary bladder samples were also used for paraffin embedding, scanning electron microscopy and immunofluorescence labelling of uroplakins. During carcinogenesis, the structure of the urinary bladder luminal surface changed from microridges to microvilli and ropy ridges and the expression of urothelial-specific glycoproteins uroplakins was decreased. Ex vivo and in vivo lectin binding experiments gave comparable results. Jacalin (lectin from Artocarpus integrifolia) exhibited the highest selectivity for neoplastic compared to normal urothelium of rats and mice. The binding of lectin from Amaranthus caudatus decreased in rat model and increased in mouse carcinogenesis model, indicating interspecies variations of plasma membrane glycosylation. Lectin from Datura stramonium showed higher affinity for neoplastic urothelium compared to the normal in rat and mouse model. The BBN-induced animal models of bladder carcinogenesis offer a promising approach for lectin binding experiments and further lectin-mediated targeted drug delivery research. Moreover, in vivo lectin binding experiments are comparable to ex vivo experiments, which should be considered when planning and optimizing future research.
Robson, Scott A; Peterson, Robert; Bouchard, Louis-S; Villareal, Valerie A; Clubb, Robert T
2010-07-21
Chemical exchange phenomena in NMR spectra can be quantitatively interpreted to measure the rates of ligand binding, as well as conformational and chemical rearrangements. In macromolecules, processes that occur slowly on the chemical shift time scale are frequently studied using 2D heteronuclear ZZ or N(z)-exchange spectroscopy. However, to successfully apply this method, peaks arising from each exchanging species must have unique chemical shifts in both dimensions, a condition that is often not satisfied in protein-ligand binding equilibria for (15)N nuclei. To overcome the problem of (15)N chemical shift degeneracy we developed a heteronuclear zero-quantum (and double-quantum) coherence N(z)-exchange experiment that resolves (15)N chemical shift degeneracy in the indirect dimension. We demonstrate the utility of this new experiment by measuring the heme binding kinetics of the IsdC protein from Staphylococcus aureus. Because of peak overlap, we could not reliably analyze binding kinetics using conventional methods. However, our new experiment resulted in six well-resolved systems that yielded interpretable data. We measured a relatively slow k(off) rate of heme from IsdC (<10 s(-1)), which we interpret as necessary so heme loaded IsdC has time to encounter downstream binding partners to which it passes the heme. The utility of using this new exchange experiment can be easily expanded to (13)C nuclei. We expect our heteronuclear zero-quantum coherence N(z)-exchange experiment will expand the usefulness of exchange spectroscopy to slow chemical exchange events that involve ligand binding.
Binding biological motion and visual features in working memory.
Ding, Xiaowei; Zhao, Yangfan; Wu, Fan; Lu, Xiqian; Gao, Zaifeng; Shen, Mowei
2015-06-01
Working memory mechanisms for binding have been examined extensively in the last decade, yet few studies have explored bindings relating to human biological motion (BM). Human BM is the most salient and biologically significant kinetic information encountered in everyday life and is stored independently from other visual features (e.g., colors). The current study explored 3 critical issues of BM-related binding in working memory: (a) how many BM binding units can be retained in working memory, (b) whether involuntarily object-based binding occurs during BM binding, and (c) whether the maintenance of BM bindings in working memory requires attention above and beyond that needed to maintain the constituent dimensions. We isolated motion signals of human BM from non-BM sources by using point-light displays as to-be-memorized BM and presented the participants colored BM in a change detection task. We found that working memory capacity for BM-color bindings is rather low; only 1 or 2 BM-color bindings could be retained in working memory regardless of the presentation manners (Experiments 1-3). Furthermore, no object-based encoding took place for colored BM stimuli regardless of the processed dimensions (Experiments 4 and 5). Central executive attention contributes to the maintenance of BM-color bindings, yet maintaining BM bindings in working memory did not require more central attention than did maintaining the constituent dimensions in working memory (Experiment 6). Overall, these results suggest that keeping BM bindings in working memory is a fairly resource-demanding process, yet central executive attention does not play a special role in this cross-module binding. (c) 2015 APA, all rights reserved).
Bisphenol A affects androgen receptor function via multiple mechanisms.
Teng, Christina; Goodwin, Bonnie; Shockley, Keith; Xia, Menghang; Huang, Ruili; Norris, John; Merrick, B Alex; Jetten, Anton M; Austin, Christopher P; Tice, Raymond R
2013-05-25
Bisphenol A (BPA), is a well-known endocrine disruptor compound (EDC) that affects the normal development and function of the female and male reproductive system, however the mechanisms of action remain unclear. To investigate the molecular mechanisms of how BPA may affect ten different nuclear receptors, stable cell lines containing individual nuclear receptor ligand binding domain (LBD)-linked to the β-Gal reporter were examined by a quantitative high throughput screening (qHTS) format in the Tox21 Screening Program of the NIH. The results showed that two receptors, estrogen receptor alpha (ERα) and androgen receptor (AR), are affected by BPA in opposite direction. To confirm the observed effects of BPA on ERα and AR, we performed transient transfection experiments with full-length receptors and their corresponding response elements linked to luciferase reporters. We also included in this study two BPA analogs, bisphenol AF (BPAF) and bisphenol S (BPS). As seen in African green monkey kidney CV1 cells, the present study confirmed that BPA and BPAF act as ERα agonists (half maximal effective concentration EC50 of 10-100 nM) and as AR antagonists (half maximal inhibitory concentration IC50 of 1-2 μM). Both BPA and BPAF antagonized AR function via competitive inhibition of the action of synthetic androgen R1881. BPS with lower estrogenic activity (EC50 of 2.2 μM), did not compete with R1881 for AR binding, when tested at 30 μM. Finally, the effects of BPA were also evaluated in a nuclear translocation assays using EGPF-tagged receptors. Similar to 17β-estradiol (E2) which was used as control, BPA was able to enhance ERα nuclear foci formation but at a 100-fold higher concentration. Although BPA was able to bind AR, the nuclear translocation was reduced. Furthermore, BPA was unable to induce functional foci in the nuclei and is consistent with the transient transfection study that BPA is unable to activate AR. Published by Elsevier Ireland Ltd.
Gurd, J W; Bissoon, N
1997-08-01
The NMDA receptor has recently been found to be phosphorylated on tyrosine. To assess the possible connection between tyrosine phosphorylation of the NMDA receptor and signaling pathways in the postsynaptic cell, we have investigated the relationship between tyrosine phosphorylation and the binding of NMDA receptor subunits to the SH2 domains of phospholipase C-gamma (PLC-gamma). A glutathione S-transferase (GST) fusion protein containing both the N- and the C-proximal SH2 domains of PLC-gamma was bound to glutathione-agarose and reacted with synaptic junctional proteins and glycoproteins. Tyrosine-phosphorylated PSD-GP180, which has been identified as the NR2B subunit of the NMDA receptor, bound to the SH2-agarose beads in a phosphorylation-dependent fashion. Immunoblot analysis with antibodies specific for individual NMDA receptor subunits showed that both NR2A and NR2B subunits bound to the SH2-agarose. No binding occurred to GST-agarose lacking an associated SH2 domain, indicating that binding was specific for the SH2 domains. The binding of receptor subunits increased after the incubation of synaptic junctions with ATP and decreased after treatment of synaptic junctions with exogenous protein tyrosine phosphatase. Immunoprecipitation experiments confirmed that NR2A and NR2B were phosphorylated on tyrosine and further that tyrosine phosphorylation of each of the subunits was increased after incubation with ATP. The results demonstrate that NMDA receptor subunits NR2A and NR2B will bind to the SH2 domains of PLC-gamma and that isolated synaptic junctions contain endogenous protein tyrosine kinase(s) that can phosphorylate both NR2A and NR2B receptor subunits, and suggest that interaction of the tyrosine-phosphorylated NMDA receptor with proteins that contain SH2 domains may serve to link it to signaling pathways in the postsynaptic cell.
Characterization of high affinity (/sup 3/H)triazolam binding in rat brain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Earle, M.; Concas, A.; Yamamura, H.I.
1986-03-01
The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on (/sup 3/H)TZ binding. Saturation studies showed a shift to lower affinity at 37/sup 0/C (K/sub d/ = 0.25 +/- 0.01 nM at O/sup 0/C; K/sub d/ = 1.46 +/- 0.03 nM at 37/sup 0/C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. atmore » 0/sup 0/C and 1001 +/- 43 fmoles/mg prot. at 37/sup 0/C). Inhibition studies showed that (/sup 3/H)TZ binding displayed no GABA shift at 0/sup 0/C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37/sup 0/C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37/sup 0/C. In Ro 15-1788/(/sup 3/H)TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on (/sup 3/H)TZ binding at both temperatures. In conclusion (/sup 3/H)TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao Jincun; Wang Wei; Yuan Zhihong
The spike (S) protein of SARS coronavirus (SARS-CoV) is responsible for viral binding with ACE2 molecules. Its receptor-binding motif (S-RBM) is located between residues 424 and 494, which folds into 2 anti-parallel {beta}-sheets, {beta}5 and {beta}6. We have previously demonstrated that fragment 450-650 of the S protein (S450-650) is predominantly recognized by convalescent sera of SARS patients. The N-terminal 60 residues (450-510) of the S450-650 fragment covers the entire {beta}6 strand of S-RBM. In the present study, we demonstrate that patient sera predominantly recognized 2 linear epitopes outside the {beta}6 fragment, while the mouse antisera, induced by immunization of BALB/cmore » mice with recombinant S450-650, mainly recognized the {beta}6 strand-containing region. Unlike patient sera, however, the mouse antisera were unable to inhibit the infectivity of S protein-expressing (SARS-CoV-S) pseudovirus. Fusion protein between green fluorescence protein (GFP) and S450-650 (S450-650-GFP) was able to stain Vero E6 cells and deletion of the {beta}6 fragment rendered the fusion product (S511-650-GFP) unable to do so. Similarly, recombinant S450-650, but not S511-650, was able to block the infection of Vero E6 cells by the SARS-CoV-S pseudovirus. Co-precipitation experiments confirmed that S450-650 was able to specifically bind with ACE2 molecules in lysate of Vero E6 cells. However, the ability of S450-510, either alone or in fusion with GFP, to bind with ACE2 was significantly poorer compared with S450-650. Our data suggest a possibility that, although the {beta}6 strand alone is able to bind with ACE2 with relatively high affinity, residues outside the S-RBM could also assist the receptor binding of SARS-CoV-S protein.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wubben, Thomas J.; Mesecar, Andrew D.; UIC)
Phosphopantetheine adenylyltransferase (PPAT) catalyzes the penultimate step in the coenzyme A (CoA) biosynthetic pathway, reversibly transferring an adenylyl group from ATP to 4'-phosphopantetheine (PhP) to form dephosphocoenzyme A. This reaction sits at the branch point between the de novo pathway and the salvage pathway, and has been shown to be a rate-limiting step in the biosynthesis of CoA. Importantly, bacterial and mammalian PPATs share little sequence homology, making the enzyme a potential target for antibiotic development. A series of steady-state kinetic, product inhibition, and direct binding studies with Mycobacterium tuberculosis PPAT (MtPPAT) was conducted and suggests that the enzyme utilizesmore » a nonrapid-equilibrium random bi-bi mechanism. The kinetic response of MtPPAT to the binding of ATP was observed to be sigmoidal under fixed PhP concentrations, but substrate inhibition was observed at high PhP concentrations under subsaturating ATP concentrations, suggesting a preferred pathway to ternary complex formation. Negative cooperativity in the kinetic response of MtPPAT to PhP binding was observed under certain conditions and confirmed thermodynamically by isothermal titration calorimetry, suggesting the formation of an asymmetric quaternary structure during sequential ligation of substrates. Asymmetry in binding was also observed in isothermal titration calorimetry experiments with dephosphocoenzyme A and CoA. X-ray structures of MtPPAT in complex with PhP and the nonhydrolyzable ATP analogue adenosine-5'-[({alpha},{beta})-methyleno]triphosphate were solved to 1.57 {angstrom} and 2.68 {angstrom}, respectively. These crystal structures reveal small conformational changes in enzyme structure upon ligand binding, which may play a role in the nonrapid-equilibrium mechanism. We suggest that the proposed kinetic mechanism and asymmetric character in MtPPAT ligand binding may provide a means of reaction and pathway regulation in addition to that of the previously determined CoA feedback.« less
Preassembled Fluorescent Multivalent Probes for the Imaging of Anionic Membranes.
Roland, Felicia M; Peck, Evan M; Rice, Douglas R; Smith, Bradley D
2017-04-19
A new self-assembly process known as Synthavidin (synthetic avidin) technology was used to prepare targeted probes for near-infrared fluorescence imaging of anionic membranes and cell surfaces, a hallmark of many different types of disease. The probes were preassembled by threading a tetralactam macrocycle with six appended zinc-dipicolylamine (ZnDPA) targeting units onto a linear scaffold with one or two squaraine docking stations to produce hexavalent or dodecavalent fluorescent probes. A series of liposome titration experiments showed that multivalency promoted stronger membrane binding by the dodecavalent probe. In addition, the dodecavalent probe exhibited turn-on fluorescence due to probe unfolding during fluorescence microscopy at the membrane surface. However, the dodecavalent probe also had a higher tendency to self-aggregate after membrane binding, leading to probe self-quenching under certain conditions. This self-quenching effect was apparent during fluorescence microscopy experiments that recorded low fluorescence intensity from anionic dead and dying mammalian cells that were saturated with the dodecavalent probe. Conversely, probe self-quenching was not a factor with anionic microbial surfaces, where there was intense fluorescence staining by the dodecavalent probe. A successful set of rat tumor imaging experiments confirmed that the preassembled probes have sufficient mechanical stability for effective in vivo imaging. The results demonstrate the feasibility of this general class of preassembled fluorescent probes for multivalent targeting, but fluorescence imaging performance depends on the specific physical attributes of the biomarker target, such as the spatial distance between different copies of the biomarker and the propensity of the probe-biomarker complex to self-aggregate.
Kunkel, Christian; Viñes, Francesc; Ramírez, Pedro J.; ...
2018-01-15
Early transition metal carbides (TMC; TM = Ti, Zr, Hf, V, Nb, Ta, Mo) with face-centered cubic crystallographic structure have emerged as promising materials for CO 2 capture and activation. Density functional theory (DFT) calculations using the Perdew–Burke–Ernzerhof exchange–correlation functional evidence charge transfer from the TMC surface to CO 2 on the two possible adsorption sites, namely, MMC and TopC, and the electronic structure and binding strength differences are discussed. Further, the suitability of multiple experimental techniques with respect to (1) adsorbed CO2 recognition and (2) MMC/TopC adsorption distinction is assessed from extensive DFT simulations. Results show that ultraviolet photoemissionmore » spectroscopies (UPS), work function changes, core level X-ray photoemission spectroscopy (XPS), and changes in linear optical properties could well allow for adsorbed CO2 detection. Only infrared (IR) spectra and scanning tunnelling microscopy (STM) seem to additionally allow for MMC/TopC adsorption site distinction. These findings are confirmed with experimental XPS measurements, demonstrating CO 2 binding on single crystal (001) surfaces of TiC, ZrC, and VC. The experiments also help resolving ambiguities for VC, where CO 2 activation was unexpected due to low adsorption energy, but could be related to kinetic trapping involving a desorption barrier. With a wealth of data reported and direct experimental evidence provided, this study aims to motivate further basic surface science experiments on an interesting case of CO 2 activating materials, allowing also for a benchmark of employed theoretical models.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kunkel, Christian; Viñes, Francesc; Ramírez, Pedro J.
Early transition metal carbides (TMC; TM = Ti, Zr, Hf, V, Nb, Ta, Mo) with face-centered cubic crystallographic structure have emerged as promising materials for CO 2 capture and activation. Density functional theory (DFT) calculations using the Perdew–Burke–Ernzerhof exchange–correlation functional evidence charge transfer from the TMC surface to CO 2 on the two possible adsorption sites, namely, MMC and TopC, and the electronic structure and binding strength differences are discussed. Further, the suitability of multiple experimental techniques with respect to (1) adsorbed CO2 recognition and (2) MMC/TopC adsorption distinction is assessed from extensive DFT simulations. Results show that ultraviolet photoemissionmore » spectroscopies (UPS), work function changes, core level X-ray photoemission spectroscopy (XPS), and changes in linear optical properties could well allow for adsorbed CO2 detection. Only infrared (IR) spectra and scanning tunnelling microscopy (STM) seem to additionally allow for MMC/TopC adsorption site distinction. These findings are confirmed with experimental XPS measurements, demonstrating CO 2 binding on single crystal (001) surfaces of TiC, ZrC, and VC. The experiments also help resolving ambiguities for VC, where CO 2 activation was unexpected due to low adsorption energy, but could be related to kinetic trapping involving a desorption barrier. With a wealth of data reported and direct experimental evidence provided, this study aims to motivate further basic surface science experiments on an interesting case of CO 2 activating materials, allowing also for a benchmark of employed theoretical models.« less
NASA Astrophysics Data System (ADS)
Pan, Jinhong
The receptor of advanced glycation end product (RAGE) is a multiligand receptor of the immunoglobulin superfamily of cell surface molecules, which plays an important role in immune responses. Full-length RAGE includes three extracellular immunoglobulin domains, a transmembrane domain and an intracellular domain. It is a pattern recognition receptor that can bind diverse ligands. NMR spectroscopy and x-ray crystallization studies of the extracellular domains of RAGE indicate that RAGE ligands bind by distinct charge- and hydrophobicity-dependent mechanisms. It is found that calgranulin binding to the C1C2 domain or AGEs binding to the V domain activates extracellular signaling, which triggers interactions of the RAGE cytoplasmic tail (ctRAGE) with intracellular effector, such as diaphanous 1 (DIAPH1), to initiate signal transduction cascades. ctRAGE is essential for RAGE-ligand-mediated signal transduction and consequent modulation of gene expression and cellular properties. RAGE is over-expressed in diseased tissues of most RAGE-associated pathogenic conditions, such as complications of Alzheimer's diseases, diabetes, vascular diseases, inflammation, cancers and neurodegeneration. They are the major diseases affecting a large population worldwide. RAGE can function as a biomarker or drug target for these diseases. The cytoplasmic tail of RAGE can be used as a drug target to inhibit RAGE-induced intracellular signaling by small molecule inhibitors to treat RAGE-associated diseases. We developed a high throughput screening assay with which we probed a small molecule library of 58,000 compounds to find that 777 small molecules displayed 50% inhibition and 97 compounds demonstrated dose-dependent inhibition of the binding of ctRAGE-DIAPH1. Eventually, there were 13 compounds which displayed dose-dependent inhibition of ctRAGE binding to DIAPH1 and direct binding to ctRAGE analyzed by 15N HSQC-NMR and native tryptophan fluorescence titration experiments; thus, they were identified as competitive inhibitors of ctRAGE interaction with DIAPH1. These compounds, which exhibit in vitro and in vivo inhibition of RAGE-dependent molecular processes, present attractive molecular scaffolds for the development of therapeutics against RAGE-induced diseases, and provide support for the feasibility of inhibition of protein-protein interaction (PPI). Among those 13 compounds, compounds 3, 4 and 11 with novel druggable structural features, strongly bound to ctRAGE with Kd values reaching to 18, 2 and 2 nM, respectively. There were 28 quinoline acetamide analogues of compound 11, and 20 carbazole/benzimidazole/indole 1,3-diamino-2-propanol analogues of compounds 3 and 4 were selected for SAR study by 15N-HSQC NMR. Native tryptophan fluorescence titration studies quantified the binding affinity and confirmed that tryptophan is involved in this interaction. The binding affinity tests found 19 compounds binding to ctRAGE with nanomolar binding affinities. They would be developed into lead compounds for in vitro and in vivo studies. The site directed mutagenesis was adopted to verify the interaction mode, in which the amino acid residues at the binding sites (Q3 and Q6) were knocked out individually and replaced with one alanine, resulting in weaker binding to the selective small molecule inhibitors across these knock-out sites. Therefore, it is confirmed that the amino acid residues of ctRAGE, Q3, and Q6, were involved in binding with R24, R102, R108, R 166, R167 and R208. Mutation modeling verified the established binding models for ctRAGE-R25 and ctRAGE-compound 3. Mapping the binding sites by NMR and CYANA calculation which established three-dimensional structure models of the ctRAGE-compound 3 complex and the ctRAGE-R25 complex, found the interactions between ctRAGE and compound 3 take place at W2, Q3 and Q6, while the interactions between ctRAGE and R25 take place W2, Q3, Q6 and E11. Their binding sites overlap the binding sites of ctRAGE-DIAPH1, which results that these two inhibitors bind to ctRAGE by replacing DIAPH1, and thus inhibit RAGE signaling.
Bosdriesz, Evert; Magnúsdóttir, Stefanía; Bruggeman, Frank J; Teusink, Bas; Molenaar, Douwe
2015-06-01
Microorganisms rely on binding-protein assisted, active transport systems to scavenge for scarce nutrients. Several advantages of using binding proteins in such uptake systems have been proposed. However, a systematic, rigorous and quantitative analysis of the function of binding proteins is lacking. By combining knowledge of selection pressure and physiochemical constraints, we derive kinetic, thermodynamic, and stoichiometric properties of binding-protein dependent transport systems that enable a maximal import activity per amount of transporter. Under the hypothesis that this maximal specific activity of the transport complex is the selection objective, binding protein concentrations should exceed the concentration of both the scarce nutrient and the transporter. This increases the encounter rate of transporter with loaded binding protein at low substrate concentrations, thereby enhancing the affinity and specific uptake rate. These predictions are experimentally testable, and a number of observations confirm them. © 2015 FEBS.
Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.
Hamill, Terence G; Krause, Stephen; Ryan, Christine; Bonnefous, Celine; Govek, Steve; Seiders, T Jon; Cosford, Nicholas D P; Roppe, Jeffrey; Kamenecka, Ted; Patel, Shil; Gibson, Raymond E; Sanabria, Sandra; Riffel, Kerry; Eng, Waisi; King, Christopher; Yang, Xiaoqing; Green, Mitchell D; O'Malley, Stacey S; Hargreaves, Richard; Burns, H Donald
2005-06-15
Three metabotropic glutamate receptor subtype 5 (mGluR5) PET tracers have been labeled with either carbon-11 or fluorine-18 and their in vitro and in vivo behavior in rhesus monkey has been characterized. Each of these tracers share the common features of high affinity for mGluR5 (0.08-0.23 nM vs. rat mGluR5) and moderate lipophilicity (log P 2.8-3.4). Compound 1b was synthesized using a Suzuki or Stille coupling reaction with [11C]MeI. Compounds 2b and 3b were synthesized by a SNAr reaction using a 3-chlorobenzonitrile precursor. Autoradiographic studies in rhesus monkey brain slices using 2b and 3b showed specific binding in cortex, caudate, putamen, amygdala, hippocampus, most thalamic nuclei, and lower binding in the cerebellum. PET imaging studies in monkey showed that all three tracers readily enter the brain and provide an mGluR5-specific signal in all gray matter regions, including the cerebellum. The specific signal observed in the cerebellum was confirmed by the autoradiographic studies and saturation binding experiments that showed tracer binding in the cerebellum of rhesus monkeys. In vitro metabolism studies using the unlabeled compounds showed that 1a, 2a, and 3a are metabolized slower by human liver microsomes than by monkey liver microsomes. In vivo metabolism studies showed 3b to be long-lived in rhesus plasma with only one other more polar metabolite observed. (c) 2005 Wiley-Liss, Inc.
Song, Lei; Liu, Yingying; Zhang, Zhifang; Wang, Xi; Chen, Jinchun
2010-10-01
Inorganic-binding peptides termed as genetically engineered polypeptides for inorganics (GEPIs), are small peptide sequences selected via combinatorial biology-based protocols of phage or cell surface display technologies. Recent advances in nanotechnology and molecular biology allow the engineering of these peptides with specific affinity to inorganics, often used as molecular linkers or assemblers, to facilitate materials synthesis, which provides a new insight into the material science and engineering field. As a case study on this biomimetic application, here we report a novel biosynthetic ZnO binding protein and its application in promoting bio-inorganic materials synthesis. In brief, the gene encoding a ZnO binding peptide(ZBP) was genetically fused with His(6)-tag and GST-tag using E.coli expression vector pET-28a (+) and pGEX-4T-3. The recombinant protein GST-His-ZBP was expressed, purified with Ni-NTA system, identified by SDS-PAGE electrophoresis and Western blot analysis and confirmed by liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analysis. Affinity adsorption test demonstrated that the fusion protein had a specific avidity for ZnO nanoparticles (NPs). Results from the bio-inorganic synthesis experiment indicated that the new protein played a promoting part in grain refinement and accelerated precipitation during the formation of the ultra-fine precursor powders in the Zn(OH)(2) sol. X-ray diffraction (XRD) analysis on the final products after calcining the precursor powders showed that hexagonal wurtzite ZnO crystals were obtained. Our work suggested a novel approach to the application about the organic-inorganic interactions.
Zúñiga, Matías A; Alderete, Joel B; Jaña, Gonzalo A; Jiménez, Verónica A
2017-07-01
Peloruside A (PLA) and Laulimalide (LAU) are novel microtubule-stabilizing agents with promising properties against different cancer types. These ligands share a non-taxoid binding site at the outer surface of β-tubulin and promote microtubule stabilization by bridging two adjacent αβ-tubulin dimers from parallel protofilaments. Recent site-directed mutagenesis experiments confirmed the existence of a unique β-tubulin site mutation (Gln293Met) that specifically increased the activity of PLA and caused resistance to LAU, without affecting the stability of microtubules in the absence of the ligands. In this work, fully atomistic molecular dynamics simulations were carried out to examine the PLA and LAU association with native and mutated αβ-tubulin in the search for structural and energetic evidence to explain the role of Gln293Met mutation on determining the activity of these ligands. Our results revealed that Gln293Met mutation induced the loss of relevant LAU-tubulin contacts but exerted negligible changes in the interaction networks responsible for PLA-tubulin association. Binding free energy calculations (MM/GBSA and MM/PBSA), and weak interaction analysis (aNCI) predicted an increased affinity for PLA, and a weakened association for LAU after mutation, thus suggesting that Gln293Met mutation exerts its action by a modulation of drug-tubulin interactions. These results are valuable to increase understanding about PLA and LAU activity and to assist the future design of novel agents targeting the PLA/LAU binding pocket.
NASA Astrophysics Data System (ADS)
Zúñiga, Matías A.; Alderete, Joel B.; Jaña, Gonzalo A.; Jiménez, Verónica A.
2017-07-01
Peloruside A (PLA) and Laulimalide (LAU) are novel microtubule-stabilizing agents with promising properties against different cancer types. These ligands share a non-taxoid binding site at the outer surface of β-tubulin and promote microtubule stabilization by bridging two adjacent αβ-tubulin dimers from parallel protofilaments. Recent site-directed mutagenesis experiments confirmed the existence of a unique β-tubulin site mutation (Gln293Met) that specifically increased the activity of PLA and caused resistance to LAU, without affecting the stability of microtubules in the absence of the ligands. In this work, fully atomistic molecular dynamics simulations were carried out to examine the PLA and LAU association with native and mutated αβ-tubulin in the search for structural and energetic evidence to explain the role of Gln293Met mutation on determining the activity of these ligands. Our results revealed that Gln293Met mutation induced the loss of relevant LAU-tubulin contacts but exerted negligible changes in the interaction networks responsible for PLA-tubulin association. Binding free energy calculations (MM/GBSA and MM/PBSA), and weak interaction analysis (aNCI) predicted an increased affinity for PLA, and a weakened association for LAU after mutation, thus suggesting that Gln293Met mutation exerts its action by a modulation of drug-tubulin interactions. These results are valuable to increase understanding about PLA and LAU activity and to assist the future design of novel agents targeting the PLA/LAU binding pocket.
Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.
2013-01-01
CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590
Pfohl-Leszkowicz, A; Hadjeba-Medjdoub, K; Ballet, N; Schrickx, J; Fink-Gremmels, J
2015-01-01
The aim of this paper was to evaluate the capacity of several yeast-based products, derived from baker's and brewer's yeasts, to sequester the mycotoxin ochratoxin A (OTA) and to decrease its rate of absorption and DNA adduct formation in vivo. The experimental protocol included in vitro binding studies using isotherm models, in vivo chicken experiments, in which the serum and tissue concentrations of OTA were analysed in the absence and presence of the test compounds, and the profile of OTA-derived metabolites and their associated DNA adducts were determined. Additionally in vitro cell culture studies (HK2 cells) were applied to assess further the effects for yeast cell product enriched with glutathione (GSH) or selenium. Results of the in vitro binding assay in a buffer system indicated the ability of the yeast-based products, as sequester of OTA, albeit at a different level. In the in vitro experiments in chickens, decreased serum and tissue concentrations of treated animals confirmed that yeast-based products are able to prevent the absorption of OTA. A comparison of the binding affinity in a standard in vitro binding assay with the results obtained in an in vivo chicken experiment, however, showed a poor correlation and resulted in a different ranking of the products. More importantly, we could show that yeast-based products actively modulate the biotransformation of OTA in vivo as well as in vitro in a cell culture model. This effect seems to be attributable to residual enzymatic activities in the yeast-based products. An enrichment of yeast cell wall products with GSH or selenium further modulated the profile of the generated OTA metabolites and the associated pattern of OTA-induced DNA adducts by increasing the conversion of OTA into less toxic metabolites such as OTA, OTB and 4-OH-OTA. A reduced absorption and DNA adduct formation was particularly observed with GSH-enriched yeast, whereas selenium-enriched yeasts could counteract the OTA-induced decrease in cell viability, but at the same time increased the OTA-DNA adducts formation. These findings indicate the need for an in-depth characterisation of yeast-based products used as mycotoxin-mitigating feed additives, in in vivo models with target animal species taking into account not only their ability to sequester toxins in the gastrointestinal tract but also their potential effects on the biotransformation of mycotoxins.
NASA Astrophysics Data System (ADS)
Khan, Asma Yasmeen; Saha, Baishakhi; Kumar, Gopinatha Suresh
2014-10-01
A comprehensive study on the binding of phenazinium dyes viz. janus green B, indoine blue, safranine O and phenosafranine with double stranded poly(A) using various spectroscopic and calorimetric techniques is presented. A higher binding of janus green B and indoine blue over safranine O and phenosafranine to poly(A) was observed from all experiments. Intercalative mode of binding of the dyes was inferred from fluorescence polarization anisotropy, iodide quenching and viscosity experiments. Circular dichroism study revealed significant perturbation of the secondary structure of poly(A) on binding of these dyes. Results from isothermal titration calorimetry experiments suggested that the binding was predominantly entropy driven with a minor contribution of enthalpy to the standard molar Gibbs energy. The results presented here may open new opportunities in the application of these dyes as RNA targeted therapeutic agents.
Jana, Jagannath; Mondal, Soma; Bhattacharjee, Payel; Sengupta, Pallabi; Roychowdhury, Tanaya; Saha, Pranay; Kundu, Pallob; Chatterjee, Subhrangsu
2017-01-01
A putative anticancer plant alkaloid, Chelerythrine binds to G-quadruplexes at promoters of VEGFA, BCL2 and KRAS genes and down regulates their expression. The association of Chelerythrine to G-quadruplex at the promoters of these oncogenes were monitored using UV absorption spectroscopy, fluorescence anisotropy, circular dichroism spectroscopy, CD melting, isothermal titration calorimetry, molecular dynamics simulation and quantitative RT-PCR technique. The pronounced hypochromism accompanied by red shifts in UV absorption spectroscopy in conjunction with ethidium bromide displacement assay indicates end stacking mode of interaction of Chelerythrine with the corresponding G-quadruplex structures. An increase in fluorescence anisotropy and CD melting temperature of Chelerythrine-quadruplex complex revealed the formation of stable Chelerythrine-quadruplex complex. Isothermal titration calorimetry data confirmed that Chelerythrine-quadruplex complex formation is thermodynamically favourable. Results of quantative RT-PCR experiment in combination with luciferase assay showed that Chelerythrine treatment to MCF7 breast cancer cells effectively down regulated transcript level of all three genes, suggesting that Chelerythrine efficiently binds to in cellulo quadruplex motifs. MD simulation provides the molecular picture showing interaction between Chelerythrine and G-quadruplex. Binding of Chelerythrine with BCL2, VEGFA and KRAS genes involved in evasion, angiogenesis and self sufficiency of cancer cells provides a new insight for the development of future therapeutics against cancer. PMID:28102286
Atomic model of a cell-wall cross-linking enzyme in complex with an intact bacterial peptidoglycan.
Schanda, Paul; Triboulet, Sébastien; Laguri, Cédric; Bougault, Catherine M; Ayala, Isabel; Callon, Morgane; Arthur, Michel; Simorre, Jean-Pierre
2014-12-24
The maintenance of bacterial cell shape and integrity is largely attributed to peptidoglycan, a highly cross-linked biopolymer. The transpeptidases that perform this cross-linking are important targets for antibiotics. Despite this biomedical importance, to date no structure of a protein in complex with an intact bacterial peptidoglycan has been resolved, primarily due to the large size and flexibility of peptidoglycan sacculi. Here we use solid-state NMR spectroscopy to derive for the first time an atomic model of an l,d-transpeptidase from Bacillus subtilis bound to its natural substrate, the intact B. subtilis peptidoglycan. Importantly, the model obtained from protein chemical shift perturbation data shows that both domains-the catalytic domain as well as the proposed peptidoglycan recognition domain-are important for the interaction and reveals a novel binding motif that involves residues outside of the classical enzymatic pocket. Experiments on mutants and truncated protein constructs independently confirm the binding site and the implication of both domains. Through measurements of dipolar-coupling derived order parameters of bond motion we show that protein binding reduces the flexibility of peptidoglycan. This first report of an atomic model of a protein-peptidoglycan complex paves the way for the design of new antibiotic drugs targeting l,d-transpeptidases. The strategy developed here can be extended to the study of a large variety of enzymes involved in peptidoglycan morphogenesis.
OnpA, an Unusual Flavin-Dependent Monooxygenase Containing a Cytochrome b5 Domain
Xiao, Yi; Liu, Ting-Ting; Dai, Hui; Zhang, Jun-Jie; Liu, Hong; Tang, Huiru; Leak, David J.
2012-01-01
ortho-Nitrophenol 2-monooxygenase (EC 1.14.13.31) from Alcaligenes sp. strain NyZ215 catalyzes monooxygenation of ortho-nitrophenol to form catechol via ortho-benzoquinone. Sequence analysis of this onpA-encoded enzyme revealed that it contained a flavin-binding monooxygenase domain and a heme-binding cytochrome b5 domain. OnpA was purified to homogeneity as a His-tagged protein and was considered a monomer, as determined by gel filtration. FAD and heme were identified by high-performance liquid chromatography (HPLC) and HPLC-mass spectrometry (HPLC-MS) as cofactors in this enzyme, and quantitative analysis indicated that 1 mol of the purified recombinant OnpA contained 0.66 mol of FAD and 0.20 mol of heme. However, the enzyme activity of OnpA was increased by 60% and 450% after addition of FAD and hemin, respectively, suggesting that the optimal stoichiometry was 1:1:1. In addition, site-directed mutagenesis experiments confirmed that two highly conserved histidines located in the cytochrome b5 domain were associated with binding of the heme, and the cytochrome b5 domain was involved in the OnpA activity. These results indicate that OnpA is an unusual FAD-dependent monooxygenase containing a fused cytochrome b5 domain that is essential for its activity. Therefore, we here demonstrate a link between cytochrome b5 and flavin-dependent monooxygenases. PMID:22267507
Intracellular Localization Map of Human Herpesvirus 8 Proteins▿
Sander, Gaby; Konrad, Andreas; Thurau, Mathias; Wies, Effi; Leubert, Rene; Kremmer, Elisabeth; Dinkel, Holger; Schulz, Thomas; Neipel, Frank; Stürzl, Michael
2008-01-01
Human herpesvirus 8 (HHV-8) is the etiological agent of Kaposi's sarcoma. We present a localization map of 85 HHV-8-encoded proteins in mammalian cells. Viral open reading frames were cloned with a Myc tag in expression plasmids, confirmed by full-length sequencing, and expressed in HeLa cells. Protein localizations were analyzed by immunofluorescence microscopy. Fifty-one percent of all proteins were localized in the cytoplasm, 22% were in the nucleus, and 27% were found in both compartments. Surprisingly, we detected viral FLIP (v-FLIP) in the nucleus and in the cytoplasm, whereas cellular FLIPs are generally localized exclusively in the cytoplasm. This suggested that v-FLIP may exert additional or alternative functions compared to cellular FLIPs. In addition, it has been shown recently that the K10 protein can bind to at least 15 different HHV-8 proteins. We noticed that K10 and only five of its 15 putative binding factors were localized in the nucleus when the proteins were expressed in HeLa cells individually. Interestingly, in coexpression experiments K10 colocalized with 87% (13 of 15) of its putative binding partners. Colocalization was induced by translocation of either K10 alone or both proteins. These results indicate active intracellular translocation processes in virus-infected cells. Specifically in this framework, the localization map may provide a useful reference to further elucidate the function of HHV-8-encoded genes in human diseases. PMID:18077714
Slavik, Roger; Müller Herde, Adrienne; Haider, Ahmed; Krämer, Stefanie D; Weber, Markus; Schibli, Roger; Ametamey, Simon M; Mu, Linjing
2016-09-01
The cannabinoid receptor type 2 (CB2) is part of the endocannabinoid system and has gained growing attention in recent years because of its important role in neuroinflammatory/neurodegenerative diseases. Recently, we reported on a carbon-11 labeled 4-oxo-quinoline derivative, designated RS-016, as a promising radiotracer for imaging CB2 using PET. In this study, three novel fluorinated analogs of RS-016 were designed, synthesized, and pharmacologically evaluated. The results of our efforts led to the identification of N-(1-adamantyl)-1-(2-(2-fluoroethoxy)ethyl)-8-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxamide (RS-126) as the most potent candidate for evaluation as a CB2 PET ligand. [(18) F]RS-126 was obtained in ≥ 99% radiochemical purity with an average specific radioactivity of 98 GBq/μmol at the end of the radiosynthesis. [(18) F]RS-126 showed a logD7.4 value of 1.99 and is stable in vitro in rat and human plasma over 120 min, whereas 55% intact parent compound was found in vivo in rat blood plasma at 10 min post injection. In vitro autoradiographic studies with CB2-positive rat spleen tissue revealed high and blockable binding which was confirmed in in vivo displacement experiments with rats by dynamic PET imaging. Ex vivo biodistribution studies confirmed accumulation of [(18) F]RS-126 in rat spleen with a specificity of 79% under blocking conditions. The moderate elevated CB2 levels in LPS-treated mice brain did not permit the detection of CB2 by [(18) F]RS-126 using PET imaging. In summary, [(18) F]RS-126 demonstrated high specificity toward CB2 receptor in vitro and in vivo and is a promising radioligand for imaging CB2 receptor expression. Cannabinoid receptor type 2 (CB2) is an interesting target for PET imaging. Specific binding of [(18) F]RS-126 in CB2-positive spleen tissue (white arrow head) was confirmed in in vivo displacement experiments with rats. Time activity curve of [(18) F]RS-126 in the spleen after the addition of GW405833 (CB2 specific ligand, green) demonstrates faster radiotracer elimination (blue) compared to the tracer only (red). © 2016 International Society for Neurochemistry.
ERIC Educational Resources Information Center
Kugel, Jennifer F.
2008-01-01
An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…
Shahabadi, Nahid; Pourfoulad, Mehdi; Moghadam, Neda Hosseinpour
2017-01-02
DNA-binding properties of an antiviral drug, valganciclovir (valcyte) was studied by using emission, absorption, circular dichroism, viscosity, differential pulse voltammetry, fluorescence techniques, and computational studies. The drug bound to calf thymus DNA (ct-DNA) in a groove-binding mode. The calculated binding constant of UV-vis, K a , is comparable to groove-binding drugs. Competitive fluorimetric studies with Hoechst 33258 showed that valcyte could displace the DNA-bound Hoechst 33258. The drug could not displace intercalated methylene blue from DNA double helix. Furthermore, the induced detectable changes in the CD spectrum of ct-DNA as well as changes in its viscosity confirm the groove-binding mode. In addition, an integrated molecular docking was employed to further investigate the binding interactions between valcyte and calf thymus DNA.
Stable heavy pentaquarks in constituent models
NASA Astrophysics Data System (ADS)
Richard, J.-M.; Valcarce, A.; Vijande, J.
2017-11-01
It is shown that standard constituent quark models produce (c bar cqqq) hidden-charm pentaquarks, where c denotes the charmed quark and q a light quark, which lie below the lowest threshold for spontaneous dissociation and thus are stable in the limit where the internal c bar c annihilation is neglected. The binding is a cooperative effect of the chromoelectric and chromomagnetic components of the interaction, and it disappears in the static limit with a pure chromoelectric potential. Their wave function contains color sextet and color octet configurations for the subsystems and can hardly be reduced to a molecular state made of two interacting hadrons. These pentaquark states could be searched for in the experiments having discovered or confirmed the hidden-charm meson and baryon resonances.
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
Binding of Disordered Peptides to Kelch: Insights from Enhanced Sampling Simulations.
Do, Trang Nhu; Choy, Wing-Yiu; Karttunen, Mikko
2016-01-12
Keap1 protein plays an essential role in regulating cellular oxidative stress response and is a crucial binding hub for multiple proteins, several of which are intrinsically disordered proteins (IDP). Among Kelch's IDP binding partners, NRF2 and PTMA are the two most interesting cases. They share a highly similar binding motif; however, NRF2 binds to Kelch with a binding affinity of approximately 100-fold higher than that of PTMA. In this study, we perform an exhaustive sampling composed of 6 μs well-tempered metadynamics and 2 μs unbiased molecular dynamics (MD) simulations aiming at characterizing the binding mechanisms and structural properties of these two peptides. Our results agree with previous experimental observations that PTMA is remarkably more disordered than NRF2 in both the free and bound states. This explains PTMA's lower binding affinity. Our extensive sampling also provides valuable insights into the vast conformational ensembles of both NRF2 and PTMA, supports the hypothesis of coupled folding-binding, and confirms the essential role of linear motifs in IDP binding.
Dissociation of binding and learning processes.
Moeller, Birte; Frings, Christian
2017-11-01
A single encounter of a stimulus together with a response can result in a short-lived association between the stimulus and the response [sometimes called an event file, see Hommel, Müsseler, Aschersleben, & Prinz, (2001) Behavioral and Brain Sciences, 24, 910-926]. The repetition of stimulus-response pairings typically results in longer lasting learning effects indicating stimulus-response associations (e.g., Logan & Etherton, (1994) Journal of Experimental Psychology: Learning, Memory, and Cognition, 20, 1022-1050]. An important question is whether or not what has been described as stimulus-response binding in action control research is actually identical with an early stage of incidental learning (e.g., binding might be seen as single-trial learning). Here, we present evidence that short-lived binding effects can be distinguished from learning of longer lasting stimulus-response associations. In two experiments, participants always responded to centrally presented target letters that were flanked by response irrelevant distractor letters. Experiment 1 varied whether distractors flanked targets on the horizontal or vertical axis. Binding effects were larger for a horizontal than for a vertical distractor-target configuration, while stimulus configuration did not influence incidental learning of longer lasting stimulus-response associations. In Experiment 2, the duration of the interval between response n - 1 and presentation of display n (500 ms vs. 2000 ms) had opposing influences on binding and learning effects. Both experiments indicate that modulating factors influence stimulus-response binding and incidental learning effects in different ways. We conclude that distinct underlying processes should be assumed for binding and incidental learning effects.
NASA Astrophysics Data System (ADS)
Okada, Tomoko; Minoura, Norihiko
2011-03-01
We develop a fluorescent ruthenium metalloglycocluster for use as a powerful molecular probe in evaluating the binding between carbohydrates and lectins by fluorescence emission (FE) and fluorescence polarization (FP) analyses. Changes in the FE and FP of these metalloglycoclusters are measured following the addition of lectin [peanut agglutinin (PNA), Ricinus communis agglutinin 120, Concanavalin A (ConA), or wheat germ agglutinin] or tetanus toxin c-fragment (TCF). After the addition of PNA, the FE spectrum of [Ru(bpy-2Gal)3] shows a new emission peak and the FP value of [Ru(bpy-2Gal)3] increases. Similarly, the FE spectrum of [Ru(bpy-2Glc)3] shows a new emission peak and the FP value increases on addition of ConA. Because other combinations of metalloglycoclusters and lectins show little change, specific binding of galactose to PNA and that of glucose to ConA are confirmed by the FE and FP measurements. Resulting dissociation constants (Kd) prove that the metalloglycoclusters with highly clustered carbohydrates show higher affinity for the respective lectins than those with less clustered carbohydrates. Furthermore, specific binding of [Ru(bpy-2Gal)3] to TCF was confirmed by the FP measurement.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
SONAR Discovers RNA-Binding Proteins from Analysis of Large-Scale Protein-Protein Interactomes.
Brannan, Kristopher W; Jin, Wenhao; Huelga, Stephanie C; Banks, Charles A S; Gilmore, Joshua M; Florens, Laurence; Washburn, Michael P; Van Nostrand, Eric L; Pratt, Gabriel A; Schwinn, Marie K; Daniels, Danette L; Yeo, Gene W
2016-10-20
RNA metabolism is controlled by an expanding, yet incomplete, catalog of RNA-binding proteins (RBPs), many of which lack characterized RNA binding domains. Approaches to expand the RBP repertoire to discover non-canonical RBPs are currently needed. Here, HaloTag fusion pull down of 12 nuclear and cytoplasmic RBPs followed by quantitative mass spectrometry (MS) demonstrates that proteins interacting with multiple RBPs in an RNA-dependent manner are enriched for RBPs. This motivated SONAR, a computational approach that predicts RNA binding activity by analyzing large-scale affinity precipitation-MS protein-protein interactomes. Without relying on sequence or structure information, SONAR identifies 1,923 human, 489 fly, and 745 yeast RBPs, including over 100 human candidate RBPs that contain zinc finger domains. Enhanced CLIP confirms RNA binding activity and identifies transcriptome-wide RNA binding sites for SONAR-predicted RBPs, revealing unexpected RNA binding activity for disease-relevant proteins and DNA binding proteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Redesign of LAOBP to bind novel l-amino acid ligands.
Banda-Vázquez, Jesús; Shanmugaratnam, Sooruban; Rodríguez-Sotres, Rogelio; Torres-Larios, Alfredo; Höcker, Birte; Sosa-Peinado, Alejandro
2018-05-01
Computational protein design is still a challenge for advancing structure-function relationships. While recent advances in this field are promising, more information for genuine predictions is needed. Here, we discuss different approaches applied to install novel glutamine (Gln) binding into the Lysine/Arginine/Ornithine binding protein (LAOBP) from Salmonella typhimurium. We studied the ligand binding behavior of two mutants: a binding pocket grafting design based on a structural superposition of LAOBP to the Gln binding protein QBP from Escherichia coli and a design based on statistical coupled positions. The latter showed the ability to bind Gln even though the protein was not very stable. Comparison of both approaches highlighted a nonconservative shared point mutation between LAOBP_graft and LAOBP_sca. This context dependent L117K mutation in LAOBP turned out to be sufficient for introducing Gln binding, as confirmed by different experimental techniques. Moreover, the crystal structure of LAOBP_L117K in complex with its ligand is reported. © 2018 The Protein Society.
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
NASA Astrophysics Data System (ADS)
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
What Do We Learn from Binding Features? Evidence for Multilevel Feature Integration
ERIC Educational Resources Information Center
Colzato, Lorenza S.; Raffone, Antonino; Hommel, Bernhard
2006-01-01
Four experiments were conducted to investigate the relationship between the binding of visual features (as measured by their after-effects on subsequent binding) and the learning of feature-conjunction probabilities. Both binding and learning effects were obtained, but they did not interact. Interestingly, (shape-color) binding effects…
Krieger, Miriam; Felder, Stefan
2013-01-01
Rather than conforming to the assumption of perfect rationality in neoclassical economic theory, decision behavior has been shown to display a host of systematic biases. Properly understood, these patterns can be instrumentalized to improve outcomes in the public realm. We conducted a laboratory experiment to study whether decisions over health insurance policies are subject to status quo bias and, if so, whether experience mitigates this framing effect. Choices in two treatment groups with status quo defaults are compared to choices in a neutrally framed control group. A two-step design features sorting of subjects into the groups, allowing us to control for selection effects due to risk preferences. The results confirm the presence of a status quo bias in consumer choices over health insurance policies. However, this effect of the default framing does not persist as subjects repeat this decision in later periods of the experiment. Our results have implications for health care policy, for example suggesting that the use of non-binding defaults in health insurance can facilitate the spread of co-insurance policies and thereby help contain health care expenditure. PMID:23783222
Adaptation of avian influenza A (H6N1) virus from avian to human receptor-binding preference
Wang, Fei; Qi, Jianxun; Bi, Yuhai; Zhang, Wei; Wang, Min; Zhang, Baorong; Wang, Ming; Liu, Jinhua; Yan, Jinghua; Shi, Yi; Gao, George F
2015-01-01
The receptor-binding specificity of influenza A viruses is a major determinant for the host tropism of the virus, which enables interspecies transmission. In 2013, the first human case of infection with avian influenza A (H6N1) virus was reported in Taiwan. To gather evidence concerning the epidemic potential of H6 subtype viruses, we performed comprehensive analysis of receptor-binding properties of Taiwan-isolated H6 HAs from 1972 to 2013. We propose that the receptor-binding properties of Taiwan-isolated H6 HAs have undergone three major stages: initially avian receptor-binding preference, secondarily obtaining human receptor-binding capacity, and recently human receptor-binding preference, which has been confirmed by receptor-binding assessment of three representative virus isolates. Mutagenesis work revealed that E190V and G228S substitutions are important to acquire the human receptor-binding capacity, and the P186L substitution could reduce the binding to avian receptor. Further structural analysis revealed how the P186L substitution in the receptor-binding site of HA determines the receptor-binding preference change. We conclude that the human-infecting H6N1 evolved into a human receptor preference. PMID:25940072
Pozhitkov, Alex E; Noble, Peter A; Bryk, Jarosław; Tautz, Diethard
2014-01-01
Although microarrays are analysis tools in biomedical research, they are known to yield noisy output that usually requires experimental confirmation. To tackle this problem, many studies have developed rules for optimizing probe design and devised complex statistical tools to analyze the output. However, less emphasis has been placed on systematically identifying the noise component as part of the experimental procedure. One source of noise is the variance in probe binding, which can be assessed by replicating array probes. The second source is poor probe performance, which can be assessed by calibrating the array based on a dilution series of target molecules. Using model experiments for copy number variation and gene expression measurements, we investigate here a revised design for microarray experiments that addresses both of these sources of variance. Two custom arrays were used to evaluate the revised design: one based on 25 mer probes from an Affymetrix design and the other based on 60 mer probes from an Agilent design. To assess experimental variance in probe binding, all probes were replicated ten times. To assess probe performance, the probes were calibrated using a dilution series of target molecules and the signal response was fitted to an adsorption model. We found that significant variance of the signal could be controlled by averaging across probes and removing probes that are nonresponsive or poorly responsive in the calibration experiment. Taking this into account, one can obtain a more reliable signal with the added option of obtaining absolute rather than relative measurements. The assessment of technical variance within the experiments, combined with the calibration of probes allows to remove poorly responding probes and yields more reliable signals for the remaining ones. Once an array is properly calibrated, absolute quantification of signals becomes straight forward, alleviating the need for normalization and reference hybridizations.
Interaction of Lysozyme with Rhodamine B: A combined analysis of spectroscopic & molecular docking.
Millan, Sabera; Satish, Lakkoji; Kesh, Sandeep; Chaudhary, Yatendra S; Sahoo, Harekrushna
2016-09-01
The interaction of Rhodamine B (RB) with Lysozyme (Lys) was investigated by different optical spectroscopic techniques such as absorption, fluorescence, and circular-dichroism (CD), along with molecular docking studies. The fluorescence results (including steady-state and time-resolved mode) revealed that the addition of RB effectively causes strong quenching of intrinsic fluorescence in Lysozyme and mostly, by the static quenching mechanism. Different binding and thermodynamic parameters were calculated at different temperatures and the binding constant value was found to be 2963.54Lmol(-1) at 25°C. The average distance (r0) was found to be 3.31nm according to Förster's theory of non-radiative energy transfer between Lysozyme and RB. The conformational change in Lysozyme during interaction with RB was confirmed from absorbance, synchronous fluorescence, and circular dichroism measurements. Finally, molecular docking studies were done to confirm that the dye binds with Lysozyme. Copyright © 2016 Elsevier B.V. All rights reserved.
Agelis, George; Roumelioti, Panagiota; Resvani, Amalia; Durdagi, Serdar; Androutsou, Maria-Eleni; Kelaidonis, Konstantinos; Vlahakos, Demetrios; Mavromoustakos, Thomas; Matsoukas, John
2010-09-01
A new 1,5 disubstituted imidazole AT(1) Angiotensin II (AII) receptor antagonist related to losartan with reversion of butyl and hydroxymethyl groups at the 2-, 5-positions of the imidazole ring was synthesized and evaluated for its antagonist activity (V8). In vitro results indicated that the reorientation of butyl and hydroxymethyl groups on the imidazole template of losartan retained high binding affinity to the AT(1) receptor concluding that the spacing of the substituents at the 2,5- positions is of primary importance. The docking studies are confirmed by binding assay results which clearly show a comparable binding score of the designed compound V8 with that of the prototype losartan. An efficient, regioselective and cost effective synthesis renders the new compound as an attractive candidate for advanced toxicological evaluation and a drug against hypertension.
NASA Astrophysics Data System (ADS)
Agelis, George; Roumelioti, Panagiota; Resvani, Amalia; Durdagi, Serdar; Androutsou, Maria-Eleni; Kelaidonis, Konstantinos; Vlahakos, Demetrios; Mavromoustakos, Thomas; Matsoukas, John
2010-09-01
A new 1,5 disubstituted imidazole AT1 Angiotensin II (AII) receptor antagonist related to losartan with reversion of butyl and hydroxymethyl groups at the 2-, 5-positions of the imidazole ring was synthesized and evaluated for its antagonist activity ( V8). In vitro results indicated that the reorientation of butyl and hydroxymethyl groups on the imidazole template of losartan retained high binding affinity to the AT1 receptor concluding that the spacing of the substituents at the 2,5- positions is of primary importance. The docking studies are confirmed by binding assay results which clearly show a comparable binding score of the designed compound V8 with that of the prototype losartan. An efficient, regioselective and cost effective synthesis renders the new compound as an attractive candidate for advanced toxicological evaluation and a drug against hypertension.
LaRbp38: A Leishmania amazonensis protein that binds nuclear and kinetoplast DNAs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lira, C.B.B.; Instituto de Biologia, UNICAMP, Campinas, SP; Siqueira Neto, J.L.
Leishmania amazonensis causes a wide spectrum of leishmaniasis. There are no vaccines or adequate treatment for leishmaniasis, therefore there is considerable interest in the identification of new targets for anti-leishmania drugs. The central role of telomere-binding proteins in cell maintenance makes these proteins potential targets for new drugs. In this work, we used a combination of purification chromatographies to screen L. amazonensis proteins for molecules capable of binding double-stranded telomeric DNA. This approach resulted in the purification of a 38 kDa polypeptide that was identified by mass spectrometry as Rbp38, a trypanosomatid protein previously shown to stabilize mitochondrial RNA andmore » to associate with nuclear and kinetoplast DNAs. Western blotting and supershift assays confirmed the identity of the protein as LaRbp38. Competition and chromatin immunoprecipitation assays confirmed that LaRbp38 interacted with kinetoplast and nuclear DNAs in vivo and suggested that LaRbp38 may have dual cellular localization and more than one function.« less
Spectroscopic and theoretical investigation of oxali-palladium interactions with β-lactoglobulin.
Ghalandari, Behafarid; Divsalar, Adeleh; Saboury, Ali Akbar; Haertlé, Thomas; Parivar, Kazem; Bazl, Roya; Eslami-Moghadam, Mahbube; Amanlou, Massoud
2014-01-24
The possibility of using a small cheap dairy protein, β-lactoglobulin (β-LG), as a carrier for oxali-palladium for drug delivery was studied. Their binding in an aqueous solution at two temperatures of 25 and 37°C was investigated using spectroscopic techniques in combination with a molecular docking study. Fluorescence intensity changes showed combined static and dynamic quenching during β-LG oxali-palladium binding, with the static mode being predominant in the quenching mechanism. The binding and thermodynamic parameters were determined by analyzing the results of quenching and those of the van't Hoff equation. According to obtained results the binding constants at two temperatures of 25 and 37°C are 3.3×10(9) M(-1) and 18.4×10(6) M(-1) respectively. Fluorescence resonance energy transfer (FRET) showed that the experimental results and the molecular docking results were coherent. An absence change of β-LG secondary structure was confirmed by the CD results. Molecular docking results agreed fully with the experimental results since the fluorescence studies also revealed the presence of two binding sites with a negative value for the Gibbs free energy of binding of oxali-palladium to β-LG. Furthermore, molecular docking and experimental results suggest that the hydrophobic effect plays a critical role in the formation of the oxali-palladium complex with β-LG. This agreement between molecular docking and experimental results implies that docking studies may be a suitable method for predicting and confirming experimental results, as shown in this study. Hence, the combination of molecular docking and spectroscopy methods is an effective innovative approach for binding studies, particularly for pharmacophores. Copyright © 2013 Elsevier B.V. All rights reserved.
Arginine- and lysine-specific polymers for protein recognition and immobilization.
Renner, Christian; Piehler, Jacob; Schrader, Thomas
2006-01-18
Free radical polymerization of methacrylamide-based bisphosphonates turns weak arginine binders into powerful polymeric protein receptors. Dansyl-labeled homo- and copolymers with excellent water solubility are accessible through a simple copolymerization protocol. Modeling studies point to a striking structural difference between the stiff rodlike densely packed homopolymer 1 and the flexible copolymer 2 with spatially separated bisphosphonate units. Fluorescence titrations in buffered aqueous solution (pH = 7.0) confirm the superior affinity of the homopolymer toward oligoarginine peptides reaching nanomolar K(D) values for the Tat peptide. Basic proteins are bound almost equally well by 1 and 2 with micromolar affinities, with the latter producing much more soluble complexes. The Arg selectivity of the monomer is transferred to the polymer, which binds Arg-rich proteins 1 order of magnitude tighter than lysine-rich pendants of comparable pI, size, and (Arg/Lys vs Glu/Asp) ratio. Noncovalent deposition of both polymers on glass substrates via polyethyleneimine layers results in new materials suitable for peptide and protein immobilization. RIfS measurements allow calculation of association constants K(a) as well as dissociation kinetics k(D). They generally confirm the trends already found in free solution. Close inspection of electrostatic potential surfaces suggest that basic domains favor protein binding on the flat surface. The high specificity of the bisphosphonate polymers toward basic proteins is demonstrated by comparison with polyvinyl sulfate, which has almost no effect in RIfS experiments. Thus, copolymerization of few different comonomer units without cross-linking enables surface recognition of basic proteins in free solution as well as their effective immobilization on surfaces.
Theory of long binding events in single-molecule–controlled rotation experiments on F1-ATPase
Volkán-Kacsó, Sándor; Marcus, Rudolph A.
2017-01-01
The theory of elastic group transfer for the binding and release rate constants for nucleotides in F1-ATPase as a function of the rotor angle is further extended in several respects. (i) A method is described for predicting the experimentally observed lifetime distribution of long binding events in the controlled rotation experiments by taking into account the hydrolysis and synthesis reactions occurring during these events. (ii) A method is also given for treating the long binding events in the experiments and obtaining the rate constants for the hydrolysis and synthesis reactions occurring during these events. (iii) The theory in the previous paper is given in a symmetric form, an extension that simplifies the application of the theory to experiments. It also includes a theory-based correction of the reported “on” and “off” rates by calculating the missed events. A near symmetry of the data about the angle of −40° and a “turnover” in the binding rate data vs. rotor angle for angles greater than ∼40° is also discussed. PMID:28652332
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gogami, Toshiyuki
In 2009 (August-November), the E05-115 experiment was carried out at JLab to investigate L hypernuclei in the wide mass region up to A = 52 (more » $$7\\atop{Λ}$$He, $$10\\atop{Λ}$$Be, $$12\\atop{Λ}$$B and $$52\\atop{Λ}$$V) with the (e,e'K +) reaction. This is the first attempt to investigate a medium heavy L hypernucleus with the (e,e'K +) reaction. Experimentally, it is difficult to measure heavier L hypernuclei as background rates of particles which originate from electromagnetic processes are roughly in proportion to Z2 (Z: target proton number) in the (e,e'K +) experiment. To perform the experiment, many experimental techniques have been developed and introduced such as optimization of the electron spectrometer configuration (tilt method), clean kaon identification, particle tracking under high multiplicity environment, precise energy scale calibration and so on. In the present thesis, experimental results of the elementary process of p(e,e'K +)L, L hypernuclei of $$7\\atop{Λ}$$He, $$10\\atop{Λ}$$Be, $$12\\atop{Λ}$$B and $$52\\atop{Λ}$$V are shown. Elementary processes of the electroproduction of L and Σ 0, p(e,e'K +)L, Σ 0 were used for the absolute energy scale calibration of our spectrometer systems. A careful Monte Carlo simulation shows that the binding energy can be obtained with a systematic error of 0.11 MeV with our energy scale calibration method. A study of the elementary process of L is important to understand L hypernuclei as it is essential for theoretical calculations of L hypernuclei. The differential cross section of the p(e,e'K +)L reaction at the small K + scattering angle (theta-CM/gamma-K approx. 15.5°), the small Q 2 (approx 0.01 [GeV/c] 2) and the total energy of W = 1.92 GeV, where no experimental data exists was obtained to be 235 ± 13$$+28\\atop{-24}$$ nb/sr. The ground state (1/2 +) binding energy of $$7\\atop{Λ}$$He was already measured in JLab E01-011 (2005). In the present work, the binding energy of 1/2 + state was determined to be B Λ = 5.55 ± 0.10 ±0.11 MeV with five times more statistic and smaller systematic errors than those of the previous experiment. The ground state binding energy is important to test the phe- nomenologically introduced CSB (Charge Symmetry Breaking) LN interaction for A = 7, T = 1 hypernuclear systems. In addition, a peak which is interpreted as 3/2 + and 5/2 + states was measured to be B Λ = 3.65 ± 0.20 ±0.11 MeV with sufficient statistic for the first time. Only three events of the ground state of $$10\\atop{Λ}$$ Be had been observed in the emulsion experiments. The present experiment is the first spectroscopic measurement of 10/L-Be, and the detailed structures have been successfully measured for the first time. About three times better energy resolution was achieved in the present experiment (0.78 MeV in FWHM) than that of the mirror L hy- pernucleus, $$10\\atop{Λ}$$B (2.2 MeV in FWHM) which was measured in the (π +,K +) experiment at KEK. The result of the ground state binding energy was obtained to be B Λ = 8.55 ± 0.07 ± 0.11 MeV which serves also to discuss about the CSB effect in the LN interaction. $$12\\atop{Λ}$$B has been measured with the world best energy resolution of 0:5 MeV (FWHM) among the reaction spectroscopy of L hypernuclei. The results of $$12\\atop{Λ}$$B are compared with the experimental results in the previous experiments to confirm the consistency. Furthermore, the obtained ground state binding energies of $$12\\atop{Λ}$$B (B Λ= 11.38 ± 0.02 ± 0.11 MeV) and $$52\\atop{Λ}$$V (B Λ = 21.88 ± 0.59 ± 0.11 MeV) indicate that the reported value of 12/L-C which has been used as a reference of binding energy measurements for the (π +,K +) experiments would be shallower by ~ 0.5 MeV. A pilot study for investigation in the medium-heavy mass region with the (e,e'K +) experiment was performed by measuring $$52\\atop{Λ}$$V. The ground state binding energy of $$52\\atop{Λ}$$V has been measured, overcoming high multiplicity environment. The results are discussed with the ex- perimental results of 51/L-V measured at KEK. The present result is the first measurement of L's binding energy of the ground state without the emulsion reference in the medium-heavy mass region, which could be a substantial improvement in the information needed for understanding the single particle potential of L. In the present experiment, L hypernuclear measurement with a small systematic error of ~ 0.1 MeV by the (e,e'K +) reaction has been established. Moreover, the present work opened a door to the heavier L hypernuclear measurement with the (e,e'K +) reaction in the future.« less
Conformational selection in protein binding and function
Weikl, Thomas R; Paul, Fabian
2014-01-01
Protein binding and function often involves conformational changes. Advanced nuclear magnetic resonance (NMR) experiments indicate that these conformational changes can occur in the absence of ligand molecules (or with bound ligands), and that the ligands may “select” protein conformations for binding (or unbinding). In this review, we argue that this conformational selection requires transition times for ligand binding and unbinding that are small compared to the dwell times of proteins in different conformations, which is plausible for small ligand molecules. Such a separation of timescales leads to a decoupling and temporal ordering of binding/unbinding events and conformational changes. We propose that conformational-selection and induced-change processes (such as induced fit) are two sides of the same coin, because the temporal ordering is reversed in binding and unbinding direction. Conformational-selection processes can be characterized by a conformational excitation that occurs prior to a binding or unbinding event, while induced-change processes exhibit a characteristic conformational relaxation that occurs after a binding or unbinding event. We discuss how the ordering of events can be determined from relaxation rates and effective on- and off-rates determined in mixing experiments, and from the conformational exchange rates measured in advanced NMR or single-molecule fluorescence resonance energy transfer experiments. For larger ligand molecules such as peptides, conformational changes and binding events can be intricately coupled and exhibit aspects of conformational-selection and induced-change processes in both binding and unbinding direction. PMID:25155241
Striking Confinement Effect: AuCl[subscript 4][superscript -] Binding to Amines in a Nanocage Cavity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henao, Juan D.; Suh, Young-Woong; Lee, Jeong-Kyu
2009-02-23
Binding of AuCl{sub 4}{sup -} to amine groups tethered to the interior of a 2 nm siloxane nanocage was determined in solutions containing various concentrations of acid. The mode of binding was inferred from EXAFS and UV-vis spectra to be by ligand exchange of amine for chloride, which implies that the amines remain unprotonated. Cyclic voltammetry confirmed that the Au complexes bind to the nanocage interior and established a 1:1 relationship between bound Au complex and amine groups. The results suggested a 5-7 pH unit shift in the protonation constant of the interior amines relative to free amines in solution.
Capillarity theory for the fly-casting mechanism
Trizac, Emmanuel; Levy, Yaakov; Wolynes, Peter G.
2010-01-01
Biomolecular folding and function are often coupled. During molecular recognition events, one of the binding partners may transiently or partially unfold, allowing more rapid access to a binding site. We describe a simple model for this fly-casting mechanism based on the capillarity approximation and polymer chain statistics. The model shows that fly casting is most effective when the protein unfolding barrier is small and the part of the chain which extends toward the target is relatively rigid. These features are often seen in known examples of fly casting in protein–DNA binding. Simulations of protein–DNA binding based on well-funneled native-topology models with electrostatic forces confirm the trends of the analytical theory. PMID:20133683
Programming A Molecular Relay for Ultrasensitive Biodetection through 129 Xe NMR
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yanfei; Roose, Benjamin W.; Philbin, John P.
2015-12-21
We reported a supramolecular strategy for detecting specific proteins in complex media by using hyperpolarized 129Xe NMR. A cucurbit[6]uril (CB[6])-based molecular relay was programmed for three sequential equilibrium conditions by designing a two-faced guest (TFG) that initially binds CB[6] and blocks the CB[6]–Xe interaction. Moreover, the protein analyte recruits the TFG and frees CB[6] for Xe binding. TFGs containing CB[6]- and carbonic anhydrase II (CAII)-binding domains were synthesized in one or two steps. X-ray crystallography confirmed TFG binding to Zn 2+ in the deep CAII active-site cleft, which precludes simultaneous CB[6] binding. The molecular relay was reprogrammed to detect avidinmore » by using a different TFG. Finally, Xe binding by CB[6] was detected in buffer and in E. coli cultures expressing CAII through ultrasensitive 129Xe NMR spectroscopy.« less
Dissection of the methyl-CpG binding domain from the chromosomal protein MeCP2.
Nan, X; Meehan, R R; Bird, A
1993-01-01
MeCP2 is a chromosomal protein which binds to DNA that is methylated at CpG. In situ immunofluorescence in mouse cells has shown that the protein is most concentrated in pericentromeric heterochromatin, suggesting that MeCP2 may play a role in the formation of inert chromatin. Here we have isolated a minimal methyl-CpG binding domain (MBD) from MeCP2. MBD is 85 amino acids in length, and binds exclusively to DNA that contains one or more symmetrically methylated CpGs. MBD has negligable non-specific affinity for DNA, confirming that non-specific and methyl-CpG specific binding domains of MeCP2 are distinct. In vitro footprinting indicates that MBD binding can protect a 12 nucleotide region surrounding a methyl-CpG pair, with an approximate dissociation constant of 10(-9) M. Images PMID:8177735
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
Santi-Gadelha, T; Rocha, B A M; Oliveira, C C; Aragão, K S; Marinho, E S; Gadelha, C A A; Toyama, M H; Pinto, V P T; Nagano, C S; Delatorre, P; Martins, J L; Galvani, F R; Sampaio, A H; Debray, H; Cavada, B S
2008-07-01
A lectin-like protein from the seeds of Acacia farnesiana was isolated from the albumin fraction, characterized, and sequenced by tandem mass spectrometry. The albumin fraction was extracted with 0.5 M NaCl, and the lectin-like protein of A. farnesiana (AFAL) was purified by ion-exchange chromatography (Mono-Q) followed by chromatofocusing. AFAL agglutinated rabbit erythrocytes and did not agglutinate human ABO erythrocytes either native or treated with proteolytic enzymes. In sodium dodecyl sulfate gel electrophoresis under reducing and nonreducing conditions, AFAL separated into two bands with a subunit molecular mass of 35 and 50 kDa. The homogeneity of purified protein was confirmed by chromatofocusing with a pI = 4.0 +/- 0.5. Molecular exclusion chromatography confirmed time-dependent oligomerization in AFAL, in accordance with mass spectrometry analysis, which confers an alteration in AFAL affinity for chitin. The protein sequence was obtained by a liquid chromatography quadrupole time-of-flight experiment and showed that AFAL has 68% and 63% sequence similarity with lectins of Phaseolus vulgaris and Dolichos biflorus, respectively.
Neuroscience: toward unbinding the binding problem.
Whitney, David
2009-03-24
How the brain 'binds' information to create a coherent perceptual experience is an enduring question. Recent research in the psychophysics of perceptual binding and developments in fMRI analysis techniques are bringing us closer to an understanding of how the brain solves the binding problem.
NASA Astrophysics Data System (ADS)
Day, Emily Shannon
2011-12-01
This thesis advances the use of nanoparticles as multifunctional agents for molecularly-targeted cancer imaging and photothermal therapy. Cancer mortality has remained relatively unchanged for several decades, indicating a significant need for improvements in care. Researchers are evaluating strategies incorporating nanoparticles as exogenous energy absorbers to deliver heat capable of inducing cell death selectively to tumors, sparing normal tissue. Molecular targeting of nanoparticles is predicted to improve photothermal therapy by enhancing tumor retention. This hypothesis is evaluated with two types of nanoparticles. The nanoparticles utilized, silica-gold nanoshells and gold-gold sulfide nanoparticles, can convert light energy into heat to damage cancerous cells. For in vivo applications nanoparticles are usually coated with poly(ethylene glycol) (PEG) to increase blood circulation time. Here, heterobifunctional PEG links nanoparticles to targeting agents (antibodies and growth factors) to provide cell-specific binding. This approach is evaluated through a series of experiments. In vitro, antibody-coated nanoparticles can bind breast carcinoma cells expressing the targeted receptor and act as contrast agents for multiphoton microscopy prior to inducing cell death via photoablation. Furthermore, antibody-coated nanoparticles can bind tissue ex vivo at levels corresponding to receptor expression, suggesting they should bind their target even in the complex biological milieu. This is evaluated by comparing the accumulation of antibody-coated and PEG-coated nanoparticles in subcutaneous glioma tumors in mice. Contrary to expectations, antibody targeting did not yield more nanoparticles within tumors. Nevertheless, these studies established the sensitivity of glioma to photothermal therapy; mice treated with PEG-coated nanoshells experienced 57% complete tumor regression versus no regression in control mice. Subsequent experiments employed intracranial tumors to better mimic the clinical setting. These tumors are highly vascularized, so nanoparticles were addressed toward receptors abundantly expressed on tumor vessels using growth factors as a novel targeting strategy. Photothermal therapy with these vascular-targeted nanoparticles disrupted tumor vessels, leading to a 2.2-fold prolongation of median survival versus control mice. This work confirms that nanoparticle surface coating can affect biodistribution and therapeutic efficacy. With continued optimization of molecular targeting strategies, imaging and photothermal therapy mediated by nanoshells and gold-gold sulfide nanoparticles may offer an effective alternative to conventional cancer management.
ERIC Educational Resources Information Center
Peihong Liang; Adhyaru, Bhavin; Pearson, Wright L.; Williams, Kathryn R.
2006-01-01
The experiment used [to the third power]H-labeled estradiol to determine the binding constant of estradiol to bovine serum albumin. Estradiol must complex with serum proteins for the transport in the blood stream because of its low solubility in aqueous systems and estradiol-protein binding constant, where K[subscript B] is important to understand…
Mozafari, Mona; Balasupramaniam, Shantheya; Preu, Lutz; El Deeb, Sami; Reiter, Christian G; Wätzig, Hermann
2017-06-01
A fast and precise affinity capillary electrophoresis (ACE) method has been developed and applied for the investigation of the binding interactions between P-selectin and heparinoids as potential P-selectin inhibitors in the presence and absence of calcium ions. Furthermore, model proteins and vitronectin were used to appraise the binding behavior of P-selectin. The normalized mobility ratios (∆R/R f ), which provided information about the binding strength and the overall charge of the protein-ligand complex, were used to evaluate the binding affinities. It was found that P-selectin interacts more strongly with heparinoids in the presence of calcium ions. P-selectin was affected by heparinoids at the concentration of 3 mg/L. In addition, the results of the ACE experiments showed that among other investigated proteins, albumins and vitronectin exhibited strong interactions with heparinoids. Especially with P-selectin and vitronectin, the interaction may additionally induce conformational changes. Subsequently, computational models were applied to interpret the ACE experiments. Docking experiments explained that the binding of heparinoids on P-selectin is promoted by calcium ions. These docking models proved to be particularly well suited to investigate the interaction of charged compounds, and are therefore complementary to ACE experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Genistein Binding to Copper(II)-Solvent Dependence and Effects on Radical Scavenging.
Yang, Jing; Xu, Yi; Liu, Hao-Yu; Han, Rui-Min; Zhang, Jian-Ping; Skibsted, Leif H
2017-10-18
Genistein, but not daidzein, binds to copper(II) with a 1:2 stoichiometry in ethanol and with a 1:1 stoichiometry in methanol, indicating chelation by the 5-phenol and the 4-keto group of the isoflavonoid as demonstrated by the Jobs method and UV-visible absorption spectroscopy. In ethanol, the stability constants had the value 1.12 × 10 11 L²∙mol -2 for the 1:2 complex and in methanol 6.0 × 10⁵ L∙mol -1 for the 1:1 complex at 25 °C. Binding was not detected in water, as confirmed by an upper limit for the 1:1 stability constant of K = 5 mol -1 L as calculated from the difference in solvation free energy of copper(II) between methanol and the more polar water. Solvent molecules compete with genistein as demonstrated in methanol where binding stoichiometry changes from 1:2 to 1:1 compared to ethanol and methanol/chloroform (7/3, v / v ). Genistein binding to copper(II) increases the scavenging rate of the stable, neutral 2,2-diphenyl-1-picrylhydrazyl radical by more than a factor of four, while only small effects were seen for the short-lived but more oxidizing β -carotene radical cation using laser flash photolysis. The increased efficiency of coordinated genistein is concluded to depend on kinetic rather than on thermodynamic factors, as confirmed by the small change in reduction potential of -0.016 V detected by cyclic voltammetry upon binding of genistein to copper(II) in methanol/chloroform solutions.
Pokemon promotes the invasiveness of hepatocellular carcinoma by enhancing MEF2D transcription.
Kong, Jing; Liu, Xiaoping; Li, Xiangqian; Wu, Jinsheng; Wu, Ning; Chen, Jun; Fang, Fang
2016-05-01
Pokemon, a master oncogene crucial for the tumorigenicity and progression of a variety of cancers, has been demonstrated to enhance the proliferation and survival of hepatocellular carcinoma (HCC). However, the contribution of Pokemon to the invasiveness of HCC has not yet been studied. In this study, we employed HCC cells to investigate the role of Pokemon in the invasion of HCC with multidisciplinary approaches. Pokemon overexpression was found to be closely associated with invasion and intrahepatic metastasis of HCC in clinical specimens. Suppression of Pokemon attenuated the invasion of HCC cells by in vitro transwell and wound-healing assays. Myocyte enhancer factor 2D (MEF2D), an oncogene that can promote the invasiveness of HCC, was found to be underexpressed during Pokemon silencing in HCC cells. Restoration of MEF2D abolished the effect of Pokemon downregulation on the migration of HCC cells. Further experiments verified that Pokemon binds two putative recognition sites located within the upstream region of the MEF2D promoter and enhances its transcription. The association between Pokemon and MEF2D was further confirmed in HCC specimens. Animal experiments further confirmed that Pokemon downregulation attenuated the metastasis of HCC cells in mice. Collectively, Pokemon was found to enhance the migration and invasion of HCC by increasing MEF2D expression. Thus, targeting Pokemon and MEF2D may be an effective strategy to suppress the metastasis of HCC.
Wang, Weijun; Mai-Gisondi, Galina; Stogios, Peter J.; Kaur, Amrit; Xu, Xiaohui; Cui, Hong; Turunen, Ossi; Savchenko, Alexei
2014-01-01
Xylan-debranching enzymes facilitate the complete hydrolysis of xylan and can be used to alter xylan chemistry. Here, the family GH62 α-l-arabinofuranosidase from Streptomyces thermoviolaceus (SthAbf62A) was shown to have a half-life of 60 min at 60°C and the ability to cleave α-1,3 l-arabinofuranose (l-Araf) from singly substituted xylopyranosyl (Xylp) backbone residues in wheat arabinoxylan; low levels of activity on arabinan as well as 4-nitrophenyl α-l-arabinofuranoside were also detected. After selective removal of α-1,3 l-Araf substituents from disubstituted Xylp residues present in wheat arabinoxylan, SthAbf62A could also cleave the remaining α-1,2 l-Araf substituents, confirming the ability of SthAbf62A to remove α-l-Araf residues that are (1→2) and (1→3) linked to monosubstituted β-d-Xylp sugars. Three-dimensional structures of SthAbf62A and its complex with xylotetraose and l-arabinose confirmed a five-bladed β-propeller fold and revealed a molecular Velcro in blade V between the β1 and β21 strands, a disulfide bond between Cys27 and Cys297, and a calcium ion coordinated in the central channel of the fold. The enzyme-arabinose complex structure further revealed a narrow and seemingly rigid l-arabinose binding pocket situated at the center of one side of the β propeller, which stabilized the arabinofuranosyl substituent through several hydrogen-bonding and hydrophobic interactions. The predicted catalytic amino acids were oriented toward this binding pocket, and the catalytic essentiality of Asp53 and Glu213 was confirmed by site-specific mutagenesis. Complex structures with xylotetraose revealed a shallow cleft for xylan backbone binding that is open at both ends and comprises multiple binding subsites above and flanking the l-arabinose binding pocket. PMID:24951792
NASA Astrophysics Data System (ADS)
Xi, Lei; Wang, Yu; He, Qing; Zhang, Qingyan; Du, Linfang
2016-12-01
The binding of epigallocatechin-3-gallate (EGCG) to wild type Pin1 in solution was studied by spectroscopic methods and molecular dynamics simulations in this research to explore the binding mode and inhibition mechanism. The binding constants and number of binding sites per Pin1 for EGCG were calculated through the Stern-Volmer equation. The values of binding free energy and thermodynamic parameters were calculated and indicated that hydrogen bonds, electrostatic interaction and Van der Waals interaction played the major role in the binding process. The alterations of Pin1 secondary structure in the presence of EGCG were confirmed by far-UV circular dichroism spectra. The binding model at atomic-level revealed that EGCG was bound to the Glu12, Lys13, Arg14, Met15 and Arg17 in WW domain. Furthermore, EGCG could also interact with Arg69, Asp112, Cys113 and Ser114 in PPIase domain.
Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R
2013-09-17
Cell adhesion and the adhesion of vesicles to the membranes of cells or organelles are pivotal for immune responses, tissue formation, and cell signaling. The adhesion processes depend sensitively on the binding constant of the membrane-anchored receptor and ligand proteins that mediate adhesion, but this constant is difficult to measure in experiments. We have investigated the binding of membrane-anchored receptor and ligand proteins with molecular dynamics simulations. We find that the binding constant of the anchored proteins strongly decreases with the membrane roughness caused by thermally excited membrane shape fluctuations on nanoscales. We present a theory that explains the roughness dependence of the binding constant for the anchored proteins from membrane confinement and that relates this constant to the binding constant of soluble proteins without membrane anchors. Because the binding constant of soluble proteins is readily accessible in experiments, our results provide a useful route to compute the binding constant of membrane-anchored receptor and ligand proteins.
Relational and conjunctive binding functions dissociate in short-term memory.
Parra, Mario A; Fabi, Katia; Luzzi, Simona; Cubelli, Roberto; Hernandez Valdez, Maria; Della Sala, Sergio
2015-02-01
Remembering complex events requires binding features within unified objects (conjunctions) and holding associations between objects (relations). Recent studies suggest that the two functions dissociate in long-term memory (LTM). Less is known about their functional organization in short-term memory (STM). The present study investigated this issue in patient AE affected by a stroke which caused damage to brain regions known to be relevant for relational functions both in LTM and in STM (i.e., the hippocampus). The assessment involved a battery of standard neuropsychological tasks and STM binding tasks. One STM binding task (Experiment 1) presented common objects and common colors forming either pairs (relations) or integrated objects (conjunctions). Free recall of relations or conjunctions was assessed. A second STM binding task used random polygons and non-primary colors instead (Experiment 2). Memory was assessed by selecting the features that made up the relations or the conjunctions from a set of single polygons and a set of single colors. The neuropsychological assessment revealed impaired delayed memory in AE. AE's pronounced relational STM binding deficits contrasted with his completely preserved conjunctive binding functions in both Experiments 1 and 2. Only 2.35% and 1.14% of the population were expected to have a discrepancy more extreme than that presented by AE in Experiments 1 and 2, respectively. Processing relations and conjunctions of very elementary nonspatial features in STM led to dissociating performances in AE. These findings may inform current theories of memory decline such as those linked to cognitive aging.
Annexin A5 binds to lipopolysaccharide and reduces its endotoxin activity.
Rand, Jacob H; Wu, Xiao-Xuan; Lin, Elaine Y; Griffel, Alexander; Gialanella, Philip; McKitrick, John C
2012-01-01
Annexin A5 (AnxA5) has a high affinity for phosphatidylserine. The protein is widely used to detect apoptotic cells because phosphatidylserine, a phospholipid that is normally present in the inner leaflets of cytoplasmic membranes, becomes translocated to the outer leaflets during programmed cell death. Here we report the novel observation that AnxA5 binds to Gram-negative bacteria via the lipid A domain of lipopolysaccharide (LPS). Binding of AnxA5 to bacteria was measured quantitatively, confirmed by fluorescence microscopy, and found to be inhibited by antibodies against lipid A. AnxA5 also bound to purified dot-blotted LPS and lipid A. Through ellipsometry, we found that the binding of AnxA5 to purified LPS was calcium dependent and rapid and showed a high affinity-characteristics similar to those of AnxA5 binding to phosphatidylserine. Initial functional studies indicated that AnxA5 can affect LPS activities. AnxA5 inhibited LPS-mediated gelation in the Limulus amebocyte lysate assay. Incubation of LPS with the protein reduced the quantity of tumor necrosis factor alpha (TNF-α) released by cultured monocytes compared to that released upon incubation with LPS alone. Initial in vivo experiments indicated that injection of mice with LPS preincubated with AnxA5 produced serum TNF-α levels lower than those seen after injection of LPS alone. These data demonstrate that AnxA5 binds to LPS and open paths to investigation of the potential biological and therapeutic implications of this interaction. AnxA5 is highly expressed in cells that have a barrier function-including, among others, vascular endothelium, placental trophoblasts, and epithelial cells lining bile ducts, renal tubules, mammary ducts, and nasal epithelium. The protein has been well characterized for its binding to phospholipid bilayers that contain phosphatidylserine. This report of a previously unrecognized activity of AnxA5 opens the door to investigation of the possibility that this binding may have biological and therapeutic ramifications. In view of the tissue expression of the protein, the present results suggest the possibility that AnxA5 plays a role in modulating the host defense against lipopolysaccharide at these anatomic sites, where cells may interface with microorganisms. These results also raise the intriguing possibility that AnxA5 or analogous proteins or peptides could provide novel approaches to addressing the difficult clinical problem of Gram-negative sepsis.
Vippagunta, S R; Dorn, A; Matile, H; Bhattacharjee, A K; Karle, J M; Ellis, W Y; Ridley, R G; Vennerstrom, J L
1999-11-04
Considerable data now support the hypothesis that chloroquine (CQ)-hematin binding in the parasite food vacuole leads to inhibition of hematin polymerization and parasite death by hematin poisoning. To better understand the structural specificity of CQ-hematin binding, 13 CQ analogues were chosen and their hematin binding affinity, inhibition of hematin polymerization, and inhibition of parasite growth were measured. As determined by isothermal titration calorimetry (ITC), the stoichiometry data and exothermic binding enthalpies indicated that, like CQ, these analogues bind to two or more hematin mu-oxo dimers in a cofacial pi-pi sandwich-type complex. Association constants (K(a)'s) ranged from 0.46 to 2.9 x 10(5) M(-1) compared to 4.0 x 10(5) M(-1) for CQ. Remarkably, we were not able to measure any significant interaction between hematin mu-oxo dimer and 11, the 6-chloro analogue of CQ. This result indicates that the 7-chloro substituent in CQ is a critical structural determinant in its binding affinity to hematin mu-oxo dimer. Molecular modeling experiments reinforce the view that the enthalpically favorable pi-pi interaction observed in the CQ-hematin mu-oxo dimer complex derives from a favorable alignment of the out-of-plane pi-electron density in CQ and hematin mu-oxo dimer at the points of intermolecular contact. For 4-aminoquinolines related to CQ, our data suggest that electron-withdrawing functional groups at the 7-position of the quinoline ring are required for activity against both hematin polymerization and parasite growth and that chlorine substitution at position 7 is optimal. Our results also confirm that the CQ diaminoalkyl side chain, especially the aliphatic tertiary nitrogen atom, is an important structural determinant in CQ drug resistance. For CQ analogues 1-13, the lack of correlation between K(a) and hematin polymerization IC(50) values suggests that other properties of the CQ-hematin mu-oxo dimer complex, rather than its association constant alone, play a role in the inhibition of hematin polymerization. However, there was a modest correlation between inhibition of hematin polymerization and inhibition of parasite growth when hematin polymerization IC(50) values were normalized for hematin mu-oxo dimer binding affinities, adding further evidence that antimalarial 4-aminoquinolines act by this mechanism.
Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.
2011-01-01
Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997
Naik, Subhashchandra; Brock, Susan; Akkaladevi, Narahari; Tally, Jon; Mcginn-Straub, Wesley; Zhang, Na; Gao, Phillip; Gogol, E. P.; Pentelute, B. L.; Collier, R. John; Fisher, Mark T.
2013-01-01
Domain 2 of the anthrax protective antigen (PA) prepore heptamer unfolds and refolds during endosome acidification to generate an extended 100 Å beta barrel pore that inserts into the endosomal membrane. The PA pore facilitates the pH dependent unfolding and translocation of bound toxin enzymic components, lethal factor (LF) and/or edema factor (EF), from the endosome into the cytoplasm. We constructed immobilized complexes of the prepore with the PA-binding domain of LF (LFN) to monitor the real-time prepore to pore kinetic transition using surface plasmon resonance (SPR) and bio-layer interferometry (BLI). The kinetics of this transition increased as the solution pH was decreased from pH 7.5 to pH 5.0, mirroring acidification of the endosome. Once transitioned, the LFN-PA pore complex was removed from the BLI biosensor tip and deposited onto EM grids, where the PA pore formation was confirmed by negative stain electron microscopy. When the soluble receptor domain (ANTRX2/CMG2) binds the immobilized PA prepore, the transition to the pore state was observed only after the pH was lowered to early or late endosomal pH conditions (5.5 to 5.0 respectively). Once the pore formed, the soluble receptor readily dissociated from the PA pore. Separate binding experiments with immobilized PA pores and soluble receptor indicate that the receptor has a weakened propensity to bind to the transitioned pore. This immobilized anthrax toxin platform can be used to identify or validate potential antimicrobial lead compounds capable of regulating and/or inhibiting anthrax toxin complex formation or pore transitions. PMID:23964683
Naik, Subhashchandra; Brock, Susan; Akkaladevi, Narahari; Tally, Jon; McGinn-Straub, Wesley; Zhang, Na; Gao, Phillip; Gogol, E P; Pentelute, B L; Collier, R John; Fisher, Mark T
2013-09-17
Domain 2 of the anthrax protective antigen (PA) prepore heptamer unfolds and refolds during endosome acidification to generate an extended 100 Å β barrel pore that inserts into the endosomal membrane. The PA pore facilitates the pH-dependent unfolding and translocation of bound toxin enzymic components, lethal factor (LF) and/or edema factor, from the endosome to the cytoplasm. We constructed immobilized complexes of the prepore with the PA-binding domain of LF (LFN) to monitor the real-time prepore to pore kinetic transition using surface plasmon resonance and biolayer interferometry (BLI). The kinetics of this transition increased as the solution pH was decreased from 7.5 to 5.0, mirroring acidification of the endosome. Once it had undergone the transition, the LFN-PA pore complex was removed from the BLI biosensor tip and deposited onto electron microscopy grids, where PA pore formation was confirmed by negative stain electron microscopy. When the soluble receptor domain (ANTRX2/CMG2) binds the immobilized PA prepore, the transition to the pore state was observed only after the pH was lowered to early (pH 5.5) or late (pH 5.0) endosomal pH conditions. Once the pore formed, the soluble receptor readily dissociated from the PA pore. Separate binding experiments with immobilized PA pores and the soluble receptor indicate that the receptor has a weakened propensity to bind to the transitioned pore. This immobilized anthrax toxin platform can be used to identify or validate potential antimicrobial lead compounds capable of regulating and/or inhibiting anthrax toxin complex formation or pore transitions.
Pawar, Suma K; Jaldappagari, Seetharamappa
2017-09-01
In the present work, the mechanism of the interaction between a β1 receptor blocker, metoprolol succinate (MS) and human serum albumin (HSA) under physiological conditions was investigated by spectroscopic techniques, namely fluorescence, Fourier transform infra-red spectroscopy (FT-IR), fluorescence lifetime decay and circular dichroism (CD) as well as molecular docking and cyclic voltammetric methods. The fluorescence and lifetime decay results indicated that MS quenched the intrinsic intensity of HSA through a static quenching mechanism. The Stern-Volmer quenching constants and binding constants for the MS-HSA system at 293, 298 and 303 K were obtained from the Stern-Volmer plot. Thermodynamic parameters for the interaction of MS with HSA were evaluated; negative values of entropy change (ΔG°) indicated the spontaneity of the MS and HSA interaction. Thermodynamic parameters such as negative ΔH° and positive ΔS° values revealed that hydrogen bonding and hydrophobic forces played a major role in MS-HSA interaction and stabilized the complex. The binding site for MS in HSA was identified by competitive site probe experiments and molecular docking studies. These results indicated that MS was bound to HSA at Sudlow's site I. The efficiency of energy transfer and the distance between the donor (HSA) and acceptor (MS) was calculated based on the theory of Fosters' resonance energy transfer (FRET). Three-dimensional fluorescence spectra and CD results revealed that the binding of MS to HSA resulted in an obvious change in the conformation of HSA. Cyclic voltammograms of the MS-HSA system also confirmed the interaction between MS and HSA. Furthermore, the effects of metal ions on the binding of MS to HSA were also studied. Copyright © 2017 John Wiley & Sons, Ltd.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function.
The effect of natural organic matter on the adsorption of mercury to bacterial cells
NASA Astrophysics Data System (ADS)
Dunham-Cheatham, Sarrah; Mishra, Bhoopesh; Myneni, Satish; Fein, Jeremy B.
2015-02-01
We investigated the ability of non-metabolizing Bacillus subtilis, Shewanella oneidensis MR-1, and Geobacter sulfurreducens bacterial species to adsorb mercury in the absence and presence of Suwanee River fulvic acid (FA). Bulk adsorption and X-ray absorption spectroscopy (XAS) experiments were conducted at three pH conditions, and the results indicate that the presence of FA decreases the extent of Hg adsorption to biomass under all of the pH conditions studied. Hg XAS results show that the presence of FA does not alter the binding environment of Hg adsorbed onto the biomass regardless of pH or FA concentration, indicating that ternary bacteria-Hg-FA complexes do not form to an appreciable extent under the experimental conditions, and that Hg binding on the bacteria is dominated by sulfhydryl binding. We used the experimental results to calculate apparent partition coefficients, Kd, for Hg under each experimental condition. The calculations yield similar coefficients for Hg onto each of the bacterial species studies, suggesting there is no significant difference in Hg partitioning between the three bacterial species. The calculations also indicate similar coefficients for Hg-bacteria and Hg-FA complexes. S XAS measurements confirm the presence of sulfhydryl sites on both the FA and bacterial cells, and demonstrate the presence of a wide range of S moieties on the FA in contrast to the bacterial biomass, whose S sites are dominated by thiols. Our results suggest that although FA can compete with bacterial binding sites for aqueous Hg, because of the relatively similar partition coefficients for the types of sorbents, the competition is not dominated by either bacteria or FA unless the concentration of one type of site greatly exceeds that of the other.
Galoian, Karina; Abrahamyan, Silva; Chailyan, Gor; Qureshi, Amir; Patel, Parthik; Metser, Gil; Moran, Alexandra; Sahakyan, Inesa; Tumasyan, Narine; Lee, Albert; Davtyan, Tigran; Chailyan, Samvel; Galoyan, Armen
2018-01-01
Metastatic chondrosarcoma is a bone malignancy not responsive to conventional therapies; new approaches and therapies are urgently needed. We have previously reported that mTORC1 inhibitor, antitumorigenic cytostatic proline rich polypeptide 1 (PRP-1), galarmin caused a significant upregulation of tumor suppressors including TET1/2 and SOCS3 (known to be involved in inflammatory processes), downregulation of oncoproteins and embryonic stem cell marker miR-302C and its targets Nanog, c-Myc and Bmi-1 in human chondrosarcoma. To understand better the mechanism of PRP-1 action it was very important to identify the receptor it binds to. Nuclear pathway receptor and GPCR assays indicated that PRP-1 receptors are not G protein coupled, neither do they belong to family of nuclear or orphan receptors. In the present study, we have demonstrated that PRP-1 binding interacting partners belong to innate immunity pattern recognition toll like receptors TLR1/2 and TLR6 and gel forming secreted mucin MUC5B. MUC5B was identified as PRP-1 receptor in human chondrosarcoma JJ012 cell line using Ligand-receptor capture technology. Toll like receptors TLR1/2 and TLR6 were identified as binding interaction partners with PRP-1 by western blot analysis in human chondrosarcoma JJ012 cell line lysates. Immunocytochemistry experiments confirmed the finding and indicated the localization of PRP-1 receptors in the tumor nucleus predominantly. TLR1/2, TLR6 and MUC5B were downregulated in human chondrosarcoma and upregulated in dose-response manner upon PRP-1 treatment. Experimental data indicated that in this cellular context the mentioned receptors had tumor suppressive function. PMID:29138803
Functional Divergence of FimX in PilZ Binding and Type IV Pilus Regulation
Qi, Yaning; Xu, Linghui; Dong, Xueming; Yau, Yin Hoe; Ho, Chun Loong; Koh, Siew Lee; Shochat, Susana Geifman; Chou, Shan-Ho; Tang, Kai
2012-01-01
Type IV pili (T4P) are polar surface structures that play important roles in bacterial motility, biofilm formation, and pathogenicity. The protein FimX and its orthologs are known to mediate T4P formation in the human pathogen Pseudomonas aeruginosa and some other bacterial species. It was reported recently that FimXXAC2398 from Xanthomonas axonopodis pv. citri interacts with PilZXAC1133 directly through the nonenzymatic EAL domain of FimXXAC2398. Here we present experimental data to reveal that the strong interaction between FimXXAC2398 and PilZXAC1133 is not conserved in P. aeruginosa and likely other Pseudomonas species. In vitro and in vivo binding experiments showed that the interaction between FimX and PilZ in P. aeruginosa is below the measurable limit. Surface plasmon resonance assays further confirmed that the interaction between the P. aeruginosa proteins is at least more than 3 orders of magnitude weaker than that between the X. axonopodis pv. citri pair. The N-terminal lobe region of FimXXAC2398 was identified as the binding surface for PilZXAC1133 by amide hydrogen-deuterium exchange and site-directed mutagenesis studies. Lack of several key residues in the N-terminal lobe region of the EAL domain of FimX is likely to account for the greatly reduced binding affinity between FimX and PilZ in P. aeruginosa. All together, the results suggest that the interaction between PilZ and FimX in Xanthomonas species is not conserved in P. aeruginosa due to the evolutionary divergence among the FimX orthologs. The precise roles of FimX and PilZ in bacterial motility and T4P biogenesis are likely to vary among bacterial species. PMID:22942245
Kerekes, Éva; Kókai, Endre; Páldy, Ferenc Sándor; Dombrádi, Viktor
2014-06-01
The product of the CG9238 gene that we termed glycogen binding subunit 70E (Gbs-70E) was characterized by biochemical and molecular genetics methods. The interaction between Gbs-70E and all catalytic subunits of protein phosphatase 1 (Pp1-87B, Pp1-9C, Pp1-96A and Pp1-13C) of Drosophila melanogaster was confirmed by pairwise yeast two-hybrid tests, co-immunoprecipitation and pull down experiments. The binding of Gbs-70E to glycogen was demonstrated by sedimentation analysis. With RT-PCR we found that the mRNAs coding for the longer Gbs-70E PB/PC protein were expressed in all developmental stages of the fruit flies while the mRNA for the shorter Gbs-70E PA was restricted to the eggs and the ovaries of the adult females. The development specific expression of the shorter splice variant was not conserved in different Drosophila species. The expression level of the gene was manipulated by P-element insertions and gene deletion to analyze the functions of the gene product. A small or moderate reduction in the gene expression resulted in no significant changes, however, a deletion mutant expressing very low level of the transcript lived shorter and exhibited reduced glycogen content in the imagos. In addition, the gene deletion decreased the fertility of the fruit flies. Our results prove that Gbs-70E functions as the glycogen binding subunit of protein phosphatase 1 that regulates glycogen content and plays a role in the development of eggs in D. melanogaster. Copyright © 2014 Elsevier Ltd. All rights reserved.
Molecular simulation to investigate the cofactor specificity for pichia stipitis Xylose reductase.
Xia, Xiao-Le; Cong, Shan; Weng, Xiao-Rong; Chen, Jin-Hua; Wang, Jing-Fang; Chou, Kuo-Chen
2013-11-01
Xylose is one of the most abundant carbohydrates in nature, and widely used to produce bioethanol via fermentation in industry. Xylulose can produce two key enzymes: xylose reductase and xylitol dehydrogenase. Owing to the disparate cofactor specificities of xylose reductase and xylitol dehydrogenase, intracellular redox imbalance is detected during the xylose fermentation, resulting in low ethanol yields. To overcome this barrier, a common strategy is applied to artificially modify the cofactor specificity of xylose reductase. In this study, we utilized molecular simulation approaches to construct a 3D (three-dimensional) structural model for the NADP-dependent Pichia stipitis xylose reductase (PsXR). Based on the 3D model, the favourable binding modes for both cofactors NAD and NADP were obtained using the flexible docking procedure and molecular dynamics simulation. Structural analysis of the favourable binding modes showed that the cofactor binding site of PsXR was composed of 3 major components: a hydrophilic pocket, a hydrophobic pocket as well as a linker channel between the aforementioned two pockets. The hydrophilic pocket could recognize the nicotinamide moiety of the cofactors by hydrogen bonding networks, while the hydrophobic pocket functioned to position the adenine moiety of the cofactors by hydrophobic and Π-Π stacking interactions. The linker channel contained some key residues for ligand-binding; their mutation could have impact to the specificity of PsXR. Finally, it was found that any of the two single mutations, K21A and K270N, might reverse the cofactor specificity of PsXR from major NADP- to NADdependent, which was further confirmed by the additional experiments. Our findings may provide useful insights into the cofactor specificity of PsXR, stimulating new strategies for better designing xylose reductase and improving ethanol production in industry.
Nemashkalova, Ekaterina L; Kazakov, Alexei S; Khasanova, Leysan M; Permyakov, Eugene A; Permyakov, Sergei E
2013-09-10
HAMLET is a complex of human α-lactalbumin (hLA) with oleic acid (OA) that kills various tumor cells and strains of Streptococcus pneumoniae. More potent protein-OA complexes were previously reported for bovine α-lactalbumin (bLA) and β-lactoglobulin (bLG), and pike parvalbumin (pPA), and here we explore their structural features. The concentration dependencies of the tryptophan fluorescence of hLA, bLA, and bLG complexes with OA reveal their disintegration at protein concentrations below the micromolar level. Chemical cross-linking experiments provide evidence that association with OA shifts the distribution of oligomeric forms of hLA, bLA, bLG, and pPA toward higher-order oligomers. This effect is confirmed for bLA and bLG using the dynamic light scattering method, while pPA is shown to associate with OA vesicles. Like hLA binding, OA binding increases the affinity of bLG for small unilamellar dipalmitoylphosphatidylcholine vesicles, while pPA efficiently binds to the vesicles irrespective of OA binding. The association of OA with bLG and pPA increases their α-helix and cross-β-sheet content and resistance to enzymatic proteolysis, which is indicative of OA-induced protein structuring. The lack of excess heat sorption during melting of bLG and pPA in complex with OA and the presence of a cooperative thermal transition at the level of their secondary structure suggest that the OA-bound forms of bLG and pPA lack a fixed tertiary structure but exhibit a continuous thermal transition. Overall, despite marked differences, the HAMLET-like complexes that were studied exhibit a common feature: a tendency toward protein oligomerization. Because OA-induced oligomerization has been reported for other proteins, this phenomenon is inherent to many proteins.
Chakravarthy, Suma; Tuori, Robert P.; D'Ascenzo, Mark D.; Fobert, Pierre R.; Després, Charles; Martin, Gregory B.
2003-01-01
The tomato transcription factor Pti4, an ethylene-responsive factor (ERF), interacts physically with the disease resistance protein Pto and binds the GCC box cis element that is present in the promoters of many pathogenesis-related (PR) genes. We reported previously that Arabidopsis plants expressing Pti4 constitutively express several GCC box–containing PR genes and show reduced disease symptoms compared with wild-type plants after inoculation with Pseudomonas syringae pv tomato or Erysiphe orontii. To gain insight into how genome-wide gene expression is affected by Pti4, we used serial analysis of gene expression (SAGE) to compare transcripts in wild-type and Pti4-expressing Arabidopsis plants. SAGE provided quantitative measurements of >20,000 transcripts and identified the 50 most highly expressed genes in Arabidopsis vegetative tissues. Comparison of the profiles from wild-type and Pti4-expressing Arabidopsis plants revealed 78 differentially abundant transcripts encoding defense-related proteins, protein kinases, ribosomal proteins, transporters, and two transcription factors (TFs). Many of the genes identified were expressed differentially in wild-type Arabidopsis during infection by Pseudomonas syringae pv tomato, supporting a role for them in defense-related processes. Unexpectedly, the promoters of most Pti4-regulated genes did not have a GCC box. Chromatin immunoprecipitation experiments confirmed that Pti4 binds in vivo to promoters lacking this cis element. Potential binding sites for ERF, MYB, and GBF TFs were present in statistically significantly increased numbers in promoters regulated by Pti4. Thus, Pti4 appears to regulate gene expression directly by binding the GCC box and possibly a non-GCC box element and indirectly by either activating the expression of TF genes or interacting physically with other TFs. PMID:14630974
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya
2017-09-01
The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.
Schmaderer, Harald; Bhuyan, Mouchumi
2009-01-01
Summary Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp’s acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels–Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance. PMID:19590745
Schmaderer, Harald; Bhuyan, Mouchumi; König, Burkhard
2009-05-28
Flavin chromophores can mediate redox reactions upon irradiation by blue light. In an attempt to increase their catalytic efficacy, flavin derivatives bearing a guanidinium ion as oxoanion binding site were prepared. Chromophore and substrate binding site are linked by a rigid Kemp's acid structure. The molecular structure of the new flavins was confirmed by an X-ray structure analysis and their photocatalytic activity was investigated in benzyl ester cleavage, nitroarene reduction and a Diels-Alder reaction. The modified flavins photocatalyze the reactions, but the introduced substrate binding site does not enhance their performance.
Insight into the novel inhibition mechanism of apigenin to Pneumolysin by molecular modeling
NASA Astrophysics Data System (ADS)
Niu, Xiaodi; Yang, Yanan; Song, Meng; Wang, Guizhen; Sun, Lin; Gao, Yawen; Wang, Hongsu
2017-11-01
In this study, the mechanism of apigenin inhibition was explored using molecular modelling, binding energy calculation, and mutagenesis assays. Energy decomposition analysis indicated that apigenin binds in the gap between domains 3 and 4 of PLY. Using principal component analysis, we found that binding of apigenin to PLY weakens the motion of domains 3 and 4. Consequently, these domains cannot complete the transition from monomer to oligomer, thereby blocking oligomerisation of PLY and counteracting its haemolytic activity. This inhibitory mechanism was confirmed by haemolysis assays, and these findings will promote the future development of an antimicrobial agent.
Dey, Sandeep Kumar; Das, Gopal
2012-08-07
A tren-based tris(thiourea) receptor, L with electron-withdrawing p-nitrophenyl terminals has been established as a competent hydrogen-bonding scaffold that can selectively encapsulate PO(4)(3-) within persistent and rigid dimeric capsules, assembled by aromatic π-stacking interactions between the receptor side-arms. A quaternary ammonium salt of PO(4)(3-) capsules (complexes 1 and 1b, 2:1 host-guest) can reproducibly be obtained in quantitative yields by a solution-state deprotonation of [HL](+) moieties and a bound HPO(4)(2-) anion of complex 1a (HPO(4)(2-) complex of protonated L, 2:1 host-guest), induced by the presence of a large excess of anions such as HCO(3)(-), CH(3)CO(2)(-), and F(-). Qualitative as well as quantitative (1)H and (31)P NMR experiments (DMSO-d(6)) have been carried out in detail to demonstrate the selective and preferential inclusion of PO(4)(3-) by L in solution-states. Competitive crystallization experiments performed in the presence of an excess of anions such as HCO(3)(-), HSO(4)(-), CH(3)CO(2)(-), NO(3)(-) and halides (F(-) and Cl(-)) further establish the phenomenon of selective PO(4)(3-) encapsulation as confirmed by (1)H NMR, (31)P NMR, FT-IR and powder X-ray diffraction patterns of the isolated crystals. X-ray structural analyses and (31)P NMR studies of the isolated crystals of phosphate complexes (1, 1a and 1b) provide evidence of the binding discrepancy of inorganic phosphates with protonated and neutral form of L. Furthermore, extensive studies have been carried out with other anions of different sizes and dimensions in solid- and solution-states (complexes 2a, 3, 4 and 5). Crystal structure elucidation revealed the formation of a solvent (DMSO) sealed unimolecular capsule in the F(-) encapsulated complex, 2a (1:1 host-guest), a CO(3)(2-) encapsulated centrosymmetric molecular capsule in 3 (2:1 host-guest) and a cation (tetrabutylammonium) sealed SO(4)(2-) encapsulated unimolecular capsule in 4 (1:1 host-guest). 2D-NOESY NMR experiments carried out on these capsule complexes further confirm the relevant binding stoichiometry of complexes (2a-4) except for the PO(4)(3-)-encapsulated complex (1b) which showed a 1:1 host-guest stoichiometry in solution.
BiFC Assay to Detect Calmodulin Binding to Plant Receptor Kinases.
Fischer, Cornelia; Sauter, Margret; Dietrich, Petra
2017-01-01
Plant receptor-like kinases (RLKs) are regulated at various levels including posttranscriptional modification and interaction with regulatory proteins. Calmodulin (CaM) is a calcium-sensing protein that was shown to bind to some RLKs such as the PHYTOSULFOKINE RECEPTOR1 (PSKR1). The CaM-binding site is embedded in subdomain VIa of the kinase domain. It is possible that many more of RLKs interact with CaM than previously described. To unequivocally confirm CaM binding, several methods exist. Bimolecular fluorescence complementation (BiFC) and pull-down assays have been successfully used to study CaM binding to PSKR1 and are described in this chapter (BiFC) and in Chapter 15 (pull down). The two methods are complementary. BiFC is useful to show localization and interaction of soluble as well as of membrane-bound proteins in planta.
Pedò, Massimo; D'Onofrio, Mariapina; Ferranti, Pasquale; Molinari, Henriette; Assfalg, Michael
2009-11-15
Bile acid binding proteins (BABPs) are cytosolic lipid chaperones contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Liver BABPs act in parallel with ileal transporters to ensure vectorial transport of bile salts in hepatocytes and enterocytes, respectively. We describe the investigation of ligand binding to liver BABP, an essential step in the understanding of intracellular bile salt transport. Binding site occupancies were monitored in NMR titration experiments using (15)N-labelled ligand, while the relative populations of differently bound BABP forms were assessed by mass spectrometry. This site-specific information allowed the determination of intrinsic thermodynamic parameters and the identification of an extremely high cooperativity between two binding sites. Protein-observed NMR experiments revealed a global structural rearrangement which suggests an allosteric mechanism at the basis of the observed cooperativity. The view of a molecular tool capable of buffering against significant concentrations of free bile salts in a large range of solution conditions emerges from the observed pH-dependence of binding. We set to determine the molecular determinants of cooperativity by analysing the binding properties of a protein containing a mutated internal histidine. Both mass spectrometry and NMR experiments are consistent with an overall decreased binding affinity of the mutant, while the measured diffusion coefficients of ligand species reveal that the affinity loss concerns essentially one of the two binding sites. We therefore identified a mutation able to disrupt energetic communication functional to efficient binding and conclude that the buried histidine establishes contacts that stabilize the ternary complex. 2009 Wiley-Liss, Inc.
Selection of homeotic proteins for binding to a human DNA replication origin.
de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G
2000-06-09
We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.
The chromokinesin Kid is required for maintenance of proper metaphase spindle size.
Tokai-Nishizumi, Noriko; Ohsugi, Miho; Suzuki, Emiko; Yamamoto, Tadashi
2005-11-01
The human chromokinesin Kid/kinesin-10, a plus end-directed microtubule (MT)-based motor with both microtubule- and DNA-binding domains, is required for proper chromosome alignment at the metaphase plate. Here, we performed RNA interference experiments to deplete endogenous Kid from HeLa cells and confirmed defects in metaphase chromosome arm alignment in Kid-depleted cells. In addition, we noted a shortening of the spindle length, resulting in a pole-to-pole distance only 80% of wild type. The spindle microtubule-bundles with which Kid normally colocalize became less robust. Rescue of the two Kid deficiency phenotypes-imprecise chromosome alignment at metaphase and shortened spindles- exhibited distinct requirements. Mutants lacking either the DNA-binding domain or the MT motor ATPase failed to rescue the former defect, whereas rescue of the shortened spindle phenotype required neither activity. Kid also exhibits microtubule bundling activity in vitro, and rescue of the shortened spindle phenotype and the bundling activity displayed similar domain requirements, except that rescue required a coiled-coil domain not needed for bundling. These results suggest that distinct from its role in chromosome movement, Kid contributes to spindle morphogenesis by mediating spindle microtubules stabilization.
The Chromokinesin Kid Is Required for Maintenance of Proper Metaphase Spindle SizeD⃞
Tokai-Nishizumi, Noriko; Ohsugi, Miho; Suzuki, Emiko; Yamamoto, Tadashi
2005-01-01
The human chromokinesin Kid/kinesin-10, a plus end-directed microtubule (MT)-based motor with both microtubule- and DNA-binding domains, is required for proper chromosome alignment at the metaphase plate. Here, we performed RNA interference experiments to deplete endogenous Kid from HeLa cells and confirmed defects in metaphase chromosome arm alignment in Kid-depleted cells. In addition, we noted a shortening of the spindle length, resulting in a pole-to-pole distance only 80% of wild type. The spindle microtubule-bundles with which Kid normally colocalize became less robust. Rescue of the two Kid deficiency phenotypes—imprecise chromosome alignment at metaphase and shortened spindles— exhibited distinct requirements. Mutants lacking either the DNA-binding domain or the MT motor ATPase failed to rescue the former defect, whereas rescue of the shortened spindle phenotype required neither activity. Kid also exhibits microtubule bundling activity in vitro, and rescue of the shortened spindle phenotype and the bundling activity displayed similar domain requirements, except that rescue required a coiled-coil domain not needed for bundling. These results suggest that distinct from its role in chromosome movement, Kid contributes to spindle morphogenesis by mediating spindle microtubules stabilization. PMID:16176979
Mechanistic Insights on the Inhibition of C5 DNA Methyltransferases by Zebularine
Champion, Christine; Guianvarc'h, Dominique; Sénamaud-Beaufort, Catherine; Jurkowska, Renata Z.; Jeltsch, Albert; Ponger, Loïc; Arimondo, Paola B.; Guieysse-Peugeot, Anne-Laure
2010-01-01
In mammals DNA methylation occurs at position 5 of cytosine in a CpG context and regulates gene expression. It plays an important role in diseases and inhibitors of DNA methyltransferases (DNMTs)—the enzymes responsible for DNA methylation—are used in clinics for cancer therapy. The most potent inhibitors are 5-azacytidine and 5-azadeoxycytidine. Zebularine (1-(β-D-ribofuranosyl)-2(1H)- pyrimidinone) is another cytidine analog described as a potent inhibitor that acts by forming a covalent complex with DNMT when incorporated into DNA. Here we bring additional experiments to explain its mechanism of action. First, we observe an increase in the DNA binding when zebularine is incorporated into the DNA, compared to deoxycytidine and 5-fluorodeoxycytidine, together with a strong decrease in the dissociation rate. Second, we show by denaturing gel analysis that the intermediate covalent complex between the enzyme and the DNA is reversible, differing thus from 5-fluorodeoxycytidine. Third, no methylation reaction occurs when zebularine is present in the DNA. We confirm that zebularine exerts its demethylation activity by stabilizing the binding of DNMTs to DNA, hindering the methylation and decreasing the dissociation, thereby trapping the enzyme and preventing turnover even at other sites. PMID:20808780
Androgen responsiveness of the new human endometrial cancer cell line MFE-296.
Hackenberg, R; Beck, S; Filmer, A; Hushmand Nia, A; Kunzmann, R; Koch, M; Slater, E P; Schulz, K D
1994-04-01
MFE-296 endometrial cancer cells express androgen receptors in vitro. These cells, which are tumorigenic in nude mice, are derived from a moderately differentiated human endometrial adenocarcinoma. They express vimentin and the cytokeratins 7, 8, 18, and 19. Karyotyping revealed near-tetraploidy for most of the cells. No marker chromosomes were observed. DNA analyses confirmed the genetic identity of the cell line and the patient from whom the cell line was derived. Proliferation of MFE-296 cells was inhibited by the progestin R5020 and the androgen dihydrotestosterone (DHT). The inhibition of proliferation by DHT was antagonized by the antiandrogen Casodex, demonstrating the involvement of the androgen receptor. Androgen binding was determined at 22,000 binding sites per cell using a whole-cell assay (KD = 0.05 nM) and 30 fmol/mg protein with the dextran charcoal method; 7 fmol/mg protein of progesterone receptors were found, whereas estrogen receptors were below 5 fmol/mg protein. The androgen receptor was functionally intact, as demonstrated by transfection experiments with a reporter-gene construct, containing an androgen-responsive element. In MFE-296 cells the content of the androgen receptor was up-regulated by its own ligand.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garzon, J.; Sanchez-Blazquez, P.; Lee, N.M.
1984-10-01
The binding of the putative kappa agonist ethylketocyclazocine (EKC) to synaptosomal membranes of mouse brain was studied. This benzomorphan was able to bind to different opioid receptors. A portion of this binding was not inhibited by the agonist naloxone, even at high concentrations (10 microM). This population of receptors, to which opioate alkaloids and opiod peptides display very low affinity, is probably the sigma receptor. Another class of binding sites was identified by the simultaneous addition of the selective agonists Sandoz FK-33824 and D-Ala2-D-Leu5-enkephalin, which blocked the access of EKC to mu and delta opioid receptors, respectively, leaving a portionmore » of naloxone-displaceable benzomorphan binding still detectable. Analysis of this remaining binding revealed a small population of receptors of high affinity, the kappa receptor. Therefore, EKC binds to the mu, delta, kappa and sigma receptors in the mouse brain, with similar affinities for the mu and kappa (0.22 and 0.15 nM). These results confirm the existence of a kappa opioid receptor type in the mouse brain.« less
Targeted binding of the M13 bacteriophage to thiamethoxam organic crystals.
Cho, Whirang; Fowler, Jeffrey D; Furst, Eric M
2012-04-10
Phage display screening with a combinatorial library was used to identify M13-type bacteriophages that express peptides with selective binding to organic crystals of thiamethoxam. The six most strongly binding phages exhibit at least 1000 times the binding affinity of wild-type M13 and express heptapeptide sequences that are rich in hydrophobic, hydrogen-bonding amino acids and proline. Among the peptide sequences identified, M13 displaying the pIII domain heptapeptide ASTLPKA exhibits the strongest binding to thiamethoxam in competitive binding assays. Electron and confocal microscopy confirm the specific binding affinity of ASTLPKA to thiamethoxam. Using atomic force microscope (AFM) probes functionalized with ASTLPKA expressing phage, we found that the average adhesion force between the bacteriophage and a thiamethoxam surface is 1.47 ± 0.80 nN whereas the adhesion force of wild-type M13KE phage is 0.18 ± 0.07 nN. Such a strongly binding bacteriophage could be used to modify the surface chemistry of thiamethoxam crystals and other organic solids with a high degree of specificity. © 2012 American Chemical Society
Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate
Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.
2013-01-01
NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581
Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N. L.; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H.
2016-01-01
Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at sub-stoichiometric concentrations relative to this amyloidogenic peptide. The hairpin binding hypothesis stands confirmed. PMID:27317951
Mass Spectrometry to Identify New Biomarkers of Nerve Agent Exposure
2010-04-01
target for oganophosphorus agent (OP) binding to enzymes is the active site serine in the consensus sequence GlyXSerXGly of acetylcholinesterase. By...human plasma. Task 6. Use a second method, for example enzyme activity assays or immunoprecipitation, to confirm the identity of soman-labeled proteins...spectrometry identifies covalent binding of soman, sarin, chlorpyrifos oxon, diisopropyl fluorophosphate, and FP-biotin to tyrosines on tubulin: a potential
A simple and efficient method to enhance audiovisual binding tendencies
Wozny, David R.; Shams, Ladan
2017-01-01
Individuals vary in their tendency to bind signals from multiple senses. For the same set of sights and sounds, one individual may frequently integrate multisensory signals and experience a unified percept, whereas another individual may rarely bind them and often experience two distinct sensations. Thus, while this binding/integration tendency is specific to each individual, it is not clear how plastic this tendency is in adulthood, and how sensory experiences may cause it to change. Here, we conducted an exploratory investigation which provides evidence that (1) the brain’s tendency to bind in spatial perception is plastic, (2) that it can change following brief exposure to simple audiovisual stimuli, and (3) that exposure to temporally synchronous, spatially discrepant stimuli provides the most effective method to modify it. These results can inform current theories about how the brain updates its internal model of the surrounding sensory world, as well as future investigations seeking to increase integration tendencies. PMID:28462016
Recombinant phage probes for Listeria monocytogenes
NASA Astrophysics Data System (ADS)
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
ERIC Educational Resources Information Center
John, Nancy J.; Firestone, Gary L.
1987-01-01
Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…
Liquid phase blending of metal-organic frameworks.
Longley, Louis; Collins, Sean M; Zhou, Chao; Smales, Glen J; Norman, Sarah E; Brownbill, Nick J; Ashling, Christopher W; Chater, Philip A; Tovey, Robert; Schönlieb, Carola-Bibiane; Headen, Thomas F; Terrill, Nicholas J; Yue, Yuanzheng; Smith, Andrew J; Blanc, Frédéric; Keen, David A; Midgley, Paul A; Bennett, Thomas D
2018-06-15
The liquid and glass states of metal-organic frameworks (MOFs) have recently become of interest due to the potential for liquid-phase separations and ion transport, alongside the fundamental nature of the latter as a new, fourth category of melt-quenched glass. Here we show that the MOF liquid state can be blended with another MOF component, resulting in a domain structured MOF glass with a single, tailorable glass transition. Intra-domain connectivity and short range order is confirmed by nuclear magnetic resonance spectroscopy and pair distribution function measurements. The interfacial binding between MOF domains in the glass state is evidenced by electron tomography, and the relationship between domain size and T g investigated. Nanoindentation experiments are also performed to place this new class of MOF materials into context with organic blends and inorganic alloys.
Bradford, Seth S; Ross, Martin James; Fidai, Insiya; Cowan, James A
2014-06-01
The complex Cu-GGHYrFK-amide (1-Cu) was previously reported as a novel metallotherapeutic that catalytically inactivates stem loop IIb (SLIIb) of the hepatitis C virus (HCV) internal ribosomal entry site (IRES) RNA and demonstrates significant antiviral activity in a cellular HCV replicon assay. Herein we describe additional studies focused on understanding the cleavage mechanism as well as the relationship of catalyst configuration to structural recognition and site-selective cleavage of the structured RNA motif. These are advanced by use of a combination of MALDI-TOF mass spectrometry, melting temperature determinations, and computational analysis to develop a structural model for binding and reactivity toward SLIIb of the IRES RNA. In addition, the binding, reactivity, and structural chemistry of the all-D-amino acid form of this metallopeptide, complex 2-Cu, are reported and compared with those of complex 1-Cu. In vitro RNA binding and cleavage assays for complex 2-Cu show a KD value of 76 ± 3 nM, and Michaelis-Menten parameters of kcat =0.14 ± 0.01 min(-1) and KM =7.9 ± 1.2 μM, with a turnover number exceeding 40. In a luciferase-based cellular replicon assay Cu-GGhyrfk-amide shows activity similar to that of the 1-Cu parent peptide, with an IC50 value of 1.9 ± 0.4 μM and cytotoxicity exceeding 100 μM. RT-PCR experiments confirm a significant decrease in HCV RNA levels in replicon assays for up to nine days when treated with complex 1-Cu in three-day dosing increments. This study shows the influence that the α-carbon stereocenter has for this new class of compounds, while detailed mass spectrometry and computational analyses provide new insight into the mechanisms of recognition, binding, and reactivity. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Thyroid hormones upregulate apolipoprotein E gene expression in astrocytes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roman, Corina; Fuior, Elena V.; Trusca, Violeta G.
Apolipoprotein E (apoE), a protein mainly involved in lipid metabolism, is associated with several neurodegenerative disorders including Alzheimer's disease. Despite numerous attempts to elucidate apoE gene regulation in the brain, the exact mechanism is still uncovered. The mechanism of apoE gene regulation in the brain involves the proximal promoter and multienhancers ME.1 and ME.2, which evolved by gene duplication. Herein we questioned whether thyroid hormones and their nuclear receptors have a role in apoE gene regulation in astrocytes. Our data showed that thyroid hormones increase apoE gene expression in HTB14 astrocytes in a dose-dependent manner. This effect can be intermediatedmore » by the thyroid receptor β (TRβ) which is expressed in these cells. In the presence of triiodothyronine (T3) and 9-cis retinoic acid, in astrocytes transfected to overexpress TRβ and retinoid X receptor α (RXRα), apoE promoter was indirectly activated through the interaction with ME.2. To determine the location of TRβ/RXRα binding site on ME.2, we performed DNA pull down assays and found that TRβ/RXRα complex bound to the region 341–488 of ME.2. This result was confirmed by transient transfection experiments in which a series of 5′- and 3′-deletion mutants of ME.2 were used. These data support the existence of a biologically active TRβ binding site starting at 409 in ME.2. In conclusion, our data revealed that ligand-activated TRβ/RXRα heterodimers bind with high efficiency on tissue-specific distal regulatory element ME.2 and thus modulate apoE gene expression in the brain. - Highlights: • T3 induce a dose-dependent increase of apoE expression in astrocytes. • Thyroid hormones activate apoE promoter in a cell specific manner. • Ligand activated TRβ/RXRα bind on the distal regulatory element ME.2 to modulate apoE. • The binding site of TRβ/RXRα heterodimer is located at 409 bp on ME.2.« less
Koley Seth, Banabithi; Saha, Arpita; Haldar, Srijan; Chakraborty, Partha Pratim; Saha, Partha; Basu, Samita
2016-09-01
This work highlights a systematic and comparative study of the structure-dependent influence of a series of biologically active Cu(II) Schiff base complexes (CSCs) on their in vitro cytotoxicity, apoptosis and binding with polymeric DNA-bases in ground and photo-excited states. The structure-activity relationship of the closely resembled CSCs towards in vitro cytotoxicity and apoptosis against cervical cancerous HeLa and normal human diploid WI-38 cell lines has been investigated by MTT assay and FACS techniques respectively. The steady-state and time-resolved spectroscopic studies have also been carried out to explore the selective binding affinities of the potential complexes towards different polymeric nucleic acid bases (poly d(A), poly d(T), poly d(G), poly d(C), Poly d(G)-Poly d(C)), which enlighten the knowledge regarding their ability in controlling the structure and medium dependent interactions in 'ground' and 'excited' states. The pyridine containing water soluble complexes (CuL(1) and CuL(3)) are much more cytotoxic than the corresponding pyrrole counterparts (CuL(2) and CuL(4)). Moreover the acidic hydrogens in CuL(1) increase its cytotoxicity much more than methyl substitution as in CuL(3). The results of MTT assay and double staining FACS experiments indicate selective inhibition of cell growth (cell viability 39% (HeLa) versus 85% (WI-38)) and occurrence of apoptosis rather than necrosis. The ground state binding of CuL(1) with polymeric DNA bases, especially with guanine rich DNA (Kb=6.41±0.122×10(5)), that enhances its cytotoxic activity, is further confirmed from its binding isotherms. On the other hand the pyrrole substituted CuL(4) complex exhibits the structure and medium dependent selective electron-transfer in triplet state as observed in laser flash photolysis studies followed by magnetic field (MF) effect. Copyright © 2016 Elsevier B.V. All rights reserved.
Mohammadgholi, Mohsen; Sadeghzadeh, Nourollah; Erfani, Mostafa; Abediankenari, Saeid; Abedi, Seyed Mohammad; Emrarian, Iman; Jafari, Narjes; Behzadi, Ramezan
2018-01-01
Human fibronectin extra-domain B (EDB) is particularly expressed during angiogenesis progression. It is, thus, a promising marker of tumour growth. Aptides are a novel class of peptides with high-affinity binding to specific protein targets. APTEDB is an antagonist-like ligand that especially interacts with human fibronectin EDB. This study was the first attempt in which the hydrazinonicotinamide (HYNIC)-conjugated APTEDB was labelled with technetium-99m (99mTc) as an appropriate radiotracer and tricine/EDDA exchange labeling. Radiochemical purity, normal saline, and serum stability were evaluated by HPLC and radio-isotope TLC scanner. Other examinations, such as protein-binding calculation, dissociation radioligand binding assay, and partition coefficient constant determination, were also carried out. The cellular-specific binding of 99mTc- HYNIC-conjugated APTEDB was assessed in two EDB-positive (U87MG) and EDB-negative (U373MG) cell lines. Bio-distribution was investigated in normal mice as well as in U87MG and U373MG tumour-bearing mice. Eventually, the radiolabelled APTEDB was used for tumour imaging using planar SPECT. Radiolabelling was achieved with high purity (up to 97%) and accompanied by high solution (over 90% after overnight) and serum (80% after 2 hours) stability. The obtained cellular-specific binding ratio was greater than nine-fold. In-vivo experiments showed rapid blood clearance with mainly renal excretion and tumour uptake specificity (0.48±0.03% ID/g after 1h). The results of the imaging also confirmed considerable tumour uptake for EDB-positive cell line compared with the EDB-negative one. Aptides are considered to be a potent candidate for biopharmaceutical applications. They can be modified with imaging or therapeutic agents. This report shows the capability of 99mTc-HYNIC-APTEDB for human EDB-expressing tumours detection. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Åvall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi
2003-01-01
Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium. PMID:12676705
Avall-Jääskeläinen, Silja; Lindholm, Agneta; Palva, Airi
2003-04-01
Lactobacillus brevis is a promising lactic acid bacterium for use as a probiotic dietary adjunct and a vaccine vector. The N-terminal region of the S-layer protein (SlpA) of L. brevis ATCC 8287 was recently shown to mediate adhesion to various human cell lines in vitro. In this study, a surface display cassette was constructed on the basis of this SlpA receptor-binding domain, a proteinase spacer, and an autolysin anchor. The cassette was expressed under control of the nisA promoter in Lactococcus lactis NZ9000. Western blot assay of lactococcal cell wall extracts with anti-SlpA antibodies confirmed that the SlpA adhesion domain of the fusion protein was expressed and located within the cell wall layer. Whole-cell enzyme-linked immunosorbent assay and immunofluorescence microscopy verified that the SlpA adhesion-mediating region was accessible on the lactococcal cell surface. In vitro adhesion assays with the human intestinal epithelial cell line Intestine 407 indicated that the recombinant lactococcal cells had gained an ability to adhere to Intestine 407 cells significantly greater than that of wild-type L. lactis NZ9000. Serum inhibition assay further confirmed that adhesion of recombinant lactococci to Intestine 407 cells was indeed mediated by the N terminus-encoding part of the slpA gene. The ability of the receptor-binding region of SlpA to adhere to fibronectin was also confirmed with this lactococcal surface display system. These results show that, with the aid of the receptor-binding region of the L. brevis SlpA protein, the ability to adhere to gut epithelial cells can indeed be transferred to another, nonadhesive, lactic acid bacterium.
Iman, Maryam; Khansefid, Zeynab; Davood, Asghar
2016-01-01
Ribonucleotide Reductase (RNR) is an important anticancer chemotherapy target. It has main key role in DNA synthesis and cell growth. Therefore several RNR inhibitors, such as hydroxyurea, have entered the clinical trials. Based on our proposed mechanism, radical site of RNR protein reacts with hydroxyurea in which hydroxyurea is converted into its oxidized form compound III, and whereby the tyrosyl radical is converted into a normal tyrosine residue. In this study, docking and molecular dynamics simulations were used for proposed molecular mechanism of hydroxyurea in RNR inhibition as anticancer agent. The binding affinity of hydroxyurea and compound III to RNR was studied by docking method. The docking study was performed for the crystal structure of human RNR with the radical scavenger Hydroxyurea and its oxidized form to inhibit the human RNR. hydroxyurea and compound III bind at the active site with Tyr-176, which are essential for free radical formation. This helps to understand the functional aspects and also aids in the development of novel inhibitors for the human RNR2. To confirm the binding mode of inhibitors, the molecular dynamics (MD) simulations were performed using GROMACS 4.5.5, based upon the docked conformation of inhibitors. Both of the studied compounds stayed in the active site. The results of MD simulations confirmed the binding mode of ligands, accuracy of docking and the reliability of active conformations which were obtained by AutoDock. MD studies confirm our proposed mechanism in which compound III reacts with the active site residues specially Tyr-176, and inhibits the radical generation and subsequently inhibits the RNR enzyme.
Gkekas, Sotirios; Singh, Ranjan Kumar; Shkumatov, Alexander V; Messens, Joris; Fauvart, Maarten; Verstraeten, Natalie; Michiels, Jan; Versées, Wim
2017-04-07
The Obg protein family belongs to the TRAFAC (translation factor) class of P-loop GTPases and is conserved from bacteria to eukaryotes. Essential roles in many different cellular processes have been suggested for the Obg protein from Escherichia coli (ObgE), and we recently showed that it is a central regulator of bacterial persistence. Here, we report the first crystal structure of ObgE at 1.85-Å resolution in the GDP-bound state, showing the characteristic N-terminal domain and a central G domain that are common to all Obg proteins. ObgE also contains an intrinsically disordered C-terminal domain, and we show here that this domain specifically contributed to GTP binding, whereas it did not influence GDP binding or GTP hydrolysis. Biophysical analysis, using small angle X-ray scattering and multi-angle light scattering experiments, revealed that ObgE is a monomer in solution, regardless of the bound nucleotide. In contrast to recent suggestions, our biochemical analyses further indicate that ObgE is neither activated by K + ions nor by homodimerization. However, the ObgE GTPase activity was stimulated upon binding to the ribosome, confirming the ribosome-dependent GTPase activity of the Obg family. Combined, our data represent an important step toward further unraveling the detailed molecular mechanism of ObgE, which might pave the way to further studies into how this GTPase regulates bacterial physiology, including persistence. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Gao, Chunyan; Xie, Rui; Yu, Chengyuan; Ma, Ruishuang; Dong, Weijun; Meng, Huan; Zhang, Yan; Si, Yu; Zhang, Zhuo; Novakovic, Valerie; Zhang, Yong; Kou, Junjie; Bi, Yayan; Li, Baoxin; Xie, Rujuan; Gilbert, Gary E.; Zhou, Jin; Shi, Jialan
2015-01-01
The mechanisms contributing to an increased risk of thrombosis in uremia are complex and require clarification. There is scant morphological evidence of membrane-dependent binding of factor Xa (FXa) and factor Va (FVa) on endothelial cells (EC) in vitro. Our objectives were to confirm that exposed phosphatidylserine (PS) on microparticle (MP), EC, and peripheral blood cell (PBC) has a prothrombotic role in uremic patients and to provide visible and morphological evidence of PS-dependent prothrombinase assembly in vitro. We found that uremic patients had more circulating MP (derived from PBC and EC) than controls. Additionally, patients had more exposed PS on their MPs and PBCs, especially in the hemodialysis group. In vitro, EC exposed more PS in uremic toxins or serum. Moreover, reconstitution experiments showed that at the early stages, PS exposure was partially reversible. Using confocal microscopy, we observed that PS-rich membranes of EC and MP provided binding sites for FVa and FXa. Further, exposure of PS in uremia resulted in increased generation of FXa, thrombin, and fibrin and significantly shortened coagulation time. Lactadherin, a protein that blocks PS, reduced 80% of procoagulant activity on PBC, EC, and MP. Our results suggest that PBC and EC in uremic milieu are easily injured or activated, which exposes PS and causes a release of MP, providing abundant procoagulant membrane surfaces and thus facilitating thrombus formation. Blocking PS binding sites could become a new therapeutic target for preventing thrombosis. PMID:26580207
Imaging Neurotensin Receptor in Prostate Cancer With 64Cu-Labeled Neurotensin Analogs.
Deng, Huaifu; Wang, Hui; Zhang, He; Wang, Mengzhe; Giglio, Ben; Ma, Xiaofen; Jiang, Guihua; Yuan, Hong; Wu, Zhanhong; Li, Zibo
2017-01-01
Neurotensin receptor 1 (NTR-1) is expressed and activated in prostate cancer cells. In this study, we explore the NTR expression in normal mouse tissues and study the positron emission tomography (PET) imaging of NTR in prostate cancer models. Three 64 Cu chelators (1, 4, 7, 10-tetraazacyclododecane-1, 4, 7, 10-tetraacetic acid [DOTA], 1,4,7-triazacyclononane-N,N',N″-triacetic acid [NOTA], or AmBaSar) were conjugated to an NT analog. Neurotensin receptor binding affinity was evaluated using cell binding assay. The imaging profile of radiolabeled probes was compared in well-established NTR + HT-29 tumor model. Stability of the probes was tested. The selected agents were further evaluated in human prostate cancer PC3 xenografts. All 3 NT conjugates retained the majority of NTR binding affinity. In HT-29 tumor, all agents demonstrated prominent tumor uptake. Although comparable stability was observed, 64 Cu-NOTA-NT and 64 Cu-AmBaSar-NT demonstrated improved tumor to background contrast compared with 64 Cu-DOTA-NT. Positron emission tomography/computed tomography imaging of the NTR expression in PC-3 xenografts showed high tumor uptake of the probes, correlating with the in vitro Western blot results. Blocking experiments further confirmed receptor specificity. Our results demonstrated that 64 Cu-labeled neurotensin analogs are promising imaging agents for NTR-positive tumors. These agents may help us identify NTR-positive lesions and predict which patients and individual tumors are likely to respond to novel interventions targeting NTR-1.
NASA Astrophysics Data System (ADS)
Resende, Stella M.; De Almeida, Wagner B.; van Duijneveldt-van de Rijdt, Jeanne G. C. M.; van Duijneveldt, Frans B.
2001-08-01
Geometrical parameters for the equilibrium (MIN) and lowest saddle-point (TS) geometries of the C2H4⋯SO2 dimer, and the corresponding binding energies, were calculated using the Hartree-Fock and correlated levels of ab initio theory, in basis sets ranging from the D95(d,p) double-zeta basis set to the aug-cc-pVQZ correlation consistent basis set. An assessment of the effect of the basis set superposition error (BSSE) on these results was made. The dissociation energy from the lowest vibrational state was estimated to be 705±100 cm-1 at the basis set limit, which is well within the range expected from experiment. The barrier to internal rotation was found to be 53±5 cm-1, slightly higher than the (revised) experimental result of 43 cm-1, probably due to zero-point vibrational effects. Our results clearly show that, in direct contrast with recent ideas, the BSSE correction affects differentially the MIN and TS binding energies and so has to be included in the calculation of small energy barriers such as that in the C2H4⋯SO2 dimer. Previous reports of positive MP2 frozen-core binding energies for this complex in basis D95(d,p) are confirmed. The anomalies are shown to be an artifact arising from an incorrect removal of virtual orbitals by the default frozen-core option in the GAUSSIAN program.
Chen, Wei; Li, Yanying; Chen, Chang-Er; Sweetman, Andrew J; Zhang, Hao; Jones, Kevin C
2017-11-21
Widespread use of organic chemicals in household and personal care products (HPCPs) and their discharge into aquatic systems means reliable, robust techniques to monitor environmental concentrations are needed. The passive sampling approach of diffusive gradients in thin-films (DGT) is developed here and demonstrated to provide in situ quantitative and time-weighted average (TWA) measurement of these chemicals in waters. The novel technique is developed for HPCPs, including preservatives, antioxidants and disinfectants, by evaluating the performance of different binding agents. Ultrasonic extraction of binding gels in acetonitrile gave good and consistent recoveries for all test chemicals. Uptake by DGT with HLB (hydrophilic-lipophilic-balanced) as the binding agent was relatively independent of pH (3.5-9.5), ionic strength (0.001-0.1 M) and dissolved organic matter (0-20 mg L -1 ), making it suitable for applications across a wide range of environments. Deployment time and diffusion layer thickness dependence experiments confirmed DGT accumulated chemicals masses are consistent with theoretical predictions. The technique was further tested and applied in the influent and effluent of a wastewater treatment plant. Results were compared with conventional grab-sampling and 24-h-composited samples from autosamplers. DGT provided TWA concentrations over up to 18 days deployment, with minimal effects from biofouling or the diffusive boundary layer. The field application demonstrated advantages of the DGT technique: it gives in situ analyte preconcentration in a simple matrix, with more quantitative measurement of the HPCP analytes.
NASA Astrophysics Data System (ADS)
Choi, Youngseon; Kim, Minjung; Cho, Yoojin; Yun, Eunsuk; Song, Rita
2013-02-01
Elucidation of unknown target proteins of a drug is of great importance in understanding cell biology and drug discovery. There have been extensive studies to discover and identify target proteins in the cell. Visualization of targets using drug-conjugated probes has been an important approach to gathering mechanistic information of drug action at the cellular level. As quantum dot (QD) nanocrystals have attracted much attention as a fluorescent probe in the bioimaging area, we prepared drug-conjugated QD to explore the potential of target discovery. As a model drug, we selected a well-known anticancer drug, methotrexate (MTX), which has been known to target dihydrofolate reductase (DHFR) with high affinity binding (Kd = 0.54 nM). MTX molecules were covalently attached to amino-PEG-polymer-coated QDs. Specific interactions of MTX-conjugated QDs with DHFR were identified using agarose gel electrophoresis and fluorescence microscopy. Cellular uptake of the MTX-conjugated QDs in living CHO cells was investigated with regard to their localization and distribution pattern. MTX-QD was found to be internalized into the cells via caveolae-medicated endocytosis without significant sequestration in endosomes. A colocalization experiment of the MTX-QD conjugate with antiDHFR-TAT-QD also confirmed that MTX-QD binds to the target DHFR. This study showed the potential of the drug-QD conjugate to identify or visualize drug-target interactions in the cell, which is currently of great importance in the area of drug discovery and chemical biology.
The effects of value on context-item associative memory in younger and older adults.
Hennessee, Joseph P; Knowlton, Barbara J; Castel, Alan D
2018-02-01
Valuable items are often remembered better than items that are less valuable by both older and younger adults, but older adults typically show deficits in binding. Here, we examine whether value affects the quality of recognition memory and the binding of incidental details to valuable items. In Experiment 1, participants learned English words each associated with a point-value they earned for correct recognition with the goal of maximizing their score. In Experiment 2, value was manipulated by presenting items that were either congruent or incongruent with an imagined state of physiological need (e.g., hunger). In Experiment 1, point-value was associated with enhanced recollection in both age groups. Memory for the color associated with the word was in fact reduced for high-value recollected items compared with low-value recollected items, suggesting value selectively enhances binding of task-relevant details. In Experiment 2, memory for learned images was enhanced by value in both age groups. However, value differentially enhanced binding of an imagined context to the item in younger and older adults, with a strong trend for increased binding in younger adults only. These findings suggest that value enhances episodic encoding in both older and younger adults but that binding of associated details may be reduced for valuable items compared to less valuable items, particularly in older adults. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
The role of attention in item-item binding in visual working memory.
Peterson, Dwight J; Naveh-Benjamin, Moshe
2017-09-01
An important yet unresolved question regarding visual working memory (VWM) relates to whether or not binding processes within VWM require additional attentional resources compared with processing solely the individual components comprising these bindings. Previous findings indicate that binding of surface features (e.g., colored shapes) within VWM is not demanding of resources beyond what is required for single features. However, it is possible that other types of binding, such as the binding of complex, distinct items (e.g., faces and scenes), in VWM may require additional resources. In 3 experiments, we examined VWM item-item binding performance under no load, articulatory suppression, and backward counting using a modified change detection task. Binding performance declined to a greater extent than single-item performance under higher compared with lower levels of concurrent load. The findings from each of these experiments indicate that processing item-item bindings within VWM requires a greater amount of attentional resources compared with single items. These findings also highlight an important distinction between the role of attention in item-item binding within VWM and previous studies of long-term memory (LTM) where declines in single-item and binding test performance are similar under divided attention. The current findings provide novel evidence that the specific type of binding is an important determining factor regarding whether or not VWM binding processes require attention. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Fluorescence studies on binding of pyrene and its derivatives to humic acid
NASA Astrophysics Data System (ADS)
Nakashima, K.; Maki, M.; Ishikawa, F.; Yoshikawa, T.; Gong, Y.-K.; Miyajima, T.
2007-07-01
Binding of pyrene (PyH) and its derivatives to humic acid (HA) has been studied by fluorescence spectroscopy. The nature of the interaction between HA and pyrene derivatives are extensively investigated by employing three derivatives ranging from anionic to cationic compounds: 1-pyrenebutylic acid (PyA), 1-pyrenemethanol (PyM), and 1-pyrenebutyltrimethylammonium bromide (PyB). Binding constants between HA and PyX (X = H, A, M, B) are obtained by steady-state fluorescence quenching techniques, and it is found that PyB has a markedly large binding constant among the pyrene family. This is attributed to a strong electrostatic interaction between cationic PyB and anionic HA. The result suggests that an electrostatic interaction plays a dominant role in binding of pyrenes to humic acid. The importance of electrostatic interaction was also confirmed by a salt effect on the binding constant. Influence of collisional quenching on the binding constant, which causes overestimation of the binding constant, was examined by time-resolved fluorescence spectroscopy as well as temperature effect in steady-state fluorescence measurements. It is elucidated that collisional quenching does not much bring overestimation into the binding constants.
Ferrero, Maximiliano R; Heins, Anja M; Soprano, Luciana L; Acosta, Diana M; Esteva, Mónica I; Jacobs, Thomas; Duschak, Vilma G
2016-02-01
In order to investigate the involvement of sulfated groups in the Trypanosoma cruzi host-parasite relationship, we studied the interaction between the major cysteine proteinase of T. cruzi, cruzipain (Cz), a sulfate-containing sialylated molecule and the sialic acid-binding immunoglobulin like lectin-E (Siglec-E). To this aim, ELISA, indirect immunofluorescence assays and flow cytometry, using mouse Siglec-E-Fc fusion molecules and glycoproteins of parasites, were performed. Competition assays verified that the lectins, Maackia amurensis II (Mal II) and Siglec-E-Fc, compete for the same binding sites. Taking into account that Mal II binding remains unaltered by sulfation, we established this lectin as sialylation degree control. Proteins of an enriched microsomal fraction showed the highest binding to Siglec-E as compared with those from the other parasite subcellular fractions. ELISA assays and the affinity purification of Cz by a Siglec-E column confirmed the interaction between both molecules. The significant decrease in binding of Siglec-E-Fc to Cz and to its C-terminal domain (C-T) after desulfation of these molecules suggests that sulfates contribute to the interaction between Siglec-E-Fc and these glycoproteins. Competitive ELISA assays confirmed the involvement of sulfated epitopes in the affinity between Siglec-E and Cz, probably modified by natural protein environment. Interestingly, data from flow cytometry of untreated and chlorate-treated parasites suggested that sulfates are not primary receptors, but enhance the binding of Siglec-E to trypomastigotic forms. Altogether, our findings support the notion that sulfate-containing sialylated glycoproteins interact with Siglec-E, an ortholog protein of human Siglec-9, and might modulate the immune response of the host, favoring parasitemia and persistence of the parasite.
Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H
1997-03-14
Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.
Plazinska, Anita; Plazinski, Wojciech
2017-05-02
The β 2 -adrenergic receptor (β 2 -AR) is one of the most studied G-protein-coupled receptors. When interacting with ligand molecules, it exhibits a binding characteristic that is strongly dependent on ligand stereoconfiguration. In particular, many experimental and theoretical studies confirmed that stereoisomers of an important β 2 -AR agonist, fenoterol, are associated with diverse mechanisms of binding and activation of β 2 -AR. The objective of the present study was to explore the stereoselective binding of fenoterol to β 2 -AR through the application of an advanced computational methodology based on enhanced-sampling molecular dynamics simulations and potentials of interactions tailored to investigate the stereorecognition effects. The results remain in very good, quantitative agreement with the experimental data (measured in the context of ligand-receptor affinities and their dependence on the temperature), which provides an additional validation for the applied computational protocols. Additionally, our results contribute to the understanding of stereoselective agonist binding by β 2 -AR. Although the significant role of the N293 6.55 residue is confirmed, we additionally show that stereorecognition does not depend solely on the N293-ligand interactions; the stereoselective effects rely on the co-operation of several residues located on both the 6th and 7th transmembrane domains and on extracellular loops. The magnitude and character of the contributions of these residues may be very diverse and result in either enhancing or reducing the stereoselective effects. The same is true when considering the enthalpic and entropic contributions to the binding free energies, which also are dependent on the ligand stereoconfiguration.
Fiacconi, Chris M; Milliken, Bruce
2012-08-01
The purpose of the present study was to highlight the role of location-identity binding mismatches in obscuring explicit awareness of a strong contingency. In a spatial-priming procedure, we introduced a high likelihood of location-repeat trials. Experiments 1, 2a, and 2b demonstrated that participants' explicit awareness of this contingency was heavily influenced by the local match in location-identity bindings. In Experiment 3, we sought to determine why location-identity binding mismatches produce such low levels of contingency awareness. Our results suggest that binding mismatches can interfere substantially with visual-memory performance. We attribute the low levels of contingency awareness to participants' inability to remember the critical location-identity binding in the prime on a trial-to-trial basis. These results imply a close interplay between object files and visual working memory.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gobbi, M.; Taddei, C.; Mennini, T.
1988-01-01
In the present paper, the authors confirm and extend previous studies showing heterogeneous /sup 3/H-imipramine (/sup 3/H-IMI) binding sites. Inhibition curves of various drugs (serotonin, imipramine, desmethyl-imipramine, d-fenfluramine, d-norfenfluramine and indalpine, a potent serotonin uptake inhibitor) obtained using 2 nM /sup 3/H-IMI and in presence of 120 mM NaCl, confirmed the presence of at least three /sup 3/H-IMI binding sites: two of these were serotonin-insensitive while the third one was selectively inhibited by serotonin and indalpine with nanomolar affinities. Moreover this last component was found to be selectively modulated by chronic imipramine treatment thus suggesting a close relation to serontoninmore » uptake mechanism. These data indicate that the use of a more selective inhibitors of the serotonin-sensitive component (like indalpine or serotonin itself) to define non specific /sup 3/H-IMI, may be of help in understanding its relation with serotonin uptake system. 22 references, 2 figures, 2 tables.« less
Anumala, Upendra Rao; Gu, Jiamin; Lo Monte, Fabio; Kramer, Thomas; Heyny-von Haußen, Roland; Hölzer, Jana; Goetschy-Meyer, Valerie; Schön, Christian; Mall, Gerhard; Hilger, Ingrid; Czech, Christian; Herms, Jochen; Schmidt, Boris
2013-09-01
There is a high demand for the development of an imaging agent for neurofibrillary tangles (NFTs) detection in Alzheimer's diagnosis. In the present study, a series of rhodanine-3-acetic acids was synthesized and evaluated for fluorescence imaging of NFTs in brain tissues of AD patients. Five out of seven probes have shown excellent binding affinity to NFTs over amyloid plaques in the Thiazine red R displacement assay. However, the selectivity in this in vitro assay is not confirmed by the histopathological evaluation, which indicates significant differences in the binding sites in the assays. Probe 6 showed binding affinity (IC50=19nM) to tau aggregates which is the highest among this series. Probes 2, 3, 4 and 5 display IC50 values of lower than 100nM to tau aggregates to displace Thiazine red R. Evaluation of the cytotoxicity of these five probes with human liver carcinoma cells revealed that these compounds excert negligible cytotoxicity. The in vivo studies with zebrafish embryos confirmed negligible cytotoxicity at 24 and 72h post fertilization. Copyright © 2013 Elsevier Ltd. All rights reserved.
Novel L-Dopa and dopamine prodrugs containing a 2-phenyl-imidazopyridine moiety.
Denora, Nunzio; Laquintana, Valentino; Lopedota, Angela; Serra, Mariangela; Dazzi, Laura; Biggio, Giovanni; Pal, Dhananjay; Mitra, Ashim K; Latrofa, Andrea; Trapani, Giuseppe; Liso, Gaetano
2007-07-01
The aim of this study was to gain insight into the feasibility of enhancing the delivery of L-Dopa and dopamine to the brain by linking these neurotransmitters and L-Dopa ethyl ester to 2-phenyl-3-carboxymethyl-imidazopyridine compounds giving rise to the so-called Dopimid compounds. A number of Dopimid compounds were synthesized and both stability and binding studies to dopaminergic and benzodiazepine receptors were performed. To evaluate whether Dopimid compounds are P-gp substrates, [(3)H]ritonavir uptake experiments and bi-directional transport studies on confluent MDCKII-MDR1 monolayers were carried out. The brain penetration properties of Dopimid compounds were estimated by the Clark's computational model and evaluated by investigation of their transport across BBMECs monolayers. The dopamine levels following the intraperitoneal administration of the selected Dopimid compounds were measured in vivo by using brain microdialysis in rat. Tested compounds were adequately stable in solution buffered at pH 7.4 but undergo faster cleavage in dilute rat serum at 37 degrees C. Receptor binding studies showed that Dopimid compounds are essentially devoid of affinity for dopaminergic and benzodiazepine receptors. [(3)H]ritonavir uptake experiments indicated that selected Dopimid compounds, like L-Dopa and dopamine hydrochloride, are not substrates of P-gp and it was also confirmed by bi-directional transport experiments across MDCKII-MDR1 monolayers. By Clark's model a significant brain penetration was deduced for L-Dopa ethyl ester and dopamine derivatives. Transport studies involving BBMECs monolayers indicated that some of these compounds should be able to cross the BBB. Interestingly, the rank order of apparent permeability (P (app)) values observed in these assays parallels that calculated by the computational approach. Brain microdialysis experiments in rat showed that intraperitoneal acute administration of some Dopimid compounds induced a dose-dependent increase in cortical dopamine output. Based on these results, it may be concluded that some Dopimid compounds can be proposed as novel L-Dopa and dopamine prodrugs.
Zhang, Yi; Chen, Lihan
2016-01-01
Recent studies of brain plasticity that pertain to time perception have shown that fast training of temporal discrimination in one modality, for example, the auditory modality, can improve performance of temporal discrimination in another modality, such as the visual modality. We here examined whether the perception of visual Ternus motion could be recalibrated through fast crossmodal statistical binding of temporal information and stimuli properties binding. We conducted two experiments, composed of three sessions each: pre-test, learning, and post-test. In both the pre-test and the post-test, participants classified the Ternus display as either “element motion” or “group motion.” For the training session in Experiment 1, we constructed two types of temporal structures, in which two consecutively presented sound beeps were dominantly (80%) flanked by one leading visual Ternus frame and by one lagging visual Ternus frame (VAAV) or dominantly inserted by two Ternus visual frames (AVVA). Participants were required to respond which interval (auditory vs. visual) was longer. In Experiment 2, we presented only a single auditory–visual pair but with similar temporal configurations as in Experiment 1, and asked participants to perform an audio–visual temporal order judgment. The results of these two experiments support that statistical binding of temporal information and stimuli properties can quickly and selectively recalibrate the sensitivity of perceiving visual motion, according to the protocols of the specific bindings. PMID:27065910
Scanpath memory binding: multiple read-out experiments
NASA Astrophysics Data System (ADS)
Stark, Lawrence W.; Privitera, Claudio M.; Yang, Huiyang; Azzariti, Michela; Ho, Yeuk F.; Chan, Angie; Krischer, Christof; Weinberger, Adam
1999-05-01
The scanpath theory proposed that an internal spatial- cognitive model controls perception and the active looking eye movements, EMs, of the scanpath sequence. Evidence for this came from new quantitative methods, experiments with ambiguous figures and visual imagery and from MRI studies, all on cooperating human subjects. Besides recording EMs, we introduce other experimental techniques wherein the subject must depend upon memory bindings as in visual imagery, but may call upon other motor behaviors than EMs to read-out the remembered patterns. How is the internal model distributed and operationally assembled. The concept of binding speaks to the assigning of values for the model and its execution in various parts of the brain. Current neurological information helps to localize different aspects of the spatial-cognitive model in the brain. We suppose that there are several levels of 'binding' -- semantic or symbolic binding, structural binding for the spatial locations of the regions-of-interest and sequential binding for the dynamic execution program that yields the sequence of EMs. Our aim is to dissect out respective contributions of these different forms of binding.
Chu, Byron C. H.; Otten, Renee; Krewulak, Karla D.; Mulder, Frans A. A.; Vogel, Hans J.
2014-01-01
The periplasmic binding protein (PBP) FepB plays a key role in transporting the catecholate siderophore ferric enterobactin from the outer to the inner membrane in Gram-negative bacteria. The solution structures of the 34-kDa apo- and holo-FepB from Escherichia coli, solved by NMR, represent the first solution structures determined for the type III class of PBPs. Unlike type I and II PBPs, which undergo large “Venus flytrap” conformational changes upon ligand binding, both forms of FepB maintain similar overall folds; however, binding of the ligand is accompanied by significant loop movements. Reverse methyl cross-saturation experiments corroborated chemical shift perturbation results and uniquely defined the binding pocket for gallium enterobactin (GaEnt). NMR relaxation experiments indicated that a flexible loop (residues 225–250) adopted a more rigid and extended conformation upon ligand binding, which positioned residues for optimal interactions with the ligand and the cytoplasmic membrane ABC transporter (FepCD), respectively. In conclusion, this work highlights the pivotal role that structural dynamics plays in ligand binding and transporter interactions in type III PBPs. PMID:25173704
Martí-Arbona, Ricardo; Teshima, Munehiro; Anderson, Penelope S; Nowak-Lovato, Kristy L; Hong-Geller, Elizabeth; Unkefer, Clifford J; Unkefer, Pat J
2012-01-01
We have developed a high-throughput approach using frontal affinity chromatography coupled to mass spectrometry (FAC-MS) for the identification and characterization of the small molecules that modulate transcriptional regulator (TR) binding to TR targets. We tested this approach using the methionine biosynthesis regulator (MetJ). We used effector mixtures containing S-adenosyl-L-methionine (SAM) and S-adenosyl derivatives as potential ligands for MetJ binding. The differences in the elution time of different compounds allowed us to rank the binding affinity of each compound. Consistent with previous results, FAC-MS showed that SAM binds to MetJ with the highest affinity. In addition, adenine and 5'-deoxy-5'-(methylthio)adenosine bind to the effector binding site on MetJ. Our experiments with MetJ demonstrate that FAC-MS is capable of screening complex mixtures of molecules and identifying high-affinity binders to TRs. In addition, FAC-MS experiments can be used to discriminate between specific and nonspecific binding of the effectors as well as to estimate the dissociation constant (K(d)) for effector-TR binding. Copyright © 2012 S. Karger AG, Basel.
Targeting Phosphatidylserine with a 64Cu-Labeled Peptide for Molecular Imaging of Apoptosis.
Perreault, Amanda; Richter, Susan; Bergman, Cody; Wuest, Melinda; Wuest, Frank
2016-10-03
Molecular imaging of programmed cell death (apoptosis) in vivo is an innovative strategy for early assessment of treatment response and treatment efficacy in cancer patients. Externalization of phosphatidylserine (PS) to the cell membrane surface of dying cells makes this phospholipid an attractive molecular target for the development of apoptosis imaging probes. In this study, we have radiolabeled PS-binding 14-mer peptide FNFRLKAGAKIRFG (PSBP-6) with positron-emitter copper-64 ( 64 Cu) for PET imaging of apoptosis. Peptide PSBP-6 was conjugated with radiometal chelator 1,4,7-triazacyclononane-1,4,7-triacetic acid (NOTA) through an aminovaleric acid (Ava) linker for subsequent radiolabeling with 64 Cu to prepare radiotracer 64 Cu-NOTA-Ava-PSBP-6. PS-binding potencies of PSBP-6, NOTA-Ava-PSBP-6, and nat Cu-NOTA-Ava-PSBP-6 were determined in a competitive radiometric PS-binding assay. Radiotracer 64 Cu-NOTA-Ava-PSBP-6 was studied in camptothecin-induced apoptotic EL4 mouse lymphoma cells and in a murine EL4 tumor model of apoptosis using dynamic PET imaging. Peptide PSBP-6 was also conjugated via an Ava linker with fluorescein isothiocyanate (FITC). FITC-Ava-PSBP-6 was evaluated in flow cytometry and fluorescence confocal microscopy experiments. Radiopeptide 64 Cu-NOTA-Ava-PSBP-6 was synthesized in high radiochemical yields of >95%. The IC 50 values for PS-binding potency of PSBP-6, NOTA-Ava-PSBP-6, and nat Cu-NOTA-PSBP-6 were 600 μM, 30 μM, and 23 μM, respectively. A competitive radiometric cell binding assay confirmed binding of 64 Cu-NOTA-Ava-PSBP-6 to camptothecin-induced apoptotic EL4 cells in a Ca 2+ -independent manner. PET imaging studies demonstrated significantly higher uptake of 64 Cu-NOTA-Ava-PSBP-6 in apoptotic EL4 tumors (SUV 5min 0.95 ± 0.04) compared to control tumors (SUV 5min 0.74 ± 0.03). Flow cytometry studies showed significantly higher binding of FITC-Ava-PSBP-6 to EL4 cells treated with camptothecin compared to untreated cells. Fluorescence microscopy studies revealed that FITC-Ava-PSBP-6 was binding to cell membranes of early apoptotic cells, but was internalized in late apoptotic and necrotic cells. The present study showed that radiotracer 64 Cu-NOTA-Ava-PSBP-6 holds promise as a first peptide-based PET imaging agent for molecular imaging of apoptosis. However, additional "fine-tuning" of 64 Cu-NOTA-Ava-PSBP-6 is required to enhance PS-binding potency and in vivo stability to improve tumor uptake and retention.
Sivanesam, Kalkena; Shu, Irene; Huggins, Kelly N L; Tatarek-Nossol, Marianna; Kapurniotu, Aphrodite; Andersen, Niels H
2016-08-01
Versions of a previously discovered β-hairpin peptide inhibitor of IAPP aggregation that are stabilized in that conformation, or even forced to remain in the hairpin conformation by a backbone cyclization constraint, display superior activity as inhibitors. The cyclized hairpin, cyclo-WW2, displays inhibitory activity at substoichiometric concentrations relative to this amyloidogenic peptide. The hairpin-binding hypothesis stands confirmed. © 2016 Federation of European Biochemical Societies.
Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio
2007-11-01
We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.
Cytoskeleton and paclitaxel sensitivity in breast cancer: the role of beta-tubulins.
Tommasi, Stefania; Mangia, Anita; Lacalamita, Rosanna; Bellizzi, Antonia; Fedele, Vita; Chiriatti, Annalisa; Thomssen, Christopher; Kendzierski, Nancy; Latorre, Agnese; Lorusso, Vito; Schittulli, Francesco; Zito, Francesco; Kavallaris, Maria; Paradiso, Angelo
2007-05-15
The antineoplastic effect of paclitaxel is mainly related to its ability to bind the beta subunit of tubulin, thus preventing tubulin chain depolarization and inducing apoptosis. The relevance of the Class I beta-tubulin characteristics have also been confirmed in the clinical setting where mutations of paclitaxel-binding site of beta-tubulin Class I have been related to paclitaxel resistance in non small cell lung and ovarian cancers. In the present study, we verified the hypothesis of a relationship between molecular alterations of beta-tubulin Class I and paclitaxel sensitivity in a panel of breast cell lines with different drug IC(50). The Class I beta-tubulin gene cDNA has been sequenced detecting heterozygous missense mutations (exon 1 and 4) only in MCF-7 and SK-BR-3 lines. Furthermore, the expression (at both mRNA and protein level) of the different isotypes have been analyzed demonstrating an association between low cell sensitivity to paclitaxel and Class III beta-tubulin expression increasing. Antisense oligonucleotide (ODN) experiments confirmed that the inhibition of Class III beta-tubulin could at least partially increase paclitaxel-chemosensitivity. The hypothesis of a relationship between beta-tubulin tumor expression and paclitaxel clinical response has been finally verified in a series of 92 advanced breast cancer patients treated with a first line paclitaxel-based chemotherapy. Thirty-five percent (95% CI: 45-31) of patients with high Class III beta-tubulin expression showed a disease progression vs. only 7% of patients with low expression (35% vs. 7%, p < 0.002). Our study suggests that Class III beta-tubulin tumor expression could be considered a predictive biomarker of paclitaxel-clinical resistance for breast cancer patients. (c) 2007 Wiley-Liss, Inc.
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P.; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-01-01
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10–100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven. PMID:26193329
Fei, Yiyan; Sun, Yung-Shin; Li, Yanhong; Yu, Hai; Lau, Kam; Landry, James P; Luo, Zeng; Baumgarth, Nicole; Chen, Xi; Zhu, Xiangdong
2015-07-16
A key step leading to influenza viral infection is the highly specific binding of a viral spike protein, hemagglutinin (HA), with an extracellular glycan receptor of a host cell. Detailed and timely characterization of virus-receptor binding profiles may be used to evaluate and track the pandemic potential of an influenza virus strain. We demonstrate a label-free glycan microarray assay platform for acquiring influenza virus binding profiles against a wide variety of glycan receptors. By immobilizing biotinylated receptors on a streptavidin-functionalized solid surface, we measured binding curves of five influenza A virus strains with 24 glycans of diverse structures and used the apparent equilibrium dissociation constants (avidity constants, 10-100 pM) as characterizing parameters of viral receptor profiles. Furthermore by measuring binding kinetic constants of solution-phase glycans to immobilized viruses, we confirmed that the glycan-HA affinity constant is in the range of 10 mM and the reaction is enthalpy-driven.
Calorimetric and spectroscopic studies of the interaction between zidovudine and human serum albumin
NASA Astrophysics Data System (ADS)
Pîrnău, Adrian; Mic, Mihaela; Neamţu, Silvia; Floare, Călin G.; Bogdan, Mircea
2018-02-01
A quantitative analysis of the interaction between zidovudine (AZT) and human serum albumin (HSA) was achieved using Isothermal titration calorimetry (ITC) in combination with fluorescence and 1H NMR spectroscopy. ITC directly measure the heat during a biomolecular binding event and gave us thermodynamic parameters and the characteristic association constant. By fluorescence quenching, the binding parameters of AZT-HSA interaction was determined and location to binding site I of HSA was confirmed. Via T1 NMR selective relaxation time measurements the drug-protein binding extent was evaluated as dissociation constants Kd and the involvement of azido moiety of zidovudine in molecular complex formation was put in evidence. All three methods indicated a very weak binding interaction. The association constant determined by ITC (3.58 × 102 M- 1) is supported by fluorescence quenching data (2.74 × 102 M- 1). The thermodynamic signature indicates that at least hydrophobic and electrostatic type interactions played a main role in the binding process.
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Perusko, Marija; Al-Hanish, Ayah; Mihailovic, Jelena; Minic, Simeon; Trifunovic, Sara; Prodic, Ivana; Cirkovic Velickovic, Tanja
2017-10-01
Major green tea catechin, epigallocatechin-3-gallate (EGCG), binds non-covalently to numerous dietary proteins, including beta-lactoglobulin of cow's milk. The effects of glycation of proteins via Maillard reaction on the binding capacity for polyphenols and the antiradical properties of the formed complexes have not been studied previously. Binding constant of BLG glycated by milk sugar lactose to EGCG was measured by the method of fluorophore quenching. Binding of EGCG was confirmed by CD and FTIR. The antioxidative properties of the complexes were examined by measuring ABTS radical scavenging capacity, superoxide anion scavenging capacity and total reducing power assay. Glycation of BLG does not significantly influence the binding constant of EGCG for the protein. Conformational changes were observed for both native and glycated BLG upon complexation with EGCG. Masking effect of polyphenol complexation on the antioxidative potential of the protein was of the similar degree for both glycated BLG and native BLG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yu, Haixiang; Canoura, Juan; Guntupalli, Bhargav; Lou, Xinhui
2017-01-01
Sensors employing split aptamers that reassemble in the presence of a target can achieve excellent specificity, but the accompanying reduction of target affinity mitigates any overall gains in sensitivity. We for the first time have developed a split aptamer that achieves enhanced target-binding affinity through cooperative binding. We have generated a split cocaine-binding aptamer that incorporates two binding domains, such that target binding at one domain greatly increases the affinity of the second domain. We experimentally demonstrate that the resulting cooperative-binding split aptamer (CBSA) exhibits higher target binding affinity and is far more responsive in terms of target-induced aptamer assembly compared to the single-domain parent split aptamer (PSA) from which it was derived. We further confirm that the target-binding affinity of our CBSA can be affected by the cooperativity of its binding domains and the intrinsic affinity of its PSA. To the best of our knowledge, CBSA-5335 has the highest cocaine affinity of any split aptamer described to date. The CBSA-based assay also demonstrates excellent performance in target detection in complex samples. Using this CBSA, we achieved specific, ultra-sensitive, one-step fluorescence detection of cocaine within fifteen minutes at concentrations as low as 50 nM in 10% saliva without signal amplification. This limit of detection meets the standards recommended by the European Union's Driving under the Influence of Drugs, Alcohol and Medicines program. Our assay also demonstrates excellent reproducibility of results, confirming that this CBSA-platform represents a robust and sensitive means for cocaine detection in actual clinical samples. PMID:28451157
ERIC Educational Resources Information Center
Lessard, George M.
1980-01-01
Described is an experiment used in an undergraduate biochemistry laboratory involving inducing rickets in chicks and correlating the disease to a reduction in vitamin D-dependent calcium binding protein. Techniques involved are hormone induction, protein isolation, and radioisotope methodology. (Author/DS)
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
Chen, Xun; Stout, Steven; Mueller, Uwe; Boykow, George; Visconti, Richard; Siliphaivanh, Phieng; Spencer, Kerrie; Presland, Jeremy; Kavana, Michael; Basso, Andrea D; McLaren, David G; Myers, Robert W
2017-08-01
We have developed and validated label-free, liquid chromatography-mass spectrometry (LC-MS)-based equilibrium direct and competition binding assays to quantitate small-molecule antagonist binding to recombinant human and mouse BLT1 receptors expressed in HEK 293 cell membranes. Procedurally, these binding assays involve (1) equilibration of the BLT1 receptor and probe ligand, with or without a competitor; (2) vacuum filtration through cationic glass fiber filters to separate receptor-bound from free probe ligand; and (3) LC-MS analysis in selected reaction monitoring mode for bound probe ligand quantitation. Two novel, optimized probe ligands, compounds 1 and 2, were identified by screening 20 unlabeled BLT1 antagonists for direct binding. Saturation direct binding studies confirmed the high affinity, and dissociation studies established the rapid binding kinetics of probe ligands 1 and 2. Competition binding assays were established using both probe ligands, and the affinities of structurally diverse BLT1 antagonists were measured. Both binding assay formats can be executed with high specificity and sensitivity and moderate throughput (96-well plate format) using these approaches. This highly versatile, label-free method for studying ligand binding to membrane-associated receptors should find broad application as an alternative to traditional methods using labeled ligands.
Binding, Thermodynamics, and Selectivity of a Non-peptide Antagonist to the Melanocortin-4 Receptor
Saleh, Noureldin; Kleinau, Gunnar; Heyder, Nicolas; Clark, Timothy; Hildebrand, Peter W.; Scheerer, Patrick
2018-01-01
The melanocortin-4 receptor (MC4R) is a potential drug target for treatment of obesity, anxiety, depression, and sexual dysfunction. Crystal structures for MC4R are not yet available, which has hindered successful structure-based drug design. Using microsecond-scale molecular-dynamics simulations, we have investigated selective binding of the non-peptide antagonist MCL0129 to a homology model of human MC4R (hMC4R). This approach revealed that, at the end of a multi-step binding process, MCL0129 spontaneously adopts a binding mode in which it blocks the agonistic-binding site. This binding mode was confirmed in subsequent metadynamics simulations, which gave an affinity for human hMC4R that matches the experimentally determined value. Extending our simulations of MCL0129 binding to hMC1R and hMC3R, we find that receptor subtype selectivity for hMC4R depends on few amino acids located in various structural elements of the receptor. These insights may support rational drug design targeting the melanocortin systems.
Horsfall, A C; Venables, P J; Mumford, P A; Maini, R N
1981-01-01
The Raji cell assay is regarded as a test for the detection and quantitation of immune complexes. It is frequently positive in sera from patients with SLE. We have demonstrated a relationship between Raji cell binding and antibodies to DNA and soluble cellular antigens. In five sera containing high titres of antibodies of known single specificity, most of the Raji cell binding occurred in the 7S IgG fraction where the majority of anti-nuclear antibody was also found. When each of these sera was incubated with its specific antigen, Raji cell binding increased. Subsequent fractionation showed that this binding was in the high molecular weight fraction (greater than 200,000 daltons) and that Raji cell binding and antibody activity were abolished in the 7S fraction. These data confirm that Raji cell bind immune complexes but also indicate that 7S anti-nuclear antibodies may interact directly with Raji cells by an unknown mechanism. Therefore, in sera of patients with anti-nuclear antibodies, binding to Raji cells does not necessarily imply the presence of immune complexes alone. PMID:6975676
Margaryan, Hasmik; Dorosh, Andriy; Capkova, Jana; Manaskova-Postlerova, Pavla; Philimonenko, Anatoly; Hozak, Pavel; Peknicova, Jana
2015-03-08
Sperm proteins are important for the sperm cell function in fertilization. Some of them are involved in the binding of sperm to the egg. We characterized the acrosomal sperm protein detected by a monoclonal antibody (MoAb) (Hs-8) that was prepared in our laboratory by immunization of BALB/c mice with human ejaculated sperms and we tested the possible role of this protein in the binding assay. Indirect immunofluorescence and immunogold labelling, gel electrophoresis, Western blotting and protein sequencing were used for Hs-8 antigen characterization. Functional analysis of GAPDHS from the sperm acrosome was performed in the boar model using sperm/zona pellucida binding assay. Monoclonal antibody Hs-8 is an anti-human sperm antibody that cross-reacts with the Hs-8-related protein in spermatozoa of other mammalian species (boar, mouse). In the immunofluorescence test, Hs-8 antibody recognized the protein localized in the acrosomal part of the sperm head and in the principal piece of the sperm flagellum. In immunoblotting test, MoAb Hs-8 labelled a protein of 45 kDa in the extract of human sperm. Sequence analysis identified protein Hs-8 as GAPDHS (glyceraldehyde 3-phosphate dehydrohenase-spermatogenic). For this reason, commercial mouse anti-GAPDHS MoAb was applied in control tests. Both antibodies showed similar staining patterns in immunofluorescence tests, in electron microscopy and in immunoblot analysis. Moreover, both Hs-8 and anti-GAPDHS antibodies blocked sperm/zona pellucida binding. GAPDHS is a sperm-specific glycolytic enzyme involved in energy production during spermatogenesis and sperm motility; its role in the sperm head is unknown. In this study, we identified the antigen with Hs8 antibody and confirmed its localization in the apical part of the sperm head in addition to the principal piece of the flagellum. In an indirect binding assay, we confirmed the potential role of GAPDHS as a binding protein that is involved in the secondary sperm/oocyte binding.
Laudenbach, Beatrice Theres; Martínez-Montero, Saúl; Cencic, Regina; Habjan, Matthias; Pichlmair, Andreas; Damha, Masad J.; Pelletier, Jerry; Nagar, Bhushan
2017-01-01
IFIT1 (IFN-induced protein with tetratricopeptide repeats-1) is an effector of the host innate immune antiviral response that prevents propagation of virus infection by selectively inhibiting translation of viral mRNA. It relies on its ability to compete with the translation initiation factor eIF4F to specifically recognize foreign capped mRNAs, while remaining inactive against host mRNAs marked by ribose 2′-O methylation at the first cap-proximal nucleotide (N1). We report here several crystal structures of RNA-bound human IFIT1, including a 1.6-Å complex with capped RNA. IFIT1 forms a water-filled, positively charged RNA-binding tunnel with a separate hydrophobic extension that unexpectedly engages the cap in multiple conformations (syn and anti) giving rise to a relatively plastic and nonspecific mode of binding, in stark contrast to eIF4E. Cap-proximal nucleotides encircled by the tunnel provide affinity to compete with eIF4F while allowing IFIT1 to select against N1 methylated mRNA. Gel-shift binding assays confirm that N1 methylation interferes with IFIT1 binding, but in an RNA-dependent manner, whereas translation assays reveal that N1 methylation alone is not sufficient to prevent mRNA recognition at high IFIT1 concentrations. Structural and functional analysis show that 2′-O methylation at N2, another abundant mRNA modification, is also detrimental for RNA binding, thus revealing a potentially synergistic role for it in self- versus nonself-mRNA discernment. Finally, structure-guided mutational analysis confirms the importance of RNA binding for IFIT1 restriction of a human coronavirus mutant lacking viral N1 methylation. Our structural and biochemical analysis sheds new light on the molecular basis for IFIT1 translational inhibition of capped viral RNA. PMID:28251928
Binding of group 15 and group 16 oxides by a concave host containing an isophthalamide unit.
Eckelmann, Jens; Saggiomo, Vittorio; Fischmann, Svenja; Lüning, Ulrich
2012-01-01
A bi-macrocycle with an incorporated isophthalamide substructure was synthesized by double amide formation between an isophthaloyl dichloride and two equivalents of a bis(alkenyloxy)aniline, followed by ring-closing metathesis and hydrogenation. In contrast to many related isophthalamides, the concave host exhibits a better binding for oxides, such as DMSO or pyridine-N-oxide, than for halide anions. A general method for a quick estimation of the strength of binding derived from only a few data points is presented and gives an estimated K(ass) of pyridine-N-oxide of ca. 40 M(-1), NMR titration confirms 25 M(-1).
Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.
Schuller, Marion; Höfner, Georg; Wanner, Klaus T
2017-10-09
MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Saito, Kazuki; Nakato, Mamiko; Mizuguchi, Takaaki; Wada, Shinji; Uchimura, Hiromasa; Kataoka, Hiroshi; Yokoyama, Shigeyuki; Hirota, Hiroshi; Kiso, Yoshiaki
2014-03-01
To discover peptide ligands that bind to a target protein with a higher molecular mass, a concise screening methodology has been established, by applying a "plug-plug" technique to ACE experiments. Exploratory experiments using three mixed peptides, mastoparan-X, β-endorphin, and oxytocin, as candidates for calmodulin-binding ligands, revealed that the technique not only reduces the consumption of the protein sample, but also increases the flexibility of the experimental conditions, by allowing the use of MS detection in the ACE experiments. With the plug-plug technique, the ACE-MS screening methodology successfully selected calmodulin-binding peptides from a random library with diverse constituents, such as protease digests of BSA. Three peptides with Kd values between 8-147 μM for calmodulin were obtained from a Glu-C endoprotease digest of reduced BSA, although the digest showed more than 70 peaks in its ACE-MS electropherogram. The method established here will be quite useful for the screening of peptide ligands, which have only low affinities due to their flexible chain structures but could potentially provide primary information for designing inhibitors against the target protein. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Saurabh, Suman; Sahoo, Anil Kumar; Maiti, Prabal K.
2016-10-01
Experiments and computational studies have established that de-protonated dendrimers (SPL7013 and PAMAM) act as entry-inhibitors of HIV. SPL7013 based Vivagel is currently under clinical development. The dendrimer binds to gp120 in the gp120-CD4 complex, destabilizes it by breaking key contacts between gp120 and CD4 and prevents viral entry into target cells. In this work, we provide molecular details and energetics of the formation of the SPL7013-gp120-CD4 ternary complex and decipher modes of action of the dendrimer in preventing viral entry. It is also known from experiments that the dendrimer binds weakly to gp120 that is not bound to CD4. It binds even more weakly to the CD4-binding region of gp120 and thus cannot directly block gp120-CD4 complexation. In this work, we examine the feasibility of dendrimer binding to the gp120-binding region of CD4 and directly blocking gp120-CD4 complex formation. We find that the process of the dendrimer binding to CD4 can compete with gp120-CD4 binding due to comparable free energy change for the two processes, thus creating a possibility for the dendrimer to directly block gp120-CD4 complexation by binding to the gp120-binding region of CD4.
Binding and thermodynamics of REV peptide-ctDNA interaction.
Upadhyay, Santosh Kumar
2017-03-01
The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically driven. ITC based analysis of salt dependence of binding constant gave a charge value (Z) = +4.01, as determined for the δlnK/δln[Na + ] parameter, suggesting the participation of only 3-4 Arg out of 11 Arg charge from REV peptide. The stoichiometry observed for the complex was three molar charge of REV peptide binding per molar charge of ctDNA. ITC based analysis further confirmed that the binding between ctDNA and REV peptide is governed by electrostatic interaction. Molecular interactions including H-bonding, van der Waals forces, and solvent molecules rearrangement, underlie the binding of REV peptide to ctDNA. © 2016 Wiley Periodicals, Inc.
A novel methodological approach for the analysis of host-ligand interactions.
Strat, Daniela; Missailidis, Sotiris; Drake, Alex F
2007-02-02
Traditional analysis of drug-binding data relies upon the Scatchard formalism. These methods rely upon the fitting of a linear equation providing intercept and gradient data that relate to physical properties, such as the binding constant, cooperativity coefficients and number of binding sites. However, the existence of different binding modes with different binding constants makes the implementation of these models difficult. This article describes a novel approach to the binding model of host-ligand interactions by using a derived analytical function describing the observed signal. The benefit of this method is that physically significant parameters, that is, binding constants and number of binding sites, are automatically derived by the use of a minimisation routine. This methodology was utilised to analyse the interactions between a novel antitumour agent and DNA. An optical spectroscopy study confirms that the pentacyclic acridine derivative (DH208) binds to nucleic acids. Two binding modes can be identified: a stronger one that involves intercalation and a weaker one that involves oriented outer-sphere binding. In both cases the plane of the bound acridine ring is parallel to the nucleic acid bases, orthogonal to the phosphate backbone. Ultraviolet (UV) and circular dichroism (CD) data were fitted using the proposed model. The binding constants and the number of binding sites derived from the model remained consistent across the different techniques used. The different wavelengths at which the measurements were made maintained the coherence of the results.
Mu, Yi; Cai, Pengfei; Hu, Siqi; Ma, Sucan; Gao, Youhe
2014-01-01
Protein-protein interactions (PPIs) are essential events to play important roles in a series of biological processes. There are probably more ways of PPIs than we currently realized. Structural and functional investigations of weak PPIs have lagged behind those of strong PPIs due to technical difficulties. Weak PPIs are often short-lived, which may result in more dynamic signals with important biological roles within and/or between cells. For example, the characteristics of PSD-95/Dlg/ZO-1 (PDZ) domain binding to internal sequences, which are primarily weak interactions, have not yet been systematically explored. In the present study, we constructed a nearly random octapeptide yeast two-hybrid library. A total of 24 PDZ domains were used as baits for screening the library. Fourteen of these domains were able to bind internal PDZ-domain binding motifs (PBMs), and PBMs screened for nine PDZ domains exhibited strong preferences. Among 11 PDZ domains that have not been reported their internal PBM binding ability, six were confirmed to bind internal PBMs. The first PDZ domain of LNX2, which has not been reported to bind C-terminal PBMs, was found to bind internal PBMs. These results suggest that the internal PBMs binding ability of PDZ domains may have been underestimated. The data provided diverse internal binding properties for several PDZ domains that may help identify their novel binding partners.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
NASA Astrophysics Data System (ADS)
Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe
2017-02-01
We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate Kd values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to Kd(ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (Kd, ΔH) pairs greatly improved the fits and yielded a second Kd(ITC) close to Kd(ESI-MS). The striking features are: (1) ITC detected a minor binding mode ( 20%) of `low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (Kd, ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments.
Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe
2017-02-01
We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate K d values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to K d (ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (K d , ΔH) pairs greatly improved the fits and yielded a second K d (ITC) close to K d (ESI-MS). The striking features are: (1) ITC detected a minor binding mode (~20%) of 'low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (K d , ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments. Graphical Abstract ᅟ.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ali, S.F.; Newport, G.D.; Scallet, A.C.
THC is the major psychoactive constituent of marijuana and is also known as an hallucinogenic compound. Numerous reports have shown that large doses of THC produce significant alterations in various neurotransmitter systems. The present study was designed to determine whether chronic exposure to THC produces significant alterations in selected neurotransmitter systems (dopamine, serotonin, acetylcholine, GABAergic, benzodiazepine, and opiate) in the rat brain. In Experiment 1, male Sprague-Dawley rats were gavaged with vehicle, 10 or 20 mg THC/kg body weight daily, 5 days/week for 90 days. Animals were killed either 24 hours or two months after the last dose. Brains weremore » dissected into different regions for neurochemical analyses. Two months after the cessation of chronic administration, there was a significant decrease in GABA receptor binding in the hippocampus of animals in the high dose group. However, no other significant changes were found in neurotransmitter receptor binding characteristics in the hippocampus or in neurotransmitter concentrations in the caudate nucleus, hypothalamus or septum after chronic THC administration. In an attempt to replicate the GABA receptor binding changes and also to determine the (35S)TBPS binding in hippocampus, we designed Experiment 2. In this experiment, we dosed the animals by gavage with 0, 5, 10 or 20 mg THC/kg daily, 5 days/week or with 20 mg THC/kg Monday through Thursday and 60 mg/kg on Friday for 90 days. Results from this experiment failed to replicate the dose-dependent effect of THC on GABA receptor binding in hippocampus. Modulation of (35S)TBPS binding by GABA or 3 alpha-OH-DHP or inhibition by cold TBPS in frontal cortex did not show any significant dose-related effects.« less
Annexin VI is a mannose-6-phosphate-independent endocytic receptor for bovine β-glucuronidase.
Ramírez-Mata, Alberto; Michalak, Colette; Mendoza-Hernández, Guillermo; León-Del-Río, Alfonso; González-Noriega, Alfonso
2011-10-01
Endocytosis and transport of bovine liver β-glucuronidase to lysosomes in human fibroblasts are mediated by two receptors: the well-characterized cation-independent mannose 6-phosphate receptor (IGF-II/Man6PR) and an IGF-II/Man6PR-independent receptor, which recognizes a Ser-Trp*-Ser sequence present on the ligand. The latter receptor was detergent extracted from bovine liver membranes and purified. LC/ESI-MS/MS analysis revealed that this endocytic receptor was annexin VI (AnxA6). Several approaches were used to confirm this finding. First, the binding of bovine β-glucuronidase to the purified receptor from bovine liver membranes and His-tagged recombinant human AnxA6 protein was confirmed using ligand-blotting assays. Second, western blot analysis using antibodies raised against IGF-II/Man6PR-independent receptor as well as commercial antibodies against AnxA6 confirmed that the receptor and AnxA6 were indeed the same protein. Third, double immunofluorescence experiments in human fibroblasts confirmed a complete colocalization of the bovine β-glucuronidase and the AnxA6 receptor on the plasma membrane. Lastly, two cell lines were stably transfected with a plasmid containing the cDNA for human AnxA6. In both transfected cell lines, an increase in cell surface AnxA6 and in mannose 6-phosphate-independent endocytosis of bovine β-glucuronidase was detected. These results indicate that AnxA6 is a novel receptor that mediates the endocytosis of the bovine β-glucuronidase. Copyright © 2011 Elsevier Inc. All rights reserved.
Fragment-based protein-protein interaction antagonists of a viral dimeric protease
Gable, Jonathan E.; Lee, Gregory M.; Acker, Timothy M.; Hulce, Kaitlin R.; Gonzalez, Eric R.; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J.; Craik, Charles S.
2016-01-01
Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi’s sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose response determination was performed as a confirmation screen and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed via NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80% of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogs. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. PMID:26822284
In vitro expressed GPCR inserted in polymersome membranes for ligand-binding studies.
May, Sylvia; Andreasson-Ochsner, Mirjam; Fu, Zhikang; Low, Ying Xiu; Tan, Darren; de Hoog, Hans-Peter M; Ritz, Sandra; Nallani, Madhavan; Sinner, Eva-Kathrin
2013-01-07
The dopamine receptor D2 (DRD2), a G-protein coupled receptor is expressed into PBd(22)-PEO(13) and PMOXA(20)-PDMS(54)-PMOXA(20) block copolymer vesicles. The conformational integrity of the receptor is confirmed by antibody- and ligand-binding assays. Replacement of bound dopamine is demonstrated on surface-immobilized polymersomes, thus making this a promising platform for drug screening. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Screening a fragment cocktail library using ultrafiltration
Shibata, Sayaka; Zhang, Zhongsheng; Korotkov, Konstantin V.; Delarosa, Jaclyn; Napuli, Alberto; Kelley, Angela M.; Mueller, Natasha; Ross, Jennifer; Zucker, Frank H.; Buckner, Frederick S.; Merritt, Ethan A.; Verlinde, Christophe L. M. J.; Van Voorhis, Wesley C.; Hol, Wim G. J.; Fan, Erkang
2011-01-01
Ultrafiltration provides a generic method to discover ligands for protein drug targets with millimolar to micromolar Kd, the typical range of fragment-based drug discovery. This method was tailored to a 96-well format, and cocktails of fragment-sized molecules, with molecular masses between 150 and 300 Da, were screened against medical structural genomics target proteins. The validity of the method was confirmed through competitive binding assays in the presence of ligands known to bind the target proteins. PMID:21750879
Spotting and designing promiscuous ligands for drug discovery.
Schneider, P; Röthlisberger, M; Reker, D; Schneider, G
2016-01-21
The promiscuous binding behavior of bioactive compounds forms a mechanistic basis for understanding polypharmacological drug action. We present the development and prospective application of a computational tool for identifying potential promiscuous drug-like ligands. In combination with computational target prediction methods, the approach provides a working concept for rationally designing such molecular structures. We could confirm the multi-target binding of a de novo generated compound in a proof-of-concept study relying on the new method.
Steady-State Fluorescence Anisotropy to Investigate Flavonoids Binding to Proteins
ERIC Educational Resources Information Center
Ingersoll, Christine M.; Strollo, Christen M.
2007-01-01
The steady-state fluorescence anisotropy is employed to study the binding of protein of a model protein, human serum albumin, to a commonly used flavonoid, quercetin. The experiment describes the thermodynamics, as well as the biochemical interactions of such binding effectively.
Dharmu, Indra; Ramamurty, N; Kannan, Ramalingam; Babu, Mary
2007-01-01
The hemolymph-derived achatinin(H) (lectin) from Achatina fulica showed a marked cytotoxic effect on MCF7, a human mammary carcinoma cell line. IC(50) values as measured by the 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide assay for achatinin(H) ranged from 6 to 10 microg/ml in the MCF7 cells. MCF7 cells showed significant morphological changes leading to cell death. The above cell death was observed after 48 h of treatment with 8 microg/ml when compared to untreated cells. Alterations in the tumor marker enzymes, as well as in antioxidant enzymes, were observed after achatinin(H) treatment. The specificity and purity of the achatinin(H) was confirmed by the Western blot assay. Achatinin(H) binding to MCF7 cells was detected by anti-achatinin(H), and visualization of the achatinin(H) binding sites on confluent MCF7 cells was confirmed by flourescein isothiocyanate conjugated secondary antibody. MCF7-treated cells fluoresced, indicating the presence of achatinin(H) binding sites. Fluorescence-activated cell sorting analysis of the cell cycle showed a significant increase in S-phase in MCF7 cells after 48 h of achatinin(H) treatment. The cells were arrested in G(2)/M phase of the cell cycle after 48 h with significant changes in cell viability. Cellular damage was confirmed by agarose gel electrophoresis with the characteristic appearance of a DNA streak in treated MCF7 cells indicating the ongoing apoptosis.
Akt regulates the subcellular localization of the Rab27a-binding protein JFC1 by phosphorylation.
Johnson, Jennifer L; Pacquelet, Sandrine; Lane, William S; Eam, Boreth; Catz, Sergio D
2005-08-01
Here, we show that the Rab27a-binding protein JFC1/Slp1 (synaptotagmin-like protein) is regulated by Akt-mediated phosphorylation. Using the phosphatase and tensin homolog-null LNCaP cells and the phosphatidylinositol 3-kinase inhibitor LY294002, we show that the phosphorylation of endogenous JFC1 is dependent on the phosphatidylinositol 3-kinase/Akt pathway. JFC1 was phosphorylated in cells expressing a constitutively active Akt, confirming that it is an Akt substrate in vivo. Direct phosphorylation of JFC1 by Akt was confirmed in vitro. Using microcapillary high-performance liquid chromatography tandem mass spectrometry, we identified five Akt-phosphorylation sites in JFC1. By mutagenesis analysis and subsequent immunoprecipitation (IP), we established that Akt phosphorylates JFC1 at serine 241. JFC1 and Rab27a colocalize in the proximity of the plasma membrane in LNCaP cells. The interaction was confirmed by IP analysis and was abolished by the point mutation W83S in JFC1. Phosphorylation did not alter the ability of JFC1 to bind to Rab27a. Instead, phosphorylation by Akt dramatically decreased when JFC1 was bound to Rab27a. Finally, we show that as a consequence of in vivo phosphorylation, JFC1 dissociates from the membrane, promoting JFC1 redistribution to the cytosol. Our results suggest that Akt regulates JFC1/Slp1 function by phosphorylation and may have implications on Rab27a-containing vesicle secretion.