Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

Development of gastrointestinal surface. VIII. Lectin identification of carbohydrate differences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pang, K.Y.; Bresson, J.L.; Walker, W.A.

Binding of microvillus membranes (MVM) from newborn and adult rats by concanavalin A (Con A), Ulex europaeus (UEA I), Dolichos bifluorus (DBA), and Triticum vulgaris (WGA) was examined to determine the availability of carbohydrate-containing sites for these lectins on the intestinal surface during development. Consistent patterns of differences in the reaction of MVM with these lectins were found. Con A and UEA had much higher reactivities to MVM of adult than newborn rats. /sup 125/I-labeled-UEA gel overlay experiments revealed the abundance of UEA-binding sites in MVM of adult rat in contrast to the two binding sites in MVM of amore » newborn rat. DBA bound only to MVM of the adults, and very few binding sites were found in immature MVM. In contrast to these lectins, WGA binding was much higher in MVM of the newborns and decreased with maturation. Additional experiments on the age dependence of UEA and DBA reactivities revealed that the most striking changes occur in animals from 2 to 2 wk of age. In MVM from 2-wk-old rats, there were only 13.9% and < 0.2% of the adult binding capacities for UEA and DBA, respectively. By the time the animals were 4 wk old, the binding capacity for UEA had attained close to the level of the adults, whereas for DBA it reached 71.3% of the adult value. These results provide definite evidence of changes in the intestinal surface during perinatal development.« less

Static and kinetic studies of calmodulin and melittin complex.

PubMed

Itakura, M; Iio, T

1992-08-01

Ca2+ binding to calmodulin triggers conformational change of the protein which induces exposure of hydrophobic surfaces. Melittin has been believed to bind to Ca(2+)-bound calmodulin through the exposed hydrophobic surfaces. However, tryptophan fluorescence measurements and gel chromatography experiments with the melittin-calmodulin system revealed that melittin bound to calmodulin at zero salt concentration even in the absence of Ca2+; addition of salt removed melittin from Ca(2+)-free calmodulin. This means not only the hydrophobic interaction but also the electrostatic interaction contributes to the melittin-calmodulin binding. The fluorescence stopped-flow studies of the dissociation reaction of melittin-calmodulin complex revealed that Ca2+ removal from the complex induced a conformational change of calmodulin, resulting in reduction of the hydrophobic interaction between melittin and calmodulin, but the electrostatic interaction kept melittin still bound to calmodulin for a subsecond lag period, after which melittin dissociated from calmodulin. The fluorescence stopped-flow experiments on the dissociation reaction of complex of melittin and tryptic fragment(s) of calmodulin revealed that the lag period of the melittin dissociation reaction was attributable to the interaction between the C-terminal half of calmodulin and the C-terminal region of melittin.

Arousal-Enhanced Location Memory for Pictures

PubMed Central

Mather, Mara; Nesmith, Kathryn

2008-01-01

Four experiments revealed arousal-enhanced location memory for pictures. After an incidental encoding task, participants were more likely to remember the locations of positive and negative arousing pictures than the locations of non-arousing pictures, indicating better binding of location to picture. This arousal-enhanced binding effect did not have a cost for the binding of nearby pictures to their locations. Thus, arousal can enhance binding of an arousing picture’s content to its location without interfering with picture-location binding for nearby pictures. In addition, arousal-enhanced picture-location memory binding is not just a side effect of enhanced memory for the picture itself, as it occurs both when recognition memory is good and when it is poor. PMID:19190722

Identifying mRNA sequence elements for target recognition by human Argonaute proteins

PubMed Central

Li, Jingjing; Kim, TaeHyung; Nutiu, Razvan; Ray, Debashish; Hughes, Timothy R.; Zhang, Zhaolei

2014-01-01

It is commonly known that mammalian microRNAs (miRNAs) guide the RNA-induced silencing complex (RISC) to target mRNAs through the seed-pairing rule. However, recent experiments that coimmunoprecipitate the Argonaute proteins (AGOs), the central catalytic component of RISC, have consistently revealed extensive AGO-associated mRNAs that lack seed complementarity with miRNAs. We herein test the hypothesis that AGO has its own binding preference within target mRNAs, independent of guide miRNAs. By systematically analyzing the data from in vivo cross-linking experiments with human AGOs, we have identified a structurally accessible and evolutionarily conserved region (∼10 nucleotides in length) that alone can accurately predict AGO–mRNA associations, independent of the presence of miRNA binding sites. Within this region, we further identified an enriched motif that was replicable on independent AGO-immunoprecipitation data sets. We used RNAcompete to enumerate the RNA-binding preference of human AGO2 to all possible 7-mer RNA sequences and validated the AGO motif in vitro. These findings reveal a novel function of AGOs as sequence-specific RNA-binding proteins, which may aid miRNAs in recognizing their targets with high specificity. PMID:24663241

Change of the binding mode of the DNA/proflavine system induced by ethanol.

PubMed

García, Begoña; Leal, José M; Ruiz, Rebeca; Biver, Tarita; Secco, Fernando; Venturini, M

2010-07-01

The equilibria and kinetics of the binding of proflavine to poly(dG-dC).poly(dG-dC) and poly(dA-dT).poly(dA-dT) were investigated in ethanol/water mixtures using spectrophotometric, circular dichroism, viscometric, and T-jump methods. All methods concur in showing that two modes of interaction are operative: intercalation and surface binding. The latter mode is favored by increasing ethanol and/or the proflavine content. Both static and kinetic experiments show that, concerning the poly(dG-dC).poly(dG-dC)/proflavine system, intercalation largely prevails up to 20% EtOH. For higher EtOH levels surface binding becomes dominant. Concerning the poly(dA-dT).poly(dA-dT)/proflavine system, melting experiments show that addition of proflavine stabilizes the double stranded structure, but the effect is reduced in the presence of EtOH. The DeltaH degrees and DeltaS degrees values of the melting process, measured at different concentrations of added proflavine, are linearly correlated, revealing the presence of the enthalpy-entropy compensation phenomenon (EEC). The nonmonotonicity of the "entropic term" of the EEC reveals the transition between the two binding modes. T-jump experiments show two relaxation effects, but at the highest levels of EtOH (>25%) the kinetic curves become monophasic, confirming the prevalence of the surface complex. A branched mechanism is proposed where diffusion controlled formation of a precursor complex occurs in the early stage of the binding process. This evolves toward the surface and/or the intercalated complex according to two rate-determining parallel steps. CD spectra suggest that, in the surface complex, proflavine is bound to DNA in the form of an aggregate.

A unique PDZ domain and arrestin-like fold interaction reveals mechanistic details of endocytic recycling by SNX27-retromer.

PubMed

Gallon, Matthew; Clairfeuille, Thomas; Steinberg, Florian; Mas, Caroline; Ghai, Rajesh; Sessions, Richard B; Teasdale, Rohan D; Collins, Brett M; Cullen, Peter J

2014-09-02

The sorting nexin 27 (SNX27)-retromer complex is a major regulator of endosome-to-plasma membrane recycling of transmembrane cargos that contain a PSD95, Dlg1, zo-1 (PDZ)-binding motif. Here we describe the core interaction in SNX27-retromer assembly and its functional relevance for cargo sorting. Crystal structures and NMR experiments reveal that an exposed β-hairpin in the SNX27 PDZ domain engages a groove in the arrestin-like structure of the vacuolar protein sorting 26A (VPS26A) retromer subunit. The structure establishes how the SNX27 PDZ domain simultaneously binds PDZ-binding motifs and retromer-associated VPS26. Importantly, VPS26A binding increases the affinity of the SNX27 PDZ domain for PDZ- binding motifs by an order of magnitude, revealing cooperativity in cargo selection. With disruption of SNX27 and retromer function linked to synaptic dysfunction and neurodegenerative disease, our work provides the first step, to our knowledge, in the molecular description of this important sorting complex, and more broadly describes a unique interaction between a PDZ domain and an arrestin-like fold.

Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.

PubMed

Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S

2008-01-01

Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.

Relational and conjunctive binding functions dissociate in short-term memory.

PubMed

Parra, Mario A; Fabi, Katia; Luzzi, Simona; Cubelli, Roberto; Hernandez Valdez, Maria; Della Sala, Sergio

2015-02-01

Remembering complex events requires binding features within unified objects (conjunctions) and holding associations between objects (relations). Recent studies suggest that the two functions dissociate in long-term memory (LTM). Less is known about their functional organization in short-term memory (STM). The present study investigated this issue in patient AE affected by a stroke which caused damage to brain regions known to be relevant for relational functions both in LTM and in STM (i.e., the hippocampus). The assessment involved a battery of standard neuropsychological tasks and STM binding tasks. One STM binding task (Experiment 1) presented common objects and common colors forming either pairs (relations) or integrated objects (conjunctions). Free recall of relations or conjunctions was assessed. A second STM binding task used random polygons and non-primary colors instead (Experiment 2). Memory was assessed by selecting the features that made up the relations or the conjunctions from a set of single polygons and a set of single colors. The neuropsychological assessment revealed impaired delayed memory in AE. AE's pronounced relational STM binding deficits contrasted with his completely preserved conjunctive binding functions in both Experiments 1 and 2. Only 2.35% and 1.14% of the population were expected to have a discrepancy more extreme than that presented by AE in Experiments 1 and 2, respectively. Processing relations and conjunctions of very elementary nonspatial features in STM led to dissociating performances in AE. These findings may inform current theories of memory decline such as those linked to cognitive aging.

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Application of plug-plug technique to ACE experiments for discovery of peptides binding to a larger target protein: a model study of calmodulin-binding fragments selected from a digested mixture of reduced BSA.

PubMed

Saito, Kazuki; Nakato, Mamiko; Mizuguchi, Takaaki; Wada, Shinji; Uchimura, Hiromasa; Kataoka, Hiroshi; Yokoyama, Shigeyuki; Hirota, Hiroshi; Kiso, Yoshiaki

2014-03-01

To discover peptide ligands that bind to a target protein with a higher molecular mass, a concise screening methodology has been established, by applying a "plug-plug" technique to ACE experiments. Exploratory experiments using three mixed peptides, mastoparan-X, β-endorphin, and oxytocin, as candidates for calmodulin-binding ligands, revealed that the technique not only reduces the consumption of the protein sample, but also increases the flexibility of the experimental conditions, by allowing the use of MS detection in the ACE experiments. With the plug-plug technique, the ACE-MS screening methodology successfully selected calmodulin-binding peptides from a random library with diverse constituents, such as protease digests of BSA. Three peptides with Kd values between 8-147 μM for calmodulin were obtained from a Glu-C endoprotease digest of reduced BSA, although the digest showed more than 70 peaks in its ACE-MS electropherogram. The method established here will be quite useful for the screening of peptide ligands, which have only low affinities due to their flexible chain structures but could potentially provide primary information for designing inhibitors against the target protein. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Self-Organization of Metal Nanoparticles in Light: Electrodynamics-Molecular Dynamics Simulations and Optical Binding Experiments.

PubMed

McCormack, Patrick; Han, Fei; Yan, Zijie

2018-02-01

Light-driven self-organization of metal nanoparticles (NPs) can lead to unique optical matter systems, yet simulation of such self-organization (i.e., optical binding) is a complex computational problem that increases nonlinearly with system size. Here we show that a combined electrodynamics-molecular dynamics simulation technique can simulate the trajectories and predict stable configurations of silver NPs in optical fields. The simulated dynamic equilibrium of a two-NP system matches the probability density of oscillations for two optically bound NPs obtained experimentally. The predicted stable configurations for up to eight NPs are further compared to experimental observations of silver NP clusters formed by optical binding in a Bessel beam. All configurations are confirmed to form in real systems, including pentagonal clusters with five-fold symmetry. Our combined simulations and experiments have revealed a diverse optical matter system formed by anisotropic optical binding interactions, providing a new strategy to discover artificial materials.

Nanopore Force Spectroscopy of Aptamer–Ligand Complexes

PubMed Central

Arnaut, Vera; Langecker, Martin; Simmel, Friedrich C.

2013-01-01

The stability of aptamer–ligand complexes is probed in nanopore-based dynamic force spectroscopy experiments. Specifically, the ATP-binding aptamer is investigated using a backward translocation technique, in which the molecules are initially pulled through an α-hemolysin nanopore from the cis to the trans side of a lipid bilayer membrane, allowed to refold and interact with their target, and then translocated back in the trans–cis direction. From these experiments, the distribution of bound and unbound complexes is determined, which in turn allows determination of the dissociation constant Kd ≈ 0.1 mM of the aptamer and of voltage-dependent unfolding rates. The experiments also reveal differences in binding of the aptamer to AMP, ADP, or ATP ligands. Investigation of an aptamer variant with a stabilized ATP-binding site indicates fast conformational switching of the original aptamer before ATP binding. Nanopore force spectroscopy is also used to study binding of the thrombin-binding aptamer to its target. To detect aptamer–target interactions in this case, the stability of the ligand-free aptamer—containing G-quadruplexes—is tuned via the potassium content of the buffer. Although the presence of thrombin was detected, limitations of the method for aptamers with strong secondary structures and complexes with nanomolar Kd were identified. PMID:24010663

Ibrutinib targets mutant-EGFR kinase with a distinct binding conformation.

PubMed

Wang, Aoli; Yan, Xiao-E; Wu, Hong; Wang, Wenchao; Hu, Chen; Chen, Cheng; Zhao, Zheng; Zhao, Peng; Li, Xixiang; Wang, Li; Wang, Beilei; Ye, Zi; Wang, Jinhua; Wang, Chu; Zhang, Wei; Gray, Nathanael S; Weisberg, Ellen L; Chen, Liang; Liu, Jing; Yun, Cai-Hong; Liu, Qingsong

2016-10-25

Ibrutinib, a clinically approved irreversible BTK kinase inhibitor for Mantle Cell Lymphoma (MCL) and Chronic Lymphocytic Leukemia (CLL) etc, has been reported to be potent against EGFR mutant kinase and currently being evaluated in clinic for Non Small Cell Lung Cancer (NSCLC). Through EGFR wt/mutant engineered isogenic BaF3 cell lines we confirmed the irreversible binding mode of Ibrutinib with EGFR wt/mutant kinase via Cys797. However, comparing to typical irreversible EGFR inhibitor, such as WZ4002, the washing-out experiments revealed a much less efficient covalent binding for Ibrutinib. The biochemical binding affinity examination in the EGFR L858R/T790M kinase revealed that, comparing to more efficient irreversible inhibitor WZ4002 (Kd: 0.074 μM), Ibrutinib exhibited less efficient binding (Kd: 0.18 μM). An X-ray crystal structure of EGFR (T790M) in complex with Ibrutinib exhibited a unique DFG-in/c-Helix-out inactive binding conformation, which partially explained the less efficiency of covalent binding and provided insight for further development of highly efficient irreversible binding inhibitor for the EGFR mutant kinase. These results also imply that, unlike the canonical irreversible inhibitor, sustained effective concentration might be required for Ibrutinib in order to achieve the maximal efficacy in the clinic application against EGFR driven NSCLC.

Mapping Hfq-RNA interaction surfaces using tryptophan fluorescence quenching

PubMed Central

Robinson, Kirsten E.; Orans, Jillian; Kovach, Alexander R.; Link, Todd M.; Brennan, Richard G.

2014-01-01

Hfq is a posttranscriptional riboregulator and RNA chaperone that binds small RNAs and target mRNAs to effect their annealing and message-specific regulation in response to environmental stressors. Structures of Hfq-RNA complexes indicate that U-rich sequences prefer the proximal face and A-rich sequences the distal face; however, the Hfq-binding sites of most RNAs are unknown. Here, we present an Hfq-RNA mapping approach that uses single tryptophan-substituted Hfq proteins, all of which retain the wild-type Hfq structure, and tryptophan fluorescence quenching (TFQ) by proximal RNA binding. TFQ properly identified the respective distal and proximal binding of A15 and U6 RNA to Gram-negative Escherichia coli (Ec) Hfq and the distal face binding of (AA)3A, (AU)3A and (AC)3A to Gram-positive Staphylococcus aureus (Sa) Hfq. The inability of (GU)3G to bind the distal face of Sa Hfq reveals the (R-L)n binding motif is a more restrictive (A-L)n binding motif. Remarkably Hfq from Gram-positive Listeria monocytogenes (Lm) binds (GU)3G on its proximal face. TFQ experiments also revealed the Ec Hfq (A-R-N)n distal face-binding motif should be redefined as an (A-A-N)n binding motif. TFQ data also demonstrated that the 5′-untranslated region of hfq mRNA binds both the proximal and distal faces of Ec Hfq and the unstructured C-terminus. PMID:24288369

Cu(I)-mediated Allosteric Switching in a Copper-sensing Operon Repressor (CsoR)*

PubMed Central

Chang, Feng-Ming James; Coyne, H. Jerome; Cubillas, Ciro; Vinuesa, Pablo; Fang, Xianyang; Ma, Zhen; Ma, Dejian; Helmann, John D.; García-de los Santos, Alejandro; Wang, Yun-Xing; Dann, Charles E.; Giedroc, David P.

2014-01-01

The copper-sensing operon repressor (CsoR) is representative of a major Cu(I)-sensing family of bacterial metalloregulatory proteins that has evolved to prevent cytoplasmic copper toxicity. It is unknown how Cu(I) binding to tetrameric CsoRs mediates transcriptional derepression of copper resistance genes. A phylogenetic analysis of 227 DUF156 protein members, including biochemically or structurally characterized CsoR/RcnR repressors, reveals that Geobacillus thermodenitrificans (Gt) CsoR characterized here is representative of CsoRs from pathogenic bacilli Listeria monocytogenes and Bacillus anthracis. The 2.56 Å structure of Cu(I)-bound Gt CsoR reveals that Cu(I) binding induces a kink in the α2-helix between two conserved copper-ligating residues and folds an N-terminal tail (residues 12–19) over the Cu(I) binding site. NMR studies of Gt CsoR reveal that this tail is flexible in the apo-state with these dynamics quenched upon Cu(I) binding. Small angle x-ray scattering experiments on an N-terminally truncated Gt CsoR (Δ2–10) reveal that the Cu(I)-bound tetramer is hydrodynamically more compact than is the apo-state. The implications of these findings for the allosteric mechanisms of other CsoR/RcnR repressors are discussed. PMID:24831014

Exploring the site-selective binding of jatrorrhizine to human serum albumin: spectroscopic and molecular modeling approaches.

PubMed

Mi, Ran; Hu, Yan-Jun; Fan, Xiao-Yang; Ouyang, Yu; Bai, Ai-Min

2014-01-03

This paper exploring the site-selective binding of jatrorrhizine to human serum albumin (HSA) under physiological conditions (pH=7.4). The investigation was carried out using fluorescence spectroscopy, UV-vis spectroscopy, and molecular modeling. The results of fluorescence quenching and UV-vis absorption spectra experiments indicated the formation of the complex of HSA-jatrorrhizine. Binding parameters calculating from Stern-Volmer method and Scatchard method were calculated at 298, 304 and 310 K, with the corresponding thermodynamic parameters ΔG, ΔH and ΔS as well. Binding parameters calculating from Stern-Volmer method and Scatchard method showed that jatrorrhizine bind to HSA with the binding affinities of the order 10(4) L mol(-1). The thermodynamic parameters studies revealed that the binding was characterized by negative enthalpy and positive entropy changes and the electrostatic interactions play a major role for jatrorrhizine-HSA association. Site marker competitive displacement experiments and molecular modeling calculation demonstrating that jatrorrhizine is mainly located within the hydrophobic pocket of the subdomain IIIA of HSA. Furthermore, the synchronous fluorescence spectra suggested that the association between jatrorrhizine and HSA changed molecular conformation of HSA. Copyright © 2013. Published by Elsevier B.V.

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

Insights into the interaction of methotrexate and human serum albumin: A spectroscopic and molecular modeling approach.

PubMed

Cheng, Li-Yang; Fang, Min; Bai, Ai-Min; Ouyang, Yu; Hu, Yan-Jun

2017-08-01

In this study, fluorescence spectroscopy and molecular modeling approaches were employed to investigate the binding of methotrexate to human serum albumin (HSA) under physiological conditions. From the mechanism, it was demonstrated that fluorescence quenching of HSA by methotrexate results from the formation of a methotrexate/HSA complex. Binding parameters calculated using the Stern-Volmer method and the Scatchard method showed that methotrexate binds to HSA with binding affinities in the order 10 4  L·mol -1 . Thermodynamic parameter studies revealed that the binding reaction is spontaneous, and that hydrogen bonds and van der Waals interactions play a major role in the reaction. Site marker competitive displacement experiments and a molecular modeling approach demonstrated that methotrexate binds with appropriate affinity to site I (subdomain IIA) of HSA. Furthermore, we discuss some factors that influence methotrexate binding to HSA. Copyright © 2017 John Wiley & Sons, Ltd.

A comparative analysis on the binding characteristics of various mammalian albumins towards a multitherapeutic agent, pinostrobin

PubMed Central

FEROZ, Shevin R.; SUMI, Rumana A.; MALEK, Sri N.A.; TAYYAB, Saad

2014-01-01

The interaction of pinostrobin (PS), a multitherapeutic agent with serum albumins of various mammalian species namely, goat, bovine, human, porcine, rabbit, sheep and dog was investigated using fluorescence quench titration and competitive drug displacement experiments. Analysis of the intrinsic fluorescence quenching data revealed values of the association constant, Ka in the range of 1.49 – 6.12 × 104 M−1, with 1:1 binding stoichiometry. Based on the PS–albumin binding characteristics, these albumins were grouped into two classes. Ligand displacement studies using warfarin as the site I marker ligand correlated well with the binding data. Albumins from goat and bovine were found to be closely similar to human albumin on the basis of PS binding characteristics. PMID:25519455

Microfluidic experiments reveal that antifreeze proteins bound to ice crystals suffice to prevent their growth

PubMed Central

Celik, Yeliz; Drori, Ran; Pertaya-Braun, Natalya; Altan, Aysun; Barton, Tyler; Bar-Dolev, Maya; Groisman, Alex; Davies, Peter L.; Braslavsky, Ido

2013-01-01

Antifreeze proteins (AFPs) are a subset of ice-binding proteins that control ice crystal growth. They have potential for the cryopreservation of cells, tissues, and organs, as well as for production and storage of food and protection of crops from frost. However, the detailed mechanism of action of AFPs is still unclear. Specifically, there is controversy regarding reversibility of binding of AFPs to crystal surfaces. The experimentally observed dependence of activity of AFPs on their concentration in solution appears to indicate that the binding is reversible. Here, by a series of experiments in temperature-controlled microfluidic devices, where the medium surrounding ice crystals can be exchanged, we show that the binding of hyperactive Tenebrio molitor AFP to ice crystals is practically irreversible and that surface-bound AFPs are sufficient to inhibit ice crystal growth even in solutions depleted of AFPs. These findings rule out theories of AFP activity relying on the presence of unbound protein molecules. PMID:23300286

The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site.

PubMed

Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph

2009-08-07

SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.

The Role of IQGAP1 in Breast Carcinoma

DTIC Science & Technology

2012-10-01

and"-tubulin expression was measured as described above. Statistical Analysis —All experiments were repeated inde- pendently at least three times...IQGAP1 Binds HER2—In vitro analysis with pure proteins was used to examine a possible interaction between IQGAP1 and HER2. GST alone or GST-HER2 was...incubated with puri- fied IQGAP1, and complexes were isolated with glutathione- Sepharose. Analysis by Western blotting reveals that IQGAP1 bindsHER2

SSB-1 of the yeast Saccharomyces cerevisiae is a nucleolar-specific, silver-binding protein that is associated with the snR10 and snR11 small nuclear RNAs

PubMed Central

1990-01-01

SSB-1, the yeast single-strand RNA-binding protein, is demonstrated to be a yeast nucleolar-specific, silver-binding protein. In double-label immunofluorescence microscopy experiments antibodies to two other nucleolar proteins, RNA Pol I 190-kD and fibrillarin, were used to reveal the site of rRNA transcription; i.e., the fibrillar region of the nucleolus. SSB-1 colocalized with fibrillarin in a double-label immunofluorescence mapping experiment to the yeast nucleolus. SSB-1 is located, though, over a wider region of the nucleolus than the transcription site marker. Immunoprecipitations of yeast cell extracts with the SSB-1 antibody reveal that in 150 mM NaCl SSB-1 is bound to two small nuclear RNAs (snRNAs). These yeast snRNAs are snR10 and snR11, with snR10 being predominant. Since snR10 has been implicated in pre-rRNA processing, the association of SSB-1 and snR10 into a nucleolar snRNP particle indicates SSB-1 involvement in rRNA processing as well. Also, another yeast protein, SSB-36-kD, isolated by single- strand DNA chromatography, is shown to bind silver under the conditions used for nucleolar-specific staining. It is, most likely, another yeast nucleolar protein. PMID:2121740

Supramolecular interaction of 6-shogaol, a therapeutic agent of Zingiber officinale with human serum albumin as elucidated by spectroscopic, calorimetric and molecular docking methods.

PubMed

Feroz, S R; Mohamad, S B; Lee, G S; Malek, S N A; Tayyab, S

2015-06-01

6-Shogaol, one of the main bioactive constituents of Zingiber officinale has been shown to possess various therapeutic properties. Interaction of a therapeutic compound with plasma proteins greatly affects its pharmacokinetic and pharmacodynamic properties. The present investigation was undertaken to characterize the interaction between 6-shogaol and the main in vivo transporter, human serum albumin (HSA). Various binding characteristics of 6-shogaol-HSA interaction were studied using fluorescence spectroscopy. Thermal stability of 6-shogaol-HSA system was determined by circular dichroism (CD) and differential scanning calorimetric (DSC) techniques. Identification of the 6-shogaol binding site on HSA was made by competitive drug displacement and molecular docking experiments. Fluorescence quench titration results revealed the association constant, Ka of 6-shogaol-HSA interaction as 6.29 ± 0.33 × 10(4) M(-1) at 25 ºC. Values of the enthalpy change (-11.76 kJ mol(-1)) and the entropy change (52.52 J mol(-1) K(-1)), obtained for the binding reaction suggested involvement of hydrophobic and van der Waals forces along with hydrogen bonds in the complex formation. Higher thermal stability of HSA was noticed in the presence of 6-shogaol, as revealed by DSC and thermal denaturation profiles. Competitive ligand displacement experiments along with molecular docking results suggested the binding preference of 6-shogaol for Sudlow's site I of HSA. All these results suggest that 6-shogaol binds to Sudlow's site I of HSA through moderate binding affinity and involves hydrophobic and van der Waals forces along with hydrogen bonds. Copyright © 2015 Elsevier GmbH. All rights reserved.

The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

PubMed

Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

2017-01-01

Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

Characterization of strychnine-sensitive glycine receptor in the intact frog retina: modulation by protein kinases.

PubMed

Salceda, Rocío; Aguirre-Ramirez, Marisela

2005-03-01

We studied 3H-glycine and 3H-strychnine specific binding to glycine receptor (GlyR) in intact isolated frog retinas. To avoid glycine binding to glycine uptake sites, experiments were performed at low ligand concentrations in a sodium-free medium. The binding of both radiolabeled ligands was saturated. Scatchard analysis of bound glycine and strychnine revealed a KD of 2.5 and 2.0 microM, respectively. Specific binding of glycine was displaced by beta-alanine, sarcosine, and strychnine. Strychnine binding was displaced 50% by glycine, and sarcosine. Properties of the strychnine-binding site in the GlyR were modified by sarcosine. Binding of both radioligands was considerably reduced by compounds that inhibit or activate adenylate cyclase and increased cAMP levels. A phorbol ester activator of PKC remarkably decreased glycine and strychnine binding. These results suggest modulation of GlyR in response to endogenous activation of protein kinases A and C, as well as protein phosphorylation modulating GlyR function in retina.

Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connelly, P.R.; Gill, S.J.; Miller, K.I.

1989-02-21

Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

Kinetic method for the large-scale analysis of the binding mechanism of histone deacetylase inhibitors.

PubMed

Meyners, Christian; Baud, Matthias G J; Fuchter, Matthew J; Meyer-Almes, Franz-Josef

2014-09-01

Performing kinetic studies on protein ligand interactions provides important information on complex formation and dissociation. Beside kinetic parameters such as association rates and residence times, kinetic experiments also reveal insights into reaction mechanisms. Exploiting intrinsic tryptophan fluorescence a parallelized high-throughput Förster resonance energy transfer (FRET)-based reporter displacement assay with very low protein consumption was developed to enable the large-scale kinetic characterization of the binding of ligands to recombinant human histone deacetylases (HDACs) and a bacterial histone deacetylase-like amidohydrolase (HDAH) from Bordetella/Alcaligenes. For the binding of trichostatin A (TSA), suberoylanilide hydroxamic acid (SAHA), and two other SAHA derivatives to HDAH, two different modes of action, simple one-step binding and a two-step mechanism comprising initial binding and induced fit, were verified. In contrast to HDAH, all compounds bound to human HDAC1, HDAC6, and HDAC8 through a two-step mechanism. A quantitative view on the inhibitor-HDAC systems revealed two types of interaction, fast binding and slow dissociation. We provide arguments for the thesis that the relationship between quantitative kinetic and mechanistic information and chemical structures of compounds will serve as a valuable tool for drug optimization. Copyright © 2014 Elsevier Inc. All rights reserved.

Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less

Allosteric regulation of focal adhesion kinase by PIP₂ and ATP.

PubMed

Zhou, Jing; Bronowska, Agnieszka; Le Coq, Johanne; Lietha, Daniel; Gräter, Frauke

2015-02-03

Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase that regulates cell signaling, proliferation, migration, and development. A major mechanism of regulation of FAK activity is an intramolecular autoinhibitory interaction between two of its domains--the catalytic and FERM domains. Upon cell adhesion to the extracellular matrix, FAK is being translocated toward focal adhesion sites and activated. Interactions of FAK with phosphoinositide phosphatidylinsositol-4,5-bis-phosphate (PIP₂) are required to activate FAK. However, the molecular mechanism of the activation remains poorly understood. Recent fluorescence resonance energy transfer experiments revealed a closure of the FERM-kinase interface upon ATP binding, which is reversed upon additional binding of PIP₂. Here, we addressed the allosteric regulation of FAK by performing all-atom molecular-dynamics simulations of a FAK fragment containing the catalytic and FERM domains, and comparing the dynamics in the absence or presence of ATP and PIP₂. As a major conformational change, we observe a closing and opening motion upon ATP and additional PIP₂ binding, respectively, in good agreement with the fluorescence resonance energy transfer experiments. To reveal how the binding of the regulatory PIP₂ to the FERM F2 lobe is transduced to the very distant F1/N-lobe interface, we employed force distribution analysis. We identified a network of mainly charged residue-residue interactions spanning from the PIP₂ binding site to the distant interface between the kinase and FERM domains, comprising candidate residues for mutagenesis to validate the predicted mechanism of FAK activation. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A Novel MHC-I Surface Targeted for Binding by the MCMV m06 Immunoevasin Revealed by Solution NMR.

PubMed

Sgourakis, Nikolaos G; May, Nathan A; Boyd, Lisa F; Ying, Jinfa; Bax, Ad; Margulies, David H

2015-11-27

As part of its strategy to evade detection by the host immune system, murine cytomegalovirus (MCMV) encodes three proteins that modulate cell surface expression of major histocompatibility complex class I (MHC-I) molecules: the MHC-I homolog m152/gp40 as well as the m02-m16 family members m04/gp34 and m06/gp48. Previous studies of the m04 protein revealed a divergent Ig-like fold that is unique to immunoevasins of the m02-m16 family. Here, we engineer and characterize recombinant m06 and investigate its interactions with full-length and truncated forms of the MHC-I molecule H2-L(d) by several techniques. Furthermore, we employ solution NMR to map the interaction footprint of the m06 protein on MHC-I, taking advantage of a truncated H2-L(d), "mini-H2-L(d)," consisting of only the α1α2 platform domain. Mini-H2-L(d) refolded in vitro with a high affinity peptide yields a molecule that shows outstanding NMR spectral features, permitting complete backbone assignments. These NMR-based studies reveal that m06 binds tightly to a discrete site located under the peptide-binding platform that partially overlaps with the β2-microglobulin interface on the MHC-I heavy chain, consistent with in vitro binding experiments showing significantly reduced complex formation between m06 and β2-microglobulin-associated MHC-I. Moreover, we carry out NMR relaxation experiments to characterize the picosecond-nanosecond dynamics of the free mini-H2-L(d) MHC-I molecule, revealing that the site of interaction is highly ordered. This study provides insight into the mechanism of the interaction of m06 with MHC-I, suggesting a structural manipulation of the target MHC-I molecule at an early stage of the peptide-loading pathway. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Evidence for estrogen receptor beta-selective activity of Vitex agnus-castus and isolated flavones.

PubMed

Jarry, Hubertus; Spengler, Barbara; Porzel, Andrea; Schmidt, Juergen; Wuttke, Wolfgang; Christoffel, Volker

2003-10-01

Recent cell culture experiments indicated that extracts of Vitex agnus-castus (VAC) may contain yet unidentified phytoestrogens. Estrogenic actions are mediated via estrogen receptors (ER). To investigate whether VAC compounds bind to the currently known isoforms ERalpha or ERss, ligand binding assays (LBA) were performed. Subtype specific ER-LBA revealed a binding of VAC to ERss only. To isolate the ERss-selective compounds, the extract was fractionated by bio-guidance. The flavonoid apigenin was isolated and identified as the most active ERss-selective phytoestrogen in VAC. Other isolated compounds were vitexin and penduletin. These data demonstrate that the phytoestrogens in VAC are ERss-selective.

Frizzled 7 and PIP2 binding by syntenin PDZ2 domain supports Frizzled 7 trafficking and signalling

NASA Astrophysics Data System (ADS)

Egea-Jimenez, Antonio Luis; Gallardo, Rodrigo; Garcia-Pino, Abel; Ivarsson, Ylva; Wawrzyniak, Anna Maria; Kashyap, Rudra; Loris, Remy; Schymkowitz, Joost; Rousseau, Frederic; Zimmermann, Pascale

2016-07-01

PDZ domain-containing proteins work as intracellular scaffolds to control spatio-temporal aspects of cell signalling. This function is supported by the ability of their PDZ domains to bind other proteins such as receptors, but also phosphoinositide lipids important for membrane trafficking. Here we report a crystal structure of the syntenin PDZ tandem in complex with the carboxy-terminal fragment of Frizzled 7 and phosphatidylinositol 4,5-bisphosphate (PIP2). The crystal structure reveals a tripartite interaction formed via the second PDZ domain of syntenin. Biophysical and biochemical experiments establish co-operative binding of the tripartite complex and identify residues crucial for membrane PIP2-specific recognition. Experiments with cells support the importance of the syntenin-PIP2 interaction for plasma membrane targeting of Frizzled 7 and c-jun phosphorylation. This study contributes to our understanding of the biology of PDZ proteins as key players in membrane compartmentalization and dynamics.

Differential Epitope Mapping by STD NMR Spectroscopy To Reveal the Nature of Protein-Ligand Contacts.

PubMed

Monaco, Serena; Tailford, Louise E; Juge, Nathalie; Angulo, Jesus

2017-11-27

Saturation transfer difference (STD) NMR spectroscopy is extensively used to obtain epitope maps of ligands binding to protein receptors, thereby revealing structural details of the interaction, which is key to direct lead optimization efforts in drug discovery. However, it does not give information about the nature of the amino acids surrounding the ligand in the binding pocket. Herein, we report the development of the novel method differential epitope mapping by STD NMR (DEEP-STD NMR) for identifying the type of protein residues contacting the ligand. The method produces differential epitope maps through 1) differential frequency STD NMR and/or 2) differential solvent (D 2 O/H 2 O) STD NMR experiments. The two approaches provide different complementary information on the binding pocket. We demonstrate that DEEP-STD NMR can be used to readily obtain pharmacophore information on the protein. Furthermore, if the 3D structure of the protein is known, this information also helps in orienting the ligand in the binding pocket. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

The Fyn tyrosine kinase binds Irs-1 and forms a distinct signaling complex during insulin stimulation.

PubMed

Sun, X J; Pons, S; Asano, T; Myers, M G; Glasheen, E; White, M F

1996-05-03

Irs-proteins link the receptors for insulin/IGF-1, growth hormones, and several interleukins and interferons to signaling proteins that contain Src homology-2 (SH2). To identify new Irs-1-binding proteins, we screened a mouse embryo expression library with recombinant [32P]Irs-1, which revealed a specific association between p59fyn and Irs-1. The SH2 domain in p59fyn bound to phosphorylated Tyr895 and Tyr1172, which are located in YXX(L/I) motifs. Mutation of p59fyn at the COOH-terminal tyrosine phosphorylation site (Tyr531) enhanced its binding to Irs-1 during insulin stimulation. Binding experiments with various SH2 protein revealed that Grb-2 was largely excluded from Irs-1 complexes containing p59fyn, whereas Grb-2 and p85 occurred in the same Irs-1 complex. By comparison with the insulin receptor, p59fyn kinase phosphorylated a unique cohort of tyrosine residues in Irs-1. These results outline a role for p59fyn or other related Src-kinases during insulin and cytokine signaling.

Binding analysis for interaction of diacetylcurcumin with β-casein nanoparticles by using fluorescence spectroscopy and molecular docking calculations

NASA Astrophysics Data System (ADS)

Mehranfar, Fahimeh; Bordbar, Abdol-Khalegh; Fani, Najme; Keyhanfar, Mehrnaz

2013-11-01

The interaction of diacetylcurcumin (DAC), as a novel synthetic derivative of curcumin, with bovine β-casein (an abundant milk protein that is highly amphiphilic and self assembles into stable micellar nanoparticles in aqueous solution) was investigated using fluorescence quenching experiments, Forster energy transfer measurements and molecular docking calculations. The fluorescence quenching measurements revealed the presence of a single binding site on β-casein for DAC with the binding constant value equals to (4.40 ± 0.03) × 104 M-1. Forster energy transfer measurements suggested that the distance between bound DAC and Trp143 residue is higher than the respective critical distance, hence, the static quenching is more likely responsible for fluorescence quenching other than the mechanism of non-radiative energy transfer. Our results from molecular docking calculations indicated that binding of DAC to β-casein predominantly occurred through hydrophobic contacts in the hydrophobic core of protein. Additionally, in vitro investigation of the cytotoxicity of free DAC and DAC-β-casein complex in human breast cancer cell line MCF7 revealed the higher cytotoxic effect of DAC-β-casein complex.

Crystal structures of ryanodine receptor SPRY1 and tandem-repeat domains reveal a critical FKBP12 binding determinant

NASA Astrophysics Data System (ADS)

Yuchi, Zhiguang; Yuen, Siobhan M. Wong King; Lau, Kelvin; Underhill, Ainsley Q.; Cornea, Razvan L.; Fessenden, James D.; van Petegem, Filip

2015-08-01

Ryanodine receptors (RyRs) form calcium release channels located in the membranes of the sarcoplasmic and endoplasmic reticulum. RyRs play a major role in excitation-contraction coupling and other Ca2+-dependent signalling events, and consist of several globular domains that together form a large assembly. Here we describe the crystal structures of the SPRY1 and tandem-repeat domains at 1.2-1.5 Å resolution, which reveal several structural elements not detected in recent cryo-EM reconstructions of RyRs. The cryo-EM studies disagree on the position of SPRY domains, which had been proposed based on homology modelling. Computational docking of the crystal structures, combined with FRET studies, show that the SPRY1 domain is located next to FK506-binding protein (FKBP). Molecular dynamics flexible fitting and mutagenesis experiments suggest a hydrophobic cluster within SPRY1 that is crucial for FKBP binding. A RyR1 disease mutation, N760D, appears to directly impact FKBP binding through interfering with SPRY1 folding.

The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding[W][OA

PubMed Central

Cesari, Stella; Thilliez, Gaëtan; Ribot, Cécile; Chalvon, Véronique; Michel, Corinne; Jauneau, Alain; Rivas, Susana; Alaux, Ludovic; Kanzaki, Hiroyuki; Okuyama, Yudai; Morel, Jean-Benoit; Fournier, Elisabeth; Tharreau, Didier; Terauchi, Ryohei; Kroj, Thomas

2013-01-01

Resistance (R) proteins recognize pathogen avirulence (Avr) proteins by direct or indirect binding and are multidomain proteins generally carrying a nucleotide binding (NB) and a leucine-rich repeat (LRR) domain. Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia, indicating that the corresponding R proteins possess dual recognition specificity. For RGA5, two alternative transcripts, RGA5-A and RGA5-B, were identified. Genetic analysis showed that only RGA5-A confers resistance, while RGA5-B is inactive. Yeast two-hybrid, coimmunoprecipitation, and fluorescence resonance energy transfer–fluorescence lifetime imaging experiments revealed direct binding of AVR-Pia and AVR1-CO39 to RGA5-A, providing evidence for the recognition of multiple Avr proteins by direct binding to a single R protein. Direct binding seems to be required for resistance as an inactive AVR-Pia allele did not bind RGA5-A. A small Avr interaction domain with homology to the Avr recognition domain in the rice R protein Pik-1 was identified in the C terminus of RGA5-A. This reveals a mode of Avr protein recognition through direct binding to a novel, non-LRR interaction domain. PMID:23548743

Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

NASA Astrophysics Data System (ADS)

Ahmad, Ajaz; Ahmad, Masood

2018-01-01

Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

CELF1 preferentially binds to exon-intron boundary and regulates alternative splicing in HeLa cells.

PubMed

Xia, Heng; Chen, Dong; Wu, Qijia; Wu, Gang; Zhou, Yanhong; Zhang, Yi; Zhang, Libin

2017-09-01

The current RIP-seq approach has been developed for the identification of genome-wide interaction between RNA binding protein (RBP) and the bound RNA transcripts, but still rarely for identifying its binding sites. In this study, we performed RIP-seq experiments in HeLa cells using a monoclonal antibody against CELF1. Mapping of the RIP-seq reads showed a biased distribution at the 3'UTR and intronic regions. A total of 15,285 and 1384 CELF1-specific sense and antisense peaks were identified using the ABLIRC software tool. Our bioinformatics analyses revealed that 5' and 3' splice site motifs and GU-rich motifs were highly enriched in the CELF1-bound peaks. Furthermore, transcriptome analyses revealed that alternative splicing was globally regulated by CELF1 in HeLa cells. For example, the inclusion of exon 16 of LMO7 gene, a marker gene of breast cancer, is positively regulated by CELF1. Taken together, we have shown that RIP-seq data can be used to decipher RBP binding sites and reveal an unexpected landscape of the genome-wide CELF1-RNA interactions in HeLa cells. In addition, we found that CELF1 globally regulates the alternative splicing by binding the exon-intron boundary in HeLa cells, which will deepen our understanding of the regulatory roles of CELF1 in the pre-mRNA splicing process. Copyright © 2017 Elsevier B.V. All rights reserved.

Probing the interaction of anticancer drug temsirolimus with human serum albumin: molecular docking and spectroscopic insight.

PubMed

Shamsi, Anas; Ahmed, Azaj; Bano, Bilqees

2018-05-01

The binding interaction between temsirolimus, an important antirenal cancer drug, and HSA, an important carrier protein was scrutinized making use of UV and fluorescence spectroscopy. Hyper chromaticity observed in UV spectroscopy in the presence of temsirolimus as compared to free HSA suggests the formation of complex between HSA and temsirolimus. Fluorescence quenching experiments clearly showed quenching in the fluorescence of HSA in the presence of temsirolimus confirming the complex formation and also confirmed that static mode of interaction is operative for this binding process. Binding constant values obtained through UV and fluorescence spectroscopy reveal strong interaction; temsirolimus binds to HSA at 298 K with a binding constant of 2.9 × 10 4  M -1 implying the strength of interaction. The negative Gibbs free energy obtained through Isothermal titration calorimetry as well as quenching experiments suggests that binding process is spontaneous. Molecular docking further provides an insight of various residues that are involved in this binding process; showing the binding energy to be -12.9 kcal/mol. CD spectroscopy was retorted to analyze changes in secondary structure of HSA; increased intensity in presence of temsirolimus showing changes in secondary structure of HSA induced by temsirolimus. This study is of importance as it provides an insight into the binding mechanism of an important antirenal cancer drug with an important carrier protein. Once temsirolimus binds to HSA, it changes conformation of HSA which in turn can alter the functionality of this important carrier protein and this altered functionality of HSA can be highlighted in variety of diseases.

How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent

NASA Astrophysics Data System (ADS)

Dudev, Todor; Grauffel, Cédric; Lim, Carmay

2017-02-01

Adenosine triphosphate (ATP), the major energy currency of the cell, exists in solution mostly as ATP-Mg. Recent experiments suggest that Mg2+ interacts with the highly charged ATP triphosphate group and Li+ can co-bind with the native Mg2+ to form ATP-Mg-Li and modulate the neuronal purine receptor response. However, it is unclear how the negatively charged ATP triphosphate group binds Mg2+ and Li+ (i.e. which phosphate group(s) bind Mg2+/Li+) and how the ATP solution conformation depends on the type of metal cation and the metal-binding mode. Here, we reveal the preferred ATP-binding mode of Mg2+/Li+ alone and combined: Mg2+ prefers to bind ATP tridentately to each of the three phosphate groups, but Li+ prefers to bind bidentately to the terminal two phosphates. We show that the solution ATP conformation depends on the cation and its binding site/mode, but it does not change significantly when Li+ binds to Mg2+-loaded ATP. Hence, ATP-Mg-Li, like Mg2+-ATP, can fit in the ATP-binding site of the host enzyme/receptor, activating specific signaling pathways.

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Molecular interaction of 2,4-diacetylphloroglucinol (DAPG) with human serum albumin (HSA): The spectroscopic, calorimetric and computational investigation

NASA Astrophysics Data System (ADS)

Pragna Lakshmi, T.; Mondal, Moumita; Ramadas, Krishna; Natarajan, Sakthivel

2017-08-01

Drug molecule interaction with human serum albumin (HSA) affects the distribution and elimination of the drug. The compound, 2,4-diacetylphloroglucinol (DAPG) has been known for its antimicrobial, antiviral, antihelminthic and anticancer properties. However, its interaction with HSA is not yet reported. In this study, the interaction between HSA and DAPG was investigated through steady-state fluorescence, time-resolved fluorescence (TRF), circular dichroism (CD), Fourier transform infrared (FT-IR) spectroscopy, isothermal titration calorimetry (ITC), molecular docking and molecular dynamics simulation (MDS). Fluorescence spectroscopy results showed the strong quenching of intrinsic fluorescence of HSA due to interaction with DAPG, through dynamic quenching mechanism. The compound bound to HSA with reversible and moderate affinity which explained its easy diffusion from circulatory system to target tissue. The thermodynamic parameters from fluorescence spectroscopic data clearly revealed the contribution of hydrophobic forces but, the role of hydrogen bonds was not negligible according to the ITC studies. The interaction was exothermic and spontaneous in nature. Binding with DAPG reduced the helical content of protein suggesting the unfolding of HSA. Site marker fluorescence experiments revealed the change in binding constant of DAPG in the presence of site I (warfarin) but not site II marker (ibuprofen) which confirmed that the DAPG bound to site I. ITC experiments also supported this as site I marker could not bind to HSA-DAPG complex while site II marker was accommodated in the complex. In silico studies further showed the lowest binding affinity and more stability of DAPG in site I than in site II. Thus the data presented in this study confirms the binding of DAPG to the site I of HSA which may help in further understanding of pharmacokinetic properties of DAPG.

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

The centrosomal component CEP161 of Dictyostelium discoideum interacts with the Hippo signaling pathway

PubMed Central

Sukumaran, Salil K.; Blau-Wasser, Rosemarie; Rohlfs, Meino; Gallinger, Christoph; Schleicher, Michael; Noegel, Angelika A

2015-01-01

CEP161 is a novel component of the Dictyostelium discoideum centrosome which was identified as binding partner of the pericentriolar component CP250. Here we show that the amino acids 1-763 of the 1381 amino acids CEP161 are sufficient for CP250 binding, centrosomal targeting and centrosome association. Analysis of AX2 cells over-expressing truncated and full length CEP161 proteins revealed defects in growth and development. By immunoprecipitation experiments we identified the Hippo related kinase SvkA (Hrk-svk) as binding partner for CEP161. Both proteins colocalize at the centrosome. In in vitro kinase assays the N-terminal domain of CEP161 (residues 1-763) inhibited the kinase activity of Hrk-svk. A comparison of D. discoideum Hippo kinase mutants with mutants overexpressing CEP161 polypeptides revealed similar defects. We propose that the centrosomal component CEP161 is a novel player in the Hippo signaling pathway and affects various cellular properties through this interaction. PMID:25607232

Snapshot of the equilibrium dynamics of a drug bound to HIV-1 reverse transcriptase

NASA Astrophysics Data System (ADS)

Kuroda, Daniel G.; Bauman, Joseph D.; Challa, J. Reddy; Patel, Disha; Troxler, Thomas; Das, Kalyan; Arnold, Eddy; Hochstrasser, Robin M.

2013-03-01

The anti-AIDS drug rilpivirine undergoes conformational changes to bind HIV-1 reverse transcriptase (RT), which is an essential enzyme for the replication of HIV. These changes allow it to retain potency against mutations that otherwise would render the enzyme resistant. Here we report that water molecules play an essential role in this binding process. Femtosecond experiments and theory expose the molecular level dynamics of rilpivirine bound to HIV-1 RT. Two nitrile substituents, one on each arm of the drug, are used as vibrational probes of the structural dynamics within the binding pocket. Two-dimensional vibrational echo spectroscopy reveals that one nitrile group is unexpectedly hydrogen-bonded to a mobile water molecule, not identified in previous X-ray structures. Ultrafast nitrile-water dynamics are confirmed by simulations. A higher (1.51 Å) resolution X-ray structure also reveals a water-drug interaction network. Maintenance of a crucial anchoring hydrogen bond may help retain the potency of rilpivirine against pocket mutations despite the structural variations they cause.

Effects of Zinc on Particulate Methane Monooxygenase Activity and Structure*

PubMed Central

Sirajuddin, Sarah; Barupala, Dulmini; Helling, Stefan; Marcus, Katrin; Stemmler, Timothy L.; Rosenzweig, Amy C.

2014-01-01

Particulate methane monooxygenase (pMMO) is a membrane-bound metalloenzyme that oxidizes methane to methanol in methanotrophic bacteria. Zinc is a known inhibitor of pMMO, but the details of zinc binding and the mechanism of inhibition are not understood. Metal binding and activity assays on membrane-bound pMMO from Methylococcus capsulatus (Bath) reveal that zinc inhibits pMMO at two sites that are distinct from the copper active site. The 2.6 Å resolution crystal structure of Methylocystis species strain Rockwell pMMO reveals two previously undetected bound lipids, and metal soaking experiments identify likely locations for the two zinc inhibition sites. The first is the crystallographic zinc site in the pmoC subunit, and zinc binding here leads to the ordering of 10 previously unobserved residues. A second zinc site is present on the cytoplasmic side of the pmoC subunit. Parallels between these results and zinc inhibition studies of several respiratory complexes suggest that zinc might inhibit proton transfer in pMMO. PMID:24942740

3- and 4-O-sulfoconjugated and methylated dopamine: highly reduced binding affinity to dopamine D2 receptors in rat striatal membranes.

PubMed

Werle, E; Lenz, T; Strobel, G; Weicker, H

1988-07-01

The binding properties of 3- and 4-O-sulfo-conjugated dopamine (DA-3-O-S, DA-4-O-S) as well as 3-O-methylated dopamine (MT) to rat striatal dopamine D2 receptors were investigated. 3H-spiperone was used as a radioligand in the binding studies. In saturation binding experiments (+)butaclamol, which has been reported to bind to dopaminergic D2 and serotoninergic 5HT2 receptors, was used in conjunction with ketanserin and sulpiride, which preferentially label 5HT2 and D2 receptors, respectively, in order to discriminate between 3H-spiperone binding to D2 and to 5HT2 receptors. Under our particular membrane preparation and assay conditions, 3H-spiperone binds to D2 and 5HT2 receptors with a maximal binding capacity (Bmax) of 340 fmol/mg protein in proportions of about 75%:25% with similar dissociation constants KD (35 pmol/l; 43 pmol/l). This result was verified by the biphasic competition curve of ketanserin, which revealed about 20% high (KD = 24 nmol/l) and 80% low (KD = 420 nmol/l) affinity binding sites corresponding to 5HT2 and D2 receptors, respectively. Therefore, all further competition experiments at a tracer concentration of 50 pmol/l were performed in the presence of 0.1 mumol/l ketanserin to mask the 5HT2 receptors. DA competition curves were best fitted assuming two binding sites, with high (KH = 0.12 mumol/l) and low (KL = 18 mumol/l) affinity, present in a ratio of 3:1. The high affinity binding sites were interconvertible by 100 mumol/l guanyl-5-yl imidodiphosphate [Gpp(NH)p], resulting in a homogenous affinity state of DA receptors (KD = 2.8 mumol/l).2+ off

Copper binding affinity of the C2B domain of synaptotagmin-1 and its potential role in the nonclassical secretion of Acidic Fibroblast Growth Factor

PubMed Central

Jayanthi, Srinivas; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy; Furr, Mercede; Daily, Anna; Thurman, Ryan; Rutherford, Lindsay; Chandrashekar, Reena; Adams, Paul; Prudovsky, Igor; Suresh Kumar, Thallapuranam Krishnaswamy

2014-01-01

Fibroblast growth factor 1 (FGF1) is a heparin-binding proangiogenic protein. FGF1 lacks the conventional N-terminal signal peptide required for secretion through the endoplasmic reticulum (ER) -Golgi secretory pathway. FGF1 is released through a Cu2+ - mediated nonclassical secretion pathway. The secretion of FGF1 involves the formation of a Cu2+- mediated multiprotein release complex (MRC) including FGF1, S100A13 (a calcium-binding protein) and p40 synaptotagmin (Syt1). It is believed that binding of Cu2+ to the C2B domain is important for the release of FGF1 in to the extracellular medium. In this study, using a variety of biophysical studies, Cu2+ and lipid interactions of the C2B domain of Syt1were characterized. Isothermal titration calorimetry (ITC) experiments reveal that C2B domain binds to Cu2+ in a biphasic manner involving an initial endothermic and a subsequent exothermic phase. Fluorescence energy transfer experiments using Tb3+ show that there are two Cu2+- binding pockets on the C2B domain, and one of these is also a Ca2+- binding site. Lipid-binding studies using ITC demonstrate that the C2B domain preferentially binds to small unilamellar vesicles of phosphatidyl serine (PS). Results of the differential scanning calorimetry and limited trypsin digestion experiments suggest that C2B domain is marginally destabilized upon binding to PS vesicles. These results, for the first time, suggest that the main role of the C2B domain of Syt1 is to serve as an anchor for the FGF1 MRC on the membrane bilayer. In addition, binding of the C2B domain to the lipid bilayer is shown to significantly decrease the binding affinity of the protein to Cu2+. The study provides valuable insights on the sequence of structural events that occur in the nonclassical secretion of FGF1. PMID:25224745

Novel Mechanism of Hemin Capture by Hbp2, the Hemoglobin-binding Hemophore from Listeria monocytogenes*

PubMed Central

Malmirchegini, G. Reza; Sjodt, Megan; Shnitkind, Sergey; Sawaya, Michael R.; Rosinski, Justin; Newton, Salete M.; Klebba, Phillip E.; Clubb, Robert T.

2014-01-01

Iron is an essential nutrient that is required for the growth of the bacterial pathogen Listeria monocytogenes. In cell cultures, this microbe secretes hemin/hemoglobin-binding protein 2 (Hbp2; Lmo2185) protein, which has been proposed to function as a hemophore that scavenges heme from the environment. Based on its primary sequence, Hbp2 contains three NEAr transporter (NEAT) domains of unknown function. Here we show that each of these domains mediates high affinity binding to ferric heme (hemin) and that its N- and C-terminal domains interact with hemoglobin (Hb). The results of hemin transfer experiments are consistent with Hbp2 functioning as an Hb-binding hemophore that delivers hemin to other Hbp2 proteins that are attached to the cell wall. Surprisingly, our work reveals that the central NEAT domain in Hbp2 binds hemin even though its primary sequence lacks a highly conserved YXXXY motif that is used by all other previously characterized NEAT domains to coordinate iron in the hemin molecule. To elucidate the mechanism of hemin binding by Hbp2, we determined crystal structures of its central NEAT domain (Hbp2N2; residues 183–303) in its free and hemin-bound states. The structures reveal an unprecedented mechanism of hemin binding in which Hbp2N2 undergoes a major conformational rearrangement that facilitates metal coordination by a non-canonical tyrosine residue. These studies highlight previously unrecognized plasticity in the hemin binding mechanism of NEAT domains and provide insight into how L. monocytogenes captures heme iron. PMID:25315777

The structure of the Tiam1 PDZ domain/ phospho-syndecan1 complex reveals a ligand conformation that modulates protein dynamics.

PubMed

Liu, Xu; Shepherd, Tyson R; Murray, Ann M; Xu, Zhen; Fuentes, Ernesto J

2013-03-05

PDZ (PSD-95/Dlg/ZO-1) domains are protein-protein interaction modules often regulated by ligand phosphorylation. Here, we investigated the specificity, structure, and dynamics of Tiam1 PDZ domain/ligand interactions. We show that the PDZ domain specifically binds syndecan1 (SDC1), phosphorylated SDC1 (pSDC1), and SDC3 but not other syndecan isoforms. The crystal structure of the PDZ/SDC1 complex indicates that syndecan affinity is derived from amino acids beyond the four C-terminal residues. Remarkably, the crystal structure of the PDZ/pSDC1 complex reveals a binding pocket that accommodates the phosphoryl group. Methyl relaxation experiments of PDZ/SCD1 and PDZ/pSDC1 complexes reveal that PDZ-phosphoryl interactions dampen dynamic motions in a distal region of the PDZ domain by decoupling them from the ligand-binding site. Our data are consistent with a selection model by which specificity and phosphorylation regulate PDZ/syndecan interactions and signaling events. Importantly, our relaxation data demonstrate that PDZ/phospho-ligand interactions regulate protein dynamics and their coupling to distal sites. Copyright © 2013 Elsevier Ltd. All rights reserved.

Vibrational Softening of a Protein on Ligand Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balog, Erica; Perahia, David; Smith, Jeremy C

2011-01-01

Neutron scattering experiments have demonstrated that binding of the cancer drug methotrexate softens the low-frequency vibrations of its target protein, dihydrofolate reductase (DHFR). Here, this softening is fully reproduced using atomic detail normal-mode analysis. Decomposition of the vibrational density of states demonstrates that the largest contributions arise from structural elements of DHFR critical to stability and function. Mode-projection analysis reveals an increase of the breathing-like character of the affected vibrational modes consistent with the experimentally observed increased adiabatic compressibility of the protein on complexation.

Characterization of the interaction between furosemide and bovine serum albumin

NASA Astrophysics Data System (ADS)

Zhou, Neng; Liang, Yi-Zeng; Wang, Ping

2008-01-01

The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.

Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy

PubMed Central

Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

2015-01-01

The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA. PMID:26140374

Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy.

PubMed

Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

2015-07-01

The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA.

Supramolecular binding and separation of hydrocarbons within a functionalized porous metal–organic framework

DOE PAGES

Yang, Sihai; Ramirez-Cuesta, Anibal J.; Newby, Ruth; ...

2014-12-01

Supramolecular interactions are fundamental to host–guest binding in many chemical and biological processes. Direct visualization of such supramolecular interactions within host–guest systems is extremely challenging, but crucial to understanding their function. Within this paper, we report a comprehensive study that combines neutron scattering, synchrotron X-ray and neutron diffraction, and computational modelling to define the detailed binding at a molecular level of acetylene, ethylene and ethane within the porous host NOTT-300. This study reveals simultaneous and cooperative hydrogen-bonding, π···π stacking interactions and intermolecular dipole interactions in the binding of acetylene and ethylene to give up to 12 individual weak supramolecular interactionsmore » aligned within the host to form an optimal geometry for the selective binding of hydrocarbons. In addition, we also report the cooperative binding of a mixture of acetylene and ethylene within the porous host, together with the corresponding breakthrough experiments and analysis of adsorption isotherms of gas mixtures.« less

Protein unfolding as a switch from self-recognition to high-affinity client binding

PubMed Central

Groitl, Bastian; Horowitz, Scott; Makepeace, Karl A. T.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.; Reichmann, Dana; Bardwell, James C. A.; Jakob, Ursula

2016-01-01

Stress-specific activation of the chaperone Hsp33 requires the unfolding of a central linker region. This activation mechanism suggests an intriguing functional relationship between the chaperone's own partial unfolding and its ability to bind other partially folded client proteins. However, identifying where Hsp33 binds its clients has remained a major gap in our understanding of Hsp33's working mechanism. By using site-specific Fluorine-19 nuclear magnetic resonance experiments guided by in vivo crosslinking studies, we now reveal that the partial unfolding of Hsp33's linker region facilitates client binding to an amphipathic docking surface on Hsp33. Furthermore, our results provide experimental evidence for the direct involvement of conditionally disordered regions in unfolded protein binding. The observed structural similarities between Hsp33's own metastable linker region and client proteins present a possible model for how Hsp33 uses protein unfolding as a switch from self-recognition to high-affinity client binding. PMID:26787517

In-situ Geochronology on the Mars 2020 Rover with KArLE (The Potassium-Argon Laser Experiment)

NASA Technical Reports Server (NTRS)

Cohen, Barbara A.; Li, Z. -H.; Miller, J. S.; Devismes, D.; Swindle, T. D.; Schwenzer, S. P.; Kelley, S. P.; Zacny, K. A.; Roark, S. E.; Hardaway, L. R.;

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

Genetic Characterization of Escherichia coli Type 1 Pilus Adhesin Mutants and Identification of a Novel Binding Phenotype

PubMed Central

Hamrick, Terri S.; Harris, Sandra L.; Spears, Patricia A.; Havell, Edward A.; Horton, John R.; Russell, Perry W.; Orndorff, Paul E.

2000-01-01

Five Escherichia coli type 1 pilus mutants that had point mutations in fimH, the gene encoding the type 1 pilus adhesin FimH, were characterized. FimH is a minor component of type 1 pili that is required for the pili to bind and agglutinate guinea pig erythrocytes in a mannose-inhibitable manner. Point mutations were located by DNA sequencing and deletion mapping. All mutations mapped within the signal sequence or in the first 28% of the predicted mature protein. All mutations were missense mutations except for one, a frameshift lesion that was predicted to cause the loss of approximately 60% of the mature FimH protein. Bacterial agglutination tests with polyclonal antiserum raised to a LacZ-FimH fusion protein failed to confirm that parental amounts of FimH cross-reacting material were expressed in four of the five mutants. The remaining mutant, a temperature-sensitive (ts) fimH mutant that agglutinated guinea pig erythrocytes after growth at 31°C but not at 42°C, reacted with antiserum at both temperatures in a manner similar to the parent. Consequently, this mutant was chosen for further study. Temperature shift experiments revealed that new FimH biosynthesis was required for the phenotypic change. Guinea pig erythrocyte and mouse macrophage binding experiments using the ts mutant grown at the restrictive and permissive temperatures revealed that whereas erythrocyte binding was reduced to a level comparable to that of a fimH insertion mutant at the restrictive temperature, mouse peritoneal macrophages were bound with parental efficiency at both the permissive and restrictive temperatures. Also, macrophage binding by the ts mutant was insensitive to mannose inhibition after growth at 42°C but sensitive after growth at 31°C. The ts mutant thus binds macrophages with one receptor specificity at 31°C and another at 42°C. PMID:10869080

Neonicotinoid Binding, Toxicity and Expression of Nicotinic Acetylcholine Receptor Subunits in the Aphid Acyrthosiphon pisum

PubMed Central

Taillebois, Emiliane; Beloula, Abdelhamid; Quinchard, Sophie; Jaubert-Possamai, Stéphanie; Daguin, Antoine; Servent, Denis; Tagu, Denis

2014-01-01

Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI), thiamethoxam (TMX) and clothianidin (CLT). Binding studies on aphid membrane preparations revealed the existence of high and low-affinity binding sites for [3H]-IMI (Kd of 0.16±0.04 nM and 41.7±5.9 nM) and for the nicotinic antagonist [125I]-α-bungarotoxin (Kd of 0.008±0.002 nM and 1.135±0.213 nM). Competitive binding experiments demonstrated that TMX displayed a higher affinity than IMI for [125I]-α-bungarotoxin binding sites while CLT affinity was similar for both [125I]-α-bungarotoxin and [3H]-IMI binding sites. Interestingly, toxicological studies revealed that at 48 h, IMI (LC50 = 0.038 µg/ml) and TMX (LC50 = 0.034 µg/ml) were more toxic than CLT (LC50 = 0.118 µg/ml). The effect of TMX could be associated to its metabolite CLT as demonstrated by HPLC/MS analysis. In addition, we found that aphid larvae treated either with IMI, TMX or CLT showed a strong variation of nAChR subunit expression. Using semi-quantitative PCR experiments, we detected for all insecticides an increase of Apisumα10 and Apisumβ1 expressions levels, whereas Apisumβ2 expression decreased. Moreover, some other receptor subunits seemed to be differently regulated according to the insecticide used. Finally, we also demonstrated that nAChR subunit expression differed during pea aphid development. Altogether these results highlight species specificity that should be taken into account in pest management strategies. PMID:24801634

Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

PubMed

Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

2018-02-01

Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

Revealing of Saccharomyces cerevisiae yeast cell wall proteins capable of binding thioflavin T, a fluorescent dye specifically interacting with amyloid fibrils.

PubMed

Gorkovskii, A A; Bezsonov, E E; Plotnikova, T A; Kalebina, T S; Kulaev, I S

2009-11-01

Proteins binding thioflavin T leading to its specific fluorescence were discovered in a fraction of noncovalently bound Saccharomyces cerevisiae yeast cell wall mannoproteins. Thioflavin-binding proteins display high resistance to trypsin digestion in solution. These data are the first experimental evidence for the presence of proteins whose properties are characteristic of amyloids in yeast cell wall, except for data on glucanotransferase Bgl2p that has amyloid properties. Our data suggest the anchoring of these proteins in the cell wall by a trypsin-sensitive part of the protein molecule. Experiments with a mutant strain devoid of the BGL2 gene suggest the compensation of absent amyloid-like protein Bgl2p by increase in contents of thioflavin-binding proteins in the cell wall.

Energetics of Glutathione Binding to Human Eukaryotic Elongation Factor 1 Gamma: Isothermal Titration Calorimetry and Molecular Dynamics Studies.

PubMed

Tshabalala, Thabiso N; Tomescu, Mihai-Silviu; Prior, Allan; Balakrishnan, Vijayakumar; Sayed, Yasien; Dirr, Heini W; Achilonu, Ikechukwu

2016-12-01

The energetics of ligand binding to human eukaryotic elongation factor 1 gamma (heEF1γ) was investigated using reduced glutathione (GSH), oxidised glutathione (GSSG), glutathione sulfonate and S-hexylglutathione as ligands. The experiments were conducted using isothermal titration calorimetry, and the findings were supported using computational studies. The data show that the binding of these ligands to heEF1γ is enthalpically favourable and entropically driven (except for the binding of GSSG). The full length heEF1γ binds GSSG with lower affinity (K d  = 115 μM), with more hydrogen-bond contacts (ΔH = -73.8 kJ/mol) and unfavourable entropy (-TΔS = 51.7 kJ/mol) compared to the glutathione transferase-like N-terminus domain of heEF1γ, which did not show preference to any specific ligand. Computational free binding energy calculations from the 10 ligand poses show that GSSG and GSH consistently bind heEF1γ, and that both ligands bind at the same site with a folded bioactive conformation. This study reveals the possibility that heEF1γ is a glutathione-binding protein.

Selective binding of choline by a phosphate-coordination-based triple helicate featuring an aromatic box.

PubMed

Jia, Chuandong; Zuo, Wei; Yang, Dong; Chen, Yanming; Cao, Liping; Custelcean, Radu; Hostaš, Jiří; Hobza, Pavel; Glaser, Robert; Wang, Yao-Yu; Yang, Xiao-Juan; Wu, Biao

2017-10-16

In nature, proteins have evolved sophisticated cavities tailored for capturing target guests selectively among competitors of similar size, shape, and charge. The fundamental principles guiding the molecular recognition, such as self-assembly and complementarity, have inspired the development of biomimetic receptors. In the current work, we report a self-assembled triple anion helicate (host 2) featuring a cavity resembling that of the choline-binding protein ChoX, as revealed by crystal and density functional theory (DFT)-optimized structures, which binds choline in a unique dual-site-binding mode. This similarity in structure leads to a similarly high selectivity of host 2 for choline over its derivatives, as demonstrated by the NMR and fluorescence competition experiments. Furthermore, host 2 is able to act as a fluorescence displacement sensor for discriminating choline, acetylcholine, L-carnitine, and glycine betaine effectively.The choline-binding protein ChoX exhibits a synergistic dual-site binding mode that allows it to discriminate choline over structural analogues. Here, the authors design a biomimetic triple anion helicate receptor whose selectivity for choline arises from a similar binding mechanism.

Dynamic binding of visual features by neuronal/stimulus synchrony.

PubMed

Iwabuchi, A

1998-05-01

When people see a visual scene, certain parts of the visual scene are treated as belonging together and we regard them as a perceptual unit, which is called a "figure". People focus on figures, and the remaining parts of the scene are disregarded as "ground". In Gestalt psychology this process is called "figure-ground segregation". According to current perceptual psychology, a figure is formed by binding various visual features in a scene, and developments in neuroscience have revealed that there are many feature-encoding neurons, which respond to such features specifically. It is not known, however, how the brain binds different features of an object into a coherent visual object representation. Recently, the theory of binding by neuronal synchrony, which argues that feature binding is dynamically mediated by neuronal synchrony of feature-encoding neurons, has been proposed. This review article portrays the problem of figure-ground segregation and features binding, summarizes neurophysiological and psychophysical experiments and theory relevant to feature binding by neuronal/stimulus synchrony, and suggests possible directions for future research on this topic.

Hydration Changes upon DNA Folding Studied by Osmotic Stress Experiments

PubMed Central

Nakano, Shu-ichi; Yamaguchi, Daisuke; Tateishi-Karimata, Hisae; Miyoshi, Daisuke; Sugimoto, Naoki

2012-01-01

The thermal stability of nucleic acid structures is perturbed under the conditions that mimic the intracellular environment, typically rich in inert components and under osmotic stress. We now describe the thermodynamic stability of DNA oligonucleotide structures in the presence of high background concentrations of neutral cosolutes. Small cosolutes destabilize the basepair structures, and the DNA structures consisting of the same nearest-neighbor composition show similar thermodynamic parameters in the presence of various types of cosolutes. The osmotic stress experiments reveal that water binding to flexible loops, unstable mismatches, and an abasic site upon DNA folding are almost negligible, whereas the binding to stable mismatch pairs is significant. The studies using the basepair-mimic nucleosides and the peptide nucleic acid suggest that the sugar-phosphate backbone and the integrity of the basepair conformation make important contributions to the binding of water molecules to the DNA bases and helical grooves. The study of the DNA hydration provides the basis for understanding and predicting nucleic acid structures in nonaqueous solvent systems. PMID:22735531

Augmentor α and β (FAM150) are ligands of the receptor tyrosine kinases ALK and LTK: Hierarchy and specificity of ligand-receptor interactions.

PubMed

Reshetnyak, Andrey V; Murray, Phillip B; Shi, Xiarong; Mo, Elizabeth S; Mohanty, Jyotidarsini; Tome, Francisco; Bai, Hanwen; Gunel, Murat; Lax, Irit; Schlessinger, Joseph

2015-12-29

Receptor tyrosine kinases (RTKs) are a class of cell surface receptors that, upon ligand binding, stimulate a variety of critical cellular functions. The orphan receptor anaplastic lymphoma kinase (ALK) is one of very few RTKs that remain without a firmly established protein ligand. Here we present a novel cytokine, FAM150B, which we propose naming augmentor-α (AUG-α), as a ligand for ALK. AUG-α binds ALK with high affinity and activates ALK in cells with subnanomolar potency. Detailed binding experiments using cells expressing ALK or the related receptor leukocyte tyrosine kinase (LTK) demonstrate that AUG-α binds and robustly activates both ALK and LTK. We show that the previously established LTK ligand FAM150A (AUG-β) is specific for LTK and only weakly binds to ALK. Furthermore, expression of AUG-α stimulates transformation of NIH/3T3 cells expressing ALK, induces IL-3 independent growth of Ba/F3 cells expressing ALK, and is expressed in neuroblastoma, a cancer partly driven by ALK. These experiments reveal the hierarchy and specificity of two cytokines as ligands for ALK and LTK and set the stage for elucidating their roles in development and disease states.

Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

PubMed Central

Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

2015-01-01

The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

Hot-spot residues at the E9/Im9 interface help binding via different mechanisms.

PubMed

Wong, Sergio E; Baron, Riccardo; McCammon, J Andrew

2008-11-01

Protein-protein association involves many interface interactions, but they do not contribute equally. Ala scanning experiments reveal that only a few mutations significantly lower binding affinity. These key residues, which appear to drive protein-protein association, are called hot-spot residues. Molecular dynamics simulations of the Colicin E9/Im9 complex show Im9 Glu41 and Im9 Ser50, both hot-spots, bind via different mechanisms. The results suggest that Im9 Ser50 restricts Glu41 in a conformation auspicious for salt-bridge formation across the interface. This type of model may be helpful in engineering hot-spot clusters at protein-protein interfaces and, consequently, the design of specificity.

Theoretical and experimental study of organic nano-material for acetate anion based on 1, 10-phenanthroline.

PubMed

Shang, Xuefang; Zhao, Yuan; Wei, Xiaofang; Feng, Yaqian; Li, Xin; Gao, Shuyan; Xu, Xiufang

2015-01-01

New phenanthroline derivatives (1, 2, 3, 4) containing phenol groups have been synthesized and optimized. The nano-material of compound 2 was also developed. Their binding properties were evaluated for various biological anions (F(-), Cl(-), Br(-), I(-), AcO(-) and H(2)PO(4)(-)) by theoretical investigation, UV-vis, fluorescence, (1)HNMR titration experiments and these compounds all showed strong binding ability for AcO(-) without the interference of other anions tested. The anion binding ability could be regularized by electron push-pull properties of the ortho- or para- substituent on benzene. Theoretical investigation analysis revealed the effect of intramolecular hydrogen bond existed between -OH and other atoms in the structure of these compounds.

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Determinants of Ligand Subtype-Selectivity at α1A-Adrenoceptor Revealed Using Saturation Transfer Difference (STD) NMR.

PubMed

Yong, Kelvin J; Vaid, Tasneem M; Shilling, Patrick J; Wu, Feng-Jie; Williams, Lisa M; Deluigi, Mattia; Plückthun, Andreas; Bathgate, Ross A D; Gooley, Paul R; Scott, Daniel J

2018-04-20

α 1A - and α 1B -adrenoceptors (α 1A -AR and α 1B -AR) are closely related G protein-coupled receptors (GPCRs) that modulate the cardiovascular and nervous systems in response to binding epinephrine and norepinephrine. The GPCR gene superfamily is made up of numerous subfamilies that, like α 1A -AR and α 1B -AR, are activated by the same endogenous agonists but may modulate different physiological processes. A major challenge in GPCR research and drug discovery is determining how compounds interact with receptors at the molecular level, especially to assist in the optimization of drug leads. Nuclear magnetic resonance spectroscopy (NMR) can provide great insight into ligand-binding epitopes, modes, and kinetics. Ideally, ligand-based NMR methods require purified, well-behaved protein samples. The instability of GPCRs upon purification in detergents, however, makes the application of NMR to study ligand binding challenging. Here, stabilized α 1A -AR and α 1B -AR variants were engineered using Cellular High-throughput Encapsulation, Solubilization, and Screening (CHESS), allowing the analysis of ligand binding with Saturation Transfer Difference NMR (STD NMR). STD NMR was used to map the binding epitopes of epinephrine and A-61603 to both receptors, revealing the molecular determinants for the selectivity of A-61603 for α 1A -AR over α 1B -AR. The use of stabilized GPCRs for ligand-observed NMR experiments will lead to a deeper understanding of binding processes and assist structure-based drug design.

Dissection of structural and functional requirements that underlie the interaction of ERdj3 protein with substrates in the endoplasmic reticulum.

PubMed

Otero, Joel H; Lizák, Beata; Feige, Matthias J; Hendershot, Linda M

2014-10-03

ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Dissection of Structural and Functional Requirements That Underlie the Interaction of ERdj3 Protein with Substrates in the Endoplasmic Reticulum*

PubMed Central

Otero, Joel H.; Lizák, Beata; Feige, Matthias J.; Hendershot, Linda M.

2014-01-01

ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. PMID:25143379

Study on interaction of mangiferin to insulin and glucagon in ternary system

NASA Astrophysics Data System (ADS)

Lin, Hui; Chen, Rui; Liu, Xiaoyan; Sheng, Fenling; Zhang, Haixia

2010-05-01

The binding of mangiferin to insulin and glucagon was investigated in the presence and absence of another Peptide by optical spectroscopy. Fluorescence titration experiments revealed that mangiferin quenched the intrinsic fluorescence of insulin and glucagon by static quenching. The ratios of binding constants of glucagon-mangiferin to insulin-mangiferin at different temperatures were calculated in "pure" and ternary system, respectively. The results indicated that the Peptides were competitive with each other to act on mangiferin. Values of the thermodynamic parameters and the experiments of pH effect proved that the key interacting forces between mangiferin and the Peptides were hydrophobic interaction. In addition, UV-vis absorption, synchronous fluorescence and Fourier transform infrared measurements showed that the conformation of insulin and glucagon were changed after adding mangiferin.

Thermodynamic Effects of Noncoded and Coded Methionine Substitutions in Calmodulin

PubMed Central

Yamniuk, Aaron P.; Ishida, Hiroaki; Lippert, Dustin; Vogel, Hans J.

2009-01-01

The methionine residues in the calcium (Ca2+) regulatory protein calmodulin (CaM) are structurally and functionally important. They are buried within the N- and C-domains of apo-CaM but become solvent-exposed in Ca2+-CaM, where they interact with numerous target proteins. Previous structural studies have shown that methionine substitutions to the noncoded amino acids selenomethionine, ethionine, or norleucine, or mutation to leucine do not impact the main chain structure of CaM. Here we used differential scanning calorimetry to show that these substitutions enhance the stability of both domains, with the largest increase in melting temperature (19–26°C) achieved with leucine or norleucine in the apo-C-domain. Nuclear magnetic resonance spectroscopy experiments also revealed the loss of a slow conformational exchange process in the Leu-substituted apo-C-domain. In addition, isothermal titration calorimetry experiments revealed considerable changes in the enthalpy and entropy of target binding to apo-CaM and Ca2+-CaM, but the free energy of binding was largely unaffected due to enthalpy-entropy compensation. Collectively, these results demonstrate that noncoded and coded methionine substitutions can be accommodated in CaM because of the structural plasticity of the protein. However, adjustments in side-chain packing and dynamics lead to significant differences in protein stability and the thermodynamics of target binding. PMID:19217866

Cor a 14, the allergenic 2S albumin from hazelnut, is highly thermostable and resistant to gastrointestinal digestion

PubMed Central

Pfeifer, Sabine; Bublin, Merima; Dubiela, Pawel; Hummel, Karin; Wortmann, Judith; Hofer, Gerhard; Keller, Walter; Radauer, Christian

2015-01-01

Scope Allergens from nuts frequently induce severe allergic reactions in sensitive individuals. The aim of this study was to elucidate the physicochemical characteristics of natural Cor a 14, the 2S albumin from hazelnut. Methods and results Cor a 14 was purified from raw hazelnuts using a combination of precipitation and chromatographic techniques. The protein was analyzed using gel electrophoresis, MS, and far‐UV circular dichroism (CD) analyses. The immunoglobulin E (IgE) binding of native, heat‐treated, and in vitro digested Cor a 14 was studied. We identified two different Cor a 14 isoforms and showed microclipping at the C‐terminus. CD spectra at room temperature showed the typical characteristics of 2S albumins, and temperatures of more than 80°C were required to start unfolding of Cor a 14 demonstrating its high stability to heat treatment. In vitro digestion experiments revealed that Cor a 14 is resistant to proteolytic degradation. Native and heat‐treated protein was recognized by sera from hazelnut allergic patients. However, denaturation of the allergen led to significantly reduced IgE binding. Conclusion We identified two different isoforms of Cor a 14 displaying high stability under heating and gastric and duodenal conditions. Data from IgE‐binding experiments revealed the existence of both, linear and conformational epitopes. PMID:26178695

Progesterone receptor membrane component-1 (PGRMC1) is the mediator of progesterone's antiapoptotic action in spontaneously immortalized granulosa cells as revealed by PGRMC1 small interfering ribonucleic acid treatment and functional analysis of PGRMC1 mutations.

PubMed

Peluso, John J; Romak, Jonathan; Liu, Xiufang

2008-02-01

Progesterone (P4) receptor membrane component-1 (PGRMC1) and its binding partner, plasminogen activator inhibitor 1 RNA binding protein (PAIRBP1) are thought to form a complex that functions as membrane receptor for P4. The present investigations confirm PGRMC1's role in this membrane receptor complex by demonstrating that depleting PGMRC1 with PGRMC1 small interfering RNA results in a 60% decline in [(3)H]P4 binding and the loss of P4's antiapoptotic action. Studies conducted on partially purified GFP-PGRMC1 fusion protein indicate that [(3)H]P4 specifically binds to PGRMC1 at a single site with an apparent K(d) of about 35 nm. In addition, experiments using various deletion mutations reveal that the entire PGRMC1 molecule is required for maximal [(3)H]P4 binding and P4 responsiveness. Analysis of the binding data also suggests that the P4 binding site is within a segment of PGRMC1 that is composed of the transmembrane domain and the initial segment of the C terminus. Interestingly, PAIRBP1 appears to bind to the C terminus between amino acids 70-130, which is distal to the putative P4 binding site. Taken together, these data provide compelling evidence that PGRMC1 is the P4 binding protein that mediates P4's antiapoptotic action. Moreover, the deletion mutation studies indicate that each domain of PGRMC1 plays an essential role in modulating PGRMC1's capacity to both bind and respond to P4. Additional studies are required to more precisely delineate the role of each PGRMC1 domain in transducing P4's antiapoptotic action.

The MTA family proteins as novel histone H3 binding proteins.

PubMed

Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

2013-01-03

The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

The MTA family proteins as novel histone H3 binding proteins

PubMed Central

2013-01-01

Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

Using attribute amnesia to test the limits of hyper-binding and associative deficits in working memory.

PubMed

McCormick-Huhn, John M; Chen, Hui; Wyble, Bradley P; Dennis, Nancy A

2018-02-01

Previous work has shown mixed evidence regarding age-related deficits for binding in working memory. The current study used the newly developed attribute amnesia effect (H. Chen & Wyble, 2015a) to test the associative-deficit hypothesis during working memory and to probe whether hyper-binding extends to include binding of de-selected information. In studies of attribute amnesia, participants use target attributes (e.g., identity, color) to demonstrate near ceiling levels of reporting of a second target attribute (e.g., location) across a series of trials (H. Chen & Wyble, 2015a, 2016). Yet, despite having just processed the target-defining attribute, they have difficulty reporting it on a surprise trial. This effect provides several predictions for associative binding in aging. The associative-deficit hypothesis predicts age-related decline on the surprise trial, whereas an extension of hyper-binding predicts age-related increase in performance in older adults. In Experiment 1, when working memory load was low, older adults demonstrated attribute amnesia equal to that found in younger adults. When load increased in Experiment 2, older adults again demonstrated attribute amnesia as well as an age deficit for reporting target attributes. In lieu of spontaneous binding, results suggest that expectancy plays a critical role in older adults' propensity to encode and bind target attributes in working memory. Results further suggest that expectancy alone is not enough for older adults to form bound representations when task demands are high. Taken together results revealed a boundary condition of hyper-binding and further provided conditional support for the associative-deficit hypothesis in working memory. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Investigation of the binding of Salvianolic acid B to human serum albumin and the effect of metal ions on the binding

NASA Astrophysics Data System (ADS)

Chen, Tingting; Cao, Hui; Zhu, Shajun; Lu, Yapeng; Shang, Yanfang; Wang, Miao; Tang, Yanfeng; Zhu, Li

2011-10-01

The studies on the interaction between HSA and drugs have been an interesting research field in life science, chemistry and clinical medicine. There are also many metal ions present in blood plasma, thus the research about the effect of metal ions on the interaction between drugs and plasma proteins is crucial. In this study, the interaction of Salvianolic acid B (Sal B) with human serum albumin (HSA) was investigated by the steady-state, synchronous fluorescence and circular dichroism (CD) spectroscopies. The results showed that Sal B had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching mechanism. Binding parameters calculated showed that Sal B was bound to HSA with the binding affinities of 10 5 L mol -1. The thermodynamic parameters studies revealed that the binding was characterized by positive enthalpy and positive entropy changes, and hydrophobic interactions were the predominant intermolecular forces to stabilize the complex. The specific binding distance r (2.93 nm) between donor (HSA) and acceptor (Sal B) was obtained according to Förster non-radiative resonance energy transfer theory. The synchronous fluorescence experiment revealed that Sal B cannot lead to the microenvironmental changes around the Tyr and Trp residues of HSA, and the binding site of Sal B on HSA is located in hydrophobic cavity of subdomain IIA. The CD spectroscopy indicated the secondary structure of HSA is not changed in the presence of Sal B. Furthermore, The effect of metal ions (e.g. Zn 2+, Cu 2+, Co 2+, Ni 2+, Fe 3+) on the binding constant of Sal B-HSA complex was also discussed.

Non-Native Metal Ion Reveals the Role of Electrostatics in Synaptotagmin 1-Membrane Interactions.

PubMed

Katti, Sachin; Nyenhuis, Sarah B; Her, Bin; Srivastava, Atul K; Taylor, Alexander B; Hart, P John; Cafiso, David S; Igumenova, Tatyana I

2017-06-27

C2 domains are independently folded modules that often target their host proteins to anionic membranes in a Ca 2+ -dependent manner. In these cases, membrane association is triggered by Ca 2+ binding to the negatively charged loop region of the C2 domain. Here, we used a non-native metal ion, Cd 2+ , in lieu of Ca 2+ to gain insight into the contributions made by long-range Coulombic interactions and direct metal ion-lipid bridging to membrane binding. Using X-ray crystallography, NMR, Förster resonance energy transfer, and vesicle cosedimentation assays, we demonstrate that, although Cd 2+ binds to the loop region of C2A/B domains of synaptotagmin 1 with high affinity, long-range Coulombic interactions are too weak to support membrane binding of individual domains. We attribute this behavior to two factors: the stoichiometry of Cd 2+ binding to the loop regions of the C2A and C2B domains and the impaired ability of Cd 2+ to directly coordinate the lipids. In contrast, electron paramagnetic resonance experiments revealed that Cd 2+ does support membrane binding of the C2 domains in full-length synaptotagmin 1, where the high local lipid concentrations that result from membrane tethering can partially compensate for lack of a full complement of divalent metal ions and specific lipid coordination in Cd 2+ -complexed C2A/B domains. Our data suggest that long-range Coulombic interactions alone can drive the initial association of C2A/B with anionic membranes and that Ca 2+ further augments membrane binding by the formation of metal ion-lipid coordination bonds and additional Ca 2+ ion binding to the C2 domain loop regions.

NMR studies reveal the role of biomembranes in modulating ligand binding and release by intracellular bile acid binding proteins.

PubMed

Pedò, Massimo; Löhr, Frank; D'Onofrio, Mariapina; Assfalg, Michael; Dötsch, Volker; Molinari, Henriette

2009-12-18

Bile acid molecules are transferred vectorially between basolateral and apical membranes of hepatocytes and enterocytes in the context of the enterohepatic circulation, a process regulating whole body lipid homeostasis. This work addresses the role of the cytosolic lipid binding proteins in the intracellular transfer of bile acids between different membrane compartments. We present nuclear magnetic resonance (NMR) data describing the ternary system composed of the bile acid binding protein, bile acids, and membrane mimetic systems, such as anionic liposomes. This work provides evidence that the investigated liver bile acid binding protein undergoes association with the anionic membrane and binding-induced partial unfolding. The addition of the physiological ligand to the protein-liposome mixture is capable of modulating this interaction, shifting the equilibrium towards the free folded holo protein. An ensemble of NMR titration experiments, based on nitrogen-15 protein and ligand observation, confirm that the membrane and the ligand establish competing binding equilibria, modulating the cytoplasmic permeability of bile acids. These results support a mechanism of ligand binding and release controlled by the onset of a bile salt concentration gradient within the polarized cell. The location of a specific protein region interacting with liposomes is highlighted.

Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

PubMed

Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

2016-02-24

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

PubMed Central

Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

2009-01-01

Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

PubMed Central

Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

2003-01-01

Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

Parish apprenticeship and the old poor law in London1

PubMed Central

Levene, Alysa

2010-01-01

This article offers an examination of the patterns and motivations behind parish apprenticeship in late eighteenth- and early nineteenth-century London. It stresses continuity in outlook from parish officials binding children, which involved placements in both the traditional and industrializing sectors of the economy. Evidence on the ages, employment types, and locations of 3,285 pauper apprentices bound from different parts of London between 1767 and 1833 indicates a variety of local patterns. The analysis reveals a pattern of youthful age at binding, a range of employment experiences, and parish-specific links to particular trades and manufactures. PMID:20939134

Parish apprenticeship and the old poor law in London.

PubMed

Levene, Alysa

2010-01-01

This article offers an examination of the patterns and motivations behind parish apprenticeship in late eighteenth- and early nineteenth-century London. It stresses continuity in outlook from parish officials binding children, which involved placements in both the traditional and industrializing sectors of the economy. Evidence on the ages, employment types, and locations of 3,285 pauper apprentices bound from different parts of London between 1767 and 1833 indicates a variety of local patterns. The analysis reveals a pattern of youthful age at binding, a range of employment experiences, and parish-specific links to particular trades and manufactures.

A semisynthetic Atg3 reveals that acetylation promotes Atg3 membrane binding and Atg8 lipidation

NASA Astrophysics Data System (ADS)

Li, Yi-Tong; Yi, Cong; Chen, Chen-Chen; Lan, Huan; Pan, Man; Zhang, Shao-Jin; Huang, Yi-Chao; Guan, Chao-Jian; Li, Yi-Ming; Yu, Li; Liu, Lei

2017-03-01

Acetylation of Atg3 regulates the lipidation of the protein Atg8 in autophagy. The molecular mechanism behind this important biochemical event remains to be elucidated. We describe the first semi-synthesis of homogeneous K19/K48-diacetylated Atg3 through sequential hydrazide-based native chemical ligation. In vitro reconstitution experiments with the semi-synthetic proteins confirm that Atg3 acetylation can promote the lipidation of Atg8. We find that acetylation of Atg3 enhances its binding to phosphatidylethanolamine-containing liposomes and to endoplasmic reticulum, through which it promotes the lipidation process.

Tes, a specific Mena interacting partner, breaks the rules for EVH1 binding.

PubMed

Boëda, Batiste; Briggs, David C; Higgins, Theresa; Garvalov, Boyan K; Fadden, Andrew J; McDonald, Neil Q; Way, Michael

2007-12-28

The intracellular targeting of Ena/VASP family members is achieved via the interaction of their EVH1 domain with FPPPP sequence motifs found in a variety of cytoskeletal proteins, including lamellipodin, vinculin, and zyxin. Here we show that the LIM3 domain of Tes, which lacks the FPPPP motif, binds to the EVH1 domain of Mena, but not to those of VASP or Evl. The structure of the LIM3:EVH1 complex reveals that Tes occludes the FPPPP-binding site and competes with FPPPP-containing proteins for EVH1 binding. Structure-based gain-of-function experiments define the molecular basis for the specificity of the Tes-Mena interaction. Consistent with in vitro observations, the LIM3 domain displaces Mena, but not VASP, from the leading edge and focal adhesions. It also regulates cell migration through a Mena-dependent mechanism. Our observations identify Tes as an atypical EVH1 binding partner and a regulator specific to a single Ena/VASP family member.

Extended HSR/CARD domain mediates AIRE binding to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

Structures of human thymidylate synthase R163K with dUMP, FdUMP and glutathione show asymmetric ligand binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibson, Lydia M.; Celeste, Lesa R.; Lovelace, Leslie L.

Thymidylate synthase (TS) is a well validated target in cancer chemotherapy. Here, a new crystal form of the R163K variant of human TS (hTS) with five subunits per asymmetric part of the unit cell, all with loop 181-197 in the active conformation, is reported. This form allows binding studies by soaking crystals in artificial mother liquors containing ligands that bind in the active site. Using this approach, crystal structures of hTS complexes with FdUMP and dUMP were obtained, indicating that this form should facilitate high-throughput analysis of hTS complexes with drug candidates. Crystal soaking experiments using oxidized glutathione revealed thatmore » hTS binds this ligand. Interestingly, the two types of binding observed are both asymmetric. In one subunit of the physiological dimer covalent modification of the catalytic nucleophile Cys195 takes place, while in another dimer a noncovalent adduct with reduced glutathione is formed in one of the active sites.« less

Single-molecule fluorescence measurements reveal the reaction mechanisms of the core RISC, composed of human Argonaute 2 and a guide RNA.

PubMed

Jo, Myung Hyun; Song, Ji-Joon; Hohng, Sungchul

2015-12-01

In eukaryotes, small RNAs play important roles in both gene regulation and resistance to viral infection. Argonaute proteins have been identified as a key component of the effector complexes of various RNA-silencing pathways, but the mechanistic roles of Argonaute proteins in these pathways are not clearly understood. To address this question, we performed single-molecule fluorescence experiments using an RNA-induced silencing complex (core-RISC) composed of a small RNA and human Argonaute 2. We found that target binding of core-RISC starts at the seed region of the guide RNA. After target binding, four distinct reactions followed: target cleavage, transient binding, stable binding, and Argonaute unloading. Target cleavage required extensive sequence complementarity and accelerated core-RISC dissociation for recycling. In contrast, the stable binding of core-RISC to target RNAs required seed-match only, suggesting a potential explanation for the seed-match rule of microRNA (miRNA) target selection.

Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

PubMed Central

Kfoury, N.; Kapatos, G.

2009-01-01

CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

Mapping and analysis of Caenorhabditis elegans transcription factor sequence specificities

PubMed Central

Narasimhan, Kamesh; Lambert, Samuel A; Yang, Ally WH; Riddell, Jeremy; Mnaimneh, Sanie; Zheng, Hong; Albu, Mihai; Najafabadi, Hamed S; Reece-Hoyes, John S; Fuxman Bass, Juan I; Walhout, Albertha JM; Weirauch, Matthew T; Hughes, Timothy R

2015-01-01

Caenorhabditis elegans is a powerful model for studying gene regulation, as it has a compact genome and a wealth of genomic tools. However, identification of regulatory elements has been limited, as DNA-binding motifs are known for only 71 of the estimated 763 sequence-specific transcription factors (TFs). To address this problem, we performed protein binding microarray experiments on representatives of canonical TF families in C. elegans, obtaining motifs for 129 TFs. Additionally, we predict motifs for many TFs that have DNA-binding domains similar to those already characterized, increasing coverage of binding specificities to 292 C. elegans TFs (∼40%). These data highlight the diversification of binding motifs for the nuclear hormone receptor and C2H2 zinc finger families and reveal unexpected diversity of motifs for T-box and DM families. Motif enrichment in promoters of functionally related genes is consistent with known biology and also identifies putative regulatory roles for unstudied TFs. DOI: http://dx.doi.org/10.7554/eLife.06967.001 PMID:25905672

Mechanisms of Zn(II) binded to collagen and its effect on the capacity of eco-friendly Zn-Cr combination tanning system.

PubMed

Cao, Shan; Liu, Bing; Cheng, Baozhen; Lu, Fuping; Wang, Yanping; Li, Yu

2017-01-05

The eco-friendly combination tanning process has been developed to reduce chromium in existing researches, which is based on zinc tanning agents. This can be considered as a less-chrome substitute for current tanning process. To gain deeper understanding of the binding mechanisms of zinc-collagen interaction, which are affected by tanning pH, experiments have been carried out. Analysis in this paper reveals how chemical bonds from the collagen's main function groups combine with zinc. XPS and NIR data was analyzed for further understanding of where the zinc binding sites lie on collagen fibers at different pH. The results indicate that high pH is helpful to amino-binding sites while low pH promotes carboxyl-binding sites on collagen fibers. Furthermore, from the effect of Zinc-chrome combination tanning, we can see that the new method reduces the chromium dosage in tanning process compared to the conventional chrome tanning method. Copyright © 2016 Elsevier B.V. All rights reserved.

Differential binding of colors to objects in memory: red and yellow stick better than blue and green

PubMed Central

Kuhbandner, Christof; Spitzer, Bernhard; Lichtenfeld, Stephanie; Pekrun, Reinhard

2015-01-01

Both evolutionary considerations and recent research suggest that the color red serves as a signal indicating an object’s importance. However, until now, there is no evidence that this signaling function of red is also reflected in human memory. To examine the effect of red on memory, we conducted four experiments in which we presented objects colored in four different colors (red, green, blue, and yellow) and measured later memory for the presence of an object and for the color of an object. Across experiments, we varied the type of objects (words vs. pictures), task complexity (single objects vs. multiple objects in visual scenes), and intentionality of encoding (intentional vs. incidental learning). Memory for the presence of an object was not influenced by color. However, in all four experiments, memory for the color of an object depended on color type and was particularly high for red and yellow-colored objects and particularly low for green-colored objects, indicating that the binding of colors into object memory representations varies as a function of color type. Analyzing the observers’ confidence in their color memories revealed that color not only influenced objective memory performance but also subjective confidence. Subjective confidence judgments differentiated well between correct and incorrect color memories for red-colored objects, but poorly for green-colored objects. Our findings reveal a previously unknown color effect which may be of considerable interest for both basic color research and applied settings like eyewitness testimony in which memory for color features is relevant. Furthermore, our results indicate that feature binding in memory is not a uniform process by which any attended feature is automatically bound into unitary memory representations. Rather, memory binding seems to vary across different subtypes of features, a finding that supports recent research showing that object features are stored in memory rather independently from each other. PMID:25784892

Differential binding of colors to objects in memory: red and yellow stick better than blue and green.

PubMed

Kuhbandner, Christof; Spitzer, Bernhard; Lichtenfeld, Stephanie; Pekrun, Reinhard

2015-01-01

Both evolutionary considerations and recent research suggest that the color red serves as a signal indicating an object's importance. However, until now, there is no evidence that this signaling function of red is also reflected in human memory. To examine the effect of red on memory, we conducted four experiments in which we presented objects colored in four different colors (red, green, blue, and yellow) and measured later memory for the presence of an object and for the color of an object. Across experiments, we varied the type of objects (words vs. pictures), task complexity (single objects vs. multiple objects in visual scenes), and intentionality of encoding (intentional vs. incidental learning). Memory for the presence of an object was not influenced by color. However, in all four experiments, memory for the color of an object depended on color type and was particularly high for red and yellow-colored objects and particularly low for green-colored objects, indicating that the binding of colors into object memory representations varies as a function of color type. Analyzing the observers' confidence in their color memories revealed that color not only influenced objective memory performance but also subjective confidence. Subjective confidence judgments differentiated well between correct and incorrect color memories for red-colored objects, but poorly for green-colored objects. Our findings reveal a previously unknown color effect which may be of considerable interest for both basic color research and applied settings like eyewitness testimony in which memory for color features is relevant. Furthermore, our results indicate that feature binding in memory is not a uniform process by which any attended feature is automatically bound into unitary memory representations. Rather, memory binding seems to vary across different subtypes of features, a finding that supports recent research showing that object features are stored in memory rather independently from each other.

Quantum annealing versus classical machine learning applied to a simplified computational biology problem

PubMed Central

Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.

2018-01-01

Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to predict binding specificity. Using simplified datasets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified datasets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems. PMID:29652405

Characterization of substrate binding of the WW domains in human WWP2 protein.

PubMed

Jiang, Jiahong; Wang, Nan; Jiang, Yafei; Tan, Hongwei; Zheng, Jimin; Chen, Guangju; Jia, Zongchao

2015-07-08

WW domains harbor substrates containing proline-rich motifs, but the substrate specificity and binding mechanism remain elusive for those WW domains less amenable for structural studies, such as human WWP2 (hWWP2). Herein we have employed multiple techniques to investigate the second WW domain (WW2) in hWWP2. Our results show that hWWP2 is a specialized E3 for PPxY motif-containing substrates only and does not recognize other amino acids and phospho-residues. The strongest binding affinity of WW2, and the incompatibility between each WW domain, imply a novel relationship, and our SPR experiment reveals a dynamic binding mode in Class-I WW domains for the first time. The results from alanine-scanning mutagenesis and modeling further point to functionally conserved residues in WW2. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Selective binding of choline by a phosphate-coordination-based triple helicate featuring an aromatic box

DOE PAGES

Jia, Chuandong; Zuo, Wei; Yang, Dong; ...

2017-10-16

In nature, proteins have evolved sophisticated cavities tailored for capturing target guests selectively among competitors of similar size, shape, and charge. The fundamental principles guiding the molecular recognition, such as self-assembly and complementarity, have inspired the development of biomimetic receptors. In the current work, we report a self-assembled triple anion helicate (host 2) featuring a cavity resembling that of the choline-binding protein ChoX, as revealed by crystal and density functional theory (DFT)-optimized structures, which binds choline in a unique dual-site-binding mode. Here, this similarity in structure leads to a similarly high selectivity of host 2 for choline over its derivatives,more » as demonstrated by the NMR and fluorescence competition experiments. Furthermore, host 2 is able to act as a fluorescence displacement sensor for discriminating choline, acetylcholine, l-carnitine, and glycine betaine effectively.« less

Serial interactome capture of the human cell nucleus.

PubMed

Conrad, Thomas; Albrecht, Anne-Susann; de Melo Costa, Veronica Rodrigues; Sauer, Sascha; Meierhofer, David; Ørom, Ulf Andersson

2016-04-04

Novel RNA-guided cellular functions are paralleled by an increasing number of RNA-binding proteins (RBPs). Here we present 'serial RNA interactome capture' (serIC), a multiple purification procedure of ultraviolet-crosslinked poly(A)-RNA-protein complexes that enables global RBP detection with high specificity. We apply serIC to the nuclei of proliferating K562 cells to obtain the first human nuclear RNA interactome. The domain composition of the 382 identified nuclear RBPs markedly differs from previous IC experiments, including few factors without known RNA-binding domains that are in good agreement with computationally predicted RNA binding. serIC extends the number of DNA-RNA-binding proteins (DRBPs), and reveals a network of RBPs involved in p53 signalling and double-strand break repair. serIC is an effective tool to couple global RBP capture with additional selection or labelling steps for specific detection of highly purified RBPs.

Spatial and identity negative priming in audition: evidence of feature binding in auditory spatial memory.

PubMed

Mayr, Susanne; Buchner, Axel; Möller, Malte; Hauke, Robert

2011-08-01

Two experiments are reported with identical auditory stimulation in three-dimensional space but with different instructions. Participants localized a cued sound (Experiment 1) or identified a sound at a cued location (Experiment 2). A distractor sound at another location had to be ignored. The prime distractor and the probe target sound were manipulated with respect to sound identity (repeated vs. changed) and location (repeated vs. changed). The localization task revealed a symmetric pattern of partial repetition costs: Participants were impaired on trials with identity-location mismatches between the prime distractor and probe target-that is, when either the sound was repeated but not the location or vice versa. The identification task revealed an asymmetric pattern of partial repetition costs: Responding was slowed down when the prime distractor sound was repeated as the probe target, but at another location; identity changes at the same location were not impaired. Additionally, there was evidence of retrieval of incompatible prime responses in the identification task. It is concluded that feature binding of auditory prime distractor information takes place regardless of whether the task is to identify or locate a sound. Instructions determine the kind of identity-location mismatch that is detected. Identity information predominates over location information in auditory memory.

Carbachol dimers as homobivalent modulators of muscarinic receptors.

PubMed

Matucci, Rosanna; Nesi, Marta; Martino, Maria Vittoria; Bellucci, Cristina; Manetti, Dina; Ciuti, Elisa; Mazzolari, Angelica; Dei, Silvia; Guandalini, Luca; Teodori, Elisabetta; Vistoli, Giulio; Romanelli, Maria Novella

2016-05-15

A series of homodimers of the well-known cholinergic agonist carbachol have been synthesized, showing the two agonist units symmetrically connected through a methylene chain of variable length. The new compounds have been tested on the five cloned muscarinic receptors (hM1-5) expressed in CHO cells by means of equilibrium binding studies, showing an increase in affinity by rising the number of methylene units up to 7 and 9. Functional experiments on guinea-pig ileum and assessment of ERK1/2 phosphorylation on hM1, hM2 and hM3 on CHO cells have shown that the new compounds are endowed with muscarinic antagonistic properties. Kinetic binding studies have revealed that some of the tested compounds are able to slow the rate of dissociation of NMS, suggesting a bitopic behavior. Docking simulations, performed on the hM1 and hM2 receptors, give a sound rationalization of the experimental data revealing how these compounds are able to interact with both orthosteric and allosteric binding sites depending on the length of their connecting chain. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

A lipid-binding loop of botulinum neurotoxin serotypes B, DC and G is an essential feature to confer their exquisite potency

PubMed Central

Le Blanc, Alexander; Mahrhold, Stefan; Piesker, Janett; Luppa, Peter B.

2018-01-01

The exceptional toxicity of botulinum neurotoxins (BoNTs) is mediated by high avidity binding to complex polysialogangliosides and intraluminal segments of synaptic vesicle proteins embedded in the presynaptic membrane. One peculiarity is an exposed hydrophobic loop in the toxin’s cell binding domain HC, which is located between the ganglioside- and protein receptor-binding sites, and that is particularly pronounced in the serotypes BoNT/B, DC, and G sharing synaptotagmin as protein receptor. Here, we provide evidence that this HC loop is a critical component of their tripartite receptor recognition complex. Binding to nanodisc-embedded receptors and toxicity were virtually abolished in BoNT mutants lacking residues at the tip of the HC loop. Surface plasmon resonance experiments revealed that only insertion of the HC loop into the lipid-bilayer compensates for the entropic penalty inflicted by the dual-receptor binding. Our results represent a new paradigm of how BoNT/B, DC, and G employ ternary interactions with a protein, ganglioside, and lipids to mediate their extraordinary neurotoxicity. PMID:29718991

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Image Restoration and Analysis of Influenza Virions Binding to Membrane Receptors Reveal Adhesion-Strengthening Kinetics

PubMed Central

Lee, Donald W.; Hsu, Hung-Lun; Bacon, Kaitlyn B.; Daniel, Susan

2016-01-01

With the development of single-particle tracking (SPT) microscopy and host membrane mimics called supported lipid bilayers (SLBs), stochastic virus-membrane binding interactions can be studied in depth while maintaining control over host receptor type and concentration. However, several experimental design challenges and quantitative image analysis limitations prevent the widespread use of this approach. One main challenge of SPT studies is the low signal-to-noise ratio of SPT videos, which is sometimes inevitable due to small particle sizes, low quantum yield of fluorescent dyes, and photobleaching. These situations could render current particle tracking software to yield biased binding kinetic data caused by intermittent tracking error. Hence, we developed an effective image restoration algorithm for SPT applications called STAWASP that reveals particles with a signal-to-noise ratio of 2.2 while preserving particle features. We tested our improvements to the SPT binding assay experiment and imaging procedures by monitoring X31 influenza virus binding to α2,3 sialic acid glycolipids. Our interests lie in how slight changes to the peripheral oligosaccharide structures can affect the binding rate and residence times of viruses. We were able to detect viruses binding weakly to a glycolipid called GM3, which was undetected via assays such as surface plasmon resonance. The binding rate was around 28 folds higher when the virus bound to a different glycolipid called GD1a, which has a sialic acid group extending further away from the bilayer surface than GM3. The improved imaging allowed us to obtain binding residence time distributions that reflect an adhesion-strengthening mechanism via multivalent bonds. We empirically fitted these distributions using a time-dependent unbinding rate parameter, koff, which diverges from standard treatment of koff as a constant. We further explain how to convert these models to fit ensemble-averaged binding data obtained by assays such as surface plasmon resonance. PMID:27695072

PilN binding modulates the structure and binding partners of the Pseudomonas aeruginosa type IVa pilus protein PilM

DOE PAGES

McCallum, Matthew; Tammam, Stephanie; Little, Dustin J.; ...

2016-03-28

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that expresses type IVa pili. The pilus assembly system, which promotes surface-associated twitching motility and virulence, is composed of inner and outer membrane subcomplexes, connected by an alignment subcomplex composed of PilMNOP. PilM binds to the N terminus of PilN, and we hypothesize that this interaction causes functionally significant structural changes in PilM. To characterize this interaction, we determined the crystal structures of PilM and a PilM chimera where PilM was fused to the first 12 residues of PilN (PilM·PilN(1–12)). Structural analysis, multiangle light scattering coupled with size exclusion chromatography, and bacterial two-hybridmore » data revealed that PilM forms dimers mediated by the binding of a novel conserved motif in the N terminus of PilM, and binding PilN abrogates this binding interface, resulting in PilM monomerization. Structural comparison of PilM with PilM·PilN(1–12) revealed that upon PilN binding, there is a large domain closure in PilM that alters its ATP binding site. Using biolayer interferometry, we found that the association rate of PilN with PilM is higher in the presence of ATP compared with ADP. Bacterial two-hybrid data suggested the connectivity of the cytoplasmic and inner membrane components of the type IVa pilus machinery in P. aeruginosa, with PilM binding to PilB, PilT, and PilC in addition to PilN. Pull-down experiments demonstrated direct interactions of PilM with PilB and PilT. As a result, we propose a working model in which dynamic binding of PilN facilitates functionally relevant structural changes in PilM.« less

Interactions of the Metalloregulatory Protein SloR from Streptococcus mutans with Its Metal Ion Effectors and DNA Binding Site

PubMed Central

Corbett, John; Cornacchione, Louis; Daly, William; Galan, Diego; Wysota, Michael; Tivnan, Patrick; Collins, Justin; Nye, Dillon; Levitz, Talya; Breyer, Wendy A.; Glasfeld, Arthur

2015-01-01

ABSTRACT Streptococcus mutans is the causative agent of dental caries, a significant concern for human health, and therefore an attractive target for therapeutics development. Previous work in our laboratory has identified a homodimeric, manganese-dependent repressor protein, SloR, as an important regulator of cariogenesis and has used site-directed mutagenesis to map functions to specific regions of the protein. Here we extend those studies to better understand the structural interaction between SloR and its operator and its effector metal ions. The results of DNase I assays indicate that SloR protects a 42-bp region of DNA that overlaps the sloABC promoter on the S. mutans UA159 chromosome, while electrophoretic mobility shift and solution binding assays indicate that each of two SloR dimers binds to this region. Real-time semiquantitative reverse transcriptase PCR (real-time semi-qRT-PCR) experiments were used to determine the individual base pairs that contribute to SloR-DNA binding specificity. Solution studies indicate that Mn2+ is better than Zn2+ at specifically activating SloR to bind DNA, and yet the 2.8-Å resolved crystal structure of SloR bound to Zn2+ provides insight into the means by which selective activation by Mn2+ may be achieved and into how SloR may form specific interactions with its operator. Taken together, these experimental observations are significant because they can inform rational drug design aimed at alleviating and/or preventing S. mutans-induced caries formation. IMPORTANCE This report focuses on investigating the SloR protein as a regulator of essential metal ion transport and virulence gene expression in the oral pathogen Streptococcus mutans and on revealing the details of SloR binding to its metal ion effectors and binding to DNA that together facilitate this expression. We used molecular and biochemical approaches to characterize the interaction of SloR with Mn2+ and with its SloR recognition element to gain a clearer picture of the regulatory networks that optimize SloR-mediated metal ion homeostasis and virulence gene expression in S. mutans. These experiments can have a significant impact on caries treatment and/or prevention by revealing the S. mutans SloR-DNA binding interface as an appropriate target for the development of novel therapeutic interventions. PMID:26350131

Structure of the Nucleoprotein Binding Domain of Mokola Virus Phosphoprotein▿

PubMed Central

Assenberg, René; Delmas, Olivier; Ren, Jingshan; Vidalain, Pierre-Olivier; Verma, Anil; Larrous, Florence; Graham, Stephen C.; Tangy, Frédéric; Grimes, Jonathan M.; Bourhy, Hervé

2010-01-01

Mokola virus (MOKV) is a nonsegmented, negative-sense RNA virus that belongs to the Lyssavirus genus and Rhabdoviridae family. MOKV phosphoprotein P is an essential component of the replication and transcription complex and acts as a cofactor for the viral RNA-dependent RNA polymerase. P recruits the viral polymerase to the nucleoprotein-bound viral RNA (N-RNA) via an interaction between its C-terminal domain and the N-RNA complex. Here we present a structure for this domain of MOKV P, obtained by expression of full-length P in Escherichia coli, which was subsequently truncated during crystallization. The structure has a high degree of homology with P of rabies virus, another member of Lyssavirus genus, and to a lesser degree with P of vesicular stomatitis virus (VSV), a member of the related Vesiculovirus genus. In addition, analysis of the crystal packing of this domain reveals a potential binding site for the nucleoprotein N. Using both site-directed mutagenesis and yeast two-hybrid experiments to measure P-N interaction, we have determined the relative roles of key amino acids involved in this interaction to map the region of P that binds N. This analysis also reveals a structural relationship between the N-RNA binding domain of the P proteins of the Rhabdoviridae and the Paramyxoviridae. PMID:19906936

Mechanistic Insights into the Allosteric Modulation of Opioid Receptors by Sodium Ions

PubMed Central

2015-01-01

The idea of sodium ions altering G-protein-coupled receptor (GPCR) ligand binding and signaling was first suggested for opioid receptors (ORs) in the 1970s and subsequently extended to other GPCRs. Recently published ultra-high-resolution crystal structures of GPCRs, including that of the δ-OR subtype, have started to shed light on the mechanism underlying sodium control in GPCR signaling by revealing details of the sodium binding site. Whether sodium accesses different receptor subtypes from the extra- or intracellular sides, following similar or different pathways, is still an open question. Earlier experiments in brain homogenates suggested a differential sodium regulation of ligand binding to the three major OR subtypes, in spite of their high degree of sequence similarity. Intrigued by this possibility, we explored the dynamic nature of sodium binding to δ-OR, μ-OR, and κ-OR by means of microsecond-scale, all-atom molecular dynamics (MD) simulations. Rapid sodium permeation was observed exclusively from the extracellular milieu, and following similar binding pathways in all three ligand-free OR systems, notwithstanding extra densities of sodium observed near nonconserved residues of κ-OR and δ-OR, but not in μ-OR. We speculate that these differences may be responsible for the differential increase in antagonist binding affinity of μ-OR by sodium resulting from specific ligand binding experiments in transfected cells. On the other hand, sodium reduced the level of binding of subtype-specific agonists to all OR subtypes. Additional biased and unbiased MD simulations were conducted using the δ-OR ultra-high-resolution crystal structure as a model system to provide a mechanistic explanation for this experimental observation. PMID:25073009

Mechanistic insights into the allosteric modulation of opioid receptors by sodium ions.

PubMed

Shang, Yi; LeRouzic, Valerie; Schneider, Sebastian; Bisignano, Paola; Pasternak, Gavril W; Filizola, Marta

2014-08-12

The idea of sodium ions altering G-protein-coupled receptor (GPCR) ligand binding and signaling was first suggested for opioid receptors (ORs) in the 1970s and subsequently extended to other GPCRs. Recently published ultra-high-resolution crystal structures of GPCRs, including that of the δ-OR subtype, have started to shed light on the mechanism underlying sodium control in GPCR signaling by revealing details of the sodium binding site. Whether sodium accesses different receptor subtypes from the extra- or intracellular sides, following similar or different pathways, is still an open question. Earlier experiments in brain homogenates suggested a differential sodium regulation of ligand binding to the three major OR subtypes, in spite of their high degree of sequence similarity. Intrigued by this possibility, we explored the dynamic nature of sodium binding to δ-OR, μ-OR, and κ-OR by means of microsecond-scale, all-atom molecular dynamics (MD) simulations. Rapid sodium permeation was observed exclusively from the extracellular milieu, and following similar binding pathways in all three ligand-free OR systems, notwithstanding extra densities of sodium observed near nonconserved residues of κ-OR and δ-OR, but not in μ-OR. We speculate that these differences may be responsible for the differential increase in antagonist binding affinity of μ-OR by sodium resulting from specific ligand binding experiments in transfected cells. On the other hand, sodium reduced the level of binding of subtype-specific agonists to all OR subtypes. Additional biased and unbiased MD simulations were conducted using the δ-OR ultra-high-resolution crystal structure as a model system to provide a mechanistic explanation for this experimental observation.

The Actin Nucleator Cobl Is Controlled by Calcium and Calmodulin

PubMed Central

Haag, Natja; Kessels, Michael M.; Qualmann, Britta

2015-01-01

Actin nucleation triggers the formation of new actin filaments and has the power to shape cells but requires tight control in order to bring about proper morphologies. The regulation of the members of the novel class of WASP Homology 2 (WH2) domain-based actin nucleators, however, thus far has largely remained elusive. Our study reveals signal cascades and mechanisms regulating Cordon-Bleu (Cobl). Cobl plays some, albeit not fully understood, role in early arborization of neurons and nucleates actin by a mechanism that requires a combination of all three of its actin monomer–binding WH2 domains. Our experiments reveal that Cobl is regulated by Ca2+ and multiple, direct associations of the Ca2+ sensor Calmodulin (CaM). Overexpression analyses and rescue experiments of Cobl loss-of-function phenotypes with Cobl mutants in primary neurons and in tissue slices demonstrated the importance of CaM binding for Cobl’s functions. Cobl-induced dendritic branch initiation was preceded by Ca2+ signals and coincided with local F-actin and CaM accumulations. CaM inhibitor studies showed that Cobl-mediated branching is strictly dependent on CaM activity. Mechanistic studies revealed that Ca2+/CaM modulates Cobl’s actin binding properties and furthermore promotes Cobl’s previously identified interactions with the membrane-shaping F-BAR protein syndapin I, which accumulated with Cobl at nascent dendritic protrusion sites. The findings of our study demonstrate a direct regulation of an actin nucleator by Ca2+/CaM and reveal that the Ca2+/CaM-controlled molecular mechanisms we discovered are crucial for Cobl’s cellular functions. By unveiling the means of Cobl regulation and the mechanisms, by which Ca2+/CaM signals directly converge on a cellular effector promoting actin filament formation, our work furthermore sheds light on how local Ca2+ signals steer and power branch initiation during early arborization of nerve cells—a key process in neuronal network formation. PMID:26334624

Water-soluble Manganese and Iron Mesotetrakis(carboxyl)porphyrin: DNA Binding, Oxidative Cleavage, and Cytotoxic Activities.

PubMed

Shi, Lei; Jiang, Yi-Yu; Jiang, Tao; Yin, Wei; Yang, Jian-Ping; Cao, Man-Li; Fang, Yu-Qi; Liu, Hai-Yang

2017-06-29

Two new water-soluble metal carboxyl porphyrins, manganese (III) meso -tetrakis (carboxyl) porphyrin and iron (III) meso -tetrakis (carboxyl) porphyrin, were synthesized and characterized. Their interactions with ct-DNA were investigated by UV-Vis titration, fluorescence spectra, viscosity measurement and CD spectra. The results showed they can strongly bind to ct-DNA via outside binding mode. Electrophoresis experiments revealed that both complexes can cleave pBR322 DNA efficiently in the presence of hydrogen peroxide, albeit 2-Mn exhibited a little higher efficiency. The inhibitor tests suggest the oxidative DNA cleavage by these two complexes may involve hydroxyl radical active intermediates. Notably, 2-Mn exhibited considerable photocytotoxicity against Hep G2 cell via triggering a significant generation of ROS and causing disruption of MMP after irradiation.

Characterization of the binding of 2-mercaptobenzimidazole to bovine serum albumin.

PubMed

Teng, Yue; Zou, Luyi; Huang, Ming; Zong, Wansong

2015-04-01

2-Mercaptobenzimidazole (MBI) is widely utilized as a corrosion inhibitor, copper-plating brightener and rubber accelerator. The residue of MBI in the environment is potentially harmful to human health. In this article, the interaction of MBI with bovine serum albumin (BSA) was explored using spectroscopic and molecular docking methods under physiological conditions. The positively charged MBI can spontaneously bind with the negatively charged BSA through electrostatic forces with one binding site. The site marker competition experiments and the molecular docking study revealed that MBI bound into site II (subdomain IIIA) of BSA, which further led to some secondary structure and microenvironmental changes of BSA. This work provides useful information on understanding the toxicological actions of MBI at the molecular level. Copyright © 2015 John Wiley & Sons, Ltd.

The Liverwort Contains a Lectin That Is Structurally and Evolutionary Related to the Monocot Mannose-Binding Lectins1

PubMed Central

Peumans, Willy J.; Barre, Annick; Bras, Julien; Rougé, Pierre; Proost, Paul; Van Damme, Els J.M.

2002-01-01

A mannose (Man)-binding lectin has been isolated and characterized from the thallus of the liverwort Marchantia polymorpha. N-terminal sequencing indicated that the M. polymorpha agglutinin (Marpola) shares sequence similarity with the superfamily of monocot Man-binding lectins. Searches in the databases yielded expressed sequence tags encoding Marpola. Sequence analysis, molecular modeling, and docking experiments revealed striking structural similarities between Marpola and the monocot Man-binding lectins. Activity and specificity studies further indicated that Marpola is a much stronger agglutinin than the Galanthus nivalis agglutinin and exhibits a preference for methylated Man and glucose, which is unprecedented within the family of monocot Man-binding lectins. The discovery of Marpola allows us, for the first time, to corroborate the evolutionary relationship between a lectin from a lower plant and a well-established lectin family from flowering plants. In addition, the identification of Marpola sheds a new light on the molecular evolution of the superfamily of monocot Man-binding lectins. Beside evolutionary considerations, the occurrence of a G. nivalis agglutinin homolog in a lower plant necessitates the rethinking of the physiological role of the whole family of monocot Man-binding lectins. PMID:12114560

Investigation of the complex structure, comparative DNA-binding and DNA cleavage of two water-soluble mono-nuclear lanthanum(III) complexes and cytotoxic activity of chitosan-coated magnetic nanoparticles as drug delivery for the complexes

NASA Astrophysics Data System (ADS)

Asadi, Zahra; Nasrollahi, Neda; Karbalaei-Heidari, Hamidreza; Eigner, Vaclav; Dusek, Michal; Mobaraki, Nabiallah; Pournejati, Roya

2017-05-01

Two water-soluble mono-nuclear macrocyclic lanthanum(III) complexes of 2,6-diformyl-4-methylphenol with 1,3-diamino-2-propanol (C1) or 1,3-propylenediamine (C2) were synthesized and characterized by UV-Vis, FT-IR, 13C and 1H NMR spectroscopy and elemental analysis. C1 complex was structurally characterized by single-crystal X-ray diffraction, which revealed that the complex was mononuclear and ten-coordinated. The coordination sites around lanthanum(III) were occupied with a five-dentate ligand, two bidentate nitrates, and one water molecule. The interaction of complexes with DNA was studied in buffered aqueous solution at pH 7.4. UV-Vis absorption spectroscopy, emission spectroscopy, circular dichroism (CD) and viscometric measurements provided clear evidence of the intercalation mechanism of binding. The obtained intrinsic binding constants (Kb) 9.3 × 103 and 1.2 × 103 M- 1 for C1 and C2, respectively confirmed that C1 is better intercalator than C2. The DNA docking studies suggested that the complexes bind with DNA in a groove binding mode with the binding affinity of C1 > C2. Moreover, agarose gel electrophoresis study of the DNA-complex for both compounds revealed that the C1 intercalation cause ethidium bromide replacement in a competitive manner which confirms the suggested mechanism of binding. Finally, the anticancer experiments for the treated cancerous cell lines with both synthesized compounds show that these hydrophilic molecules need a suitable carrier to pass through the hydrophobic nature of cell membrane efficiently.

Dopaminergic receptor-ligand binding assays based on molecularly imprinted polymers on quartz crystal microbalance sensors.

PubMed

Naklua, Wanpen; Suedee, Roongnapa; Lieberzeit, Peter A

2016-07-15

Molecularly imprinted polymers (MIPs) have been successfully applied as selective materials for assessing the binding activity of agonist and antagonist of dopamine D1 receptor (D1R) by using quartz crystal microbalance (QCM). In this study, D1R derived from rat hypothalamus was used as a template and thus self-organized on stamps. Those were pressed into an oligomer film consisting of acrylic acid: N-vinylpyrrolidone: N,N'-(1,2-dihydroxyethylene) bis-acrylamide in a ratio of 2:3:12 spin coated onto a dual electrode QCM. Such we obtained one D1R-MIP-QCM electrode, whereas the other electrode carried the non-imprinted control polymer (NIP) that had remained untreated. Successful imprinting of D1R was confirmed by AFM. The polymer can re-incorporate D1R leading to frequency responses of 100-1200Hz in a concentration range of 5.9-47.2µM. In a further step such frequency changes proved inherently useful for examining the binding properties of test ligands to D1R. The resulting mass-sensitive measurements revealed Kd of dopamine∙HCl, haloperidol, and (+)-SCH23390 at 0.874, 25.6, and 0.004nM, respectively. These results correlate well with the values determined in radio ligand binding assays. Our experiments revealed that D1R-MIP sensors are useful for estimating the strength of ligand binding to the active single site. Therefore, we have developed a biomimetic surface imprinting strategy for QCM studies of D1R-ligand binding and presented a new method to ligand binding assay for D1R. Copyright © 2016 Elsevier B.V. All rights reserved.

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE PAGES

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.; ...

2017-11-30

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

Photoaffinity Labeling Studies on a Promoter of Dendritic Spine Formation

NASA Astrophysics Data System (ADS)

Sibucao, Kevin Carlo Abril

The small molecule BTA-EG4 has been shown to be a promoter of dendritic spine formation. The mechanism behind this phenomenon, however, is not well understood. The work in this dissertation is motivated by this gap in knowledge. The first part of this dissertation focuses on photoaffinity labeling studies to identify the cellular targets of BTA-EG4. Chapter 1 provides a summary of Alzheimer's disease, the rational design of BTA-EG 4, and methods to determine targets of small molecules. In Chapter 2, the synthesis of a BTA-EG4-based photoaffinity labeling probe and photodegradation studies are presented. Kinetic studies demonstrate that the probe photolyzes rapidly under UV light. In Chapter 3, photoaffinity labeling studies and subsequent protein identification experiments are reported. Competition experiments with the photoaffinity labeling probe and BTA-EG4 demonstrate that the probe labels a 55-kDa protein specifically. Tandem mass spectrometry revealed that the 55-kDa protein is the actin binding protein fascin 1. The second part of this dissertation focuses on the major protein identified from photoaffinity labeling studies, fascin 1. Chapter 4 provides a brief survey of the structure and function of fascin 1. In Chapter 5, characterizations of the interaction between BTA-EG4 and fascin 1 are reported. Isothermal titration calorimetry confirms the physical binding between fascin 1 and BTA-EG6, a BTA-EG4 analog. Slow speed sedimentation assays reveal that BTA-EG4 does not affect the actin-bundling activity of fascin 1. However, GST pull-down experiments show that BTA-EG4 inhibits the binding of fascin 1 with the GTPase Rab35. In addition, this work demonstrates that BTA-EG4 may be mechanistically distinct from the known fascin inhibitor G2.

Investigating the interaction of anticancer drug temsirolimus with human transferrin: Molecular docking and spectroscopic approach.

PubMed

Shamsi, Anas; Ahmed, Azaj; Khan, Mohd Shahnawaz; Husain, Fohad Mabood; Amani, Samreen; Bano, Bilqees

2018-05-16

In our present study, binding between an important anti renal cancer drug temsirolimus and human transferrin (hTF) was investigated employing spectroscopic and molecular docking approach. In the presence of temsirolimus, hyper chromaticity is observed in hTF in UV spectroscopy suggestive of complex formation between hTF and temsirolimus. Fluorescence spectroscopy revealed the occurrence of quenching in hTF in the presence of temsirolimus implying complex formation taking place between hTF and temsirolimus. Further, the mode of interaction between hTF and temsirolimus was revealed to be static by fluorescence quenching analysis at 3 different temperatures. Binding constant values obtained employing fluorescence spectroscopy depicts strong interaction between hTF and temsirolimus; temsirolimus binds to hTF at 298 K with a binding constant of .32 × 10 4  M -1 implying the strength of this interaction. The negative Gibbs free energy obtained through quenching experiments is evident of the fact that the binding is spontaneous. CD spectra of hTF also showed a downward shift in the presence of temsirolimus as compared with free hTF implying complex formation between hTF and temsirolimus. Molecular docking was performed with a view to find out which residues are key players in this interaction. The importance of our study stems from the fact it will provide an insight into binding pattern of commonly administered renal cancer drug with an important protein that plays a pivotal role in many physiological processes. Copyright © 2018 John Wiley & Sons, Ltd.

(15)N and (13)C group-selective techniques extend the scope of STD NMR detection of weak host-guest interactions and ligand screening.

PubMed

Kövér, Katalin E; Wéber, Edit; Martinek, Tamás A; Monostori, Eva; Batta, Gyula

2010-10-18

Saturation transfer difference (STD) is a valuable tool for studying the binding of small molecules to large biomolecules and for obtaining detailed information on the binding epitopes. Here, we demonstrate that the proposed (15)N/(13)C variants of group-selective, "GS-STD" experiments provide a powerful approach to mapping the binding epitope of a ligand even in the absence of efficient spin diffusion within the target protein. Therefore, these experimental variants broaden the scope of STD studies to smaller and/or more-dynamic targets. The STD spectra obtained in four different experimental setups (selective (1)H STD, (15)N GS-STD, (13)C(Ar) and (13)C(aliphatic) GS-STD approaches) revealed that the signal-intensity pattern of the difference spectra is affected by both the type and the spatial distribution of the excited "transmitter" atoms, as well as by the efficiency of the spin-diffusion-mediated magnetization transfer. The performance of the experiments is demonstrated on a system by using the lectin, galectin-1 and its carbohydrate ligand, lactose.

Camouflaging endothelial cells: does it prolong graft survival?

PubMed

Stuhlmeier, K M; Lin, Y

1999-08-05

Camouflaging antigens on the surface of cells seems an appealing way to prevent activation of the immune system. We explored the possibility of preventing hyperacute rejection by chemically camouflaging endothelial cells (EC). In vitro as well as in vivo experiments were performed. First, the ability of mPEG coating to prevent antibody-antigen interactions was evaluated. Second, we tested the degree to which mPEG coating prevents activation of EC by stimuli such as TNF-alpha and LPS. Third, in vivo experiments were performed to test the ability of mPEG coating to prolong xenograft survival. We demonstrate that binding of several antibodies to EC or serum proteins can be inhibited by mPEG. Furthermore, binding of TNF-alpha as well as LPS to EC is blocked since mPEG treatment of EC inhibits the subsequent up-regulation of E-selectin by these stimuli. However, in vivo experiments revealed that currently this method alone is not sufficient to prevent hyperacute rejection.

[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

PubMed Central

Dumont, Yvan; Quirion, Rémi

2000-01-01

GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

Visual feature binding in younger and older adults: encoding and suffix interference effects.

PubMed

Brown, Louise A; Niven, Elaine H; Logie, Robert H; Rhodes, Stephen; Allen, Richard J

2017-02-01

Three experiments investigated younger (18-25 yrs) and older (70-88 yrs) adults' temporary memory for colour-shape combinations (binding). We focused upon estimating the magnitude of the binding cost for each age group across encoding time (Experiment 1; 900/1500 ms), presentation format (Experiment 2; simultaneous/sequential), and interference (Experiment 3; control/suffix) conditions. In Experiment 1, encoding time did not differentially influence binding in the two age groups. In Experiment 2, younger adults exhibited poorer binding performance with sequential relative to simultaneous presentation, and serial position analyses highlighted a particular age-related difficulty remembering the middle item of a series (for all memory conditions). Experiments 1-3 demonstrated small to medium binding effect sizes in older adults across all encoding conditions, with binding less accurate than shape memory. However, younger adults also displayed negative effects of binding (small to large) in two of the experiments. Even when older adults exhibited a greater suffix interference effect in Experiment 3, this was for all memory types, not just binding. We therefore conclude that there is no consistent evidence for a visual binding deficit in healthy older adults. This relative preservation contrasts with the specific and substantial deficits in visual feature binding found in several recent studies of Alzheimer's disease.

Actin-induced dimerization of palladin promotes actin-bundling

PubMed Central

Vattepu, Ravi; Yadav, Rahul; Beck, Moriah R

2015-01-01

A subset of actin binding proteins is able to form crosslinks between two or more actin filaments, thus producing structures of parallel or networked bundles. These actin crosslinking proteins interact with actin through either bivalent binding or dimerization. We recently identified two binding sites within the actin binding domain of palladin, an actin crosslinking protein that plays an important role in normal cell adhesion and motility during wound healing and embryonic development. In this study, we show that actin induces dimerization of palladin. Furthermore, the extent of dimerization reflects earlier comparisons of actin binding and bundling between different domains of palladin. On the basis of these results we hypothesized that actin binding may promote a conformational change that results in dimerization of palladin, which in turn may drive the crosslinking of actin filaments. The proximal distance between two actin binding sites on crosslinking proteins determines the ultrastructural properties of the filament network, therefore we also explored interdomain interactions using a combination of chemical crosslinking experiments and actin cosedimentation assays. Limited proteolysis data reveals that palladin is less susceptible to enzyme digestion after actin binding. Our results suggest that domain movements in palladin are necessary for interactions with actin and are induced by interactions with actin filaments. Accordingly, we put forth a model linking the structural changes to functional dynamics. PMID:25307943

Optical Sensing of Aromatic Amino Acids and Dipeptides by a Crown-Ether-Functionalized Perylene Bisimide Fluorophore.

PubMed

Weißenstein, Annike; Saha-Möller, Chantu R; Würthner, Frank

2018-06-04

The host-guest binding properties of a fluorescent perylene bisimide (PBI) receptor equipped with crown ether were studied in detail with a series of aromatic amino acids and dipeptides by UV/Vis, fluorescence and NMR spectroscopy. Fluorescence titration experiments showed that electron-rich aromatic amino acids and dipeptides strongly quench the fluorescence of the electron-poor PBI host molecule. Benesi-Hildebrand plots of fluorescence titration data confirmed the formation of host-guest complexes with 1:2 stoichiometry. Binding constants determined by global analysis of UV/Vis and fluorescence titration experiments revealed values between 10 3  m -1 and 10 5  m -1 in acetonitrile/methanol (9:1) at 23 °C. These data showed that amino acid l-Trp having an indole group and dipeptides containing this amino acid bind to the PBI receptor more strongly than other amino acids and dipeptides investigated here. For dipeptides containing l-Trp or l-Tyr, the binding strength is dependent on the distance between the ammonium group and the aromatic unit of the amino acids and dipeptides leading to a strong sensitivity for Ala-Trp dipeptide. 1D and 2D NMR experiments also corroborated 1:2 host-guest complexation and indicated formation of two diastereomeric species of host-guest complexes. The studies have shown that a properly functionalized PBI fluorophore functions as a molecular probe for the optical sensing of aromatic amino acids and dipeptides. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Identification of amino acids important for binding of Clostridium perfringens epsilon toxin to host cells and to HAVCR1.

PubMed

Ivie, Susan E; McClain, Mark S

2012-09-25

Clostridium perfringens epsilon toxin belongs to the aerolysin-like family of pore-forming toxins and is one of the most potent bacterial toxins known. The epsilon toxin causes fatal enterotoxemia in sheep, goats, and possibly humans. Evidence indicates that the toxin binds to protein receptors including hepatitis A virus cellular receptor 1 (HAVCR1), but the region of the toxin responsible for cell binding has not been identified. In the present study, we identify amino acids within the epsilon toxin important for this cell interaction. Site-specific mutagenesis was used to investigate the role of a surface-accessible cluster of aromatic amino acids, and purified mutant proteins were tested in a series of cell-culture assays to assess cytotoxic activity and cell binding. When added to cells, four mutant proteins (Etx-Y29E, Etx-Y30E, Etx-Y36E and Etx-Y196E) were severely impaired in their ability to not only kill host cells, but also in their ability to permeabilize the plasma membrane. Circular dichroism spectroscopy and thermal stability studies revealed that the wild-type and mutant proteins were similarly folded. Additional experiments revealed that these mutant proteins were defective in binding to host cells and to HAVCR1. These data indicate that an amino acid motif including Y29, Y30, Y36, and Y196 is important for the ability of epsilon toxin to interact with cells and HAVCR1.

Identification of amino acids important for binding of Clostridium perfringens epsilon toxin to host cells and to HAVCR1

PubMed Central

Ivie, Susan E.; McClain, Mark S.

2012-01-01

Clostridium perfringens epsilon toxin belongs to the aerolysin-like family of pore-forming toxins and is one of the most potent bacterial toxins known. The epsilon toxin causes fatal enterotoxemia in sheep, goats, and possibly humans. Evidence indicates that the toxin binds to protein receptors including hepatitis A virus cellular receptor 1 (HAVCR1), but the region of the toxin responsible for cell binding has not been identified. In the present study, we identify amino acids within the epsilon toxin important for this cell interaction. Site-specific mutagenesis was used to investigate the role of a surface-accessible cluster of aromatic amino acids, and purified mutant proteins were tested in a series of cell-culture assays to assess cytotoxic activity and cell binding. When added to cells, four mutant proteins (Etx-Y29E, Etx-Y30E, Etx-Y36E and Etx-Y196E) were severely impaired in their ability to not only kill host cells, but also in their ability to permeabilize the plasma membrane. Circular dichroism spectroscopy and thermal stability studies revealed that the wild-type and mutant proteins were similarly folded. Additional experiments revealed that these mutant proteins were defective in binding to host cells and to HAVCR1. These data indicate that an amino acid motif including Y29, Y30, Y36, and Y196 is important for the ability of epsilon toxin to interact with cells and HAVCR1. PMID:22938730

Structure and Orientation of a Voltage-Sensor Toxin in Lipid Membranes

PubMed Central

Jung, Hyun Ho; Jung, Hoi Jong; Milescu, Mirela; Lee, Chul Won; Lee, Seungkyu; Lee, Ju Yeon; Eu, Young-Jae; Kim, Ha Hyung; Swartz, Kenton J.; Kim, Jae Il

2010-01-01

Abstract Amphipathic protein toxins from tarantula venom inhibit voltage-activated potassium (Kv) channels by binding to a critical helix-turn-helix motif termed the voltage sensor paddle. Although these toxins partition into membranes to bind the paddle motif, their structure and orientation within the membrane are unknown. We investigated the interaction of a tarantula toxin named SGTx with membranes using both fluorescence and NMR spectroscopy. Depth-dependent fluorescence-quenching experiments with brominated lipids suggest that Trp30 in SGTx is positioned ∼9 Å from the center of the bilayer. NMR spectra reveal that the inhibitor cystine knot structure of the toxin does not radically change upon membrane partitioning. Transferred cross-saturation NMR experiments indicate that the toxin's hydrophobic protrusion contacts the hydrophobic core of the membrane, whereas most surrounding polar residues remain at interfacial regions of the bilayer. The inferred orientation of the toxin reveals a twofold symmetry in the arrangement of basic and hydrophobic residues, a feature that is conserved among tarantula toxins. These results have important implications for regions of the toxin involved in recognizing membranes and voltage-sensor paddles, and for the mechanisms by which tarantula toxins alter the activity of different types of ion channels. PMID:20643084

Unfolding mechanism of thrombin-binding aptamer revealed by molecular dynamics simulation and Markov State Model

NASA Astrophysics Data System (ADS)

Zeng, Xiaojun; Zhang, Liyun; Xiao, Xiuchan; Jiang, Yuanyuan; Guo, Yanzhi; Yu, Xinyan; Pu, Xuemei; Li, Menglong

2016-04-01

Thrombin-binding aptamer (TBA) with the sequence 5‧GGTTGGTGTGGTTGG3‧ could fold into G-quadruplex, which correlates with functionally important genomic regionsis. However, unfolding mechanism involved in the structural stability of G-quadruplex has not been satisfactorily elucidated on experiments so far. Herein, we studied the unfolding pathway of TBA by a combination of molecular dynamics simulation (MD) and Markov State Model (MSM). Our results revealed that the unfolding of TBA is not a simple two-state process but proceeds along multiple pathways with multistate intermediates. One high flux confirms some observations from NMR experiment. Another high flux exhibits a different and simpler unfolding pathway with less intermediates. Two important intermediate states were identified. One is similar to the G-triplex reported in the folding of G-quadruplex, but lack of H-bonding between guanines in the upper plane. More importantly, another intermediate state acting as a connector to link the folding region and the unfolding one, was the first time identified, which exhibits higher population and stability than the G-triplex-like intermediate. These results will provide valuable information for extending our understanding the folding landscape of G-quadruplex formation.

Anti-tumor Study of Chondroitin Sulfate-Methotrexate Nanogels

NASA Astrophysics Data System (ADS)

Wang, Jinyu; Zhao, Weibo; Chen, Haixiao; Qin, An; Zhu, Peizhi

2017-10-01

Self-assembly nanogels (NGs) were formed by bioconjugating methotrexate (MTX) with chondroitin sulfate (CS). MTX-CS NGs can greatly enhance the solubility and improve the delivery efficacy of MTX due to the CD44 binding property of CS. Vivo experiments revealed that MTX-CS NGs showed less toxicity than MTX. MTX-CS NGs can improve the anti-tumor effect while reducing the side effects of MTX. Due to their CD44 binding property, chondroitin sulfate-drug conjugates could be a promising and efficient platform for improving the solubility of sparingly soluble drug molecules as well as targeted delivery to cancer cells and tumor tissues.

Binding of polarity-sensitive hydrophobic ligands to erythroid and nonerythroid spectrin: fluorescence and molecular modeling studies.

PubMed

Patra, Malay; Mitra, Madhurima; Chakrabarti, Abhijit; Mukhopadhyay, Chaitali

2014-01-01

We have used three polarity-sensitive fluorescence probes, 6-propionyl 2-(N,N-dimethyl-amino) naphthalene (Prodan), pyrene and 8-anilino 1-naphthalene sulphonic acid, to study their binding with erythroid and nonerythroid spectrin, using fluorescence spectroscopy. We have found that both bind to prodan and pyrene with high affinities with apparent dissociation constants (Kd) of .50 and .17 μM, for prodan, and .04 and .02 μM, for pyrene, respectively. The most striking aspect of these bindings have been that the binding stoichiometry have been equal to 1 in erythroid spectrin, both in dimeric and tetrameric form, and in tetrameric nonerythroid spectrin. From an estimate of apparent dielectric constants, the polarity of the binding site in both erythroid and nonerythroid forms have been found to be extremely hydrophobic. Thermodynamic parameters associated with such binding revealed that the binding is favored by positive change in entropy. Molecular docking studies alone indicate that both prodan and pyrene bind to the four major structural domains, following the order in the strength of binding to the Ankyrin binding domain > SH3 domain > Self-association domain > N-terminal domain of α-spectrin of both forms of spectrin. The binding experiments, particularly with the tetrameric nonerythroid spectrin, however, indicate more toward the self association domain in offering the unique binding site, since the binding stoichiometry have been 1 in all forms of dimeric and tetrameric spectrin, so far studied by us. Further studies are needed to characterize the hydrophobic binding sites in both forms of spectrin.

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

Comprehensive assay of kinase catalytic activity reveals features of kinase inhibitor selectivity

PubMed Central

Anastassiadis, Theonie; Deacon, Sean W.; Devarajan, Karthik; Ma, Haiching; Peterson, Jeffrey R.

2011-01-01

Small-molecule protein kinase inhibitors are central tools for elucidating cellular signaling pathways and are promising therapeutic agents. Due to evolutionary conservation of the ATP-binding site, most kinase inhibitors that target this site promiscuously inhibit multiple kinases. Interpretation of experiments utilizing these compounds is confounded by a lack of data on the comprehensive kinase selectivity of most inhibitors. Here we profiled the activity of 178 commercially available kinase inhibitors against a panel of 300 recombinant protein kinases using a functional assay. Quantitative analysis revealed complex and often unexpected kinase-inhibitor interactions, with a wide spectrum of promiscuity. Many off-target interactions occur with seemingly unrelated kinases, revealing how large-scale profiling can be used to identify multi-targeted inhibitors of specific, diverse kinases. The results have significant implications for drug development and provide a resource for selecting compounds to elucidate kinase function and for interpreting the results of experiments that use them. PMID:22037377

Different effects of color-based and location-based selection on visual working memory.

PubMed

Li, Qi; Saiki, Jun

2015-02-01

In the present study, we investigated how feature- and location-based selection influences visual working memory (VWM) encoding and maintenance. In Experiment 1, cue type (color, location) and cue timing (precue, retro-cue) were manipulated in a change detection task. The stimuli were color-location conjunction objects, and binding memory was tested. We found a significantly greater effect for color precues than for either color retro-cues or location precues, but no difference between location pre- and retro-cues, consistent with previous studies (e.g., Griffin & Nobre in Journal of Cognitive Neuroscience, 15, 1176-1194, 2003). We also found no difference between location and color retro-cues. Experiment 2 replicated the color precue advantage with more complex color-shape-location conjunction objects. Only one retro-cue effect was different from that in Experiment 1: Color retro-cues were significantly less effective than location retro-cues in Experiment 2, which may relate to a structural property of multidimensional VWM representations. In Experiment 3, a visual search task was used, and the result of a greater location than color precue effect suggests that the color precue advantage in a memory task is related to the modulation of VWM encoding rather than of sensation and perception. Experiment 4, using a task that required only memory for individual features but not for feature bindings, further confirmed that the color precue advantage is specific to binding memory. Together, these findings reveal new aspects of the interaction between attention and VWM and provide potentially important implications for the structural properties of VWM representations.

Revealing Ligand Binding Sites and Quantifying Subunit Variants of Noncovalent Protein Complexes in a Single Native Top-Down FTICR MS Experiment

NASA Astrophysics Data System (ADS)

Li, Huilin; Wongkongkathep, Piriya; Van Orden, Steve L.; Ogorzalek Loo, Rachel R.; Loo, Joseph A.

2014-12-01

"Native" mass spectrometry (MS) has been proven to be increasingly useful for structural biology studies of macromolecular assemblies. Using horse liver alcohol dehydrogenase (hADH) and yeast alcohol dehydrogenase (yADH) as examples, we demonstrate that rich information can be obtained in a single native top-down MS experiment using Fourier transform ion cyclotron mass spectrometry (FTICR MS). Beyond measuring the molecular weights of the protein complexes, isotopic mass resolution was achieved for yeast ADH tetramer (147 kDa) with an average resolving power of 412,700 at m/z 5466 in absorption mode, and the mass reflects that each subunit binds to two zinc atoms. The N-terminal 89 amino acid residues were sequenced in a top-down electron capture dissociation (ECD) experiment, along with the identifications of the zinc binding site at Cys46 and a point mutation (V58T). With the combination of various activation/dissociation techniques, including ECD, in-source dissociation (ISD), collisionally activated dissociation (CAD), and infrared multiphoton dissociation (IRMPD), 40% of the yADH sequence was derived directly from the native tetramer complex. For hADH, native top-down ECD-MS shows that both E and S subunits are present in the hADH sample, with a relative ratio of 4:1. Native top-down ISD of the hADH dimer shows that each subunit (E and S chains) binds not only to two zinc atoms, but also the NAD/NADH ligand, with a higher NAD/NADH binding preference for the S chain relative to the E chain. In total, 32% sequence coverage was achieved for both E and S chains.

Differential mechanisms of binding of anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA to E. coli RNA polymerase lead to diverse physiological consequences.

PubMed

Sharma, Umender K; Chatterji, Dipankar

2008-05-01

Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, sigma(70), of E. coli. Though both factors are known to interact with the C-terminal region of sigma(70), the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to sigma(70) with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with sigma(70) studied by using the yeast two-hybrid system revealed that region 4 of sigma(70) is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of sigma(70) as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to sigma(70).

Differential Mechanisms of Binding of Anti-Sigma Factors Escherichia coli Rsd and Bacteriophage T4 AsiA to E. coli RNA Polymerase Lead to Diverse Physiological Consequences▿

PubMed Central

Sharma, Umender K.; Chatterji, Dipankar

2008-01-01

Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, σ70, of E. coli. Though both factors are known to interact with the C-terminal region of σ70, the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to σ70 with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with σ70 studied by using the yeast two-hybrid system revealed that region 4 of σ70 is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of σ70 as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to σ70. PMID:18359804

Models of metal binding structures in fulvic acid from the Suwannee River, Georgia

USGS Publications Warehouse

Leenheer, J.A.; Brown, G.K.; MacCarthy, P.; Cabaniss, S.E.

1998-01-01

Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The 'metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-1R spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short- chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca2+, Cd2+, Cu2+, Ni2+, and Zn2+ ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca2+ ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The `metal binding' fraction was characterized by quantitative 13C NMR, 1H NMR, and FT-IR spectrometry and elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca2+ binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.

Understanding the Effect of Carbonate Ion on Cisplatin Binding to DNA

PubMed Central

Todd, Ryan C.; Lovejoy, Katherine S.; Lippard, Stephen J.

2008-01-01

The role of carbonate in the binding of cis-diamminedichloroplatinum(II) to DNA was investigated in order to understand the potential involvement of carbonato-cisplatin species in the mechanism of action of platinum anticancer agents. Cisplatin was allowed to react with both double- and single-stranded DNA in carbonate, phosphate, and HEPES buffers, and the products were analyzed by agarose gel electrophoresis and enzymatic digestion/mass spectrometry, respectively. The data from these experiments demonstrate (1) that carbonate, like other biological nucleophiles, forms relatively inert complexes with platinum that inactivate cisplatin, and (2) that the major cisplatin-DNA adduct formed is a bifunctional cross-link. These results are in accord with previous studies of cisplatin-DNA binding and reveal that the presence of carbonate has no consequence on the nature of the resulting adducts. PMID:17465550

Location and ion-binding of membrane-associated valinomycin, a proton nuclear magnetic resonance study.

PubMed

Meers, P; Feigenson, G W

1988-03-03

Valinomycin, incorporated in small unilamellar vesicles of perdeuterated dimyristoylphosphatidylcholine, reveals several well-resolved 1H-NMR resonances. These resonances were used to examine the location, orientation and ion-binding of membrane-bound valinomycin. The order of affinity of membrane-bound valinomycin for cations is Rb+ greater than K+ greater than Cs+ greater than Ba2+, and binding is sensitive to surface change. The exchange between bound and free forms is fast on the NMR time scale. The intrinsic binding constants, extrapolated to zero anion concentration, are similar to those determined in aqueous solution. Rb+ and K+ show 1:1 binding to valinomycin, whereas the stoichiometry of Cs+ and Ba2+ is not certain. Paramagnetic chemical shift reagents and nitroxide spin label relaxation probes were used to study the location and orientation of valinomycin in the membrane. Despite relatively fast exchange of bound cations, the time average location of the cation-free form of valinomycin is deep within the bilayer under the conditions of these experiments. Upon complexation to K+, valinomycin moves closer to the interfacial region.

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

Interactions between antimicrobial polynorbornenes and phospholipid vesicles monitored by light scattering and microcalorimetry.

PubMed

Gabriel, Gregory J; Pool, Joanna G; Som, Abhigyan; Dabkowski, Jeffrey M; Coughlin, E Bryan; Muthukumar, M; Tew, Gregory N

2008-11-04

Antimicrobial polynorbornenes composed of facially amphiphilic monomers have been previously reported to accurately emulate the antimicrobial activity of natural host-defense peptides (HDPs). The lethal mechanism of most HDPs involves binding to the membrane surface of bacteria leading to compromised phospholipid bilayers. In this paper, the interactions between biomimetic vesicle membranes and these cationic antimicrobial polynorbornenes are reported. Vesicle dye-leakage experiments were consistent with previous biological assays and corroborated a mode of action involving membrane disruption. Dynamic light scattering (DLS) showed that these antimicrobial polymers cause extensive aggregation of vesicles without complete bilayer disintegration as observed with surfactants that efficiently solubilize the membrane. Fluorescence microscopy on vesicles and bacterial cells also showed polymer-induced aggregation of both synthetic vesicles and bacterial cells. Isothermal titration calorimetry (ITC) afforded free energy of binding values (Delta G) and polymer to lipid binding ratios, plus revealed that the interaction is entropically favorable (Delta S>0, Delta H>0). It was observed that the strength of vesicle binding was similar between the active polymers while the binding stoichiometries were dramatically different.

Protein profile of Lupinus texensis phloem sap exudates: searching for Fe- and Zn-containing proteins.

PubMed

Lattanzio, Giuseppe; Andaluz, Sofía; Matros, Andrea; Calvete, Juan José; Kehr, Julia; Abadía, Anunciación; Abadía, Javier; López-Millán, Ana-Flor

2013-08-01

The aim of this study was to obtain a comprehensive overview of the phloem sap protein profile of Lupinus texensis, with a special focus on proteins binding Fe and Zn. L. texensis was chosen as model plant given the simplicity to obtain exudates from sieve elements. Protein profiling by 2DE revealed 249 spots, and 54 of them were unambiguously identified by MALDI-MS and ESI-MS/MS. The largest number of identified protein species belongs to protein modification/turnover and general metabolism (19-21%), followed by redox homeostasis (9%) and defense and cell structural components (7%). This protein profile is similar to that reported in other plant species, suggesting that the phloem sap proteome is quite conserved. Staining of 2DE gels for Fe-containing proteins and affinity chromatography experiments revealed the presence of two low molecular weight Fe-binding proteins in phloem sap: a metallothionein-like protein type 2B identified in the Fe-affinity chromatography, and a second protein identified with both Fe staining methods. This protein species had a molecular weight of 13.5 kDa, a pI of 5.6 and 51% homology to a phloem-specific protein from Medicago truncatula. Zinc affinity chromatography revealed four Zn-binding proteins in phloem sap, one belonging to the dehydrin family and three Zn finger proteins. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rational Design of Glycomimetic Compounds Targeting the Saccharomyces cerevisiae Transglycosylase Gas2.

PubMed

Delso, Ignacio; Valero-González, Jessika; Marca, Eduardo; Tejero, Tomás; Hurtado-Guerrero, Ramón; Merino, Pedro

2016-02-01

The transglycosylase Saccharomyces cerevisiae Gas2 (ScGas2) belongs to a large family of enzymes that are key players in yeast cell wall remodeling. Despite its biologic importance, no studies on the synthesis of substrate-based compounds as potential inhibitors have been reported. We have synthesized a series of docking-guided glycomimetics that were evaluated by fluorescence spectroscopy and saturation-transfer difference (STD) NMR experiments, revealing that a minimum of three glucose units linked via a β-(1,3) linkage are required for achieving molecular recognition at the binding donor site. The binding mode of our compounds is further supported by STD-NMR experiments using the active site-mutants Y107Q and Y244Q. Our results are important for both understanding of ScGas2-substrate interactions and setting up the basis for future design of glycomimetics as new antifungal agents. © 2015 John Wiley & Sons A/S.

Color-binding errors during rivalrous suppression of form.

PubMed

Hong, Sang Wook; Shevell, Steven K

2009-09-01

How does a physical stimulus determine a conscious percept? Binocular rivalry provides useful insights into this question because constant physical stimulation during rivalry causes different visual experiences. For example, presentation of vertical stripes to one eye and horizontal stripes to the other eye results in a percept that alternates between horizontal and vertical stripes. Presentation of a different color to each eye (color rivalry) produces alternating percepts of the two colors or, in some cases, a color mixture. The experiments reported here reveal a novel and instructive resolution of rivalry for stimuli that differ in both form and color: perceptual alternation between the rivalrous forms (e.g., horizontal or vertical stripes), with both eyes' colors seen simultaneously in separate parts of the currently perceived form. Thus, the colors presented to the two eyes (a) maintain their distinct neural representations despite resolution of form rivalry and (b) can bind separately to distinct parts of the perceived form.

Electrostatic forces govern the binding mechanism of intrinsically disordered histone chaperones

PubMed Central

Liu, Chuanbo; Wang, Tianshu; Bai, Yawen; Wang, Jin

2017-01-01

A unified picture to understand the protein recognition and function must include the native binding complex structure ensembles and the underlying binding mechanisms involved in specific biological processes. However, quantifications of both binding complex structures and dynamical mechanisms are still challenging for IDP. In this study, we have investigated the underlying molecular mechanism of the chaperone Chz1 and histone H2A.Z-H2B association by equilibrium and kinetic stopped-flow fluorescence spectroscopy. The dependence of free energy and kinetic rate constant on electrolyte mean activity coefficient and urea concentration are uncovered. Our results indicate a previous unseen binding kinetic intermediate. An initial conformation selection step of Chz1 is also revealed before the formation of this intermediate state. Based on these observations, a mixed mechanism of three steps including both conformation selection and induced fit is proposed. By combination of the ion- and denaturant-induced experiments, we demonstrate that electrostatic forces play a dominant role in the recognition of bipolar charged intrinsically disordered protein Chz1 to its preferred partner H2A.Z-H2B. Both the intra-chain and inter-chain electrostatic interactions have direct impacts on the native collapsed structure and binding mechanism. PMID:28552960

The Binding of Four Licorice Flavonoids to Bovine Serum Albumin by Multi-Spectroscopic and Molecular Docking Methods: Structure-Affinity Relationship

NASA Astrophysics Data System (ADS)

Hou, J.; Liang, Q.; Shao, S.

2017-03-01

Flavanones are the main compound of licorice, and the C'-4 position substitution is a significant structural feature for their biological activity. The ability of three selected flavanones (liquiritigenin, liquiritin, and liquiritin apioside) bearing different substituents (hydroxyl groups, glucose, and glucose-apiose sugar moiety) at the C'-4 position and a chalcone ( isoliquiritigenin, an isomer of liquiritigenin) to bind bovine serum albumin (BSA) was studied by multispectroscopic and molecular docking methods under physiological conditions. The binding mechanism of fl avonoids to BSA can be explained by the formation of a flavonoids-BSA complex, and the binding affinity is the strongest for isoliquiritigenin, followed by liquiritin apioside, liquiritin, and liquiritigenin. The thermodynamic analysis and the molecular docking indicated that the interaction between flavonoids and BSA was dominated by the hydrophobic force and hydrogen bonds. The competitive experiments as well as the molecular docking results suggested the most possible binding site of licorice flavonoids on BSA at subdomain IIA. These results revealed that the basic skeleton structure and the substituents at the C'-4 position of flavanones significantly affect the structure-affinity relationships of the licorice flavonoid binding to BSA.

Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

NASA Astrophysics Data System (ADS)

David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

2010-09-01

Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

Experimental and DFT studies on DNA binding and photocleavage of two cationic porphyrins. Effects of the introduction of a carboxyphenyl into pyridinium porphyrin.

PubMed

Zhao, Ping; Xu, Lian-Cai; Huang, Jin-Wang; Liu, Jie; Yu, Han-Cheng; Zheng, Kang-Cheng; Ji, Liang-Nian

2008-12-15

The DNA-binding affinities and DNA photocleavage abilities of cationic porphyrin, 5-(4-carboxyphenyl)-10,15,20-tris(4-methylpyridiniumyl)porphyrin (CTMPyP), and its reference compound meso-tetrakis(N-methyl-4-pyridiniumyl)porphyrin (H2TMPyP) have been investigated. The DNA-binding behaviors of the two compounds in NaH2PO4 buffer were compared systematically by using absorption, fluorescence and circular dichroism (CD) spectra, thermal denaturation as well as viscosity measurements. The experimental results show that CTMPyP binds to DNA in an outside binding mode, while H2TMPyP in an intercalative mode. Photocleavage experiments reveal that both two compounds employ 1O2-mediated mechanism in cleaving DNA and H2TMPyP can cleave DNA more efficiently than CTMPyP. Theoretical calculations were carried out with the density functional theory (DFT), and the calculated results indicate that the character and energies of some frontier orbitals of CTMPyP are quite different from those of H2TMPyP. These theoretical results can be used to explain their different DNA-binding modes and affinities to a certain extent.

Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

PubMed Central

Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

2013-01-01

Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

Crystal structures of two novel dye-decolorizing peroxidases reveal a beta-barrel fold with a conserved heme-binding motif.

PubMed

Zubieta, Chloe; Krishna, S Sri; Kapoor, Mili; Kozbial, Piotr; McMullan, Daniel; Axelrod, Herbert L; Miller, Mitchell D; Abdubek, Polat; Ambing, Eileen; Astakhova, Tamara; Carlton, Dennis; Chiu, Hsiu-Ju; Clayton, Thomas; Deller, Marc C; Duan, Lian; Elsliger, Marc-André; Feuerhelm, Julie; Grzechnik, Slawomir K; Hale, Joanna; Hampton, Eric; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kumar, Abhinav; Marciano, David; Morse, Andrew T; Nigoghossian, Edward; Okach, Linda; Oommachen, Silvya; Reyes, Ron; Rife, Christopher L; Schimmel, Paul; van den Bedem, Henry; Weekes, Dana; White, Aprilfawn; Xu, Qingping; Hodgson, Keith O; Wooley, John; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

2007-11-01

BtDyP from Bacteroides thetaiotaomicron (strain VPI-5482) and TyrA from Shewanella oneidensis are dye-decolorizing peroxidases (DyPs), members of a new family of heme-dependent peroxidases recently identified in fungi and bacteria. Here, we report the crystal structures of BtDyP and TyrA at 1.6 and 2.7 A, respectively. BtDyP assembles into a hexamer, while TyrA assembles into a dimer; the dimerization interface is conserved between the two proteins. Each monomer exhibits a two-domain, alpha+beta ferredoxin-like fold. A site for heme binding was identified computationally, and modeling of a heme into the proposed active site allowed for identification of residues likely to be functionally important. Structural and sequence comparisons with other DyPs demonstrate a conservation of putative heme-binding residues, including an absolutely conserved histidine. Isothermal titration calorimetry experiments confirm heme binding, but with a stoichiometry of 0.3:1 (heme:protein). (c) 2007 Wiley-Liss, Inc.

Structural basis for LeishIF4E-1 modulation by an interacting protein in the human parasite Leishmania major.

PubMed

Meleppattu, Shimi; Arthanari, Haribabu; Zinoviev, Alexandra; Boeszoermenyi, Andras; Wagner, Gerhard; Shapira, Michal; Léger-Abraham, Mélissa

2018-03-19

Leishmania parasites are unicellular pathogens that are transmitted to humans through the bite of infected sandflies. Most of the regulation of their gene expression occurs post-transcriptionally, and the different patterns of gene expression required throughout the parasites' life cycle are regulated at the level of translation. Here, we report the X-ray crystal structure of the Leishmania cap-binding isoform 1, LeishIF4E-1, bound to a protein fragment of previously unknown function, Leish4E-IP1, that binds tightly to LeishIF4E-1. The molecular structure, coupled to NMR spectroscopy experiments and in vitro cap-binding assays, reveal that Leish4E-IP1 allosterically destabilizes the binding of LeishIF4E-1 to the 5' mRNA cap. We propose mechanisms through which Leish4E-IP1-mediated LeishIF4E-1 inhibition could regulate translation initiation in the human parasite.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA

NASA Astrophysics Data System (ADS)

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-01

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA.

PubMed

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-15

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging. Copyright © 2015 Elsevier B.V. All rights reserved.

Quantum annealing versus classical machine learning applied to a simplified computational biology problem

NASA Astrophysics Data System (ADS)

Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.

2018-03-01

Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to classify and rank binding affinities. Using simplified data sets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified data sets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems.

LeuT-Desipramine Structure Reveals How Antidepressants Block Neurotransmitter Reuptake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou,Z.; Zhen, J.; Karpowich, N.

2007-01-01

Tricyclic antidepressants exert their pharmacological effect -- inhibiting the reuptake of serotonin, norepinephrine, and dopamine -- by directly blocking neurotransmitter transporters (SERT, NET, and DAT, respectively) in the presynaptic membrane. The drug-binding site and the mechanism of this inhibition are poorly understood. We determined the crystal structure at 2.9 angstroms of the bacterial leucine transporter (LeuT), a homolog of SERT, NET, and DAT, in complex with leucine and the antidepressant desipramine. Desipramine binds at the inner end of the extracellular cavity of the transporter and is held in place by a hairpin loop and by a salt bridge. This bindingmore » site is separated from the leucine-binding site by the extracellular gate of the transporter. By directly locking the gate, desipramine prevents conformational changes and blocks substrate transport. Mutagenesis experiments on human SERT and DAT indicate that both the desipramine-binding site and its inhibition mechanism are probably conserved in the human neurotransmitter transporters.« less

An allosteric conduit facilitates dynamic multisite substrate recognition by the SCFCdc4 ubiquitin ligase

NASA Astrophysics Data System (ADS)

Csizmok, Veronika; Orlicky, Stephen; Cheng, Jing; Song, Jianhui; Bah, Alaji; Delgoshaie, Neda; Lin, Hong; Mittag, Tanja; Sicheri, Frank; Chan, Hue Sun; Tyers, Mike; Forman-Kay, Julie D.

2017-01-01

The ubiquitin ligase SCFCdc4 mediates phosphorylation-dependent elimination of numerous substrates by binding one or more Cdc4 phosphodegrons (CPDs). Methyl-based NMR analysis of the Cdc4 WD40 domain demonstrates that Cyclin E, Sic1 and Ash1 degrons have variable effects on the primary Cdc4WD40 binding pocket. Unexpectedly, a Sic1-derived multi-CPD substrate (pSic1) perturbs methyls around a previously documented allosteric binding site for the chemical inhibitor SCF-I2. NMR cross-saturation experiments confirm direct contact between pSic1 and the allosteric pocket. Phosphopeptide affinity measurements reveal negative allosteric communication between the primary CPD and allosteric pockets. Mathematical modelling indicates that the allosteric pocket may enhance ultrasensitivity by tethering pSic1 to Cdc4. These results suggest negative allosteric interaction between two distinct binding pockets on the Cdc4WD40 domain may facilitate dynamic exchange of multiple CPD sites to confer ultrasensitive dependence on substrate phosphorylation.

Homotropic Cooperativity from the Activation Pathway of the Allosteric Ligand-Responsive Regulatory Protein TRAP†

PubMed Central

Kleckner, Ian R.; McElroy, Craig A.; Kuzmic, Petr; Gollnick, Paul; Foster, Mark P.

2014-01-01

The trp RNA-binding Attenuation Protein (TRAP) assembles into an 11-fold symmetric ring that regulates transcription and translation of trp-mRNA in bacilli via heterotropic allosteric activation by the amino acid tryptophan (Trp). Whereas nuclear magnetic resonance studies have revealed that Trp-induced activation coincides with both μs-ms rigidification and local structural changes in TRAP, the pathway of binding of the 11 Trp ligands to the TRAP ring remains unclear. Moreover, because each of eleven bound Trp molecules is completely surrounded by protein, its release requires flexibility of Trp-bound (holo) TRAP. Here, we used stopped-flow fluorescence to study the kinetics of Trp binding by Bacillus stearothermophilus TRAP over a range of temperatures and we observed well-separated kinetic steps. These data were analyzed using non-linear least-squares fitting of several two- and three-step models. We found that a model with two binding steps best describes the data, although the structural equivalence of the binding sites in TRAP implies a fundamental change in the time-dependent structure of the TRAP rings upon Trp binding. Application of the two binding step model reveals that Trp binding is much slower than the diffusion limit, suggesting a gating mechanism that depends on the dynamics of apo TRAP. These data also reveal that Trp dissociation from the second binding mode is much slower than after the first Trp binding mode, revealing insight into the mechanism for positive homotropic allostery, or cooperativity. Temperature dependent analyses reveal that both binding modes imbue increases in bondedness and order toward a more compressed active state. These results provide insight into mechanisms of cooperative TRAP activation, and underscore the importance of protein dynamics for ligand binding, ligand release, protein activation, and allostery. PMID:24224873

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Solution structure of the C-terminal X domain of the measles virus phosphoprotein and interaction with the intrinsically disordered C-terminal domain of the nucleoprotein.

PubMed

Gely, Stéphane; Lowry, David F; Bernard, Cédric; Jensen, Malene R; Blackledge, Martin; Costanzo, Stéphanie; Bourhis, Jean-Marie; Darbon, Hervé; Daughdrill, Gary; Longhi, Sonia

2010-01-01

In this report, the solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein (XD, aa 459-507) is described. A dynamic description of the interaction between XD and the disordered C-terminal domain of the nucleocapsid protein, (N(TAIL), aa 401-525), is also presented. XD is an all alpha protein consisting of a three-helix bundle with an up-down-up arrangement of the helices. The solution structure of XD is very similar to the crystal structures of both the free and bound form of XD. One exception is the presence of a highly dynamic loop encompassing XD residues 489-491, which is involved in the embedding of the alpha-helical XD-binding region of N(TAIL). Secondary chemical shift values for full-length N(TAIL) were used to define the precise boundaries of a transient helical segment that coincides with the XD-binding domain, thus shedding light on the pre-recognition state of N(TAIL). Titration experiments with unlabeled XD showed that the transient alpha-helical conformation of N(TAIL) is stabilized upon binding. Lineshape analysis of NMR resonances revealed that residues 483-506 of N(TAIL) are in intermediate exchange with XD, while the 475-482 and 507-525 regions are in fast exchange. The N(TAIL) resonance behavior in the titration experiments is consistent with a complex binding model with more than two states.

No significant regulation of bicoid mRNA by Pumilio or Nanos in the early Drosophila embryo.

PubMed

Wharton, Tammy H; Nomie, Krystle J; Wharton, Robin P

2018-01-01

Drosophila Pumilio (Pum) is a founding member of the conserved Puf domain class of RNA-binding translational regulators. Pum binds with high specificity, contacting eight nucleotides, one with each of the repeats in its RNA-binding domain. In general, Pum is thought to block translation in collaboration with Nanos (Nos), which exhibits no binding specificity in isolation but is recruited jointly to regulatory sequences containing a Pum binding site in the 3'-UTRs of target mRNAs. Unlike Pum, which is ubiquitous in the early embryo, Nos is tightly restricted to the posterior, ensuring that repression of its best-characterized target, maternal hunchback (hb) mRNA, takes place exclusively in the posterior. An exceptional case of Nos-independent regulation by Pum has been described-repression of maternal bicoid (bcd) mRNA at the anterior pole of the early embryo, dependent on both Pum and conserved Pum binding sites in the 3'-UTR of the mRNA. We have re-investigated regulation of bcd in the early embryo; our experiments reveal no evidence of a role for Pum or its conserved binding sites in regulation of the perdurance of bcd mRNA or protein. Instead, we find that Pum and Nos control the accumulation of bcd mRNA in testes.

Binding of puerarin to human serum albumin: a spectroscopic analysis and molecular docking.

PubMed

He, Yang; Wang, Yiwei; Tang, Lifei; Liu, Hui; Chen, Wei; Zheng, Zhongliang; Zou, Guolin

2008-03-01

Puerarin is a widely used compound in Chinese traditional medicine and exhibits many pharmacological activities. Binding of puerarin to human serum albumin (HSA) was investigated by ultraviolet absorbance, fluorescence, circular dichroism and molecular docking. Puerarin caused a static quenching of intrinsic fluorescence of HSA, the quenching data was analyzed by Stern-Volmer equation. There was one primary puerarin binding site on HSA with a binding constant of 4.12 x 10(4) M(-1) at 298 K. Thermodynamic analysis by Van Hoff equation found enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) were -28.01 kJ/mol and -5.63 J/mol K respectively, which indicated the hydrogen bond and Van der Waas interaction were the predominant forces in the binding process. Competitive experiments showed a displacement of warfarin by puerarin, which revealed that the binding site was located at the drug site I. Puerarin was about 2.22 nm far from the tryptophan according to the observed fluorescence resonance energy transfer between HSA and puerarin. Molecular docking suggested the hydrophobic residues such as tyrosine (Tyr) 150, Tyr 148, Tyr 149 and polar residues such as lysine (Lys) 199, Lys 195, arginine 257 and histidine 242 played an important role in the binding reaction.

Structural basis for modulation of a G-protein-coupled receptor by allosteric drugs

NASA Astrophysics Data System (ADS)

Dror, Ron O.; Green, Hillary F.; Valant, Celine; Borhani, David W.; Valcourt, James R.; Pan, Albert C.; Arlow, Daniel H.; Canals, Meritxell; Lane, J. Robert; Rahmani, Raphaël; Baell, Jonathan B.; Sexton, Patrick M.; Christopoulos, Arthur; Shaw, David E.

2013-11-01

The design of G-protein-coupled receptor (GPCR) allosteric modulators, an active area of modern pharmaceutical research, has proved challenging because neither the binding modes nor the molecular mechanisms of such drugs are known. Here we determine binding sites, bound conformations and specific drug-receptor interactions for several allosteric modulators of the M2 muscarinic acetylcholine receptor (M2 receptor), a prototypical family A GPCR, using atomic-level simulations in which the modulators spontaneously associate with the receptor. Despite substantial structural diversity, all modulators form cation-π interactions with clusters of aromatic residues in the receptor extracellular vestibule, approximately 15Å from the classical, `orthosteric' ligand-binding site. We validate the observed modulator binding modes through radioligand binding experiments on receptor mutants designed, on the basis of our simulations, either to increase or to decrease modulator affinity. Simulations also revealed mechanisms that contribute to positive and negative allosteric modulation of classical ligand binding, including coupled conformational changes of the two binding sites and electrostatic interactions between ligands in these sites. These observations enabled the design of chemical modifications that substantially alter a modulator's allosteric effects. Our findings thus provide a structural basis for the rational design of allosteric modulators targeting muscarinic and possibly other GPCRs.

Probing the behavior of bovine serum albumin upon binding to atenolol: insights from spectroscopic and molecular docking approaches.

PubMed

Jiang, Tuo-Ying; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi; Shi, Jie-Hua

2018-04-01

Molecular interaction of atenolol, a selective β 1 receptor antagonist with the major carrier protein, bovine serum albumin (BSA), was investigated under imitated physiological conditions (pH 7.4) by means of fluorescence spectroscopy, UV absorption spectroscopy, Fourier transform infrared spectroscopy (FT-IR), and molecular modeling studies. The steady-state fluorescence spectra manifested that static type, due to formation of the atenolol-BSA complex, was the dominant mechanism for fluorescence quenching. The characteristic information about the binding interaction of atenolol with BSA in terms of binding constant (K b ) were determined by the UV-vis absorption titration, and were found to be in the order of 10 3  M -1 at different temperatures, indicating the existence of a weak binding in this system. Thermodynamic analysis revealed that the binding process was primarily mediated by van der Waals force and hydrogen bonds due to the negative sign for enthalpy change (ΔH 0 ), entropy change (ΔS 0 ). The molecular docking results elucidated that atenolol preferred binding on the site II of BSA according to the findings observed in competitive binding experiments. Moreover, via alterations in synchronous fluorescence, three-dimensional fluorescence and FT-IR spectral properties, it was concluded that atenolol could arouse slight configurational and micro-environmental changes of BSA.

Molecular modeling and SPRi investigations of interleukin 6 (IL6) protein and DNA aptamers.

PubMed

Rhinehardt, Kristen L; Vance, Stephen A; Mohan, Ram V; Sandros, Marinella; Srinivas, Goundla

2018-06-01

Interleukin 6 (IL6), an inflammatory response protein has major implications in immune-related inflammatory diseases. Identification of aptamers for the IL6 protein aids in diagnostic, therapeutic, and theranostic applications. Three different DNA aptamers and their interactions with IL6 protein were extensively investigated in a phosphate buffed saline (PBS) solution. Molecular-level modeling through molecular dynamics provided insights of structural, conformational changes and specific binding domains of these protein-aptamer complexes. Multiple simulations reveal consistent binding region for all protein-aptamer complexes. Conformational changes coupled with quantitative analysis of center of mass (COM) distance, radius of gyration (R g ), and number of intermolecular hydrogen bonds in each IL6 protein-aptamer complex was used to determine their binding performance strength and obtain molecular configurations with strong binding. A similarity comparison of the molecular configurations with strong binding from molecular-level modeling concurred with Surface Plasmon Resonance imaging (SPRi) for these three aptamer complexes, thus corroborating molecular modeling analysis findings. Insights from the natural progression of IL6 protein-aptamer binding modeled in this work has identified key features such as the orientation and location of the aptamer in the binding event. These key features are not readily feasible from wet lab experiments and impact the efficacy of the aptamers in diagnostic and theranostic applications.

MGA, L3MBTL2 and E2F6 determine genomic binding of the non-canonical Polycomb repressive complex PRC1.6

PubMed Central

Stielow, Bastian; Finkernagel, Florian; Stiewe, Thorsten

2018-01-01

Diverse Polycomb repressive complexes 1 (PRC1) play essential roles in gene regulation, differentiation and development. Six major groups of PRC1 complexes that differ in their subunit composition have been identified in mammals. How the different PRC1 complexes are recruited to specific genomic sites is poorly understood. The Polycomb Ring finger protein PCGF6, the transcription factors MGA and E2F6, and the histone-binding protein L3MBTL2 are specific components of the non-canonical PRC1.6 complex. In this study, we have investigated their role in genomic targeting of PRC1.6. ChIP-seq analysis revealed colocalization of MGA, L3MBTL2, E2F6 and PCGF6 genome-wide. Ablation of MGA in a human cell line by CRISPR/Cas resulted in complete loss of PRC1.6 binding. Rescue experiments revealed that MGA recruits PRC1.6 to specific loci both by DNA binding-dependent and by DNA binding-independent mechanisms. Depletion of L3MBTL2 and E2F6 but not of PCGF6 resulted in differential, locus-specific loss of PRC1.6 binding illustrating that different subunits mediate PRC1.6 loading to distinct sets of promoters. Mga, L3mbtl2 and Pcgf6 colocalize also in mouse embryonic stem cells, where PRC1.6 has been linked to repression of germ cell-related genes. Our findings unveil strikingly different genomic recruitment mechanisms of the non-canonical PRC1.6 complex, which specify its cell type- and context-specific regulatory functions. PMID:29381691

Multifunctional centromere binding factor 1 is essential for chromosome segregation in the human pathogenic yeast Candida glabrata.

PubMed

Stoyan, T; Gloeckner, G; Diekmann, S; Carbon, J

2001-08-01

The CBF1 (centromere binding factor 1) gene of Candida glabrata was cloned by functional complementation of the methionine biosynthesis defect of a Saccharomyces cerevisiae cbf1 deletion mutant. The C. glabrata-coded protein, CgCbf1, contains a basic-helix-loop-helix leucine zipper domain and has features similar to those of other budding yeast Cbf1 proteins. CgCbf1p binds in vitro to the centromere DNA element I (CDEI) sequence GTCACATG with high affinity (0.9 x 10(9) M(-1)). Bandshift experiments revealed a pattern of protein-DNA complexes on CgCEN DNA different from that known for S. cerevisiae. We examined the effect of altering the CDEI binding site on CEN plasmid segregation, using a newly developed colony-sectoring assay. Internal deletion of the CDEI binding site led only to a fivefold increase in rates of plasmid loss, indicating that direct binding of Cbf1p to the centromere DNA is not required for full function. Additional deletion of sequences to the left of CDEI, however, led to a 70-fold increase in plasmid loss rates. Deletion of the CBF1 gene proved to be lethal in C. glabrata. C. glabrata cells containing the CBF1 gene under the influence of a shutdown promoter (tetO-ScHOP) arrested their growth after 5 h of cultivation in the presence of the reactive drug doxycycline. DAPI (4',6'-diamidino-2-phenylindole) staining of the arrested cells revealed a significant increase in the number of large-budded cells with single nuclei, 2C DNA content, and short spindles, indicating a defect in the G(2)/M transition of the cell cycle. Thus, we conclude that Cbf1p is required for chromosome segregation in C. glabrata.

Probing the recognition surface of a DNA triplex: binding studies with intercalator-neomycin conjugates.

PubMed

Xue, Liang; Xi, Hongjuan; Kumar, Sunil; Gray, David; Davis, Erik; Hamilton, Paris; Skriba, Michael; Arya, Dev P

2010-07-06

Thermodynamic studies on the interactions between intercalator-neomycin conjugates and a DNA polynucleotide triplex [poly(dA).2poly(dT)] were conducted. To draw a complete picture of such interactions, naphthalene diimide-neomycin (3) and anthraquinone-neomycin (4) conjugates were synthesized and used together with two other analogues, previously synthesized pyrene-neomycin (1) and BQQ-neomycin (2) conjugates, in our investigations. A combination of experiments, including UV denaturation, circular dichroism (CD) titration, differential scanning calorimetry (DSC), and isothermal titration calorimetry (ITC), revealed that all four conjugates (1-4) stabilized poly(dA).2poly(dT) much more than its parent compound, neomycin. UV melting experiments clearly showed that the temperature (T(m3-->2)) at which poly(dA).2poly(dT) dissociated into poly(dA).poly(dT) and poly(dT) increased dramatically (>12 degrees C) in the presence of intercalator-neomycin conjugates (1-4) even at a very low concentration (2 muM). In contrast to intercalator-neomycin conjugates, the increment of T(m3-->2) of poly(dA).2poly(dT) induced by neomycin was negligible under the same conditions. The binding preference of intercalator-neomycin conjugates (1-4) to poly(dA).2poly(dT) was also confirmed by competition dialysis and a fluorescent intercalator displacement assay. Circular dichroism titration studies revealed that compounds 1-4 had slightly larger binding site size ( approximately 7-7.5) with poly(dA).2poly(dT) as compared to neomycin ( approximately 6.5). The thermodynamic parameters of these intercalator-neomycin conjugates with poly(dA).2poly(dT) were derived from an integrated van't Hoff equation using the T(m3-->2) values, the binding site size numbers, and other parameters obtained from DSC and ITC. The binding affinity of all tested ligands with poly(dA).2poly(dT) increased in the following order: neomycin < 1 < 3 < 4 < 2. Among them, the binding constant [(2.7 +/- 0.3) x 10(8) M(-1)] of 2 with poly(dA).2poly(dT) was the highest, almost 1000-fold greater than that of neomycin. The binding of compounds 1-4 with poly(dA).2poly(dT) was mostly enthalpy-driven and gave negative DeltaC(p) values. The results described here suggest that the binding affinity of intercalator-neomycin conjugates for poly(dA).2poly(dT) increases as a function of the surface area of the intercalator moiety.

Both endothelin-A and endothelin-B receptors are present on adult rat cardiac ventricular myocytes.

PubMed

Allen, Bruce G; Phuong, Luu Lien; Farhat, Hala; Chevalier, Dominique

2003-02-01

Endothelin-A (ET(A)) and endothelin-B (ET(B)) receptors have been demonstrated in intact heart and cardiac membranes. ET(A) receptors have been demonstrated on adult ventricular myocytes. The aim of the present study was to determine the presence of ET(B) and the relative contribution of this receptor subtype to total endothelin-1 (ET-1) binding on adult ventricular myocytes. Saturation binding experiments indicated that ET-1 bound to a single population of receptors (Kd = 0.52 +/- 0.13 nM, n = 4) with an apparent maximum binding (Bmax) of 2.10 +/- 0.25 sites (x 10(5))/cell (n = 4). Competition experiments using 40 pM [125I]ET-1 and nonradioactive ET-1 revealed a Ki of 660 +/- 71 pM (n = 10) and a Hill coefficient (nH) of 0.99 +/- 0.10 (n = 10). A selective ET(A) antagonist, BQ610, displaced 80% of the bound [125I]ET-1. No displacement was observed by concentrations of an ET(B)-selective antagonist, BQ788, up to 1.0 microM. However, in the presence of 1.0 microM BQ610, BQ788 inhibited the remaining [125I]ET-1 binding. Similarly, in the presence of 1.0 microM BQ788, BQ610 inhibited the remaining specific [125I]ET-1 binding. Binding of an ET(B1)-selective agonist, [125I]IRL-1620, confirmed the presence of ET(B). ET(B) bound to ET-1 irreversibly, whereas binding to ET(A) demonstrated both reversible and irreversible components, and BQ610 and BQ788 bound reversibly. Reducing the incubation temperature to 0 degrees C did not alter the irreversible component of ET-1 binding. Hence, both ET(A) and ET(B) receptors are present on intact adult rat ventricular myocytes, and the ratio of ET(A):ET(B) binding sites is 4:1. Both receptor subtypes bind to ET-1 by a two-step association involving the formation of a tight receptor-ligand complex; however, the kinetics of ET-1 binding to ET(A) versus ET(B) differ.

Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

PubMed

Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

2016-12-15

The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

PubMed

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Anchoring protein crystals to mounting loops with hydrogel using inkjet technology.

PubMed

Shinoda, Akira; Tanaka, Yoshikazu; Yao, Min; Tanaka, Isao

2014-11-01

X-ray crystallography is an important technique for structure-based drug discovery, mainly because it is the only technique that can reveal whether a ligand binds to the target protein as well as where and how it binds. However, ligand screening by X-ray crystallography involves a crystal-soaking experiment, which is usually performed manually. Thus, the throughput is not satisfactory for screening large numbers of candidate ligands. In this study, a technique to anchor protein crystals to mounting loops by using gel and inkjet technology has been developed; the method allows soaking of the mounted crystals in ligand-containing solution. This new technique may assist in the design of a fully automated drug-screening pipeline.

Computational structural analysis of an anti-l-amino acid antibody and inversion of its stereoselectivity

PubMed Central

Ranieri, Daniel I.; Hofstetter, Heike; Hofstetter, Oliver

2009-01-01

The binding site of a monoclonal anti-l-amino acid antibody was modeled using the program SWISS-MODEL. Docking experiments with the enantiomers of phenylalanine revealed that the antibody interacts with l-phenylalanine via hydrogen bonds and hydrophobic contacts, whereas the d-enantiomer is rejected due to steric hindrance. Comparison of the sequences of this antibody and an anti-d-amino acid antibody indicates that both immunoglobulins derived from the same germline progenitor. Substitution of four amino acids residues, three in the framework and one in the complementarity determining regions, allowed in silico conversion of the anti-l-amino acid antibody into an antibody that stereoselectively binds d-phenylalanine. PMID:19472280

Small ubiquitin-related modifier is secreted and shows cytokine-like activity.

PubMed

Hosono, Hidetaka; Yokosawa, Hideyoshi

2008-05-01

Small ubiquitin-related modifier (SUMO) is a type I ubiquitin-like protein family member and is covalently attached to various target proteins. Through this post-translational modification, SUMO plays important roles in various cellular events. Here, we show that SUMO is secreted from cultured cells in an endoplasmic reticulum (ER)/Golgi-independent manner and that this secretion occurs without covalent binding to target proteins or chain formation. Overexpression experiments using C-terminally truncated mutants of SUMO revealed that the secretion requires the C-terminal sequence. Recombinant SUMO-3 protein was capable of binding to and promoting the proliferation of cultured cells. Thus, we propose that SUMO functions as a cytokine-like molecule extracellularly.

SMC condensation centers in Bacillus subtilis are dynamic structures.

PubMed

Kleine Borgmann, Luise A K; Hummel, Hanna; Ulbrich, Maximilian H; Graumann, Peter L

2013-05-01

SMC and MukB complexes consist of a central SMC dimer and two essential binding partners, ScpA and ScpB (MukE and MukF), and are crucial for correct chromosome compaction and segregation. The complexes form two bipolar assemblies on the chromosome, one in each cell half. Using fluorescence recovery after photobleaching (FRAP), we provide evidence that the SMC complex has high exchange rates. This depends to a considerable degree on de novo protein synthesis, revealing that the bacterial SMC complex has high on and off rates for binding to the chromosome. A mutation in SMC that affects ATPase activity and results in exaggerated DNA binding in vitro causes a strong segregation defect in vivo and affects the localization of the entire SMC complex, which localizes to many more sites in the cell than under normal conditions. These data indicate that ATP turnover is important for the function of Bacillus subtilis SMC. In contrast, the centromere protein Spo0J and DNA gyrase showed much less exchange between distinct binding sites on the chromosome than that seen with SMC. Binding of Spo0J to the origin regions was rather static and remained partially conserved until the next cell cycle. Our experiments reveal that the SMC complex has a high, condensin-like turnover rate and that an alteration of the ATPase cycle affects SMC function in vivo, while several nucleoid-associated proteins feature limited or slow exchange between different sites on the nucleoid, which may be the basis for epigenetic-like phenomena observed in bacteria.

Functional roles of H98 and W99 and β2α2 loop dynamics in the α-l-arabinofuranosidase from Thermobacillus xylanilyticus.

PubMed

Arab-Jaziri, Faten; Bissaro, Bastien; Barbe, Sophie; Saurel, Olivier; Débat, Hélène; Dumon, Claire; Gervais, Virginie; Milon, Alain; André, Isabelle; Fauré, Régis; O'Donohue, Michael J

2012-10-01

This study is focused on the elucidation of the functional role of the mobile β2α2 loop in the α-L-arabinofuranosidase from Thermobacillus xylanilyticus, and particularly on the roles of loop residues H98 and W99. Using site-directed mutagenesis, coupled to characterization methods including isothermal titration calorimetry (ITC) and saturation transfer difference nuclear magnetic resonance (STD-NMR) spectroscopy, and molecular dynamics simulations, it has been possible to provide a molecular level view of interactions and the consequences of mutations. Binding of para-nitrophenyl α-L-arabinofuranoside (pNP-α-l-Araf) to the wild-type arabinofuranosidase was characterized by K(d) values (0.32 and 0.16 mm, from ITC and STD-NMR respectively) that highly resembled that of the arabinoxylo-oligosaccharide XA(3)XX (0.21 mm), and determination of the thermodynamic parameters of enzyme : pNP-α-L-Araf binding revealed that this process is driven by favourable entropy, which is linked to the movement of the β2α2 loop. Loop closure relocates the solvent-exposed W99 into a buried location, allowing its involvement in substrate binding and in the formation of a functional active site. Similarly, the data underline the role of H98 in the ‘dynamic’ formation and definition of a catalytically operational active site, which may be a specific feature of a subset of GH51 arabinofuranosidases. Substitution of H98 and W99 by alanine or phenylalanine revealed that mutations affected K(M) and/or k(cat). Molecular dynamics performed on W99A implied that this mutation causes the loss of a hydrogen bond and leads to an alternative binding mode that is detrimental for catalysis. STD-NMR experiments revealed altered binding of the aglycon motif in the active site, combined with reduced STD intensities of the α-L-arabinofuranosyl moiety for W99 substitutions. © 2012 The Authors Journal compilation © 2012 FEBS.

Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo

Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding tomore » the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.« less

A Cross-Species Study of PI3K Protein-Protein Interactions Reveals the Direct Interaction of P85 and SHP2

NASA Astrophysics Data System (ADS)

Breitkopf, Susanne B.; Yang, Xuemei; Begley, Michael J.; Kulkarni, Meghana; Chiu, Yu-Hsin; Turke, Alexa B.; Lauriol, Jessica; Yuan, Min; Qi, Jie; Engelman, Jeffrey A.; Hong, Pengyu; Kontaridis, Maria I.; Cantley, Lewis C.; Perrimon, Norbert; Asara, John M.

2016-02-01

Using a series of immunoprecipitation (IP) - tandem mass spectrometry (LC-MS/MS) experiments and reciprocal BLAST, we conducted a fly-human cross-species comparison of the phosphoinositide-3-kinase (PI3K) interactome in a drosophila S2R+ cell line and several NSCLC and human multiple myeloma cell lines to identify conserved interacting proteins to PI3K, a critical signaling regulator of the AKT pathway. Using H929 human cancer cells and drosophila S2R+ cells, our data revealed an unexpected direct binding of Corkscrew, the drosophila ortholog of the non-receptor protein tyrosine phosphatase type II (SHP2) to the Pi3k21B (p60) regulatory subunit of PI3K (p50/p85 human ortholog) but no association with Pi3k92e, the human ortholog of the p110 catalytic subunit. The p85-SHP2 association was validated in human cell lines, and formed a ternary regulatory complex with GRB2-associated-binding protein 2 (GAB2). Validation experiments with knockdown of GAB2 and Far-Western blots proved the direct interaction of SHP2 with p85, independent of adaptor proteins and transfected FLAG-p85 provided evidence that SHP2 binding on p85 occurred on the SH2 domains. A disruption of the SHP2-p85 complex took place after insulin/IGF1 stimulation or imatinib treatment, suggesting that the direct SHP2-p85 interaction was both independent of AKT activation and positively regulates the ERK signaling pathway.

Interaction of Chelerythrine with Keyhole Limpet Hemocyanin: a Fluorescence Spectroscopy and Molecular Docking Study

NASA Astrophysics Data System (ADS)

Zhong, M.; Long, R. Q.; Wang, Y. H.; Chen, C. L.

2018-05-01

The quenching mechanism between chelerythrine (CHE) and keyhole limpet hemocyanin (KLH) was investigated using fluorescence spectroscopy and molecular docking. The experiments were conducted at three different temperatures (293, 298, and 303 K). The results revealed that the intrinsic fluorescence of KLH was strongly quenched by CHE through a static quenching mechanism. The thermodynamic parameters (ΔG, ΔH, and ΔS) of the interaction were calculated, indicating that the interaction between CHE and KLH was spontaneous and that van der Waals forces and hydrogen bond formation played major roles in the binding process. The intrinsic fluorescence of the tyrosine and tryptophan residues in KLH was studied by synchronous fluorescence, which suggested that CHE changed the conformation of KLH. Finally, molecular docking was used to obtain detailed information on the binding sites and binding affinities between CHE and KLH.

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

PubMed

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selective Nitrate Recognition by a Halogen‐Bonding Four‐Station [3]Rotaxane Molecular Shuttle

PubMed Central

Barendt, Timothy A.; Docker, Andrew; Marques, Igor; Félix, Vítor

2016-01-01

Abstract The synthesis of the first halogen bonding [3]rotaxane host system containing a bis‐iodo triazolium‐bis‐naphthalene diimide four station axle component is reported. Proton NMR anion binding titration experiments revealed the halogen bonding rotaxane is selective for nitrate over the more basic acetate, hydrogen carbonate and dihydrogen phosphate oxoanions and chloride, and exhibits enhanced recognition of anions relative to a hydrogen bonding analogue. This elaborate interlocked anion receptor functions via a novel dynamic pincer mechanism where upon nitrate anion binding, both macrocycles shuttle from the naphthalene diimide stations at the periphery of the axle to the central halogen bonding iodo‐triazolium station anion recognition sites to form a unique 1:1 stoichiometric nitrate anion–rotaxane sandwich complex. Molecular dynamics simulations carried out on the nitrate and chloride halogen bonding [3]rotaxane complexes corroborate the 1H NMR anion binding results. PMID:27436297

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

Synthesis and crystal structure determination of copper(II)-complex: In vitro DNA and HSA binding, pBR322 plasmid cleavage, cell imaging and cytotoxic studies.

PubMed

Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh

2014-08-18

New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Epitope mapping of histo blood group antigens bound to norovirus VLPs using STD NMR experiments reveals fine details of molecular recognition.

PubMed

Fiege, Brigitte; Leuthold, Mila; Parra, Francisco; Dalton, Kevin P; Meloncelli, Peter J; Lowary, Todd L; Peters, Thomas

2017-10-01

Attachment of human noroviruses to histo blood group antigens (HBGAs) is thought to be critical for the infection process. Therefore, we have determined binding epitopes of synthetic type 1 to 6 blood group A- and B-tetrasaccharides binding to GII.4 human Norovirus virus like particles (VLPs) using STD NMR experiments. So far, little information is available from crystal structure analysis studies on the interactions of the reducing-end sugars with the protruding domain (P-domain) of the viral coat protein VP1. Here, we show that the reducing-end sugars make notable contacts with the protein surface. The type of glycosidic linkage, and the identity of the sugar at the reducing end modulate HBGA recognition. Most strikingly, type 2 structures yield only very poor saturation transfer indicating impeded binding. This observation is in accordance with previous mass spectrometry based affinity measurements, and can be understood based on recent crystal structure data of a complex of highly homologous GII.4 P-dimers with H-type 2 trisaccharide where the N-acetyl group of the reducing N-acetyl glucosamine residue points towards a loop comprising amino acids Q390 to H395. We suggest that in our case, binding of type 2 A- and B-tetrasaccharides leads to steric conflicts with this loop. In order to identify factors determining L-Fuc recognition, we also synthesized GII.4 VLPs with point mutations D391A and H395A. Prior studies had suggested that these residues, located in a second shell around the L-Fuc binding site, assist L-Fuc binding. STD NMR experiments with L-Fuc and B-trisaccharide in the presence of wild type and mutant VLPs yield virtually identical binding epitopes suggesting that these two mutations do not significantly alter HBGA recognition. Our study emphasizes that recognition of α-(1→2)-linked L-Fuc residues is a conserved feature of GII.4 noroviruses. However, structural variation of the HBGA core structures clearly modulates molecular recognition depending on the genotype.

Synthesis, structure, DNA/protein binding, and cytotoxic activity of a rhodium(III) complex with 2,6-bis(2-benzimidazolyl)pyridine.

PubMed

Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh

2017-02-15

A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Blocking the Interactions between Calcium-Bound S100A12 Protein and the V Domain of RAGE Using Tranilast

PubMed Central

Chiou, Jian Wei; Fu, Brian

2016-01-01

The receptor for advanced glycation end products (RAGE), a transmembrane receptor in the immunoglobulin superfamily, is involved in several inflammatory processes. RAGE induces cellular signaling pathways upon binding with various ligands, such as advanced glycation end products (AGEs), β-amyloids, and S100 proteins. The solution structure of S100A12 and the V ligand-binding region of RAGE have been reported previously. Using heteronuclear NMR spectroscopy to conduct 1H–15N heteronuclear single quantum coherence (HSQC) titration experiments, we identified and mapped the binding interface between S100A12 and the V domain of RAGE. The NMR chemical shift data were used as the constraints for the High Ambiguity Driven biomolecular DOCKing (HADDOCK) calculation to generate a structural model of the S100A12–V domain complex. In addition, tranilast (an anti-allergic drug) showed strong interaction with S100A12 in the 1H–15N HSQC titration, fluorescence experiments, and WST-1 assay. The results also indicated that tranilast was located at the binding site between S100A12 and the V domain, blocking interaction between these two proteins. Our results provide the mechanistic details for a structural model and reveal a potential precursor for an inhibitor for pro-inflammatory diseases, which could be useful for the development of new drugs. PMID:27598566

Intermolecular interaction of fosinopril with bovine serum albumin (BSA): The multi-spectroscopic and computational investigation.

PubMed

Zhou, Kai-Li; Pan, Dong-Qi; Lou, Yan-Yue; Shi, Jie-Hua

2018-04-16

The intermolecular interaction of fosinopril, an angiotensin converting enzyme inhibitor with bovine serum albumin (BSA), has been investigated in physiological buffer (pH 7.4) by multi-spectroscopic methods and molecular docking technique. The results obtained from fluorescence and UV absorption spectroscopy revealed that the fluorescence quenching mechanism of BSA induced by fosinopril was mediated by the combined dynamic and static quenching, and the static quenching was dominant in this system. The binding constant, K b , value was found to lie between 2.69 × 10 3 and 9.55 × 10 3  M -1 at experimental temperatures (293, 298, 303, and 308 K), implying the low or intermediate binding affinity between fosinopril and BSA. Competitive binding experiments with site markers (phenylbutazone and diazepam) suggested that fosinopril preferentially bound to the site I in sub-domain IIA on BSA, as evidenced by molecular docking analysis. The negative sign for enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) indicated that van der Waals force and hydrogen bonds played important roles in the fosinopril-BSA interaction, and 8-anilino-1-naphthalenesulfonate binding assay experiments offered evidence of the involvements of hydrophobic interactions. Moreover, spectroscopic results (synchronous fluorescence, 3-dimensional fluorescence, and Fourier transform infrared spectroscopy) indicated a slight conformational change in BSA upon fosinopril interaction. Copyright © 2018 John Wiley & Sons, Ltd.

Control of interference during working memory updating.

PubMed

Szmalec, Arnaud; Verbruggen, Frederick; Vandierendonck, André; Kemps, Eva

2011-02-01

The current study examined the nature of the processes underlying working memory updating. In 4 experiments using the n-back paradigm, the authors demonstrate that continuous updating of items in working memory prevents strong binding of those items to their contexts in working memory, and hence leads to an increased susceptibility to proactive interference. Results of Experiments 1 and 2 show that this interference reflects a competition between a process that reveals the degree of familiarity of an item and a context-sensitive recollection process that depends on the strength of bindings in working memory. Experiment 3 further clarifies the origins of interference during updating by demonstrating that even items that are semantically related to the updated working memory contents but that have not been maintained in working memory before cause proactive interference. Finally, the results of Experiment 4 indicate that the occurrence of interference leads to top-down behavioral adjustments that prioritize recollection over familiarity assessment. The implications of these findings for the construct validity of the n-back task, for the control processes involved in working memory updating, and for the concept of executive control more generally are discussed. (c) 2010 APA, all rights reserved.

Thermodynamic and conformational analysis of the interaction between antibody binding proteins and IgG.

PubMed

Tanwar, Neetu; Munde, Manoj

2018-06-01

Studying interaction of IgG with bacterial proteins such as proA (Protein A) and proG is essential for development in the areas of drug discovery and biotechnology. Some solution studies in the past have hinted at the possibility of variable binding ratios for IgG with proA and proG. Since earlier crystallographic studies focussed mostly on monomeric complexes, the knowledge about the binding interfaces and protein conformational changes involved in multimeric complexes is scarce. In this paper, we observed that single proA molecule was able to bind to three IgG molecules (1:3, proA:IgG) in ITC accentuating the presence of conformational flexibility in proA, corroborated also by CD results. By contrast, proG binds with 1:1 stoichiometry to IgG, which also involves key structural rearrangement within the binding interface of IgG-proG complex, confirmed by fluorescence KI quenching study. It is implicit from CD and fluorescence results that IgG does not undergo any significant conformational changes, which further suggests that proA and proG dictate the phenomenon of recognition in antibody complexes. ANS as a hydrophobic probe helped in revealing the distinctive antibody binding mechanism of proA and proG. Additionally, the binding competition experiments using ITC established that proA and proG cannot bind IgG concurrently. Copyright © 2018. Published by Elsevier B.V.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strittmatter, S.M.; Snyder, S.H.

We demonstrate that (3H)captopril selectively labels angiotensin converting enzyme (EC 3.14.15.1) (ACE) and employ this technique to probe enzyme-inhibitor interactions. (3H)Captopril binding sites copurify with ACE activity from rat lung or rat brain. At each stage of the purification the Vmax/Bmax ratio, or kcat is 17,000 min-1 with hippuryl-L-histidyl-L-leucine as substrate. The specificity of (3H)captopril binding is apparent in the similar pharmacologic profile of inhibition in crude and pure enzyme preparations. Furthermore, binding sites and enzyme activity comigrate in gel filtration and sucrose gradient sedimentation experiments. Equilibrium analysis of (3H)captopril binding to purified ACE reveals a Bmax of 6 nmol/mgmore » of protein (KD = 2 nM), demonstrating the presence of one inhibitor binding site per polypeptide chain. The kinetics of (3H)captopril binding are characterized by monophasic association and dissociation rate constants of 0.026 nM-1 min-1 and 0.034 min-1, respectively. The affinity of ACE for both (3H) captopril and enalaprilat is greater at 37 degrees than at 0 degree, demonstrating that these interactions are entropically driven, perhaps by an isomerization of the enzyme molecule. The ionic requirements for (3H)captopril binding and substrate catalysis differ. Chloride and bromide ion, but not fluoride, are about 100-fold more potent stimulators of binding than catalysis. When the active site Zn2+ ion is replaced by Co2+, catalysis was stimulated 2-fold, whereas binding activity was decreased by 70%.« less

Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

PubMed

Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

2018-05-04

Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.)

PubMed Central

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W.; Hochholdinger, Frank

2012-01-01

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize. PMID:22527397

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.).

PubMed

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W; Hochholdinger, Frank

2012-06-05

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize.

Decipher the mechanisms of protein conformational changes induced by nucleotide binding through free-energy landscape analysis: ATP binding to Hsp70.

PubMed

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins.

Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

PubMed Central

Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick

2013-01-01

ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins. PMID:24348227

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gencoglu, Maria F.; Spurri, Amanda; Franko, Mitchell

We report that soft-templated mesoporous carbon is morphologically a non-nano type of carbon. It is a relatively newer variety of biomaterial, which has already demonstrated its successful role in drug delivery applications. To investigate the toxicity and biocompatibility, we introduced three types of mesoporous carbons with varying synthesis conditions and pore textural properties. We compared the Brunauer–Emmett–Teller (BET) surface area and pore width and performed cytotoxicity experiments with HeLa cells, cell viability studies with fibroblast cells and hemocomapatibility studies. Cytotoxicity tests reveal that two of the carbons are not cytotoxic, with cell survival over 90%. The mesoporous carbon with themore » highest surface area showed slight toxicity (~70% cell survival) at the highest carbon concentration of 500 μg/mL. Fibroblast cell viability assays suggested high and constant viability of over 98% after 3 days with no apparent relation with materials property and good visible cell-carbon compatibility. No hemolysis (<1%) was confirmed for all the carbon materials. Protein adsorption experiments with bovine serum albumin (BSA) and fibrinogen revealed a lower protein binding capacity of 0.2–0.6 mg/m 2 and 2–4 mg/m 2 for BSA and fibrinogen, respectively, with lower binding associated with an increase in surface area. The results of this study confirm the biocompatibility of soft-templated mesoporous carbons.« less

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

In vitro study on binding interaction of quinapril with bovine serum albumin (BSA) using multi-spectroscopic and molecular docking methods.

PubMed

Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi

2017-08-01

The binding interaction between quinapril (QNPL) and bovine serum albumin (BSA) in vitro has been investigated using UV absorption spectroscopy, steady-state fluorescence spectroscopic, synchronous fluorescence spectroscopy, 3D fluorescence spectroscopy, Fourier transform infrared spectroscopy, circular dichroism, and molecular docking methods for obtaining the binding information of QNPL with BSA. The experimental results confirm that the quenching mechanism of the intrinsic fluorescence of BSA induced by QNPL is static quenching based on the decrease in the quenching constants of BSA in the presence of QNPL with the increase in temperature and the quenching rates of BSA larger than 10 10  L mol -1  s -1 , indicating forming QNPL-BSA complex through the intermolecular binding interaction. The binding constant for the QNPL-BSA complex is in the order of 10 5  M -1 , indicating there is stronger binding interaction of QNPL with BSA. The analysis of thermodynamic parameters together with molecular docking study reveal that the main binding forces in the binding process of QNPL with BSA are van der Waal's forces and hydrogen bonding interaction. And, the binding interaction of BSA with QNPL is an enthalpy-driven process. Based on Förster resonance energy transfer, the binding distance between QNPL and BSA is calculated to be 2.76 nm. The results of the competitive binding experiments and molecular docking confirm that QNPL binds to sub-domain IIA (site I) of BSA. It is confirmed there is a slight change in the conformation of BSA after binding QNPL, but BSA still retains its secondary structure α-helicity.

Silencing of Chemosensory Protein Gene NlugCSP8 by RNAi Induces Declining Behavioral Responses of Nilaparvata lugens

PubMed Central

Waris, Muhammad I.; Younas, Aneela; ul Qamar, Muhammad T.; Hao, Liu; Ameen, Asif; Ali, Saqib; Abdelnabby, Hazem Elewa; Zeng, Fang-Fang; Wang, Man-Qun

2018-01-01

Chemosensory proteins (CSPs) play imperative functions in chemical and biochemical signaling of insects, as they distinguish and transfer ecological chemical indications to a sensory system in order to initiate behavioral responses. The brown planthopper (BPH), Nilaparvata lugens Stål (Hemiptera: Delphacidae), has emerged as the most destructive pest, causing serious damage to rice in extensive areas throughout Asia. Biotic characteristics like monophagy, dual wing forms, and annual long-distance migration imply a critical role of chemoreception in N. lugens. In this study, we cloned the full-length CSP8 gene from N. lugens. Protein sequence analysis indicated that NlugCSP8 shared high sequence resemblance with the CSPs of other insect family members and had the typical four-cysteine signature. Analysis of gene expression indicated that NlugCSP8 mRNA was specifically expressed in the wings of mated 3-day brachypterous females with a 175-fold difference compare to unmated 3-day brachypterous females. The NlugCSP8 mRNA was also highly expressed in the abdomen of unmated 5-day brachypterous males and correlated to the age, gender, adult wing form, and mating status. A competitive ligand-binding assay demonstrated that ligands with long chain carbon atoms, nerolidol, hexanal, and trans-2-hexenal were able to bind to NlugCSP8 in declining order of affinity. By using bioinformatics techniques, three-dimensional protein structure modeling and molecular docking, the binding sites of NlugCSP8 to the volatiles which had high binding affinity were predicted. In addition, behavioral experiments using the compounds displaying the high binding affinity for the NlugCSP8, revealed four compounds able to elicit significant behavioral responses from N. lugens. The in vivo functions of NlugCSP8 were further confirmed through the testing of RNAi and post-RNAi behavioral experiments. The results revealed that reduction in NlugCSP8 transcript abundance caused a decrease in behavioral response to representative attractants. An enhanced understanding of the NlugCSP8 is expected to contribute in the improvement of more effective and eco-friendly control strategies of BPH. PMID:29706901

Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

PubMed Central

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

2015-01-01

SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

Exploiting Uniformly 13C-Labeled Carbohydrates for Probing Carbohydrate-Protein Interactions by NMR Spectroscopy.

PubMed

Nestor, Gustav; Anderson, Taigh; Oscarson, Stefan; Gronenborn, Angela M

2017-05-03

NMR of a uniformly 13 C-labeled carbohydrate was used to elucidate the atomic details of a sugar-protein complex. The structure of the 13 C-labeled Manα(1-2)Manα(1-2)ManαOMe trisaccharide ligand, when bound to cyanovirin-N (CV-N), was characterized and revealed that in the complex the glycosidic linkage torsion angles between the two reducing-end mannoses are different from the free trisaccharide. Distances within the carbohydrate were employed for conformational analysis, and NOE-based distance mapping between sugar and protein revealed that Manα(1-2)Manα(1-2)ManαOMe is bound more intimately with its two reducing-end mannoses into the domain A binding site of CV-N than with the nonreducing end unit. Taking advantage of the 13 C spectral dispersion of 13 C-labeled carbohydrates in isotope-filtered experiments is a versatile means for a simultaneous mapping of the binding interactions on both, the carbohydrate and the protein.

Mapping of Adenovirus of serotype 3 fibre interaction to desmoglein 2 revealed a novel 'non-classical' mechanism of viral receptor engagement.

PubMed

Vassal-Stermann, Emilie; Mottet, Manon; Ducournau, Corinne; Iseni, Frédéric; Vragniau, Charles; Wang, Hongjie; Zubieta, Chloe; Lieber, André; Fender, Pascal

2018-05-30

High-affinity binding of the trimeric fibre protein to a cell surface primary receptor is a common feature shared by all adenovirus serotypes. Recently, a long elusive species B adenovirus receptor has been identified. Desmoglein 2 (DSG2) a component of desmosomal junction, has been reported to interact at high affinity with Human adenoviruses HAd3, HAd7, HAd11 and HAd14. Little is known with respect to the molecular interactions of adenovirus fibre with the DSG2 ectodomain. By using different DSG2 ectodomain constructs and biochemical and biophysical experiments, we report that the third extracellular cadherin domain (EC3) of DSG2 is critical for HAd3 fibre binding. Unexpectedly, stoichiometry studies using multi-angle laser light scattering (MALLS) and analytical ultra-centrifugation (AUC) revealed a non-classical 1:1 interaction (one DSG2 per trimeric fibre), thus differentiating 'DSG2-interacting' adenoviruses from other protein receptor interacting adenoviruses in their infection strategy.

H3.Y discriminates between HIRA and DAXX chaperone complexes and reveals unexpected insights into human DAXX-H3.3-H4 binding and deposition requirements

PubMed Central

Zink, Lisa-Maria; Delbarre, Erwan; Eberl, H. Christian; Keilhauer, Eva C.; Bönisch, Clemens; Pünzeler, Sebastian; Bartkuhn, Marek; Collas, Philippe; Mann, Matthias

2017-01-01

Abstract Histone chaperones prevent promiscuous histone interactions before chromatin assembly. They guarantee faithful deposition of canonical histones and functionally specialized histone variants into chromatin in a spatial- and temporally-restricted manner. Here, we identify the binding partners of the primate-specific and H3.3-related histone variant H3.Y using several quantitative mass spectrometry approaches, and biochemical and cell biological assays. We find the HIRA, but not the DAXX/ATRX, complex to recognize H3.Y, explaining its presence in transcriptionally active euchromatic regions. Accordingly, H3.Y nucleosomes are enriched in the transcription-promoting FACT complex and depleted of repressive post-translational histone modifications. H3.Y mutational gain-of-function screens reveal an unexpected combinatorial amino acid sequence requirement for histone H3.3 interaction with DAXX but not HIRA, and for H3.3 recruitment to PML nuclear bodies. We demonstrate the importance and necessity of specific H3.3 core and C-terminal amino acids in discriminating between distinct chaperone complexes. Further, chromatin immunoprecipitation sequencing experiments reveal that in contrast to euchromatic HIRA-dependent deposition sites, human DAXX/ATRX-dependent regions of histone H3 variant incorporation are enriched in heterochromatic H3K9me3 and simple repeat sequences. These data demonstrate that H3.Y's unique amino acids allow a functional distinction between HIRA and DAXX binding and its consequent deposition into open chromatin. PMID:28334823

Direct observation of a single nanoparticle-ubiquitin corona formation

NASA Astrophysics Data System (ADS)

Ding, Feng; Radic, Slaven; Chen, Ran; Chen, Pengyu; Geitner, Nicholas K.; Brown, Jared M.; Ke, Pu Chun

2013-09-01

The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate, transport, and toxicity of nanomaterials in living systems and for enabling the vast applications of nanomedicine. Here we combined multiscale molecular dynamics simulations and complementary experiments to characterize the silver nanoparticle-ubiquitin corona formation. Notably, ubiquitins competed with citrates for the nanoparticle surface, governed by specific electrostatic interactions. Under a high protein/nanoparticle stoichiometry, ubiquitins formed a multi-layer corona on the particle surface. The binding exhibited an unusual stretched-exponential behavior, suggesting a rich binding kinetics. Furthermore, the binding destabilized the α-helices while increasing the β-sheet content of the proteins. This study revealed the atomic and molecular details of the structural and dynamic characteristics of nanoparticle-protein corona formation.The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate, transport, and toxicity of nanomaterials in living systems and for enabling the vast applications of nanomedicine. Here we combined multiscale molecular dynamics simulations and complementary experiments to characterize the silver nanoparticle-ubiquitin corona formation. Notably, ubiquitins competed with citrates for the nanoparticle surface, governed by specific electrostatic interactions. Under a high protein/nanoparticle stoichiometry, ubiquitins formed a multi-layer corona on the particle surface. The binding exhibited an unusual stretched-exponential behavior, suggesting a rich binding kinetics. Furthermore, the binding destabilized the α-helices while increasing the β-sheet content of the proteins. This study revealed the atomic and molecular details of the structural and dynamic characteristics of nanoparticle-protein corona formation. Electronic supplementary information (ESI) available: Experimental and computational methods as well as supporting figures. See DOI: 10.1039/c3nr02147e

Comparison of the interaction between lactoferrin and isomeric drugs

NASA Astrophysics Data System (ADS)

Guo, Ming; Lu, Xiaowang; Wang, Yan; Brodelius, Peter E.

2017-02-01

The binding properties of pentacyclic triterpenoid isomeric drugs, i.e. ursolic acid (UA) and oleanolic acid (OA), to bovine lactoferrin (BLF) have been studied by molecule modeling, fluorescence spectroscopy, UV-visible absorbance spectroscopy and infrared spectroscopy (IR). Molecular docking, performed to reveal the possible binding mode or mechanism, suggested that hydrophobic interaction and hydrogen bonding play important roles to stabilize the complex. The results of spectroscopic measurements showed that the two isomeric drugs both strongly quenched the intrinsic fluorescence of BLF through a static quenching procedure although some differences between UA and OA binding strength and non-radiation energy transfer occurred within the molecules. The number of binding sites was 3.44 and 3.10 for UA and OA, respectively, and the efficiency of Förster energy transfer provided a distance of 0.77 and 1.21 nm for UA and OA, respectively. The conformation transformation of BLF affected by the drugs conformed to the ;all-or-none; pattern. In addition, the changes of the ratios of α-helices, β-sheets and β-turns of BLF during the process of the interaction were obtained. The results of the experiments in combination with the calculations showed that there are two modes of pentacyclic triterpenoid binding to BLF instead of one binding mode only governed by the principle of the lowest bonding energy.

Thermometric sensing of nitrofurantoin by noncovalently imprinted polymers containing two complementary functional monomers.

PubMed

Athikomrattanakul, Umporn; Gajovic-Eichelmann, Nenad; Scheller, Frieder W

2011-10-15

Molecularly imprinted polymers (MIPs) for nitrofurantoin (NFT) recognition addressing in parallel of two complementary functional groups were created using a noncovalent imprinting approach. Specific tailor-made functional monomers were synthesized: a diaminopyridine derivative as the receptor for the imide residue and three (thio)urea derivatives for the interaction with the nitro group of NFT. A significantly improved binding of NFT to the new MIPs was revealed from the imprinting factor, efficiency of binding, affinity constants and maximum binding number as compared to previously reported MIPs, which addressed either the imide or the nitro residue. Substances possessing only one functionality (either the imide group or nitro group) showed significantly weaker binding to the new imprinted polymers than NFT. However, the compounds lacking both functionalities binds extremely weak to all imprinted polymers. The new imprinted polymers were applied in a flow-through thermistor in organic solvent for the first time. The MIP-thermistor allows the detection of NFT down to a concentration of 5 μM in acetonitrile + 0.2% dimethyl sulfoxide (DMSO). The imprinting factor of 3.91 at 0.1 mM of NFT as obtained by thermistor measurements is well comparable to the value obtained by batch binding experiments. © 2011 American Chemical Society

Fragment-based screen against HIV protease.

PubMed

Perryman, Alexander L; Zhang, Qing; Soutter, Holly H; Rosenfeld, Robin; McRee, Duncan E; Olson, Arthur J; Elder, John E; Stout, C David

2010-03-01

We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 A resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the 'exo site' adjacent to the Gly(16)Gly(17)Gln(18)loop where the amide of Gly(17)is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys(14)and Leu(63). Another fragment, indole-6-carboxylic acid, binds on the 'outside/top of the flap' via hydrophobic contacts with Trp(42), Pro(44), Met(46), and Lys(55), a hydrogen bond with Val(56), and a salt-bridge with Arg(57). 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target.

Fragment-Based Screen against HIV Protease

PubMed Central

Perryman, A. L.; Zhang, Q.; Soutter, H. H.; Rosenfeld, R.; McRee, D. E.; Olson, A. J.; Elder, J. E.; Stout, C. D.

2009-01-01

We have employed a fragment-based screen against wild-type (NL4-3) HIV protease (PR) using the Active Sight fragment library and X-ray crystallography. The experiments reveal two new binding sites for small molecules. PR was co-crystallized with fragments, or crystals were soaked in fragment solutions, using five crystal forms, and 378 data sets were collected to 2.3-1.3 Å resolution. Fragment binding induces a distinct conformation and specific crystal form of TL-3 inhibited PR during co-crystallization. One fragment, 2-methylcyclohexanol, binds in the ‘exo site’ adjacent to the Gly16Gly17Gln18 loop where the amide of Gly17 is a specific hydrogen bond donor, and hydrophobic contacts occur with the side chains of Lys14 and Leu63. Another fragment, indole-6-carboxylic acid, binds on the ‘outside/top of the flap’ via hydrophobic contacts with Trp42, Pro44, Met46, and Lys55, a hydrogen bond with Val56, and a salt-bridge with Arg57. 2-acetyl-benzothiophene also binds at this site. This study is the first fragment-based crystallographic screen against HIV PR, and the first time that fragments were screened against an inhibitor-bound drug target to search for compounds that both bind to novel sites and stabilize the inhibited conformation of the target. PMID:20659109

Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

PubMed

DasGupta, G; White, J; Cheung, P; Reisler, E

1990-09-11

The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

Evidence for Conformationa1 Heterogeneity of Fission Protein Fis1 from Saccharomyces cerevisiae†

PubMed Central

Picton, Lora K.; Casares, Salvador; Monahan, Ann C.; Majumdar, Ananya; Hill, R. Blake

2009-01-01

Fission 1 (Fis1) is an evolutionarily conserved, type II integral membrane protein implicated in maintaining the proper morphology of mitochondria and peroxisomes. A concave surface on the cytosolic domain of Fis1 from Saccharomyces cerevisiae is implicated in binding other fission proteins, yet structural studies reveal that this surface is sterically occluded by its N-terminal arm. Here we address the question of whether the N-terminal arm of yeast Fis1 exists in a dynamic equilibrium that would allow access to this functionally important surface. NMR measurements sensitive to dynamics occurring on a wide range of time scales (picoseconds to minutes) were used to assess whether the Fis1 arm is dynamic. Hydrogen–deuterium exchange experiments revealed that the Fis1 arm, α-helix 6, and proximal loops were not protected from solvent exchange, consistent with motions on the second to minute time scale. An engineered cysteine, I85C, located on the concave surface that lies underneath the Fis1 arm, was readily modified by a fluorescent probe, revealing more solvent accessibility of this position than would be predicted from the structure. Chemical denaturation, NMR chemical shift perturbation, and residual dipolar coupling experiments support the idea that the dynamic equilibrium can be shifted on the basis of changing pH and temperature, with the changes primarily localizing to the Fis1 arm and proximal regions. The data as a whole are consistent with the Fis1 arm adopting a primarily “closed” conformational state able to undergo dynamic excursions that reveal the concave surface and therefore may be important for binding other fission factors and for Fis1 function. PMID:19522466

Force spectroscopy studies on protein-ligand interactions: a single protein mechanics perspective.

PubMed

Hu, Xiaotang; Li, Hongbin

2014-10-01

Protein-ligand interactions are ubiquitous and play important roles in almost every biological process. The direct elucidation of the thermodynamic, structural and functional consequences of protein-ligand interactions is thus of critical importance to decipher the mechanism underlying these biological processes. A toolbox containing a variety of powerful techniques has been developed to quantitatively study protein-ligand interactions in vitro as well as in living systems. The development of atomic force microscopy-based single molecule force spectroscopy techniques has expanded this toolbox and made it possible to directly probe the mechanical consequence of ligand binding on proteins. Many recent experiments have revealed how ligand binding affects the mechanical stability and mechanical unfolding dynamics of proteins, and provided mechanistic understanding on these effects. The enhancement effect of mechanical stability by ligand binding has been used to help tune the mechanical stability of proteins in a rational manner and develop novel functional binding assays for protein-ligand interactions. Single molecule force spectroscopy studies have started to shed new lights on the structural and functional consequence of ligand binding on proteins that bear force under their biological settings. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Structural basis of nucleic-acid recognition and double-strand unwinding by the essential neuronal protein Pur-alpha

PubMed Central

Weber, Janine; Bao, Han; Hartlmüller, Christoph; Wang, Zhiqin; Windhager, Almut; Janowski, Robert; Madl, Tobias; Jin, Peng; Niessing, Dierk

2016-01-01

The neuronal DNA-/RNA-binding protein Pur-alpha is a transcription regulator and core factor for mRNA localization. Pur-alpha-deficient mice die after birth with pleiotropic neuronal defects. Here, we report the crystal structure of the DNA-/RNA-binding domain of Pur-alpha in complex with ssDNA. It reveals base-specific recognition and offers a molecular explanation for the effect of point mutations in the 5q31.3 microdeletion syndrome. Consistent with the crystal structure, biochemical and NMR data indicate that Pur-alpha binds DNA and RNA in the same way, suggesting binding modes for tri- and hexanucleotide-repeat RNAs in two neurodegenerative RNAopathies. Additionally, structure-based in vitro experiments resolved the molecular mechanism of Pur-alpha's unwindase activity. Complementing in vivo analyses in Drosophila demonstrated the importance of a highly conserved phenylalanine for Pur-alpha's unwinding and neuroprotective function. By uncovering the molecular mechanisms of nucleic-acid binding, this study contributes to understanding the cellular role of Pur-alpha and its implications in neurodegenerative diseases. DOI: http://dx.doi.org/10.7554/eLife.11297.001 PMID:26744780

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Crystal structure of Yersinia pestis virulence factor YfeA reveals two polyspecific metal-binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Radka, Christopher D.; DeLucas, Lawrence J.; Wilson, Landon S.

2017-06-30

Gram-negative bacteria use siderophores, outer membrane receptors, inner membrane transporters and substrate-binding proteins (SBPs) to transport transition metals through the periplasm. The SBPs share a similar protein fold that has undergone significant structural evolution to communicate with a variety of differentially regulated transporters in the cell. InYersinia pestis, the causative agent of plague, YfeA (YPO2439, y1897), an SBP, is important for full virulence during mammalian infection. To better understand the role of YfeA in infection, crystal structures were determined under several environmental conditions with respect to transition-metal levels. Energy-dispersive X-ray spectroscopy and anomalous X-ray scattering data show that YfeA ismore » polyspecific and can alter its substrate specificity. In minimal-media experiments, YfeA crystals grown after iron supplementation showed a threefold increase in iron fluorescence emission over the iron fluorescence emission from YfeA crystals grown from nutrient-rich conditions, and YfeA crystals grown after manganese supplementation during overexpression showed a fivefold increase in manganese fluorescence emission over the manganese fluorescence emission from YfeA crystals grown from nutrient-rich conditions. In all experiments, the YfeA crystals produced the strongest fluorescence emission from zinc and could not be manipulated otherwise. Additionally, this report documents the discovery of a novel surface metal-binding site that prefers to chelate zinc but can also bind manganese. Flexibility across YfeA crystal forms in three loops and a helix near the buried metal-binding site suggest that a structural rearrangement is required for metal loading and unloading.« less

Computational study of Gleevec and G6G reveals molecular determinants of kinase inhibitor selectivity

DOE PAGES

Lin, Yen -Lin; Meng, Yilin; Huang, Lei; ...

2014-10-22

Gleevec is a potent inhibitor of Abl tyrosine kinase but not of the highly homologous c-Src kinase. Because the ligand binds to an inactive form of the protein in which an Asp-Phe-Gly structural motif along the activation loop adopts a so-called DFG-out conformation, it was suggested that binding specificity was controlled by a “conformational selection” mechanism. In this context, the binding affinity displayed by the kinase inhibitor G6G poses an intriguing challenge. Although it possesses a chemical core very similar to that of Gleevec, G6G is a potent inhibitor of both Abl and c-Src kinases. Both inhibitors bind to themore » DFG-out conformation of the kinases, which seems to be in contradiction with the conformational selection mechanism. To address this issue and display the hidden thermodynamic contributions affecting the binding selectivity, molecular dynamics free energy simulations with explicit solvent molecules were carried out. Relative to Gleevec, G6G forms highly favorable van der Waals dispersive interactions upon binding to the kinases via its triazine functional group, which is considerably larger than the corresponding pyridine moiety in Gleevec. Upon binding of G6G to c-Src, these interactions offset the unfavorable free energy cost of the DFG-out conformation. When binding to Abl, however, G6G experiences an unfavorable free energy penalty due to steric clashes with the phosphate-binding loop, yielding an overall binding affinity that is similar to that of Gleevec. Such steric clashes are absent when G6G binds to c-Src, due to the extended conformation of the phosphate-binding loop.« less

A kinetic and thermodynamic framework for the Azoarcus group I ribozyme reaction

PubMed Central

Gleitsman, Kristin R.

2014-01-01

Determination of quantitative thermodynamic and kinetic frameworks for ribozymes derived from the Azoarcus group I intron and comparisons to their well-studied analogs from the Tetrahymena group I intron reveal similarities and differences between these RNAs. The guanosine (G) substrate binds to the Azoarcus and Tetrahymena ribozymes with similar equilibrium binding constants and similar very slow association rate constants. These and additional literature observations support a model in which the free ribozyme is not conformationally competent to bind G and in which the probability of assuming the binding-competent state is determined by tertiary interactions of peripheral elements. As proposed previously, the slow binding of guanosine may play a role in the specificity of group I intron self-splicing, and slow binding may be used analogously in other biological processes. The internal equilibrium between ribozyme-bound substrates and products is similar for these ribozymes, but the Azoarcus ribozyme does not display the coupling in the binding of substrates that is observed with the Tetrahymena ribozyme, suggesting that local preorganization of the active site and rearrangements within the active site upon substrate binding are different for these ribozymes. Our results also confirm the much greater tertiary binding energy of the 5′-splice site analog with the Azoarcus ribozyme, binding energy that presumably compensates for the fewer base-pairing interactions to allow the 5′-exon intermediate in self splicing to remain bound subsequent to 5′-exon cleavage and prior to exon ligation. Most generally, these frameworks provide a foundation for design and interpretation of experiments investigating fundamental properties of these and other structured RNAs. PMID:25246656

Electropolymerized molecularly imprinted polypyrrole film for sensing of clofibric acid.

PubMed

Schweiger, Bianca; Kim, Jungtae; Kim, Young Jun; Ulbricht, Mathias

2015-02-26

Piezoelectric quartz crystals and analogous gold substrates were electrochemically coated with molecularly imprinted polypyrrole films for pulsed amperometric detection (PAD) of clofibric acid, a metabolite of clofibrate. Cyclic voltammetry data obtained during polymerization and deposited weight estimations revealed a decrease of the polymerization rate with increasing clofibric acid concentration. XPS measurements indicated that clofibric acid could be removed after imprinting with an aqueous ethanol solution, which was further optimized by using PAD. Zeta potential and contact angle measurements revealed differences between molecularly imprinted (MIP) and non-imprinted polymer (NIP) layers. Binding experiments with clofibric acid and other substances showed a pronounced selectivity of the MIP for clofibric acid vs. carbamazepine, but the response of MIP and NIP to 2,4-dichlorophenoxyacetic acid was higher than that for clofibric acid. A smooth surface, revealed by AFM measurements, with roughness of 6-8 nm for imprinted and non-imprinted layers, might be a reason for an excessively low density of specific binding sites for clofibric acid. Furthermore, the decreased polymerization rate in the presence of clofibric acid might not result in well-defined polymer structures, which could be the reason for the lower sensitivity.

Electropolymerized Molecularly Imprinted Polypyrrole Film for Sensing of Clofibric Acid

PubMed Central

Schweiger, Bianca; Kim, Jungtae; Kim, Young Jun; Ulbricht, Mathias

2015-01-01

Piezoelectric quartz crystals and analogous gold substrates were electrochemically coated with molecularly imprinted polypyrrole films for pulsed amperometric detection (PAD) of clofibric acid, a metabolite of clofibrate. Cyclic voltammetry data obtained during polymerization and deposited weight estimations revealed a decrease of the polymerization rate with increasing clofibric acid concentration. XPS measurements indicated that clofibric acid could be removed after imprinting with an aqueous ethanol solution, which was further optimized by using PAD. Zeta potential and contact angle measurements revealed differences between molecularly imprinted (MIP) and non-imprinted polymer (NIP) layers. Binding experiments with clofibric acid and other substances showed a pronounced selectivity of the MIP for clofibric acid vs. carbamazepine, but the response of MIP and NIP to 2,4-dichlorophenoxyacetic acid was higher than that for clofibric acid. A smooth surface, revealed by AFM measurements, with roughness of 6–8 nm for imprinted and non-imprinted layers, might be a reason for an excessively low density of specific binding sites for clofibric acid. Furthermore, the decreased polymerization rate in the presence of clofibric acid might not result in well-defined polymer structures, which could be the reason for the lower sensitivity. PMID:25730487

Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study

PubMed Central

Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

2011-01-01

Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570

Induction of dystrophin Dp71 expression during neuronal differentiation: opposite roles of Sp1 and AP2alpha in Dp71 promoter activity.

PubMed

Morales-Lázaro, Sara Luz; González-Ramírez, Ricardo; Gómez, Pablo; Tapia-Ramírez, Victor; de León, Mario Bermúdez; Cisneros, Bulmaro

2010-01-01

In this study, we delineated the molecular mechanisms that modulate Dp71 expression during neuronal differentiation, using the N1E-115 cell line. We demonstrated that Dp71 expression is up-regulated in response to cAMP-mediated neuronal differentiation of these cells, and that this induction is controlled at promoter level. Functional deletion analysis of the Dp71 promoter revealed that a 5'-flanking 159-bp DNA fragment that contains Sp1 and AP2 binding sites is necessary and sufficient for basal expression of this TATA-less promoter, as well as for its induction during neuronal differentiation. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that Sp1 and AP2alpha bind to their respective DNA elements within the Dp71 basal promoter. Overall, mutagenesis assays on the Sp1 and AP2 binding sites, over-expression of Sp1 and AP2alpha, as well as knock-down experiments on Sp1 and AP2alpha gene expression established that Dp71 basal expression is controlled by the combined action of Sp1 and AP2alpha, which act as activator and repressor, respectively. Furthermore, we demonstrated that induction of Dp71 expression in differentiated cells is the result of the maintenance of positive regulation exerted by Sp1, as well as of the loss of AP2alpha binding, which ultimately releases the promoter from repression.

Stochastic steps in secondary active sugar transport

PubMed Central

Adelman, Joshua L.; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D. F.; Choe, Seungho; Abramson, Jeff; Rosenberg, John M.; Wright, Ernest M.; Grabe, Michael

2016-01-01

Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state. PMID:27325773

Sensing of Double-Stranded DNA/RNA Secondary Structures by Water Soluble Homochiral Perylene Bisimide Dyes.

PubMed

Gershberg, Jana; Radić Stojković, Marijana; Škugor, Marko; Tomić, Sanja; Rehm, Thomas H; Rehm, Stefanie; Saha-Möller, Chantu R; Piantanida, Ivo; Würthner, Frank

2015-05-18

A broad series of homochiral perylene bisimide (PBI) dyes were synthesized that are appended with amino acids and cationic side chains at the imide positions. Self-assembly behavior of these ionic PBIs has been studied in aqueous media by UV/Vis spectroscopy, revealing formation of excitonically coupled H-type aggregates. The interactions of these ionic PBIs with different ds-DNA and ds-RNA have been explored by thermal denaturation, fluorimetric titration and circular dichroism (CD) experiments. These PBIs strongly stabilized ds-DNA/RNA against thermal denaturation as revealed by high melting temperatures of the formed PBI/polynucleotide complexes. Fluorimetric titrations showed that these PBIs bind to ds-DNA/RNA with high binding constants depending on the number of the positive charges in the side chains. Thus, spermine-containing PBIs with six positive charges each showed higher binding constants (logKs =9.2-9.8) than their dioxa analogues (logKs =6.5-7.9) having two positive charges each. Induced circular dichroism (ICD) of PBI assemblies created within DNA/RNA grooves was observed. These ICD profiles are strongly dependent on the steric demand of the chiral substituents of the amino acid units and the secondary structure of the DNA or RNA. The observed ICD effects can be explained by non-covalent binding of excitonically coupled PBI dimer aggregates into the minor groove of DNA and major groove of RNA which is further supported by molecular modeling studies. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stochastic steps in secondary active sugar transport.

PubMed

Adelman, Joshua L; Ghezzi, Chiara; Bisignano, Paola; Loo, Donald D F; Choe, Seungho; Abramson, Jeff; Rosenberg, John M; Wright, Ernest M; Grabe, Michael

2016-07-05

Secondary active transporters, such as those that adopt the leucine-transporter fold, are found in all domains of life, and they have the unique capability of harnessing the energy stored in ion gradients to accumulate small molecules essential for life as well as expel toxic and harmful compounds. How these proteins couple ion binding and transport to the concomitant flow of substrates is a fundamental structural and biophysical question that is beginning to be answered at the atomistic level with the advent of high-resolution structures of transporters in different structural states. Nonetheless, the dynamic character of the transporters, such as ion/substrate binding order and how binding triggers conformational change, is not revealed from static structures, yet it is critical to understanding their function. Here, we report a series of molecular simulations carried out on the sugar transporter vSGLT that lend insight into how substrate and ions are released from the inward-facing state of the transporter. Our simulations reveal that the order of release is stochastic. Functional experiments were designed to test this prediction on the human homolog, hSGLT1, and we also found that cytoplasmic release is not ordered, but we confirmed that substrate and ion binding from the extracellular space is ordered. Our findings unify conflicting published results concerning cytoplasmic release of ions and substrate and hint at the possibility that other transporters in the superfamily may lack coordination between ions and substrate in the inward-facing state.

Investigation on the interaction of Rutin with serum albumins: Insights from spectroscopic and molecular docking techniques.

PubMed

Sengupta, Priti; Sardar, Pinki Saha; Roy, Pritam; Dasgupta, Swagata; Bose, Adity

2018-06-01

The binding interaction of Rutin, a flavonoid, with model transport proteins, bovine serum albumin (BSA) and human serum albumin (HSA), were investigated using different spectroscopic techniques, such as fluorescence, time-resolved single photon counting (TCSPC) and circular dichroism (CD) spectroscopy as well as molecular docking method. The emission studies revealed that the fluorescence quenching of BSA/HSA by Rutin occurred through a simultaneous static and dynamic quenching process, and we have evaluated both the quenching constants individually. The binding constants of Rutin-BSA and Rutin-HSA system were found to be 2.14 × 10 6  M -1 and 2.36 × 10 6  M -1 at 298 K respectively, which were quite high. Further, influence of some biologically significant metal ions (Ca 2+ , Zn 2+ and Mg 2+ ) on binding of Rutin to BSA and HSA were also investigated. Thermodynamic parameters justified the involvement of hydrogen bonding and weak van der Waals forces in the interaction of Rutin with both BSA and HSA. Further a site-marker competitive experiment was performed to evaluate Rutin binding site in the albumins. Additionally, the CD spectra of BSA and HSA revealed that the secondary structure of the proteins was perturbed in the presence of Rutin. Finally protein-ligand docking studies have also been performed to determine the probable location of the ligand molecule. Copyright © 2018 Elsevier B.V. All rights reserved.

Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Senogles, S.E.; Caron, M.G.

1986-05-01

The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 ..mu..M NPA. /sup 35/S-GTP..gamma..Smore » binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.« less

Characterization of the telomere complex, TERF1 and TERF2 genes in muntjac species with fusion karyotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hartmann, Nils; Scherthan, Harry

The telomere binding proteins TRF1 and TRF2 maintain and protect chromosome ends and confer karyotypic stability. Chromosome evolution in the genus Muntiacus is characterized by numerous tandem (end-to-end) fusions. To study TRF1 and TRF2 telomere binding proteins in Muntiacus species, we isolated and characterized the TERF1 and -2 genes from Indian muntjac (Muntiacus muntjak vaginalis; 2n = 6 female) and from Chinese muntjac (Muntiacus reveesi; 2n = 46). Expression analysis revealed that both genes are ubiquitously expressed and sequence analysis identified several transcript variants of both TERF genes. Control experiments disclosed a novel testis-specific splice variant of TERF1 in humanmore » testes. Amino acid sequence comparisons demonstrate that Muntiacus TRF1 and in particular TRF2 are highly conserved between muntjac and human. In vivo TRF2-GFP and immuno-staining studies in muntjac cell lines revealed telomeric TRF2 localization, while deletion of the DNA binding domain abrogated this localization, suggesting muntjac TRF2 represents a functional telomere protein. Finally, expression analysis of a set of telomere-related genes revealed their presence in muntjac fibroblasts and testis tissue, which suggests the presence of a conserved telomere complex in muntjacs. However, a deviation from the common theme was noted for the TERT gene, encoding the catalytic subunit of telomerase; TERT expression could not be detected in Indian or Chinese muntjac cDNA or genomic DNA using a series of conserved primers, while TRAP assay revealed functional telomerase in Chinese muntjac testis tissues. This suggests muntjacs may harbor a diverged telomerase sequence.« less

Characterization of the Group A Streptococcus Mga Virulence Regulator Reveals a Role for the C-terminal Region in Oligomerization and Transcriptional Activation

PubMed Central

Hondorp, Elise R.; Hou, Sherry C.; Hempstead, Andrew D.; Hause, Lara L.; Beckett, Dorothy M.; McIver, Kevin S.

2012-01-01

The Group A Streptococcus (GAS) is a strict human pathogen that causes a broad spectrum of illnesses. One of the key regulators of virulence in GAS is the transcriptional activator Mga, which coordinates the early stages of infection. Although the targets of Mga have been well characterized, basic biochemical analyses have been limited due to difficulties in obtaining purified protein. In this study, high-level purification of soluble Mga was achieved, enabling the first detailed characterization of the protein. Fluorescence titrations coupled with filter-binding assays indicate that Mga binds cognate DNA with nanomolar affinity. Gel filtration analyses, analytical ultracentrifugation, and co-immunoprecipitation experiments demonstrate that Mga forms oligomers in solution. Moreover, the ability of the protein to oligomerize in solution was found to correlate with transcriptional activation; DNA binding appears to be necessary but insufficient for full activity. Truncation analyses reveal that the uncharacterized C-terminal region of Mga, possessing similarity to phosphotransferase system EIIB proteins, plays a critical role in oligomerization and in vivo activity. Mga from a divergent serotype was found to behave similarly, suggesting that this study describes a general mechanism for Mga regulation of target virulence genes within GAS and provides insight into related regulators in other Gram-positive pathogens. PMID:22468267

NMR unfolding studies on a liver bile acid binding protein reveal a global two-state unfolding and localized singular behaviors.

PubMed

D'Onofrio, Mariapina; Ragona, Laura; Fessas, Dimitrios; Signorelli, Marco; Ugolini, Raffaella; Pedò, Massimo; Assfalg, Michael; Molinari, Henriette

2009-01-01

The folding properties of a bile acid binding protein, belonging to a subfamily of the fatty acid binding proteins, have been here investigated both by hydrogen exchange measurements, using the SOFAST NMR approach, and urea denaturation experiments. The urea unfolding profiles of individual residues, acting as single probes, were simultaneously analyzed through a global fit, according to a two-state unfolding model. The resulting conformational stability DeltaG(U)(H(2)O)=7.2+/-0.25kcal mol(-1) is in good agreement with hydrogen exchange stability DeltaG(op). While the majority of protein residues satisfy this model, few amino-acids display a singular behavior, not directly amenable to the presence of a folding intermediate, as reported for other fatty acid binding proteins. These residues are part of a protein patch characterized by enhanced plasticity. To explain this singular behavior a tentative model has been proposed which takes into account the interplay between the dynamic features and the formation of transient aggregates. A functional role for this plasticity, related to translocation across the nuclear membrane, is discussed.

Dimeric Arrangement of the Parathyroid Hormone Receptor and a Structural Mechanism for Ligand-induced Dissociation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pioszak, Augen A.; Harikumar, Kaleeckal G.; Parker, Naomi R.

2010-06-25

The parathyroid hormone receptor (PTH1R) is a class B G protein-coupled receptor that is activated by parathyroid hormone (PTH) and PTH-related protein (PTHrP). Little is known about the oligomeric state of the receptor and its regulation by hormone. The crystal structure of the ligand-free PTH1R extracellular domain (ECD) reveals an unexpected dimer in which the C-terminal segment of both ECD protomers forms an {alpha}-helix that mimics PTH/PTHrP by occupying the peptide binding groove of the opposing protomer. ECD-mediated oligomerization of intact PTH1R was confirmed in living cells by bioluminescence and fluorescence resonance energy transfer experiments. As predicted by the structure,more » PTH binding disrupted receptor oligomerization. A receptor rendered monomeric by mutations in the ECD retained wild-type PTH binding and cAMP signaling ability. Our results are consistent with the hypothesis that PTH1R forms constitutive dimers that are dissociated by ligand binding and that monomeric PTH1R is capable of activating G protein.« less

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

DETECTION OF TWO ISOMERIC BINDING CONFIGURATIONS IN A PROTEIN-APTAMER COMPLEX WITH A BIOLOGICAL NANOPORE

PubMed Central

Van Meervelt, Veerle; Soskine, Misha; Maglia, Giovanni

2015-01-01

Protein-DNA interactions play critical roles in biological systems, and they often involve complex mechanisms and dynamics that are not easily measured by ensemble experiments. Recently, we have shown that folded proteins can be internalised inside ClyA nanopores and studied by ionic current recordings at the single-molecule level. Here, we use ClyA nanopores to sample the interaction between the G-quadruplex fold of the thrombin binding aptamer (TBA) and human thrombin (HT). Surprisingly, the internalisation of the HT:TBA complex inside the nanopore induced two types of current blockades with distinguished residual current and lifetime. Using single nucleobase substitutions to TBA we showed that these two types of blockades originate from TBA binding to thrombin with two isomeric orientations. Voltage dependencies and the use of ClyA nanopores with two different diameters allowed assessing the effect of the applied potential and confinement, and revealed that the two binding configurations of TBA to HT display different lifetimes. These results show that the ClyA nanopores might provide a new approach to probe conformational heterogeneity in protein:DNA interactions. PMID:25493908

Structure and DNA-binding of meiosis-specific protein Hop2

NASA Astrophysics Data System (ADS)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Molecular modeling and spectroscopic studies on the interaction of the chiral drug venlafaxine hydrochloride with bovine serum albumin

NASA Astrophysics Data System (ADS)

Shahabadi, Nahid; Hadidi, Saba

2014-03-01

This study was designed to examine the interaction of racemic antidepressant drug "S,R-venlafaxine hydrochloride (VEN)" with bovine serum albumin (BSA) under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques combination with molecular modeling. Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The thermodynamic parameters indicated that the hydrogen bonding and weak van der Waals interactions are the predominant intermolecular forces stabilizing the complex. The number of binding sites (n) was calculated. Through the site marker competitive experiment, VEN was confirmed to be located in subdomain IIIA of BSA. The binding distance (r = 4.93 nm) between the donor BSA and acceptor VEN was obtained according to Förster's non-radiative energy transfer theory. According to UV-vis spectra and CD data binding of VEN leaded to conformational changes of BSA. Molecular docking simulations of S and R-VEN revealed that both isomers have similar interaction and the same binding sites, from this point of view S and R isomers are equal.

Prediction and Dissection of Protein-RNA Interactions by Molecular Descriptors.

PubMed

Liu, Zhi-Ping; Chen, Luonan

2016-01-01

Protein-RNA interactions play crucial roles in numerous biological processes. However, detecting the interactions and binding sites between protein and RNA by traditional experiments is still time consuming and labor costing. Thus, it is of importance to develop bioinformatics methods for predicting protein-RNA interactions and binding sites. Accurate prediction of protein-RNA interactions and recognitions will highly benefit to decipher the interaction mechanisms between protein and RNA, as well as to improve the RNA-related protein engineering and drug design. In this work, we summarize the current bioinformatics strategies of predicting protein-RNA interactions and dissecting protein-RNA interaction mechanisms from local structure binding motifs. In particular, we focus on the feature-based machine learning methods, in which the molecular descriptors of protein and RNA are extracted and integrated as feature vectors of representing the interaction events and recognition residues. In addition, the available methods are classified and compared comprehensively. The molecular descriptors are expected to elucidate the binding mechanisms of protein-RNA interaction and reveal the functional implications from structural complementary perspective.

Genome-Wide Identification of Chromatin Transitional Regions Reveals Diverse Mechanisms Defining the Boundary of Facultative Heterochromatin

PubMed Central

Li, Guangyao; Zhou, Lei

2013-01-01

Due to the self-propagating nature of the heterochromatic modification H3K27me3, chromatin barrier activities are required to demarcate the boundary and prevent it from encroaching into euchromatic regions. Studies in Drosophila and vertebrate systems have revealed several important chromatin barrier elements and their respective binding factors. However, epigenomic data indicate that the binding of these factors are not exclusive to chromatin boundaries. To gain a comprehensive understanding of facultative heterochromatin boundaries, we developed a two-tiered method to identify the Chromatin Transitional Region (CTR), i.e. the nucleosomal region that shows the greatest transition rate of the H3K27me3 modification as revealed by ChIP-Seq. This approach was applied to identify CTRs in Drosophila S2 cells and human HeLa cells. Although many insulator proteins have been characterized in Drosophila, less than half of the CTRs in S2 cells are associated with known insulator proteins, indicating unknown mechanisms remain to be characterized. Our analysis also revealed that the peak binding of insulator proteins are usually 1–2 nucleosomes away from the CTR. Comparison of CTR-associated insulator protein binding sites vs. those in heterochromatic region revealed that boundary-associated binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significant decreased nucleosome density and increased binding intensities of co-factors. Interestingly, several subgroups of boundaries have enhanced H3.3 incorporation but reduced nucleosome turnover rate. Our genome-wide study reveals that diverse mechanisms are employed to define the boundaries of facultative heterochromatin. In both Drosophila and mammalian systems, only a small fraction of insulator protein binding sites co-localize with H3K27me3 boundaries. However, boundary-associated insulator binding sites are distinctively flanked by nucleosome destabilizing sequences, which correlates with significantly decreased nucleosome density and increased binding of co-factors. PMID:23840609

Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263.

PubMed

Guncheva, Maya; Ivanov, Ivaylo; Galunsky, Boris; Stambolieva, Nicolina; Kaneti, Jose

2004-06-01

Kinetic experiments with a substrate series of phenylacetyl-arylamides reveal that at least one polar group in the amine moiety is required for the proper orientation of the substrate in the large nucleophile-binding subsite of penicillin acylase of Escherichia coli. Quantum mechanical molecular modelling of enzyme-substrate interactions in the enzyme active site shows that in the case of substrates lacking local symmetry, the productive binding implies two nonsymmetrical arrangements with respect to the two positively charged guanidinium residues of ArgA145 and ArgB263. This indicates a crucial role of the specified arginine pair in the substrate- and stereoselectivity of penicillin acylase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio

Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less

Copper tolerance in Frankia sp. strain EuI1c involves surface binding and copper transport.

PubMed

Rehan, Medhat; Furnholm, Teal; Finethy, Ryan H; Chu, Feixia; El-Fadly, Gomaah; Tisa, Louis S

2014-09-01

Several Frankia strains have been shown to be copper-tolerant. The mechanism of their copper tolerance was investigated for Frankia sp. strain EuI1c. Copper binding was shown by binding studies. Unusual globular structures were observed on the surface of the bacterium. These globular structures were composed of aggregates containing many relatively smaller "leaf-like" structures. Scanning electron microscopy with energy-dispersive X-ray (SEM-EDAX) analysis of these structures indicated elevated copper and phosphate levels compared to the control cells. Fourier transform infrared spectroscopy (FTIR) analysis indicated an increase in extracellular phosphate on the cell surface of copper-stressed cells. Bioinformatics' analysis of the Frankia sp. strain EuI1c genome revealed five potential cop genes: copA, copZ, copC, copCD, and copD. Experiments with Frankia sp. strain EuI1c using qRT-PCR indicated an increase in messenger RNA (mRNA) levels of the five cop genes upon Cu(2+) stress. After 5 days of Cu(2+) stress, the copA, copZ, copC, copCD, and copD mRNA levels increased 25-, 8-, 18-, 18-, and 25-fold, respectively. The protein profile of Cu(2+)-stressed Frankia sp. strain EuI1c cells revealed the upregulation of a 36.7 kDa protein that was identified as FraEuI1c_1092 (sulfate-binding periplasmic transport protein). Homologues of this gene were only present in the genomes of the Cu(2+)-resistant Frankia strains (EuI1c, DC12, and CN3). These data indicate that copper tolerance by Frankia sp. strain EuI1c involved the binding of copper to the cell surface and transport proteins.

Active Participation of Cellular Chaperone Hsp90 in Regulating the Function of Rotavirus Nonstructural Protein 3 (NSP3)*

PubMed Central

Dutta, Dipanjan; Chattopadhyay, Shiladitya; Bagchi, Parikshit; Halder, Umesh Chandra; Nandi, Satabdi; Mukherjee, Anupam; Kobayashi, Nobumichi; Taniguchi, Koki; Chawla-Sarkar, Mamta

2011-01-01

Heat shock protein 90 (Hsp90) has been reported to positively regulate rotavirus replication by modulating virus induced PI3K/Akt and NFκB activation. Here, we report the active association of Hsp90 in the folding and stabilization of rotavirus nonstructural protein 3 (NSP3). In pCD-NSP3-transfected cells, treatment with Hsp90 inhibitor (17-N,N-dimethylethylenediamine-geldanamycin (17DMAG)) resulted in the proteasomal degradation of NSP3. Sequence analysis and deletion mutations revealed that the region spanning amino acids 225–258 within the C-terminal eIF4G-binding domain of NSP3 is a putative Hsp90 binding region. Co-immunoprecipitation and mammalian two-hybrid experiments revealed direct interaction of the C-terminal 12-kDa domain of Hsp90 (C90) with residues 225–258 of NSP3. NSP3-Hsp90 interaction is important for the formation of functionally active mature NSP3, because full-length NSP3 in the presence of the Hsp90 inhibitor or NSP3 lacking the amino acid 225–258 region did not show NSP3 dimers following in vitro coupled transcription-translation followed by chase. Disruption of residues 225–258 within NSP3 also resulted in poor RNA binding and eIF4G binding activity. In addition, inhibition of Hsp90 by 17DMAG resulted in reduced nuclear translocation of poly(A)-binding protein and translation of viral proteins. These results highlight the crucial role of Hsp90 chaperone in the regulation of assembly and functionality of a viral protein during the virus replication and propagation in host cells. PMID:21489987

Structure and Interactions of the CS Domain of Human H/ACA RNP Assembly Protein Shq1

DOE PAGES

Singh, Mahavir; Wang, Zhonghua; Cascio, Duilio; ...

2014-12-29

Shq1 is an essential protein involved in the early steps of biogenesis and assembly of H/ACA ribonucleoprotein particles (RNPs). Shq1 binds to dyskerin (Cbf5 in yeast) at an early step of H/ACA RNP assembly and is subsequently displaced by the H/ACA RNA. Shq1 contains an N-terminal CS and a C-terminal Shq1-specific domain (SSD). Dyskerin harbors many mutations associated with dyskeratosis congenita. Structures of yeast Shq1 SSD bound to Cbf5 revealed that only a subset of these mutations is in the SSD binding site, implicating another subset in the putative CS binding site. Here in this paper, we present the crystalmore » structure of human Shq1 CS (hCS) and the nuclear magnetic resonance (NMR) and crystal structures of hCS containing a serine substitution for proline 22 that is associated with some prostate cancers. The structure of hCS is similar to yeast Shq1 CS domain (yCS) and consists of two β-sheets that form an immunoglobulin-like β-sandwich fold. The N-terminal affinity tag sequence AHHHHHH associates with a neighboring protein in the crystal lattice to form an extra β-strand. Deletion of this tag was required to get spectra suitable for NMR structure determination, while the tag was required for crystallization. NMR chemical shift perturbation (CSP) experiments with peptides derived from putative CS binding sites on dyskerin and Cbf5 revealed a conserved surface on CS important for Cbf5/dyskerin binding. A HADDOCK (high-ambiguity-driven protein-protein docking) model of a Shq1-Cbf5 complex that defines the position of CS domain in the pre-H/ACA RNP was calculated using the CSP data.« less

Zinc-mediated binding of a low-molecular-weight stabilizer of the host anti-viral factor apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G.

PubMed

Radwan, Mohamed O; Sonoda, Sachiko; Ejima, Tomohiko; Tanaka, Ayumi; Koga, Ryoko; Okamoto, Yoshinari; Fujita, Mikako; Otsuka, Masami

2016-09-15

Apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G (APOBEC3G, A3G), is a human anti-virus restriction protein which works deaminase-dependently and -independently. A3G is known to be ubiquitinated by HIV-1 viral infectivity factor (Vif) protein, leading to proteasomal degradation. A3G contains two zinc ions at the N-terminal domain and the C-terminal domain. Four lysine residues, K(297), K(301), K(303), and K(334), are known to be required for Vif-mediated A3G ubiquitination and degradation. Previously, we reported compound SN-1, a zinc chelator that increases steady-state expression level of A3G in the presence of Vif. In this study, we prepared Biotin-SN-1, a biotinylated derivative of SN-1, to study the SN-1-A3G interaction. A pull-down assay revealed that Biotin-SN-1 bound A3G. A zinc-abstraction experiment indicated that SN-1 binds to the zinc site of A3G. We carried out a SN-1-A3G docking study using molecular operating environment. The calculations revealed that SN-1 binds to the C-terminal domain through Zn(2+), H(216), P(247), C(288), and Y(315). Notably, SN-1-binding covers the H(257), E(259), C(288), and C(291) residues that participate in zinc-mediated deamination, and the ubiquitination regions of A3G. The binding of SN-1 presumably perturbs the secondary structure between C(288) and Y(315), leading to less efficient ubiquitination. Copyright © 2016 Elsevier Ltd. All rights reserved.

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

PubMed

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-01

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

[Study on the interaction of doxycycline with human serum albumin].

PubMed

Hu, Tao-Ying; Chen, Lin; Liu, Ying

2014-05-01

The present study was designed to investigate the interaction of doxycycline (DC) with human serum albumin (HSA) by the inner filter effects, displacement experiments and molecular docking methods, based on classic multi-spectroscopy. With fluorescence quenching method at 298 and 310 K, the binding constants Ka, were determined to be 2. 73 X 10(5) and 0. 74X 10(5) L mol-1, respectively, and there was one binding site between DC and HSA, indicating that the binding of DC to HSA was strong, and the quenching mechanism was a static quenching. The thermodynamic parameters (enthalpy change, AH and enthropy change, delta S) were calculated to be -83. 55 kJ mol-1 and -176. 31 J mol-1 K-1 via the Vant' Hoff equation, which indicated that the interaction of DC with HSA was driven mainly by hydrogen bonding and van der Waals forces. Based on the Föster's theory of non-radiation energy transfer, the specific binding distance between Trp-214 (acceptor) and DC (donor) was 4. 98 nm, which was similar to the result confirmed by molecular docking. Through displacement experiments, sub-domain IIA of HSA was assigned to possess the high-affinity binding site of DC. Three-dimensional fluorescence spectra indicated that the binding of DC to HSA induced the conformation change of HSA and increased the disclosure of some part of hydrophobic regions that had been buried before. The results of FTIR spectroscopy showed that DC bound to HSA led to the slight unfolding of the polypeptide chain of HSA. Furthermore, the binding details between DC and HSA were further confirmed by molecular docking methods, which revealed that DC was bound at sub-domain IIA through multiple interactions, such as hydrophobic effect, polar forces and pi-pi interactions. The experimental results provide theoretical basis and reliable data for the study of the interaction between small drug molecule and human serum albumin

Rational Design of a New Class of Toll-Like Receptor 4 (TLR4) Tryptamine Related Agonists by Means of the Structure- and Ligand-Based Virtual Screening for Vaccine Adjuvant Discovery.

PubMed

Honegr, Jan; Dolezal, Rafael; Malinak, David; Benkova, Marketa; Soukup, Ondrej; Almeida, Joyce S F D de; Franca, Tanos C C; Kuca, Kamil; Prymula, Roman

2018-01-04

In order to identify novel lead structures for human toll-like receptor 4 ( h TLR4) modulation virtual high throughput screening by a peta-flops-scale supercomputer has been performed. Based on the in silico studies, a series of 12 compounds related to tryptamine was rationally designed to retain suitable molecular geometry for interaction with the h TLR4 binding site as well as to satisfy general principles of drug-likeness. The proposed compounds were synthesized, and tested by in vitro and ex vivo experiments, which revealed that several of them are capable to stimulate h TLR4 in vitro up to 25% activity of Monophosphoryl lipid A. The specific affinity of the in vitro most potent substance was confirmed by surface plasmon resonance direct-binding experiments. Moreover, two compounds from the series show also significant ability to elicit production of interleukin 6.

Comparison of Saccharomyces cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site.

PubMed

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R; Kenniston, Jon A; Mendrola, Jeannine M; Ferguson, Kathryn M; Lemmon, Mark A

2015-02-03

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparison of Saccharomyces cerevisiae F-BAR Domain Structures Reveals a Conserved Inositol Phosphate Binding Site

DOE PAGES

Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; ...

2015-01-22

F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although they are generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here in this paper, we compare membrane-binding properties of the Saccharomyces cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound tomore » an inositol phosphate. The structures explain phospholipid-binding selectivity differences and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip and is partly retained in certain other F-BAR domains. In conclusion, our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity and provide a basis for its prediction from sequence.« less

Glucose monitoring using a polymer brush modified polypropylene hollow fiber-based hydraulic flow sensor.

PubMed

Fortin, Nicolas; Klok, Harm-Anton

2015-03-04

Tight regulation of blood glucose levels of diabetic patients requires durable and robust continuous glucose sensing schemes. This manuscript reports the fabrication of ultrathin, phenylboronic acid (PBA) functionalized polymer brushes that swell upon glucose binding and which were integrated as the sensing interface in a new polypropylene hollow fiber (PPHF)-based hydraulic flow glucose sensor prototype. The polymer brushes were prepared via surface-initiated atom transfer radical polymerization of sodium methacrylate followed by postpolymerization modification with 3-aminophenyl boronic acid. In a first series of experiments, the glucose-response of PBA-functionalized poly(methacrylic acid) (PMAA) brushes grafted from planar silicon surfaces was investigated by quartz crystal microbalance with dissipation (QCM-D) and atomic force microscopy (AFM) experiments. The QCM-D experiments revealed a more or less linear change of the frequency shift for glucose concentrations up to ∼10 mM and demonstrated that glucose binding was completely reversible for up to seven switching cycles. The AFM experiments indicated that glucose binding was accompanied by an increase in the film thickness of the PBA functionalized PMAA brushes. The PBA functionalized PMAA brushes were subsequently grafted from the surface of PPHF membranes. The hydraulic permeability of these porous fibers depends on the thickness and swelling of the PMAA brush coating. PBA functionalized brush-coated PPHFs showed a decrease in flux upon exposure to glucose, which is consistent with swelling of the brush coating. Because they avoid the use of enzymes and do not rely on an electrochemical transduction scheme, these PPHF-based hydraulic flow sensors could represent an interesting alternative class of continuous glucose sensors.

Definition of a consensus DNA-binding site for PecS, a global regulator of virulence gene expression in Erwinia chrysanthemi and identification of new members of the PecS regulon.

PubMed

Rouanet, Carine; Reverchon, Sylvie; Rodionov, Dmitry A; Nasser, William

2004-07-16

In Erwinia chrysanthemi, production of pectic enzymes is modulated by a complex network involving several regulators. One of them, PecS, which belongs to the MarR family, also controls the synthesis of various other virulence factors, such as cellulases and indigoidine. Here, the PecS consensus-binding site is defined by combining a systematic evolution of ligands by an exponential enrichment approach and mutational analyses. The consensus consists of a 23-base pair palindromic-like sequence (C(-11)G(-10)A(-9)N(-8)W(-7)T(-6)C(-5)G(-4)T(-3)A(-2))T(-1)A(0)T(1)(T(2)A(3)C(4)G(5)A(6)N(7)N(8)N(9)C(10)G(11)). Mutational experiments revealed that (i) the palindromic organization is required for the binding of PecS, (ii) the very conserved part of the consensus (-6 to 6) allows for a specific interaction with PecS, but the presence of the relatively degenerated bases located apart significantly increases PecS affinity, (iii) the four bases G, A, T, and C are required for efficient binding of PecS, and (iv) the presence of several binding sites on the same promoter increases the affinity of PecS. This consensus is detected in the regions involved in PecS binding on the previously characterized target genes. This variable consensus is in agreement with the observation that the members of the MarR family are able to bind various DNA targets as dimers by means of a winged helix DNA-binding motif. Binding of PecS on a promoter region containing the defined consensus results in a repression of gene transcription in vitro. Preliminary scanning of the E. chrysanthemi genome sequence with the consensus revealed the presence of strong PecS-binding sites in the intergenic region between fliE and fliFGHIJKLMNOPQR which encode proteins involved in the biogenesis of flagellum. Accordingly, PecS directly represses fliE expression. Thus, PecS seems to control the synthesis of virulence factors required for the key steps of plant infection.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leenheer, J.A.; Brown, G.K.; Cabaniss, S.E.

Fulvic acid, isolated from the Suwannee River, Georgia, was assessed for its ability to bind Ca{sup 2+}, Cd{sup 2+}, Cu{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} ions at pH 6 before and after extensive fractionation that was designed to reveal the nature of metal binding functional groups. The binding constant for Ca{sup 2+} ion had the greatest increase of all the ions in a metal binding fraction that was selected for intensive characterization for the purpose of building quantitative average model structures. The metal binding fraction was characterized by quantitative {sup 13}C NMR, {sup 1}H NMR, and FT-IR spectrometry andmore » elemental, titrimetric, and molecular weight determinations. The characterization data revealed that carboxyl groups were clustered in short-chain aliphatic dibasic acid structures. The Ca{sup 2+} binding data suggested that ether-substituted oxysuccinic acid structures are good models for the metal binding sites at pH 6. Structural models were derived based upon oxidation and photolytic rearrangements of cutin, lignin, and tannin precursors. These structural models rich in substituted dibasic acid structures revealed polydentate binding sites with the potential for both inner-sphere and outer-sphere type binding. The majority of the fulvic acid molecule was involved with metal binding rather than a small substructural unit.« less

Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

NASA Astrophysics Data System (ADS)

Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

2008-11-01

The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

Molecular Features of the Copper Binding Sites in the Octarepeat Domain of the Prion Protein†

PubMed Central

Burns, Colin S.; Aronoff-Spencer, Eliah; Dunham, Christine M.; Lario, Paula; Avdievich, Nikolai I.; Antholine, William E.; Olmstead, Marilyn M.; Vrielink, Alice; Gerfen, Gary J.; Peisach, Jack; Scott, William G.; Millhauser, Glenn L.

2010-01-01

Recent evidence suggests that the prion protein (PrP) is a copper binding protein. The N-terminal region of human PrP contains four sequential copies of the highly conserved octarepeat sequence PHGGGWGQ spanning residues 60–91. This region selectively binds Cu2+ in vivo. In a previous study using peptide design, EPR, and CD spectroscopy, we showed that the HGGGW segment within each octarepeat comprises the fundamental Cu2+ binding unit [Aronoff-Spencer et al. (2000) Biochemistry 40, 13760–13771]. Here we present the first atomic resolution view of the copper binding site within an octarepeat. The crystal structure of HGGGW in a complex with Cu2+ reveals equatorial coordination by the histidine imidazole, two deprotonated glycine amides, and a glycine carbonyl, along with an axial water bridging to the Trp indole. Companion S-band EPR, X-band ESEEM, and HYSCORE experiments performed on a library of 15N-labeled peptides indicate that the structure of the copper binding site in HGGGW and PHGGGWGQ in solution is consistent with that of the crystal structure. Moreover, EPR performed on PrP(23–28, 57–91) and an 15N-labeled analogue demonstrates that the identified structure is maintained in the full PrP octarepeat domain. It has been shown that copper stimulates PrP endocytosis. The identified Gly–Cu linkage is unstable below pH ≈6.5 and thus suggests a pH-dependent molecular mechanism by which PrP detects Cu2+ in the extracellular matrix or releases PrP-bound Cu2+ within the endosome. The structure also reveals an unusual complementary interaction between copper-structured HGGGW units that may facilitate molecular recognition between prion proteins, thereby suggesting a mechanism for transmembrane signaling and perhaps conversion to the pathogenic form. PMID:11900542

Purification and characterization of Lep d I, a major allergen from the mite Lepidoglyphus destructor.

PubMed

Ventas, P; Carreira, J; Polo, F

1992-04-01

A major allergen of the storage mite Lepidoglyphus destructor (Lep d I) has been purified by affinity chromatography using an anti-Lep d I monoclonal antibody. The purity of the protein obtained by this procedure was assessed by reverse-phase HPLC. Lep d I displayed a molecular weight of 14 kD on SDS-PAGE under non-reducing conditions, and 16 kD in the presence of a reducing agent. Analytical IEF revealed a little charge microheterogeneity, showing three bands with pIs 7.6-7.8. Purified Lep d I retained IgE-binding ability, as proved by immunoblotting experiments after SDS-PAGE and RAST with individual sera from L. destructor-sensitive patients. Results from the latter technique demonstrated that 87% of L. destructor-allergic patients had specific IgE to Lep d I, and a good correlation between IgE reactivity with L. destructor extract and Lep d I was found. In addition, RAST inhibition experiments showed that IgE-binding sites on Lep d I are major L. destructor-allergenic determinants, since Lep d I could inhibit up to 75% the binding of specific IgE to L. destructor extract; on the other hand, Lep d I did not cross-react with D. pteronyssinus allergens.

Mechanism of human antibody-mediated neutralization of Marburg virus.

PubMed

Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

2015-02-26

The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

The Role of Chaperone-subunit Usher Domain Interactions in the Mechanism of Bacterial Pilus Biogenesis Revealed by ESI-MS*

PubMed Central

Morrissey, Bethny; Leney, Aneika C.; Toste Rêgo, Ana; Phan, Gilles; Allen, William J.; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E.; Radford, Sheena E.

2012-01-01

The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species. PMID:22371487

The role of chaperone-subunit usher domain interactions in the mechanism of bacterial pilus biogenesis revealed by ESI-MS.

PubMed

Morrissey, Bethny; Leney, Aneika C; Toste Rêgo, Ana; Phan, Gilles; Allen, William J; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E; Radford, Sheena E

2012-07-01

The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species.

The coxsackievirus-adenovirus receptor reveals complex homophilic and heterophilic interactions on neural cells.

PubMed

Patzke, Christopher; Max, Klaas E A; Behlke, Joachim; Schreiber, Jadwiga; Schmidt, Hannes; Dorner, Armin A; Kröger, Stephan; Henning, Mechthild; Otto, Albrecht; Heinemann, Udo; Rathjen, Fritz G

2010-02-24

The coxsackievirus-adenovirus receptor (CAR) is a member of the Ig superfamily strongly expressed in the developing nervous system. Our histological investigations during development reveal an initial uniform distribution of CAR on all neural cells with a concentration on membranes that face the margins of the nervous system (e.g., the basal laminae and the ventricular side). At more advanced stages, CAR becomes downregulated and restricted to specific regions including areas rich in axonal and dendritic surfaces. To study the function of CAR on neural cells, we used the fiber knob of the adenovirus, extracellular CAR domains, blocking antibodies to CAR, as well as CAR-deficient neural cells. Blocking antibodies were found to inhibit neurite extension in retina organ and retinal explant cultures, whereas the application of the recombinant fiber knob of the adenovirus subtype Ad2 or extracellular CAR domains promoted neurite extension and adhesion to extracellular matrices. We observed a promiscuous interaction of CAR with extracellular matrix glycoproteins, which was deduced from analytical ultracentrifugation experiments, affinity chromatography, and adhesion assays. The membrane proximal Ig domain of CAR, termed D2, was found to bind to a fibronectin fragment, including the heparin-binding domain 2, which promotes neurite extension of wild type, but not of CAR-deficient neural cells. In contrast to heterophilic interactions, homophilic association of CAR involves both Ig domains, as was revealed by ultracentrifugation, chemical cross-linking, and adhesion studies. The results of these functional and binding studies are correlated to a U-shaped homodimer of the complete extracellular domains of CAR detected by x-ray crystallography.

Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures

PubMed Central

Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

2013-01-01

Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein–chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/. PMID:23873955

Arpeggio: harmonic compression of ChIP-seq data reveals protein-chromatin interaction signatures.

PubMed

Stanton, Kelly Patrick; Parisi, Fabio; Strino, Francesco; Rabin, Neta; Asp, Patrik; Kluger, Yuval

2013-09-01

Researchers generating new genome-wide data in an exploratory sequencing study can gain biological insights by comparing their data with well-annotated data sets possessing similar genomic patterns. Data compression techniques are needed for efficient comparisons of a new genomic experiment with large repositories of publicly available profiles. Furthermore, data representations that allow comparisons of genomic signals from different platforms and across species enhance our ability to leverage these large repositories. Here, we present a signal processing approach that characterizes protein-chromatin interaction patterns at length scales of several kilobases. This allows us to efficiently compare numerous chromatin-immunoprecipitation sequencing (ChIP-seq) data sets consisting of many types of DNA-binding proteins collected from a variety of cells, conditions and organisms. Importantly, these interaction patterns broadly reflect the biological properties of the binding events. To generate these profiles, termed Arpeggio profiles, we applied harmonic deconvolution techniques to the autocorrelation profiles of the ChIP-seq signals. We used 806 publicly available ChIP-seq experiments and showed that Arpeggio profiles with similar spectral densities shared biological properties. Arpeggio profiles of ChIP-seq data sets revealed characteristics that are not easily detected by standard peak finders. They also allowed us to relate sequencing data sets from different genomes, experimental platforms and protocols. Arpeggio is freely available at http://sourceforge.net/p/arpeggio/wiki/Home/.

Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

PubMed Central

Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

2011-01-01

Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

The 13-kD FK506 Binding Protein, FKBP13, Interacts with a Novel Homologue of the Erythrocyte Membrane Cytoskeletal Protein 4.1

PubMed Central

Walensky, Loren D.; Gascard, Philippe; Field, Michael E.; Blackshaw, Seth; Conboy, John G.; Mohandas, Narla; Snyder, Solomon H.

1998-01-01

We have identified a novel generally expressed homologue of the erythrocyte membrane cytoskeletal protein 4.1, named 4.1G, based on the interaction of its COOH-terminal domain (CTD) with the immunophilin FKBP13. The 129-amino acid peptide, designated 4.1G–CTD, is the first known physiologic binding target of FKBP13. FKBP13 is a 13-kD protein originally identified by its high affinity binding to the immunosuppressant drugs FK506 and rapamycin (Jin, Y., M.W. Albers, W.S. Lane, B.E. Bierer, and S.J. Burakoff. 1991. Proc. Natl. Acad. Sci. USA. 88:6677– 6681); it is a membrane-associated protein thought to function as an ER chaperone (Bush, K.T., B.A. Henrickson, and S.K. Nigam. 1994. Biochem. J. [Tokyo]. 303:705–708). We report the specific association of FKBP13 with 4.1G–CTD based on yeast two-hybrid, in vitro binding and coimmunoprecipitation experiments. The histidyl-proline moiety of 4.1G–CTD is required for FKBP13 binding, as indicated by yeast experiments with truncated and mutated 4.1G–CTD constructs. In situ hybridization studies reveal cellular colocalizations for FKBP13 and 4.1G–CTD throughout the body during development, supporting a physiologic role for the interaction. Interestingly, FKBP13 cofractionates with the red blood cell homologue of 4.1 (4.1R) in ghosts, inside-out vesicles, and Triton shell preparations. The identification of FKBP13 in erythrocytes, which lack ER, suggests that FKBP13 may additionally function as a component of membrane cytoskeletal scaffolds. PMID:9531554

Noncovalent PEGylation through Protein-Polyelectrolyte Interaction: Kinetic Experiment and Molecular Dynamics Simulation.

PubMed

Kurinomaru, Takaaki; Kuwada, Kengo; Tomita, Shunsuke; Kameda, Tomoshi; Shiraki, Kentaro

2017-07-20

Noncovalent binding of polyethylene glycol (PEG) to a protein surface is a unique protein handling technique to control protein function and stability. A diblock copolymer containing PEG and polyelectrolyte chains (PEGylated polyelectrolyte) is a promising candidate for noncovalent attachment of PEG to a protein surface because of the binding through multiple electrostatic interactions without protein denaturation. To obtain a deeper understanding of protein-polyelectrolyte interaction at the molecular level, we investigated the manner in which cationic PEGylated polyelectrolyte binds to anionic α-amylase in enzyme kinetic experiments and molecular dynamics (MD) simulations. Cationic PEG-block-poly(N,N-dimethylaminoethyl) (PEG-b-PAMA) inhibited the enzyme activity of anionic α-amylase due to binding of PAMA chains. Enzyme kinetics revealed that the inhibition of α-amylase activity by PEG-b-PAMA is noncompetitive inhibition manner. In MD simulations, the PEG-b-PAMA molecule was initially located at six different placements of the x-, y-, and z-axis ±20 Å from the center of α-amylase, which showed that the PEG-b-PAMA nonspecifically bound to the α-amylase surface, corresponding to the noncompetitive inhibition manner that stems from the polymer binding to an enzyme surface other than the active site. In addition, the enzyme activity of α-amylase in the presence of PEG-b-PAMA was not inhibited by increasing the ionic strength, consistent with the MD simulation; i.e., PEG-b-PAMA did not interact with α-amylase in high ionic strength conditions. The results reported in this paper suggest that enzyme inhibition by PEGylated polyelectrolyte can be attributed to the random electrostatic interaction between protein and polyelectrolyte.

Preclinical evaluation of a bispecific low-molecular heterodimer targeting both PSMA and GRPR for improved PET imaging and therapy of prostate cancer.

PubMed

Eder, Matthias; Schäfer, Martin; Bauder-Wüst, Ulrike; Haberkorn, Uwe; Eisenhut, Michael; Kopka, Klaus

2014-05-01

It has recently been reported that metastases of prostate cancer usually show highly heterogeneous or partly lost prostate-specific membrane antigen (PSMA) expression. In order to image and treat both PSMA positive and negative tissues PSMA targeting probes need to be extended by a further specificity. Since prostate cancer cells usually express both PSMA and gastrin-releasing peptide receptor (GRPR) a bispecific low-molecular heterodimeric molecule, addressing both targets at the same time, may significantly improve prostate cancer imaging and therapy. The nonapeptide BZH3 representing the GRPR binding part was combined with the urea-based PSMA inhibitor Glu-urea-Lys(Ahx)-HBED-CC. The syntheses of the compounds were performed according to standard Fmoc-solid phase peptide synthesis. The binding properties were analyzed by competitive cell binding and internalization experiments. The in vivo targeting properties were investigated by means of biodistribution studies. Cell binding experiments revealed high binding affinities to both GRPR and PSMA expressing cell lines. The heterodimer bound with IC50 -values essentially matching the IC50 values of the respective monomers (25.0 ± 5.4 nM for PSMA and 9.0 ± 1.8 nM for GRPR, respectively). In vivo, the heterodimer showed dual targeting of PSMA (5.4%ID/g for PSMA-positive tumors) and GRPR receptors (3.3% ID/g for GRPR-positive tumors) while exhibiting fast pharmacokinetic properties. The clearance from background was comparable to the monomeric PSMA-targeting reference. The heterodimeric molecule is a promising agent for PET imaging of primary and recurrent prostate cancer covering two receptor entities which might lead to an improved diagnostic sensitivity and therapeutic efficiency. © 2014 Wiley Periodicals, Inc.

99mTc-HYNIC-(tricine/EDDA)-FROP peptide for MCF-7 breast tumor targeting and imaging.

PubMed

Ahmadpour, Sajjad; Noaparast, Zohreh; Abedi, Seyed Mohammad; Hosseinimehr, Seyed Jalal

2018-02-19

Breast cancer is the most common malignancy among women in the world. Development of novel tumor-specific radiopharmaceuticals for early breast tumor diagnosis is highly desirable. In this study we developed 99m Tc-HYNIC-(tricine/EDDA)-Lys-FROP peptide with the ability of specific binding to MCF-7 breast tumor. The FROP-1 peptide was conjugated with the bifunctional chelator hydrazinonicotinamide (HYNIC) and labeled with 99m Tc using tricine/EDDA co-ligand. The cellular specific binding of 99m Tc-HYNIC-FROP was evaluated on different cell lines as well as with blocking experiment on MCF-7 (human breast adenocarcinoma). The tumor targeting and imaging of this labeled peptide were performed on MCF-7 tumor bearing mice. Radiochemical purity for 99m Tc-HYNIC-(tricine/EDDA)-FROP was 99% which was determined with ITLC method. This radiolabeled peptide showed high stability in normal saline and serum about 98% which was monitored with HPLC method. In saturation binding experiments, the binding constant (K d ) to MCF-7 cells was determined to be 158 nM. Biodistribution results revealed that the 99m Tc-HYNIC-FROP was mainly exerted from urinary route. The maximum tumor uptake was found after 30 min post injection (p.i.); however maximum tumor/muscle ratio was seen at 15 min p.i. The tumor uptake of this labeled peptide was specific and blocked by co-injection of excess FROP. According to the planar gamma imaging result, tumor was clearly visible due to the tumor uptake of 99m Tc-HYNIC-(tricine/EDDA)-FROP in mouse after 15 min p.i. The 99m Tc-HYNIC-(tricine/EDDA)-FROP is considered a promising probe with high specific binding to MCF-7 breast cancer cells.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques.

PubMed

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-30

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 10 5  M -1 ) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

PubMed Central

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-01-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M−1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA. PMID:28358124

Optimization of the Alkyl Linker of TO Base Surrogate in Triplex-Forming PNA for Enhanced Binding to Double-Stranded RNA.

PubMed

Sato, Takaya; Sato, Yusuke; Nishizawa, Seiichi

2017-03-23

A series of triplex-forming peptide nucleic acid (TFP) probes carrying a thiazole orange (TO) base surrogate through an alkyl linker was synthesized, and the interactions between these so-called tFIT probes and purine-rich sequences within double-stranded RNA (dsRNA) were examined. We found that the TO base surrogate linker significantly affected both the binding affinity and the fluorescence response upon triplex formation with the target dsRNA. Among the probes examined, the TO base surrogate connected through the propyl linker in the tFIT probes increased the binding affinity by a factor of ten while maintaining its function as the fluorescent universal base. Isothermal titration calorimetry experiments revealed that the increased binding affinity resulted from the gain in the binding enthalpy, which could be explained by the enhanced π-stacking interaction between the TO base surrogate and the dsRNA part of the triplex. We expect that these results will provide a molecular basis for designing strong binding tFIT probes for fluorescence sensing of various kinds of purine-rich dsRNAs sequences including those carrying a pyrimidine-purine inversion. The obtained data also offers a new insight into further development of the universal bases incorporated in TFP. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Domain-specific interactions between MLN8237 and human serum albumin estimated by STD and WaterLOGSY NMR, ITC, spectroscopic, and docking techniques

NASA Astrophysics Data System (ADS)

Yang, Hongqin; Liu, Jiuyang; Huang, Yanmei; Gao, Rui; Tang, Bin; Li, Shanshan; He, Jiawei; Li, Hui

2017-03-01

Alisertib (MLN8237) is an orally administered inhibitor of Aurora A kinase. This small-molecule inhibitor is under clinical or pre-clinical phase for the treatment of advanced malignancies. The present study provides a detailed characterization of the interaction of MLN8237 with a drug transport protein called human serum albumin (HSA). STD and WaterLOGSY nuclear magnetic resonance (NMR)-binding studies were conducted first to confirm the binding of MLN8237 to HSA. In the ligand orientation assay, the binding sites of MLN8237 were validated through two site-specific spy molecules (warfarin sodium and ibuprofen, which are two known site-selective probes) by using STD and WaterLOGSY NMR competition techniques. These competition experiments demonstrate that both spy molecules do not compete with MLN8237 for the specific binding site. The AutoDock-based blind docking study recognizes the hydrophobic subdomain IB of the protein as the probable binding site for MLN8237. Thermodynamic investigations by isothermal titration calorimetry (ITC) reveal that the non-covalent interaction between MLN8237 and HSA (binding constant was approximately 105 M-1) is driven mainly by favorable entropy and unfavorable enthalpy. In addition, synchronous fluorescence, circular dichroism (CD), and 3D fluorescence spectroscopy suggest that MLN8237 may induce conformational changes in HSA.

Specific Eph receptor-cytoplasmic effector signaling mediated by SAM-SAM domain interactions.

PubMed

Wang, Yue; Shang, Yuan; Li, Jianchao; Chen, Weidi; Li, Gang; Wan, Jun; Liu, Wei; Zhang, Mingjie

2018-05-11

The Eph receptor tyrosine kinase (RTK) family is the largest subfamily of RTKs playing critical roles in many developmental processes such as tissue patterning, neurogenesis and neuronal circuit formation, angiogenesis, etc. How the 14 Eph proteins, via their highly similar cytoplasmic domains, can transmit diverse and sometimes opposite cellular signals upon engaging ephrins is a major unresolved question. Here we systematically investigated the bindings of each SAM domain of Eph receptors to the SAM domains from SHIP2 and Odin, and uncover a highly specific SAM-SAM interaction-mediated cytoplasmic Eph-effector binding pattern. Comparative X-ray crystallographic studies of several SAM-SAM heterodimer complexes, together with biochemical and cell biology experiments, not only revealed the exquisite specificity code governing Eph/effector interactions but also allowed us to identify SAMD5 as a new Eph binding partner. Finally, these Eph/effector SAM heterodimer structures can explain many Eph SAM mutations identified in patients suffering from cancers and other diseases. © 2018, Wang et al.

Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE PAGES

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...

2017-01-03

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

Structural Basis of Immune Evasion at the Site of CD4 Attachment on HIV-1 gp120

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Lei; Kwon, Young Do; Zhou, Tongqing

2010-01-13

The site on HIV-1 gp120 that binds to the CD4 receptor is vulnerable to antibodies. However, most antibodies that interact with this site cannot neutralize HIV-1. To understand the basis of this resistance, we determined co-crystal structures for two poorly neutralizing, CD4-binding site (CD4BS) antibodies, F105 and b13, in complexes with gp120. Both antibodies exhibited approach angles to gp120 similar to those of CD4 and a rare, broadly neutralizing CD4BS antibody, b12. Slight differences in recognition, however, resulted in substantial differences in F105- and b13-bound conformations relative to b12-bound gp120. Modeling and binding experiments revealed these conformations to be poorlymore » compatible with the viral spike. This incompatibility, the consequence of slight differences in CD4BS recognition, renders HIV-1 resistant to all but the most accurately targeted antibodies.« less

Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

PubMed Central

Weidmann, Alyson G.; Barton, Jacqueline K.

2015-01-01

We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

Quantitative analysis reveals how EGFR activation and downregulation are coupled in normal but not in cancer cells

PubMed Central

Capuani, Fabrizio; Conte, Alexia; Argenzio, Elisabetta; Marchetti, Luca; Priami, Corrado; Polo, Simona; Di Fiore, Pier Paolo; Sigismund, Sara; Ciliberto, Andrea

2015-01-01

Ubiquitination of the epidermal growth factor receptor (EGFR) that occurs when Cbl and Grb2 bind to three phosphotyrosine residues (pY1045, pY1068 and pY1086) on the receptor displays a sharp threshold effect as a function of EGF concentration. Here we use a simple modelling approach together with experiments to show that the establishment of the threshold requires both the multiplicity of binding sites and cooperative binding of Cbl and Grb2 to the EGFR. While the threshold is remarkably robust, a more sophisticated model predicted that it could be modulated as a function of EGFR levels on the cell surface. We confirmed experimentally that the system has evolved to perform optimally at physiological levels of EGFR. As a consequence, this system displays an intrinsic weakness that causes—at the supraphysiological levels of receptor and/or ligand associated with cancer—uncoupling of the mechanisms leading to signalling through phosphorylation and attenuation through ubiquitination. PMID:26264748

Protonation of key acidic residues is critical for the K+-selectivity of the Na/K pump

PubMed Central

Yu, Haibo; Ratheal, Ian; Artigas, Pablo; Roux, Benoît

2011-01-01

The sodium-potassium (Na/K) pump is a P-type ATPase that generates Na+ and K+ concentration gradients across the cell membrane. For each ATP molecule, the pump extrudes three Na+ and imports two K+ by alternating between outward- and inward-facing conformations that preferentially bind K+ or Na+, respectively. Remarkably, the selective K+ and Na+ binding sites share several residues, and how the pump is able to achieve the selectivity required for the functional cycle is unclear. Here, free energy perturbation molecular dynamics (FEP/MD) simulations based on the crystal structures of the Na/K pump in a K+-loaded state (E2·Pi) reveal that protonation of the high-field acidic side-chains involved in the binding sites is critical to achieve the proper K+ selectivity. This prediction is tested with electrophysiological experiments showing that the selectivity of the E2P state for K+ over Na+ is affected by extracellular pH. PMID:21909093

Selective Nitrate Recognition by a Halogen-Bonding Four-Station [3]Rotaxane Molecular Shuttle.

PubMed

Barendt, Timothy A; Docker, Andrew; Marques, Igor; Félix, Vítor; Beer, Paul D

2016-09-05

The synthesis of the first halogen bonding [3]rotaxane host system containing a bis-iodo triazolium-bis-naphthalene diimide four station axle component is reported. Proton NMR anion binding titration experiments revealed the halogen bonding rotaxane is selective for nitrate over the more basic acetate, hydrogen carbonate and dihydrogen phosphate oxoanions and chloride, and exhibits enhanced recognition of anions relative to a hydrogen bonding analogue. This elaborate interlocked anion receptor functions via a novel dynamic pincer mechanism where upon nitrate anion binding, both macrocycles shuttle from the naphthalene diimide stations at the periphery of the axle to the central halogen bonding iodo-triazolium station anion recognition sites to form a unique 1:1 stoichiometric nitrate anion-rotaxane sandwich complex. Molecular dynamics simulations carried out on the nitrate and chloride halogen bonding [3]rotaxane complexes corroborate the (1) H NMR anion binding results. © 2016 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

PubMed

Weidmann, Alyson G; Barton, Jacqueline K

2015-10-05

We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

The membrane bound bacterial lipocalin Blc is a functional dimer with binding preference for lysophospholipids

PubMed Central

Campanacci, Valérie; Bishop, Russell E.; Blangy, Stéphanie; Tegoni, Mariella; Cambillau, Christian

2016-01-01

Lipocalins, a widespread multifunctional family of small proteins (15–25 kDa) have been first described in eukaryotes and more recently in Gram-negative bacteria. Bacterial lipocalins belonging to class I are outer membrane lipoproteins, among which Blc from E. coli is the better studied. Blc is expressed under conditions of starvation and high osmolarity, conditions known to exert stress on the cell envelope. The structure of Blc that we have previously solved (V. Campanacci, D. Nurizzo, S. Spinelli, C. Valencia, M. Tegoni, C. Cambillau, FEBS Lett. 562 (2004) 183–188.) suggested its possible role in binding fatty acids or phospholipids. Both physiological and structural data on Blc, therefore, point to a role in storage or transport of lipids necessary for membrane maintenance. In order to further document this hypothesis for Blc function, we have performed binding studies using fluorescence quenching experiments. Our results indicate that dimeric Blc binds fatty acids and phospholipids in a micromolar Kd range. The crystal structure of Blc with vaccenic acid, an unsaturated C18 fatty acid, reveals that the binding site spans across the Blc dimer, opposite to its membrane anchored face. An exposed unfilled pocket seemingly suited to bind a polar group attached to the fatty acid prompted us to investigate lyso-phospholipids, which were found to bind in a nanomolar Kd range. We discuss these findings in terms of a potential role for Blc in the metabolism of lysophospholipids generated in the bacterial outer membrane. PMID:16920109

Probing the binding reaction of cytarabine to human serum albumin using multispectroscopic techniques with the aid of molecular docking.

PubMed

Xu, Liang; Hu, Yan-Xi; Li, Jin; Liu, Yu-Feng; Zhang, Li; Ai, Hai-Xin; Liu, Hong-Sheng

2017-08-01

Cytarabine is a kind of chemotherapy medication. In the present study, the molecular interaction between cytarabine and human serum albumin (HSA) was investigated via fluorescence, UV-vis absorption, circular dichroism (CD) spectroscopy and molecular docking method under simulative physiological conditions. It was found that cytarabine could effectively quench the intrinsic fluorescence of HSA through a static quenching process. The apparent binding constants between drug and HSA at 288, 293 and 298K were estimated to be in the order of 10 3 L·mol -1 . The thermodynamic parameters ΔH°, ΔG°and ΔS° were calculated, in which the negative ΔG°suggested that the binding of cytarabine to HSA was spontaneous, moreover the negative ΔS°and negative ΔH°revealed that van der Waals force and hydrogen bonds were the major forces to stabilize the protein-cytarabine (1:1) complex. The competitive binding experiments showed that the primary binding site of cytarabine was located in the site I (subdomain IIA) of HSA. In addition, the binding distance was calculated to be 3.4nm according to the Förster no-radiation energy transfer theory. The analysis of CD and three-dimensional (3D) fluorescence spectra demonstrated that the binding of drug to HSA induced some conformational changes in HSA. The molecular docking study also led to the same conclusion obtained from the spectral results. Copyright © 2017 Elsevier B.V. All rights reserved.

Cryptic MCAT enhancer regulation in fibroblasts and smooth muscle cells. Suppression of TEF-1 mediated activation by the single-stranded DNA-binding proteins, Pur alpha, Pur beta, and MSY1.

PubMed

Carlini, Leslie E; Getz, Michael J; Strauch, Arthur R; Kelm, Robert J

2002-03-08

An asymmetric polypurine-polypyrimidine cis-element located in the 5' region of the mouse vascular smooth muscle alpha-actin gene serves as a binding site for multiple proteins with specific affinity for either single- or double-stranded DNA. Here, we test the hypothesis that single-stranded DNA-binding proteins are responsible for preventing a cryptic MCAT enhancer centered within this element from cooperating with a nearby serum response factor-interacting CArG motif to trans-activate the minimal promoter in fibroblasts and smooth muscle cells. DNA binding studies revealed that the core MCAT sequence mediates binding of transcription enhancer factor-1 to the double-stranded polypurine-polypyrimidine element while flanking nucleotides account for interaction of Pur alpha and Pur beta with the purine-rich strand and MSY1 with the complementary pyrimidine-rich strand. Mutations that selectively impaired high affinity single-stranded DNA binding by fibroblast or smooth muscle cell-derived Pur alpha, Pur beta, and MSY1 in vitro, released the cryptic MCAT enhancer from repression in transfected cells. Additional experiments indicated that Pur alpha, Pur beta, and MSY1 also interact specifically, albeit weakly, with double-stranded DNA and with transcription enhancer factor-1. These results are consistent with two plausible models of cryptic MCAT enhancer regulation by Pur alpha, Pur beta, and MSY1 involving either competitive single-stranded DNA binding or masking of MCAT-bound transcription enhancer factor-1.

Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

Thermodynamic dissection of the binding energetics of proline-rich peptides to the Abl-SH3 domain: implications for rational ligand design.

PubMed

Palencia, Andrés; Cobos, Eva S; Mateo, Pedro L; Martínez, Jose C; Luque, Irene

2004-02-13

The inhibition of the interactions between SH3 domains and their targets is emerging as a promising therapeutic strategy. To date, rational design of potent ligands for these domains has been hindered by the lack of understanding of the origins of the binding energy. We present here a complete thermodynamic analysis of the binding energetics of the p41 proline-rich decapeptide (APSYSPPPPP) to the SH3 domain of the c-Abl oncogene. Isothermal titration calorimetry experiments have revealed a thermodynamic signature for this interaction (very favourable enthalpic contributions opposed by an unfavourable binding entropy) inconsistent with the highly hydrophobic nature of the p41 ligand and the Abl-SH3 binding site. Our structural and thermodynamic analyses have led us to the conclusion, having once ruled out any possible ionization events or conformational changes coupled to the association, that the establishment of a complex hydrogen-bond network mediated by water molecules buried at the binding interface is responsible for the observed thermodynamic behaviour. The origin of the binding energetics for proline-rich ligands to the Abl-SH3 domain is further investigated by a comparative calorimetric analysis of a set of p41-related ligands. The striking effects upon the enthalpic and entropic contributions provoked by conservative substitutions at solvent-exposed positions in the ligand confirm the complexity of the interaction. The implications of these results for rational ligand design are discussed.

Probing Cocaine-Antibody Interactions in Buffer and Human Serum

PubMed Central

Ramakrishnan, Muthu; Alves De Melo, Fernando; Kinsey, Berma M.; Ladbury, John E.; Kosten, Thomas R.; Orson, Frank M.

2012-01-01

Background Despite progress in cocaine immunotherapy, the kinetic and thermodynamic properties of antibodies which bind to cocaine and its metabolites are not well understood. It is also not clear how the interactions between them differ in a complex matrix such as the serum present in the human body. In the present study, we have used microscale thermophoresis (MST), isothermal titration calorimetry (ITC), and surface plasmon resonance (SPR) we have evaluated the affinity properties of a representative mouse monoclonal (mAb08) as well as those of polyclonal antibodies purified from vaccinated mouse and human patient serum. Results MST analysis of fluorescently tagged mAb08 binding to cocaine reveals an approximately 15 fold decrease in its equilibrium dissociation constant in 20–50% human serum compared with that in saline buffer. A similar trend was also found using enriched polyclonal antibodies purified from vaccinated mice and patient serum, for which we have used fluorescently tagged bovine serum albumin conjugated to succinyl norcocaine (BSA-SNC). This conjugate closely mimics both cocaine and the hapten used to raise these antibodies. The ITC data also revealed that cocaine has a moderate affinity of about 2 µM to 20% human serum and very little interaction with human serum albumin or nonspecific human IgG at that concentration range. In a SPR inhibition experiment, the binding of mAb08 to immobilized BSA-SNC was inhibited by cocaine and benzoylecgonine in a highly competitive manner, whereas the purified polyclonal antibodies from vaccinated humans and mice, revealed preferential selectivity to pharmacologically active cocaine but not to the inactive metabolite benzoylecgonine. We have also developed a simple binding model to simulate the challenges associated with cocaine immunotherapy using the variable quantitative and kinetic properties of the antibodies. Conclusions High sensitivity calorimetric determination of antibody binding to cocaine and its metabolites provide valuable information for characterization of their interactions and thermodynamic properties. In addition MST measurements of antibody affinity in the presence of biological fluids will provide a better opportunity to make reliable decisions and facilitate the design of cocaine vaccines and immunization conditions. The methods should be more widely adopted in characterization of antibody complexes. PMID:22859949

Recognition and Detoxification of the Insecticide DDT by Drosophila melanogaster Glutathione S-Transferase D1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Low, Wai Yee; Feil, Susanne C.; Ng, Hooi Ling

2010-06-14

GSTD1 is one of several insect glutathione S-transferases capable of metabolizing the insecticide DDT. Here we use crystallography and NMR to elucidate the binding of DDT and glutathione to GSTD1. The crystal structure of Drosophila melanogaster GSTD1 has been determined to 1.1 {angstrom} resolution, which reveals that the enzyme adopts the canonical GST fold but with a partially occluded active site caused by the packing of a C-terminal helix against one wall of the binding site for substrates. This helix would need to unwind or be displaced to enable catalysis. When the C-terminal helix is removed from the model ofmore » the crystal structure, DDT can be computationally docked into the active site in an orientation favoring catalysis. Two-dimensional {sup 1}H,{sup 15}N heteronuclear single-quantum coherence NMR experiments of GSTD1 indicate that conformational changes occur upon glutathione and DDT binding and the residues that broaden upon DDT binding support the predicted binding site. We also show that the ancestral GSTD1 is likely to have possessed DDT dehydrochlorinase activity because both GSTD1 from D. melanogaster and its sibling species, Drosophila simulans, have this activity.« less

Screening of biologically important Zn2 + by a chemosensor with fluorescent turn on-off mechanism

NASA Astrophysics Data System (ADS)

Khan, Tanveer A.; Sheoran, Monika; Nikhil Raj M., Venkata; Jain, Surbhi; Gupta, Diksha; Naik, Sunil G.

2018-01-01

Reported herein the synthesis, characterization and biologically important zinc ion binding propensity of a weakly fluorescent chemosensor, 4-methyl-2,6-bis((E)-(2-(4-phenylthiazol-2-yl)hydrazono)methyl)phenol (1). 1H NMR spectroscopic titration experiment reveals the binding knack of 1 to the essential Zn2 +. The photo-physical studies of 1 exhibit an enhancement in the fluorescence by several folds upon binding with the zinc ions attributed to PET-off process, with a binding constant value of 5.22 × 103 M- 1. 1 exhibits an excellent detection range for Zn2 + with lower detection limit value of 2.31 × 10- 8 M. The selectivity of 1 was studied with various mono and divalent metal cations and it was observed that most cations either quenches the fluorescence or remains unchanged except for Cd2 +, which shows a slight enhancement in fluorescence intensity of 1. The ratiometric displacement of Cd2 + ions by Zn2 + ions shows an excellent selectivity towards in-situ detection of Zn2 + ions. Photo-physical studies also support the reversible binding of 1 to Zn2 + ions having on and off mechanism in presence of EDTA. Such recognition of the biologically important zinc ions finds potential application in live cell imaging.

Nicotinamide Cofactors Suppress Active-Site Labeling of Aldehyde Dehydrogenases.

PubMed

Stiti, Naim; Chandrasekar, Balakumaran; Strubl, Laura; Mohammed, Shabaz; Bartels, Dorothea; van der Hoorn, Renier A L

2016-06-17

Active site labeling by (re)activity-based probes is a powerful chemical proteomic tool to globally map active sites in native proteomes without using substrates. Active site labeling is usually taken as a readout for the active state of the enzyme because labeling reflects the availability and reactivity of active sites, which are hallmarks for enzyme activities. Here, we show that this relationship holds tightly, but we also reveal an important exception to this rule. Labeling of Arabidopsis ALDH3H1 with a chloroacetamide probe occurs at the catalytic Cys, and labeling is suppressed upon nitrosylation and oxidation, and upon treatment with other Cys modifiers. These experiments display a consistent and strong correlation between active site labeling and enzymatic activity. Surprisingly, however, labeling is suppressed by the cofactor NAD(+), and this property is shared with other members of the ALDH superfamily and also detected for unrelated GAPDH enzymes with an unrelated hydantoin-based probe in crude extracts of plant cell cultures. Suppression requires cofactor binding to its binding pocket. Labeling is also suppressed by ALDH modulators that bind at the substrate entrance tunnel, confirming that labeling occurs through the substrate-binding cavity. Our data indicate that cofactor binding adjusts the catalytic Cys into a conformation that reduces the reactivity toward chloroacetamide probes.

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

PubMed

Bhuiya, Sutanwi; Haque, Lucy; Goswami, Rapti; Das, Suman

2017-12-14

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 10 6 M -1 ) compared to that for the duplex counterpart (1.0 × 10 5 M -1 ). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

DNA residence time is a regulatory factor of transcription repression

PubMed Central

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Monomeric ephrinB2 binding induces allosteric changes in Nipah virus G that precede its full activation.

PubMed

Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S

2017-10-03

Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.

Fluorescence spectroscopic and molecular docking studies of the binding interaction between the new anaplastic lymphoma kinase inhibitor crizotinib and bovine serum albumin

NASA Astrophysics Data System (ADS)

Abdelhameed, Ali S.; Alanazi, Amer M.; Bakheit, Ahmed H.; Darwish, Hany W.; Ghabbour, Hazem A.; Darwish, Ibrahim A.

2017-01-01

Binding of the recently introduced anti-cancer drug, crizotinib (CRB) with the bovine serum albumin (BSA) was comprehensively studied with the aid of fluorescence and UV-Vis spectroscopic as well as molecular docking techniques. The collective results of the study under the simulated physiological conditions proposed a static type of binding occurring between the CRB and BSA with binding constants of 104 L mol- 1. BSA conformational changes were investigated using three dimensional (3D) and synchronous fluorescence measurements. Moreover, the results of site marker competitive experiments and molecular docking, it could be deduced that CRB was inserted into the subdomain IIA (site I) of BSA yielding a more stabilized system. This was further confirmed with the molecular docking results which revealed that CRB is located in the active site residues Try149, Glu152, Ser191, Arg194, Arg198, Trp213, Arg217, Arg256, His287, Ala290, Glu291, Ser343, Asp450 within a radius of 6 Å. Combining the molecular docking studies and the computed thermodynamic parameters, it can be inferred that hydrophobic and electrostatic interactions are the major binding forces involved in formation of the CRB-BSA complex.

Impact of the alkyl chain length on binding of imidazolium-based ionic liquids to bovine serum albumin

NASA Astrophysics Data System (ADS)

Zhang, Mengyue; Wang, Ying; Zhang, Hongmei; Cao, Jian; Fei, Zhenghao; Wang, Yanqing

2018-05-01

The effects of six imidazolium-based ionic liquids (ILs) with different alkyl chain length ([CnMim]Cl, n = 2, 4, 6, 8, 10, 12) on the structure and functions of bovine serum albumin (BSA) were studied by multi-spectral methods and molecular docking. ILs with the longer alkyl chain length have the stronger binding interaction with BSA and the greater conformational damage to protein. The effects of ILs on the functional properties of BSA were further studied by the determination of non-enzyme esterase activity, β-fibrosis and other properties of BSA. The thermal stability of BSA was reduced, the rate of the formation of beta sheet structures of BSA was lowered, and the esterase-like activity of BSA were decreased with the increase of ILs concentration. Simultaneous molecular modeling technique revealed the favorable binding sites of ILs on protein. The hydrophobic force and polar interactions were the mainly binding forces of them. The calculated results are in a good agreement with the spectroscopic experiments. These studies on the impact of the alkyl chain length on binding of imidazolium-based ionic liquids to BSA are of great significance for understanding and developing the application of ionic liquid in life and physiological system.

AKAP18:PKA-RIIα structure reveals crucial anchor points for recognition of regulatory subunits of PKA

PubMed Central

Götz, Frank; Roske, Yvette; Schulz, Maike Svenja; Autenrieth, Karolin; Bertinetti, Daniela; Faelber, Katja; Zühlke, Kerstin; Kreuchwig, Annika; Kennedy, Eileen J.; Krause, Gerd; Daumke, Oliver; Herberg, Friedrich W.; Heinemann, Udo; Klussmann, Enno

2016-01-01

A-kinase anchoring proteins (AKAPs) interact with the dimerization/docking (D/D) domains of regulatory subunits of the ubiquitous protein kinase A (PKA). AKAPs tether PKA to defined cellular compartments establishing distinct pools to increase the specificity of PKA signalling. Here, we elucidated the structure of an extended PKA-binding domain of AKAP18β bound to the D/D domain of the regulatory RIIα subunits of PKA. We identified three hydrophilic anchor points in AKAP18β outside the core PKA-binding domain, which mediate contacts with the D/D domain. Such anchor points are conserved within AKAPs that bind regulatory RII subunits of PKA. We derived a different set of anchor points in AKAPs binding regulatory RI subunits of PKA. In vitro and cell-based experiments confirm the relevance of these sites for the interaction of RII subunits with AKAP18 and of RI subunits with the RI-specific smAKAP. Thus we report a novel mechanism governing interactions of AKAPs with PKA. The sequence specificity of each AKAP around the anchor points and the requirement of these points for the tight binding of PKA allow the development of selective inhibitors to unequivocally ascribe cellular functions to the AKAP18-PKA and other AKAP-PKA interactions. PMID:27102985

Binding polarity of RPA to telomeric sequences and influence of G-quadruplex stability.

PubMed

Safa, Layal; Delagoutte, Emmanuelle; Petruseva, Irina; Alberti, Patrizia; Lavrik, Olga; Riou, Jean-François; Saintomé, Carole

2014-08-01

Replication protein A (RPA) is a single-stranded DNA binding protein that plays an essential role in telomere maintenance. RPA binds to and unfolds G-quadruplex (G4) structures formed in telomeric DNA, thus facilitating lagging strand DNA replication and telomerase activity. To investigate the effect of G4 stability on the interactions with human RPA (hRPA), we used a combination of biochemical and biophysical approaches. Our data revealed an inverse relationship between G4 stability and ability of hRPA to bind to telomeric DNA; notably small G4 ligands that enhance G4 stability strongly impaired G4 unfolding by hRPA. To gain more insight into the mechanism of binding and unfolding of telomeric G4 structures by RPA, we carried out photo-crosslinking experiments to elucidate the spatial arrangement of the RPA subunits along the DNA strands. Our results showed that RPA1 and RPA2 are arranged from 5' to 3' along the unfolded telomeric G4, as already described for unstructured single-stranded DNA, while no contact is possible with RPA3 on this short oligonucleotide. In addition, these data are compatible with a 5' to 3' directionality in G4 unfolding by hRPA. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

PubMed Central

Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

2015-01-01

Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

h5-HT1B receptor-mediated constitutive Gαi3-protein activation in stably transfected Chinese hamster ovary cells: an antibody capture assay reveals protean efficacy of 5-HT

PubMed Central

Newman-Tancredi, Adrian; Cussac, Didier; Marini, Laetitia; Touzard, Manuelle; Millan, Mark J

2003-01-01

Serotonin 5-HT1B receptors couple to G-proteins of the Gi/o family. However, their activation of specific G-protein subtypes is poorly characterised. Using an innovative antibody capture/guanosine-5′-0-(3-[35S]thio)-triphosphate ([35S]GTPγS) binding strategy, we characterised Gαi3 subunit activation by h5-HT1B receptors stably expressed in Chinese hamster ovary (CHO) cells. The agonists, 5-HT, alniditan and BMS181,101, stimulated Gαi3, whereas methiothepin and SB224,289 behaved as inverse agonists. The selective 5-HT1B receptor ligand, S18127, modestly stimulated Gαi3 and reversed the actions of both 5-HT and methiothepin. S18127 (1 μM) also produced parallel, dextral shifts of the 5-HT and methiothepin isotherms. Isotopic dilution experiments ([35S]GTPγS versus GTPγS) revealed high-affinity [35S]GTPγS binding to Gαi3 subunits in the absence of receptor ligands indicating constitutive activity. High-affinity [35S]GTPγS binding was increased 2.8-fold by 5-HT with an increase in the affinity of GTPγS for Gαi3 subunits. In contrast, methiothepin halved the number of high-affinity binding sites and decreased their affinity. h5-HT1B receptor-mediated Gαi3 subunit activation was dependent on the concentration of NaCl. At 300 mM, 5-HT stimulated [35S]GTPγS binding, basal Gαi3 activation was low and methiothepin was inactive. In contrast, at 10 mM NaCl, basal activity was enhanced and the inverse agonist activity of methiothepin was accentuated. Under these conditions, 5-HT decreased Gαi3 activation. In conclusion, at h5-HT1B receptors expressed in CHO cells: (i) inverse agonist induced inhibition of Gαi3, and its reversal by S18127, reveals constitutive activation of this Gα subunit; (ii) constitutive Gαi3 activation can be quantified by isotopic dilution [35S]GTPγS binding and (iii) decreasing NaCl concentrations enhances Gαi3 activation and leads to protean agonist properties of 5-HT: that is a switch to inhibition of Gαi3. PMID:12684263

h5-HT(1B) receptor-mediated constitutive Galphai3-protein activation in stably transfected Chinese hamster ovary cells: an antibody capture assay reveals protean efficacy of 5-HT.

PubMed

Newman-Tancredi, Adrian; Cussac, Didier; Marini, Laetitia; Touzard, Manuelle; Millan, Mark J

2003-03-01

1. Serotonin 5-HT(1B) receptors couple to G-proteins of the Gi/o family. However, their activation of specific G-protein subtypes is poorly characterised. Using an innovative antibody capture/guanosine-5'-0-(3-[(35)S]thio)-triphosphate ([(35)S]GTPgammaS) binding strategy, we characterised Galpha(i3) subunit activation by h5-HT(1B) receptors stably expressed in Chinese hamster ovary (CHO) cells. 2. The agonists, 5-HT, alniditan and BMS181,101, stimulated Galpha(i3), whereas methiothepin and SB224,289 behaved as inverse agonists. The selective 5-HT(1B) receptor ligand, S18127, modestly stimulated Galpha(i3) and reversed the actions of both 5-HT and methiothepin. S18127 (1 micro M) also produced parallel, dextral shifts of the 5-HT and methiothepin isotherms. 3. Isotopic dilution experiments ([(35)S]GTPgammaS versus GTPgammaS) revealed high-affinity [(35)S]GTPgammaS binding to Galpha(i3) subunits in the absence of receptor ligands indicating constitutive activity. High-affinity [(35)S]GTPgammaS binding was increased 2.8-fold by 5-HT with an increase in the affinity of GTPgammaS for Galpha(i3) subunits. In contrast, methiothepin halved the number of high-affinity binding sites and decreased their affinity. 4. h5-HT(1B) receptor-mediated Galpha(i3) subunit activation was dependent on the concentration of NaCl. At 300 mM, 5-HT stimulated [(35)S]GTPgammaS binding, basal Galpha(i3) activation was low and methiothepin was inactive. In contrast, at 10 mM NaCl, basal activity was enhanced and the inverse agonist activity of methiothepin was accentuated. Under these conditions, 5-HT decreased Galpha(i3) activation. 5. In conclusion, at h5-HT(1B) receptors expressed in CHO cells: (i) inverse agonist induced inhibition of Galpha(i3), and its reversal by S18127, reveals constitutive activation of this Galpha subunit; (ii) constitutive Galpha(i3) activation can be quantified by isotopic dilution [(35)S]GTPgammaS binding and (iii) decreasing NaCl concentrations enhances Galpha(i3) activation and leads to protean agonist properties of 5-HT: that is a switch to inhibition of Galpha(i3).

Synthesis of a Temperature-Sensitive Matrine-Imprinted Polymer and Its Potential Application for the Selective Extraction of Matrine from Radix Sophorae Tonkinensis

PubMed Central

Jiang, Minjie; Wang, Lisheng; Liu, Xu; Yang, Hua; Ren, Fan; Gan, Lizhen; Jiang, Weizhe

2015-01-01

A temperature-sensitive matrine-imprinted polymer was prepared in chloroform by free-radical cross-linking copolymerization of methacrylic acid at 60 °C in the presence of ethylene glycol dimethacrylate as the cross-linker, N-isopropyl acrylamide as the temperature-responsive monomer and matrine as the template molecule. Binding experiments and Scatchard analyses revealed that two classes of binding sites were formed on molecular imprinted polymer (MIP) at 50 °C. Additionally, the thermoresponsive MIP was tested for its application as a sorbent material for the selective separation of matrine from Chinese medicinal plant radix Sophorae tonkinensis. It was shown that the thermoresponsive MIP displayed different efficiency in clean-up and enrichments using the SPE protocol at different temperatures. PMID:25658797

Estrogen receptor-independent catechol estrogen binding activity: protein binding studies in wild-type, Estrogen receptor-alpha KO, and aromatase KO mice tissues.

PubMed

Philips, Brian J; Ansell, Pete J; Newton, Leslie G; Harada, Nobuhiro; Honda, Shin-Ichiro; Ganjam, Venkataseshu K; Rottinghaus, George E; Welshons, Wade V; Lubahn, Dennis B

2004-06-01

Primary evidence for novel estrogen signaling pathways is based upon well-documented estrogenic responses not inhibited by estrogen receptor antagonists. In addition to 17beta-E2, the catechol estrogen 4-hydroxyestradiol (4OHE2) has been shown to elicit biological responses independent of classical estrogen receptors in estrogen receptor-alpha knockout (ERalphaKO) mice. Consequently, our research was designed to biochemically characterize the protein(s) that could be mediating the biological effects of catechol estrogens using enzymatically synthesized, radiolabeled 4-hydroxyestrone (4OHE1) and 4OHE2. Scatchard analyses identified a single class of high-affinity (K(d) approximately 1.6 nM), saturable cytosolic binding sites in several ERalphaKO estrogen-responsive tissues. Specific catechol estrogen binding was competitively inhibited by unlabeled catechol estrogens, but not by 17beta-E2 or the estrogen receptor antagonist ICI 182,780. Tissue distribution studies indicated significant binding differences both within and among various tissues in wild-type, ERalphaKO, and aromatase knockout female mice. Ligand metabolism experiments revealed extensive metabolism of labeled catechol estrogen, suggesting that catechol estrogen metabolites were responsible for the specific binding. Collectively, our data provide compelling evidence for the interaction of catechol estrogen metabolites with a novel binding protein that exhibits high affinity, specificity, and selective tissue distribution. The extensive biochemical characterization of this binding protein indicates that this protein may be a receptor, and thus may mediate ERalpha/beta-independent effects of catechol estrogens and their metabolites.

The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

PubMed Central

Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

2009-01-01

PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

PubMed

Dudev, Todor; Chang, Li-Ying; Lim, Carmay

2005-03-23

Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

Structure of an Arrestin2-clathrin Complex Reveals a Novel Clathrin Binding Domain that Modulates Receptor Trafficking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, D.; Kern, R; Puthenveedu, M

2009-01-01

Non-visual arrestins play a pivotal role as adaptor proteins in regulating the signaling and trafficking of multiple classes of receptors. Although arrestin interaction with clathrin, AP-2, and phosphoinositides contributes to receptor trafficking, little is known about the configuration and dynamics of these interactions. Here, we identify a novel interface between arrestin2 and clathrin through x-ray diffraction analysis. The intrinsically disordered clathrin binding box of arrestin2 interacts with a groove between blades 1 and 2 in the clathrin {beta}-propeller domain, whereas an 8-amino acid splice loop found solely in the long isoform of arrestin2 (arrestin2L) interacts with a binding pocket formedmore » by blades 4 and 5 in clathrin. The apposition of the two binding sites in arrestin2L suggests that they are exclusive and may function in higher order macromolecular structures. Biochemical analysis demonstrates direct binding of clathrin to the splice loop in arrestin2L, whereas functional analysis reveals that both binding domains contribute to the receptor-dependent redistribution of arrestin2L to clathrin-coated pits. Mutagenesis studies reveal that the clathrin binding motif in the splice loop is (L/I){sub 2}GXL. Taken together, these data provide a framework for understanding the dynamic interactions between arrestin2 and clathrin and reveal an essential role for this interaction in arrestin-mediated endocytosis.« less

Binding of fluorescent acridine dyes acridine orange and 9-aminoacridine to hemoglobin: Elucidation of their molecular recognition by spectroscopy, calorimetry and molecular modeling techniques.

PubMed

Chatterjee, Sabyasachi; Kumar, Gopinatha Suresh

2016-06-01

The molecular interaction between hemoglobin (HHb), the major human heme protein, and the acridine dyes acridine orange (AO) and 9-aminoacridine (9AA) was studied by various spectroscopic, calorimetric and molecular modeling techniques. The dyes formed stable ground state complex with HHb as revealed from spectroscopic data. Temperature dependent fluorescence data showed the strength of the dye-protein complexation to be inversely proportional to temperature and the fluorescence quenching was static in nature. The binding-induced conformational change in the protein was investigated using circular dichroism, synchronous fluorescence, 3D fluorescence and FTIR spectroscopy results. Circular dichroism data also quantified the α-helicity change in hemoglobin due to the binding of acridine dyes. Calorimetric studies revealed the binding to be endothermic in nature for both AO and 9AA, though the latter had higher affinity, and this was also observed from spectroscopic data. The binding of both dyes was entropy driven. pH dependent fluorescence studies revealed the existence of electrostatic interaction between the protein and dye molecules. Molecular modeling studies specified the binding site and the non-covalent interactions involved in the association. Overall, the results revealed that a small change in the acridine chromophore leads to remarkable alteration in the structural and thermodynamic aspects of binding to HHb. Copyright © 2016 Elsevier B.V. All rights reserved.

The Shine-Dalgarno sequence of riboswitch-regulated single mRNAs shows ligand-dependent accessibility bursts

NASA Astrophysics Data System (ADS)

Rinaldi, Arlie J.; Lund, Paul E.; Blanco, Mario R.; Walter, Nils G.

2016-01-01

In response to intracellular signals in Gram-negative bacteria, translational riboswitches--commonly embedded in messenger RNAs (mRNAs)--regulate gene expression through inhibition of translation initiation. It is generally thought that this regulation originates from occlusion of the Shine-Dalgarno (SD) sequence upon ligand binding; however, little direct evidence exists. Here we develop Single Molecule Kinetic Analysis of RNA Transient Structure (SiM-KARTS) to investigate the ligand-dependent accessibility of the SD sequence of an mRNA hosting the 7-aminomethyl-7-deazaguanine (preQ1)-sensing riboswitch. Spike train analysis reveals that individual mRNA molecules alternate between two conformational states, distinguished by `bursts' of probe binding associated with increased SD sequence accessibility. Addition of preQ1 decreases the lifetime of the SD's high-accessibility (bursting) state and prolongs the time between bursts. In addition, ligand-jump experiments reveal imperfect riboswitching of single mRNA molecules. Such complex ligand sensing by individual mRNA molecules rationalizes the nuanced ligand response observed during bulk mRNA translation.

Molecular basis for TANK recognition by TRAF1 revealed by the crystal structure of TRAF1/TANK complex.

PubMed

Kim, Chang Min; Jeong, Jae-Hee; Son, Young-Jin; Choi, Jun-Hyuk; Kim, Sunghwan; Park, Hyun Ho

2017-03-01

Tumor necrosis factor receptor-associated factor 1 (TRAF1) is a multifunctional adaptor protein involved in important processes of cellular signaling, including innate immunity and apoptosis. TRAF family member-associated NF-kappaB activator (TANK) has been identified as a competitive intracellular inhibitor of TRAF2 function. Although TRAF recognition by various receptors has been studied extensively in the field of TRAF-mediated biology, molecular and functional details of TANK recognition and interaction with TRAF1 have not been studied. In this study, we report the crystal structure of the TRAF1/TANK peptide complex. Quantitative interaction experiments showed that TANK peptide interacts with both TRAF1 and TRAF2 with similar affinity in a micromolar range. Our structural study also reveals that TANK binds TRAF1 using a minor minimal consensus motif for TRAF binding, Px(Q/E)xT. Coordinate and structural factor were deposited in the Protein Data Bank under PDB ID code 5H10. © 2017 Federation of European Biochemical Societies.

Dynamically Coupled Residues within the SH2 Domain of FYN Are Key to Unlocking Its Activity.

PubMed

Huculeci, Radu; Cilia, Elisa; Lyczek, Agatha; Buts, Lieven; Houben, Klaartje; Seeliger, Markus A; van Nuland, Nico; Lenaerts, Tom

2016-11-01

Src kinase activity is controlled by various mechanisms involving a coordinated movement of kinase and regulatory domains. Notwithstanding the extensive knowledge related to the backbone dynamics, little is known about the more subtle side-chain dynamics within the regulatory domains and their role in the activation process. Here, we show through experimental methyl dynamic results and predicted changes in side-chain conformational couplings that the SH2 structure of Fyn contains a dynamic network capable of propagating binding information. We reveal that binding the phosphorylated tail of Fyn perturbs a residue cluster near the linker connecting the SH2 and SH3 domains of Fyn, which is known to be relevant in the regulation of the activity of Fyn. Biochemical perturbation experiments validate that those residues are essential for inhibition of Fyn, leading to a gain of function upon mutation. These findings reveal how side-chain dynamics may facilitate the allosteric regulation of the different members of the Src kinase family. Copyright © 2016 Elsevier Ltd. All rights reserved.

Crystal structure and biochemical characterization of beta-keto thiolase B from polyhydroxyalkanoate-producing bacterium Ralstonia eutropha H16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Eun-Jung; Son, Hyeoncheol Francis; Kim, Sangwoo

Highlights: • We determined a crystal structure of β-keto thiolase from Ralstonia eutropha H16 (ReBktB). • Distinct substrate binding mode ReBktB was elucidated. • Enzymatic kinetic parameters of ReBktB were revealed. - Abstract: ReBktB is a β-keto thiolase from Ralstonia eutropha H16 that catalyzes condensation reactions between acetyl-CoA with acyl-CoA molecules that contains different numbers of carbon atoms, such as acetyl-CoA, propionyl-CoA, and butyryl-CoA, to produce valuable bioproducts, such as polyhydroxybutyrate, polyhydroxybutyrate-hydroxyvalerate, and hexanoate. We solved a crystal structure of ReBktB at 2.3 Å, and the overall structure has a similar fold to that of type II biosynthetic thiolases, suchmore » as PhbA from Zoogloea ramigera (ZrPhbA). The superposition of this structure with that of ZrPhbA complexed with CoA revealed the residues that comprise the catalytic and substrate binding sites of ReBktB. The catalytic site of ReBktB contains three conserved residues, Cys90, His350, and Cys380, which may function as a covalent nucleophile, a general base, and second nucleophile, respectively. For substrate binding, ReBktB stabilized the ADP moiety of CoA in a distinct way compared to ZrPhbA with His219, Arg221, and Asp228 residues, whereas the stabilization of β-mercaptoethyamine and pantothenic acid moieties of CoA was quite similar between these two enzymes. Kinetic study of ReBktB revealed that K{sub m}, V{sub max}, and K{sub cat} values of 11.58 μM, 1.5 μmol/min, and 102.18 s{sup −1}, respectively, and the catalytic and substrate binding sites of ReBktB were further confirmed by site-directed mutagenesis experiments.« less

Interaction of ATP with a small heat shock protein from Mycobacterium leprae: effect on its structure and function.

PubMed

Nandi, Sandip Kumar; Chakraborty, Ayon; Panda, Alok Kumar; Ray, Sougata Sinha; Kar, Rajiv Kumar; Bhunia, Anirban; Biswas, Ashis

2015-03-01

Adenosine-5'-triphosphate (ATP) is an important phosphate metabolite abundantly found in Mycobacterium leprae bacilli. This pathogen does not derive ATP from its host but has its own mechanism for the generation of ATP. Interestingly, this molecule as well as several antigenic proteins act as bio-markers for the detection of leprosy. One such bio-marker is the 18 kDa antigen. This 18 kDa antigen is a small heat shock protein (HSP18) whose molecular chaperone function is believed to help in the growth and survival of the pathogen. But, no evidences of interaction of ATP with HSP18 and its effect on the structure and chaperone function of HSP18 are available in the literature. Here, we report for the first time evidences of "HSP18-ATP" interaction and its consequences on the structure and chaperone function of HSP18. TNP-ATP binding experiment and surface plasmon resonance measurement showed that HSP18 interacts with ATP with a sub-micromolar binding affinity. Comparative sequence alignment between M. leprae HSP18 and αB-crystallin identified the sequence 49KADSLDIDIE58 of HSP18 as the Walker-B ATP binding motif. Molecular docking studies revealed that β4-β8 groove/strands as an ATP interactive region in M. leprae HSP18. ATP perturbs the tertiary structure of HSP18 mildly and makes it less susceptible towards tryptic cleavage. ATP triggers exposure of additional hydrophobic patches at the surface of HSP18 and induces more stability against chemical and thermal denaturation. In vitro aggregation and thermal inactivation assays clearly revealed that ATP enhances the chaperone function of HSP18. Our studies also revealed that the alteration in the chaperone function of HSP18 is reversible and is independent of ATP hydrolysis. As the availability and binding of ATP to HSP18 regulates its chaperone function, this functional inflection may play an important role in the survival of M. leprae in hosts.

The role of attention in binding visual features in working memory: evidence from cognitive ageing.

PubMed

Brown, Louise A; Brockmole, James R

2010-10-01

Two experiments were conducted to assess the costs of attentional load during a feature (colour-shape) binding task in younger and older adults. Experiment 1 showed that a demanding backwards counting task, which draws upon central executive/general attentional resources, reduced binding to a greater extent than individual feature memory, but the effect was no greater in older than in younger adults. Experiment 2 showed that presenting memory items sequentially rather than simultaneously, such that items are required to be maintained while new representations are created, selectively affects binding performance in both age groups. Although this experiment exhibited an age-related binding deficit overall, both age groups were affected by the attention manipulation to an equal extent. While a role for attentional processes in colour-shape binding was apparent across both experiments, manipulations of attention exerted equal effects in both age groups. We therefore conclude that age-related binding deficits neither emerge nor are exacerbated under conditions of high attentional load. Implications for theories of visual working memory and cognitive ageing are discussed.

The Collagen Binding Protein Cnm Contributes to Oral Colonization and Cariogenicity of Streptococcus mutans OMZ175

PubMed Central

Miller, James H.; Avilés-Reyes, Alejandro; Scott-Anne, Kathy; Gregoire, Stacy; Watson, Gene E.; Sampson, Edith; Progulske-Fox, Ann; Koo, Hyun; Bowen, William H.; Lemos, José A.

2015-01-01

Streptococcus mutans is the etiological agent of dental caries and one of the many bacterial species implicated in infective endocarditis. The expression of the collagen-binding protein Cnm by S. mutans has been associated with extraoral infections, but its relevance for dental caries has only been theorized to date. Due to the collagenous composition of dentinal and root tissues, we hypothesized that Cnm may facilitate the colonization of these surfaces, thereby enhancing the pathogenic potential of S. mutans in advancing carious lesions. As shown for extraoral endothelial cell lines, Cnm mediates the invasion of oral keratinocytes and fibroblasts by S. mutans. In this study, we show that in the Cnm+ native strain, OMZ175, Cnm mediates stringent adhesion to dentinal and root tissues as well as collagen-coated surfaces and promotes both cariogenicity and carriage in vivo. In vitro, ex vivo, and in vivo experiments revealed that while Cnm is not universally required for S. mutans cariogenicity, it contributes to (i) the invasion of the oral epithelium, (ii) enhanced binding on collagenous surfaces, (iii) implantation of oral biofilms, and (IV) the severity of caries due to a native Cnm+ isolate. Taken together, our findings reveal that Cnm is a colonization factor that contributes to the pathogenicity of certain S. mutans strains in their native habitat, the oral cavity. PMID:25733523

NO Dioxygenase Activity in Hemoglobins Is Ubiquitous In Vitro, but Limited by Reduction In Vivo

PubMed Central

Smagghe, Benoit J.; Trent, James T.; Hargrove, Mark S.

2008-01-01

Genomics has produced hundreds of new hemoglobin sequences with examples in nearly every living organism. Structural and biochemical characterizations of many recombinant proteins reveal reactions, like oxygen binding and NO dioxygenation, that appear general to the hemoglobin superfamily regardless of whether they are related to physiological function. Despite considerable attention to “hexacoordinate” hemoglobins, which are found in nearly every plant and animal, no clear physiological role(s) has been assigned to them in any species. One popular and relevant hypothesis for their function is protection against NO. Here we have tested a comprehensive representation of hexacoordinate hemoglobins from plants (rice hemoglobin), animals (neuroglobin and cytoglobin), and bacteria (Synechocystis hemoglobin) for their abilities to scavenge NO compared to myoglobin. Our experiments include in vitro comparisons of NO dioxygenation, ferric NO binding, NO-induced reduction, NO scavenging with an artificial reduction system, and the ability to substitute for a known NO scavenger (flavohemoglobin) in E. coli. We conclude that none of these tests reveal any distinguishing predisposition toward a role in NO scavenging for the hxHbs, but that any hemoglobin could likely serve this role in the presence of a mechanism for heme iron re-reduction. Hence, future research to test the role of Hbs in NO scavenging would benefit more from the identification of cognate reductases than from in vitro analysis of NO and O2 binding. PMID:18446211

Geraniin extracted from the rind of Nephelium lappaceum binds to dengue virus type-2 envelope protein and inhibits early stage of virus replication.

PubMed

Abdul Ahmad, Siti Aisyah; Palanisamy, Uma D; Tejo, Bimo A; Chew, Miaw Fang; Tham, Hong Wai; Syed Hassan, Sharifah

2017-11-21

The rapid rise and spread in dengue cases, together with the unavailability of safe vaccines and effective antiviral drugs, warrant the need to discover and develop novel anti-dengue treatments. In this study the antiviral activity of geraniin, extracted from the rind of Nephelium lappaceum, against dengue virus type-2 (DENV-2) was investigated. Geraniin was prepared from Nephelium lappaceum rind by reverse phase C-18 column chromatography. Cytotoxicity of geraniin towards Vero cells was evaluated using MTT assay while IC 50 value was determined by plaque reduction assay. The mode-of-action of geraniin was characterized using the virucidal, attachment, penetration and the time-of-addition assays'. Docking experiments with geraniin molecule and the DENV envelope (E) protein was also performed. Finally, recombinant E Domain III (rE-DIII) protein was produced to physiologically test the binding of geraniin to DENV-2 E-DIII protein, through ELISA competitive binding assay. Cytotoxicity assay confirmed that geraniin was not toxic to Vero cells, even at the highest concentration tested. The compound exhibited DENV-2 plaque formation inhibition, with an IC 50 of 1.75 μM. We further revealed that geraniin reduced viral infectivity and inhibited DENV-2 from attaching to the cells but had little effect on its penetration. Geraniin was observed to be most effective when added at the early stage of DENV-2 infection. Docking experiments showed that geraniin binds to DENV E protein, specifically at the DIII region, while the ELISA competitive binding assay confirmed geraniin's interaction with rE-DIII with high affinity. Geraniin from the rind of Nephelium lappaceum has antiviral activity against DENV-2. It is postulated that the compound inhibits viral attachment by binding to the E-DIII protein and interferes with the initial cell-virus interaction. Our results demonstrate that geraniin has the potential to be developed into an effective antiviral treatment, particularly for early phase dengue viral infection.

Crystal structures of the transpeptidase domain of the Mycobacterium tuberculosis penicillin-binding protein PonA1 reveal potential mechanisms of antibiotic resistance.

PubMed

Filippova, Ekaterina V; Kieser, Karen J; Luan, Chi-Hao; Wawrzak, Zdzislaw; Kiryukhina, Olga; Rubin, Eric J; Anderson, Wayne F

2016-06-01

Mycobacterium tuberculosis is a human respiratory pathogen that causes the deadly disease tuberculosis. The rapid global spread of antibiotic-resistant M. tuberculosis makes tuberculosis infections difficult to treat. To overcome this problem new effective antimicrobial strategies are urgently needed. One promising target for new therapeutic approaches is PonA1, a class A penicillin-binding protein, which is required for maintaining physiological cell wall synthesis and cell shape during growth in mycobacteria. Here, crystal structures of the transpeptidase domain, the enzymatic domain responsible for penicillin binding, of PonA1 from M. tuberculosis in the inhibitor-free form and in complex with penicillin V are reported. We used site-directed mutagenesis, antibiotic profiling experiments, and fluorescence thermal shift assays to measure PonA1's sensitivity to different classes of β-lactams. Structural comparison of the PonA1 apo-form and the antibiotic-bound form shows that binding of penicillin V induces conformational changes in the position of the loop β4'-α3 surrounding the penicillin-binding site. We have also found that binding of different antibiotics including penicillin V positively impacts protein stability, while other tested β-lactams such as clavulanate or meropenem resulted in destabilization of PonA1. Our antibiotic profiling experiments indicate that the transpeptidase activity of PonA1 in both M. tuberculosis and M. smegmatis mediates tolerance to specific cell wall-targeting antibiotics, particularly to penicillin V and meropenem. Because M. tuberculosis is an important human pathogen, these structural data provide a template to design novel transpeptidase inhibitors to treat tuberculosis infections. Structural data are available in the PDB database under the accession numbers 5CRF and 5CXW. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Detection of Specific Solvent Rearrangement Regions of an Enzyme: NMR and ITC Studies with Aminoglycoside Phosphotransferase(3??)-IIIa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozen, C.; Norris, Adrianne; Land, Miriam L

2008-01-01

This work describes differential effects of solvent in complexes of the aminoglycoside phosphotransferase(3¢)-IIIa (APH) with different aminoglycosides and the detection of change in solvent structure at specific sites away from substrates. Binding of kanamycins to APH occurs with a larger negative ¢H in H2O relative to D2O (¢¢H(H2O-D2O) < 0), while the reverse is true for neomycins. Unusually large negative ¢Cp values were observed for binding of aminoglycosides to APH. ¢Cp for the APHneomycin complex was -1.6 kcalâmol-1âdeg-1. A break at 30 C was observed in the APH-kanamycin complex yielding ¢Cp values of -0.7 kcalâmol-1âdeg-1 and -3.8 kcalâmol-1âdeg-1 below andmore » above 30 C, respectively. Neither the change in accessible surface area (¢ASA) nor contributions from heats of ionization were sufficient to explain the large negative ¢Cp values. Most significantly, 15N-1H HSQC experiments showed that temperature-dependent shifts of the backbone amide protons of Leu 88, Ser 91, Cys 98, and Leu143 revealed a break at 30 C only in the APH-kanamycin complex in spectra collected between 21 C and 38 C. These amino acids represent solVent reorganization sites that experience a change in solvent structure in their immediate environment as structurally different ligands bind to the enzyme. These residues were away from the substrate binding site and distributed in three hydrophobic patches in APH. Overall, our results show that a large number of factors affect ¢Cp and binding of structurally different ligand groups cause different solvent structure in the active site as well as differentially affecting specific sites away from the ligand binding site.« less

Molecular modeling studies of substrate binding by penicillin acylase.

PubMed

Chilov, G G; Stroganov, O V; Svedas, V K

2008-01-01

Molecular modeling has revealed intimate details of the mechanism of binding of natural substrate, penicillin G (PG), in the penicillin acylase active center and solved questions raised by analysis of available X-ray structures, mimicking Michaelis complex, which substantially differ in the binding pattern of the PG leaving group. Three MD trajectories were launched, starting from PDB complexes of the inactive mutant enzyme with PG (1FXV) and native penicillin acylase with sluggishly hydrolyzed substrate analog penicillin G sulfoxide (1GM9), or from the complex obtained by PG docking. All trajectories converged to a similar PG binding mode, which represented the near-to-attack conformation, consistent with chemical criteria of how reactive Michaelis complex should look. Simulated dynamic structure of the enzyme-substrate complex differed significantly from 1FXV, resembling rather 1GM9; however, additional contacts with residues bG385, bS386, and bN388 have been found, which were missing in X-ray structures. Combination of molecular docking and molecular dynamics also clarified the nature of extremely effective phenol binding in the hydrophobic pocket of penicillin acylase, which lacked proper explanation from crystallographic experiments. Alternative binding modes of phenol were probed, and corresponding trajectories converged to a single binding pattern characterized by a hydrogen bond between the phenol hydroxyl and the main chain oxygen of bS67, which was not evident from the crystal structure. Observation of the trajectory, in which phenol moved from its steady bound to pre-dissociation state, mapped the consequence of molecular events governing the conformational transitions in a coil region a143-a146 coupled to substrate binding and release of the reaction products. The current investigation provided information on dynamics of the conformational transitions accompanying substrate binding and significance of poorly structured and flexible regions in maintaining catalytic framework.

CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

PubMed Central

Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

2011-01-01

The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

Volatile anesthetics, not intravenous anesthetic propofol bind to and attenuate the activation of platelet receptor integrin αIIbβ3.

PubMed

Yuki, Koichi; Bu, Weiming; Shimaoka, Motomu; Eckenhoff, Roderic

2013-01-01

In clinical reports, the usage of isoflurane and sevoflurane was associated with more surgical field bleeding in endoscopic sinus surgeries as compared to propofol. The activation of platelet receptor αIIbβ3 is a crucial event for platelet aggregation and clot stability. Here we studied the effect of isoflurane, sevoflurane, and propofol on the activation of αIIbβ3. The effect of anesthetics on the activation of αIIbβ3 was probed using the activation sensitive antibody PAC-1 in both cell-based (platelets and αIIbβ3 transfectants) and cell-free assays. The binding sites of isoflurane on αIIbβ3 were explored using photoactivatable isoflurane (azi-isoflurane). The functional implication of revealed isoflurane binding sites were studied using alanine-scanning mutagenesis. Isoflurane and sevoflurane diminished the binding of PAC-1 to wild-type αIIbβ3 transfectants, but not to the high-affinity mutant, β3-N305T. Both anesthetics also impaired PAC-1 binding in a cell-free assay. In contrast, propofol did not affect the activation of αIIbβ3. Residues adducted by azi-isoflurane were near the calcium binding site (an important regulatory site termed SyMBS) just outside of the ligand binding site. The mutagenesis experiments demonstrated that these adducted residues were important in regulating integrin activation. Isoflurane and sevoflurane, but not propofol, impaired the activation of αIIbβ3. Azi-isoflurane binds to the regulatory site of integrin αIIbβ3, thereby suggesting that isoflurane blocks ligand binding of αIIbβ3 in not a competitive, but an allosteric manner.

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed Central

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-01-01

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis. Images PMID:1408831

The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.

PubMed

Diccianni, M B; Imagawa, M; Muramatsu, M

1992-10-11

Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.

Ultralong-range Rydberg Molecules: Investigation of a Novel Binding Mechanism

NASA Astrophysics Data System (ADS)

Butscher, Björn; Bendkowsky, Vera; Nipper, Johannes; Balewski, Jonathan; Shaffer, James P.; Löw, Robert; Pfau, Tilman

2010-03-01

For highly excited Rydberg atoms, the scattering of the Rydberg electron from a nearby polarizable ground state atom can generate an attractive mean-field potential which is able to bind the ground state atom to the Rydberg atom within the Rydberg electron wave function at binding energies ranging from a few MHz to hundreds of MHz[1]. We present spectroscopic data on the observation of various bound states including the vibrational ground and excited states of rubidium dimers Rb(5S)-Rb(nS) as well as those of trimer states. Furthermore, we show calculations that reproduce the observed binding energies remarkably well and reveal that some of the excited states are purely bound by quantum reflection at a shape resonance for p-wave scattering [2]. To further characterize the coherent excitation of the molecular states, we performed echo experiments. [0pt] [1] V. Bendkowsky, B. Butscher, J. Nipper, J. P. Shaffer, R. Löw, T. Pfau, Nature 458, 1005 (2009); [2] V. Bendkowsky, B. Butscher, J. Nipper, J. Balewski, J. P. Shaffer, R. Löw, T. Pfau, W. Li, J. Stanojevic, T. Pohl,and J. M. Rost, arXiv:0912.4058 (2009)

GNL3L Inhibits Estrogen Receptor-Related Protein Activities by Competing for Coactivator Binding

PubMed Central

Yasumoto, Hiroaki; Meng, Lingjun; Lin, Tao; Zhu, Qubo; Tsai, Robert Y.L.

2010-01-01

Summary Guanine-nucleotide binding protein 3-like (GNL3L) is the closest homologue of a stem cell-enriched factor nucleostemin in vertebrates. They share the same yeast orthologue, Grn1p, but only GNL3L can rescue the growth-deficient phenotype in Grn1p-null yeasts. To determine the unique function of GNL3L, we identified estrogen receptor-related protein-γ (ERRγ) as a GNL3L-specific binding protein. GNL3L and ERRγ are coexpressed in the eye, kidney and muscle, and co-reside in the nucleoplasm. The interaction between GNL3L and ERRγ requires the intermediate domain of GNL3L and the AF2-domain of ERRγ. Gain- and loss-of-function experiments show that GNL3L can inhibit the transcriptional activities of ERR genes in a cell-based reporter system, which does not require the nucleolar localization of GNL3L. We further demonstrate that GNL3L is able to reduce the steroid receptor coactivator (SRC) binding and the SRC-mediated transcriptional coactivation of ERRγ. This work reveals a novel mechanism that negatively regulates the transcriptional function of ERRγ by GNL3L through coactivator competition. PMID:17623774

Characterization of the Saccharomyces cerevisiae ATP-Interactome using the iTRAQ-SPROX Technique

NASA Astrophysics Data System (ADS)

Geer, M. Ariel; Fitzgerald, Michael C.

2016-02-01

The stability of proteins from rates of oxidation (SPROX) technique was used in combination with an isobaric mass tagging strategy to identify adenosine triphosphate (ATP) interacting proteins in the Saccharomyces cerevisiae proteome. The SPROX methodology utilized in this work enabled 373 proteins in a yeast cell lysate to be assayed for ATP interactions (both direct and indirect) using the non-hydrolyzable ATP analog, adenylyl imidodiphosphate (AMP-PNP). A total of 28 proteins were identified with AMP-PNP-induced thermodynamic stability changes. These protein hits included 14 proteins that were previously annotated as ATP-binding proteins in the Saccharomyces Genome Database (SGD). The 14 non-annotated ATP-binding proteins included nine proteins that were previously found to be ATP-sensitive in an earlier SPROX study using a stable isotope labeling with amino acids in cell culture (SILAC)-based approach. A bioinformatics analysis of the protein hits identified here and in the earlier SILAC-SPROX experiments revealed that many of the previously annotated ATP-binding protein hits were kinases, ligases, and chaperones. In contrast, many of the newly discovered ATP-sensitive proteins were not from these protein classes, but rather were hydrolases, oxidoreductases, and nucleic acid-binding proteins.

Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

PubMed

Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

2011-08-01

Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

Galectin-1-asialofetuin interaction is inhibited by peptides containing the tyr-xxx-tyr motif acting on the glycoprotein.

PubMed

Wéber, Edit; Hetényi, Anasztázia; Váczi, Balázs; Szolnoki, Eva; Fajka-Boja, Roberta; Tubak, Vilmos; Monostori, Eva; Martinek, Tamás A

2010-01-25

Galectin-1 (Gal-1), a ubiquitous beta-galactoside-binding protein expressed by various normal and pathological tissues, has been implicated in cancer and autoimmune/inflammatory diseases in consequence of its regulatory role in adhesion, cell viability, proliferation, and angiogenesis. The functions of Gal-1 depend on its affinity for beta-galactoside-containing glycoconjugates; accordingly, the inhibition of sugar binding blocks its functions, hence promising potential therapeutic tools. The Tyr-Xxx-Tyr peptide motifs have been reported to be glycomimetic sequences, mainly on the basis of their inhibitory effect on the Gal-1-asialofetuin (ASF) interaction. However, the results regarding the efficacy of the Tyr-Xxx-Tyr motif as a glycomimetic inhibitor are still controversial. The present STD and trNOE NMR experiments reveal that the Tyr-Xxx-Tyr peptides studied do not bind to Gal-1, whereas their binding to ASF is clearly detected. (15)N,(1)H HSQC titrations with (15)N-labeled Gal-1 confirm the absence of any peptide-Gal-1 interaction. These data indicate that the Tyr-Xxx-Tyr peptides tested in this work are not glycomimetics as they interact with ASF via an unrevealed molecular linkage.

Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(ʟ-Lysine): Experimental Study and Modeling Approach.

PubMed

Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

2017-06-17

The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(ʟ-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4.

Optimization of Polyplex Formation between DNA Oligonucleotide and Poly(l-Lysine): Experimental Study and Modeling Approach

PubMed Central

Vasiliu, Tudor; Cojocaru, Corneliu; Rotaru, Alexandru; Pricope, Gabriela; Pinteala, Mariana; Clima, Lilia

2017-01-01

The polyplexes formed by nucleic acids and polycations have received a great attention owing to their potential application in gene therapy. In our study, we report experimental results and modeling outcomes regarding the optimization of polyplex formation between the double-stranded DNA (dsDNA) and poly(l-Lysine) (PLL). The quantification of the binding efficiency during polyplex formation was performed by processing of the images captured from the gel electrophoresis assays. The design of experiments (DoE) and response surface methodology (RSM) were employed to investigate the coupling effect of key factors (pH and N/P ratio) affecting the binding efficiency. According to the experimental observations and response surface analysis, the N/P ratio showed a major influence on binding efficiency compared to pH. Model-based optimization calculations along with the experimental confirmation runs unveiled the maximal binding efficiency (99.4%) achieved at pH 5.4 and N/P ratio 125. To support the experimental data and reveal insights of molecular mechanism responsible for the polyplex formation between dsDNA and PLL, molecular dynamics simulations were performed at pH 5.4 and 7.4. PMID:28629130

Investigation of the interaction between naringin and human serum albumin

NASA Astrophysics Data System (ADS)

Zhang, Yaheng; Li, Ying; Dong, Lijun; Li, Jiazhong; He, Wenying; Chen, Xingguo; Hu, Zhide

2008-03-01

The interaction between naringin and human serum albumin (HSA) has been thoroughly studied by fluorescence quenching technique in combination with UV absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, circular dichroism (CD) spectroscopy and molecular modeling method. Under the simulative physiological conditions, fluorescence data revealed the presence of the binding site on HSA and its binding constants ( K) are 1.62 × 10 4, 1.68 × 10 4, 1.72 × 10 4, and 1.79 × 10 4 M -1 at 289, 296, 303, and 310 K, respectively. The alterations of protein secondary structure in the presence of naringin aqueous solution were qualitative and quantitative calculated by the evidence from CD and FT-IR spectroscopes. In addition, according to the Van't Hoff equation, the thermodynamic functions standard enthalpy (Δ H0) and standard entropy (Δ S0) for the reaction were calculated to be 3.45 kJ mol -1 and 92.52 J mol -1 K -1. These results indicated that naringin binds to HSA mainly by a hydrophobic interaction. Furthermore, the displacement experiments confirmed that naringin could bind to the site I of HSA, which was also in agreement with the result of the molecular modeling study.

Single-molecule photobleaching reveals increased MET receptor dimerization upon ligand binding in intact cells

PubMed Central

2013-01-01

Background The human receptor tyrosine kinase MET and its ligand hepatocyte growth factor/scatter factor are essential during embryonic development and play an important role during cancer metastasis and tissue regeneration. In addition, it was found that MET is also relevant for infectious diseases and is the target of different bacteria, amongst them Listeria monocytogenes that induces bacterial uptake through the surface protein internalin B. Binding of ligand to the MET receptor is proposed to lead to receptor dimerization. However, it is also discussed whether preformed MET dimers exist on the cell membrane. Results To address these issues we used single-molecule fluorescence microscopy techniques. Our photobleaching experiments show that MET exists in dimers on the membrane of cells in the absence of ligand and that the proportion of MET dimers increases significantly upon ligand binding. Conclusions Our results indicate that partially preformed MET dimers may play a role in ligand binding or MET signaling. The addition of the bacterial ligand internalin B leads to an increase of MET dimers which is in agreement with the model of ligand-induced dimerization of receptor tyrosine kinases. PMID:23731667

Predicting DNA binding proteins using support vector machine with hybrid fractal features.

PubMed

Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

2014-02-21

DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

The Vibrio cholerae Colonization Factor GbpA Possesses a Modular Structure that Governs Binding to Different Host Surfaces

PubMed Central

Wong, Edmond; Vaaje-Kolstad, Gustav; Ghosh, Avishek; Hurtado-Guerrero, Ramon; Konarev, Peter V.; Ibrahim, Adel F. M.; Svergun, Dmitri I.; Eijsink, Vincent G. H.; Chatterjee, Nabendu S.; van Aalten, Daan M. F.

2012-01-01

Vibrio cholerae is a bacterial pathogen that colonizes the chitinous exoskeleton of zooplankton as well as the human gastrointestinal tract. Colonization of these different niches involves an N-acetylglucosamine binding protein (GbpA) that has been reported to mediate bacterial attachment to both marine chitin and mammalian intestinal mucin through an unknown molecular mechanism. We report structural studies that reveal that GbpA possesses an unusual, elongated, four-domain structure, with domains 1 and 4 showing structural homology to chitin binding domains. A glycan screen revealed that GbpA binds to GlcNAc oligosaccharides. Structure-guided GbpA truncation mutants show that domains 1 and 4 of GbpA interact with chitin in vitro, whereas in vivo complementation studies reveal that domain 1 is also crucial for mucin binding and intestinal colonization. Bacterial binding studies show that domains 2 and 3 bind to the V. cholerae surface. Finally, mouse virulence assays show that only the first three domains of GbpA are required for colonization. These results explain how GbpA provides structural/functional modular interactions between V. cholerae, intestinal epithelium and chitinous exoskeletons. PMID:22253590

Intracellular calcium movements during excitation–contraction coupling in mammalian slow-twitch and fast-twitch muscle fibers

PubMed Central

Hollingworth, Stephen

2012-01-01

In skeletal muscle fibers, action potentials elicit contractions by releasing calcium ions (Ca2+) from the sarcoplasmic reticulum. Experiments on individual mouse muscle fibers micro-injected with a rapidly responding fluorescent Ca2+ indicator dye reveal that the amount of Ca2+ released is three- to fourfold larger in fast-twitch fibers than in slow-twitch fibers, and the proportion of the released Ca2+ that binds to troponin to activate contraction is substantially smaller. PMID:22450485

Synthesis and pharmacological characterization of beta2-adrenergic agonist enantiomers: zilpaterol.

PubMed

Kern, Christopher; Meyer, Thorsten; Droux, Serge; Schollmeyer, Dieter; Miculka, Christian

2009-03-26

The beta-adrenergic agonist 1 (zilpaterol) is used as production enhancer in cattle. Binding experiments of separated enantiomers on recombinant human beta(2)-adrenergic and mu-opioid receptors and functional studies showed that the (-)-1 enantiomer accounts for essentially all the beta(2)-adrenergic agonist activity and that it exhibits less affinity toward the mu-opioid receptor than (+)-1, which is a mu-opioid receptor antagonist. X-ray crystallography revealed the absolute configuration of (-)-1 to be 6R,7R.

An anti-hapten camelid antibody reveals a cryptic binding site with significant energetic contributions from a nonhypervariable loop

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fanning, Sean W.; Horn, James R.

2014-03-05

Conventional anti-hapten antibodies typically bind low-molecular weight compounds (haptens) in the crevice between the variable heavy and light chains. Conversely, heavy chain-only camelid antibodies, which lack a light chain, must rely entirely on a single variable domain to recognize haptens. While several anti-hapten VHHs have been generated, little is known regarding the underlying structural and thermodynamic basis for hapten recognition. Here, an anti-methotrexate VHH (anti-MTX VHH) was generated using grafting methods whereby the three complementarity determining regions (CDRs) were inserted onto an existing VHH framework. Thermodynamic analysis of the anti-MTX VHH CDR1-3 Graft revealed a micromolar binding affinity, while themore » crystal structure of the complex revealed a somewhat surprising noncanonical binding site which involved MTX tunneling under the CDR1 loop. Due to the close proximity of MTX to CDR4, a nonhypervariable loop, the CDR4 loop sequence was subsequently introduced into the CDR1-3 graft, which resulted in a dramatic 1000-fold increase in the binding affinity. Crystal structure analysis of both the free and complex anti-MTX CDR1-4 graft revealed CDR4 plays a significant role in both intermolecular contacts and binding site conformation that appear to contribute toward high affinity binding. Additionally, the anti-MTX VHH possessed relatively high specificity for MTX over closely related compounds aminopterin and folate, demonstrating that VHH domains are capable of binding low-molecular weight ligands with high affinity and specificity, despite their reduced interface.« less

Mechanical Unfolding Studies on Single-Domain SUMO and Multi-Domain Periplasmic Binding Proteins

NASA Astrophysics Data System (ADS)

Kotamarthi, Hema Chandra; Ainavarapu, Sri Rama Koti

Protein mechanics is a key component of many cellular and sub-cellular processes. The current review focuses on recent studies from our laboratory that probe the effect of sequence on the mechanical stability of structurally similar proteins and the unfolding mechanisms of multi-domain periplasmic binding proteins. Ubiquitin and small ubiquitin-related modifiers (SUMOs) are structurally similar and possess different mechanical stabilities, ubiquitin being stronger than SUMOs as revealed from their unfolding forces. These differences are plausibly due to the variation in number of inter-residue contacts. The unfolding potential widths determined from the pulling speed-dependent studies revealed that SUMOs are mechanically more flexible than ubiquitin. This flexibility of SUMOs plays a role in ligand binding and our single-molecule studies on SUMO interaction with SUMO binding motifs (SBMs) have shown that ligand binding decreases the SUMO flexibility and increases its mechanical stability. Studies on multi-domain periplasmic binding proteins have revealed that the unfolding energy landscape of these proteins is complex and they follow kinetic partitioning between two-state and multiple three-state pathways.

Thermodynamic Exploration of Eosin-Lysozyme Binding: A Physical Chemistry and Biochemistry Laboratory Experiment

ERIC Educational Resources Information Center

Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.

2010-01-01

We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…

Adaptation of avian influenza A (H6N1) virus from avian to human receptor-binding preference

PubMed Central

Wang, Fei; Qi, Jianxun; Bi, Yuhai; Zhang, Wei; Wang, Min; Zhang, Baorong; Wang, Ming; Liu, Jinhua; Yan, Jinghua; Shi, Yi; Gao, George F

2015-01-01

The receptor-binding specificity of influenza A viruses is a major determinant for the host tropism of the virus, which enables interspecies transmission. In 2013, the first human case of infection with avian influenza A (H6N1) virus was reported in Taiwan. To gather evidence concerning the epidemic potential of H6 subtype viruses, we performed comprehensive analysis of receptor-binding properties of Taiwan-isolated H6 HAs from 1972 to 2013. We propose that the receptor-binding properties of Taiwan-isolated H6 HAs have undergone three major stages: initially avian receptor-binding preference, secondarily obtaining human receptor-binding capacity, and recently human receptor-binding preference, which has been confirmed by receptor-binding assessment of three representative virus isolates. Mutagenesis work revealed that E190V and G228S substitutions are important to acquire the human receptor-binding capacity, and the P186L substitution could reduce the binding to avian receptor. Further structural analysis revealed how the P186L substitution in the receptor-binding site of HA determines the receptor-binding preference change. We conclude that the human-infecting H6N1 evolved into a human receptor preference. PMID:25940072

Conformational Preference of ‘CαNN’ Short Peptide Motif towards Recognition of Anions

PubMed Central

Banerjee, Raja

2013-01-01

Among several ‘anion binding motifs’, the recently described ‘CαNN’ motif occurring in the loop regions preceding a helix, is conserved through evolution both in sequence and its conformation. To establish the significance of the conserved sequence and their intrinsic affinity for anions, a series of peptides containing the naturally occurring ‘CαNN’ motif at the N-terminus of a designed helix, have been modeled and studied in a context free system using computational techniques. Appearance of a single interacting site with negative binding free-energy for both the sulfate and phosphate ions, as evidenced in docking experiments, establishes that the ‘CαNN’ segment has an intrinsic affinity for anions. Molecular Dynamics (MD) simulation studies reveal that interaction with anion triggers a conformational switch from non-helical to helical state at the ‘CαNN’ segment, which extends the length of the anchoring-helix by one turn at the N-terminus. Computational experiments substantiate the significance of sequence/structural context and justify the conserved nature of the ‘CαNN’ sequence for anion recognition through “local” interaction. PMID:23516403

Nickel binding and [NiFe]-hydrogenase maturation by the metallochaperone SlyD with a single metal-binding site in Escherichia coli.

PubMed

Kaluarachchi, Harini; Altenstein, Matthias; Sugumar, Sonia R; Balbach, Jochen; Zamble, Deborah B; Haupt, Caroline

2012-03-16

SlyD (sensitive to lysis D) is a nickel metallochaperone involved in the maturation of [NiFe]-hydrogenases in Escherichia coli (E. coli) and specifically contributes to the nickel delivery step during enzyme biosynthesis. This protein contains a C-terminal metal-binding domain that is rich in potential metal-binding residues that enable SlyD to bind multiple nickel ions with high affinity. The SlyD homolog from Thermus thermophilus does not contain the extended cysteine- and histidine-rich C-terminal tail of the E. coli protein, yet it binds a single Ni(II) ion tightly. To investigate whether a single metal-binding motif can functionally replace the full-length domain, we generated a truncation of E. coli SlyD, SlyD155. Ni(II) binding to SlyD155 was investigated by using isothermal titration calorimetry, NMR and electrospray ionization mass spectrometry measurements. This in vitro characterization revealed that SlyD155 contains a single metal-binding motif with high affinity for nickel. Structural characterization by X-ray absorption spectroscopy and NMR indicated that nickel was coordinated in an octahedral geometry with at least two histidines as ligands. Heterodimerization between SlyD and another hydrogenase accessory protein, HypB, is essential for optimal hydrogenase maturation and was confirmed for SlyD155 via cross-linking experiments and NMR titrations, as were conserved chaperone and peptidyl-prolyl isomerase activities. Although these properties of SlyD are preserved in the truncated version, it does not modulate nickel binding to HypB in vitro or contribute to the maturation of [NiFe]-hydrogenases in vivo, unlike the full-length protein. This study highlights the importance of the unusual metal-binding domain of E. coli SlyD in hydrogenase biogenesis. Copyright © 2012 Elsevier Ltd. All rights reserved.

Elucidating the Influence of Gold Nanoparticles on the Binding of Salvianolic Acid B and Rosmarinic Acid to Bovine Serum Albumin

PubMed Central

Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

2015-01-01

Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047

Connecting RNA Processing to Abiotic Environmental Response in Arabidopsis: the role of a polyadenylation factor

NASA Astrophysics Data System (ADS)

Li, Q. Q.; Xu, R.; Hunt, A. G.; Falcone, D. L.

Plants are constantly challenged by numerous environmental stresses both biotic and abiotic It is clear that plants have evolved to counter these stresses using all but limited means We recently discovered the potential role of a messenger RNA processing factor namely the Arabidopsis cleavage and polyadenylation specificity factor 30 kDa subunit AtCPSF30 when a mutant deficient in this factor displayed altered responses to an array of abiotic stresses This AtCPSF30 mutant named oxt6 exhibited an elevated tolerance to oxidative stress Microarray experiments of oxt6 and its complemented lines revealed an altered gene expression profile among which were antioxidative defense genes Interestingly the same gene encoding AtCPSF30 can also be transcribed into a large transcript that codes for a potential splicing factor Both protein products have a domain for RNA binding and a calmodulin binding domain activities of which have been confirmed by biochemical assays Surprisingly binding of AtCPSF30 to calmodulin inhibits the RNA-binding activity of the protein Mutational analysis shows that a small part of the protein is responsible for calmodulin binding and point mutations in this region abolished both RNA binding activity and the inhibition of this activity by calmodulin Analyses of the potential splicing factor are on going and the results will be presented The interesting possibilities for both the interplay between splicing and polyadenylation and the regulation of these processes by stimuli that act through

How Robust Is the Mechanism of Folding-Upon-Binding for an Intrinsically Disordered Protein?

PubMed

Bonetti, Daniela; Troilo, Francesca; Brunori, Maurizio; Longhi, Sonia; Gianni, Stefano

2018-04-24

The mechanism of interaction of an intrinsically disordered protein (IDP) with its physiological partner is characterized by a disorder-to-order transition in which a recognition and a binding step take place. Even if the mechanism is quite complex, IDPs tend to bind their partner in a cooperative manner such that it is generally possible to detect experimentally only the disordered unbound state and the structured complex. The interaction between the disordered C-terminal domain of the measles virus nucleoprotein (N TAIL ) and the X domain (XD) of the viral phosphoprotein allows us to detect and quantify the two distinct steps of the overall reaction. Here, we analyze the robustness of the folding of N TAIL upon binding to XD by measuring the effect on both the folding and binding steps of N TAIL when the structure of XD is modified. Because it has been shown that wild-type XD is structurally heterogeneous, populating an on-pathway intermediate under native conditions, we investigated the binding to 11 different site-directed variants of N TAIL of one particular variant of XD (I504A XD) that populates only the native state. Data reveal that the recognition and the folding steps are both affected by the structure of XD, indicating a highly malleable pathway. The experimental results are briefly discussed in the light of previous experiments on other IDPs. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

A spectroscopic and molecular docking approach on the binding of tinzaparin sodium with human serum albumin

NASA Astrophysics Data System (ADS)

Abdullah, Saleh M. S.; Fatma, Sana; Rabbani, Gulam; Ashraf, Jalaluddin M.

2017-01-01

Protein bound toxins are poorly removed by conventional extracorporeal therapies. Venous thromboembolism (VTE) is a major cause of morbidity and mortality in patients with cancer. The interaction between tinzaparin, an inhibitor of angiotensin converting enzyme and human serum albumin, a principal plasma protein in the liver has been investigated in vitro under a simulated physiological condition by UV-vis spectrophotometry and fluorescence spectrometry. The intrinsic fluorescence intensity of human serum albumin was strongly quenched by tinzaparin (TP). The binding constants and binding stoichiometry can be calculated from the data obtained from fluorescence quenching experiments. The negative value of ΔG° reveals that the binding process is a spontaneous process. Thermodynamic analysis shows that the HSA-TP complex formation occurs via hydrogen bonds, hydrophobic interactions and undergoes slight structural changes as evident by far-UV CD. It indicated that the hydrophobic interactions play a main role in the binding of TP to human serum albumin. In addition, the distance between TP (acceptor) and tryptophan residues of human serum albumin (donor) was estimated to be 2.21 nm according to the Förster's resonance energy transfer theory. For the deeper understanding of the interaction, thermodynamic, and molecular docking studies were performed as well. Our docking results suggest that TP forms stable complex with HSA (Kb ∼ 104) and its primary binding site is located in subdomain IIA (Sudlow Site I). The results obtained herein will be of biological significance in pharmacology and clinical medicine.

Engineered Escherichia coli Silver-Binding Periplasmic Protein That Promotes Silver Tolerance

PubMed Central

Hall Sedlak, Ruth; Hnilova, Marketa; Grosh, Carolynn; Fong, Hanson; Baneyx, Francois; Schwartz, Dan; Sarikaya, Mehmet; Tamerler, Candan

2012-01-01

Silver toxicity is a problem that microorganisms face in medical and environmental settings. Through exposure to silver compounds, some bacteria have adapted to growth in high concentrations of silver ions. Such adapted microbes may be dangerous as pathogens but, alternatively, could be potentially useful in nanomaterial-manufacturing applications. While naturally adapted isolates typically utilize efflux pumps to achieve metal resistance, we have engineered a silver-tolerant Escherichia coli strain by the use of a simple silver-binding peptide motif. A silver-binding peptide, AgBP2, was identified from a combinatorial display library and fused to the C terminus of the E. coli maltose-binding protein (MBP) to yield a silver-binding protein exhibiting nanomolar affinity for the metal. Growth experiments performed in the presence of silver nitrate showed that cells secreting MBP-AgBP2 into the periplasm exhibited silver tolerance in a batch culture, while those expressing a cytoplasmic version of the fusion protein or MBP alone did not. Transmission electron microscopy analysis of silver-tolerant cells revealed the presence of electron-dense silver nanoparticles. This is the first report of a specifically engineered metal-binding peptide exhibiting a strong in vivo phenotype, pointing toward a novel ability to manipulate bacterial interactions with heavy metals by the use of short and simple peptide motifs. Engineered metal-ion-tolerant microorganisms such as this E. coli strain could potentially be used in applications ranging from remediation to interrogation of biomolecule-metal interactions in vivo. PMID:22286990

DNA binding by a new metallointercalator that contains a proflavine group bearing a hanging chelating unit.

PubMed

Bazzicalupi, Carla; Bencini, Andrea; Bianchi, Antonio; Biver, Tarita; Boggioni, Alessia; Bonacchi, Sara; Danesi, Andrea; Giorgi, Claudia; Gratteri, Paola; Ingraín, Antonio Marchal; Secco, Fernando; Sissi, Claudia; Valtancoli, Barbara; Venturini, Marcella

2008-01-01

The new bifunctional molecule 3,6-diamine-9-[6,6-bis(2-aminoethyl)-1,6-diaminohexyl]acridine (D), which is characterised by both an aromatic moiety and a separate metal-complexing polyamine centre, has been synthesised. The characteristics of D and its ZnII complex ([ZnD]) (protonation and metal-complexing constants, optical properties and self-aggregation phenomena) have been analysed by means of NMR spectroscopy, potentiometric, spectrophotometric and spectrofluorimetric techniques. The equilibria and kinetics of the binding process of D and [ZnD] to calf thymus DNA have been investigated at I=0.11 M (NaCl) and 298.1 K by using spectroscopic methods and the stopped-flow technique. Static measurements show biphasic behaviour for both D-DNA and [ZnD]-DNA systems; this reveals the occurrence of two different binding processes depending on the polymer-to-dye molar ratio (P/D). The binding mode that occurs at low P/D values is interpreted in terms of external binding with a notable contribution from the polyamine residue. The binding mode at high P/D values corresponds to intercalation of the proflavine residue. Stopped-flow, circular dichroism and supercoiled-DNA unwinding experiments corroborate the proposed mechanism. Molecular-modelling studies support the intercalative process and evidence the influence of NH+...O interactions between the protonated acridine nitrogen atom and the oxygen atoms of the polyanion; these interactions play a key role in determining the conformation of DNA adducts.

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Structural basis of nSH2 regulation and lipid binding in PI3Kα.

PubMed

Miller, Michelle S; Schmidt-Kittler, Oleg; Bolduc, David M; Brower, Evan T; Chaves-Moreira, Daniele; Allaire, Marc; Kinzler, Kenneth W; Jennings, Ian G; Thompson, Philip E; Cole, Philip A; Amzel, L Mario; Vogelstein, Bert; Gabelli, Sandra B

2014-07-30

We report two crystal structures of the wild-type phosphatidylinositol 3-kinase α (PI3Kα) heterodimer refined to 2.9 Å and 3.4 Å resolution: the first as the free enzyme, the second in complex with the lipid substrate, diC4-PIP₂, respectively. The first structure shows key interactions of the N-terminal SH2 domain (nSH2) and iSH2 with the activation loop that suggest a mechanism by which the enzyme is inhibited in its basal state. In the second structure, the lipid substrate binds in a positively charged pocket adjacent to the ATP-binding site, bordered by the P-loop, the activation loop and the iSH2 domain. An additional lipid-binding site was identified at the interface of the ABD, iSH2 and kinase domains. The ability of PI3Kα to bind an additional PIP₂ molecule was confirmed in vitro by fluorescence quenching experiments. The crystal structures reveal key differences in the way the nSH2 domain interacts with wild-type p110α and with the oncogenic mutant p110αH1047R. Increased buried surface area and two unique salt-bridges observed only in the wild-type structure suggest tighter inhibition in the wild-type PI3Kα than in the oncogenic mutant. These differences may be partially responsible for the increased basal lipid kinase activity and increased membrane binding of the oncogenic mutant.

Structural study of the Fox-1 RRM protein hydration reveals a role for key water molecules in RRM-RNA recognition

PubMed Central

Blatter, Markus; Cléry, Antoine; Damberger, Fred F.

2017-01-01

Abstract The Fox-1 RNA recognition motif (RRM) domain is an important member of the RRM protein family. We report a 1.8 Å X-ray structure of the free Fox-1 containing six distinct monomers. We use this and the nuclear magnetic resonance (NMR) structure of the Fox-1 protein/RNA complex for molecular dynamics (MD) analyses of the structured hydration. The individual monomers of the X-ray structure show diverse hydration patterns, however, MD excellently reproduces the most occupied hydration sites. Simulations of the protein/RNA complex show hydration consistent with the isolated protein complemented by hydration sites specific to the protein/RNA interface. MD predicts intricate hydration sites with water-binding times extending up to hundreds of nanoseconds. We characterize two of them using NMR spectroscopy, RNA binding with switchSENSE and free-energy calculations of mutant proteins. Both hydration sites are experimentally confirmed and their abolishment reduces the binding free-energy. A quantitative agreement between theory and experiment is achieved for the S155A substitution but not for the S122A mutant. The S155 hydration site is evolutionarily conserved within the RRM domains. In conclusion, MD is an effective tool for predicting and interpreting the hydration patterns of protein/RNA complexes. Hydration is not easily detectable in NMR experiments but can affect stability of protein/RNA complexes. PMID:28505313

Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

PubMed

Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

2005-01-01

Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

Nonbinding Legal Instruments in Governance for Global Health: Lessons from the Global AIDS Reporting Mechanism.

PubMed

Taylor, Allyn; Alfvén, Tobias; Hougendobler, Daniel; Buse, Kent

2014-01-01

Recent debate over World Health Organization reform has included unprecedented attention to international lawmaking as a future priority function of the Organization. However, the debate is largely focused on the codification of new binding legal instruments. Drawing upon lessons from the success of the Global AIDS Reporting Mechanism, established pursuant to the United Nations' Declaration of Commitment on HIV/AIDS, we argue that effective global health governance requires consideration of a broad range of instruments, both binding and nonbinding. A detailed examination of the Global AIDS Reporting Mechanism reveals that the choice of the nonbinding format makes an important contribution to its effectiveness. For instance, the flexibility and adaptability of the nonbinding format have allowed the global community to: (1) undertake commitments in a timely manner; (2) adapt and experiment in the face of a dynamic pandemic; and (3) grant civil society an unparalleled role in monitoring and reporting on state implementation of global commitments. UNAIDS' institutional support has also played a vital role in ensuring the continuing effectiveness of the Global AIDS Reporting Mechanism. Overall, the experience of the Global AIDS Reporting Mechanism evidences that, at times, nimbler nonbinding instruments can offer benefits over slower, more rigid binding legal approaches to governance, but depend critically, like all instruments, on the perceived legitimacy thereof. © 2014 American Society of Law, Medicine & Ethics, Inc.

Cross-reactivity and epitope analysis of Pru a 1, the major cherry allergen.

PubMed

Scheurer, S; Son, D Y; Boehm, M; Karamloo, F; Franke, S; Hoffmann, A; Haustein, D; Vieths, S

1999-02-01

A high percentage of birch pollen allergic patients experiences food hypersensivity after ingestion of fresh fruits and vegetables. The cross-reactivity of the major allergens of sweet cherry (Pru a 1), apple (Mal d 1), pear (Pyr c 1), celery tuber (Api g 1) and carrot (Dau c 1) is due to structural similarities which are reflected by high amino acid sequence identities with Bet v 1a, the major birch pollen allergen. Apart from a strong cross-reactivity to Bet v 1a, IgE inhibition experiments with Mal d 1, Pru a 1 and Api g 1 demonstrated the presence of common and different epitopes among the tested food allergens. Secondary structure prediction of all investigated allergens indicated the presence of almost identical structural elements. In particular, the 'P-loop' region is a common domain of the pollen related food allergens and of pathogenesis related proteins. To identify the IgE binding epitopes, five overlapping recombinant Pru a 1 fragments representing the entire amino acid sequence with lengths of approximately 60-120 residues were investigated. Weak IgE binding capacity was measured exclusively with Pru a IF4 (1-120) by immunoblotting, whereas none of the fragments showed allergenicity in the rat basophil leukaemia cell mediator release assay. Site-directed mutagenesis experiments with Pru a 1 revealed that amino acid S112 is critical for IgE binding of almost all patients sera tested. This reduced IgE binding was also observed with a single point mutant of Bet v 1a (S112P) and thus indicated serine 112 as an essential residue for preserving the structure of a cross-reactive IgE epitope. Moreover, two Pru a 1 mutants with an altered 'P-loop' region, showed a lowered IgE binding capacity for IgE from a subgroup of allergic patients. The investigation of essential features for preserving cross-reactive IgE-epitopes provides the structural basis for understanding the clinically observed cross-allergenicity between pollen and fruits. Moreover, non-anaphylactic allergen fragments or variants derived from the IgE-inducing pollen allergens may serve as useful tools for a new strategy of specific immunotherapy.

New insights into HCV replication in original cells from Aedes mosquitoes.

PubMed

Fallecker, Catherine; Caporossi, Alban; Rechoum, Yassine; Garzoni, Frederic; Larrat, Sylvie; François, Olivier; Fender, Pascal; Morand, Patrice; Berger, Imre; Petit, Marie-Anne; Drouet, Emmanuel

2017-08-22

The existing literature about HCV association with, and replication in mosquitoes is extremely poor. To fill this gap, we performed cellular investigations aimed at exploring (i) the capacity of HCV E1E2 glycoproteins to bind on Aedes mosquito cells and (ii) the ability of HCV serum particles (HCVsp) to replicate in these cell lines. First, we used purified E1E2 expressing baculovirus-derived HCV pseudo particles (bacHCVpp) so we could investigate their association with mosquito cell lines from Aedes aegypti (Aag-2) and Aedes albopictus (C6/36). We initiated a series of infections of both mosquito cells (Ae aegypti and Ae albopictus) with the HCVsp (Lat strain - genotype 3) and we observed the evolution dynamics of viral populations within cells over the course of infection via next-generation sequencing (NGS) experiments. Our binding assays revealed bacHCVpp an association with the mosquito cells, at comparable levels obtained with human hepatocytes (HepaRG cells) used as a control. In our infection experiments, the HCV RNA (+) were detectable by RT-PCR in the cells between 21 and 28 days post-infection (p.i.). In human hepatocytes HepaRG and Ae aegypti insect cells, NGS experiments revealed an increase of global viral diversity with a selection for a quasi-species, suggesting a structuration of the population with elimination of deleterious mutations. The evolutionary pattern in Ae albopictus insect cells is different (stability of viral diversity and polymorphism). These results demonstrate for the first time that natural HCV could really replicate within Aedes mosquitoes, a discovery which may have major consequences for public health as well as in vaccine development.

Feature binding in visual short-term memory is unaffected by task-irrelevant changes of location, shape, and color.

PubMed

Logie, Robert H; Brockmole, James R; Jaswal, Snehlata

2011-01-01

Three experiments used a change detection paradigm across a range of study-test intervals to address the respective contributions of location, shape, and color to the formation of bindings of features in sensory memory and visual short-term memory (VSTM). In Experiment 1, location was designated task irrelevant and was randomized between study and test displays. The task was to detect changes in the bindings between shape and color. In Experiments 2 and 3, shape and color, respectively, were task irrelevant and randomized, with bindings tested between location and color (Experiment 2) and location and shape (Experiment 3). At shorter study-test intervals, randomizing location was most disruptive, followed by shape and then color. At longer intervals, randomizing any task-irrelevant feature had no impact on change detection for bindings between features, and location had no special role. Results suggest that location is crucial for initial perceptual binding but loses that special status once representations are formed in VSTM, which operates according to different principles, than do visual attention and perception.

Probing the mechanism of interaction of metoprolol succinate with human serum albumin by spectroscopic and molecular docking analysis.

PubMed

Pawar, Suma K; Jaldappagari, Seetharamappa

2017-09-01

In the present work, the mechanism of the interaction between a β1 receptor blocker, metoprolol succinate (MS) and human serum albumin (HSA) under physiological conditions was investigated by spectroscopic techniques, namely fluorescence, Fourier transform infra-red spectroscopy (FT-IR), fluorescence lifetime decay and circular dichroism (CD) as well as molecular docking and cyclic voltammetric methods. The fluorescence and lifetime decay results indicated that MS quenched the intrinsic intensity of HSA through a static quenching mechanism. The Stern-Volmer quenching constants and binding constants for the MS-HSA system at 293, 298 and 303 K were obtained from the Stern-Volmer plot. Thermodynamic parameters for the interaction of MS with HSA were evaluated; negative values of entropy change (ΔG°) indicated the spontaneity of the MS and HSA interaction. Thermodynamic parameters such as negative ΔH° and positive ΔS° values revealed that hydrogen bonding and hydrophobic forces played a major role in MS-HSA interaction and stabilized the complex. The binding site for MS in HSA was identified by competitive site probe experiments and molecular docking studies. These results indicated that MS was bound to HSA at Sudlow's site I. The efficiency of energy transfer and the distance between the donor (HSA) and acceptor (MS) was calculated based on the theory of Fosters' resonance energy transfer (FRET). Three-dimensional fluorescence spectra and CD results revealed that the binding of MS to HSA resulted in an obvious change in the conformation of HSA. Cyclic voltammograms of the MS-HSA system also confirmed the interaction between MS and HSA. Furthermore, the effects of metal ions on the binding of MS to HSA were also studied. Copyright © 2017 John Wiley & Sons, Ltd.

Metabolic Control of Virulence Genes in Brucella abortus: HutC Coordinates virB Expression and the Histidine Utilization Pathway by Direct Binding to Both Promoters ▿ †

PubMed Central

Sieira, Rodrigo; Arocena, Gastón M.; Bukata, Lucas; Comerci, Diego J.; Ugalde, Rodolfo A.

2010-01-01

Type IV secretion systems (T4SS) are multicomponent machineries involved in the translocation of effector molecules across the bacterial cell envelope. The virB operon of Brucella abortus codes for a T4SS that is essential for virulence and intracellular multiplication of the bacterium in the host. Previous studies showed that the virB operon of B. abortus is tightly regulated within the host cells. In order to identify factors implicated in the control of virB expression, we searched for proteins of Brucella that directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-kDa protein that binds specifically to PvirB. This protein was identified as HutC, the transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut promoter activity revealed that HutC exerts two different roles: it acts as a coactivator of transcription of the virB operon, whereas it represses the hut genes. Such activities were observed both intracellularly and in bacteria incubated under conditions that resemble the intracellular environment. Electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments revealed the structure, affinity, and localization of the HutC-binding sites and supported the regulatory role of HutC in both hut and virB promoters. Taken together, these results indicate that Brucella coopted the function of HutC to coordinate the Hut pathway with transcriptional regulation of the virB genes, probably as a way to sense its own metabolic state and develop adaptive responses to overcome intracellular host defenses. PMID:19854911

Conformational and chemical selection by a trans-acting editing domain

PubMed Central

Danhart, Eric M.; Bakhtina, Marina; Cantara, William A.; Kuzmishin, Alexandra B.; Ma, Xiao; Sanford, Brianne L.; Vargas-Rodriguez, Oscar; Košutić, Marija; Goto, Yuki; Suga, Hiroaki; Nakanishi, Kotaro; Micura, Ronald; Musier-Forsyth, Karin

2017-01-01

Molecular sieves ensure proper pairing of tRNAs and amino acids during aminoacyl-tRNA biosynthesis, thereby avoiding detrimental effects of mistranslation on cell growth and viability. Mischarging errors are often corrected through the activity of specialized editing domains present in some aminoacyl-tRNA synthetases or via single-domain trans-editing proteins. ProXp-ala is a ubiquitous trans-editing enzyme that edits Ala-tRNAPro, the product of Ala mischarging by prolyl-tRNA synthetase, although the structural basis for discrimination between correctly charged Pro-tRNAPro and mischarged Ala-tRNAAla is unclear. Deacylation assays using substrate analogs reveal that size discrimination is only one component of selectivity. We used NMR spectroscopy and sequence conservation to guide extensive site-directed mutagenesis of Caulobacter crescentus ProXp-ala, along with binding and deacylation assays to map specificity determinants. Chemical shift perturbations induced by an uncharged tRNAPro acceptor stem mimic, microhelixPro, or a nonhydrolyzable mischarged Ala-microhelixPro substrate analog identified residues important for binding and deacylation. Backbone 15N NMR relaxation experiments revealed dynamics for a helix flanking the substrate binding site in free ProXp-ala, likely reflecting sampling of open and closed conformations. Dynamics persist on binding to the uncharged microhelix, but are attenuated when the stably mischarged analog is bound. Computational docking and molecular dynamics simulations provide structural context for these findings and predict a role for the substrate primary α-amine group in substrate recognition. Overall, our results illuminate strategies used by a trans-editing domain to ensure acceptance of only mischarged Ala-tRNAPro, including conformational selection by a dynamic helix, size-based exclusion, and optimal positioning of substrate chemical groups. PMID:28768811

Contribution of familiarity and recollection to associative recognition memory: insights from event-related potentials.

PubMed

Opitz, Bertram; Cornell, Sonia

2006-09-01

Within the dual-process perspective of recognition memory, it has been claimed that familiarity is sufficient to support recognition of single items, but recollection is necessary for associative recognition of item pairs. However, there are some reports suggesting that familiarity might support associative recognition judgments when the items form an easy to access bound representation. In contrast, recollection seems to be required for the recognition of bindings that might be flexibly rearranged in novel situations. We investigated whether both forms of binding are mediated by different mechanisms as reflected by a qualitatively different spatiotemporal eventrelated potential (ERP) pattern. In a recognition memory experiment, subjects gave old/new judgments to words learned by focusing either on interitem associations or on size relation of word triplets. Results revealed higher hit rates in the relational condition as compared to the associative condition. In addition, the proportion of triplets from which all three items were remembered was significantly larger in the relational condition suggesting that memory retrieval in this condition relies primarily on bound representations of word triplets. The ERP revealed a late parietal old/new effect for both conditions, with relational processing resulting in a greater effect. In contrast, an early frontal old/new effect was solely present in the associative condition. Taken together, these data provide evidence that familiarity might support associative recognition if the associated components are coherently encoded into a bound representation. Recollection might foster the recognition of relational bindings among items. This indicates that the contribution of familiarity and recollection to associative recognition depends on the kind of binding operations performed on the items rather than on the single versus multiple item distinction.

Mycobacterium tuberculosis NmtR harbors a nickel sensing site with parallels to Escherichia coli RcnR†

PubMed Central

Reyes-Caballero, Hermes; Lee, Chul Won; Giedroc, David P.

2011-01-01

Mycobacterium tuberculosis NmtR is a Ni(II)/Co(II)-sensing metalloregulatory protein from the extensively studied ArsR/SmtB family. Two Ni(II) ions bind to the NmtR dimer to form octahedral coordination complexes with stepwise binding affinities of KNi1=1.2 (±0.1) × 1010 and KNi2=0.7 (±0.4) × 1010 M-1 (pH 7.0). A glutamine scanning mutagenesis approach reveals that Asp91, His93, His104 and His107, all contained within the C-terminal α5 helix, and His3 as part of the conserved α-NH2-Gly2-His3-Gly4 motif at the N-terminus make significant contributions to the magnitude of KNi. In contrast, substitution of residues from the C-terminal region, His109, Asp114 and His116, previously implicated in Ni(II) binding and metalloregulation in cells, gives rise to wild-type KNi and Ni(II)-dependent allosteric coupling free energies. Interestingly, deletion of residues 112-120 in the C-terminal region (Δ111 NmtR) reduces the Ni(II) binding stoichiometry to one per dimer and greatly reduces Ni(II) responsiveness. H3Q and Δ111 NmtRs also show clear perturbations in the rank order of metal responsiveness to Ni(II), Co(II) and Zn(II) that is distinct from wild-type NmtR. 15N relaxation experiments with apo-NmtR reveal that both N-terminal (residues 2-14) and C-terminal (residues 110-120) regions are unstructured in solution, and this property likely dictates the metal specificity profile characteristic of the Ni(II)-sensor NmtR relative to other ArsR family regulators. PMID:21819125

Mechanism of the Dual Activities of Human CYP17A1 and Binding to Anti-Prostate Cancer Drug Abiraterone Revealed by a Novel V366M Mutation Causing 17,20 Lyase Deficiency.

PubMed

Fernández-Cancio, Mónica; Camats, Núria; Flück, Christa E; Zalewski, Adam; Dick, Bernhard; Frey, Brigitte M; Monné, Raquel; Torán, Núria; Audí, Laura; Pandey, Amit V

2018-04-29

The CYP17A1 gene regulates sex steroid biosynthesis in humans through 17α-hydroxylase/17,20 lyase activities and is a target of anti-prostate cancer drug abiraterone. In a 46, XY patient with female external genitalia, together with a loss of function mutation S441P, we identified a novel missense mutation V366M at the catalytic center of CYP17A1 which preferentially impaired 17,20 lyase activity. Kinetic experiments with bacterially expressed proteins revealed that V366M mutant enzyme can bind and metabolize pregnenolone to 17OH-pregnenolone, but 17OH-pregnenolone binding and conversion to dehydroepiandrosterone (DHEA) was impaired, explaining the patient’s steroid profile. Abiraterone could not bind and inhibit the 17α-hydroxylase activity of the CYP17A1-V366M mutant. Molecular dynamics (MD) simulations showed that V366M creates a “one-way valve” and suggests a mechanism for dual activities of human CYP17A1 where, after the conversion of pregnenolone to 17OH-pregnenolone, the product exits the active site and re-enters for conversion to dehydroepiandrosterone. The V366M mutant also explained the effectiveness of the anti-prostate cancer drug abiraterone as a potent inhibitor of CYP17A1 by binding tightly at the active site in the WT enzyme. The V366M is the first human mutation to be described at the active site of CYP17A1 that causes isolated 17,20 lyase deficiency. Knowledge about the specificity of CYP17A1 activities is of importance for the development of treatments for polycystic ovary syndrome and inhibitors for prostate cancer therapy.

Solution Structure of the N-Terminal Domain of Mediator Subunit MED26 and Molecular Characterization of Its Interaction with EAF1 and TAF7.

PubMed

Lens, Zoé; Cantrelle, François-Xavier; Peruzzini, Riccardo; Hanoulle, Xavier; Dewitte, Frédérique; Ferreira, Elisabeth; Baert, Jean-Luc; Monté, Didier; Aumercier, Marc; Villeret, Vincent; Verger, Alexis; Landrieu, Isabelle

2017-10-13

MED26 is a subunit of Mediator, a large complex central to the regulation of gene transcription by RNA Polymerase II. MED26 plays a role in the switch between the initiation and elongation phases of RNA Polymerase II-mediated transcription process. Regulation of these steps requires successive binding of MED26 N-terminal domain (NTD) to TATA-binding protein-associated factor 7 (TAF7) and Eleven-nineteen lysine-rich in leukemia-Associated Factor 1 (EAF1). In order to investigate the mechanism of regulation by MED26, MED26-NTD structure was solved by NMR, revealing a 4-helix bundle. EAF1 (239-268) and TAF7 (205-235) peptide interactions were both mapped to the same groove formed by H3 and H4 helices of MED26-NTD. Both interactions are characterized by dissociation constants in the 10-μM range. Further experiments revealed a folding-upon-binding mechanism that leads to the formation of EAF1 (N247-S260) and TAF7 (L214-S227) helices. Chemical shift perturbations and nuclear Overhauser enhancement contacts support the involvement of residues I222/F223 in anchoring TAF7 helix to a hydrophobic pocket of MED26-NTD, including residues L48, W80 and I84. In addition, Ala mutations of charged residues located in the C-terminal disordered part of TAF7 and EAF1 peptides affected the binding, with a loss of affinity characterized by a 10-time increase of dissociation constants. A structural model of MED26-NTD/TAF7 complex shows bi-partite components, combining ordered and disordered segments, as well as hydrophobic and electrostatic contributions to the binding. This study provides molecular detail that will help to decipher the mechanistic basis for the initiation to elongation switch-function mediated by MED26-NTD. Copyright © 2017 Elsevier Ltd. All rights reserved.

Maillard reaction and enzymatic browning affect the allergenicity of Pru av 1, the major allergen from cherry (Prunus avium).

PubMed

Gruber, Patrick; Vieths, Stefan; Wangorsch, Andrea; Nerkamp, Jörg; Hofmann, Thomas

2004-06-16

The influence of thermal processing and nonenymatic as well as polyphenoloxidase-catalyzed browning reaction on the allergenicity of the major cherry allergen Pru av 1 was investigated. After thermal treatment of the recombinant protein rPru av 1 in the absence or presence of carbohydrates, SDS-PAGE, enzyme allergosorbent tests, and inhibition assays revealed that thermal treatment of rPru av 1 alone did not show any influence on the IgE-binding activity of the protein at least for 30 min, thus correlating well with the refolding of the allergen in buffer solution as demonstrated by CD spectroscopic experiments. Incubation of the protein with starch and maltose also showed no effect on IgE-binding activity, whereas reaction with glucose and ribose and, even more pronounced, with the carbohydrate breakdown products glyceraldehyde and glyoxal induced a strong decrease of the IgE-binding capacity of rPru av 1. In the second part of the study, the effect of polyphenoloxidase-catalyzed oxidation of polyphenols on food allergen activity was investigated. Incubation of rPru av 1 with epicatechin in the presence of tyrosinase led to a drastic decrease in IgE-binding activity of the protein. Variations of the phenolic compound revealed caffeic acid and epicatechin as the most active inhibitors of the IgE-binding activity of rPru av 1, followed by catechin and gallic acid, and, finally, by quercetin and rutin, showing significantly lower activity. On the basis of these data, reactive intermediates formed during thermal carbohydrate degradation as well as during enzymatic polyphenol oxidation are suggested as the active chemical species responsible for modifying nucleophilic amino acid side chains of proteins, thus inducing an irreversible change in the tertiary structure of the protein and resulting in a loss of conformational epitopes of the allergen.

Structure of the Branched-chain Amino Acid and GTP-sensing Global Regulator, CodY, from Bacillus subtilis.

PubMed

Levdikov, Vladimir M; Blagova, Elena; Young, Vicki L; Belitsky, Boris R; Lebedev, Andrey; Sonenshein, Abraham L; Wilkinson, Anthony J

2017-02-17

CodY is a branched-chain amino acid (BCAA) and GTP sensor and a global regulator of transcription in low G + C Gram-positive bacteria. It controls the expression of over 100 genes and operons, principally by repressing during growth genes whose products are required for adaptations to nutrient limitation. However, the mechanism by which BCAA binding regulates transcriptional changes is not clear. It is known that CodY consists of a GAF (c G MP-stimulated phosphodiesterases, a denylate cyclases, F hlA) domain that binds BCAAs and a winged helix-turn-helix (wHTH) domain that binds to DNA, but the way in which these domains interact and the structural basis of the BCAA dependence of this interaction are unknown. To gain new insights, we determined the crystal structure of unliganded CodY from Bacillus subtilis revealing a 10-turn α-helix linking otherwise discrete GAF and wHTH domains. The structure of CodY in complex with isoleucine revealed a reorganized GAF domain. In both complexes CodY was tetrameric. Size exclusion chromatography with multiangle laser light scattering (SEC-MALLS) experiments showed that CodY is a dimer at concentrations found in bacterial cells. Comparison of structures of dimers of unliganded CodY and CodY-Ile derived from the tetramers showed a splaying of the wHTH domains when Ile was bound; splaying is likely to account for the increased affinity of Ile-bound CodY for DNA. Electrophoretic mobility shift and SEC-MALLS analyses of CodY binding to 19-36-bp operator fragments are consistent with isoleucine-dependent binding of two CodY dimers per duplex. The implications of these observations for effector control of CodY activity are discussed. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Negatively Charged Lipid Membranes Promote a Disorder-Order Transition in the Yersinia YscU Protein

PubMed Central

Weise, Christoph F.; Login, Frédéric H.; Ho, Oanh; Gröbner, Gerhard; Wolf-Watz, Hans; Wolf-Watz, Magnus

2014-01-01

The inner membrane of Gram-negative bacteria is negatively charged, rendering positively charged cytoplasmic proteins in close proximity likely candidates for protein-membrane interactions. YscU is a Yersinia pseudotuberculosis type III secretion system protein crucial for bacterial pathogenesis. The protein contains a highly conserved positively charged linker sequence that separates membrane-spanning and cytoplasmic (YscUC) domains. Although disordered in solution, inspection of the primary sequence of the linker reveals that positively charged residues are separated with a typical helical periodicity. Here, we demonstrate that the linker sequence of YscU undergoes a largely electrostatically driven coil-to-helix transition upon binding to negatively charged membrane interfaces. Using membrane-mimicking sodium dodecyl sulfate micelles, an NMR derived structural model reveals the induction of three helical segments in the linker. The overall linker placement in sodium dodecyl sulfate micelles was identified by NMR experiments including paramagnetic relaxation enhancements. Partitioning of individual residues agrees with their hydrophobicity and supports an interfacial positioning of the helices. Replacement of positively charged linker residues with alanine resulted in YscUC variants displaying attenuated membrane-binding affinities, suggesting that the membrane interaction depends on positive charges within the linker. In vivo experiments with bacteria expressing these YscU replacements resulted in phenotypes displaying significantly reduced effector protein secretion levels. Taken together, our data identify a previously unknown membrane-interacting surface of YscUC that, when perturbed by mutations, disrupts the function of the pathogenic machinery in Yersinia. PMID:25418176

Negatively charged lipid membranes promote a disorder-order transition in the Yersinia YscU protein.

PubMed

Weise, Christoph F; Login, Frédéric H; Ho, Oanh; Gröbner, Gerhard; Wolf-Watz, Hans; Wolf-Watz, Magnus

2014-10-21

The inner membrane of Gram-negative bacteria is negatively charged, rendering positively charged cytoplasmic proteins in close proximity likely candidates for protein-membrane interactions. YscU is a Yersinia pseudotuberculosis type III secretion system protein crucial for bacterial pathogenesis. The protein contains a highly conserved positively charged linker sequence that separates membrane-spanning and cytoplasmic (YscUC) domains. Although disordered in solution, inspection of the primary sequence of the linker reveals that positively charged residues are separated with a typical helical periodicity. Here, we demonstrate that the linker sequence of YscU undergoes a largely electrostatically driven coil-to-helix transition upon binding to negatively charged membrane interfaces. Using membrane-mimicking sodium dodecyl sulfate micelles, an NMR derived structural model reveals the induction of three helical segments in the linker. The overall linker placement in sodium dodecyl sulfate micelles was identified by NMR experiments including paramagnetic relaxation enhancements. Partitioning of individual residues agrees with their hydrophobicity and supports an interfacial positioning of the helices. Replacement of positively charged linker residues with alanine resulted in YscUC variants displaying attenuated membrane-binding affinities, suggesting that the membrane interaction depends on positive charges within the linker. In vivo experiments with bacteria expressing these YscU replacements resulted in phenotypes displaying significantly reduced effector protein secretion levels. Taken together, our data identify a previously unknown membrane-interacting surface of YscUC that, when perturbed by mutations, disrupts the function of the pathogenic machinery in Yersinia.

Elucidation of intermolecular interaction of bovine serum albumin with Fenhexamid: A biophysical prospect.

PubMed

Shi, Jie-Hua; Lou, Yan-Yue; Zhou, Kai-Li; Pan, Dong-Qi

2018-03-01

Fenhexamid, as a hydroxyanilide, is widely applied to control Botrytis cinerea for protecting crops and fruits. But it could adversely affect human and animals health due to accumulation of residues in food production. Here, the affinity characteristics of fenhexamid on bovine serum albumin (BSA) was studied via a series of spectroscopic methods such as steady-state fluorescence spectroscopy, ultraviolet spectroscopy (UV), synchronous fluorescence spectroscopy (SFS), 3D fluorescence spectroscopy, and fourier transform infrared spectroscopy (FT-IR). The experimental results illustrated that the fluorescence quenching mechanism of BSA induced by fenhexamid was a static quenching. The binding constant (K b ) of fenhexamid with BSA was 2.399 × 10 4  M -1 at 298 K and the combination ratio was about 1:1. The competitive experiment demonstrated that fenhexamid was binding on the BSA at site II (subdomain IIIA), which was confirmed by the molecular docking studies. The negative values of thermodynamic parameter (ΔH 0 , ΔS 0 and ΔG 0 ) revealed that the reaction of fenhexamid with BSA could proceed spontaneously, the van der Waals force and hydrogen bonding interaction conducted the main effect, and the binding process was enthalpy-driven. What's more, the 8-Anilino-1-naphthalenesulfonate (ANS) and sucrose binding studies were also performed and further verified the binding force between BSA and fenhexamid. Copyright © 2018 Elsevier B.V. All rights reserved.

Role of Reversible Histidine Coordination in Hydroxylamine Reduction by Plant Hemoglobins (Phytoglobins).

PubMed

Athwal, Navjot Singh; Alagurajan, Jagannathan; Andreotti, Amy H; Hargrove, Mark S

2016-10-18

Reduction of hydroxylamine to ammonium by phytoglobin, a plant hexacoordinate hemoglobin, is much faster than that of other hexacoordinate hemoglobins or pentacoordinate hemoglobins such as myoglobin, leghemoglobin, and red blood cell hemoglobin. The reason for differences in reactivity is not known but could be intermolecular electron transfer between protein molecules in support of the required two-electron reduction, hydroxylamine binding, or active site architecture favoring the reaction. Experiments were conducted with phytoglobins from rice, tomato, and soybean along with human neuroglobin and soybean leghemoglobin that reveal hydroxylamine binding as the rate-limiting step. For hexacoordinate hemoglobins, binding is limited by the dissociation rate constant for the distal histidine, while leghemoglobin is limited by an intrinsically low affinity for hydroxylamine. When the distal histidine is removed from rice phytoglobin, a hydroxylamine-bound intermediate is formed and the reaction rate is diminished, indicating that the distal histidine imidazole side chain is critical for the reaction, albeit not for electron transfer but rather for direct interaction with the substrate. Together, these results demonstrate that phytoglobins are superior at hydroxylamine reduction because they have distal histidine coordination affinity constants near 1, and facile rate constants for binding and dissociation of the histidine side chain. Hexacoordinate hemoglobins such as neuroglobin are limited by tighter histidine coordination that blocks hydroxylamine binding, and pentacoordinate hemoglobins have intrinsically lower hydroxylamine affinities.

BASIC PENTACYSTEINE Proteins Mediate MADS Domain Complex Binding to the DNA for Tissue-Specific Expression of Target Genes in Arabidopsis[W

PubMed Central

Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M.

2012-01-01

BASIC PENTACYSTEINE (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)–rich consensus sequences in the SEEDSTICK (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that SHORT VEGETATIVE PHASE (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs’ wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472

The yeast kinesin-5 Cin8 interacts with the microtubule in a noncanonical manner

PubMed Central

Bell, Kayla M.; Cha, Hyo Keun; Sindelar, Charles V.; Cochran, Jared C.

2017-01-01

Kinesin motors play central roles in establishing and maintaining the mitotic spindle during cell division. Unlike most other kinesins, Cin8, a kinesin-5 motor in Saccharomyces cerevisiae, can move bidirectionally along microtubules, switching directionality according to biochemical conditions, a behavior that remains largely unexplained. To this end, we used biochemical rate and equilibrium constant measurements as well as cryo-electron microscopy methodologies to investigate the microtubule interactions of the Cin8 motor domain. These experiments unexpectedly revealed that, whereas Cin8 ATPase kinetics fell within measured ranges for kinesins (especially kinesin-5 proteins), approximately four motors can bind each αβ-tubulin dimer within the microtubule lattice. This result contrasted with those observations on other known kinesins, which can bind only a single “canonical” site per tubulin dimer. Competition assays with human kinesin-5 (Eg5) only partially abrogated this behavior, indicating that Cin8 binds microtubules not only at the canonical site, but also one or more separate (“noncanonical”) sites. Moreover, we found that deleting the large, class-specific insert in the microtubule-binding loop 8 reverts Cin8 to one motor per αβ-tubulin in the microtubule. The novel microtubule-binding mode of Cin8 identified here provides a potential explanation for Cin8 clustering along microtubules and potentially may contribute to the mechanism for direction reversal. PMID:28701465

Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

PubMed

Volkán-Kacsó, Sándor; Marcus, Rudolph A

2016-10-25

A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

Achromatic synesthesias - a functional magnetic resonance imaging study.

PubMed

Melero, H; Ríos-Lago, M; Peña-Melián, A; Álvarez-Linera, J

2014-09-01

Grapheme-color synesthetes experience consistent, automatic and idiosyncratic colors associated with specific letters and numbers. Frequently, these specific associations exhibit achromatic synesthetic qualities (e.g. white, black or gray). In this study, we have investigated for the first time the neural basis of achromatic synesthesias, their relationship to chromatic synesthesias and the achromatic congruency effect in order to understand not only synesthetic color but also other components of the synesthetic experience. To achieve this aim, functional magnetic resonance imaging experiments were performed in a group of associator grapheme-color synesthetes and matched controls who were stimulated with real chromatic and achromatic stimuli (Mondrians), and with letters and numbers that elicited different types of grapheme-color synesthesias (i.e. chromatic and achromatic inducers which elicited chromatic but also achromatic synesthesias, as well as congruent and incongruent ones). The information derived from the analysis of Mondrians and chromatic/achromatic synesthesias suggests that real and synesthetic colors/achromaticity do not fully share neural mechanisms. The whole-brain analysis of BOLD signals in response to the complete set of synesthetic inducers revealed that the functional peculiarities of the synesthetic brain are distributed, and reflect different components of the synesthetic experience: a perceptual component, an (attentional) feature binding component, and an emotional component. Additionally, the inclusion of achromatic experiences has provided new evidence in favor of the emotional binding theory, a line of interpretation which constitutes a bridge between grapheme-color synesthesia and other developmental modalities of the phenomenon. Copyright © 2014 Elsevier Inc. All rights reserved.

Spectral and computational features of the binding between riparins and human serum albumin

NASA Astrophysics Data System (ADS)

Camargo, Cintia Ramos; Caruso, Ícaro Putinhon; Gutierrez, Stanley Juan Chavez; Fossey, Marcelo Andres; Filho, José Maria Barbosa; Cornélio, Marinônio Lopes

2018-02-01

The green Brazilian bay leaf, a spice much prized in local cuisine (Aniba riparia, Lauraceae), contains chemical compounds presenting benzoyl-derivatives named riparins, which have anti-inflammatory, antimicrobial and anxiolytic properties. However, it is unclear what kind of interaction riparins perform with any molecular target. As a profitable target, human serum albumin (HSA) is one of the principal extracellular proteins, with an exceptional capacity to interact with several molecules, and it also plays a crucial role in the transport, distribution, and metabolism of a wide variety of endogenous and exogenous ligands. To outline the HSA-riparin interaction mechanism, spectroscopy and computational methods were synergistically applied. An evaluation through fluorescence spectroscopy showed that the emission, attributed to Trp 214, at 346 nm decreased with titrations of riparins. A static quenching mechanism was observed in the binding of riparins to HSA. Fluorescence experiments performed at 298, 308 and 318 K made it possible to conduct thermodynamic analysis indicating a spontaneous reaction in the complex formation (ΔG < 0). The enthalpy-entropy balance experiment with a molecular modeling calculation revealed that hydrophobic, hydrogen bond and non-specific interactions are present for riparin I-III with HSA. The set of results from fractional fluorescence changes obtained through Schatchard was inconclusive in establishing what kind of cooperativity is present in the interaction. To shed light upon the HSA-riparins complex, Hill's approach was utilized to distinguish the index of affinity and the binding constant. A correspondence between the molecular structures of riparins, due to the presence of the hydroxyl group in the B-ring, with thermodynamic parameters and index of affinity were observed. Riparin III performs an intramolecular hydrogen bond, which affects the Hill coefficient and the binding constant. Therefore, the presence of hydroxyl groups is capable of modulating the interaction between riparins and HSA. Site marker competitive experiments indicated Site I as being the most suitable, and the molecular modeling tools reinforced the experimental results detailing the participation of residues.

AZD8797 is an allosteric non-competitive modulator of the human CX3CR1 receptor.

PubMed

Cederblad, Linda; Rosengren, Birgitta; Ryberg, Erik; Hermansson, Nils-Olov

2016-03-01

The chemokine receptor CX3CR1 has been implicated as an attractive therapeutic target in several diseases, including atherosclerosis and diabetes. However, there has been a lack of non-peptide CX3CR1 inhibitors to substantiate these findings. A selective small-molecule inhibitor of CX3CR1, AZD8797, was recently reported and we present here an in-depth in vitro characterization of that molecule. In a flow adhesion assay, AZD8797 antagonized the natural ligand, fractalkine (CX3CL1), in both human whole blood (hWB) and in a B-lymphocyte cell line with IC50 values of 300 and 6 nM respectively. AZD8797 also prevented G-protein activation in a [(35)S]GTPγS (guanosine 5'-[γ-thio]triphosphate) accumulation assay. In contrast, dynamic mass redistribution (DMR) experiments revealed a weak Gαi-dependent AZD8797 agonism. Additionally, AZD8797 positively modulated the CX3CL1 response at sub-micromolar concentrations in a β-arrestin recruitment assay. In equilibrium saturation binding experiments, AZD8797 reduced the maximal binding of (125)I-CX3CL1 without affecting Kd. Kinetic experiments, determining the kon and koff of AZD8797, demonstrated that this was not an artefact of irreversible or insurmountable binding, thus a true non-competitive mechanism. Finally we show that both AZD8797 and GTPγS increase the rate with which CX3CL1 dissociates from CX3CR1 in a similar manner, indicating a connection between AZD8797 and the CX3CR1-bound G-protein. Collectively, these data show that AZD8797 is a non-competitive allosteric modulator of CX3CL1, binding CX3CR1 and effecting G-protein signalling and β-arrestin recruitment in a biased way. © 2016 Authors.

Multispectroscopic and calorimetric studies on the binding of the food colorant tartrazine with human hemoglobin.

PubMed

Basu, Anirban; Suresh Kumar, Gopinatha

2016-11-15

Interaction of the food colorant tartrazine with human hemoglobin was studied using multispectroscopic and microcalorimetric techniques to gain insights into the binding mechanism and thereby the toxicity aspects. Hemoglobin spectrum showed hypochromic changes in the presence of tartrazine. Quenching of the fluorescence of hemoglobin occurred and the quenching mechanism was through a static mode as revealed from temperature dependent and time-resolved fluorescence studies. According to the FRET theory the distance between β-Trp37 of hemoglobin and bound tartrazine was evaluated to be 3.44nm. Synchronous fluorescence studies showed that tartrazine binding led to alteration of the microenvironment around the tryptophans more in comparison to tyrosines. 3D fluorescence and FTIR data provided evidence for conformational changes in the protein on binding. Circular dichroism studies revealed that the binding led to significant loss in the helicity of hemoglobin. The esterase activity assay further complemented the circular dichroism data. Microcalorimetric study using isothermal titration calorimetry revealed the binding to be exothermic and driven largely by positive entropic contribution. Dissection of the Gibbs energy change proposed the protein-dye complexation to be dominated by non-polyelectrolytic forces. Negative heat capacity change also corroborated the involvement of hydrophobic forces in the binding process. Copyright © 2016 Elsevier B.V. All rights reserved.

Free energy calculations of glycosaminoglycan-protein interactions.

PubMed

Gandhi, Neha S; Mancera, Ricardo L

2009-10-01

Glycosaminoglycans (GAGs) are complex highly charged linear polysaccharides that have a variety of roles in biological processes. We report the first use of molecular dynamics (MD) free energy calculations using the MM/PBSA method to investigate the binding of GAGs to protein molecules, namely the platelet endothelial cell adhesion molecule 1 (PECAM-1) and annexin A2. Calculations of the free energy of the binding of heparin fragments of different sizes reveal the existence of a region of low GAG-binding affinity in domains 5-6 of PECAM-1 and a region of high affinity in domains 2-3, consistent with experimental data and ligand-protein docking studies. A conformational hinge movement between domains 2 and 3 was observed, which allows the binding of heparin fragments of increasing size (pentasaccharides to octasaccharides) with an increasingly higher binding affinity. Similar simulations of the binding of a heparin fragment to annexin A2 reveal the optimization of electrostatic and hydrogen bonding interactions with the protein and protein-bound calcium ions. In general, these free energy calculations reveal that the binding of heparin to protein surfaces is dominated by strong electrostatic interactions for longer fragments, with equally important contributions from van der Waals interactions and vibrational entropy changes, against a large unfavorable desolvation penalty due to the high charge density of these molecules.

Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

PubMed Central

Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

2007-01-01

In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

Structural elucidation of estrus urinary lipocalin protein (EULP) and evaluating binding affinity with pheromones using molecular docking and fluorescence study

PubMed Central

Rajesh, Durairaj; Muthukumar, Subramanian; Saibaba, Ganesan; Siva, Durairaj; Akbarsha, Mohammad Abdulkader; Gulyás, Balázs; Padmanabhan, Parasuraman; Archunan, Govindaraju

2016-01-01

Transportation of pheromones bound with carrier proteins belonging to lipocalin superfamily is known to prolong chemo-signal communication between individuals belonging to the same species. Members of lipocalin family (MLF) proteins have three structurally conserved motifs for delivery of hydrophobic molecules to the specific recognizer. However, computational analyses are critically required to validate and emphasize the sequence and structural annotation of MLF. This study focused to elucidate the evolution, structural documentation, stability and binding efficiency of estrus urinary lipocalin protein (EULP) with endogenous pheromones adopting in-silico and fluorescence study. The results revealed that: (i) EULP perhaps originated from fatty acid binding protein (FABP) revealed in evolutionary analysis; (ii) Dynamic simulation study shows that EULP is highly stable at below 0.45 Å of root mean square deviation (RMSD); (iii) Docking evaluation shows that EULP has higher binding energy with farnesol and 2-iso-butyl-3-methoxypyrazine (IBMP) than 2-naphthol; and (iv) Competitive binding and quenching assay revealed that purified EULP has good binding interaction with farnesol. Both, In-silico and experimental studies showed that EULP is an efficient binding partner to pheromones. The present study provides impetus to create a point mutation for increasing longevity of EULP to develop pheromone trap for rodent pest management. PMID:27782155

Structural elucidation of estrus urinary lipocalin protein (EULP) and evaluating binding affinity with pheromones using molecular docking and fluorescence study.

PubMed

Rajesh, Durairaj; Muthukumar, Subramanian; Saibaba, Ganesan; Siva, Durairaj; Akbarsha, Mohammad Abdulkader; Gulyás, Balázs; Padmanabhan, Parasuraman; Archunan, Govindaraju

2016-10-26

Transportation of pheromones bound with carrier proteins belonging to lipocalin superfamily is known to prolong chemo-signal communication between individuals belonging to the same species. Members of lipocalin family (MLF) proteins have three structurally conserved motifs for delivery of hydrophobic molecules to the specific recognizer. However, computational analyses are critically required to validate and emphasize the sequence and structural annotation of MLF. This study focused to elucidate the evolution, structural documentation, stability and binding efficiency of estrus urinary lipocalin protein (EULP) with endogenous pheromones adopting in-silico and fluorescence study. The results revealed that: (i) EULP perhaps originated from fatty acid binding protein (FABP) revealed in evolutionary analysis; (ii) Dynamic simulation study shows that EULP is highly stable at below 0.45 Å of root mean square deviation (RMSD); (iii) Docking evaluation shows that EULP has higher binding energy with farnesol and 2-iso-butyl-3-methoxypyrazine (IBMP) than 2-naphthol; and (iv) Competitive binding and quenching assay revealed that purified EULP has good binding interaction with farnesol. Both, In-silico and experimental studies showed that EULP is an efficient binding partner to pheromones. The present study provides impetus to create a point mutation for increasing longevity of EULP to develop pheromone trap for rodent pest management.

The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain.

PubMed

Shengjuler, Djoshkun; Chan, Yan Mei; Sun, Simou; Moustafa, Ibrahim M; Li, Zhen-Lu; Gohara, David W; Buck, Matthias; Cremer, Paul S; Boehr, David D; Cameron, Craig E

2017-12-05

Some viruses use phosphatidylinositol phosphate (PIP) to mark membranes used for genome replication or virion assembly. PIP-binding motifs of cellular proteins do not exist in viral proteins. Molecular-docking simulations revealed a putative site of PIP binding to poliovirus (PV) 3C protein that was validated using nuclear magnetic resonance spectroscopy. The PIP-binding site was located on a highly dynamic α helix, which also functions in RNA binding. Broad PIP-binding activity was observed in solution using a fluorescence polarization assay or in the context of a lipid bilayer using an on-chip, fluorescence assay. All-atom molecular dynamics simulations of the 3C protein-membrane interface revealed PIP clustering and perhaps PIP-dependent conformations. PIP clustering was mediated by interaction with residues that interact with the RNA phosphodiester backbone. We conclude that 3C binding to membranes will be determined by PIP abundance. We suggest that the duality of function observed for 3C may extend to RNA-binding proteins of other viruses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Structures of BmrR-Drug Complexes Reveal a Rigid Multidrug Binding Pocket And Transcription Activation Through Tyrosine Expulsion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Newberry, K.J.; Huffman, J.L.; Miller, M.C.

2009-05-22

BmrR is a member of the MerR family and a multidrug binding transcription factor that up-regulates the expression of the bmr multidrug efflux transporter gene in response to myriad lipophilic cationic compounds. The structural mechanism by which BmrR binds these chemically and structurally different drugs and subsequently activates transcription is poorly understood. Here, we describe the crystal structures of BmrR bound to rhodamine 6G (R6G) or berberine (Ber) and cognate DNA. These structures reveal each drug stacks against multiple aromatic residues with their positive charges most proximal to the carboxylate group of Glu-253 and that, unlike other multidrug binding pockets,more » that of BmrR is rigid. Substitution of Glu-253 with either alanine (E253A) or glutamine (E253Q) results in unpredictable binding affinities for R6G, Ber, and tetraphenylphosphonium. Moreover, these drug binding studies reveal that the negative charge of Glu-253 is not important for high affinity binding to Ber and tetraphenylphosphonium but plays a more significant, but unpredictable, role in R6G binding. In vitro transcription data show that E253A and E253Q are constitutively active, and structures of the drug-free E253A-DNA and E253Q-DNA complexes support a transcription activation mechanism requiring the expulsion of Tyr-152 from the multidrug binding pocket. In sum, these data delineate the mechanism by which BmrR binds lipophilic, monovalent cationic compounds and suggest the importance of the redundant negative electrostatic nature of this rigid drug binding pocket that can be used to discriminate against molecules that are not substrates of the Bmr multidrug efflux pump.« less

The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance.

PubMed

Jiang, Yanjuan; Yu, Diqiu

2016-08-01

Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. © 2016 American Society of Plant Biologists. All Rights Reserved.

Low Expression of lncRNA-GAS5 Is Implicated in Human Primary Varicose Great Saphenous Veins

PubMed Central

Yuan, Tian-You; Wang, Shi-Yi; Feng, Jing; Wang, Jing; Liu, Yuan; Wu, Ya-Han; Ma, Xiu-E; Ge, Jin; Cui, Ying-Yu; Jiang, Xiao-Yan

2015-01-01

The cellular mechanisms of primary varicose great saphenous veins (GSVs) involve inflammation, apoptosis, and proliferation of local cells and extracellular matrix degradation. Long non-coding RNAs (lncRNAs) play important roles in these cellular processes; however, which and how lncRNAs related to these mechanisms take effect on GSVs remain unclear. By screening lncRNAs that might experience changes in GSV varicosities, we selected the lower expressed lncRNA-GAS5 (growth arrest specific transcript 5) for functional assessments. Silencing of lncRNA-GAS5 promoted cell proliferation and migration, and cell cycle of the human saphenous vein smooth muscle cells (HSVSMCs), whereas overexpressing it inhibited these cellular behaviors and reduced apoptosis of HSVSMCs. RNA pull-down experiment revealed a direct bind of lncRNA-GAS5 to a Ca2+-dependent RNA-binding protein, Annexin A2. Further experiments showed that silencing of Annexin A2 reduced the HSVSMCs proliferation and vice versa. In the context of lncRNA-GAS5 knockdown, silencing of Annexin A2 reduced the proliferation of HSVSMCs while overexpression of Annexin A2 increased the proliferation. Thus, the low expression of lncRNA-GAS5 may facilitate HSVSMCs proliferation and migration through Annexin A2 and thereby the pathogenesis of GSV varicosities. PMID:25806802

Revisiting point FRAP to quantitatively characterize anomalous diffusion in live cells.

PubMed

Daddysman, Matthew K; Fecko, Christopher J

2013-02-07

Fluorescence recovery after photobleaching (FRAP) is widely used to interrogate diffusion and binding of proteins in live cells. Herein, we apply two-photon excited FRAP with a diffraction limited bleaching and observation volume to study anomalous diffusion of unconjugated green fluorescence protein (GFP) in vitro and in cells. Experiments performed on dilute solutions of GFP reveal that reversible fluorophore bleaching can be mistakenly interpreted as anomalous diffusion. We derive a reaction-diffusion FRAP model that includes reversible photobleaching, and demonstrate that it properly accounts for these photophysics. We then apply this model to investigate the diffusion of GFP in HeLa cells and polytene cells of Drosophila larval salivary glands. GFP exhibits anomalous diffusion in the cytoplasm of both cell types and in HeLa nuclei. Polytene nuclei contain optically resolvable chromosomes, permitting FRAP experiments that focus separately on chromosomal or interchrosomal regions. We find that GFP exhibits anomalous diffusion in chromosomal regions but diffuses normally in regions devoid of chromatin. This observation indicates that obstructed transport through chromatin and not crowding by macromolecules is a source of anomalous diffusion in polytene nuclei. This behavior is likely true in other cells, so it will be important to account for this type of transport physics and for reversible photobleaching to properly interpret future FRAP experiments on DNA-binding proteins.

Conformational analysis of HAMLET, the folding variant of human alpha-lactalbumin associated with apoptosis.

PubMed

Casbarra, Annarita; Birolo, Leila; Infusini, Giuseppe; Dal Piaz, Fabrizio; Svensson, Malin; Pucci, Piero; Svanborg, Catharina; Marino, Gennaro

2004-05-01

A combination of hydrogen/deuterium (H/D) exchange and limited proteolysis experiments coupled to mass spectrometry analysis was used to depict the conformation in solution of HAMLET, the folding variant of human alpha-lactalbumin, complexed to oleic acid, that induces apoptosis in tumor and immature cells. Although near- and far-UV CD and fluorescence spectroscopy were not able to discriminate between HAMLET and apo-alpha-lactalbumin, H/D exchange experiments clearly showed that they correspond to two distinct conformational states, with HAMLET incorporating a greater number of deuterium atoms than the apo and holo forms. Complementary proteolysis experiments revealed that HAMLET and apo are both accessible to proteases in the beta-domain but showed substantial differences in accessibility to proteases at specific sites. The overall results indicated that the conformational changes associated with the release of Ca2+ are not sufficient to induce the HAMLET conformation. Metal depletion might represent the first event to produce a partial unfolding in the beta-domain of alpha-lactalbumin, but some more unfolding is needed to generate the active conformation HAMLET, very likely allowing the protein to bind the C18:1 fatty acid moiety. On the basis of these data, a putative binding site of the oleic acid, which stabilizes the HAMLET conformation, is proposed.

Calixarene-Mediated Liquid-Membrane Transport of Choline Conjugates.

PubMed

Adhikari, Birendra Babu; Fujii, Ayu; Schramm, Michael P

2014-05-01

A series of supramolecular calixarenes efficiently transport distinct molecular species through a liquid membrane when attached to a receptor-complementary choline handle. Calix-[6]arene hexacarboxylic acid was highly effective at transporting different target molecules against a pH gradient. Both carboxylic- and phosphonic-acid-functionalized calix[4]arenes effect transport without requiring a pH or ion gradient. NMR binding studies, two-phase solvent extraction, and three-phase transport experiments reveal the necessary and subtle parameters to effect the transport of molecules attached to a choline "handle". On the other hand, rescorin[4]arene cavitands, which have similar guest recognition profiles, did not transport guest molecules. These developments reveal new approaches towards attempting synthetic-receptor-mediated selective small-molecule transport in vesicular and cellular systems.

How much does emotional valence of action outcomes affect temporal binding?

PubMed

Moreton, Joshua; Callan, Mitchell J; Hughes, Gethin

2017-03-01

Temporal binding refers to the compression of the perceived time interval between voluntary actions and their sensory consequences. Research suggests that the emotional content of an action outcome can modulate the effects of temporal binding. We attempted to conceptually replicate these findings using a time interval estimation task and different emotionally-valenced action outcomes (Experiments 1 and 2) than used in previous research. Contrary to previous findings, we found no evidence that temporal binding was affected by the emotional valence of action outcomes. After validating our stimuli for equivalence of perceived emotional valence and arousal (Experiment 3), in Experiment 4 we directly replicated Yoshie and Haggard's (2013) original experiment using sound vocalizations as action outcomes and failed to detect a significant effect of emotion on temporal binding. These studies suggest that the emotional valence of action outcomes exerts little influence on temporal binding. The potential implications of these findings are discussed. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Characterization of interaction between esculin and human serum albumin in membrane mimetic environments

NASA Astrophysics Data System (ADS)

Zhang, Yaheng; Li, Jiazhong; Dong, Lijun; Li, Ying; Chen, Xingguo

2008-10-01

In this study the interaction between esculin and human serum albumin (HSA) in AOT/isooctane/water microemulsions was studied for the first time using fluorescence quenching technique in combination with UV absorption spectroscopy, Fourier transform infrared (FT-IR) spectroscopy, circular dichroism (CD) spectroscopy and dynamic light scattering (DLS) technique. Fluorescence data in ω o 20 microemulsions revealed the presence of the binding site of esculin on HSA and its binding constants at four different temperatures were obtained. The affinities in microemulsions are similar to that in buffer solution. The alterations of protein secondary structure in the microemulsions in the absence and presence of esculin compared with the free form of HSA in buffer were qualitatively and quantitatively analyzed by the evidence from CD and FT-IR spectroscopes. The displacement experiments confirmed that esculin could bind to the site I of HSA, which was in agreement with the result of the molecular modeling study. Furthermore, the DLS data suggested that HSA may locate at the interface of the microemulsion and esculin could interact with them.

Molecular cloning and functional expression of the guinea pig alpha(1a)-adrenoceptor.

PubMed

González-Espinosa, C; Romero-Avila, M T; Mora-Rodríguez, D M; González-Espinosa, D; García-Sáinz, J A

2001-08-31

In the present paper, the cloning and expression of the guinea pig alpha(1A)-adrenoceptor is presented. The nucleotide sequence had an open reading frame of 1401 bp that encoded a 466 amino-acid protein with an estimated molecular mass of approximately 51.5 kDa. When the clone was expressed in Cos-1 cells, specific high-affinity binding of [(3)H]prazosin and [(3)H]tamsulosin was observed. Chloroethylclonidine treatment of membranes slightly decreased the total binding with both radioligands. Binding competition experiments using [(3)H]tamsulosin showed the following potency order: (a) for agonists: oxymetazoline >epinephrine>norepinephrine>methoxamine, and (b) for antagonists: prazosin> or 5-methyl-urapidil=benoxathian>phentolamine>BMY 7378 (8-[2-[4-(2-methoxyphenyl)-1-piperazinyl]ethyl]-8-azaspiro[4,5]decane-7,9-dione). Photoaffinity labeling using [(125)I-aryl]azido-prazosin revealed a major broad band with a molecular mass between 70 and 80 kDa. The receptor was functional, as evidenced by an epinephrine-increased production of [(3)H]inositol phosphates that was blocked by prazosin.

Cyclobutanone Mimics of Intermediates in Metallo-β-Lactamase Catalysis.

PubMed

Abboud, Martine I; Kosmopoulou, Magda; Krismanich, Anthony P; Johnson, Jarrod W; Hinchliffe, Philip; Brem, Jürgen; Claridge, Timothy D W; Spencer, James; Schofield, Christopher J; Dmitrienko, Gary I

2018-04-17

The most important resistance mechanism to β-lactam antibiotics involves hydrolysis by two β-lactamase categories: the nucleophilic serine and the metallo-β-lactamases (SBLs and MBLs, respectively). Cyclobutanones are hydrolytically stable β-lactam analogues with potential to inhibit both SBLs and MBLs. We describe solution and crystallographic studies on the interaction of a cyclobutanone penem analogue with the clinically important MBL SPM-1. NMR experiments using 19 F-labeled SPM-1 imply the cyclobutanone binds to SPM-1 with micromolar affinity. A crystal structure of the SPM-1:cyclobutanone complex reveals binding of the hydrated cyclobutanone through interactions with one of the zinc ions, stabilisation of the hydrate by hydrogen bonding to zinc-bound water, and hydrophobic contacts with aromatic residues. NMR analyses using a 13 C-labeled cyclobutanone support assignment of the bound species as the hydrated ketone. The results inform on how MBLs bind substrates and stabilize tetrahedral intermediates. They support further investigations on the use of transition-state and/or intermediate analogues as inhibitors of all β-lactamase classes. © 2018 Die Autoren. Veröffentlicht von Wiley-VCH Verlag GmbH & Co. KGaA.

Cyclobutanone Mimics of Intermediates in Metallo‐β‐Lactamase Catalysis

PubMed Central

Abboud, Martine I.; Kosmopoulou, Magda; Krismanich, Anthony P.; Johnson, Jarrod W.; Hinchliffe, Philip; Brem, Jürgen; Claridge, Timothy D. W.

2018-01-01

Abstract The most important resistance mechanism to β‐lactam antibiotics involves hydrolysis by two β‐lactamase categories: the nucleophilic serine and the metallo‐β‐lactamases (SBLs and MBLs, respectively). Cyclobutanones are hydrolytically stable β‐lactam analogues with potential to inhibit both SBLs and MBLs. We describe solution and crystallographic studies on the interaction of a cyclobutanone penem analogue with the clinically important MBL SPM‐1. NMR experiments using 19F‐labeled SPM‐1 imply the cyclobutanone binds to SPM‐1 with micromolar affinity. A crystal structure of the SPM‐1:cyclobutanone complex reveals binding of the hydrated cyclobutanone through interactions with one of the zinc ions, stabilisation of the hydrate by hydrogen bonding to zinc‐bound water, and hydrophobic contacts with aromatic residues. NMR analyses using a 13C‐labeled cyclobutanone support assignment of the bound species as the hydrated ketone. The results inform on how MBLs bind substrates and stabilize tetrahedral intermediates. They support further investigations on the use of transition‐state and/or intermediate analogues as inhibitors of all β‐lactamase classes. PMID:29250863

Insights into the Structure of Dimeric RNA Helicase CsdA and Indispensable Role of Its C-Terminal Regions

DOE PAGES

Xu, Ling; Wang, Lijun; Peng, Junhui; ...

2017-12-05

CsdA has been proposed to be essential for the biogenesis of ribosome and gene regulation after cold shock. However, the structure of CsdA and the function of its long C-terminal regions are still unclear. For this study, we solved all of the domain structures of CsdA and found two previously uncharacterized auxiliary domains: a dimerization domain (DD) and an RNA-binding domain (RBD). Small-angle X-ray scattering experiments helped to track the conformational flexibilities of the helicase core domains and C-terminal regions. Biochemical assays revealed that DD is indispensable for stabilizing the CsdA dimeric structure. We also demonstrate for the first timemore » that CsdA functions as a stable dimer at low temperature. The C-terminal regions are critical for RNA binding and efficient enzymatic activities. CsdA_RBD could specifically bind to the regions with a preference for single-stranded G-rich RNA, which may help to bring the helicase core to unwind the adjacent duplex.« less

Adsorption, Desorption, and Displacement Kinetics of H2O and CO2 on Forsterite, Mg2SiO4(011)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, R. Scott; Li, Zhenjun; Dohnalek, Zdenek

We have examined the adsorbate-substrate interaction kinetics of CO2 and H2O on a natural forsterite crystal surface, Mg2SiO4(011), with 10-15% of substitutional Fe2+. We use temperature programmed desorption (TPD) and molecular beam techniques to determine the adsorption, desorption, and displacement kinetics for H2O and CO2. Neither CO2 nor H2O has distinct sub-monolayer desorption peaks but instead both have a broad continuous desorption feature that evolve smoothly into multilayer desorption. Inversion of the monolayer coverage spectra for both molecules reveals that the corresponding binding energies for H2O are greater than that for CO2 on all sites. The relative strength of thesemore » interactions is the dominant factor in the competitive adsorption/displacement kinetics. In experiments where the two adsorbates are co-dosed, H2O always binds to the highest energy binding sites available and displaces CO2. The onset of CO2 displacement by H2O occurs between 65 and 75 K.« less

Insights into the Structure of Dimeric RNA Helicase CsdA and Indispensable Role of Its C-Terminal Regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Ling; Wang, Lijun; Peng, Junhui

CsdA has been proposed to be essential for the biogenesis of ribosome and gene regulation after cold shock. However, the structure of CsdA and the function of its long C-terminal regions are still unclear. For this study, we solved all of the domain structures of CsdA and found two previously uncharacterized auxiliary domains: a dimerization domain (DD) and an RNA-binding domain (RBD). Small-angle X-ray scattering experiments helped to track the conformational flexibilities of the helicase core domains and C-terminal regions. Biochemical assays revealed that DD is indispensable for stabilizing the CsdA dimeric structure. We also demonstrate for the first timemore » that CsdA functions as a stable dimer at low temperature. The C-terminal regions are critical for RNA binding and efficient enzymatic activities. CsdA_RBD could specifically bind to the regions with a preference for single-stranded G-rich RNA, which may help to bring the helicase core to unwind the adjacent duplex.« less

Insights into the Structure of Dimeric RNA Helicase CsdA and Indispensable Role of Its C-Terminal Regions.

PubMed

Xu, Ling; Wang, Lijun; Peng, Junhui; Li, Fudong; Wu, Lijie; Zhang, Beibei; Lv, Mengqi; Zhang, Jiahai; Gong, Qingguo; Zhang, Rongguang; Zuo, Xiaobing; Zhang, Zhiyong; Wu, Jihui; Tang, Yajun; Shi, Yunyu

2017-12-05

CsdA has been proposed to be essential for the biogenesis of ribosome and gene regulation after cold shock. However, the structure of CsdA and the function of its long C-terminal regions are still unclear. Here, we solved all of the domain structures of CsdA and found two previously uncharacterized auxiliary domains: a dimerization domain (DD) and an RNA-binding domain (RBD). Small-angle X-ray scattering experiments helped to track the conformational flexibilities of the helicase core domains and C-terminal regions. Biochemical assays revealed that DD is indispensable for stabilizing the CsdA dimeric structure. We also demonstrate for the first time that CsdA functions as a stable dimer at low temperature. The C-terminal regions are critical for RNA binding and efficient enzymatic activities. CsdA_RBD could specifically bind to the regions with a preference for single-stranded G-rich RNA, which may help to bring the helicase core to unwind the adjacent duplex. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of C-type lectins reveals an unexpectedly limited interaction between Cryptococcus neoformans spores and Dectin-1

PubMed Central

Walsh, Naomi M.; Wuthrich, Marcel; Wang, Huafeng; Klein, Bruce; Hull, Christina M.

2017-01-01

Phagocytosis by innate immune cells is an important process for protection against multiple pathologies and is particularly important for resistance to infection. However, phagocytosis has also been implicated in the progression of some diseases, including the dissemination of the human fungal pathogen, Cryptococcus neoformans. Previously, we identified Dectin-1 as a likely phagocytic receptor for C. neoformans spores through the use of soluble components in receptor-ligand blocking experiments. In this study, we used gain-of-function and loss-of-function assays with intact cells to evaluate the in vivo role of Dectin-1 and other C-type lectins in interactions with C. neoformans spores and discovered stark differences in outcome when compared with previous assays. First, we found that non-phagocytic cells expressing Dectin-1 were unable to bind spores and that highly sensitive reporter cells expressing Dectin-1 were not stimulated by spores. Second, we determined that some phagocytes from Dectin-1-/- mice interacted with spores differently than wild type (WT) cells, but the effects varied among assays and were modest overall. Third, while we detected small but statistically significant reductions in phagocytosis by primary alveolar macrophages from Dectin-1-/- mice compared to WT, we found no differences in survival between WT and Dectin-1-/- mice challenged with spores. Further analyses to assess the roles of other C-type lectins and their adapters revealed very weak stimulation of Dectin-2 reporter cells by spores and modest differences in binding and phagocytosis by Dectin-2-/- bone marrow-derived phagocytes. There were no discernable defects in binding or phagocytosis by phagocytes lacking Mannose Receptor, Mincle, Card-9, or FcRγ. Taken together, these results lead to the conclusion that Dectin-1 and other C-type lectins do not individually play a major roles in phagocytosis and innate defense by phagocytes against C. neoformans spores and highlight challenges in using soluble receptor/ligand blocking experiments to recapitulate biologically relevant interactions. PMID:28282442

Dynamic, mechanical integration between nucleus and cell- where physics meets biology.

PubMed

Dickinson, Richard B; Neelam, Srujana; Lele, Tanmay P

2015-01-01

Nuclear motions like rotation, translation and deformation suggest that the nucleus is acted upon by mechanical forces. Molecular linkages with the cytoskeleton are thought to transfer forces to the nuclear surface. We developed an approach to apply reproducible, known mechanical forces to the nucleus in spread adherent cells and quantified the elastic response of the mechanically integrated nucleus-cell. The method is sensitive to molecular perturbations and revealed new insight into the function of the LINC complex. While these experiments revealed elastic behaviors, turnover of the cytoskeleton by assembly/disassembly and binding/unbinding of linkages are expected to dissipate any stored mechanical energy in the nucleus or the cytoskeleton. Experiments investigating nuclear forces over longer time scales demonstrated the mechanical principle that expansive/compressive stresses on the nuclear surface arise from the movement of the cell boundaries to shape and position the nucleus. Such forces can shape the nucleus to conform to cell shapes during cell movements with or without myosin activity.

Dynamic, mechanical integration between nucleus and cell- where physics meets biology

PubMed Central

Dickinson, Richard B; Neelam, Srujana; Lele, Tanmay P

2015-01-01

Nuclear motions like rotation, translation and deformation suggest that the nucleus is acted upon by mechanical forces. Molecular linkages with the cytoskeleton are thought to transfer forces to the nuclear surface. We developed an approach to apply reproducible, known mechanical forces to the nucleus in spread adherent cells and quantified the elastic response of the mechanically integrated nucleus-cell. The method is sensitive to molecular perturbations and revealed new insight into the function of the LINC complex. While these experiments revealed elastic behaviors, turnover of the cytoskeleton by assembly/disassembly and binding/unbinding of linkages are expected to dissipate any stored mechanical energy in the nucleus or the cytoskeleton. Experiments investigating nuclear forces over longer time scales demonstrated the mechanical principle that expansive/compressive stresses on the nuclear surface arise from the movement of the cell boundaries to shape and position the nucleus. Such forces can shape the nucleus to conform to cell shapes during cell movements with or without myosin activity. PMID:26338356

Nitric oxide sensing by chlorophyll a.

PubMed

Bhattacharya, Abhishek; Biswas, Pranjal; Kar, Puranjoy; Roychoudhury, Piya; Basu, Sankar; Ganguly, Souradipta; Ghosh, Sanjay; Panda, Koustubh; Pal, Ruma; Dasgupta, Anjan Kr

2017-09-08

Nitric oxide (NO) acts as a signalling molecule that has direct and indirect regulatory roles in various functional processes in biology, though in plant kingdom its role is relatively unexplored. One reason for this is the fact that sensing of NO is always challenging. There are very few probes that can classify the different NO species. The present paper proposes a simple but straightforward way for sensing different NO species using chlorophyll, the source of inspiration being hemoglobin that serves as NO sink in mammalian systems. The proposed method is able to classify NO from DETA-NONOate or (Z)-1-[N-(2-aminoethyl)-N-(2-ammonioethyl) amino] diazen-1-ium-1,2-diolate, nitrite, nitrate and S-nitrosothiol or SNO. This discrimination is carried out by chlorophyll a (chl a) at nano molar (nM) order of sensitivity and at 293 K-310 K. Molecular docking reveals the differential binding effects of NO and SNO with chlorophyll, the predicted binding affinity matching with the experimental observation. Additional experiments with a diverse range of cyanobacteria reveal that apart from the spectroscopic approach the proposed sensing module can be used in microscopic inspection of NO species. Binding of NO is sensitive to temperature and static magnetic field. This provides additional support for the involvement of the porphyrin ring structures to the NO sensing process. This also, broadens the scope of the sensing methods as hinted in the text. Copyright © 2017 Elsevier B.V. All rights reserved.

Direct recognition of superparamagnetic nanocrystals by macrophage scavenger receptor SR-AI.

PubMed

Chao, Ying; Karmali, Priya P; Mukthavaram, Rajesh; Kesari, Santosh; Kouznetsova, Valentina L; Tsigelny, Igor F; Simberg, Dmitri

2013-05-28

Scavenger receptors (SRs) are molecular pattern recognition receptors that have been shown to mediate opsonin-independent uptake of therapeutic and imaging nanoparticles, underlying the importance of SRs in nanomedicine. Unlike pathogens, engineered nanomaterials offer great flexibility in control of surface properties, allowing addressing specific questions regarding the molecular mechanisms of nanoparticle recognition. Recently, we showed that SR-type AI/II mediates opsonin-independent internalization of dextran superparamagnetic iron oxide (SPIO) nanoparticles via positively charged extracellular collagen-like domain. To understand the mechanism of opsonin-independent SPIO recognition, we tested the binding and uptake of nanoparticles with different surface coatings by SR-AI. SPIO coated with 10 kDa dextran was efficiently recognized and taken up by SR-AI transfected cells and J774 macrophages, while SPIO with 20 kDa dextran coating or cross-linked dextran hydrogel avoided the binding and uptake. Nanoparticle negative charge density and zeta-potential did not correlate with SR-AI binding/uptake efficiency. Additional experiments and computer modeling revealed that recognition of the iron oxide crystalline core by the positively charged collagen-like domain of SR-AI is sterically hindered by surface polymer coating. Importantly, the modeling revealed a strong complementarity between the surface Fe-OH groups of the magnetite crystal and the charged lysines of the collagen-like domain of SR-AI, suggesting a specific recognition of SPIO crystalline surface. These data provide an insight into the molecular recognition of nanocrystals by innate immunity receptors and the mechanisms whereby polymer coatings promote immune evasion.

Disruption of the A-Kinase Anchoring Domain in Flagellar Radial Spoke Protein 3 Results in Unregulated Axonemal cAMP-dependent Protein Kinase Activity and Abnormal Flagellar Motility

PubMed Central

Gaillard, Anne R.; Fox, Laura A.; Rhea, Jeanne M.; Craige, Branch

2006-01-01

Biochemical studies of Chlamydomonas flagellar axonemes revealed that radial spoke protein (RSP) 3 is an A-kinase anchoring protein (AKAP). To determine the physiological role of PKA anchoring in the axoneme, an RSP3 mutant, pf14, was transformed with an RSP3 gene containing a mutation in the PKA-binding domain. Analysis of several independent transformants revealed that the transformed cells exhibit an unusual phenotype: a fraction of the cells swim normally; the remainder of the cells twitch feebly or are paralyzed. The abnormal/paralyzed motility is not due to an obvious deficiency of radial spoke assembly, and the phenotype cosegregates with the mutant RSP3. We postulated that paralysis was due to failure in targeting and regulation of axonemal cAMP-dependent protein kinase (PKA). To test this, reactivation experiments of demembranated cells were performed in the absence or presence of PKA inhibitors. Importantly, motility in reactivated cell models mimicked the live cell phenotype with nearly equal fractions of motile and paralyzed cells. PKA inhibitors resulted in a twofold increase in the number of motile cells, rescuing paralysis. These results confirm that flagellar RSP3 is an AKAP and reveal that a mutation in the PKA binding domain results in unregulated axonemal PKA activity and inhibition of normal motility. PMID:16571668

Structure of the complex between teicoplanin and a bacterial cell-wall peptide: use of a carrier-protein approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Economou, Nicoleta J.; Zentner, Isaac J.; Lazo, Edwin

2013-04-01

Using a carrier-protein strategy, the structure of teicoplanin bound to its bacterial cell-wall target has been determined. The structure reveals the molecular determinants of target recognition, flexibility in the antibiotic backbone and intrinsic radiation sensitivity of teicoplanin. Multidrug-resistant bacterial infections are commonly treated with glycopeptide antibiotics such as teicoplanin. This drug inhibits bacterial cell-wall biosynthesis by binding and sequestering a cell-wall precursor: a d-alanine-containing peptide. A carrier-protein strategy was used to crystallize the complex of teicoplanin and its target peptide by fusing the cell-wall peptide to either MBP or ubiquitin via native chemical ligation and subsequently crystallizing the protein–peptide–antibiotic complex.more » The 2.05 Å resolution MBP–peptide–teicoplanin structure shows that teicoplanin recognizes its ligand through a combination of five hydrogen bonds and multiple van der Waals interactions. Comparison of this teicoplanin structure with that of unliganded teicoplanin reveals a flexibility in the antibiotic peptide backbone that has significant implications for ligand recognition. Diffraction experiments revealed an X-ray-induced dechlorination of the sixth amino acid of the antibiotic; it is shown that teicoplanin is significantly more radiation-sensitive than other similar antibiotics and that ligand binding increases radiosensitivity. Insights derived from this new teicoplanin structure may contribute to the development of next-generation antibacterials designed to overcome bacterial resistance.« less

Ligand and receptor dynamics contribute to the mechanism of graded PPARγ agonism

PubMed Central

Hughes, Travis S.; Chalmers, Michael J.; Novick, Scott; Kuruvilla, Dana S.; Chang, Mi Ra; Kamenecka, Theodore M.; Rance, Mark; Johnson, Bruce A.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

2011-01-01

SUMMARY Ligand binding to proteins is not a static process, but rather involves a number of complex dynamic transitions. A flexible ligand can change conformation upon binding its target. The conformation and dynamics of a protein can change to facilitate ligand binding. The conformation of the ligand, however, is generally presumed to have one primary binding mode, shifting the protein conformational ensemble from one state to another. We report solution NMR studies that reveal peroxisome proliferator-activated receptor γ (PPARγ) modulators can sample multiple binding modes manifesting in multiple receptor conformations in slow conformational exchange. Our NMR, hydrogen/deuterium exchange and docking studies reveal that ligand-induced receptor stabilization and binding mode occupancy correlate with the graded agonist response of the ligand. Our results suggest that ligand and receptor dynamics affect the graded transcriptional output of PPARγ modulators. PMID:22244763

Structural analysis of a functional DIAP1 fragment bound to grim and hid peptides.

PubMed

Wu, J W; Cocina, A E; Chai, J; Hay, B A; Shi, Y

2001-07-01

The inhibitor of apoptosis protein DIAP1 suppresses apoptosis in Drosophila, with the second BIR domain (BIR2) playing an important role. Three proteins, Hid, Grim, and Reaper, promote apoptosis, in part by binding to DIAP1 through their conserved N-terminal sequences. The crystal structures of DIAP1-BIR2 by itself and in complex with the N-terminal peptides from Hid and Grim reveal that these peptides bind a surface groove on DIAP1, with the first four amino acids mimicking the binding of the Smac tetrapeptide to XIAP. The next 3 residues also contribute to binding through hydrophobic interactions. Interestingly, peptide binding induces the formation of an additional alpha helix in DIAP1. Our study reveals the structural conservation and diversity necessary for the binding of IAPs by the Drosophila Hid/Grim/Reaper and the mammalian Smac proteins.

Binding-Induced Fluorescence of Serotonin Transporter Ligands: A Spectroscopic and Structural Study of 4-(4-(Dimethylamino)phenyl)-1-methylpyridinium (APP+) and APP+ Analogues

PubMed Central

2014-01-01

The binding-induced fluorescence of 4-(4-(dimethylamino)-phenyl)-1-methylpyridinium (APP+) and two new serotonin transporter (SERT)-binding fluorescent analogues, 1-butyl-4-[4-(1-dimethylamino)phenyl]-pyridinium bromide (BPP+) and 1-methyl-4-[4-(1-piperidinyl)phenyl]-pyridinium (PPP+), has been investigated. Optical spectroscopy reveals that these probes are highly sensitive to their chemical microenvironment, responding to variations in polarity with changes in transition energies and responding to changes in viscosity or rotational freedom with emission enhancements. Molecular docking calculations reveal that the probes are able to access the nonpolar and conformationally restrictive binding pocket of SERT. As a result, the probes exhibit previously not identified binding-induced turn-on emission that is spectroscopically distinct from dyes that have accumulated intracellularly. Thus, binding and transport dynamics of SERT ligands can be resolved both spatially and spectroscopically. PMID:24460204

Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

PubMed

Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

2014-05-01

The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

Interaction of the replication terminator protein of Bacillus subtilis with DNA probed by NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hastings, Adam F.; Otting, Gottfried; Folmer, Rutger H.A.

2005-09-23

Termination of DNA replication in Bacillus subtilis involves the polar arrest of replication forks by a specific complex formed between the dimeric 29 kDa replication terminator protein (RTP) and DNA terminator sites. We have used NMR spectroscopy to probe the changes in {sup 1}H-{sup 15}N correlation spectra of a {sup 15}N-labelled RTP.C110S mutant upon the addition of a 21 base pair symmetrical DNA binding site. Assignment of the {sup 1}H-{sup 15}N correlations was achieved using a suite of triple resonance NMR experiments with {sup 15}N,{sup 13}C,70% {sup 2}H enriched protein recorded at 800 MHz and using TROSY pulse sequences. Perturbationsmore » to {sup 1}H-{sup 15}N spectra revealed that the N-termini, {alpha}3-helices and several loops are affected by the binding interaction. An analysis of this data in light of the crystallographically determined apo- and DNA-bound forms of RTP.C110S revealed that the NMR spectral perturbations correlate more closely to protein structural changes upon complex formation rather than to interactions at the protein-DNA interface.« less

Direct ROS scavenging activity of CueP from Salmonella enterica serovar Typhimurium.

PubMed

Yoon, Bo-Young; Yeom, Ji-Hyun; Kim, Jin-Sik; Um, Si-Hyeon; Jo, Inseong; Lee, Kangseok; Kim, Yong-Hak; Ha, Nam-Chul

2014-02-01

Salmonella enterica serovar Typhimurium (S. Typhimurium) is an intracellular pathogen that has evolved to survive in the phagosome of macrophages. The periplasmic copper-binding protein CueP was initially known to confer copper resistance to S. Typhimurium. Crystal structure and biochemical studies on CueP revealed a putative copper binding site surrounded by the conserved cysteine and histidine residues. A recent study reported that CueP supplies copper ions to periplasmic Cu, Zn-superoxide dismutase (SodCII) at a low copper concentration and thus enables the sustained SodCII activity in the periplasm. In this study, we investigated the role of CueP in copper resistance at a high copper concentration. We observed that the survival of a cueP-deleted strain of Salmonella in macrophage phagosome was significantly reduced. Subsequent biochemical experiments revealed that CueP specifically mediates the reduction of copper ion using electrons released during the formation of the disulfide bond. We observed that the copper ion-mediated Fenton reaction in the presence of hydrogen peroxide was blocked by CueP. This study provides insight into how CueP confers copper resistance to S. Typhimurium in copper-rich environments such as the phagosome of macrophages.

8-Nitro-cGMP Attenuates the Interaction between SNARE Complex and Complexin through S-Guanylation of SNAP-25.

PubMed

Kishimoto, Yusuke; Kunieda, Kohei; Kitamura, Atsushi; Kakihana, Yuki; Akaike, Takaaki; Ihara, Hideshi

2018-02-21

8-Nitroguanosine 3',5'-cyclic monophosphate (8-nitro-cGMP) is the second messenger in nitric oxide/reactive oxygen species redox signaling. This molecule covalently binds to protein thiol groups, called S-guanylation, and exerts various biological functions. Recently, we have identified synaptosomal-associated protein 25 (SNAP-25) as a target of S-guanylation, and demonstrated that S-guanylation of SNAP25 enhanced SNARE complex formation. In this study, we have examined the effects of S-guanylation of SNAP-25 on the interaction between the SNARE complex and complexin (cplx), which binds to the SNARE complex with a high affinity. Pull-down assays and coimmunoprecipitation experiments have revealed that S-guanylation of Cys90 in SNAP-25 attenuates the interaction between the SNARE complex and cplx. In addition, blue native-PAGE followed by Western blot analysis revealed that the amount of cplx detected at a high molecular weight decreased upon 8-nitro-cGMP treatment in SH-SY5Y cells. These results demonstrated for the first time that S-guanylation of SNAP-25 attenuates the interaction between the SNARE complex and cplx.

Crystal structure of the YGR205w protein from Saccharomyces cerevisiae: close structural resemblance to E. coli pantothenate kinase.

PubMed

Li de La Sierra-Gallay, Ines; Collinet, Bruno; Graille, Marc; Quevillon-Cheruel, Sophie; Liger, Dominique; Minard, Philippe; Blondeau, Karine; Henckes, Gilles; Aufrère, Robert; Leulliot, Nicolas; Zhou, Cong-Zhao; Sorel, Isabelle; Ferrer, Jean-Luc; Poupon, Anne; Janin, Joël; van Tilbeurgh, Herman

2004-03-01

The protein product of the YGR205w gene of Saccharomyces cerevisiae was targeted as part of our yeast structural genomics project. YGR205w codes for a small (290 amino acids) protein with unknown structure and function. The only recognizable sequence feature is the presence of a Walker A motif (P loop) indicating a possible nucleotide binding/converting function. We determined the three-dimensional crystal structure of Se-methionine substituted protein using multiple anomalous diffraction. The structure revealed a well known mononucleotide fold and strong resemblance to the structure of small metabolite phosphorylating enzymes such as pantothenate and phosphoribulo kinase. Biochemical experiments show that YGR205w binds specifically ATP and, less tightly, ADP. The structure also revealed the presence of two bound sulphate ions, occupying opposite niches in a canyon that corresponds to the active site of the protein. One sulphate is bound to the P-loop in a position that corresponds to the position of beta-phosphate in mononucleotide protein ATP complex, suggesting the protein is indeed a kinase. The nature of the phosphate accepting substrate remains to be determined. Copyright 2004 Wiley-Liss, Inc.

Crystal Structure of the Golgi-Associated Human Nα-Acetyltransferase 60 Reveals the Molecular Determinants for Substrate-Specific Acetylation.

PubMed

Støve, Svein Isungset; Magin, Robert S; Foyn, Håvard; Haug, Bengt Erik; Marmorstein, Ronen; Arnesen, Thomas

2016-07-06

N-Terminal acetylation is a common and important protein modification catalyzed by N-terminal acetyltransferases (NATs). Six human NATs (NatA-NatF) contain one catalytic subunit each, Naa10 to Naa60, respectively. In contrast to the ribosome-associated NatA to NatE, NatF/Naa60 specifically associates with Golgi membranes and acetylates transmembrane proteins. To gain insight into the molecular basis for the function of Naa60, we developed an Naa60 bisubstrate CoA-peptide conjugate inhibitor, determined its X-ray structure when bound to CoA and inhibitor, and carried out biochemical experiments. We show that Naa60 adapts an overall fold similar to that of the catalytic subunits of ribosome-associated NATs, but with the addition of two novel elongated loops that play important roles in substrate-specific binding. One of these loops mediates a dimer to monomer transition upon substrate-specific binding. Naa60 employs a catalytic mechanism most similar to Naa50. Collectively, these data reveal the molecular basis for Naa60-specific acetyltransferase activity with implications for its Golgi-specific functions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Peptides derived from transcription factor EB bind to calcineurin at a similar region as the NFAT-type motif

PubMed Central

Song, Ruiwen; Li, Jing; Zhang, Jin; Wang, Lu; Tong, Li; Wang, Ping; Yang, Huan; Wei, Qun; Cai, Huaibin; Luo, Jing

2018-01-01

Calcineurin (CN) is involved in many physiological processes and interacts with multiple substrates. Most of the substrates contain similar motifs recognized by CN. Recent studies revealed a new CN substrate, transcription factor EB (TFEB), which is involved in autophagy. We showed that a 15-mer QSYLENPTSYHLQQS peptide from TFEB (TFEB-YLENP) bound to CN. When the TFEB-YLENP peptide was changed to YLAVP, its affinity for CN increased and it had stronger CN inhibitory activity. Molecular dynamics simulations revealed that the TFEB-YLENP peptide has the same docking sites in CN as the 15-mer DQYLAVPQHPYQWAK motif of the nuclear factor of activated T cells, cytoplasmic 1 (NFATc1-YLAVP). Moreover expression of the NFATc1-YLAVP peptide suppressed the TFEB activation in starved Hela cells. Our studies first identified a CN binding site in TFEB and compared the inhibitory capability of various peptides derived from CN substrates. The data uncovered a diversity in recognition sequences that underlies the CN signaling within the cell. Studies of CN-substrate interactions should lay the groundwork for developing selective CN peptide inhibitors that target CN-substrate interaction in vitro experiments. PMID:28890387

Effect of polyethylene glycol conjugation on conformational and colloidal stability of a monoclonal antibody antigen-binding fragment (Fab').

PubMed

Roque, Cristopher; Sheung, Anthony; Rahman, Nausheen; Ausar, S Fernando

2015-02-02

We have investigated the effects of site specific "hinge" polyethylene glycol conjugation (PEGylation) on thermal, pH, and colloidal stability of a monoclonal antibody antigen-binding fragment (Fab') using a variety of biophysical techniques. The results obtained by circular dichroism (CD), ultraviolet (UV) absorbance, and fluorescence spectroscopy suggested that the physical stability of the Fab' is maximized at pH 6-7 with no apparent differences due to PEGylation. Temperature-induced aggregation experiments revealed that PEGylation was able to increase the transition temperature, as well as prevent the formation of visible and subvisible aggregates. Statistical comparison of the three-index empirical phase diagram (EPD) revealed significant differences in thermal and pH stability signatures between Fab' and PEG-Fab'. Upon mechanical stress, micro-flow imaging (MFI) and measurement of the optical density at 360 nm showed that the PEG-Fab' had significantly higher resistance to surface-induced aggregation compared to the Fab'. Analysis of the interaction parameter, kD, indicated repulsive intermolecular forces for PEG-Fab' and attractive forces for Fab'. In conclusion, PEGylation appears to protect Fab' against thermal and mechanical stress-induced aggregation, likely due to a steric hindrance mechanism.

[Glutamate-binding membrane proteins from human platelets].

PubMed

Gurevich, V S; Popov, Iu G; Gorodinskiĭ, A I; Dambinova, S A

1991-09-01

Solubilization of the total membrane fraction of human platelets in a 2% solution of sodium deoxycholate and subsequent affinity chromatography on glutamate agarose resulted in two protein fractions possessing a glutamate-binding activity. As can be evidenced from radioligand binding data, the first fraction contains two types of binding sites (Kd1 = 1 microM, Bmax 1 = 100 pmol/mg of protein; Kd2 = 9.3 microMm Bmax2 = 395 pmol/mg of protein). The second fraction has only one type of binding sites (Kd = 1 microM, Bmax = = 110 pmol/mg of protein). SDS-PAAG electrophoresis revealed the presence in the first fraction of proteins with Mr of 14, 24, 56 and 155 kDa, whereas the second fraction was found to contain 14, 46, 71 and 155 kDa proteins. Solid phase immunoenzymatic analysis using poly- and monoclonal specific antibodies against mammalian brain glutamate-binding proteins revealed a marked immunochemical similarity of the isolated protein fractions with human brain synaptic membrane glutamate-binding proteins.

Analyzing Ligand Depletion in a Saturation Equilibrium Binding Experiment

ERIC Educational Resources Information Center

Claro, Enrique

2006-01-01

I present a proposal for a laboratory practice to generate and analyze data from a saturation equilibrium binding experiment addressed to advanced undergraduate students. [[superscript 3]H]Quinuclidinyl benzilate is a nonselective muscarinic ligand with very high affinity and very low nonspecific binding to brain membranes, which contain a high…

Atrazine Molecular Imprinted Polymers: Comparative Analysis by Far-Infrared and Ultraviolet Induced Polymerization

PubMed Central

Chen, Jun; Bai, Lian-Yang; Liu, Kun-Feng; Liu, Run-Qiang; Zhang, Yu-Ping

2014-01-01

Atrazine molecular imprinted polymers (MIPs) were comparatively synthesized using identical polymer formulation by far-infrared (FIR) radiation and ultraviolet (UV)-induced polymerization, respectively. Equilibrium binding experiments were carried out with the prepared MIPs; the results showed that MIPuv possessed specific binding to atrazine compared with their MIPFIR radiation counterparts. Scatchard plot’s of both MIPs indicated that the affinities of the binding sites in MIPs are heterogeneous and can be approximated by two dissociation-constants corresponding to the high-and low-affinity binding sites. Moreover, several common pesticides including atrazine, cyromazine, metamitron, simazine, ametryn, terbutryn were tested to determine their specificity, similar imprinting factor (IF) and different selectivity index (SI) for both MIPs. Physical characterization of the polymers revealed that the different polymerization methods led to slight differences in polymer structures and performance by scanning electron microscope (SEM), Fourier transform infrared absorption (FT-IR), and mercury analyzer (MA). Finally, both MIPs were used as selective sorbents for solid phase extraction (SPE) of atrazine from lake water, followed by high performance liquid chromatography (HPLC) analysis. Compared with commercial C18 SPE sorbent (86.4%–94.8%), higher recoveries of atrazine in spiked lake water were obtained in the range of 90.1%–97.1% and 94.4%–101.9%, for both MIPs, respectively. PMID:24398982

NanoESI mass spectrometry of Rubisco and Rubisco activase structures and their interactions with nucleotides and sugar phosphates.

PubMed

Blayney, Michelle J; Whitney, Spencer M; Beck, Jennifer L

2011-09-01

Ribulose bisphosphate carboxylase/oxygenase (Rubisco) is the protein that is responsible for the fixation of carbon dioxide in photosynthesis. Inhibitory sugar phosphate molecules, which can include its substrate ribulose-1,5-bisphosphate (RuBP), can bind to Rubisco catalytic sites and inhibit catalysis. These are removed by interaction with Rubisco activase (RA) via an ATP hydrolytic reaction. Here we show the first nanoESI mass spectra of the hexadecameric Rubisco and of RA from a higher plant (tobacco). The spectra of recombinant, purified RA revealed polydispersity in its oligomeric forms (up to hexamer) and that ADP was bound. ADP was removed by dialysis against a high ionic strength solution and nucleotide binding experiments showed that ADP bound more tightly to RA than AMP-PNP (a non-hydrolysable ATP analog). There was evidence that there may be two nucleotide binding sites per RA monomer. The oligomerization capacity of mutant and wild-type tobacco RA up to hexamers is analogous to the subunit stoichiometry for other AAA+ enzymes. This suggests assembly of RA into hexamers is likely the most active conformation for removing inhibitory sugar phosphate molecules from Rubisco to enable its catalytic competency. Stoichiometric binding of RuBP or carboxyarabinitol bisphosphate (CABP) to each of the eight catalytic sites of Rubisco was observed.

Biochemical characterization of an inhibitor of Escherichia coli UDP-N-acetylmuramyl-l-alanine ligase.

PubMed

Ehmann, David E; Demeritt, Julie E; Hull, Kenneth G; Fisher, Stewart L

2004-05-06

UDP-N-acetylmuramyl-l-alanine ligase (MurC) is an essential bacterial enzyme involved in peptidoglycan biosynthesis and a target for the discovery of novel antibacterial agents. As a result of a high-throughput screen (HTS) against a chemical library for inhibitors of MurC, a series of benzofuran acyl-sulfonamides was identified as potential leads. One of these compounds, Compound A, inhibited Escherichia coli MurC with an IC(50) of 2.3 microM. Compound A exhibited time-dependent, partially reversible inhibition of E. coli MurC. Kinetic studies revealed a mode of inhibition consistent with the compound acting competitively with the MurC substrates ATP and UDP-N-acetyl-muramic acid (UNAM) with a K(i) of 4.5 microM against ATP and 6.3 microM against UNAM. Fluorescence binding experiments yielded a K(d) of 3.1 microM for the compound binding to MurC. Compound A also exhibited high-affinity binding to bovine serum albumin (BSA) as evidenced by a severe reduction in MurC inhibition upon addition of BSA. This finding is consistent with the high lipophilicity of the compound. Advancement of this compound series for further drug development will require reduction of albumin binding.

A novel functional domain of Cdc15 kinase is required for its interaction with Tem1 GTPase in Saccharomyces cerevisiae.

PubMed Central

Asakawa, K; Yoshida, S; Otake, F; Toh-e, A

2001-01-01

Exit from mitosis requires the inactivation of cyclin-dependent kinase (CDK) activity. In the budding yeast Saccharomyces cerevisiae, a number of gene products have been identified as components of the signal transduction network regulating inactivation of CDK (called the MEN, for the mitotic exit network). Cdc15, one of such components of the MEN, is an essential protein kinase. By the two-hybrid screening, we identified Cdc15 as a binding protein of Tem1 GTPase, another essential regulator of the MEN. Coprecipitation experiments revealed that Tem1 binds to Cdc15 in vivo. By deletion analysis, we found that the Tem1-binding domain resides near the conserved kinase domain of Cdc15. The cdc15-LF mutation, which was introduced into the Tem1-binding domain, reduced the interaction with Cdc15 and Tem1 and caused temperature-sensitive growth.The kinase activity of Cdc15 was not so much affected by the cdc15-LF mutation. However, Cdc15-LF failed to localize to the SPB at the restrictive temperature. Our data show that the interaction with Tem1 is important for the function of Cdc15 and that Cdc15 and Tem1 function in a complex to direct the exit from mitosis. PMID:11290702

Impairment of Fas-ligand-caveolin-1 interaction inhibits Fas-ligand translocation to rafts and Fas-ligand-induced cell death.

PubMed

Glukhova, Xenia A; Trizna, Julia A; Proussakova, Olga V; Gogvadze, Vladimir; Beletsky, Igor P

2018-01-22

Fas-ligand/CD178 belongs to the TNF family proteins and can induce apoptosis through death receptor Fas/CD95. The important requirement for Fas-ligand-dependent cell death induction is its localization to rafts, cholesterol- and sphingolipid-enriched micro-domains of membrane, involved in regulation of different signaling complexes. Here, we demonstrate that Fas-ligand physically associates with caveolin-1, the main protein component of rafts. Experiments with cells overexpressing Fas-ligand revealed a FasL N-terminal pre-prolin-rich region, which is essential for the association with caveolin-1. We found that the N-terminal domain of Fas-ligand bears two caveolin-binding sites. The first caveolin-binding site binds the N-terminal domain of caveolin-1, whereas the second one appears to interact with the C-terminal domain of caveolin-1. The deletion of both caveolin-binding sites in Fas-ligand impairs its distribution between cellular membranes, and attenuates a Fas-ligand-induced cytotoxicity. These results demonstrate that the interaction of Fas-ligand and caveolin-1 represents a molecular basis for Fas-ligand translocation to rafts, and the subsequent induction of Fas-ligand-dependent cell death. A possibility of a similar association between other TNF family members and caveolin-1 is discussed.

NF-Y Binding Site Architecture Defines a C-Fos Targeted Promoter Class

PubMed Central

Haubrock, Martin; Hartmann, Fabian; Wingender, Edgar

2016-01-01

ChIP-seq experiments detect the chromatin occupancy of known transcription factors in a genome-wide fashion. The comparisons of several species-specific ChIP-seq libraries done for different transcription factors have revealed a complex combinatorial and context-specific co-localization behavior for the identified binding regions. In this study we have investigated human derived ChIP-seq data to identify common cis-regulatory principles for the human transcription factor c-Fos. We found that in four different cell lines, c-Fos targeted proximal and distal genomic intervals show prevalences for either AP-1 motifs or CCAAT boxes as known binding motifs for the transcription factor NF-Y, and thereby act in a mutually exclusive manner. For proximal regions of co-localized c-Fos and NF-YB binding, we gathered evidence that a characteristic configuration of repeating CCAAT motifs may be responsible for attracting c-Fos, probably provided by a nearby AP-1 bound enhancer. Our results suggest a novel regulatory function of NF-Y in gene-proximal regions. Specific CCAAT dimer repeats bound by the transcription factor NF-Y define this novel cis-regulatory module. Based on this behavior we propose a new enhancer promoter interaction model based on AP-1 motif defined enhancers which interact with CCAAT-box characterized promoter regions. PMID:27517874

A Comparison of Two Single-Stranded DNA Binding Models by Mutational Analysis of APOBEC3G

PubMed Central

Shindo, Keisuke; Li, Ming; Gross, Phillip J.; Brown, William L.; Harjes, Elena; Lu, Yongjian; Matsuo, Hiroshi; Harris, Reuben S.

2012-01-01

APOBEC3G is the best known of several DNA cytosine deaminases that function to inhibit the replication of parasitic genetic elements including the lentivirus HIV. Several high-resolution structures of the APOBEC3G catalytic domain have been generated, but none reveal how this enzyme binds to substrate single-stranded DNA. Here, we constructed a panel of APOBEC3G amino acid substitution mutants and performed a series of biochemical, genetic, and structural assays to distinguish between “Brim” and “Kink” models for single-strand DNA binding. Each model predicts distinct sets of interactions between surface arginines and negatively charged phosphates in the DNA backbone. Concordant with both models, changing the conserved arginine at position 313 to glutamate abolished both catalytic and restriction activities. In support of the Brim model, arginine to glutamate substitutions at positions 213, 215, and 320 also compromised these APOBEC3G activities. Arginine to glutamate substitutions at Kink model residues 374 and 376 had smaller effects. These observations were supported by A3G catalytic domain-ssDNA chemical shift perturbation experiments. The overall data set is most consistent with the Brim model for single-stranded DNA binding by APOBEC3G. PMID:24832226

Efficient interrupting skills of amino acid metallointercalators with DNA at physiological pH: Evaluation of biological assays

NASA Astrophysics Data System (ADS)

Raman, Natarajan; Selvaganapathy, Muthusamy; Radhakrishnan, Srinivasan

2014-06-01

The 4-aminoantipyrine derivatives (sbnd NO2, sbnd OCH3) and their mixed-ligand complexes with amino acids have been synthesized and investigated for their binding with CT DNA using UV-visible spectroscopy, cyclic voltammetry, and viscosity measurements under physiological conditions of pH (stomach 4.7; blood 7.4). The results from all techniques i.e. binding constant (Kb), and free energy change (ΔG) were in good agreement and inferred spontaneous compound-DNA complexes formation via intercalation. Among all the compounds 1 and 4 showed comparatively greater binding at pH 7.4 as evident from its greater Kb values. All the complexes exhibit oxidative cleavage of supercoiled (SC) pBR322 plasmid DNA in the presence of H2O2 as an activator. It is remarkable that at 25 μM concentration 1 and 4 completely degrade SC DNA into undetectable minor fragments and thus they act as efficient chemical nucleases. Among the new complexes, complexes 1 and 4 have highest potential against all the microorganisms tested. The results of the above biological experiments also reveal that the choice of different metal ions has little influence on the DNA binding, DNA cleavage and antimicrobial assay.

The pure estrogen receptor antagonist ICI 182,780 promotes a novel interaction of estrogen receptor-alpha with the 3',5'-cyclic adenosine monophosphate response element-binding protein-binding protein/p300 coactivators.

PubMed

Jaber, Basem M; Gao, Tong; Huang, Luping; Karmakar, Sudipan; Smith, Carolyn L

2006-11-01

Estrogen receptor-alpha (ERalpha) is a member of the nuclear receptor superfamily of ligand-activated transcription factors. Abundant evidence demonstrates that ERalpha agonists promote, whereas antagonists inhibit, receptor binding to coactivators. In this report we demonstrate that binding of the ICI 182,780 (ICI) pure antiestrogen to ERalpha promotes its interaction with the cAMP response element-binding protein-binding protein (CBP)/p300 but not the p160 family of coactivators, demonstrating the specificity of this interaction. Amino acid mutations within the coactivator binding surface of the ERalpha ligand-binding domain revealed that CBP binds to this region of the ICI-liganded receptor. The carboxy-terminal cysteine-histidine rich domain 3 of CBP, rather than its amino-terminal nuclear interacting domain, shown previously to mediate agonist-dependent interactions of CBP with nuclear receptors, is required for binding to ICI-liganded ERalpha. Chromatin immunoprecipitation assays revealed that ICI but not the partial agonist/antagonist 4-hydroxytamoxifen is able to recruit CBP to the pS2 promoter, and this distinguishes ICI from this class of antiestrogens. Chromatin immunoprecipitation assays for pS2 and cytochrome P450 1B1 promoter regions revealed that ICI-dependent recruitment of CBP, but not receptor, to ERalpha targets is gene specific. ICI treatment did not recruit the steroid receptor coactivator 1 to the pS2 promoter, and it failed to induce the expression of this gene. Taken together, these data indicate that recruitment of the CBP coactivator/cointegrator without steroid receptor coactivator 1 to ERalpha is insufficient to promote transcription of ERalpha target genes.

Novel Functional Properties of Drosophila CNS Glutamate Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yan; Dharkar, Poorva; Han, Tae-Hee

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation bymore » its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation.« less

Novel Functional Properties of Drosophila CNS Glutamate Receptors.

PubMed

Li, Yan; Dharkar, Poorva; Han, Tae-Hee; Serpe, Mihaela; Lee, Chi-Hon; Mayer, Mark L

2016-12-07

Phylogenetic analysis reveals AMPA, kainate, and NMDA receptor families in insect genomes, suggesting conserved functional properties corresponding to their vertebrate counterparts. However, heterologous expression of the Drosophila kainate receptor DKaiR1D and the AMPA receptor DGluR1A revealed novel ligand selectivity at odds with the classification used for vertebrate glutamate receptor ion channels (iGluRs). DKaiR1D forms a rapidly activating and desensitizing receptor that is inhibited by both NMDA and the NMDA receptor antagonist AP5; crystallization of the KaiR1D ligand-binding domain reveals that these ligands stabilize open cleft conformations, explaining their action as antagonists. Surprisingly, the AMPA receptor DGluR1A shows weak activation by its namesake agonist AMPA and also by quisqualate. Crystallization of the DGluR1A ligand-binding domain reveals amino acid exchanges that interfere with binding of these ligands. The unexpected ligand-binding profiles of insect iGluRs allows classical tools to be used in novel approaches for the study of synaptic regulation. VIDEO ABSTRACT. Published by Elsevier Inc.

Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

2008-06-06

Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins.

PubMed

Park, Mi-Jeong; Sheng, Ren; Silkov, Antonina; Jung, Da-Jung; Wang, Zhi-Gang; Xin, Yao; Kim, Hyunjin; Thiagarajan-Rosenkranz, Pallavi; Song, Seohyeon; Yoon, Youngdae; Nam, Wonhee; Kim, Ilshin; Kim, Eui; Lee, Dong-Gyu; Chen, Yong; Singaram, Indira; Wang, Li; Jang, Myoung Ho; Hwang, Cheol-Sang; Honig, Barry; Ryu, Sungho; Lorieau, Justin; Kim, You-Me; Cho, Wonhwa

2016-04-07

The Src-homology 2 (SH2) domain is a protein interaction domain that directs myriad phosphotyrosine (pY)-signaling pathways. Genome-wide screening of human SH2 domains reveals that ∼90% of SH2 domains bind plasma membrane lipids and many have high phosphoinositide specificity. They bind lipids using surface cationic patches separate from pY-binding pockets, thus binding lipids and the pY motif independently. The patches form grooves for specific lipid headgroup recognition or flat surfaces for non-specific membrane binding and both types of interaction are important for cellular function and regulation of SH2 domain-containing proteins. Cellular studies with ZAP70 showed that multiple lipids bind its C-terminal SH2 domain in a spatiotemporally specific manner and thereby exert exquisite spatiotemporal control over its protein binding and signaling activities in T cells. Collectively, this study reveals how lipids control SH2 domain-mediated cellular protein-protein interaction networks and suggest a new strategy for therapeutic modulation of pY-signaling pathways. Copyright © 2016 Elsevier Inc. All rights reserved.

Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

NASA Astrophysics Data System (ADS)

Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

2010-01-01

The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

Regulator of differentiation 1 (ROD1) binds to the amphipathic C-terminal peptide of thrombospondin-4 and is involved in its mitogenic activity.

PubMed

Sadvakassova, Gulzhakhan; Dobocan, Monica C; Difalco, Marcos R; Congote, Luis F

2009-09-01

The matrix protein thrombospondin-4 has an acidic amphipathic C-terminal peptide (C21) which stimulates erythroid cell proliferation. Here we show that C21 stimulates red cell formation in anemic mice in vivo. In vitro experiments indicated that the peptide-mediated increase of erythroid colony formation in cultures of human CD34+ hematopoietic progenitor cells was possible only under continuous presence of erythropoietin. In the absence of this cytokine, C21 stimulated exclusively myeloid colony formation. Therefore, the peptide is not a specific erythroid differentiation factor. In fact, it is mitogenic in non-erythroid cells, such as skin fibroblasts and kidney epithelial cells. In erythroleukemic TF-1 cells, it actually decreased the production of the erythroid differentiation marker glycophorin A. C21-affinity chromatography revealed regulator of differentiation 1 (ROD1) as a major C21-binding protein. ROD1 is the hematopoietic cell paralog of polypyrimidine tract binding proteins (PTBs), RNA splice regulators which regulate differentiation by repressing tissue-specific exons. ROD1 binding to C21 was strongly inhibited by synthetic RNAs in the order poly A > poly U > poly G = poly C and was weakly inhibited by a synthetic phosphorylated peptide mimicking the C-terminal domain of RNA polymerase II. Cellular overexpression or knockdown experiments of ROD1 suggest a role for this protein in the mitogenic activity of C21. Since the nuclear proteins ROD1 and PTBs regulate differentiation at a posttranscriptional level and there is a fast nuclear uptake of C21, we put forward the idea that the peptide is internalized, goes to the nucleus and maintains cells in a proliferative state by supporting ROD1-mediated inhibition of differentiation.

Imaging label-free biosensor with microfluidic system

NASA Astrophysics Data System (ADS)

Jahns, S.; Glorius, P.; Hansen, M.; Nazirizadeh, Y.; Gerken, M.

2015-06-01

We present a microfluidic system suitable for parallel label-free detection of several biomarkers utilizing a compact imaging measurement system. The microfluidic system contains a filter unit to separate the plasma from human blood and a functionalized, photonic crystal slab sensor chip. The nanostructure of the photonic crystal slab sensor chip is fabricated by nanoimprint lithography of a period grating surface into a photoresist and subsequent deposition of a TiO2 layer. Photonic crystal slabs are slab waveguides supporting quasi-guided modes coupling to far-field radiation, which are sensitive to refractive index changes due to biomarker binding on the functionalized surface. In our imaging read-out system the resulting resonance shift of the quasi-guided mode in the transmission spectrum is converted into an intensity change detectable with a simple camera. By continuously taking photographs of the sensor surface local intensity changes are observed revealing the binding kinetics of the biomarker to its specific target. Data from two distinct measurement fields are used for evaluation. For testing the sensor chip, 1 μM biotin as well as 1 μM recombinant human CD40 ligand were immobilized in spotsvia amin coupling to the sensor surface. Each binding experiment was performed with 250 nM streptavidin and 90 nM CD40 ligand antibody dissolved in phosphate buffered saline. In the next test series, a functionalized sensor chip was bonded onto a 15 mm x 15 mm opening of the 75 mm x 25 mm x 2 mm microfluidic system. We demonstrate the functionality of the microfluidic system for filtering human blood such that only blood plasma was transported to the sensor chip. The results of first binding experiments in buffer with this test chip will be presented.

T cell specific adaptor protein (TSAd) promotes interaction of Nck with Lck and SLP-76 in T cells.

PubMed

Hem, Cecilie Dahl; Sundvold-Gjerstad, Vibeke; Granum, Stine; Koll, Lise; Abrahamsen, Greger; Buday, Laszlo; Spurkland, Anne

2015-07-11

The Lck and Src binding adaptor protein TSAd (T cell specific adaptor) regulates actin polymerization in T cells and endothelial cells. The molecular details as to how TSAd regulates this process remain to be elucidated. To identify novel interaction partners for TSAd, we used a scoring matrix-assisted ligand algorithm (SMALI), and found that the Src homology 2 (SH2) domain of the actin regulator Non-catalytic region of tyrosine kinase adaptor protein (Nck) potentially binds to TSAd phosphorylated on Tyr(280) (pTyr(280)) and pTyr(305). These predictions were confirmed by peptide array analysis, showing direct binding of recombinant Nck SH2 to both pTyr(280) and pTyr(305) on TSAd. In addition, the SH3 domains of Nck interacted with the proline rich region (PRR) of TSAd. Pull-down and immunoprecipitation experiments further confirmed the Nck-TSAd interactions through Nck SH2 and SH3 domains. In line with this Nck and TSAd co-localized in Jurkat cells as assessed by confocal microscopy and imaging flow cytometry. Co-immunoprecipitation experiments in Jurkat TAg cells lacking TSAd revealed that TSAd promotes interaction of Nck with Lck and SLP-76, but not Vav1. TSAd expressing Jurkat cells contained more polymerized actin, an effect dependent on TSAd exon 7, which includes interactions sites for both Nck and Lck. TSAd binds to and co-localizes with Nck. Expression of TSAd increases both Nck-Lck and Nck-SLP-76 interaction in T cells. Recruitment of Lck and SLP-76 to Nck by TSAd could be one mechanism by which TSAd promotes actin polymerization in activated T cells.

Interaction between S100P and the anti-allergy drug cromolyn

DOE Office of Scientific and Technical Information (OSTI.GOV)

Penumutchu, Srinivasa R.; Chou, Ruey-Hwang; Department of Biotechnology, Asia University, Taichung 413, Taiwan

2014-11-21

Highlights: • The interaction between S100P–cromolyn was investigated by fluorescence spectroscopy. • The interfacial residues on S100P and cromolyn contact surface were mapped by {sup 1}H-{sup 15}N HSQC experiments. • S100P–cromolyn complex model was generated from NMR restraints using HADDOCK program. • The stability of the S100P–cromolyn complex was studied using molecular dynamics simulations. - Abstract: The S100P protein has been known to mediate cell proliferation by binding the receptor for advanced glycation end products (RAGE) to activate signaling pathways, such as the extracellular regulated kinase (ERK) and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathways. S100P/RAGE signaling ismore » involved in a variety of diseases, such as cancer, metastasis, and diabetes. Cromolyn is an anti-allergy drug that binds S100P to block the interaction between S100P and RAGE. In the present study, we characterized the properties of the binding between cromolyn and calcium-bound S100P using various biophysical techniques. The binding affinity for S100P and cromolyn was measured to be in the millimolar range by fluorescence spectroscopy. NMR-HSQC titration experiments and HADDOCK modeling was employed to determine the spatial structure of the proposed heterotetramer model of the S100P–cromolyn complex. Additional MD simulation results revealed the important properties in the complex stability and conformational flexibility of the S100P–cromolyn complex. This proposed model has provided an understanding of the molecular level interactions of S100P–cromolyn complex.« less

Interaction mechanisms between organic UV filters and bovine serum albumin as determined by comprehensive spectroscopy exploration and molecular docking.

PubMed

Ao, Junjie; Gao, Li; Yuan, Tao; Jiang, Gaofeng

2015-01-01

Organic UV filters are a group of emerging PPCP (pharmaceuticals and personal care products) contaminants. Current information is insufficient to understand the in vivo processes and health risks of organic UV filters in humans. The interaction mechanism of UV filters with serum albumin provides critical information for the health risk assessment of these active ingredients in sunscreen products. This study investigates the interaction mechanisms of five commonly used UV filters (2-hydroxy-4-methoxybenzophenone, BP-3; 2-ethylhexyl 4-methoxycinnamate, EHMC; 4-methylbenzylidene camphor, 4-MBC; methoxydibenzoylmethane, BDM; homosalate, HMS) with bovine serum albumin (BSA) by spectroscopic measurements of fluorescence, circular dichroism (CD), competitive binding experiments and molecular docking. Our results indicated that the fluorescence of BSA was quenched by these UV filters through a static quenching mechanism. The values of the binding constant (Ka) ranged from (0.78±0.02)×10(3) to (1.29±0.01)×10(5) L mol(-1). Further exploration by synchronous fluorescence and CD showed that the conformation of BSA was demonstrably changed in the presence of these organic UV filters. It was confirmed that the UV filters can disrupt the α-helical stability of BSA. Moreover, the results of molecular docking revealed that the UV filter molecule is located in site II (sub-domain IIIA) of BSA, which was further confirmed by the results of competitive binding experiments. In addition, binding occurred mainly through hydrogen bonding and hydrophobic interaction. This study raises critical concerns regarding the transportation, distribution and toxicity effects of organic UV filters in human body. Copyright © 2014 Elsevier Ltd. All rights reserved.

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin.

PubMed

Donohue, Elizabeth; Balgi, Aruna D; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy.

Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin

PubMed Central

Donohue, Elizabeth; Balgi, Aruna D.; Komatsu, Masaaki; Roberge, Michel

2014-01-01

Autophagy is a cellular catabolic process responsible for the degradation of cytoplasmic constituents, including organelles and long-lived proteins, that helps maintain cellular homeostasis and protect against various cellular stresses. Verteporfin is a benzoporphyrin derivative used clinically in photodynamic therapy to treat macular degeneration. Verteporfin was recently found to inhibit autophagosome formation by an unknown mechanism that does not require exposure to light. We report that verteporfin directly targets and modifies p62, a scaffold and adaptor protein that binds both polyubiquitinated proteins destined for degradation and LC3 on autophagosomal membranes. Western blotting experiments revealed that exposure of cells or purified p62 to verteporfin causes the formation of covalently crosslinked p62 oligomers by a mechanism involving low-level singlet oxygen production. Rose bengal, a singlet oxygen producer structurally unrelated to verteporfin, also produced crosslinked p62 oligomers and inhibited autophagosome formation. Co-immunoprecipitation experiments demonstrated that crosslinked p62 oligomers retain their ability to bind to LC3 but show defective binding to polyubiquitinated proteins. Mutations in the p62 PB1 domain that abolish self-oligomerization also abolished crosslinked oligomer formation. Interestingly, small amounts of crosslinked p62 oligomers were detected in untreated cells, and other groups noted the accumulation of p62 forms with reduced SDS-PAGE mobility in cellular and animal models of oxidative stress and aging. These data indicate that p62 is particularly susceptible to oxidative crosslinking and lead us to propose a model whereby oxidized crosslinked p62 oligomers generated rapidly by drugs like verteporfin or over time during the aging process interfere with autophagy. PMID:25494214

Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ

PubMed Central

Saeloh, Dennapa; Wenzel, Michaela; Rungrotmongkol, Thanyada; Hamoen, Leendert Willem

2017-01-01

Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico), in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S)- and (R)-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states). Calculations of free binding energy showed a higher affinity of FtsZ to (S)-rhodomyrtone (−35.92 ± 0.36 kcal mol−1) than the GDP substrate (−23.47 ± 0.25 kcal mol−1) while less affinity was observed in the case of (R)-rhodomyrtone (−18.11 ± 0.11 kcal mol−1). In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance. PMID:28168121

Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ.

PubMed

Saeloh, Dennapa; Wenzel, Michaela; Rungrotmongkol, Thanyada; Hamoen, Leendert Willem; Tipmanee, Varomyalin; Voravuthikunchai, Supayang Piyawan

2017-01-01

Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach ( in silico ), in vitro , and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S)- and (R)-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states). Calculations of free binding energy showed a higher affinity of FtsZ to (S)-rhodomyrtone (-35.92 ± 0.36 kcal mol -1 ) than the GDP substrate (-23.47 ± 0.25 kcal mol -1 ) while less affinity was observed in the case of (R)-rhodomyrtone (-18.11 ± 0.11 kcal mol -1 ). In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.

Kinetic Measurements Reveal Enhanced Protein-Protein Interactions at Intercellular Junctions

PubMed Central

Shashikanth, Nitesh; Kisting, Meridith A.; Leckband, Deborah E.

2016-01-01

The binding properties of adhesion proteins are typically quantified from measurements with soluble fragments, under conditions that differ radically from the confined microenvironment of membrane bound proteins in adhesion zones. Using classical cadherin as a model adhesion protein, we tested the postulate that confinement within quasi two-dimensional intercellular gaps exposes weak protein interactions that are not detected in solution binding assays. Micropipette-based measurements of cadherin-mediated, cell-cell binding kinetics identified a unique kinetic signature that reflects both adhesive (trans) bonds between cadherins on opposing cells and lateral (cis) interactions between cadherins on the same cell. In solution, proposed lateral interactions were not detected, even at high cadherin concentrations. Mutations postulated to disrupt lateral cadherin association altered the kinetic signatures, but did not affect the adhesive (trans) binding affinity. Perturbed kinetics further coincided with altered cadherin distributions at junctions, wound healing dynamics, and paracellular permeability. Intercellular binding kinetics thus revealed cadherin interactions that occur within confined, intermembrane gaps but not in solution. Findings further demonstrate the impact of these revealed interactions on the organization and function of intercellular junctions. PMID:27009566

Computational Investigation of the Interplay of Substrate Positioning and Reactivity in Catechol O-Methyltransferase

PubMed Central

Patra, Niladri; Ioannidis, Efthymios I.

2016-01-01

Catechol O-methyltransferase (COMT) is a SAM- and Mg2+-dependent methyltransferase that regulates neurotransmitters through methylation. Simulations and experiments have identified divergent catecholamine substrate orientations in the COMT active site: molecular dynamics simulations have favored a monodentate coordination of catecholate substrates to the active site Mg2+, and crystal structures instead preserve bidentate coordination along with short (2.65 Å) methyl donor-acceptor distances. We carry out longer dynamics (up to 350 ns) to quantify interconversion between bidentate and monodentate binding poses. We provide a systematic determination of the relative free energy of the monodentate and bidentate structures in order to identify whether structural differences alter the nature of the methyl transfer mechanism and source of enzymatic rate enhancement. We demonstrate that the bidentate and monodentate binding modes are close in energy but separated by a 7 kcal/mol free energy barrier. Analysis of interactions in the two binding modes reveals that the driving force for monodentate catecholate orientations in classical molecular dynamics simulations is derived from stronger electrostatic stabilization afforded by alternate Mg2+ coordination with strongly charged active site carboxylates. Mixed semi-empirical-classical (SQM/MM) substrate C-O distances (2.7 Å) for the bidentate case are in excellent agreement with COMT X-ray crystal structures, as long as charge transfer between the substrates, Mg2+, and surrounding ligands is permitted. SQM/MM free energy barriers for methyl transfer from bidentate and monodentate catecholate configurations are comparable at around 21–22 kcal/mol, in good agreement with experiment (18–19 kcal/mol). Overall, the work suggests that both binding poses are viable for methyl transfer, and accurate descriptions of charge transfer and electrostatics are needed to provide balanced relative barriers when multiple binding poses are accessible, for example in other transferases. PMID:27564542

Metal cofactor modulated folding and target recognition of HIV-1 NCp7.

PubMed

Ren, Weitong; Ji, Dongqing; Xu, Xiulian

2018-01-01

The HIV-1 nucleocapsid 7 (NCp7) plays crucial roles in multiple stages of HIV-1 life cycle, and its biological functions rely on the binding of zinc ions. Understanding the molecular mechanism of how the zinc ions modulate the conformational dynamics and functions of the NCp7 is essential for the drug development and HIV-1 treatment. In this work, using a structure-based coarse-grained model, we studied the effects of zinc cofactors on the folding and target RNA(SL3) recognition of the NCp7 by molecular dynamics simulations. After reproducing some key properties of the zinc binding and folding of the NCp7 observed in previous experiments, our simulations revealed several interesting features in the metal ion modulated folding and target recognition. Firstly, we showed that the zinc binding makes the folding transition states of the two zinc fingers less structured, which is in line with the Hammond effect observed typically in mutation, temperature or denaturant induced perturbations to protein structure and stability. Secondly, We showed that there exists mutual interplay between the zinc ion binding and NCp7-target recognition. Binding of zinc ions enhances the affinity between the NCp7 and the target RNA, whereas the formation of the NCp7-RNA complex reshapes the intrinsic energy landscape of the NCp7 and increases the stability and zinc affinity of the two zinc fingers. Thirdly, by characterizing the effects of salt concentrations on the target RNA recognition, we showed that the NCp7 achieves optimal balance between the affinity and binding kinetics near the physiologically relevant salt concentrations. In addition, the effects of zinc binding on the inter-domain conformational flexibility and folding cooperativity of the NCp7 were also discussed.

Structural features of interfacial tyrosine residue in ROBO1 fibronectin domain-antibody complex: Crystallographic, thermodynamic, and molecular dynamic analyses

PubMed Central

Nakayama, Taisuke; Mizohata, Eiichi; Yamashita, Takefumi; Nagatoishi, Satoru; Nakakido, Makoto; Iwanari, Hiroko; Mochizuki, Yasuhiro; Kado, Yuji; Yokota, Yuki; Satoh, Reiko; Tsumoto, Kouhei; Fujitani, Hideaki; Kodama, Tatsuhiko; Hamakubo, Takao; Inoue, Tsuyoshi

2015-01-01

ROBO1, fibronectin Type-III domain (Fn)-containing protein, is a novel immunotherapeutic target for hepatocellular carcinoma in humans. The crystal structure of the antigen-binding fragment (Fab) of B2212A, the monoclonal antibody against the third Fn domain (Fn3) of ROBO1, was determined in pursuit of antibody drug for hepatocellular carcinoma. This effort was conducted in the presence or absence of the antigen, with the chemical features being investigated by determining the affinity of the antibody using molecular dynamics (MD) and thermodynamics. The structural comparison of B2212A Fab between the complex and the free form revealed that the interfacial TyrL50 (superscripts L, H, and F stand for the residues in the light chain, heavy chain, and Fn3, respectively) played important roles in Fn3 recognition. That is, the aromatic ring of TyrL50 pivoted toward PheF68, forming a CH/π interaction and a new hydrogen bond with the carbonyl O atom of PheF68. MD simulations predicted that the TyrL50-PheF68 interaction almost entirely dominated Fab-Fn3 binding, and Ala-substitution of TyrL50 led to a reduced binding of the resultant complex. On the contrary, isothermal titration calorimetry experiments underscored that Ala-substitution of TyrL50 caused an increase of the binding enthalpy between B2212A and Fn3, but importantly, it induced an increase of the binding entropy, resulting in a suppression of loss in the Gibbs free energy in total. These results suggest that mutation analysis considering the binding entropy as well as the binding enthalpy will aid in the development of novel antibody drugs for hepatocellular carcinoma. PMID:25492858

‘Partial’ competition of heterobivalent ligand binding may be mistaken for allosteric interactions: a comparison of different target interaction models

PubMed Central

Vauquelin, Georges; Hall, David; Charlton, Steven J

2015-01-01

Background and Purpose Non-competitive drugs that confer allosteric modulation of orthosteric ligand binding are of increasing interest as therapeutic agents. Sought-after advantages include a ceiling level to drug effect and greater receptor-subtype selectivity. It is thus important to determine the mode of interaction of newly identified receptor ligands early in the drug discovery process and binding studies with labelled orthosteric ligands constitute a traditional approach for this. According to the general allosteric ternary complex model, allosteric ligands that exhibit negative cooperativity may generate distinctive ‘competition’ curves: they will not reach baseline levels and their nadir will increase in par with the orthosteric ligand concentration. This behaviour is often considered a key hallmark of allosteric interactions. Experimental Approach The present study is based on differential equation-based simulations. Key Results The differential equation-based simulations revealed that the same ‘competition binding’ pattern was also obtained when a monovalent ligand binds to one of the target sites of a heterobivalent ligand, even if this process is exempt of allosteric interactions. This pattern was not strictly reciprocal when the binding of each of the ligands was recorded. The prominence of this phenomenon may vary from one heterobivalent ligand to another and we suggest that this phenomenon may take place with ligands that have been proposed to bind according to ‘two-domain’ and ‘charnière’ models. Conclusions and Implications The present findings indicate a familiar experimental situation where bivalency may give rise to observations that could inadvertently be interpreted as allosteric binding. Yet, both mechanisms could be differentiated based on alternative experiments and structural considerations. PMID:25537684

Complex Structure and Biochemical Characterization of the Staphylococcus aureus Cyclic Diadenylate Monophosphate (c-di-AMP)-binding Protein PstA, the Founding Member of a New Signal Transduction Protein Family*

PubMed Central

Campeotto, Ivan; Zhang, Yong; Mladenov, Miroslav G.; Freemont, Paul S.; Gründling, Angelika

2015-01-01

Signaling nucleotides are integral parts of signal transduction systems allowing bacteria to cope with and rapidly respond to changes in the environment. The Staphylococcus aureus PII-like signal transduction protein PstA was recently identified as a cyclic diadenylate monophosphate (c-di-AMP)-binding protein. Here, we present the crystal structures of the apo- and c-di-AMP-bound PstA protein, which is trimeric in solution as well as in the crystals. The structures combined with detailed bioinformatics analysis revealed that the protein belongs to a new family of proteins with a similar core fold but with distinct features to classical PII proteins, which usually function in nitrogen metabolism pathways in bacteria. The complex structure revealed three identical c-di-AMP-binding sites per trimer with each binding site at a monomer-monomer interface. Although distinctly different from other cyclic-di-nucleotide-binding sites, as the half-binding sites are not symmetrical, the complex structure also highlighted common features for c-di-AMP-binding sites. A comparison between the apo and complex structures revealed a series of conformational changes that result in the ordering of two anti-parallel β-strands that protrude from each monomer and allowed us to propose a mechanism on how the PstA protein functions as a signaling transduction protein. PMID:25505271

Prediction of the binding mode of N2-phenylguanine derivative inhibitors to herpes simplex virus type 1 thymidine kinase

NASA Astrophysics Data System (ADS)

Gaudio, Anderson Coser; Takahata, Yuji; Richards, William Graham

1998-01-01

The probable binding mode of the herpes simplex virus thymidine kinase (HSV1 TK) N2-[substituted]-phenylguanine inhibitors is proposed. A computational experiment was designed to check some qualitative binding parameters and to calculate the interaction binding energies of alternative binding modes of N2-phenylguanines. The known binding modes of the HSV1 TK natural substrate deoxythymidine and one of its competitive inhibitors ganciclovir were used as templates. Both the qualitative and quantitative parts of the computational experiment indicated that the N2-phenylguanine derivatives bind to the HSV1 TK active site in the deoxythymidine-like binding mode. An experimental observation that N2-phenylguanosine derivatives are not phosphorylated during the interaction with the HSV1 TK gives support to the proposed binding mode.

Feature-binding errors after eye movements and shifts of attention.

PubMed

Golomb, Julie D; L'heureux, Zara E; Kanwisher, Nancy

2014-05-01

When people move their eyes, the eye-centered (retinotopic) locations of objects must be updated to maintain world-centered (spatiotopic) stability. Here, we demonstrated that the attentional-updating process temporarily distorts the fundamental ability to bind object locations with their features. Subjects were simultaneously presented with four colors after a saccade-one in a precued spatiotopic target location-and were instructed to report the target's color using a color wheel. Subjects' reports were systematically shifted in color space toward the color of the distractor in the retinotopic location of the cue. Probabilistic modeling exposed both crude swapping errors and subtler feature mixing (as if the retinotopic color had blended into the spatiotopic percept). Additional experiments conducted without saccades revealed that the two types of errors stemmed from different attentional mechanisms (attention shifting vs. splitting). Feature mixing not only reflects a new perceptual phenomenon, but also provides novel insight into how attention is remapped across saccades.

Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

NASA Astrophysics Data System (ADS)

Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

2015-02-01

The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

The discovery of [Ni(NHC)RCN]2 species and their role as cycloaddition catalysts for the formation of pyridines.

PubMed

Stolley, Ryan M; Duong, Hung A; Thomas, David R; Louie, Janis

2012-09-12

The reaction of Ni(COD)(2), IPr, and nitrile affords dimeric [Ni(IPr)RCN](2) in high yields. X-ray analysis revealed these species display simultaneous η(1)- and η(2)-nitrile binding modes. These dimers are catalytically competent in the formation of pyridines from the cycloaddition of diynes and nitriles. Kinetic analysis showed the reaction to be first order in [Ni(IPr)RCN](2), zeroth order in added IPr, zeroth order in nitrile, and zeroth order in diyne. Extensive stoichiometric competition studies were performed, and selective incorporation of the exogenous, not dimer bound, nitrile was observed. Post cycloaddition, the dimeric state was found to be largely preserved. Nitrile and ligand exchange experiments were performed and found to be inoperative in the catalytic cycle. These observations suggest a mechanism whereby the catalyst is activated by partial dimer-opening followed by binding of exogenous nitrile and subsequent oxidative heterocoupling.

Exploring the mechanism of interaction between 5-(ethoxycarbonyl)-6-methyl-4-(4-methoxyphenyl)-3,4-dihydropyrimidin-2(1H)-one and human serum albumin: Spectroscopic, calorimetric and molecular modeling studies.

PubMed

Wang, Gongke; Li, Xiang; Ding, Xuelian; Wang, Dongchao; Yan, Changling; Lu, Yan

2011-07-15

In this paper, binding interaction of 5-(ethoxycarbonyl)-6-methyl-4-(4-methoxyphenyl)-3,4-dihydropyrimidin-2(1H)-one (EMMD) with human serum albumin (HSA) under physiological conditions was investigated by using spectroscopy, isothermal titration calorimetry (ITC) and molecular modeling techniques. The results of spectroscopic studies suggested that EMMD have a strong ability to quench the intrinsic fluorescence of HSA through static quenching procedure. ITC investigations indicated that drug-protein complex was stabilized by hydrophobic forces and hydrogen bonds, which was consistent with the results of molecular modeling studies. Competitive experiments indicated the displacement of warfarin by EMMD, which revealed that the binding site of EMMD to HSA was located at subdomain IIA. Copyright © 2011 Elsevier B.V. All rights reserved.

Role of protons in the pump cycle of KdpFABC investigated by time-resolved kinetic experiments.

PubMed

Damnjanovic, Bojana; Apell, Hans-Jürgen

2014-05-20

The time-resolved kinetics of the KdpFABC complex solubilized in Aminoxide WS-35 was investigated by ATP concentration jump experiments. ATP was photoreleased from its inactive precursor, caged ATP, and charge movements in the membrane domain of the KdpFABC were detected by the electrochromic dye RH421. At low ATP concentrations, the ATP binding step became rate-limiting with an apparent, pH-independent ATP binding affinity of ~70 μM. At saturating ATP concentrations, the rate-limiting step is the conformational transition (E1-P → P-E2) with a rate constant of ~1.7 s(-1) at 20 °C that was independent of K(+) concentration. This observation together with the detected fluorescence decrease indicates that K(+) (or another positive ion) is bound in the membrane domain after enzyme phosphorylation and the conformational transition to the P-E2 state. pH dependence experiments revealed different roles of H(+) in the transport mechanism. Two different functions of protons for the ion pump must be distinguished. On one hand, there are electrogenically bound "functional" protons, which are not transported but prerequisite for the performance of the ATP-driven half-cycle. On the other hand, protons bind to the transport sites, acting as weak congeners of K(+). There possibly are noncompetitively bound protons, affecting the enzyme activity and/or coupling between KdpA and KdpB subunits. Finally, the recently proposed Post-Albers model for the KdpFABC complex was supplemented with stoichiometry factors of 2 for K(+) and 3 for H(+), and additional inhibitory side reactions controlled by H(+) were introduced, which are relevant at pH <6.5 and/or in the absence of K(+).

RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain and is required for ubiquitination.

PubMed

Choudhury, Nila Roy; Heikel, Gregory; Trubitsyna, Maryia; Kubik, Peter; Nowak, Jakub Stanislaw; Webb, Shaun; Granneman, Sander; Spanos, Christos; Rappsilber, Juri; Castello, Alfredo; Michlewski, Gracjan

2017-11-08

TRIM25 is a novel RNA-binding protein and a member of the Tripartite Motif (TRIM) family of E3 ubiquitin ligases, which plays a pivotal role in the innate immune response. However, there is scarce knowledge about its RNA-related roles in cell biology. Furthermore, its RNA-binding domain has not been characterized. Here, we reveal that the RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain, which we postulate to be a novel RNA-binding domain. Using CLIP-seq and SILAC-based co-immunoprecipitation assays, we uncover TRIM25's endogenous RNA targets and protein binding partners. We demonstrate that TRIM25 controls the levels of Zinc Finger Antiviral Protein (ZAP). Finally, we show that the RNA-binding activity of TRIM25 is important for its ubiquitin ligase activity towards itself (autoubiquitination) and its physiologically relevant target ZAP. Our results suggest that many other proteins with the PRY/SPRY domain could have yet uncharacterized RNA-binding potential. Together, our data reveal new insights into the molecular roles and characteristics of RNA-binding E3 ubiquitin ligases and demonstrate that RNA could be an essential factor in their enzymatic activity.

Electrogenic Binding of Intracellular Cations Defines a Kinetic Decision Point in the Transport Cycle of the Human Serotonin Transporter.

PubMed

Hasenhuetl, Peter S; Freissmuth, Michael; Sandtner, Walter

2016-12-09

The plasmalemmal monoamine transporters clear the extracellular space from their cognate substrates and sustain cellular monoamine stores even during neuronal activity. In some instances, however, the transporters enter a substrate-exchange mode, which results in release of intracellular substrate. Understanding what determines the switch between these two transport modes demands time-resolved measurements of intracellular (co-)substrate binding and release. Here, we report an electrophysiological investigation of intracellular solute-binding to the human serotonin transporter (SERT) expressed in HEK-293 cells. We measured currents induced by rapid application of serotonin employing varying intracellular (co-)substrate concentrations and interpreted the data using kinetic modeling. Our measurements revealed that the induction of the substrate-exchange mode depends on both voltage and intracellular Na + concentrations because intracellular Na + release occurs before serotonin release and is highly electrogenic. This voltage dependence was blunted by electrogenic binding of intracellular K + and, notably, also H + In addition, our data suggest that Cl - is bound to SERT during the entire catalytic cycle. Our experiments, therefore, document an essential role of electrogenic binding of K + or of H + to the inward-facing conformation of SERT in (i) cancelling out the electrogenic nature of intracellular Na + release and (ii) in selecting the forward-transport over the substrate-exchange mode. Finally, the kinetics of intracellular Na + release and K + (or H + ) binding result in a voltage-independent rate-limiting step where SERT may return to the outward-facing state in a KCl- or HCl-bound form. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Binding interaction of ramipril with bovine serum albumin (BSA): Insights from multi-spectroscopy and molecular docking methods.

PubMed

Shi, Jie-Hua; Pan, Dong-Qi; Jiang, Min; Liu, Ting-Ting; Wang, Qi

2016-11-01

The binding interaction between a typical angiotensin-converting enzyme inhibitor (ACEI), ramipril, and a transport protein, bovine serum albumin (BSA), was studied in vitro using UV-vis absorption spectroscopy, steady-state fluorescence spectroscopic titration, synchronous fluorescence spectroscopy, three dimensional fluorescence spectroscopy, circular dichroism and molecular docking under the imitated physiological conditions (pH=7.4). The experimental results suggested that the intrinsic fluorescence of BSA was quenched by ramipril thought a static quenching mechanism, indicating that the stable ramipril-BSA complex was formed by the intermolecular interaction. The number of binding sites (n) and binding constant of ramipril-BSA complex were about 1 and 3.50×10 4 M -1 at 298K, respectively, suggesting that there was stronger binding interaction of ramipril with BSA. The thermodynamic parameters together with molecular docking study revealed that both van der Waal's forces and hydrogen bonding interaction dominated the formation of the ramipril-BSA complex and the binding interaction of BSA with ramipril is enthalpy-driven processes due to |ΔH°|>|TΔS°| and ΔG°<0. The spatial distance between ramipril and BSA was calculated to be 3.56nm based on Förster's non-radiative energy transfer theory. The results of the competitive displacement experiments and molecular docking confirmed that ramipril inserted into the subdomain IIA (site I) of BSA, resulting in a slight change in the conformation of BSA but BSA still retained its secondary structure α-helicity. Copyright © 2016 Elsevier B.V. All rights reserved.

Binding of cationic pentapeptides with modified side chain lengths to negatively charged lipid membranes: Complex interplay of electrostatic and hydrophobic interactions.

PubMed

Hoernke, Maria; Schwieger, Christian; Kerth, Andreas; Blume, Alfred

2012-07-01

Basic amino acids play a key role in the binding of membrane associated proteins to negatively charged membranes. However, side chains of basic amino acids like lysine do not only provide a positive charge, but also a flexible hydrocarbon spacer that enables hydrophobic interactions. We studied the influence of hydrophobic contributions to the binding by varying the side chain length of pentapeptides with ammonium groups starting with lysine to lysine analogs with shorter side chains, namely omithine (Orn), alpha, gamma-diaminobutyric acid (Dab) and alpha, beta-diaminopropionic acid (Dap). The binding to negatively charged phosphatidylglycerol (PG) membranes was investigated by calorimetry, FT-infrared spectroscopy (FT-IR) and monolayer techniques. The binding was influenced by counteracting and sometimes compensating contributions. The influence of the bound peptides on the lipid phase behavior depends on the length of the peptide side chains. Isothermal titration calorimetry (ITC) experiments showed exothermic and endothermic effects compensating to a different extent as a function of side chain length. The increase in lipid phase transition temperature was more significant for peptides with shorter side chains. FTIR-spectroscopy revealed changes in hydration of the lipid bilayer interface after peptide binding. Using monolayer techniques, the contributions of electrostatic and hydrophobic effects could clearly be observed. Peptides with short side chains induced a pronounced decrease in surface pressure of PG monolayers whereas peptides with additional hydrophobic interactions decreased the surface pressure much less or even lead to an increase, indicating insertion of the hydrophobic part of the side chain into the lipid monolayer.

The design of high affinity human PD-1 mutants by using molecular dynamics simulations (MD).

PubMed

Du, Jiangfeng; Qin, Yaping; Wu, Yahong; Zhao, Wenshan; Zhai, Wenjie; Qi, Yuanming; Wang, Chuchu; Gao, Yanfeng

2018-06-07

Programmed cell death protein 1 (PD-1), a negative co-stimulatory molecule, plays crucial roles in immune escape. Blockade of the interaction between PD-1 and PD-L1 shows exciting clinical responses in a fraction of cancer patients and the success makes PD-1 as a valuable target in immune checkpoint therapy. For the rational design of PD-1 targeting modulators, the ligand binding mechanism of PD-1 should be well understood in prior. In this study, we applied 50 ns molecular dynamics simulations to observe the structural properties of PD-1 molecule in both apo and ligand bound states, and we studied the structural features of PD-1 in human and mouse respectively. The results showed that the apo hPD-1 was more flexible than that in PD-L1 bound state. We unexpectedly found that K135 was important for binding energy although it was not at the binding interface. Moreover, the residues which stabilized the interactions with PD-L1 were distinguished. Taking the dynamic features of these residues into account, we identified several residual sites where mutations may gain the function of ligand binding. The in vitro binding experiments revealed the mutants M70I, S87 W, A129L, A132L, and K135 M were better in ligand binding than the wild type PD-1. The structural information from MD simulation combined with in silico mutagenesis provides guidance to design engineered PD-1 mutants to modulate the PD-1/PD-L1 pathway.

Atomic-level insights into metabolite recognition and specificity of the SAM-II riboswitch.

PubMed

Doshi, Urmi; Kelley, Jennifer M; Hamelberg, Donald

2012-02-01

Although S-adenosylhomocysteine (SAH), a metabolic by-product of S-adenosylmethionine (SAM), differs from SAM only by a single methyl group and an overall positive charge, SAH binds the SAM-II riboswitch with more than 1000-fold less affinity than SAM. Using atomistic molecular dynamics simulations, we investigated the molecular basis of such high selectivity in ligand recognition by SAM-II riboswitch. The biosynthesis of SAM exclusively generates the (S,S) stereoisomer, and (S,S)-SAM can spontaneously convert to the (R,S) form. We, therefore, also examined the effects of (R,S)-SAM binding to SAM-II and its potential biological function. We find that the unfavorable loss in entropy in SAM-II binding is greater for (S,S)- and (R,S)-SAM than SAH, which is compensated by stabilizing electrostatic interactions with the riboswitch. The positively charged sulfonium moiety on SAM acts as the crucial anchor point responsible for the formation of key ionic interactions as it fits favorably in the negatively charged binding pocket. In contrast, SAH, with its lone pair of electrons on the sulfur, experiences repulsion in the binding pocket of SAM-II and is enthalpically destabilized. In the presence of SAH, similar to the unbound riboswitch, the pseudoknot structure of SAM-II is not completely formed, thus exposing the Shine-Dalgarno sequence. Unlike SAM, this may further facilitate ribosomal assembly and translation initiation. Our analysis of the conformational ensemble sampled by SAM-II in the absence of ligands and when bound to SAM or SAH reveals that ligand binding follows a combination of conformational selection and induced-fit mechanisms.

Interaction of ATP with a Small Heat Shock Protein from Mycobacterium leprae: Effect on Its Structure and Function

PubMed Central

Nandi, Sandip Kumar; Chakraborty, Ayon; Panda, Alok Kumar; Sinha Ray, Sougata; Kar, Rajiv Kumar; Bhunia, Anirban; Biswas, Ashis

2015-01-01

Adenosine-5’-triphosphate (ATP) is an important phosphate metabolite abundantly found in Mycobacterium leprae bacilli. This pathogen does not derive ATP from its host but has its own mechanism for the generation of ATP. Interestingly, this molecule as well as several antigenic proteins act as bio-markers for the detection of leprosy. One such bio-marker is the 18 kDa antigen. This 18 kDa antigen is a small heat shock protein (HSP18) whose molecular chaperone function is believed to help in the growth and survival of the pathogen. But, no evidences of interaction of ATP with HSP18 and its effect on the structure and chaperone function of HSP18 are available in the literature. Here, we report for the first time evidences of “HSP18-ATP” interaction and its consequences on the structure and chaperone function of HSP18. TNP-ATP binding experiment and surface plasmon resonance measurement showed that HSP18 interacts with ATP with a sub-micromolar binding affinity. Comparative sequence alignment between M. leprae HSP18 and αB-crystallin identified the sequence 49KADSLDIDIE58 of HSP18 as the Walker-B ATP binding motif. Molecular docking studies revealed that β4-β8 groove/strands as an ATP interactive region in M. leprae HSP18. ATP perturbs the tertiary structure of HSP18 mildly and makes it less susceptible towards tryptic cleavage. ATP triggers exposure of additional hydrophobic patches at the surface of HSP18 and induces more stability against chemical and thermal denaturation. In vitro aggregation and thermal inactivation assays clearly revealed that ATP enhances the chaperone function of HSP18. Our studies also revealed that the alteration in the chaperone function of HSP18 is reversible and is independent of ATP hydrolysis. As the availability and binding of ATP to HSP18 regulates its chaperone function, this functional inflection may play an important role in the survival of M. leprae in hosts. PMID:25811190

Structural Analysis of Semi-specific Oligosaccharide Recognition by a Cellulose-binding Protein of Thermotoga maritima Reveals Adaptations for Functional Diversification of the Oligopeptide Periplasmic Binding Protein Fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuneo, Matthew J.; Beese, Lorena S.; Hellinga, Homme W.

Periplasmic binding proteins (PBPs) constitute a protein superfamily that binds a wide variety of ligands. In prokaryotes, PBPs function as receptors for ATP-binding cassette or tripartite ATP-independent transporters and chemotaxis systems. In many instances, PBPs bind their cognate ligands with exquisite specificity, distinguishing, for example, between sugar epimers or structurally similar anions. By contrast, oligopeptide-binding proteins bind their ligands through interactions with the peptide backbone but do not distinguish between different side chains. The extremophile Thermotoga maritima possesses a remarkable array of carbohydrate-processing metabolic systems, including the hydrolysis of cellulosic polymers. Here, we present the crystal structure of a T.more » maritima cellobiose-binding protein (tm0031) that is homologous to oligopeptide-binding proteins. T. maritima cellobiose-binding protein binds a variety of lengths of {beta}(1 {yields} 4)-linked glucose oligomers, ranging from two rings (cellobiose) to five (cellopentaose). The structure reveals that binding is semi-specific. The disaccharide at the nonreducing end binds specifically; the other rings are located in a large solvent-filled groove, where the reducing end makes several contacts with the protein, thereby imposing an upper limit of the oligosaccharides that are recognized. Semi-specific recognition, in which a molecular class rather than individual species is selected, provides an efficient solution for the uptake of complex mixtures.« less

Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

PubMed

Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

1997-03-01

The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

Insulin-like growth factor (IGF) binding protein from human decidua inhibits the binding and biological action of IGF-I in cultured choriocarcinoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ritvos, O.; Ranta, T.; Jalkanen, J.

1988-05-01

The placenta expresses genes for insulin-like growth factors (IGFs) and possesses IGF-receptors, suggesting that placental growth is regulated by IGFs in an autocrine manner. We have previously shown that human decidua, but not placenta, synthesizes and secretes a 34 K IGF-binding protein (34 K IGF-BP) called placental protein 12. We now used human choriocarcinoma JEG-3 cell monolayer cultures and recombinant (Thr59)IGF-I as a model to study whether the decidual 34 K IGF-BP is able to modulate the receptor binding and biological activity of IGFs in trophoblasts. JEG-3 cells, which possess type I IGF receptors, were unable to produce IGF-BPs. Purifiedmore » 34 K IGF-BP specifically bound (125I)iodo-(Thr59)IGF-I. Multiplication-stimulating activity had 2.5% the potency of (Thr59)IGF-I, and insulin had no effect on the binding of (125I) iodo-(Thr59)IGF-I. 34 K IGF-BP inhibited the binding of (125I) iodo-(Thr59)IGF-I to JEG-3 monolayers in a concentration-dependent manner by forming with the tracer a soluble complex that could not bind to the cell surface as demonstrated by competitive binding and cross-linking experiments. After incubating the cell monolayers with (125I)iodo-(Thr59)IGF-I in the presence of purified binding protein, followed by cross-linking, no affinity labeled bands were seen on autoradiography. In contrast, an intensely labeled band at 40 K was detected when the incubation medium was analyzed, suggesting that (Thr59)IGF-I and 34 K IGF-BP formed a complex in a 1:1 molar ratio. Also, 34 K IGF-BP inhibited both basal and IGF-I-stimulated uptake of alpha-(3H)aminoisobutyric acid in JEG-3 cells. RNA analysis revealed that IGF-II is expressed in JEG-3 cells.« less

Botulinum neurotoxin G binds synaptotagmin-II in a mode similar to that of serotype B: tyrosine 1186 and lysine 1191 cause its lower affinity.

PubMed

Willjes, Gesche; Mahrhold, Stefan; Strotmeier, Jasmin; Eichner, Timo; Rummel, Andreas; Binz, Thomas

2013-06-04

Botulinum neurotoxins (BoNTs) block neurotransmitter release by proteolyzing SNARE proteins in peripheral nerve terminals. Entry into neurons occurs subsequent to interaction with gangliosides and a synaptic vesicle protein. Isoforms I and II of synaptotagmin were shown to act as protein receptors for two of the seven BoNT serotypes, BoNT/B and BoNT/G, and for mosaic-type BoNT/DC. BoNT/B and BoNT/G exhibit a homologous binding site for synaptotagmin whose interacting part adopts helical structure upon binding to BoNT/B. Whereas the BoNT/B-synaptotagmin-II interaction has been elucidated in molecular detail, corresponding information about BoNT/G is lacking. Here we systematically mutated the synaptotagmin binding site in BoNT/G and performed a comparative binding analysis with mutants of the cell binding subunit of BoNT/B. The results suggest that synaptotagmin takes the same overall orientation in BoNT/B and BoNT/G governed by the strictly conserved central parts of the toxins' binding site. The surrounding nonconserved areas differently contribute to receptor binding. Reciprocal mutations Y1186W and L1191Y increased the level of binding of BoNT/G approximately to the level of BoNT/B affinity, suggesting a similar synaptotagmin-bound state. The effects of the mutations were confirmed by studying the activity of correspondingly mutated full-length BoNTs. On the basis of these data, molecular modeling experiments were employed to reveal an atomistic model of BoNT/G-synaptotagmin recognition. These data suggest a reduced length and/or a bend in the C-terminal part of the synaptotagmin helix that forms upon contact with BoNT/G as compared with BoNT/B and are in agreement with the data of the mutational analyses.

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

A combined photophysical and computational study on the binding of mycophenolate mofetil and its major metabolite to transport proteins

NASA Astrophysics Data System (ADS)

Vendrell-Criado, Victoria; González-Bello, Concepción; Miranda, Miguel A.; Jiménez, M. Consuelo

2018-06-01

Binding of the immunosuppressive agent mycophenolate mofetil (MMP) and its pharmacologically active metabolite mycophenolic acid (MPA) to human serum albumin (HSA) and α1-acid glycoprotein (HAAG) has been investigated by means of an integrated approach involving selective excitation of the drug fluorophore, following their UV-A triggered fluorescence and docking studies. The formation of the protein/ligand complexes was evidenced by a dramatic enhancement of the fluorescence intensity and a hypsochromic shift of the emission band. In HSA, competitive studies using oleic acid as site I probe revealed site I as the main binding site of the ligands. Binding constants revealed that the affinity of the active metabolite by HSA is four-fold higher than its proactive form. Moreover, the affinity of MMP by HSA is three-fold higher than by HAAG. Docking studies revealed significant molecular binding differences in the binding of MMP and MPA to sub-domain IIA of HSA (site 1). For MPA, the aromatic moiety would be in close contact to Trp214 with the flexible chain pointing to the other end of the sub-domain; on the contrary, for MMP, the carboxylate group of the chain would be fixed nearby Trp214 through electrostatic interactions with residues Arg218 and Arg222.

Glycine activated ion channel subunits encoded by ctenophore glutamate receptor genes

DOE PAGES

Alberstein, Robert; Grey, Richard; Zimmet, Austin; ...

2015-10-12

Recent genome projects for ctenophores have revealed the presence of numerous ionotropic glutamate receptors (iGluRs) in Mnemiopsis leidyi and Pleurobrachia bachei, among our earliest metazoan ancestors. Sequence alignments and phylogenetic analysis show that these form a distinct clade from the well-characterized AMPA, kainate, and NMDA iGluR subtypes found in vertebrates. Although annotated as glutamate and kainate receptors, crystal structures of the ML032222a and PbiGluR3 ligand-binding domains (LBDs) reveal endogenous glycine in the binding pocket, whereas ligand-binding assays show that glycine binds with nanomolar affinity; biochemical assays and structural analysis establish that glutamate is occluded from the binding cavity. Further analysismore » reveals ctenophore-specific features, such as an interdomain Arg-Glu salt bridge, present only in subunits that bind glycine, but also a conserved disulfide in loop 1 of the LBD that is found in all vertebrate NMDA but not AMPA or kainate receptors. In this paper, we hypothesize that ctenophore iGluRs are related to an early ancestor of NMDA receptors, suggesting a common evolutionary path for ctenophores and bilaterian species, and finally suggest that future work should consider both glycine and glutamate as candidate neurotransmitters in ctenophore species.« less

Detection of Bisphenol A in aqueous medium by screen printed carbon electrodes incorporating electrochemical molecularly imprinted polymers.

PubMed

Ekomo, Vitalys Mba; Branger, Catherine; Bikanga, Raphaël; Florea, Ana-Mihaela; Istamboulie, Georges; Calas-Blanchard, Carole; Noguer, Thierry; Sarbu, Andrei; Brisset, Hugues

2018-07-30

Electrochemical molecularly imprinted polymers (e-MIPs) were for the first time introduced in screen-printed carbon electrodes (SPCE) as the sensing element for the detection of an organic pollutant. To play this sensing role, a redox tracer was incorporated inside the binding cavities of a cross-linked MIP, as a functional monomer during the synthesis step. Ferrocenylmethyl methacrylate was used for this purpose. It was associated with 4-vinylpyridine as a co-functional monomer and ethylene glycol dimethacrylate as cross-linker for the recognition of the endocrine disruptor, Bisphenol A (BPA), as a target. Microbeads of e-MIP and e-NIP (corresponding non-imprinted polymer) were obtained via precipitation polymerization in acetonitrile. The presence of ferrocene inside the polymers was assessed via FTIR and elemental analysis and the polymers microstructure was characterized by SEM and nitrogen adsorption/desorption experiments. Binding isotherms and batch selectivity experiments evidenced the presence of binding cavities inside the e-MIP and its high affinity for BPA compared to carbamazepine and ketoprofen. e-MIP (and e-NIP) microbeads were then incorporated in a graphite-hydroxyethylcellulose composite paste to prepare SPCE. Electrochemical properties of e-MIP-SPCE revealed a high sensitivity in the presence of BPA in aqueous medium compared to e-NIP-SPCE with a limit of detection (LOD) of 0.06 nM. Selectivity towards carbamazepine and ketoprofen was also observed with the e-MIP-SPCE. Copyright © 2018 Elsevier B.V. All rights reserved.

U1 small nuclear ribonucleoprotein particle-specific proteins interact with the first and second stem-loops of U1 RNA, with the A protein binding directly to the RNA independently of the 70K and Sm proteins.

PubMed Central

Patton, J R; Habets, W; van Venrooij, W J; Pederson, T

1989-01-01

The U1 small nuclear ribonucleoprotein particle (U1 snRNP), a cofactor in pre-mRNA splicing, contains three proteins, termed 70K, A, and C, that are not present in the other spliceosome-associated snRNPs. We studied the binding of the A and C proteins to U1 RNA, using a U1 snRNP reconstitution system and an antibody-induced nuclease protection technique. Antibodies that reacted with the A and C proteins induced nuclease protection of the first two stem-loops of U1 RNA in reconstituted U1 snRNP. Detailed analysis of the antibody-induced nuclease protection patterns indicated the existence of relatively long-range protein-protein interactions in the U1 snRNP, with the 5' end of U1 RNA and its associated specific proteins interacting with proteins bound to the Sm domain near the 3' end. UV cross-linking experiments in conjunction with an A-protein-specific antibody demonstrated that the A protein bound directly to the U1 RNA rather than assembling in the U1 snRNP exclusively via protein-protein interactions. This conclusion was supported by additional experiments revealing that the A protein could bind to U1 RNA in the absence of bound 70K and Sm core proteins. Images PMID:2529425