Warfarin and Flavonoids Do Not Share the Same Binding Region in Binding to the IIA Subdomain of Human Serum Albumin.

PubMed

Rimac, Hrvoje; Dufour, Claire; Debeljak, Željko; Zorc, Branka; Bojić, Mirza

2017-07-11

Human serum albumin (HSA) binds a variety of xenobiotics, including flavonoids and warfarin. The binding of another ligand to the IIA binding site on HSA can cause warfarin displacement and potentially the elevation of its free concentration in blood. Studies dealing with flavonoid-induced warfarin displacement from HSA provided controversial results: estimated risk of displacement ranged from none to serious. To resolve these controversies, in vitro study of simultaneous binding of warfarin and eight different flavonoid aglycons and glycosides to HSA was carried out by fluorescence spectroscopy as well as molecular docking. Results show that warfarin and flavonoids do not share the same binding region in binding to HSA. Interactions were only observed at high warfarin concentrations not attainable under recommended dosing regimes. Docking experiments show that flavonoid aglycons and glycosides do not bind at warfarin high affinity sites, but rather to different regions within the IIA HSA subdomain. Thus, the risk of clinically significant warfarin-flavonoid interaction in binding to HSA should be regarded as negligible.

Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

PubMed Central

Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

2010-01-01

Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

Na+/substrate Coupling in the Multidrug Antiporter NorM Probed with a Spin-labeled Substrate

PubMed Central

Steed, P. Ryan; Stein, Richard A.; Mishra, Smriti; Goodman, Michael C.; Mchaourab, Hassane S.

2013-01-01

NorM of the multidrug and toxic compound extrusion (MATE) family of transporters couples the efflux of a broad range of hydrophobic molecules to an inward Na+ gradient across the cell membrane. Several crystal structures of MATE transporters revealed distinct substrate binding sites leading to differing models of the mechanism of ion-coupled substrate extrusion. In the experiments reported here, we observed that a spin-labeled derivative of daunorubicin, Ruboxyl, is transported by NorM from Vibrio cholerae. It is therefore ideal to characterize mechanistically relevant binding interactions with NorM and to directly address the coupling of ion and drug binding. Fluorescence and EPR experiments revealed that Ruboxyl binds to NorM with micromolar affinity and becomes immobilized upon binding, even in the presence of Na+. Using double electron-electron resonance (DEER) spectroscopy, we determined that Ruboxyl binds to a single site on the periplasmic side of the protein. The presence of Na+ did not translocate the substrate to a second site as previously proposed. These experiments surprisingly show that Na+ does not affect the affinity or location of the substrate binding site on detergent-solubilized NorM, thus suggesting that additional factors beyond simple mutual exclusivity of binding, such as the presence of a Na+ gradient across the native membrane, govern Na+/drug coupling during antiport. PMID:23902581

Substituent Effects on the Coordination Chemistry of Metal-Binding Pharmacophores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Craig, Whitney R.; Baker, Tessa W.; Marts, Amy R.

2017-09-12

A combination of XAS, UV–vis, NMR, and EPR was used to examine the binding of a series of α-hydroxythiones to CoCA. All three appear to bind preferentially in their neutral, protonated forms. Two of the three clearly bind in a monodentate fashion, through the thione sulfur alone. Thiomaltol (TM) appears to show some orientational preference, on the basis of the NMR, while it appears that thiopyromeconic acid (TPMA) retains rotational freedom. In contrast, allothiomaltol (ATM), after initially binding in its neutral form, presumably through the thione sulfur, forms a final complex that is five-coordinate via bidentate coordination of ATM. Onmore » the basis of optical titrations, we speculate that this may be due to the lower initial pKa of ATM (8.3) relative to those of TM (9.0) and TPMA (9.5). Binding through the thione is shown to reduce the hydroxyl pKa by ~0.7 pH unit on metal binding, bringing only ATM’s pKa close to the pH of the experiment, facilitating deprotonation and subsequent coordination of the hydroxyl. The data predict the presence of a solvent-exchangeable proton on TM and TPMA, and Q-band 2-pulse ESEEM experiments on CoCA + TM suggest that the proton is present. ESE-detected EPR also showed a surprising frequency dependence, giving only a subset of the expected resonances at X-band.« less

The crystal structure of ribonuclease A in complex with thymidine-3'-monophosphate provides further insight into ligand binding.

PubMed

Doucet, Nicolas; Jayasundera, Thusitha B; Simonović, Miljan; Loria, J Patrick

2010-08-15

Thymidine-3'-monophosphate (3'-TMP) is a competitive inhibitor analogue of the 3'-CMP and 3'-UMP natural product inhibitors of bovine pancreatic ribonuclease A (RNase A). Isothermal titration calorimetry experiments show that 3'-TMP binds the enzyme with a dissociation constant (K(d)) of 15 microM making it one of the strongest binding members of the five natural bases found in nucleic acids (A, C, G, T, and U). To further investigate the molecular properties of this potent natural affinity, we have determined the crystal structure of bovine pancreatic RNase A in complex with 3'-TMP at 1.55 A resolution and we have performed NMR binding experiments with 3'-CMP and 3'-TMP. Our results show that binding of 3'-TMP is very similar to other natural and non-natural pyrimidine ligands, demonstrating that single nucleotide affinity is independent of the presence or absence of a 2'-hydroxyl on the ribose moiety of pyrimidines and suggesting that the pyrimidine binding subsite of RNase A is not a significant contributor of inhibitor discrimination. Accumulating evidence suggests that very subtle structural, chemical, and potentially motional variations contribute to ligand discrimination in this enzyme. 2010 Wiley-Liss, Inc.

The effects of value on context-item associative memory in younger and older adults.

PubMed

Hennessee, Joseph P; Knowlton, Barbara J; Castel, Alan D

2018-02-01

Valuable items are often remembered better than items that are less valuable by both older and younger adults, but older adults typically show deficits in binding. Here, we examine whether value affects the quality of recognition memory and the binding of incidental details to valuable items. In Experiment 1, participants learned English words each associated with a point-value they earned for correct recognition with the goal of maximizing their score. In Experiment 2, value was manipulated by presenting items that were either congruent or incongruent with an imagined state of physiological need (e.g., hunger). In Experiment 1, point-value was associated with enhanced recollection in both age groups. Memory for the color associated with the word was in fact reduced for high-value recollected items compared with low-value recollected items, suggesting value selectively enhances binding of task-relevant details. In Experiment 2, memory for learned images was enhanced by value in both age groups. However, value differentially enhanced binding of an imagined context to the item in younger and older adults, with a strong trend for increased binding in younger adults only. These findings suggest that value enhances episodic encoding in both older and younger adults but that binding of associated details may be reduced for valuable items compared to less valuable items, particularly in older adults. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Action and perception in social contexts: intentional binding for social action effects

PubMed Central

Pfister, Roland; Obhi, Sukhvinder S.; Rieger, Martina; Wenke, Dorit

2014-01-01

The subjective experience of controlling events in the environment alters the perception of these events. For instance, the interval between one's own actions and their consequences is subjectively compressed—a phenomenon known as intentional binding. In two experiments, we studied intentional binding in a social setting in which actions of one agent prompted a second agent to perform another action. Participants worked in pairs and were assigned to a “leader” and a “follower” role, respectively. The leader's key presses triggered (after a variable interval) a tone and this tone served as go signal for the follower to perform a keypress as well. Leaders and followers estimated the interval between the leader's keypress and the following tone, or the interval between the tone and the follower's keypress. The leader showed reliable intentional binding for both intervals relative to the follower's estimates. These results indicate that human agents experience a pre-reflective sense of agency for genuinely social consequences of their actions. PMID:25228869

Simultaneous Multiple MS Binding Assays Addressing D1 and D2 Dopamine Receptors.

PubMed

Schuller, Marion; Höfner, Georg; Wanner, Klaus T

2017-10-09

MS Binding Assays are a label-free alternative to radioligand binding assays. They provide basically the same capabilities as the latter, but use a non-labeled reporter ligand instead of a radioligand. In contrast to radioligand binding assays, MS Binding Assays offer-owing to the selectivity of mass spectrometric detection-the opportunity to monitor the binding of different reporter ligands at different targets simultaneously. The present study shows a proof of concept for this strategy as exemplified for MS Binding Assays selectively addressing D 1 and D 2 dopamine receptors in a single binding experiment. A highly sensitive, rapid and robust LC-ESI-MS/MS quantification method capable of quantifying both SCH23390 and raclopride, selectively addressing D 1 and D 2 receptors, respectively, was established and validated for this purpose. Based thereon, simultaneous saturation and competition experiments with SCH23390 and raclopride in the presence of both D 1 and D 2 receptors were performed and analyzed by LC-MS/MS within a single chromatographic cycle. The present study thus demonstrates the feasibility of this strategy and the high versatility of MS Binding Assays that appears to surpass that common for conventional radioligand binding assays. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Competitive counterion complexation allows the true host : guest binding constants from a single titration by ionic receptors.

PubMed

Pessêgo, Márcia; Basílio, Nuno; Muñiz, M Carmen; García-Río, Luis

2016-07-06

Counterion competitive complexation is a background process currently ignored by using ionic hosts. Consequently, guest binding constants are strongly affected by the design of the titration experiments in such a way that the results are dependent on the guest concentration and on the presence of added salts, usually buffers. In the present manuscript we show that these experimental difficulties can be overcome by just considering the counterion competitive complexation. Moreover a single titration allows us to obtain not only the true binding constants but also the stoichiometry of the complex showing the formation of 1 : 1 : 1 (host : guest : counterion) complexes. The detection of high stoichiometry complexes is not restricted to a single titration experiment but also to a displacement assay where both competitive and competitive-cooperative complexation models are taken into consideration.

Deciphering the mechanism of interaction of edifenphos with calf thymus DNA

NASA Astrophysics Data System (ADS)

Ahmad, Ajaz; Ahmad, Masood

2018-01-01

Edifenphos is an important organophosphate pesticide with many antifungal and anti-insecticidal properties but it may cause potential hazards to human health. In this work, we have tried to explore the binding mode of action and mechanism of edifenphos to calf thymus DNA (CT-DNA). Several experiments such as ultraviolet-visible absorption spectra and emission spectroscopy showed complex formation between edifenphos and CT-DNA and low binding constant values supporting groove binding mode. These results were further confirmed by circular dichroism (CD), CT-DNA melting studies, viscosity measurements, density functional theory and molecular docking. CD study suggests that edifenphos does not alter native structure of CT-DNA. Isothermal calorimetry reveals that binding of edifenphos with CT-DNA is enthalpy driven process. Competitive binding assay and effect of ionic strength showed that edifenphos binds to CT-DNA via groove binding manner. Hence, edifenphos is a minor groove binder preferably interacting with A-T regions with docking score - 6.84 kJ/mol.

Application of plug-plug technique to ACE experiments for discovery of peptides binding to a larger target protein: a model study of calmodulin-binding fragments selected from a digested mixture of reduced BSA.

PubMed

Saito, Kazuki; Nakato, Mamiko; Mizuguchi, Takaaki; Wada, Shinji; Uchimura, Hiromasa; Kataoka, Hiroshi; Yokoyama, Shigeyuki; Hirota, Hiroshi; Kiso, Yoshiaki

2014-03-01

To discover peptide ligands that bind to a target protein with a higher molecular mass, a concise screening methodology has been established, by applying a "plug-plug" technique to ACE experiments. Exploratory experiments using three mixed peptides, mastoparan-X, β-endorphin, and oxytocin, as candidates for calmodulin-binding ligands, revealed that the technique not only reduces the consumption of the protein sample, but also increases the flexibility of the experimental conditions, by allowing the use of MS detection in the ACE experiments. With the plug-plug technique, the ACE-MS screening methodology successfully selected calmodulin-binding peptides from a random library with diverse constituents, such as protease digests of BSA. Three peptides with Kd values between 8-147 μM for calmodulin were obtained from a Glu-C endoprotease digest of reduced BSA, although the digest showed more than 70 peaks in its ACE-MS electropherogram. The method established here will be quite useful for the screening of peptide ligands, which have only low affinities due to their flexible chain structures but could potentially provide primary information for designing inhibitors against the target protein. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

STD-NMR experiments identify a structural motif with novel second-site activity against West Nile virus NS2B-NS3 protease.

PubMed

Schöne, Tobias; Grimm, Lena Lisbeth; Sakai, Naoki; Zhang, Linlin; Hilgenfeld, Rolf; Peters, Thomas

2017-10-01

West Nile virus (WNV) belongs to the genus Flavivirus of the family Flaviviridae. This mosquito-borne virus that is highly pathogenic to humans has been evolving into a global threat during the past two decades. Despite many efforts, neither antiviral drugs nor vaccines are available. The viral protease NS2B-NS3 pro is essential for viral replication, and therefore it is considered a prime drug target. However, success in the development of specific NS2B-NS3 pro inhibitors had been moderate so far. In the search for new structural motifs with binding affinity for NS2B-NS3 pro , we have screened a fragment library, the Maybridge Ro5 library, employing saturation transfer difference (STD) NMR experiments as readout. About 30% of 429 fragments showed binding to NS2B-NS3 pro . Subsequent STD-NMR competition experiments using the known active site fragment A as reporter ligand yielded 14 competitively binding fragments, and 22 fragments not competing with A. In a fluorophore-based protease assay, all of these fragments showed inhibition in the micromolar range. Interestingly, 10 of these 22 fragments showed a notable increase of STD intensities in the presence of compound A suggesting cooperative binding. The most promising non-competitive inhibitors 1 and 2 (IC 50 ∼ 500 μM) share a structural motif that may guide the development of novel second-site (potentially allosteric) inhibitors of NS2B-NS3 pro . To identify the matching protein binding site, chemical shift perturbation studies employing 1 H, 15 N-TROSY-HSQC experiments with uniformly 2 H, 15 N-labeled protease were performed in the presence of 1, and in the concomitant absence or presence of A. The data suggest that 1 interacts with Met 52* of NS2B, identifying a secondary site adjacent to the binding site of A. Therefore, our study paves the way for the synthesis of novel bidentate NS2B-NS3 pro inhibitors. Copyright © 2017 Elsevier B.V. All rights reserved.

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

PubMed

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

PubMed Central

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

Evaluation of the endotoxin binding efficiency of clay minerals using the Limulus Amebocyte lysate test: an in vitro study

PubMed Central

2014-01-01

Endotoxins are part of the cell wall of Gram-negative bacteria. They are potent immune stimulators and can lead to death if present in high concentrations. Feed additives, which bind endotoxins in the gastrointestinal tract of animals, could help to prevent their negative impact. The objective of our study was to determine the potential of a bentonite (Bentonite 1), a sodium bentonite (Bentonite 2), a chemically treated smectite (Organoclay 1) and a modified attapulgite (Organoclay 2) to bind endotoxins in vitro. Polymyxin B served as positive control. The kinetic chromogenic Limulus Amebocyte lysate test was adapted to measure endotoxin activity. Firstly, a single sorption experiment (10 endotoxin units/mL (EU/mL)) was performed. Polymyxin B and organoclays showed 100% binding efficiency. Secondly, the adsorption efficiency of sorbents in aqueous solution with increasing endotoxin concentrations (2,450 – 51,700 EU/mL) was investigated. Organoclay 1 (0.1%) showed a good binding efficiency in aqueous solution (average 81%), whereas Bentonite 1 (0.1%) obtained a lower binding efficiency (21-54%). The following absorbent capacities were calculated in highest endotoxin concentration: 5.59 mg/g (Organoclay 1) > 3.97 mg/g (Polymyxin B) > 2.58mg/g (Organoclay 2) > 1.55 mg/g (Bentonite 1) > 1.23 mg/g (Bentonite 2). Thirdly, a sorption experiment in artificial intestinal fluid was conducted. Especially for organoclays, which are known to be unspecific adsorbents, the endotoxin binding capacity was significantly reduced. In contrast, Bentonite 1 showed comparable results in artificial intestinal fluid and aqueous solution. Based on the results of this in vitro study, the effect of promising clay minerals will be investigated in in vivo trials. PMID:24383578

A double tyrosine motif in the cardiac sodium channel domain III-IV linker couples calcium-dependent calmodulin binding to inactivation gating.

PubMed

Sarhan, Maen F; Van Petegem, Filip; Ahern, Christopher A

2009-11-27

Voltage-gated sodium channels maintain the electrical cadence and stability of neurons and muscle cells by selectively controlling the transmembrane passage of their namesake ion. The degree to which these channels contribute to cellular excitability can be managed therapeutically or fine-tuned by endogenous ligands. Intracellular calcium, for instance, modulates sodium channel inactivation, the process by which sodium conductance is negatively regulated. We explored the molecular basis for this effect by investigating the interaction between the ubiquitous calcium binding protein calmodulin (CaM) and the putative sodium channel inactivation gate composed of the cytosolic linker between homologous channel domains III and IV (DIII-IV). Experiments using isothermal titration calorimetry show that CaM binds to a novel double tyrosine motif in the center of the DIII-IV linker in a calcium-dependent manner, N-terminal to a region previously reported to be a CaM binding site. An alanine scan of aromatic residues in recombinant DIII-DIV linker peptides shows that whereas multiple side chains contribute to CaM binding, two tyrosines (Tyr(1494) and Tyr(1495)) play a crucial role in binding the CaM C-lobe. The functional relevance of these observations was then ascertained through electrophysiological measurement of sodium channel inactivation gating in the presence and absence of calcium. Experiments on patch-clamped transfected tsA201 cells show that only the Y1494A mutation of the five sites tested renders sodium channel steady-state inactivation insensitive to cytosolic calcium. The results demonstrate that calcium-dependent calmodulin binding to the sodium channel inactivation gate double tyrosine motif is required for calcium regulation of the cardiac sodium channel.

Tracer diffusion in a sea of polymers with binding zones: mobile vs. frozen traps.

PubMed

Samanta, Nairhita; Chakrabarti, Rajarshi

2016-10-19

We use molecular dynamics simulations to investigate the tracer diffusion in a sea of polymers with specific binding zones for the tracer. These binding zones act as traps. Our simulations show that the tracer can undergo normal yet non-Gaussian diffusion under certain circumstances, e.g., when the polymers with traps are frozen in space and the volume fraction and the binding strength of the traps are moderate. In this case, as the tracer moves, it experiences a heterogeneous environment and exhibits confined continuous time random walk (CTRW) like motion resulting in a non-Gaussian behavior. Also the long time dynamics becomes subdiffusive as the number or the binding strength of the traps increases. However, if the polymers are mobile then the tracer dynamics is Gaussian but could be normal or subdiffusive depending on the number and the binding strength of the traps. In addition, with increasing binding strength and number of polymer traps, the probability of the tracer being trapped increases. On the other hand, removing the binding zones does not result in trapping, even at comparatively high crowding. Our simulations also show that the trapping probability increases with the increasing size of the tracer and for a bigger tracer with the frozen polymer background the dynamics is only weakly non-Gaussian but highly subdiffusive. Our observations are in the same spirit as found in many recent experiments on tracer diffusion in polymeric materials and question the validity of using Gaussian theory to describe diffusion in a crowded environment in general.

Molecular dynamics and Monte Carlo simulations for protein-ligand binding and inhibitor design.

PubMed

Cole, Daniel J; Tirado-Rives, Julian; Jorgensen, William L

2015-05-01

Non-nucleoside inhibitors of HIV reverse transcriptase are an important component of treatment against HIV infection. Novel inhibitors are sought that increase potency against variants that contain the Tyr181Cys mutation. Molecular dynamics based free energy perturbation simulations have been run to study factors that contribute to protein-ligand binding, and the results are compared with those from previous Monte Carlo based simulations and activity data. Predictions of protein-ligand binding modes are very consistent for the two simulation methods; the accord is attributed to the use of an enhanced sampling protocol. The Tyr181Cys binding pocket supports large, hydrophobic substituents, which is in good agreement with experiment. Although some discrepancies exist between the results of the two simulation methods and experiment, free energy perturbation simulations can be used to rapidly test small molecules for gains in binding affinity. Free energy perturbation methods show promise in providing fast, reliable and accurate data that can be used to complement experiment in lead optimization projects. This article is part of a Special Issue entitled "Recent developments of molecular dynamics". Copyright © 2014 Elsevier B.V. All rights reserved.

Visual feature binding in younger and older adults: encoding and suffix interference effects.

PubMed

Brown, Louise A; Niven, Elaine H; Logie, Robert H; Rhodes, Stephen; Allen, Richard J

2017-02-01

Three experiments investigated younger (18-25 yrs) and older (70-88 yrs) adults' temporary memory for colour-shape combinations (binding). We focused upon estimating the magnitude of the binding cost for each age group across encoding time (Experiment 1; 900/1500 ms), presentation format (Experiment 2; simultaneous/sequential), and interference (Experiment 3; control/suffix) conditions. In Experiment 1, encoding time did not differentially influence binding in the two age groups. In Experiment 2, younger adults exhibited poorer binding performance with sequential relative to simultaneous presentation, and serial position analyses highlighted a particular age-related difficulty remembering the middle item of a series (for all memory conditions). Experiments 1-3 demonstrated small to medium binding effect sizes in older adults across all encoding conditions, with binding less accurate than shape memory. However, younger adults also displayed negative effects of binding (small to large) in two of the experiments. Even when older adults exhibited a greater suffix interference effect in Experiment 3, this was for all memory types, not just binding. We therefore conclude that there is no consistent evidence for a visual binding deficit in healthy older adults. This relative preservation contrasts with the specific and substantial deficits in visual feature binding found in several recent studies of Alzheimer's disease.

Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

PubMed Central

Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

2000-01-01

Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

Polyethylene glycol binding alters human telomere G-quadruplex structure by conformational selection

PubMed Central

Buscaglia, Robert; Miller, M. Clarke; Dean, William L.; Gray, Robert D.; Lane, Andrew N.; Trent, John O.; Chaires, Jonathan B.

2013-01-01

Polyethylene glycols (PEGs) are widely used to perturb the conformations of nucleic acids, including G-quadruplexes. The mechanism by which PEG alters G-quadruplex conformation is poorly understood. We describe here studies designed to determine how PEG and other co-solutes affect the conformation of the human telomeric quadruplex. Osmotic stress studies using acetonitrile and ethylene glycol show that conversion of the ‘hybrid’ conformation to an all-parallel ‘propeller’ conformation is accompanied by the release of about 17 water molecules per quadruplex and is energetically unfavorable in pure aqueous solutions. Sedimentation velocity experiments show that the propeller form is hydrodynamically larger than hybrid forms, ruling out a crowding mechanism for the conversion by PEG. PEGs do not alter water activity sufficiently to perturb quadruplex hydration by osmotic stress. PEG titration experiments are most consistent with a conformational selection mechanism in which PEG binds more strongly to the propeller conformation, and binding is coupled to the conformational transition between forms. Molecular dynamics simulations show that PEG binding to the propeller form is sterically feasible and energetically favorable. We conclude that PEG does not act by crowding and is a poor mimic of the intranuclear environment, keeping open the question of the physiologically relevant quadruplex conformation. PMID:23804761

Cell-Selective Biological Activity of Rhodium Metalloinsertors Correlates with Subcellular Localization

PubMed Central

Komor, Alexis C.; Schneider, Curtis J.; Weidmann, Alyson G.; Barton, Jacqueline K.

2013-01-01

Deficiencies in the mismatch repair (MMR) pathway are associated with several types of cancers, as well as resistance to commonly used chemotherapeutics. Rhodium metalloinsertors have been found to bind DNA mismatches with high affinity and specificity in vitro, and also exhibit cell-selective cytotoxicity, targeting MMR-deficient cells over MMR-proficient cells. Ten distinct metalloinsertors with varying lipophilicities have been synthesized and their mismatch binding affinities and biological activities determined. Although DNA photocleavage experiments demonstrate that their binding affinities are quite similar, their cell-selective antiproliferative and cytotoxic activities vary significantly. Inductively coupled plasma mass spectrometry (ICP-MS) experiments have uncovered a relationship between the subcellular distribution of these metalloinsertors and their biological activities. Specifically, we find that all of our metalloinsertors localize in the nucleus at sufficient concentrations for binding to DNA mismatches. However, the metalloinsertors with high rhodium localization in the mitochondria show toxicity that is not selective for MMR-deficient cells, whereas metalloinsertors with less mitochondrial rhodium show activity that is highly selective for MMR-deficient versus proficient cells. This work supports the notion that specific targeting of the metalloinsertors to nuclear DNA gives rise to their cell-selective cytotoxic and antiproliferative activities. The selectivity in cellular targeting depends upon binding to mismatches in genomic DNA. PMID:23137296

Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

PubMed Central

Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

2011-01-01

Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

NASA Astrophysics Data System (ADS)

Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

2017-02-01

The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

Exploring the site-selective binding of jatrorrhizine to human serum albumin: spectroscopic and molecular modeling approaches.

PubMed

Mi, Ran; Hu, Yan-Jun; Fan, Xiao-Yang; Ouyang, Yu; Bai, Ai-Min

2014-01-03

This paper exploring the site-selective binding of jatrorrhizine to human serum albumin (HSA) under physiological conditions (pH=7.4). The investigation was carried out using fluorescence spectroscopy, UV-vis spectroscopy, and molecular modeling. The results of fluorescence quenching and UV-vis absorption spectra experiments indicated the formation of the complex of HSA-jatrorrhizine. Binding parameters calculating from Stern-Volmer method and Scatchard method were calculated at 298, 304 and 310 K, with the corresponding thermodynamic parameters ΔG, ΔH and ΔS as well. Binding parameters calculating from Stern-Volmer method and Scatchard method showed that jatrorrhizine bind to HSA with the binding affinities of the order 10(4) L mol(-1). The thermodynamic parameters studies revealed that the binding was characterized by negative enthalpy and positive entropy changes and the electrostatic interactions play a major role for jatrorrhizine-HSA association. Site marker competitive displacement experiments and molecular modeling calculation demonstrating that jatrorrhizine is mainly located within the hydrophobic pocket of the subdomain IIIA of HSA. Furthermore, the synchronous fluorescence spectra suggested that the association between jatrorrhizine and HSA changed molecular conformation of HSA. Copyright © 2013. Published by Elsevier B.V.

Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy

PubMed Central

Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

2015-01-01

The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA. PMID:26140374

Characterization of the Interaction between Gallic Acid and Lysozyme by Molecular Dynamics Simulation and Optical Spectroscopy.

PubMed

Zhan, Minzhong; Guo, Ming; Jiang, Yanke; Wang, Xiaomeng

2015-07-01

The binding interaction between gallic acid (GA) and lysozyme (LYS) was investigated and compared by molecular dynamics (MD) simulation and spectral techniques. The results from spectroscopy indicate that GA binds to LYS to generate a static complex. The binding constants and thermodynamic parameters were calculated. MD simulation revealed that the main driving forces for GA binding to LYS are hydrogen bonding and hydrophobic interactions. The root-mean-square deviation verified that GA and LYS bind to form a stable complex, while the root-mean-square fluctuation results showed that the stability of the GA-LYS complex at 298 K was higher than that at 310 K. The calculated free binding energies from the molecular mechanics/Poisson-Boltzmann surface area method showed that van der Waals forces and electrostatic interactions are the predominant intermolecular forces. The MD simulation was consistent with the spectral experiments. This study provides a reference for future study of the pharmacological mechanism of GA.

Self-Organization of Metal Nanoparticles in Light: Electrodynamics-Molecular Dynamics Simulations and Optical Binding Experiments.

PubMed

McCormack, Patrick; Han, Fei; Yan, Zijie

2018-02-01

Light-driven self-organization of metal nanoparticles (NPs) can lead to unique optical matter systems, yet simulation of such self-organization (i.e., optical binding) is a complex computational problem that increases nonlinearly with system size. Here we show that a combined electrodynamics-molecular dynamics simulation technique can simulate the trajectories and predict stable configurations of silver NPs in optical fields. The simulated dynamic equilibrium of a two-NP system matches the probability density of oscillations for two optically bound NPs obtained experimentally. The predicted stable configurations for up to eight NPs are further compared to experimental observations of silver NP clusters formed by optical binding in a Bessel beam. All configurations are confirmed to form in real systems, including pentagonal clusters with five-fold symmetry. Our combined simulations and experiments have revealed a diverse optical matter system formed by anisotropic optical binding interactions, providing a new strategy to discover artificial materials.

Conformational stability and aggregation of therapeutic monoclonal antibodies studied with ANS and Thioflavin T binding.

PubMed

Kayser, Veysel; Chennamsetty, Naresh; Voynov, Vladimir; Helk, Bernhard; Trout, Bernhardt L

2011-01-01

Characterization of aggregation profiles of monoclonal antibodies (mAb) is gaining importance because an increasing number of mAb-based therapeutics are entering clinical studies and gaining marketing approval. To develop a successful formulation, it is imperative to identify the critical biochemical properties of each potential mAb drug candidate. We investigated the conformational change and aggregation of a human IgG1 using external dye-binding experiments with fluorescence spectroscopy and compared the aggregation profiles obtained to the results of size-exclusion chromatography. We show that using an appropriate dye at selected mAb concentration, unfolding or aggregation can be studied. In addition, dye-binding experiments may be used as conventional assays to study therapeutic mAb stability.

Native ESI Mass Spectrometry Can Help to Avoid Wrong Interpretations from Isothermal Titration Calorimetry in Difficult Situations

NASA Astrophysics Data System (ADS)

Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe

2017-02-01

We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate Kd values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to Kd(ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (Kd, ΔH) pairs greatly improved the fits and yielded a second Kd(ITC) close to Kd(ESI-MS). The striking features are: (1) ITC detected a minor binding mode ( 20%) of `low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (Kd, ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments.

Native ESI Mass Spectrometry Can Help to Avoid Wrong Interpretations from Isothermal Titration Calorimetry in Difficult Situations.

PubMed

Wolff, Philippe; Da Veiga, Cyrielle; Ennifar, Eric; Bec, Guillaume; Guichard, Gilles; Burnouf, Dominique; Dumas, Philippe

2017-02-01

We studied by native ESI-MS the binding of various DNA-polymerase-derived peptides onto DNA-polymerase processivity rings from Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. These homodimeric rings present two equivalent specific binding sites, which leads to successive formation during a titration experiment of singly- and doubly occupied rings. By using the ESI-MS free-ring spectrum as a ruler, we derived by robust linear regression the fractions of the different ring species at each step of a titration experiment. These results led to accurate K d values (from 0.03 to 0.5 μM) along with the probability of peptide loss due to gas phase dissociation (GPD). We show that this good quality is due to the increased information content of a titration experiment with a homodimer. Isothermal titration calorimetry (ITC) led with the same binding model to K d (ITC) values systematically higher than their ESI-MS counterparts and, often, to poor fit of the ITC curves. A processing with two competing modes of binding on the same site requiring determination of two (K d , ΔH) pairs greatly improved the fits and yielded a second K d (ITC) close to K d (ESI-MS). The striking features are: (1) ITC detected a minor binding mode (~20%) of 'low-affinity' that did not appear with ESI-MS; (2) the simplest processing of ITC data with only one (K d , ΔH) pair led wrongly to the Kd of the low-affinity binding mode but to the ΔH of the high-affinity binding mode. Analogous misleading results might well exist in published data based on ITC experiments. Graphical Abstract ᅟ.

Effects of chronic delta-9-tetrahydrocannabinol (THC) administration on neurotransmitter concentrations and receptor binding in the rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, S.F.; Newport, G.D.; Scallet, A.C.

THC is the major psychoactive constituent of marijuana and is also known as an hallucinogenic compound. Numerous reports have shown that large doses of THC produce significant alterations in various neurotransmitter systems. The present study was designed to determine whether chronic exposure to THC produces significant alterations in selected neurotransmitter systems (dopamine, serotonin, acetylcholine, GABAergic, benzodiazepine, and opiate) in the rat brain. In Experiment 1, male Sprague-Dawley rats were gavaged with vehicle, 10 or 20 mg THC/kg body weight daily, 5 days/week for 90 days. Animals were killed either 24 hours or two months after the last dose. Brains weremore » dissected into different regions for neurochemical analyses. Two months after the cessation of chronic administration, there was a significant decrease in GABA receptor binding in the hippocampus of animals in the high dose group. However, no other significant changes were found in neurotransmitter receptor binding characteristics in the hippocampus or in neurotransmitter concentrations in the caudate nucleus, hypothalamus or septum after chronic THC administration. In an attempt to replicate the GABA receptor binding changes and also to determine the (35S)TBPS binding in hippocampus, we designed Experiment 2. In this experiment, we dosed the animals by gavage with 0, 5, 10 or 20 mg THC/kg daily, 5 days/week or with 20 mg THC/kg Monday through Thursday and 60 mg/kg on Friday for 90 days. Results from this experiment failed to replicate the dose-dependent effect of THC on GABA receptor binding in hippocampus. Modulation of (35S)TBPS binding by GABA or 3 alpha-OH-DHP or inhibition by cold TBPS in frontal cortex did not show any significant dose-related effects.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allescher, H.D.; Ahmad, S.; Classen, M.

Receptor binding of the opioid receptor antagonist, ({sup 3}H)diprenorphine, which has a similar affinity to the various opioid receptor subtypes, was characterized in subcellular fractions derived from either longitudinal or circular smooth muscle of the canine small intestine with their plexuses (myenteric plexus and deep muscular plexus, respectively) attached. The distribution of opioid binding activity showed a good correlation in the different fractions with the binding of the neuronal marker ({sup 3}H)saxitoxin but no correlation to the smooth muscle plasma membrane marker 5'-nucleotidase. The saturation data (Kd = 0.12 +/- 0.04 nM and maximum binding = 400 +/- 20 fmol/mg)more » and the data from kinetic experiments (Kd = 0.08 nmol) in the myenteric plexus were in good agreement with results obtained previously from the circular muscle/deep muscular plexus preparation. Competition experiments using selective drugs for mu (morphiceptin-analog (N-MePhe3-D-Pro4)-morphiceptin), delta (D-Pen2,5-enkephalin) and kappa (dynorphin 1-13, U50488-H) ligands showed the existence of all three receptor subtypes. The existence of kappa receptors was confirmed in saturation experiments using ({sup 3}H) ethylketocycloazocine as labeled ligand. Two putative opioid agonists, with effects on gastrointestinal motility, trimebutine and JO-1196 (fedotozin), were also examined. Trimebutine (Ki = 0.18 microM), Des-Met-trimebutine (Ki = 0.72 microM) and Jo-1196 (Ki = 0.19 microM) displaced specific opiate binding. The relative affinity for the opioid receptor subtypes was mu = 0.44, delta = 0.30 and kappa = 0.26 for trimebutine and mu = 0.25, delta = 0.22 and kappa = 0.52 for Jo-1196.« less

Understanding the Structural Ensembles of a Highly Extended Disordered Protein†

PubMed Central

Daughdrill, Gary W.; Kashtanov, Stepan; Stancik, Amber; Hill, Shannon E.; Helms, Gregory; Muschol, Martin

2013-01-01

Developing a comprehensive description of the equilibrium structural ensembles for intrinsically disordered proteins (IDPs) is essential to understanding their function. The p53 transactivation domain (p53TAD) is an IDP that interacts with multiple protein partners and contains numerous phosphorylation sites. Multiple techniques were used to investigate the equilibrium structural ensemble of p53TAD in its native and chemically unfolded states. The results from these experiments show that the native state of p53TAD has dimensions similar to a classical random coil while the chemically unfolded state is more extended. To investigate the molecular properties responsible for this behavior, a novel algorithm that generates diverse and unbiased structural ensembles of IDPs was developed. This algorithm was used to generate a large pool of plausible p53TAD structures that were reweighted to identify a subset of structures with the best fit to small angle X-ray scattering data. High weight structures in the native state ensemble show features that are localized to protein binding sites and regions with high proline content. The features localized to the protein binding sites are mostly eliminated in the chemically unfolded ensemble; while, the regions with high proline content remain relatively unaffected. Data from NMR experiments support these results, showing that residues from the protein binding sites experience larger environmental changes upon unfolding by urea than regions with high proline content. This behavior is consistent with the urea-induced exposure of nonpolar and aromatic side-chains in the protein binding sites that are partially excluded from solvent in the native state ensemble. PMID:21979461

Ca(2+) -complex stability of GAPAGPLIVPY peptide in gas and aqueous phase, investigated by affinity capillary electrophoresis and molecular dynamics simulations and compared to mass spectrometric results.

PubMed

Nachbar, Markus; El Deeb, Sami; Mozafari, Mona; Alhazmi, Hassan A; Preu, Lutz; Redweik, Sabine; Lehmann, Wolf Dieter; Wätzig, Hermann

2016-03-01

Strong, sequence-specific gas-phase bindings between proline-rich peptides and alkaline earth metal ions in nanoESI-MS experiments were reported by Lehmann et al. (Rapid Commun. Mass Spectrom. 2006, 20, 2404-2410), however its relevance for physiological-like aqueous phase is uncertain. Therefore, the complexes should also be studied in aqueous solution and the relevance of the MS method for binding studies be evaluated. A mobility shift ACE method was used for determining the binding between the small peptide GAPAGPLIVPY and various metal ions in aqueous solution. The findings were compared to the MS results and further explained using computational methods. While the MS data showed a strong alkaline earth ion binding, the ACE results showed nonsignificant binding. The proposed vacuum state complex also decomposed during a molecular dynamic simulation in aqueous solution. This study shows that the formed stable peptide-metal ion adducts in the gas phase by ESI-MS does not imply the existence of analogous adducts in the aqueous phase. Comparing peptide-metal ion interaction under the gaseous MS and aqueous ACE conditions showed huge difference in binding behavior. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Enantioselective binding of L, D-phenylalanine to ct DNA

NASA Astrophysics Data System (ADS)

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-01

The enantioselective binding of L, D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of L, D-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

Enantioselective binding of L,D-phenylalanine to ct DNA.

PubMed

Zhang, Lijin; Xu, Jianhua; Huang, Yan; Min, Shungeng

2009-10-15

The enantioselective binding of L,D-phenylalanine to calf thymus DNA was studied by absorption, circular dichroism, fluorescence quenching, viscosity, salt effect and emission experiments. The results obtained from absorption, circular dichroism, fluorescence quenching and viscosity experiments excluded the intercalative binding and salt effect experiments did not support electrostatic binding. So the binding of l,d-phenylalanine to ct DNA should be groove binding. Furthermore, the emission spectra revealed that the binding is enantioselective.

A Second Las17 Monomeric Actin-Binding Motif Functions in Arp2/3-Dependent Actin Polymerization During Endocytosis

PubMed Central

Feliciano, Daniel; Tolsma, Thomas O.; Farrell, Kristen B.; Aradi, Al; Di Pietro, Santiago M.

2018-01-01

During clathrin-mediated endocytosis (CME), actin assembly provides force to drive vesicle internalization. Members of the Wiskott–Aldrich syndrome protein (WASP) family play a fundamental role stimulating actin assembly. WASP family proteins contain a WH2 motif that binds globular actin (G-actin) and a central-acidic motif that binds the Arp2/3 complex, thus promoting the formation of branched actin filaments. Yeast WASP (Las17) is the strongest of five factors promoting Arp2/3-dependent actin polymerization during CME. It was suggested that this strong activity may be caused by a putative second G-actin-binding motif in Las17. Here, we describe the in vitro and in vivo characterization of such Las17 G-actin-binding motif (LGM) and its dependence on a group of conserved arginine residues. Using the yeast two-hybrid system, GST-pulldown, fluorescence polarization and pyrene-actin polymerization assays, we show that LGM binds G-actin and is necessary for normal Arp2/3-mediated actin polymerization in vitro. Live-cell fluorescence microscopy experiments demonstrate that LGM is required for normal dynamics of actin polymerization during CME. Further, LGM is necessary for normal dynamics of endocytic machinery components that are recruited at early, intermediate and late stages of endocytosis, as well as for optimal endocytosis of native CME cargo. Both in vitro and in vivo experiments show that LGM has relatively lower potency compared to the previously known Las17 G-actin-binding motif, WH2. These results establish a second G-actin-binding motif in Las17 and advance our knowledge on the mechanism of actin assembly during CME. PMID:25615019

Distributed feature binding in the auditory modality: experimental evidence toward reconciliation of opposing views on the basis of mismatch negativity and behavioral measures.

PubMed

Chernyshev, Boris V; Bryzgalov, Dmitri V; Lazarev, Ivan E; Chernysheva, Elena G

2016-08-03

Current understanding of feature binding remains controversial. Studies involving mismatch negativity (MMN) measurement show a low level of binding, whereas behavioral experiments suggest a higher level. We examined the possibility that the two levels of feature binding coexist and may be shown within one experiment. The electroencephalogram was recorded while participants were engaged in an auditory two-alternative choice task, which was a combination of the oddball and the condensation tasks. Two types of deviant target stimuli were used - complex stimuli, which required feature conjunction to be identified, and simple stimuli, which differed from standard stimuli in a single feature. Two behavioral outcomes - correct responses and errors - were analyzed separately. Responses to complex stimuli were slower and less accurate than responses to simple stimuli. MMN was prominent and its amplitude was similar for both simple and complex stimuli, whereas the respective stimuli differed from standards in a single feature or two features respectively. Errors in response only to complex stimuli were associated with decreased MMN amplitude. P300 amplitude was greater for complex stimuli than for simple stimuli. Our data are compatible with the explanation that feature binding in auditory modality depends on two concurrent levels of processing. We speculate that the earlier level related to MMN generation is an essential and critical stage. Yet, a later analysis is also carried out, affecting P300 amplitude and response time. The current findings provide resolution to conflicting views on the nature of feature binding and show that feature binding is a distributed multilevel process.

Examining the critical roles of human CB2 receptor residues Valine 3.32 (113) and Leucine 5.41 (192) in ligand recognition and downstream signaling activities.

PubMed

Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun

2014-09-26

We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.

Mixed-mode sorption of hydroxylated atrazine degradation products to sell: A mechanism for bound residue

USGS Publications Warehouse

Lerch, R.N.; Thurman, E.M.; Kruger, E.L.

1997-01-01

This study tested the hypothesis that sorption of hydroxylated atrazine degradation products (HADPs: hydroxyatrazine, HA; deethylhydroxyatrazine, DEHA; and deisopropylhydroxyatrazine, DIHA) to soils occurs by mixed-mode binding resulting from two simultaneous mechanisms: (1) cation exchange and (2) hydrophobic interaction. The objective was to use liquid chromatography and soil extraction experiments to show that mixed-mode binding is the mechanism controlling HADP sorption to soils and is also a mechanism for bound residue. Overall, HADP binding to solid-phase extraction (SPE) sorbents occurred in the order: cation exchange >> octadecyl (C18) >> cyanopropyl. Binding to cation exchange SPE and to a high-performance liquid chromatograph octyl (C8) column showed evidence for mixed-mode binding. Comparison of soil extracted by 0.5 M KH2P04, pH 7.5, or 25% aqueous CH3CN showed that, for HA and DIHA, cation exchange was a more important binding mechanism to soils than hydrophobic interaction. Based on differences between several extractants, the extent of HADP mixed-mode binding to soil occurred in the following order: HA > DIHA > DEHA. Mixed-mode extraction recovered 42.8% of bound atrazine residues from aged soil, and 88% of this fraction was identified as HADPs. Thus, a significant portion of bound atrazine residues in soils is sorbed by the mixed-mode binding mechanisms.

MCAW-DB: A glycan profile database capturing the ambiguity of glycan recognition patterns.

PubMed

Hosoda, Masae; Takahashi, Yushi; Shiota, Masaaki; Shinmachi, Daisuke; Inomoto, Renji; Higashimoto, Shinichi; Aoki-Kinoshita, Kiyoko F

2018-05-11

Glycan-binding protein (GBP) interaction experiments, such as glycan microarrays, are often used to understand glycan recognition patterns. However, oftentimes the interpretation of glycan array experimental data makes it difficult to identify discrete GBP binding patterns due to their ambiguity. It is known that lectins, for example, are non-specific in their binding affinities; the same lectin can bind to different monosaccharides or even different glycan structures. In bioinformatics, several tools to mine the data generated from these sorts of experiments have been developed. These tools take a library of predefined motifs, which are commonly-found glycan patterns such as sialyl-Lewis X, and attempt to identify the motif(s) that are specific to the GBP being analyzed. In our previous work, as opposed to using predefined motifs, we developed the Multiple Carbohydrate Alignment with Weights (MCAW) tool to visualize the state of the glycans being recognized by the GBP under analysis. We previously reported on the effectiveness of our tool and algorithm by analyzing several glycan array datasets from the Consortium of Functional Glycomics (CFG). In this work, we report on our analysis of 1081 data sets which we collected from the CFG, the results of which we have made publicly and freely available as a database called MCAW-DB. We introduce this database, its usage and describe several analysis results. We show how MCAW-DB can be used to analyze glycan-binding patterns of GBPs amidst their ambiguity. For example, the visualization of glycan-binding patterns in MCAW-DB show how they correlate with the concentrations of the samples used in the array experiments. Using MCAW-DB, the patterns of glycans found to bind to various GBP-glycan binding proteins are visualized, indicating the binding "environment" of the glycans. Thus, the ambiguity of glycan recognition is numerically represented, along with the patterns of monosaccharides surrounding the binding region. The profiles in MCAW-DB could potentially be used as predictors of affinity of unknown or novel glycans to particular GBPs by comparing how well they match the existing profiles for those GBPs. Moreover, as the glycan profiles of diseased tissues become available, glycan alignments could also be used to identify glycan biomarkers unique to that tissue. Databases of these alignments may be of great use for drug discovery. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Shielding voices: The modulation of binding processes between voice features and response features by task representations.

PubMed

Bogon, Johanna; Eisenbarth, Hedwig; Landgraf, Steffen; Dreisbach, Gesine

2017-09-01

Vocal events offer not only semantic-linguistic content but also information about the identity and the emotional-motivational state of the speaker. Furthermore, most vocal events have implications for our actions and therefore include action-related features. But the relevance and irrelevance of vocal features varies from task to task. The present study investigates binding processes for perceptual and action-related features of spoken words and their modulation by the task representation of the listener. Participants reacted with two response keys to eight different words spoken by a male or a female voice (Experiment 1) or spoken by an angry or neutral male voice (Experiment 2). There were two instruction conditions: half of participants learned eight stimulus-response mappings by rote (SR), and half of participants applied a binary task rule (TR). In both experiments, SR instructed participants showed clear evidence for binding processes between voice and response features indicated by an interaction between the irrelevant voice feature and the response. By contrast, as indicated by a three-way interaction with instruction, no such binding was found in the TR instructed group. These results are suggestive of binding and shielding as two adaptive mechanisms that ensure successful communication and action in a dynamic social environment.

To bind or not to bind, that's the wrong question: Features and objects coexist in visual short-term memory.

PubMed

Geigerman, Shriradha; Verhaeghen, Paul; Cerella, John

2016-06-01

In three experiments, we investigated whether features and whole-objects can be represented simultaneously in visual short-term memory (VSTM). Participants were presented with a memory set of colored shapes; we probed either for the constituent features or for the whole object, and analyzed retrieval dynamics (cumulative response time distributions). In our first experiment, we used whole-object probes that recombined features from the memory display; we found that subjects' data conformed to a kitchen-line model, showing that they used whole-object representations for the matching process. In the second experiment, we encouraged independent-feature representations by using probes that used features not present in the memory display; subjects' data conformed to the race-model inequality, showing that they used independent-feature representations for the matching process. In a final experiment, we used both types of probes; subjects now used both types of representations, depending on the nature of the probe. Combined, our three experiments suggest that both feature and whole-object representations can coexist in VSTM. Copyright © 2016 Elsevier B.V. All rights reserved.

Molecular conformation of the full-length tumor suppressor NF2/Merlin—a small angle neutron scattering study

PubMed Central

Khajeh, Jahan Ali; Ju, Jeong Ho; Atchiba, Moussoubaou; Allaire, Marc; Stanley, Christopher; Heller, William T.; Callaway, David J.E.; Bu, Zimei

2014-01-01

Summary The tumor suppressor protein Merlin inhibits cell proliferation upon establishing cell-cell contacts. Because Merlin has high sequence similarity to the Ezrin-Radixin-Moesin (ERM) family of proteins, the structural model of ERM protein autoinhibition and cycling between closed/resting and open/active conformational states is often employed to explain Merlin function. However, recent biochemical studies suggest alternative molecular models of Merlin function. Here, we have determined the low resolution molecular structure and binding activity of Merlin and a Merlin(S518D) mutant that mimics the inactivating phosphorylation at S518 using small angle neutron scattering (SANS) and binding experiments. SANS shows that in solution both Merlin and Merlin(S518D) adopt a closed conformation, but binding experiments indicate that a significant fraction of either Merlin or Merlin(S518D) is capable of binding to the target protein NHERF1. Upon binding to the phosphatidylinositol 4,5-bisphosphate lipid, the wild-type Merlin adopts a more open conformation than in solution, but Merlin(S518D) remains in a closed conformation. This study supports a rheostat model of Merlin in NHERF1 binding, and contributes to resolve a controversy about the molecular conformation and binding activity of Merlin. PMID:24882693

SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

PubMed

Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

2018-05-25

Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

The Role of Pectin in Pb Binding by Carrot Peel Biosorbents: Isoterm Adsorption Study

NASA Astrophysics Data System (ADS)

Hastuti, B.; Totiana, F.; Winiasih, R.

2018-04-01

Cheaply and abundantly biosorption available materials such as carrot peels can be a cost-efficient method for removing heavy metals from wastewater. To investigate the role pectin plays in metal binding by carrot peels, commerce pectin was compared. FTIR spectra confirmed the presence of carboxyl and hydroxyl groups in commerce pectin and carrot pectin. Isoterm experiments showed that all materials could remove Pb (II) ion. All of materials binding Pb (II) follow Freundlich models adsorption. The commerce pectin bindsPb (II) by involving energy 16.6 KJ/mole whereas pectin from carrot peel involves energy 21.09 KJ/mole. It indicates that commerce pectin binds the Pb (II) by physics adsorption whereas pectin from carrot peel by physics and chemical adsorption.

Crystal structure of Yersinia pestis virulence factor YfeA reveals two polyspecific metal-binding sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Radka, Christopher D.; DeLucas, Lawrence J.; Wilson, Landon S.

2017-06-30

Gram-negative bacteria use siderophores, outer membrane receptors, inner membrane transporters and substrate-binding proteins (SBPs) to transport transition metals through the periplasm. The SBPs share a similar protein fold that has undergone significant structural evolution to communicate with a variety of differentially regulated transporters in the cell. InYersinia pestis, the causative agent of plague, YfeA (YPO2439, y1897), an SBP, is important for full virulence during mammalian infection. To better understand the role of YfeA in infection, crystal structures were determined under several environmental conditions with respect to transition-metal levels. Energy-dispersive X-ray spectroscopy and anomalous X-ray scattering data show that YfeA ismore » polyspecific and can alter its substrate specificity. In minimal-media experiments, YfeA crystals grown after iron supplementation showed a threefold increase in iron fluorescence emission over the iron fluorescence emission from YfeA crystals grown from nutrient-rich conditions, and YfeA crystals grown after manganese supplementation during overexpression showed a fivefold increase in manganese fluorescence emission over the manganese fluorescence emission from YfeA crystals grown from nutrient-rich conditions. In all experiments, the YfeA crystals produced the strongest fluorescence emission from zinc and could not be manipulated otherwise. Additionally, this report documents the discovery of a novel surface metal-binding site that prefers to chelate zinc but can also bind manganese. Flexibility across YfeA crystal forms in three loops and a helix near the buried metal-binding site suggest that a structural rearrangement is required for metal loading and unloading.« less

Mechanistic aspects of thioflavin-T self-aggregation and DNA binding: evidence for dimer attack on DNA grooves.

PubMed

Biancardi, A; Biver, T; Burgalassi, A; Mattonai, M; Secco, F; Venturini, M

2014-10-07

Thioflavin-T (TFT) is a fluorescent marker widely employed in biomedical research but the mechanism of its binding to polynucleotides has been poorly understood. This paper presents a study of the mechanisms of TFT self-aggregation and binding to DNA. Relaxation kinetics of TFT solutions show that the cyanine undergoes dimerization followed by dimer isomerisation. The interaction of TFT with DNA has been investigated using static methods, such as spectrophotometric and spectrofluorometric titrations under different conditions (salt content, temperature), fluorescence quenching, viscometric experiments and the T-jump relaxation method. The combined use of these techniques enabled us to show that the TFT monomer undergoes intercalation between the DNA base pairs and external binding according to a branched mechanism. Moreover, it has also been observed that, under dye excess conditions, the TFT dimer binds to the DNA grooves. The molecular structures of intercalated TFT and the groove-bound TFT dimer are obtained by performing QM/MM MD simulations.

Thermodynamic and kinetic analyses of curcumin and bovine serum albumin binding.

PubMed

Hudson, Eliara Acipreste; de Paula, Hauster Maximiler Campos; Ferreira, Guilherme Max Dias; Ferreira, Gabriel Max Dias; Hespanhol, Maria do Carmo; da Silva, Luis Henrique Mendes; Pires, Ana Clarissa Dos S

2018-03-01

Bovine serum albumin (BSA)/curcumin binding and dye photodegradation stability were evaluated. BSA/curcumin complex showed 1:1 stoichiometry, but the thermodynamic binding parameters depended on the technique used and BSA conformation. The binding constant was of the order of 10 5 L·mol -1 by fluorescence and microcalorimetric, and 10 3 and 10 4 L·mol -1 by surface plasmon resonance (steady-state equilibrium and kinetic experiments, respectively). For native BSA/curcumin, fluorescence indicated an enthalpic and entropic driven process based on the standard enthalpy change (ΔH ○ F =-8.67kJ·mol -1 ), while microcalorimetry showed an entropic driven binding process (ΔH ○ cal =29.11kJ·mol -1 ). For the unfolded BSA/curcumin complex, it was found thatp ΔH ○ F =-16.12kJ·mol -1 and ΔH ○ cal =-42.63kJ·mol -1 . BSA (mainly native) increased the curcumin photodegradation stability. This work proved the importance of using different techniques to characterize the protein-ligand binding. Copyright © 2017 Elsevier Ltd. All rights reserved.

A molecular dynamics simulation study of the association of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate enantiomers with a chiral molecular micelle

NASA Astrophysics Data System (ADS)

Morris, Kevin F.; Billiot, Eugene J.; Billiot, Fereshteh H.; Gladis, Ashley A.; Lipkowitz, Kenny B.; Southerland, William M.; Fang, Yayin

2014-08-01

Molecular dynamics (MD) simulations were used to investigate the binding of 1,1";-binaphthyl-2,2";-diyl hydrogenphosphate (BNP) enantiomers to the molecular micelle poly-(sodium undecyl-(L,L)-leucine-valine) (poly(SULV)). Poly(SULV) is used as a chiral selector in capillary electrophoresis separations. Four poly(SULV) binding pockets were identified and either (R)-BNP or (S)-BNP were docked into each pocket. MD simulations were then used to identify the preferred BNP binding site. Within the preferred site, both enantiomers formed hydrogen bonds with poly(SULV) and penetrated into the poly(SULV) core. Comparisons of BNP enantiomer binding to the preferred poly(SULV) pocket showed that (S)-BNP formed stronger hydrogen bonds, moved deeper into the binding site, and had a lower poly(SULV) binding free energy than the (R) enantiomer. Finally, MD simulation results were in agreement with capillary electrophoresis and NMR experiments. Each technique showed (S)-BNP interacted more strongly with poly(SULV) than (R)-BNP and that the site of chiral recognition was near the poly(SULV) leucine chiral center.

Human CRISP-3 binds serum alpha(1)B-glycoprotein across species.

PubMed

Udby, Lene; Johnsen, Anders H; Borregaard, Niels

2010-04-01

CRISP-3 was previously shown to be bound to alpha(1)B-glycoprotein (A1BG) in human serum/plasma. All mammalian sera are supposed to contain A1BG, although its presence in rodent sera is not well-documented. Since animal sera are often used to supplement buffers in experiments, in particular such that involve cell cultures, binding proteins present in sera might interfere in the experiments. We examined sera from five different animal species for CRISP-3 binding proteins using gel filtration and ligand blotting. We developed a rapid method for isolation of proteins that bind to human CRISP-3 and identified the isolated proteins by mass spectrometry and N-terminal sequencing. We identified A1BG as a CRISP-3 binding protein in sera from cow, horse and rabbit. CRISP-3 bound kininogen 1 in mouse serum, whereas rat serum showed no CRISP-3 binding activity. In equine serum, we furthermore detected a possible CRISP, already bound to A1BG. It seems to be a common mechanism that A1BGs bind CRISPs, also across species. Apart from the possible physiological implications hereof, complex binding of CRISPs by A1BG (and other proteins) may interfere with the detection and function of CRISPs, when these are studied in the presence of animal sera. Copyright 2009 Elsevier B.V. All rights reserved.

FecB, a periplasmic ferric-citrate transporter from E. coli, can bind different forms of ferric-citrate as well as a wide variety of metal-free and metal-loaded tricarboxylic acids.

PubMed

Banerjee, Sambuddha; Paul, Subrata; Nguyen, Leonard T; Chu, Byron C H; Vogel, Hans J

2016-01-01

The Escherichia coli Fec system, consisting of an outer membrane receptor (FecA), a periplasmic substrate binding protein (FecB) and an inner membrane permease-ATPase type transporter (FecC/D), plays an important role in the uptake and transport of Fe(3+)-citrate. Although several FecB sequences from various organisms have been reported, there are no biophysical or structural data available for this protein to date. In this work, using isothermal titration calorimetry (ITC), we report for the first time the ability of FecB to bind different species of Fe(3+)-citrate as well as other citrate complexes with trivalent (Ga(3+), Al(3+), Sc(3+) and In(3+)) and a representative divalent metal ion (Mg(2+)) with low μM affinity. Interestingly, ITC experiments with various iron-free di- and tricarboxylic acids show that FecB can bind tricarboxylates with μM affinity but not biologically relevant dicarboxylates. The ability of FecB to bind with metal-free citrate is also observed in (1)H,(15)N HSQC-NMR titration experiments reported here at two different pH values. Further, differential scanning calorimetry (DSC) experiments indicate that the ligand-bound form of FecB has greater thermal stability than ligand-free FecB under all pH and ligand conditions tested, which is consistent with the idea of domain closure subsequent to ligand binding for this type of periplasmic binding proteins.

Three-Dimensional Structure and Biophysical Characterization of Staphylococcus aureus Cell Surface Antigen-Manganese Transporter MntC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gribenko, Alexey; Mosyak, Lidia; Ghosh, Sharmistha

MntC is a metal-binding protein component of the Mn 2 +-specific mntABC transporter from the pathogen Staphylococcus aureus. The protein is expressed during the early stages of infection and was proven to be effective at reducing both S. aureus and Staphylococcus epidermidis infections in a murine animal model when used as a vaccine antigen. MntC is currently being tested in human clinical trials as a component of a multiantigen vaccine for the prevention of S. aureus infections. To better understand the biological function of MntC, we are providing structural and biophysical characterization of the protein in this work. The three-dimensionalmore » structure of the protein was solved by X-ray crystallography at 2.2 Å resolution and suggests two potential metal binding modes, which may lead to reversible as well as irreversible metal binding. Precise Mn 2 +-binding affinity of the protein was determined from the isothermal titration calorimetry experiments using a competition approach. Differential scanning calorimetry experiments confirmed that divalent metals can indeed bind to MntC reversibly as well as irreversibly. Finally, Mn 2 +-induced structural and dynamics changes have been characterized using spectroscopic methods and deuterium–hydrogen exchange mass spectroscopy. Results of the experiments show that these changes are minimal and are largely restricted to the structural elements involved in metal coordination. Therefore, it is unlikely that antibody binding to this antigen will be affected by the occupancy of the metal-binding site by Mn 2 +.« less

Use of 2-(/sup 125/I)iodomelatonin to characterize melatonin binding sites in chicken retina

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dubocovich, M.L.; Takahashi, J.S.

2-(/sup 125/I)Iodomelatonin binds with high affinity to a site possessing the pharmacological characteristics of a melatonin receptor in chicken retinal membranes. The specific binding of 2-(/sup 125/I)iodomelatonin is stable, saturable, and reversible. Saturation experiments indicated that 2-(/sup 125/I)iodomelatonin labeled a single class of sites with an affinity constant (Kd) of 434 +/- 56 pM and a total number of binding sites (Bmax) of 74.0 +/- 13.6 fmol/mg of protein. The affinity constant obtained from kinetic analysis was in close agreement with that obtained in saturation experiments. Competition experiments showed a monophasic reduction of 2-(/sup 125/I)iodomelatonin binding with a pharmacological ordermore » of indole amine affinities characteristic of a melatonin receptor: 2-iodomelatonin greater than 6-chloromelatonin greater than or equal to melatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 6-hydroxymelatonin greater than or equal to 6-methoxymelatonin much greater than N-acetyltryptamine greater than N-acetyl-5-hydroxytryptamine greater than 5-methoxytryptamine greater than 5-hydroxytryptamine (inactive). The affinities of these melatonin analogs in competing for 2-(/sup 125/I)iodomelatonin binding sites were correlated closely with their potencies for inhibition of the calcium-dependent release of (3H)dopamine from chicken and rabbit retinas, indicating association of the binding site with a functional response regulated by melatonin. The results indicate that 2-(/sup 125/I)iodomelatonin is a selective, high-affinity radioligand for the identification and characterization of melatonin receptor sites.« less

"Life-span development of visual working memory: When is feature binding difficult?": Correction to Cowan et al. (2006).

PubMed

2016-10-01

Reports an error in "Life-span development of visual working memory: When is feature binding difficult?" by Nelson Cowan, Moshe Naveh-Benjamin, Angela Kilb and J. Scott Saults ( Developmental Psychology , 2006[Nov], Vol 42[6], 1089-1102). In the article, there were two errors in experiment 1a. The mean for color item information in older adults was incorrectly calculated. As a result, Figure 3 shows a mean of over .70. The true mean was .63 ( SEM =.04). This change diminishes the magnitude of the aging deficit for associative information, although this deficit still appears to remain, to a smaller extent. (For a conceptual replication see Peterson & Naveh-Benjamin, 2016). There also was an error in the experimental procedure of Experiment 1a. The older adults in that experiment received only half the number of trials specified in the methods section, and half as much as the other groups. For all groups, when there were 4 or 6 items and the probe was a binding change, the probed location was matched by the same color at 1 other location but, when there were 8 or 10 squares, the probed location was matched by the same color at 1, 2, or 3 other locations. For 8 squares the number of trials was identical for these three trial subtypes whereas, for 10 squares, most of the trials had the same color at just 1 other location. These errors suggest that the experiment should be taken as only preliminary evidence that there is an aging deficit in color-location binding in visual working memory when color and binding trials are mixed in the same trial blocks. (The following abstract of the original article appeared in record 2006-20488-009.) We asked whether the ability to keep in working memory the binding between a visual object and its spatial location changes with development across the life span more than memory for item information. Paired arrays of colored squares were identical or differed in the color of one square, and in the latter case, the changed color was unique on that trial (item change) or was duplicated elsewhere in the array (color-location binding change). Children (8-10 and 11-12 years old) and older adults (65-85 years old) showed deficits relative to young adults. These were only partly simulated by dividing attention in young adults. The older adults had an additional deficiency, specifically in binding information, which was evident only when item- and binding-change trials were mixed together. In that situation, the older adults often overlooked the more subtle, binding-type changes. Some working memory processes related to binding undergo life-span development in an inverted-U shape, whereas other, bias- and salience-related processes that influence the use of binding information seem to develop monotonically. PsycINFO Database Record (c) 2016 APA, all rights reserved

Insights into the interaction of methotrexate and human serum albumin: A spectroscopic and molecular modeling approach.

PubMed

Cheng, Li-Yang; Fang, Min; Bai, Ai-Min; Ouyang, Yu; Hu, Yan-Jun

2017-08-01

In this study, fluorescence spectroscopy and molecular modeling approaches were employed to investigate the binding of methotrexate to human serum albumin (HSA) under physiological conditions. From the mechanism, it was demonstrated that fluorescence quenching of HSA by methotrexate results from the formation of a methotrexate/HSA complex. Binding parameters calculated using the Stern-Volmer method and the Scatchard method showed that methotrexate binds to HSA with binding affinities in the order 10 4  L·mol -1 . Thermodynamic parameter studies revealed that the binding reaction is spontaneous, and that hydrogen bonds and van der Waals interactions play a major role in the reaction. Site marker competitive displacement experiments and a molecular modeling approach demonstrated that methotrexate binds with appropriate affinity to site I (subdomain IIA) of HSA. Furthermore, we discuss some factors that influence methotrexate binding to HSA. Copyright © 2017 John Wiley & Sons, Ltd.

Lack of color integration in visual short-term memory binding.

PubMed

Parra, Mario A; Cubelli, Roberto; Della Sala, Sergio

2011-10-01

Bicolored objects are retained in visual short-term memory (VSTM) less efficiently than unicolored objects. This is unlike shape-color combinations, whose retention in VSTM does not differ from that observed for shapes only. It is debated whether this is due to a lack of color integration and whether this may reflect the function of separate memory mechanisms. Participants judged whether the colors of bicolored objects (each with an external and an internalcolor) were the same or different across two consecutive screens. Colors had to be remembered either individually or in combination. In Experiment 1, external colors in the combined colors condition were remembered better than the internal colors, and performance for both was worse than that in the individual colors condition. The lack of color integration observed in Experiment 1 was further supported by a reduced capacity of VSTM to retain color combinations, relative to individual colors (Experiment 2). An additional account was found in Experiment 3, which showed spared color-color binding in the presence of impaired shape-color binding in a brain-damaged patient, thus suggesting that these two memory mechanisms are different.

Insulin receptor in mouse neuroblastoma cell line N18TG2: binding properties and visualization with colloidal gold.

PubMed

Sartori, C; Stefanini, S; Bernardo, A; Augusti-Tocco, G

1992-08-01

Insulin function in the nervous system is still poorly understood. Possible roles as a neuromodulator and as a growth factor have been proposed (Baskin et al., 1987, Ann. Rev. Physiol. 49, 335-347). Stable cell lines may provide an appropriate experimental system for the analysis of insulin action on the various cellular components of the central nervous system. We report here a study to investigate the presence and the properties of insulin specific binding sites in the murine neuroblastoma line, N18TG2, together with insulin action on cell growth and metabolism. Also, receptor internalization has been studied. Binding experiments, carried out in standard conditions at 20 degrees C, enabled us to demonstrate that these cells bind insulin in a specific manner, thus confirming previous findings on other cell lines. Saturation curves showed the presence of two binding sites with Kd 0.3 and 9.7 nM. Competition experiments with porcine and bovine insulin showed an IC50 of 1 and 10 nM, respectively. Competition did not occur in the presence of the unrelated hormones ACTH and FSH. Dissociation experiments indicated the existence of an internalization process of the ligand-receptor complex; this was confirmed by an ultrastructural study using gold conjugated insulin. As far as the insulin action in N18TG2 cells is concerned, physiological concentrations stimulate cell proliferation, whereas no stimulation of glucose uptake was observed, indicating that insulin action in these cells is not mediated by general metabolic effects. On the basis of these data, N18TG2 line appears to be a very suitable model for further studies of the neuronal type insulin receptors, and possibly insulin specific action on the nervous system.

Revealing Ligand Binding Sites and Quantifying Subunit Variants of Noncovalent Protein Complexes in a Single Native Top-Down FTICR MS Experiment

NASA Astrophysics Data System (ADS)

Li, Huilin; Wongkongkathep, Piriya; Van Orden, Steve L.; Ogorzalek Loo, Rachel R.; Loo, Joseph A.

2014-12-01

"Native" mass spectrometry (MS) has been proven to be increasingly useful for structural biology studies of macromolecular assemblies. Using horse liver alcohol dehydrogenase (hADH) and yeast alcohol dehydrogenase (yADH) as examples, we demonstrate that rich information can be obtained in a single native top-down MS experiment using Fourier transform ion cyclotron mass spectrometry (FTICR MS). Beyond measuring the molecular weights of the protein complexes, isotopic mass resolution was achieved for yeast ADH tetramer (147 kDa) with an average resolving power of 412,700 at m/z 5466 in absorption mode, and the mass reflects that each subunit binds to two zinc atoms. The N-terminal 89 amino acid residues were sequenced in a top-down electron capture dissociation (ECD) experiment, along with the identifications of the zinc binding site at Cys46 and a point mutation (V58T). With the combination of various activation/dissociation techniques, including ECD, in-source dissociation (ISD), collisionally activated dissociation (CAD), and infrared multiphoton dissociation (IRMPD), 40% of the yADH sequence was derived directly from the native tetramer complex. For hADH, native top-down ECD-MS shows that both E and S subunits are present in the hADH sample, with a relative ratio of 4:1. Native top-down ISD of the hADH dimer shows that each subunit (E and S chains) binds not only to two zinc atoms, but also the NAD/NADH ligand, with a higher NAD/NADH binding preference for the S chain relative to the E chain. In total, 32% sequence coverage was achieved for both E and S chains.

Characterization of lithium coordination sites with magic-angle spinning NMR

NASA Astrophysics Data System (ADS)

Haimovich, A.; Goldbourt, A.

2015-05-01

Lithium, in the form of lithium carbonate, is one of the most common drugs for bipolar disorder. Lithium is also considered to have an effect on many other cellular processes hence it possesses additional therapeutic as well as side effects. In order to quantitatively characterize the binding mode of lithium, it is required to identify the interacting species and measure their distances from the metal center. Here we use magic-angle spinning (MAS) solid-state NMR to study the binding site of lithium in complex with glycine and water (LiGlyW). Such a compound is a good enzyme mimetic since lithium is four-coordinated to one water molecule and three carboxylic groups. Distance measurements to carbons are performed using a 2D transferred echo double resonance (TEDOR) MAS solid-state NMR experiment, and water binding is probed by heteronuclear high-resolution proton-lithium and proton-carbon correlation (wPMLG-HETCOR) experiments. Both HETCOR experiments separate the main complex from impurities and non-specifically bound lithium species, demonstrating the sensitivity of the method to probe the species in the binding site. Optimizations of the TEDOR pulse scheme in the case of a quadrupolar nucleus with a small quadrupole coupling constant show that it is most efficient when pulses are positioned on the spin-1/2 (carbon-13) nucleus. Since the intensity of the TEDOR signal is not normalized, careful data analysis that considers both intensity and dipolar oscillations has to be performed. Nevertheless we show that accurate distances can be extracted for both carbons of the bound glycine and that these distances are consistent with the X-ray data and with lithium in a tetrahedral environment. The lithium environment in the complex is very similar to the binding site in inositol monophosphatase, an enzyme associated with bipolar disorder and the putative target for lithium therapy. A 2D TEDOR experiment applied to the bacterial SuhB gene product of this enzyme was designed to probe direct correlations between lithium, the enzyme inhibitor, and the closest carboxyl carbons of the binding site. At this point, the chemical shift of the bound carboxyl groups in this 29 kDa enzyme could be determined.

Unconscious Familiarity-based Color-Form Binding: Evidence from Visual Extinction.

PubMed

Rappaport, Sarah J; Riddoch, M Jane; Chechlacz, Magda; Humphreys, Glyn W

2016-03-01

There is good evidence that early visual processing involves the coding of different features in independent brain regions. A major question, then, is how we see the world in an integrated manner, in which the different features are "bound" together. A standard account of this has been that feature binding depends on attention to the stimulus, which enables only the relevant features to be linked together [Treisman, A., & Gelade, G. A feature-integration theory of attention. Cognitive Psychology, 12, 97-136, 1980]. Here we test this influential idea by examining whether, in patients showing visual extinction, the processing of otherwise unconscious (extinguished) stimuli is modulated by presenting objects in their correct (familiar) color. Correctly colored objects showed reduced extinction when they had a learned color, and this color matched across the ipsi- and contralesional items (red strawberry + red tomato). In contrast, there was no reduction in extinction under the same conditions when the stimuli were colored incorrectly (blue strawberry + blue tomato; Experiment 1). The result was not due to the speeded identification of a correctly colored ipsilesional item, as there was no benefit from having correctly colored objects in different colors (red strawberry + yellow lemon; Experiment 2). There was also no benefit to extinction from presenting the correct colors in the background of each item (Experiment 3). The data suggest that learned color-form binding can reduce extinction even when color is irrelevant for the task. The result is consistent with preattentive binding of color and shape for familiar stimuli.

Optical Sensing of Aromatic Amino Acids and Dipeptides by a Crown-Ether-Functionalized Perylene Bisimide Fluorophore.

PubMed

Weißenstein, Annike; Saha-Möller, Chantu R; Würthner, Frank

2018-06-04

The host-guest binding properties of a fluorescent perylene bisimide (PBI) receptor equipped with crown ether were studied in detail with a series of aromatic amino acids and dipeptides by UV/Vis, fluorescence and NMR spectroscopy. Fluorescence titration experiments showed that electron-rich aromatic amino acids and dipeptides strongly quench the fluorescence of the electron-poor PBI host molecule. Benesi-Hildebrand plots of fluorescence titration data confirmed the formation of host-guest complexes with 1:2 stoichiometry. Binding constants determined by global analysis of UV/Vis and fluorescence titration experiments revealed values between 10 3  m -1 and 10 5  m -1 in acetonitrile/methanol (9:1) at 23 °C. These data showed that amino acid l-Trp having an indole group and dipeptides containing this amino acid bind to the PBI receptor more strongly than other amino acids and dipeptides investigated here. For dipeptides containing l-Trp or l-Tyr, the binding strength is dependent on the distance between the ammonium group and the aromatic unit of the amino acids and dipeptides leading to a strong sensitivity for Ala-Trp dipeptide. 1D and 2D NMR experiments also corroborated 1:2 host-guest complexation and indicated formation of two diastereomeric species of host-guest complexes. The studies have shown that a properly functionalized PBI fluorophore functions as a molecular probe for the optical sensing of aromatic amino acids and dipeptides. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Personality and intentional binding: an exploratory study using the narcissistic personality inventory

PubMed Central

Hascalovitz, Ann (Chen); Obhi, Sukhvinder S.

2015-01-01

When an individual estimates the temporal interval between a voluntary action and a consequent effect, their estimates are shorter than the real duration. This perceived shortening has been termed “intentional binding”, and is often due to a shift in the perception of a voluntary action forward towards the effect and a shift in the perception of the effect back towards the action. Despite much work on binding, there is virtually no consideration of individual/personality differences and how they affect it. Narcissism is a psychological trait associated with an inflated sense of self, and individuals higher in levels of subclinical narcissism tend to see themselves as highly effective agents. Conversely, lower levels of narcissism may be associated with a reduced sense of agency. In this exploratory study, to assess whether individuals with different scores on a narcissism scale are associated with differences in intentional binding, we compared perceived times of actions and effects (tones) between participants with high, middle, and low scores on the narcissistic personality inventory (NPI). We hypothesized that participants with higher scores would show increased binding compared to participants with lower scores. We found that participants in our middle and high groups showed a similar degree of binding, which was significantly greater than the level of binding shown by participants with the lowest scores. To our knowledge, these results are the first to demonstrate that different scores on a personality scale are associated with changes in the phenomenological experience of action, and therefore underscore the importance of considering individual/personality differences in the study of volition. Our results also reinforce the notion that intentional binding is related to agency experience. PMID:25698952

Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

PubMed

Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

2016-03-01

Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

Monitoring binding affinity between drug and α1-acid glycoprotein in real time by Venturi easy ambient sonic-spray ionization mass spectrometry.

PubMed

Liu, Ning; Lu, Xin; Yang, YuHan; Yao, Chen Xi; Ning, BaoMing; He, Dacheng; He, Lan; Ouyang, Jin

2015-10-01

A new approach for monitoring the binding affinity between drugs and alpha 1-acid glycoprotein in real time was developed based on a combination of drug-protein reaction followed by Venturi easy ambient sonic-spray ionization mass spectrometry determination of the free drug concentrations. A known basic drug, propranolol was used to validate the new built method. Binding constant values calculated by venturi easy ambient sonic-spray ionization mass spectrometry was in good accordance with a traditional ultrafiltration combined with high performance liquid chromatography method. Then six types of basic drugs were used as the samples to conduct the real time analysis. Upon injection of alpha 1-acid glycoprotein to the drug mixture, the ion chromatograms were extracted to show the changes in the free drug concentrations in real time. By observing the drop-out of six types of drugs during the whole binding reaction, the binding affinities of different drugs were distinguished. A volume shift validating experiment and an injection delay correcting experiment were also performed to eliminate extraneous factors and verify the reliability of our experiment. Therefore, the features of Venturi easy ambient sonic-spray ionization mass spectrometry (V-EASI-MS) and the experimental results indicate that our technique is likely to become a powerful tool for monitoring drug-AGP binding affinity in real time. Copyright © 2015 Elsevier B.V. All rights reserved.

[(3)H]8-Ethyl-4-methyl-2-phenyl-(8R)-4,5,7,8-tetrahydro-1H-imidazo[2,1-i]-purin-5-one ([(3)H]PSB-11), a novel high-affinity antagonist radioligand for human A(3) adenosine receptors.

PubMed

Müller, Christa E; Diekmann, Martina; Thorand, Mark; Ozola, Vita

2002-02-11

This study describes the preparation and binding properties of [(3)H]PSB-11, a novel, potent, and selective antagonist radioligand for human A(3) adenosine receptors (ARs). [(3)H]PSB-11 binding to membranes of Chinese hamster ovary (CHO) cells expressing the human A(3) AR was saturable and reversible. Saturation experiments showed that [(3)H]PSB-11 labeled a single class of binding sites with high affinity (K(D)=4.9 nM) and limited capacity (B(max)=3500 fmol/mg of protein). PSB-11 is highly selective versus the other adenosine receptor subtypes. The new radioligand shows an extraordinarily low degree of non-specific binding rendering it a very useful tool for studying the (patho)physiological roles of A(3 )ARs.

Mevalonate 5-diphosphate mediates ATP binding to the mevalonate diphosphate decarboxylase from the bacterial pathogen Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Chun-Liang; Mermoud, James C.; Paul, Lake N.

The mevalonate pathway produces isopentenyl diphosphate (IPP), a building block for polyisoprenoid synthesis, and is a crucial pathway for growth of the human bacterial pathogen Enterococcus faecalis. The final enzyme in this pathway, mevalonate diphosphate decarboxylase (MDD), acts on mevalonate diphosphate (MVAPP) to produce IPP while consuming ATP. This essential enzyme has been suggested as a therapeutic target for the treatment of drug-resistant bacterial infections. Here, we report functional and structural studies on the mevalonate diphosphate decarboxylase from E. faecalis (MDDEF). The MDDEF crystal structure in complex with ATP (MDDEF–ATP) revealed that the phosphate-binding loop (amino acids 97–105) is notmore » involved in ATP binding and that the phosphate tail of ATP in this structure is in an outward-facing position pointing away from the active site. This suggested that binding of MDDEF to MVAPP is necessary to guide ATP into a catalytically favorable position. Enzymology experiments show that the MDDEF performs a sequential ordered bi-substrate reaction with MVAPP as the first substrate, consistent with the isothermal titration calorimetry (ITC) experiments. On the basis of ITC results, we propose that this initial prerequisite binding of MVAPP enhances ATP binding. In summary, our findings reveal a substrate-induced substrate-binding event that occurs during the MDDEF-catalyzed reaction. The disengagement of the phosphate-binding loop concomitant with the alternative ATP-binding configuration may provide the structural basis for antimicrobial design against these pathogenic enterococci.« less

Microfluidic experiments reveal that antifreeze proteins bound to ice crystals suffice to prevent their growth

PubMed Central

Celik, Yeliz; Drori, Ran; Pertaya-Braun, Natalya; Altan, Aysun; Barton, Tyler; Bar-Dolev, Maya; Groisman, Alex; Davies, Peter L.; Braslavsky, Ido

2013-01-01

Antifreeze proteins (AFPs) are a subset of ice-binding proteins that control ice crystal growth. They have potential for the cryopreservation of cells, tissues, and organs, as well as for production and storage of food and protection of crops from frost. However, the detailed mechanism of action of AFPs is still unclear. Specifically, there is controversy regarding reversibility of binding of AFPs to crystal surfaces. The experimentally observed dependence of activity of AFPs on their concentration in solution appears to indicate that the binding is reversible. Here, by a series of experiments in temperature-controlled microfluidic devices, where the medium surrounding ice crystals can be exchanged, we show that the binding of hyperactive Tenebrio molitor AFP to ice crystals is practically irreversible and that surface-bound AFPs are sufficient to inhibit ice crystal growth even in solutions depleted of AFPs. These findings rule out theories of AFP activity relying on the presence of unbound protein molecules. PMID:23300286

The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site.

PubMed

Bae, Jae Hyun; Lew, Erin Denise; Yuzawa, Satoru; Tomé, Francisco; Lax, Irit; Schlessinger, Joseph

2009-08-07

SH2 domain-mediated interactions represent a crucial step in transmembrane signaling by receptor tyrosine kinases. SH2 domains recognize phosphotyrosine (pY) in the context of particular sequence motifs in receptor phosphorylation sites. However, the modest binding affinity of SH2 domains to pY containing peptides may not account for and likely represents an oversimplified mechanism for regulation of selectivity of signaling pathways in living cells. Here we describe the crystal structure of the activated tyrosine kinase domain of FGFR1 in complex with a phospholipase Cgamma fragment. The structural and biochemical data and experiments with cultured cells show that the selectivity of phospholipase Cgamma binding and signaling via activated FGFR1 are determined by interactions between a secondary binding site on an SH2 domain and a region in FGFR1 kinase domain in a phosphorylation independent manner. These experiments reveal a mechanism for how SH2 domain selectivity is regulated in vivo to mediate a specific cellular process.

Copper binding affinity of the C2B domain of synaptotagmin-1 and its potential role in the nonclassical secretion of Acidic Fibroblast Growth Factor

PubMed Central

Jayanthi, Srinivas; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy; Furr, Mercede; Daily, Anna; Thurman, Ryan; Rutherford, Lindsay; Chandrashekar, Reena; Adams, Paul; Prudovsky, Igor; Suresh Kumar, Thallapuranam Krishnaswamy

2014-01-01

Fibroblast growth factor 1 (FGF1) is a heparin-binding proangiogenic protein. FGF1 lacks the conventional N-terminal signal peptide required for secretion through the endoplasmic reticulum (ER) -Golgi secretory pathway. FGF1 is released through a Cu2+ - mediated nonclassical secretion pathway. The secretion of FGF1 involves the formation of a Cu2+- mediated multiprotein release complex (MRC) including FGF1, S100A13 (a calcium-binding protein) and p40 synaptotagmin (Syt1). It is believed that binding of Cu2+ to the C2B domain is important for the release of FGF1 in to the extracellular medium. In this study, using a variety of biophysical studies, Cu2+ and lipid interactions of the C2B domain of Syt1were characterized. Isothermal titration calorimetry (ITC) experiments reveal that C2B domain binds to Cu2+ in a biphasic manner involving an initial endothermic and a subsequent exothermic phase. Fluorescence energy transfer experiments using Tb3+ show that there are two Cu2+- binding pockets on the C2B domain, and one of these is also a Ca2+- binding site. Lipid-binding studies using ITC demonstrate that the C2B domain preferentially binds to small unilamellar vesicles of phosphatidyl serine (PS). Results of the differential scanning calorimetry and limited trypsin digestion experiments suggest that C2B domain is marginally destabilized upon binding to PS vesicles. These results, for the first time, suggest that the main role of the C2B domain of Syt1 is to serve as an anchor for the FGF1 MRC on the membrane bilayer. In addition, binding of the C2B domain to the lipid bilayer is shown to significantly decrease the binding affinity of the protein to Cu2+. The study provides valuable insights on the sequence of structural events that occur in the nonclassical secretion of FGF1. PMID:25224745

Direct Measurement of the Nanomechanical Stability of a Redox Protein Active Site and Its Dependence upon Metal Binding.

PubMed

Giannotti, Marina I; Cabeza de Vaca, Israel; Artés, Juan M; Sanz, Fausto; Guallar, Victor; Gorostiza, Pau

2015-09-10

The structural basis of the low reorganization energy of cupredoxins has long been debated. These proteins reconcile a conformationally heterogeneous and exposed metal-chelating site with the highly rigid copper center required for efficient electron transfer. Here we combine single-molecule mechanical unfolding experiments with statistical analysis and computer simulations to show that the metal-binding region of apo-azurin is mechanically flexible and that high mechanical stability is imparted by copper binding. The unfolding pathway of the metal site depends on the pulling residue and suggests that partial unfolding of the metal-binding site could be facilitated by the physical interaction with certain regions of the redox protein.

Molecular simulations of multimodal ligand-protein binding: elucidation of binding sites and correlation with experiments.

PubMed

Freed, Alexander S; Garde, Shekhar; Cramer, Steven M

2011-11-17

Multimodal chromatography, which employs more than one mode of interaction between ligands and proteins, has been shown to have unique selectivity and high efficacy for protein purification. To test the ability of free solution molecular dynamics (MD) simulations in explicit water to identify binding regions on the protein surface and to shed light on the "pseudo affinity" nature of multimodal interactions, we performed MD simulations of a model protein ubiquitin in aqueous solution of free ligands. Comparisons of MD with NMR spectroscopy of ubiquitin mutants in solutions of free ligands show a good agreement between the two with regard to the preferred binding region on the surface of the protein and several binding sites. MD simulations also identify additional binding sites that were not observed in the NMR experiments. "Bound" ligands were found to be sufficiently flexible and to access a number of favorable conformations, suggesting only a moderate loss of ligand entropy in the "pseudo affinity" binding of these multimodal ligands. Analysis of locations of chemical subunits of the ligand on the protein surface indicated that electrostatic interaction units were located on the periphery of the preferred binding region on the protein. The analysis of the electrostatic potential, the hydrophobicity maps, and the binding of both acetate and benzene probes were used to further study the localization of individual ligand moieties. These results suggest that water-mediated electrostatic interactions help the localization and orientation of the MM ligand to the binding region with additional stability provided by nonspecific hydrophobic interactions.

Optimization of reverse chemical ecology method: false positive binding of Aenasius bambawalei odorant binding protein 1 caused by uncertain binding mechanism.

PubMed

Li, Q L; Yi, S C; Li, D Z; Nie, X P; Li, S Q; Wang, M-Q; Zhou, A M

2018-06-01

Odorant binding proteins (OBPs) are considered as the core molecular targets in reverse chemical ecology, which is a convenient and efficient method by which to screen potential semiochemicals. Herein, we identified a classic OBP, AbamOBP1 from Aenasius bambawalei, which showed high mRNA expression in male antennae. Fluorescence competitive binding assay (FCBA) results demonstrated that AbamOBP1 has higher binding affinity with ligands at acid pH, suggesting the physiologically inconsistent binding affinity of this protein. Amongst the four compounds with the highest binding affinities at acid pH, 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one were shown to have attractant activity for male adults, whereas (-)-limonene and an analogue of 1-octen-3-ol exhibited nonbehavioural activity. Further homology modelling and fluorescence quenching experiments demonstrated that the stoichiometry of the binding of this protein to these ligands was not 1: 1, suggesting that the results of FCBA were false. In contrast, the apparent association constants (Ka) of fluorescence quenching experiments seemed to be more reliable, because 2, 4, 4-trimethyl-2-pentene and 1-octen-3-one had observably higher Ka than (-)-limonene and 1-octen-3-ol at neutral pH. Based on the characteristics of different OBPs, various approaches should be applied to study their binding affinities with ligands, which could modify and complement the results of FCBA and contribute to the application of reverse chemical ecology. © 2018 The Royal Entomological Society.

Affinity to bovine serum albumin and anticancer activity of some new water-soluble metal Schiff base complexes

NASA Astrophysics Data System (ADS)

Asadi, Mozaffar; Asadi, Zahra; Zarei, Leila; Sadi, Somaye Barzegar; Amirghofran, Zahra

2014-12-01

Metal Schiff-base complexes show biological activity but they are usually insoluble in water so four new water-soluble metal Schiff base complexes of Na2[M(5-SO3-1,2-salben]; (5-SO3-1,2-salben denoted N,N";-bis(5-sulphosalicyliden)-1,2-diaminobenzylamine and M = Mg, Mn, Cu, Zn) were synthesized and characterized. The formation constants of the metal complexes were determined by UV-Vis absorption spectroscopy. The interaction of these complexes with bovine serum albumin (BSA) was studied by fluorescence spectroscopy. Type of quenching, binding constants, number of binding sites and binding stoichiometries were determined by fluorescence quenching method. The results showed that the mentioned complexes strongly bound to BSA. Thermodynamic parameters indicated that hydrophobic association was the major binding force and that the interaction was entropy driven and enthalpically disfavoured. The displacement experiment showed that these complexes could bind to the subdomain IIA (site I) of albumin. Furthermore the synchronous fluorescence spectra showed that the microenvironment of the tryptophan residues was not apparently changed. Based on the Förster theory of non-radiation energy transfer, the distance between the donor (Trp residues) and the acceptor metal complexes was obtained. The growth inhibitory effect of complexes toward the K562 cancer cell line was measured.

Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-binding Module*

PubMed Central

Taylor, Courtney B.; Talib, M. Faiz; McCabe, Clare; Bu, Lintao; Adney, William S.; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

2012-01-01

Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3–6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function. PMID:22147693

Interaction of lafutidine in binding to human serum albumin in gastric ulcer therapy: STD-NMR, WaterLOGSY-NMR, NMR relaxation times, Tr-NOESY, molecule docking, and spectroscopic studies.

PubMed

Yang, Hongqin; Huang, Yanmei; He, Jiawei; Li, Shanshan; Tang, Bin; Li, Hui

2016-09-15

In this study, lafutidine (LAF) was used as a model compound to investigate the binding mechanism between antiulcer drugs and human serum albumin (HSA) through various techniques, including STD-NMR, WaterLOGSY-NMR, (1)H NMR relaxation times, tr-NOESY, molecule docking calculation, FT-IR spectroscopy, and CD spectroscopy. The analyses of STD-NMR, which derived relative STD (%) intensities, and WaterLOGSY-NMR, determined that LAF bound to HSA. In particular, the pyridyl group of LAF was in close contact with HSA binding pocket, whereas furyl group had a secondary binding. Competitive STD-NMR and WaterLOGSY-NMR experiments, with warifarin and ibuprofen as site-selective probes, indicated that LAF preferentially bound to site II in the hydrophobic subdomains IIIA of HSA. The bound conformation of LAF at the HSA binding site was further elucidated by transferred NOE effect (tr-NOESY) experiment. Relaxation experiments provided quantitative information about the relationship between the affinity and structure of LAF. The molecule docking simulations conducted with AutoDock and the restraints derived from STD results led to three-dimensional models that were consistent with the NMR spectroscopic data. The presence of hydrophobic forces and hydrogen interactions was also determined. Additionally, FT-IR and CD spectroscopies showed that LAF induced secondary structure changes of HSA. Copyright © 2016 Elsevier Inc. All rights reserved.

In vivo and in vitro changes in neurochemical parameters related to mercury concentrations from specific brain regions of polar bears (Ursus maritimus).

PubMed

Krey, Anke; Kwan, Michael; Chan, Hing Man

2014-11-01

Mercury (Hg) has been detected in polar bear brain tissue, but its biological effects are not well known. Relationships between Hg concentrations and neurochemical enzyme activities and receptor binding were assessed in the cerebellum, frontal lobes, and occipital lobes of 24 polar bears collected from Nunavik (Northern Quebec), Canada. The concentration-response relationship was further studied with in vitro experiments using pooled brain homogenate of 12 randomly chosen bears. In environmentally exposed brain samples, there was no correlative relationship between Hg concentration and cholinesterase (ChE) activity or muscarinic acetylcholine receptor (mAChR) binding in any of the 3 brain regions. Monoamine oxidase (MAO) activity in the occipital lobe showed a negative correlative relationship with total Hg concentration. In vitro experiments, however, demonstrated that Hg (mercuric chloride and methylmercury chloride) can inhibit ChE and MAO activities and muscarinic mAChR binding. These results show that Hg can alter neurobiochemical parameters but the current environmental Hg exposure level does have an effect on the neurochemistry of polar bears from northern Canada. © 2014 SETAC.

D-glucose derived novel gemini surfactants: synthesis and study of their surface properties, interaction with DNA, and cytotoxicity.

PubMed

Kumar, Vikash; Chatterjee, Amrita; Kumar, Nupur; Ganguly, Anasuya; Chakraborty, Indranil; Banerjee, Mainak

2014-10-09

Four new D-glucose derived m-s-m type gemini surfactants with variable spacer and tail length have been synthesized by a simple and efficient synthetic methodology utilizing the free C-3 hydroxy group of diisopropylidene glucose. The synthetic route to these gemini surfactants with a quaternary ammonium group as polar head group involves a sequence of simple reactions including alkylation, imine formation, quaternization of amine etc. The surface properties of the new geminis were evaluated by surface tension and conductivity measurements. These gemini surfactants showed low cytotoxicity by MTT assay on HeLa cell line. The DNA binding capabilities of these surfactants were determined by agarose gel electrophoresis, fluorescence titration, and DLS experiments. The preliminary studies by agarose gel electrophoresis indicated chain length dependent DNA binding abilities, further supported by ethidium bromide exclusion experiments. Two of the D-glucose derived gemini surfactants showed effective binding with pET-28a plasmid DNA (pDNA) at relatively low N/P ratio (i.e., cationic nitrogen/DNA phosphate molar ratio). Copyright © 2014 Elsevier Ltd. All rights reserved.

Structural changes in calcium-binding allergens: use of circular dichroism to study binding characteristics.

PubMed

Hebenstreit, D; Ferreira, F

2005-09-01

Several studies showed that calcium-binding proteins have a fixed place in the spectrum of allergenic substances. Often the binding of a calcium ion induces conformational changes and affects immunoglobulin E-binding to the allergen. Hence, the quantitative characterization of the binding to calcium is of importance to understand both the biologic and allergenic activity of these proteins. In the present study we describe a procedure for determining the stoichiometry and dissociation constant (K(D)) of calcium-binding allergens using circular dichroism (CD) techniques. For the experiments, we used recombinant Bet v 4, a two EF-hand allergen from birch pollen. Solutions of Bet v 4 were titrated with calcium and the change in molar ellipticity at 222 nm was monitored with a CD spectropolarimeter. The determination of the binding stoichiometry as well as of the K(D) for one EF-hand (4 microM) demonstrated the applicability of the method. CD-monitored calcium-titration of protein solutions represents a fast and easy method for determining the binding characteristics of calcium-binding allergens.

Predicting MHC-II binding affinity using multiple instance regression

PubMed Central

EL-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

2011-01-01

Reliably predicting the ability of antigen peptides to bind to major histocompatibility complex class II (MHC-II) molecules is an essential step in developing new vaccines. Uncovering the amino acid sequence correlates of the binding affinity of MHC-II binding peptides is important for understanding pathogenesis and immune response. The task of predicting MHC-II binding peptides is complicated by the significant variability in their length. Most existing computational methods for predicting MHC-II binding peptides focus on identifying a nine amino acids core region in each binding peptide. We formulate the problems of qualitatively and quantitatively predicting flexible length MHC-II peptides as multiple instance learning and multiple instance regression problems, respectively. Based on this formulation, we introduce MHCMIR, a novel method for predicting MHC-II binding affinity using multiple instance regression. We present results of experiments using several benchmark datasets that show that MHCMIR is competitive with the state-of-the-art methods for predicting MHC-II binding peptides. An online web server that implements the MHCMIR method for MHC-II binding affinity prediction is freely accessible at http://ailab.cs.iastate.edu/mhcmir. PMID:20855923

Object-based attention underlies the rehearsal of feature binding in visual working memory.

PubMed

Shen, Mowei; Huang, Xiang; Gao, Zaifeng

2015-04-01

Feature binding is a core concept in many research fields, including the study of working memory (WM). Over the past decade, it has been debated whether keeping the feature binding in visual WM consumes more visual attention than the constituent single features. Previous studies have only explored the contribution of domain-general attention or space-based attention in the binding process; no study so far has explored the role of object-based attention in retaining binding in visual WM. We hypothesized that object-based attention underlay the mechanism of rehearsing feature binding in visual WM. Therefore, during the maintenance phase of a visual WM task, we inserted a secondary mental rotation (Experiments 1-3), transparent motion (Experiment 4), or an object-based feature report task (Experiment 5) to consume the object-based attention available for binding. In line with the prediction of the object-based attention hypothesis, Experiments 1-5 revealed a more significant impairment for binding than for constituent single features. However, this selective binding impairment was not observed when inserting a space-based visual search task (Experiment 6). We conclude that object-based attention underlies the rehearsal of binding representation in visual WM. (c) 2015 APA, all rights reserved.

Pretargeting of carcinoembryonic antigen-expressing cancers with a trivalent bispecific fusion protein produced in myeloma cells.

PubMed

Rossi, Edmund A; Chang, Chien-Hsing; Losman, Michele J; Sharkey, Robert M; Karacay, Habibe; McBride, William; Cardillo, Thomas M; Hansen, Hans J; Qu, Zhengxing; Horak, Ivan D; Goldenberg, David M

2005-10-01

To characterize a novel trivalent bispecific fusion protein and evaluate its potential utility for pretargeted delivery of radionuclides to tumors. hBS14, a recombinant fusion protein that binds bispecifically to carcinoembryonic antigen (CEA) and the hapten, histamine-succinyl-glycine (HSG), was produced by transgenic myeloma cells and purified to near homogeneity in a single step using a novel HSG-based affinity chromatography system. Biochemical characterization included size-exclusion high-performance liquid chromatography (SE-HPLC), SDS-PAGE, and isoelectric focusing. Functional characterization was provided by BIAcore and SE-HPLC. The efficacy of hBS14 for tumor pretargeting was evaluated in CEA-expressing GW-39 human colon tumor-bearing nude mice using a bivalent HSG hapten (IMP-241) labeled with (111)In. Biochemical analysis showed that single-step affinity chromatography provided highly purified material. SE-HPLC shows a single protein peak consistent with the predicted molecular size of hBS14. SDS-PAGE analysis shows only two polypeptide bands, which are consistent with the calculated molecular weights of the hBS14 polypeptides. BIAcore showed the bispecific binding properties and suggested that hBS14 possesses two functional CEA-binding sites. This was supported by SE-HPLC immunoreactivity experiments. All of the data suggest that the structure of hBS14 is an 80 kDa heterodimer with one HSG and two CEA binding sites. Pretargeting experiments in the mouse model showed high uptake of radiopeptide in the tumor, with favorable tumor-to-nontumor ratios as early as 3 hours postinjection. The results indicate that hBS14 is an attractive candidate for use in a variety of pretargeting applications, particularly tumor therapy with radionuclides and drugs.

A Lysine at the C-Terminus of an Odorant-Binding Protein is Involved in Binding Aldehyde Pheromone Components in Two Helicoverpa Species

PubMed Central

Sun, Ya-Lan; Huang, Ling-Qiao; Pelosi, Paolo; Wang, Chen-Zhu

2013-01-01

Odorant-binding proteins (OBPs) are soluble proteins, whose role in olfaction of insects is being recognized as more and more important. We have cloned, expressed and purified an OBP (HarmOBP7) from the antennae of the moth Helicoverpa armigera. Western blot experiments indicate specific expression of this protein in the antennae of adults. HarmOBP7 binds both pheromone components Z-11-hexadecenal and Z-9-hexadecenal with good affinity. We have also performed a series of binding experiments with linear aldehydes, alcohols and esters, as well as with other compounds and found a requirement of medium size for best affinity. The affinity of OBP7, as well as that of a mutant lacking the last 6 residues does not substantially decrease in acidic conditions, but increases at basic pH values with no significant differences between wild-type and mutant. Binding to both pheromone components, instead, is negatively affected by the lack of the C-terminus. A second mutant, where one of the three lysine residues in the C-terminus (Lys123) was replaced by methionine showed reduced affinity to both pheromone components, as well as to their analogues, thus indicating that Lys123 is involved in binding these compounds, likely forming hydrogen bonds with the functional groups of the ligands. PMID:23372826

Absence of C-type natriuretic peptide receptors in hamster glomeruli.

PubMed

Luk, J K; Wong, E F; Wong, N L

1994-01-01

The distribution of atrial natriuretic peptide receptor B (ANPR-B) varies between tissues and species. The aim of this study is to determine whether ANPR-B is present in the hamster glomeruli. In vitro C-type natriuretic peptide (CNP)- and atrial natriuretic factor (ANF)-stimulated cGMP accumulation studies were performed in hamster glomeruli. Elevated cGMP accumulations were observed upon ANF addition. No cGMP response was seen with CNP. Competitive receptor-binding experiments were performed with 125I-CNP and 125I-ANF against their respective cold peptides in hamster glomeruli. Although no CNP binding was detected, positive ANF binding was found and two types of ANF receptor were demonstrated. The affinity (Kdl) and maximum binding capacity (Bmaxl) of the high-affinity ANF receptor were 0.014 +/- 0.001 nM and 60.4 +/- 10.2 fmol/mg protein, respectively. Those of the low-affinity receptor (Kd2 and Bmax2) were 45.7 +/- 6.2 nM and 28.3 +/- 6.3 pmol/mg protein, respectively. Similarly, saturation binding experiments also failed to show any CNP receptor binding in hamster glomeruli. This finding suggests that ANPR-B is not present in hamster glomeruli and CNP is not a direct physiological regulator of hamster renal function.

Dynein and dynactin leverage their bivalent character to form a high-affinity interaction.

PubMed

Siglin, Amanda E; Sun, Shangjin; Moore, Jeffrey K; Tan, Sarah; Poenie, Martin; Lear, James D; Polenova, Tatyana; Cooper, John A; Williams, John C

2013-01-01

Cytoplasmic dynein and dynactin participate in retrograde transport of organelles, checkpoint signaling and cell division. The principal subunits that mediate this interaction are the dynein intermediate chain (IC) and the dynactin p150(Glued); however, the interface and mechanism that regulates this interaction remains poorly defined. Herein, we use multiple methods to show the N-terminus of mammalian dynein IC, residues 10-44, is sufficient for binding p150(Glued). Consistent with this mapping, monoclonal antibodies that antagonize the dynein-dynactin interaction also bind to this region of the IC. Furthermore, double and triple alanine point mutations spanning residues 6 to 19 in the yeast IC homolog, Pac11, produce significant defects in spindle positioning. Using the same methods we show residues 381 to 530 of p150(Glued) form a minimal fragment that binds to the dynein IC. Sedimentation equilibrium experiments indicate that these individual fragments are predominantly monomeric, but admixtures of the IC and p150(Glued) fragments produce a 2:2 complex. This tetrameric complex is sensitive to salt, temperature and pH, suggesting that the binding is dominated by electrostatic interactions. Finally, circular dichroism (CD) experiments indicate that the N-terminus of the IC is disordered and becomes ordered upon binding p150(Glued). Taken together, the data indicate that the dynein-dynactin interaction proceeds through a disorder-to-order transition, leveraging its bivalent-bivalent character to form a high affinity, but readily reversible interaction.

Resveratrol post-transcriptionally regulates pro-inflammatory gene expression via regulation of KSRP RNA binding activity

PubMed Central

Bollmann, Franziska; Art, Julia; Henke, Jenny; Schrick, Katharina; Besche, Verena; Bros, Matthias; Li, Huige; Siuda, Daniel; Handler, Norbert; Bauer, Florian; Erker, Thomas; Behnke, Felix; Mönch, Bettina; Härdle, Lorena; Hoffmann, Markus; Chen, Ching-Yi; Förstermann, Ulrich; Dirsch, Verena M.; Werz, Oliver; Kleinert, Hartmut; Pautz, Andrea

2014-01-01

Resveratrol shows beneficial effects in inflammation-based diseases like cancer, cardiovascular and chronic inflammatory diseases. Therefore, the molecular mechanisms of the anti-inflammatory resveratrol effects deserve more attention. In human epithelial DLD-1 and monocytic Mono Mac 6 cells resveratrol decreased the expression of iNOS, IL-8 and TNF-α by reducing mRNA stability without inhibition of the promoter activity. Shown by pharmacological and siRNA-mediated inhibition, the observed effects are SIRT1-independent. Target-fishing and drug responsive target stability experiments showed selective binding of resveratrol to the RNA-binding protein KSRP, a central post-transcriptional regulator of pro-inflammatory gene expression. Knockdown of KSRP expression prevented resveratrol-induced mRNA destabilization in human and murine cells. Resveratrol did not change KSRP expression, but immunoprecipitation experiments indicated that resveratrol reduces the p38 MAPK-related inhibitory KSRP threonine phosphorylation, without blocking p38 MAPK activation or activity. Mutation of the p38 MAPK target site in KSRP blocked the resveratrol effect on pro-inflammatory gene expression. In addition, resveratrol incubation enhanced KSRP-exosome interaction, which is important for mRNA degradation. Finally, resveratrol incubation enhanced its intra-cellular binding to the IL-8, iNOS and TNF-α mRNA. Therefore, modulation of KSRP mRNA binding activity and, thereby, enhancement of mRNA degradation seems to be the common denominator of many anti-inflammatory effects of resveratrol. PMID:25352548

Isolation and characterization of a new zinc-binding protein from albacore tuna plasma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dyke, B.; Hegenauer, J.; Saltman, P.

1987-06-02

The protein responsible for sequestering high levels of zinc in the plasma of the albacore tuna (Thunnus alalunga) has been isolated by sequential chromatography. The glycoprotein has a molecular weight of 66,000. Approximately 8.2% of its amino acid residues are histidines. Equilibrium dialysis experiments show it to bind 3 mol of zinc/mol of protein. The stoichiometric constant for the association of zinc with a binding site containing three histidines was determined to be 10/sup 9.4/. This protein is different from albumin and represents a previously uncharacterized zinc transport protein.

Feature binding, attention and object perception.

PubMed Central

Treisman, A

1998-01-01

The seemingly effortless ability to perceive meaningful objects in an integrated scene actually depends on complex visual processes. The 'binding problem' concerns the way in which we select and integrate the separate features of objects in the correct combinations. Experiments suggest that attention plays a central role in solving this problem. Some neurological patients show a dramatic breakdown in the ability to see several objects; their deficits suggest a role for the parietal cortex in the binding process. However, indirect measures of priming and interference suggest that more information may be implicitly available than we can consciously access. PMID:9770223

Identical linkage and cooperativity of oxygen and carbon monoxide binding to Octopus dofleini hemocyanin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connelly, P.R.; Gill, S.J.; Miller, K.I.

1989-02-21

Employment of high-precision thin-layer methods has enabled detailed functional characterization of oxygen and carbon monoxide binding for (1) the fully assembled form with 70 binding sites and (2) the isolated chains with 7 binding sites of octopus dofleini hemocyanin. The striking difference in the cooperativities of the two ligands for the assembled decamer is revealed through an examination of the binding capacities and the partition coefficient, determined as functions of the activities of both ligands. A global analysis of the data sets supported by a two-state allosteric model assuming an allosteric unit of 7. Higher level allosteric interactions were notmore » indicated. This contrasts to results obtained for arthropod hemocyanins. Oxygen and carbon monoxide experiments performed on the isolated subunit chain confirmed the presence of functional heterogeneity reported previously. The analysis shows two types of binding sites in the ratio of 4:3.« less

Characterization of interaction between doxycycline and human serum albumin by capillary electrophoresis-frontal analysis.

PubMed

Sun, Hanwen; He, Pan

2009-06-01

The binding of doxycycline to HSA under simulated physiological conditions (pH 7.4, 67 mM phosphate, I=0.17, drug concentration 100 microM, HSA concentration up to 475 microM, 36.5 degrees C) was studied by CE-frontal analysis. The number of primary binding sites, binding constant and physiological protein-binding percentage were 1.9, 1.51 x 10(3) M(-1) and 59.80%, respectively. In addition, the thermodynamic parameters including enthalpy change (DeltaH), entropy change (DeltaS) and free energy change (DeltaG) of the reaction were obtained in order to characterize the acting forces between doxycycline and HSA. Furthermore, to better understand the nature of doxycycline-HSA binding and to get information about potential interaction with other drugs, displacement experiments were performed. The results showed that doxycycline binds at site II of HSA.

Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

PubMed Central

Pinkney, M; Hoggett, J G

1988-01-01

Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

PubMed

Pinkney, M; Hoggett, J G

1988-03-15

Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase.

Bindings in working memory: The role of object-based attention.

PubMed

Gao, Zaifeng; Wu, Fan; Qiu, Fangfang; He, Kaifeng; Yang, Yue; Shen, Mowei

2017-02-01

Over the past decade, it has been debated whether retaining bindings in working memory (WM) requires more attention than retaining constituent features, focusing on domain-general attention and space-based attention. Recently, we proposed that retaining bindings in WM needs more object-based attention than retaining constituent features (Shen, Huang, & Gao, 2015, Journal of Experimental Psychology: Human Perception and Performance, doi: 10.1037/xhp0000018 ). However, only unitized visual bindings were examined; to establish the role of object-based attention in retaining bindings in WM, more emperical evidence is required. We tested 4 new bindings that had been suggested requiring no more attention than the constituent features in the WM maintenance phase: The two constituent features of binding were stored in different WM modules (cross-module binding, Experiment 1), from auditory and visual modalities (cross-modal binding, Experiment 2), or temporally (cross-time binding, Experiments 3) or spatially (cross-space binding, Experiments 4-6) separated. In the critical condition, we added a secondary object feature-report task during the delay interval of the change-detection task, such that the secondary task competed for object-based attention with the to-be-memorized stimuli. If more object-based attention is required for retaining bindings than for retaining constituent features, the secondary task should impair the binding performance to a larger degree relative to the performance of constituent features. Indeed, Experiments 1-6 consistently revealed a significantly larger impairment for bindings than for the constituent features, suggesting that object-based attention plays a pivotal role in retaining bindings in WM.

Structure of AadA from Salmonella enterica: a monomeric aminoglycoside (3′′)(9) adenyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Yang; Näsvall, Joakim; Wu, Shiying

The crystal structure of the aminoglycoside-adenylating enzyme AadA is reported together with functional experiments providing insights into its oligomeric state, ligand binding and catalysis. Aminoglycoside resistance is commonly conferred by enzymatic modification of drugs by aminoglycoside-modifying enzymes such as aminoglycoside nucleotidyltransferases (ANTs). Here, the first crystal structure of an ANT(3′′)(9) adenyltransferase, AadA from Salmonella enterica, is presented. AadA catalyses the magnesium-dependent transfer of adenosine monophosphate from ATP to the two chemically dissimilar drugs streptomycin and spectinomycin. The structure was solved using selenium SAD phasing and refined to 2.5 Å resolution. AadA consists of a nucleotidyltransferase domain and an α-helical bundlemore » domain. AadA crystallizes as a monomer and is a monomer in solution as confirmed by small-angle X-ray scattering, in contrast to structurally similar homodimeric adenylating enzymes such as kanamycin nucleotidyltransferase. Isothermal titration calorimetry experiments show that ATP binding has to occur before binding of the aminoglycoside substrate, and structure analysis suggests that ATP binding repositions the two domains for aminoglycoside binding in the interdomain cleft. Candidate residues for ligand binding and catalysis were subjected to site-directed mutagenesis. In vivo resistance and in vitro binding assays support the role of Glu87 as the catalytic base in adenylation, while Arg192 and Lys205 are shown to be critical for ATP binding.« less

Mannose-binding lectin binds to Ebola and Marburg envelope glycoproteins, resulting in blocking of virus interaction with DC-SIGN and complement-mediated virus neutralization.

PubMed

Ji, Xin; Olinger, Gene G; Aris, Sheena; Chen, Ying; Gewurz, Henry; Spear, Gregory T

2005-09-01

Mannose-binding lectin (MBL), a serum lectin that mediates innate immune functions including activation of the lectin complement pathway, binds to carbohydrates expressed on some viral glycoproteins. In this study, the ability of MBL to bind to virus particles pseudotyped with Ebola and Marburg envelope glycoproteins was evaluated. Virus particles bearing either Ebola (Zaire strain) or Marburg (Musoke strain) envelope glycoproteins bound at significantly higher levels to immobilized MBL compared with virus particles pseudotyped with vesicular stomatitis virus glycoprotein or with no virus glycoprotein. As observed in previous studies, Ebola-pseudotyped virus bound to cells expressing the lectin DC-SIGN (dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin). However, pre-incubation of virus with MBL blocked DC-SIGN-mediated binding to cells, suggesting that the two lectins bind at the same or overlapping sites on the Ebola glycoprotein. Neutralization experiments showed that virus pseudotyped with Ebola or Marburg (Musoke) glycoprotein was neutralized by complement, while the Marburg (Ravn strain) glycoprotein-pseudotyped virus was less sensitive to neutralization. Neutralization was partially mediated through the lectin complement pathway, since a complement source deficient in MBL was significantly less effective at neutralizing viruses pseudotyped with filovirus glycoproteins and addition of purified MBL to the MBL-deficient complement increased neutralization. These experiments demonstrated that MBL binds to filovirus envelope glycoproteins resulting in important biological effects and suggest that MBL can interact with filoviruses during infection in humans.

Salt modulates the stability and lipid binding affinity of the adipocyte lipid-binding proteins

NASA Technical Reports Server (NTRS)

Schoeffler, Allyn J.; Ruiz, Carmen R.; Joubert, Allison M.; Yang, Xuemei; LiCata, Vince J.

2003-01-01

Adipocyte lipid-binding protein (ALBP or aP2) is an intracellular fatty acid-binding protein that is found in adipocytes and macrophages and binds a large variety of intracellular lipids with high affinity. Although intracellular lipids are frequently charged, biochemical studies of lipid-binding proteins and their interactions often focus most heavily on the hydrophobic aspects of these proteins and their interactions. In this study, we have characterized the effects of KCl on the stability and lipid binding properties of ALBP. We find that added salt dramatically stabilizes ALBP, increasing its Delta G of unfolding by 3-5 kcal/mol. At 37 degrees C salt can more than double the stability of the protein. At the same time, salt inhibits the binding of the fluorescent lipid 1-anilinonaphthalene-8-sulfonate (ANS) to the protein and induces direct displacement of the lipid from the protein. Thermodynamic linkage analysis of the salt inhibition of ANS binding shows a nearly 1:1 reciprocal linkage: i.e. one ion is released from ALBP when ANS binds, and vice versa. Kinetic experiments show that salt reduces the rate of association between ANS and ALBP while simultaneously increasing the dissociation rate of ANS from the protein. We depict and discuss the thermodynamic linkages among stability, lipid binding, and salt effects for ALBP, including the use of these linkages to calculate the affinity of ANS for the denatured state of ALBP and its dependence on salt concentration. We also discuss the potential molecular origins and potential intracellular consequences of the demonstrated salt linkages to stability and lipid binding in ALBP.

Salt Bridge Formation between the I-BAR Domain and Lipids Increases Lipid Density and Membrane Curvature.

PubMed

Takemura, Kazuhiro; Hanawa-Suetsugu, Kyoko; Suetsugu, Shiro; Kitao, Akio

2017-07-28

The BAR domain superfamily proteins sense or induce curvature in membranes. The inverse-BAR domain (I-BAR) is a BAR domain that forms a straight "zeppelin-shaped" dimer. The mechanisms by which IRSp53 I-BAR binds to and deforms a lipid membrane are investigated here by all-atom molecular dynamics simulation (MD), binding energy analysis, and the effects of mutation experiments on filopodia on HeLa cells. I-BAR adopts a curved structure when crystallized, but adopts a flatter shape in MD. The binding of I-BAR to membrane was stabilized by ~30 salt bridges, consistent with experiments showing that point mutations of the interface residues have little effect on the binding affinity whereas multiple mutations have considerable effect. Salt bridge formation increases the local density of lipids and deforms the membrane into a concave shape. In addition, the point mutations that break key intra-molecular salt bridges within I-BAR reduce the binding affinity; this was confirmed by expressing these mutants in HeLa cells and observing their effects. The results indicate that the stiffness of I-BAR is important for membrane deformation, although I-BAR does not act as a completely rigid template.

Magnetic, core-shell structured and surface molecularly imprinted polymers for the rapid and selective recognition of salicylic acid from aqueous solutions

NASA Astrophysics Data System (ADS)

Zhang, Zulei; Niu, Dechao; Li, Yongsheng; Shi, Jianlin

2018-03-01

In this work, a novel kind of magnetic, core-shell structured and surface molecularly imprinted polymers (MMIPs) for the recognition of salicylic acid (SA) was facilely synthesized through a surface imprinting and sol-gel polymerization approach. The as-synthesized MMIPs exhibit uniform core-shell structure and favorable magnetic properties with a saturation magnetization of 22.8 emu g-1. The binding experiments demonstrated that MMIPs possessed high binding and specific recognition capacity, as well as fast binding kinetics and phase separation rate. The maximum binding capacity of MMIPs is around 36.8 mg g-1, nearly 6 times that of the magnetic non-imprinted polymers (MNIPs). Moreover, the selectivity experiments show that all the relative selectivity coefficients towards SA over its structure analogs are higher than 18, further indicating the markedly enhanced binding selectivity of MMIPs. Furthermore, the MMIPs were successfully applied for the determination of SA in environmental water samples with the recovery rates ranging from 94.0 to 108.0 %. This strategy may provide a versatile approach for the fabrication of well-defined molecularly imprinted polymers on nanomaterials for the analysis of complicated matrixes.

Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor

PubMed Central

Kuban-Jankowska, Alicja; Sahu, Kamlesh K.; Gorska, Magdalena; Tuszynski, Jack A.; Wozniak, Michal

2016-01-01

Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding. PMID:26735581

Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor.

PubMed

Kuban-Jankowska, Alicja; Sahu, Kamlesh K; Gorska, Magdalena; Tuszynski, Jack A; Wozniak, Michal

2016-01-19

Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding.

Autoinhibition of Munc18-1 modulates synaptobrevin binding and helps to enable Munc13-dependent regulation of membrane fusion.

PubMed

Sitarska, Ewa; Xu, Junjie; Park, Seungmee; Liu, Xiaoxia; Quade, Bradley; Stepien, Karolina; Sugita, Kyoko; Brautigam, Chad A; Sugita, Shuzo; Rizo, Josep

2017-05-06

Munc18-1 orchestrates SNARE complex assembly together with Munc13-1 to mediate neurotransmitter release. Munc18-1 binds to synaptobrevin, but the relevance of this interaction and its relation to Munc13 function are unclear. NMR experiments now show that Munc18-1 binds specifically and non-specifically to synaptobrevin. Specific binding is inhibited by a L348R mutation in Munc18-1 and enhanced by a D326K mutation designed to disrupt the 'furled conformation' of a Munc18-1 loop. Correspondingly, the activity of Munc18-1 in reconstitution assays that require Munc18-1 and Munc13-1 for membrane fusion is stimulated by the D326K mutation and inhibited by the L348R mutation. Moreover, the D326K mutation allows Munc13-1-independent fusion and leads to a gain-of-function in rescue experiments in Caenorhabditis elegans unc-18 nulls. Together with previous studies, our data support a model whereby Munc18-1 acts as a template for SNARE complex assembly, and autoinhibition of synaptobrevin binding contributes to enabling regulation of neurotransmitter release by Munc13-1.

Effective Mass Theory of 2D Excitons Revisited

NASA Astrophysics Data System (ADS)

Gonzalez, Joseph; Oleynik, Ivan

Two-dimensional (2D) semiconducting materials possess an exceptionally unique set of electronic and excitonic properties due to the combined effects of quantum and dielectric confinement. Reliable determination of exciton binding energies from both first-principles many-body perturbation theory (GW/BSE) and experiment is very challenging due to the enormous computational expense as well as the tremendous technical difficulties in experiment.. Very recently, effective mass theories of 2D excitons have been developed as an attractive alternative for inexpensive and accurate evaluation of the exciton binding energies. In this presentation, we evaluate two effective mass theory approaches by Velizhanin et al and Olsen et al in predicting exciton binding energies across a wide range of 2D materials. We specifically analyze the trends related to the varying screening lengths and exciton effective masses. We also extended the effective mass theory of 2D excitons to include effects of electron and hole mass anisotropies (mx ≠ my) , the latter showing a substantial influence on exciton binding energies. The recent predictions of exciton binding energies being independent of the exciton effective mass and a linear correlation with the band gap of a specific material are also critically reexamined.

Functional Targets of the Monogenic Diabetes Transcription Factors HNF-1α and HNF-4α Are Highly Conserved Between Mice and Humans

PubMed Central

Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge

2009-01-01

OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435

Fox-2 Splicing Factor Binds to a Conserved Intron Motif to PromoteInclusion of Protein 4.1R Alternative Exon 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ponthier, Julie L.; Schluepen, Christina; Chen, Weiguo

Activation of protein 4.1R exon 16 (E16) inclusion during erythropoiesis represents a physiologically important splicing switch that increases 4.1R affinity for spectrin and actin. Previous studies showed that negative regulation of E16 splicing is mediated by the binding of hnRNP A/B proteins to silencer elements in the exon and that downregulation of hnRNP A/B proteins in erythroblasts leads to activation of E16 inclusion. This paper demonstrates that positive regulation of E16 splicing can be mediated by Fox-2 or Fox-1, two closely related splicing factors that possess identical RNA recognition motifs. SELEX experiments with human Fox-1 revealed highly selective binding tomore » the hexamer UGCAUG. Both Fox-1 and Fox-2 were able to bind the conserved UGCAUG elements in the proximal intron downstream of E16, and both could activate E16 splicing in HeLa cell co-transfection assays in a UGCAUG-dependent manner. Conversely, knockdown of Fox-2 expression, achieved with two different siRNA sequences resulted in decreased E16 splicing. Moreover, immunoblot experiments demonstrate mouse erythroblasts express Fox-2, but not Fox-1. These findings suggest that Fox-2 is a physiological activator of E16 splicing in differentiating erythroid cells in vivo. Recent experiments show that UGCAUG is present in the proximal intron sequence of many tissue-specific alternative exons, and we propose that the Fox family of splicing enhancers plays an important role in alternative splicing switches during differentiation in metazoan organisms.« less

Interactions between antimicrobial polynorbornenes and phospholipid vesicles monitored by light scattering and microcalorimetry.

PubMed

Gabriel, Gregory J; Pool, Joanna G; Som, Abhigyan; Dabkowski, Jeffrey M; Coughlin, E Bryan; Muthukumar, M; Tew, Gregory N

2008-11-04

Antimicrobial polynorbornenes composed of facially amphiphilic monomers have been previously reported to accurately emulate the antimicrobial activity of natural host-defense peptides (HDPs). The lethal mechanism of most HDPs involves binding to the membrane surface of bacteria leading to compromised phospholipid bilayers. In this paper, the interactions between biomimetic vesicle membranes and these cationic antimicrobial polynorbornenes are reported. Vesicle dye-leakage experiments were consistent with previous biological assays and corroborated a mode of action involving membrane disruption. Dynamic light scattering (DLS) showed that these antimicrobial polymers cause extensive aggregation of vesicles without complete bilayer disintegration as observed with surfactants that efficiently solubilize the membrane. Fluorescence microscopy on vesicles and bacterial cells also showed polymer-induced aggregation of both synthetic vesicles and bacterial cells. Isothermal titration calorimetry (ITC) afforded free energy of binding values (Delta G) and polymer to lipid binding ratios, plus revealed that the interaction is entropically favorable (Delta S>0, Delta H>0). It was observed that the strength of vesicle binding was similar between the active polymers while the binding stoichiometries were dramatically different.

G =  MAT: linking transcription factor expression and DNA binding data.

PubMed

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-31

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

G = MAT: Linking Transcription Factor Expression and DNA Binding Data

PubMed Central

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-01

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

Experimental and Theoretical Investigations of Charged Phospholipid Bilayers.

NASA Astrophysics Data System (ADS)

Graham, Ian Stanley

1987-09-01

Lipid systems containing charged species are examined by both experiment and theory. Experimental studies of the mixing of phosphatidylcholine or phosphatidylethanolamine with phosphatidic acid show that calcium induces fast ( <=q1s) phase separation of these otherwise miscible systems, and that this can occur in an isolated bilayer. Ionogenic behaviour is theoretically investigated using a new electrolyte model which explicitly includes both the solvent and particle sizes, and a binding model which uses Guggenheim combinatorics to treat non 1-1 binding stoichiometries. This work predicts a reduced dielectric constant near charged surfaces and strong repulsive forces between closely spaced (<15A) surfaces. A reanalysis of data from charged monolayers experiments indicates (1) that the new electrolyte model describes double layer behaviour at high surface charge densities better than the traditional Derjaguin - Landau - Verwey - Overbeek (DLVO) theory, (2) that calcium and magnesium bind to phosphatidylserine monolayers with a 1-1 stoichiometry.

Face-name learning in older adults: a benefit of hyper-binding.

PubMed

Weeks, Jennifer C; Biss, Renée K; Murphy, Kelly J; Hasher, Lynn

2016-10-01

Difficulty remembering faces and corresponding names is a hallmark of cognitive aging, as is increased susceptibility to distraction. Given evidence that older adults spontaneously encode relationships between target pictures and simultaneously occurring distractors (a hyper-binding phenomenon), we asked whether memory for face-name pairs could be improved through prior exposure to faces presented with distractor names. In three experiments, young and older adults performed a selective attention task on faces while ignoring superimposed names. After a delay, they learned and were tested on face-name pairs that were either maintained or rearranged from the initial task but were not told of the connection between tasks. In each experiment, older but not younger participants showed better memory for maintained than for rearranged pairs, indicating that older adults' natural propensity to tacitly encode and bind relevant and irrelevant information can be employed to aid face-name memory performance.

Pre-folding IkappaBalpha alters control of NF-kappaB signaling.

PubMed

Truhlar, Stephanie M E; Mathes, Erika; Cervantes, Carla F; Ghosh, Gourisankar; Komives, Elizabeth A

2008-06-27

Transcription complex components frequently show coupled folding and binding but the functional significance of this mode of molecular recognition is unclear. IkappaBalpha binds to and inhibits the transcriptional activity of NF-kappaB via its ankyrin repeat (AR) domain. The beta-hairpins in ARs 5-6 in IkappaBalpha are weakly-folded in the free protein, and their folding is coupled to NF-kappaB binding. Here, we show that introduction of two stabilizing mutations in IkappaBalpha AR 6 causes ARs 5-6 to fold cooperatively to a conformation similar to that in NF-kappaB-bound IkappaBalpha. Free IkappaBalpha is degraded by a proteasome-dependent but ubiquitin-independent mechanism, and this process is slower for the pre-folded mutants both in vitro and in cells. Interestingly, the pre-folded mutants bind NF-kappaB more weakly, as shown by both surface plasmon resonance and isothermal titration calorimetry in vitro and immunoprecipitation experiments from cells. One consequence of the weaker binding is that resting cells containing these mutants show incomplete inhibition of NF-kappaB activation; they have significant amounts of nuclear NF-kappaB. Additionally, the weaker binding combined with the slower rate of degradation of the free protein results in reduced levels of nuclear NF-kappaB upon stimulation. These data demonstrate clearly that the coupled folding and binding of IkappaBalpha is critical for its precise control of NF-kappaB transcriptional activity.

How Native and Alien Metal Cations Bind ATP: Implications for Lithium as a Therapeutic Agent

NASA Astrophysics Data System (ADS)

Dudev, Todor; Grauffel, Cédric; Lim, Carmay

2017-02-01

Adenosine triphosphate (ATP), the major energy currency of the cell, exists in solution mostly as ATP-Mg. Recent experiments suggest that Mg2+ interacts with the highly charged ATP triphosphate group and Li+ can co-bind with the native Mg2+ to form ATP-Mg-Li and modulate the neuronal purine receptor response. However, it is unclear how the negatively charged ATP triphosphate group binds Mg2+ and Li+ (i.e. which phosphate group(s) bind Mg2+/Li+) and how the ATP solution conformation depends on the type of metal cation and the metal-binding mode. Here, we reveal the preferred ATP-binding mode of Mg2+/Li+ alone and combined: Mg2+ prefers to bind ATP tridentately to each of the three phosphate groups, but Li+ prefers to bind bidentately to the terminal two phosphates. We show that the solution ATP conformation depends on the cation and its binding site/mode, but it does not change significantly when Li+ binds to Mg2+-loaded ATP. Hence, ATP-Mg-Li, like Mg2+-ATP, can fit in the ATP-binding site of the host enzyme/receptor, activating specific signaling pathways.

Fluorescence correlation spectroscopy experiments to quantify free diffusion coefficients in reaction-diffusion systems: The case of Ca2 + and its dyes

NASA Astrophysics Data System (ADS)

Sigaut, Lorena; Villarruel, Cecilia; Ponce, María Laura; Ponce Dawson, Silvina

2017-06-01

Many cell signaling pathways involve the diffusion of messengers that bind and unbind to and from intracellular components. Quantifying their net transport rate under different conditions then requires having separate estimates of their free diffusion coefficient and binding or unbinding rates. In this paper, we show how performing sets of fluorescence correlation spectroscopy (FCS) experiments under different conditions, it is possible to quantify free diffusion coefficients and on and off rates of reaction-diffusion systems. We develop the theory and present a practical implementation for the case of the universal second messenger, calcium (Ca2 +) and single-wavelength dyes that increase their fluorescence upon Ca2 + binding. We validate the approach with experiments performed in aqueous solutions containing Ca2 + and Fluo4 dextran (both in its high and low affinity versions). Performing FCS experiments with tetramethylrhodamine-dextran in Xenopus laevis oocytes, we infer the corresponding free diffusion coefficients in the cytosol of these cells. Our approach can be extended to other physiologically relevant reaction-diffusion systems to quantify biophysical parameters that determine the dynamics of various variables of interest.

Key Structures and Interactions for Binding of Mycobacterium tuberculosis Protein Kinase B Inhibitors from Molecular Dynamics Simulation.

PubMed

Punkvang, Auradee; Kamsri, Pharit; Saparpakorn, Patchreenart; Hannongbua, Supa; Wolschann, Peter; Irle, Stephan; Pungpo, Pornpan

2015-07-01

Substituted aminopyrimidine inhibitors have recently been introduced as antituberculosis agents. These inhibitors show impressive activity against protein kinase B, a Ser/Thr protein kinase that is essential for cell growth of M. tuberculosis. However, up to now, X-ray structures of the protein kinase B enzyme complexes with the substituted aminopyrimidine inhibitors are currently unavailable. Consequently, structural details of their binding modes are questionable, prohibiting the structural-based design of more potent protein kinase B inhibitors in the future. Here, molecular dynamics simulations, in conjunction with molecular mechanics/Poisson-Boltzmann surface area binding free-energy analysis, were employed to gain insight into the complex structures of the protein kinase B inhibitors and their binding energetics. The complex structures obtained by the molecular dynamics simulations show binding free energies in good agreement with experiment. The detailed analysis of molecular dynamics results shows that Glu93, Val95, and Leu17 are key residues responsible to the binding of the protein kinase B inhibitors. The aminopyrazole group and the pyrimidine core are the crucial moieties of substituted aminopyrimidine inhibitors for interaction with the key residues. Our results provide a structural concept that can be used as a guide for the future design of protein kinase B inhibitors with highly increased antagonistic activity. © 2014 John Wiley & Sons A/S.

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Cloned Hemoglobin Genes Enhance Growth Of Cells

NASA Technical Reports Server (NTRS)

Khosla, Chaitan; Bailey, James E.

1991-01-01

Experiments show that portable deoxyribonucleic acid (DNA) sequences incorporated into host cells make them produce hemoglobins - oxygen-binding proteins essential to function of red blood cells. Method useful in several biotechnological applications. One, enhancement of growth of cells at higher densities. Another, production of hemoglobin to enhance supplies of oxygen in cells, for use in chemical reactions requiring oxygen, as additive to serum to increase transport of oxygen, and for binding and separating oxygen from mixtures of gases.

Characterization of an RNA aptamer against HPV-16 L1 virus-like particles.

PubMed

Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores; Alvarez-Salas, Luis Marat

2014-10-01

The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3'end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection.

Characterization of an RNA Aptamer Against HPV-16 L1 Virus-Like Particles

PubMed Central

Leija-Montoya, Ana Gabriela; Benítez-Hess, María Luisa; Toscano-Garibay, Julia Dolores

2014-01-01

The human papillomavirus (HPV) capsid is mainly composed of the L1 protein that can self-assemble into virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. We report here the characterization of RNA aptamers that recognize baculovirus-produced HPV-16 L1 VLPs. Interaction and slot-blot binding assays showed that all isolated aptamers efficiently bound HPV-16 VLPs, although the Sc5-c3 aptamer showed the highest specificity and affinity (Kd=0.05 pM). Sc5-c3 secondary structure consisted of a hairpin with a symmetric bubble and an unstructured 3′end. Biochemical and genetic analyses showed that the Sc5-c3 main loop is directly involved on VLPs binding. In particular, binding specificity appeared mediated by five non-consecutive nucleotide positions. Experiments using bacterial-produced HPV-16 L1 resulted in low Sc5-c3 binding, suggesting that recognition of HPV-16 L1 VLPs relies on quaternary structure features not present in bacteria-produced L1 protein. Sc5-c3 produced specific and stable binding to HPV-16 L1 VLPs even in biofluid protein mixes and thus it may provide a potential diagnostic tool for active HPV infection. PMID:25111024

General odorant-binding proteins and sex pheromone guide larvae of Plutella xylostella to better food.

PubMed

Zhu, Jiao; Ban, Liping; Song, Li-Mei; Liu, Yang; Pelosi, Paolo; Wang, Guirong

2016-05-01

Olfaction of Lepidopteran larvae has received little attention, compared to the damage to crops done by insects at this stage. We report that larvae of the diamondback moth Plutella xylostella are attracted to their natural sex pheromone and to their major component (Z)-11-hexadecenal, but only in a food context. For such task they use two general odorant-binding proteins (GOBPs), abundantly expressed in the three major sensilla basiconica of the larval antenna, as shown by whole-mount immunostaining and immunocytochemistry experiments. None of the three genes encoding pheromone-binding proteins (PBPs) are expressed at this stage. Both recombinant GOBPs bind (Z)-11-hexadecenal and the corresponding alcohol, but not the acetate. Binding experiments performed with five mutants of GOBP2, where aromatic residues in the binding pocket were replaced with leucine showed that only one or two amino acid substitutions can completely abolish binding to the pheromone shifting the affinity to plant-derived compounds. We hypothesise that detection of their species-specific pheromone may direct larvae to the sites of foraging chosen by their mother when laying eggs, to find better food, as well as to reduce competition with individuals of the same or other species sharing the same host plant. We also provide evidence that GOBP2 is a narrowly tuned binding protein, whose affinity can be easily switched from linear pheromones to branched plants terpenoids, representing a tool better suited for the simple olfactory system of larvae, as compared to the more sophisticated organ of adults. Copyright © 2016 Elsevier Ltd. All rights reserved.

NMR spectroscopy of the ligand binding core of ionotropic glutamate receptor 2 bound to 5-substituted willardiine partial agonists

PubMed Central

Fenwick, Michael K.; Oswald, Robert E.

2008-01-01

Glutamate receptors mediate neuronal intercommunication in the central nervous system by coupling extracellular neurotransmitter-receptor interactions to ion channel conductivity. To gain insight into structural and dynamical factors that underlie this coupling, solution NMR experiments were performed on the bi-lobed ligand-binding core of glutamate receptor 2 in complexes with a set of willardiine partial agonists. These agonists are valuable for studying structure-function relationships because their 5-position substituent size is correlated with ligand efficacy and extent of receptor desensitization whereas the substituent electronegativity is correlated with ligand potency. NMR results show that the protein backbone amide chemical shift deviations correlate mainly with efficacy and extent of desensitization. Pronounced deviations occur at specific residues in the ligand-binding site and in the two helical segments that join the lobes by a disulfide bond. Experiments detecting conformational exchange show that micro- to millisecond timescale motions also occur near the disulfide bond and vary largely with efficacy and extent of desensitization. These results thus identify regions displaying structural and dynamical dissimilarity arising from differences in ligand-protein interactions and lobe closure which may play a critical role in receptor response. Furthermore, measures of line broadening and conformational exchange for a portion of the ligand-binding site correlate with ligand EC50 data. These results do not have any correlate in the currently available crystal structures and thus provide a novel view of ligand-binding events that may be associated with agonist potency differences. PMID:18387631

A Novel Selective Inverse Agonist of the CB2 Receptor as a Radiolabeled Tool Compound for Kinetic Binding Studies.

PubMed

Martella, Andrea; Sijben, Huub; Rufer, Arne C; Grether, Uwe; Fingerle, Juergen; Ullmer, Christoph; Hartung, Thomas; IJzerman, Adriaan P; van der Stelt, Mario; Heitman, Laura H

2017-10-01

The endocannabinoid system, and in particular the cannabinoid type 2 receptor (CB2R), raised the interest of many medicinal chemistry programs for its therapeutic relevance in several (patho)physiologic processes. However, the physico-chemical properties of tool compounds for CB2R (e.g., the radioligand [ 3 H]CP55,940) are not optimal, despite the research efforts in developing effective drugs to target this system. At the same time, the importance of drug-target binding kinetics is growing since the kinetic binding profile of a ligand may provide important insights for the resulting in vivo efficacy. In this context we synthesized and characterized [ 3 H]RO6957022, a highly selective CB2R inverse agonist, as a radiolabeled tool compound. In equilibrium and kinetic binding experiments [ 3 H]RO6957022 showed high affinity for human CB2R with fast association ( k on ) and moderate dissociation ( k off ) kinetics. To demonstrate the robustness of [ 3 H]RO6957022 binding, affinity studies were carried out for a wide range of CB2R reference ligands, spanning the range of full, partial, and inverse agonists. Finally, we used [ 3 H]RO6957022 to study the kinetic binding profiles (i.e., k on and k off values) of selected synthetic and endogenous (i.e., 2-arachidonoylglycerol, anandamide, and noladin ether) CB2R ligands by competition association experiments. All tested ligands, and in particular the endocannabinoids, displayed distinct kinetic profiles, shedding more light on their mechanism of action and the importance of association rates in the determination of CB2R affinity. Altogether, this study shows that the use of a novel tool compound, i.e., [ 3 H]RO6957022, can support the development of novel ligands with a repertoire of kinetic binding profiles for CB2R. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

Graphene-Based Liquid-Gated Field Effect Transistor for Biosensing: Theory and Experiments

PubMed Central

Reiner-Rozman, Ciril; Larisika, Melanie; Nowak, Christoph; Knoll, Wolfgang

2015-01-01

We present an experimental and theoretical characterization for reduced Graphene-Oxide (rGO) based FETs used for biosensing applications. The presented approach shows a complete result analysis and theoretically predictable electrical properties. The formulation was tested for the analysis of the device performance in the liquid gate mode of operation with variation of the ionic strength and pH-values of the electrolytes in contact with the FET. The dependence on the Debye length was confirmed experimentally and theoretically, utilizing the Debye length as a working parameter and thus defining the limits of applicability for the presented rGO-FETs. Furthermore, the FETs were tested for the sensing of biomolecules (bovine serum albumin (BSA) as reference) binding to gate-immobilized anti-BSA antibodies and analyzed using the Langmuir binding theory for the description of the equilibrium surface coverage as a function of the bulk (analyte) concentration. The obtained binding coefficients for BSA are found to be same as in results from literature, hence confirming the applicability of the devices. The FETs used in the experiments were fabricated using wet-chemically synthesized graphene, displaying high electron and hole mobility (μ) and provide the strong sensitivity also for low potential changes (by change of pH, ion concentration, or molecule adsorption). The binding coefficient for BSA-anti-BSA interaction shows a behavior corresponding to the Langmuir adsorption theory with a Limit of Detection (LOD) in the picomolar concentration range. The presented approach shows high reproducibility and sensitivity and a good agreement of the experimental results with the calculated data. PMID:25791463

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

PubMed

Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

2004-11-12

Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

The influence of action-outcome delay and arousal on sense of agency and the intentional binding effect.

PubMed

Wen, Wen; Yamashita, Atsushi; Asama, Hajime

2015-11-01

The sense of agency refers to the feeling of being able to initiate and control events through one's actions. The "intentional binding" effect (Haggard, Clark, & Kalogeras, 2002), refers to a subjective compression of the temporal interval between actions and their effects. The present study examined the influence of action-outcome delays and arousal on both the subjective judgment of agency and the intentional binding effect. In the experiment, participants pressed a key to trigger a central square to jump after various delays. A red central square was used in the high-arousal condition. Results showed that a longer interval between actions and their effects was associated with a lower sense of agency but a stronger intentional binding effect. Furthermore, although arousal enhanced the intentional binding effect, it did not influence the judgment of agency. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

PubMed

Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

2016-12-21

Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

Direct detection of ligand binding to Sepharose-immobilised protein using saturation transfer double difference (STDD) NMR spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haselhorst, Thomas; Muenster-Kuehnel, Anja K.; Oschlies, Melanie

2007-08-10

We report an easy and direct application of 'Saturation Transfer Double Difference' (STDD) NMR spectroscopy to identify ligands that bind to a Sepharose-immobilised target protein. The model protein, cytidine 5'-monophosphate sialic acid (CMP-Sia) synthetase, was expressed as a Strep-Tag II fusion protein and immobilised on Strep-Tactin Sepharose. STD NMR experiments of the protein-enriched Sepharose matrix in the presence of a binding ligand (cytidine 5'-triphosphate, CTP) and a non-binding ligand ({alpha}/{beta}-glucose) clearly show that CTP binds to the immobilised enzyme, whereas glucose has no affinity. This approach has three major advantages: (a) only low quantities of protein are required, (b) nomore » specialised NMR technology or the application of additional data analysis by non-routine methods is required, and (c) easy multiple use of the immobilised protein is available.« less

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

Putative melatonin receptors in a human biological clock

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reppert, S.M.; Weaver, D.R.; Rivkees, S.A.

In vitro autoradiography with /sup 125/I-labeled melatonin was used to examine melatonin binding sites in human hypothalamus. Specific /sup 125/I-labeled melatonin binding was localized to the suprachiasmatic nuclei, the site of a putative biological clock, and was not apparent in other hypothalamic regions. Specific /sup 125/I-labeled melatonin binding was consistently found in the suprachiasmatic nuclei of hypothalami from adults and fetuses. Densitometric analysis of competition experiments with varying concentrations of melatonin showed monophasic competition curves, with comparable half-maximal inhibition values for the suprachiasmatic nuclei of adults (150 picomolar) and fetuses (110 picomolar). Micromolar concentrations of the melatonin agonist 6-chloromelatonin completelymore » inhibited specific /sup 125/I-labeled melatonin binding, whereas the same concentrations of serotonin and norepinephrine caused only a partial reduction in specific binding. The results suggest that putative melatonin receptors are located in a human biological clock.« less

Concentration-Dependent Inhibitory Effect of Baicalin on the Plasma Protein Binding and Metabolism of Chlorzoxazone, a CYP2E1 Probe Substrate, in Rats In Vitro and In Vivo

PubMed Central

Gao, Na; Zou, Dan; Qiao, Hai-Ling

2013-01-01

Some of the components found in herbs may be inhibitors or inducers of cytochrome P450 enzymes, which may therefore result in undesired herb-drug interactions. As a component extracted from Radix Scutellariae, the direct effect of baicalin on cytochrome P450 has not been investigated sufficiently. In this study, we investigated concentration-dependent inhibitory effect of baicalin on the plasma protein binding and metabolism of chlorzoxazone (CZN), a model CYP2E1 probe substrate, in rats in vitro and in vivo. Animal experiment was a randomized, three-period crossover design. Significant changes in pharmacokinetic parameters of CZN such as Cmax, t1/2 and Vd were observed after treatment with baicalin in vivo (P<0.05). Cmax decreased by 25% and 33%, whereas t1/2 increased by 34% and 53%, Vd increased by 37% and 50% in 225 mg/kg and 450 mg/kg baicalin-treated rats, respectively. The AUC and CL of CZN were not affected (P>0.05). Correlation analysis showed that the changes in CZN concentrations and baicalin concentrations were in good correlation (r>0.99). In vitro experiments, baicalin decreased the formation of 6-OH-chlorzoxazone in a concentration-dependent manner and exhibited a competitive inhibition in rat liver microsomes, with a Ki value of 145.8 µM. The values of Cmax/Ki were 20 and 39 after treatment with baicalin (225 and 450 mg/kg), respectively. Protein binding experiments in vivo showed that the plasma free-fraction (fu) of CZN increased 2.6-fold immediately after baicalin treatment (450 mg/kg) and in vitro showed that baicalin (125–2500 mg/L) increased the unbound CZN from 1.63% to 3.58%. The results indicate that pharmacokinetic changes in CZN are induced by inhibitory effect of baicalin on the plasma protein binding of CZN and CYP2E1 activity. PMID:23301016

Factor h and properdin recognize different epitopes on renal tubular epithelial heparan sulfate.

PubMed

Zaferani, Azadeh; Vivès, Romain R; van der Pol, Pieter; Navis, Gerjan J; Daha, Mohamed R; van Kooten, Cees; Lortat-Jacob, Hugues; Seelen, Marc A; van den Born, Jacob

2012-09-07

During proteinuria, renal tubular epithelial cells become exposed to ultrafiltrate-derived serum proteins, including complement factors. Recently, we showed that properdin binds to tubular heparan sulfates (HS). We now document that factor H also binds to tubular HS, although to a different epitope than properdin. Factor H was present on the urinary side of renal tubular cells in proteinuric, but not in normal renal tissues and colocalized with properdin in proteinuric kidneys. Factor H dose-dependently bound to proximal tubular epithelial cells (PTEC) in vitro. Preincubation of factor H with exogenous heparin and pretreatment of PTECs with heparitinase abolished the binding to PTECs. Surface plasmon resonance experiments showed high affinity of factor H for heparin and HS (K(D) values of 32 and 93 nm, respectively). Using a library of HS-like polysaccharides, we showed that chain length and high sulfation density are the most important determinants for glycosaminoglycan-factor H interaction and clearly differ from properdin-heparinoid interaction. Coincubation of properdin and factor H did not hamper HS/heparin binding of one another, indicating recognition of different nonoverlapping epitopes on HS/heparin by factor H and properdin. Finally we showed that certain low anticoagulant heparinoids can inhibit properdin binding to tubular HS, with a minor effect on factor H binding to tubular HS. As a result, these heparinoids can control the alternative complement pathway. In conclusion, factor H and properdin interact with different HS epitopes of PTECs. These interactions can be manipulated with some low anticoagulant heparinoids, which can be important for preventing complement-derived tubular injury in proteinuric renal diseases.

Binding and effects of KATP channel openers in the vascular smooth muscle cell line, A10

PubMed Central

Russ, Ulrich; Metzger, Friedrich; Kickenweiz, Elisabeth; Hambrock, Annette; Krippeit-Drews, Peter; Quast, Ulrich

1997-01-01

The ATP-sensitive K+ channel (KATP channel) in A10 cells, a cell line derived from rat thoracic aorta, was characterized by binding studies with the tritiated KATP channel opener, [3H]-P1075, and by electrophysiological techniques. Saturation binding experiments gave a KD value of 9.2±5.2 nM and a binding capacity (BMax) of 140±40 fmol mg−1 protein for [3H]-P1075 binding to A10 cells; from the BMax value a density of binding sites of 5–10 per μm2 plasmalemma was estimated. KATP channel modulators such as the openers P1075, pinacidil, levcromakalim and minoxidil sulphate and the blocker glibenclamide inhibited [3H]-P1075 binding. The extent of inhibition at saturation depended on the compound, levcromakalim inhibiting specific [3H]-P1075 binding by 85%, minoxidil sulphate and glibenclamide by 70%. The inhibition constants were similar to those determined in strips of rat aorta. Resting membrane potential, recorded with microelectrodes, was −51±1 mV. P1075 and levcromakalim produced a concentration-dependent hyperpolarization by up to −25 mV with EC50 values of 170±40 nM and 870±190 nM, respectively. The hyperpolarization induced by levcromakalim (3 μM) was completely reversed by glibenclamide with an IC50 value of 86±17 nM. Voltage clamp experiments were performed in the whole cell configuration under a physiological K+ gradient. Levcromakalim (10 μM) induced a current which reversed around −80 mV; the current-voltage relationship showed considerable outward rectification. Glibenclamide (3 μM) abolished the effect of levcromakalim. Analysis of the noise of the levcromakalim (10 μM)-induced current at −40 and −20 mV yielded estimates of the channel density, the single channel conductance and the probability of the channel to be open of 0.14 μm−2, 8.8 pS and 0.39, respectively. The experiments showed that A10 cells are endowed with functional KATP channels which resemble those in vascular tissue; hence, these cells provide an easily accessible source of channels for biochemical and pharmacological studies. The density of binding sites for [3H]-P1075 was estimated to be one order of magnitude higher than the density of functional KATP channels; assuming a plasmalemmal localization of the binding sites this suggests a large receptor reserve for the openers in A10 cells. PMID:9401776

Adherence of oral streptococci: evidence for nonspecific adsorption to saliva-coated hydroxylapatite surfaces.

PubMed Central

Staat, R H; Peyton, J C

1984-01-01

It is proposed that binding of oral streptococci to saliva-coated hydroxylapatite (SHA) surfaces is a multifactorial process involving both specific and nonspecific receptors. In this context, specific binding is described as a high-affinity, saturable interaction between the cell and binding surface. Conversely, nonspecific binding is considered to be a nonsaturable, generalized, low-affinity reaction. Experimental differentiation of specific binding from nonspecific binding was achieved with a competition assay which utilized a large excess of nonradiolabeled bacteria to compete with the 3H-labeled cells for attachment to receptors on 1.5 mg of SHA crystals. Competition assays of Streptococcus sanguis and Streptococcus mitis adhesion clearly demonstrated that the total binding isotherm was composed of a saturable specific binding reaction and a minor nonspecific binding component. This was further substantiated by analysis of nonlinear Scatchard plots of the total binding data. The competition data for Streptococcus mutans binding indicated that ca. 50% of the S. mutans binding appeared to be specific, although saturation of the SHA surfaces with bacterial cells could not be demonstrated. Experiments measuring desorption of radiolabeled cells from SHA crystals into buffer showed that ca. 50% of the bound S. mutans cells were removed after 4 h, whereas less than 5% of the S. sanguis cells were eluted from the SHA surfaces. The kinetics of attachment were studied by using an extract of Persea americana as a noncompetitive inhibitor of adherence. The total cell binding data for these experiments suggested a very rapid binding reaction followed by a slower rate of attachment. It was concluded from these three different experimental approaches that adherence of selected oral streptococci to SHA surfaces involves specific, high-affinity and nonspecific, low-affinity binding reactions. The concept is developed that in vitro streptococcal attachment to SHA can be described as a two-reaction process in which the low-affinity interaction of the cell with the SHA surface precedes the establishment of the stronger, specific bonds needed for the maintenance of streptococci in the oral cavity. PMID:6327530

Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

PubMed Central

Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

1992-01-01

By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343

Augmentor α and β (FAM150) are ligands of the receptor tyrosine kinases ALK and LTK: Hierarchy and specificity of ligand-receptor interactions.

PubMed

Reshetnyak, Andrey V; Murray, Phillip B; Shi, Xiarong; Mo, Elizabeth S; Mohanty, Jyotidarsini; Tome, Francisco; Bai, Hanwen; Gunel, Murat; Lax, Irit; Schlessinger, Joseph

2015-12-29

Receptor tyrosine kinases (RTKs) are a class of cell surface receptors that, upon ligand binding, stimulate a variety of critical cellular functions. The orphan receptor anaplastic lymphoma kinase (ALK) is one of very few RTKs that remain without a firmly established protein ligand. Here we present a novel cytokine, FAM150B, which we propose naming augmentor-α (AUG-α), as a ligand for ALK. AUG-α binds ALK with high affinity and activates ALK in cells with subnanomolar potency. Detailed binding experiments using cells expressing ALK or the related receptor leukocyte tyrosine kinase (LTK) demonstrate that AUG-α binds and robustly activates both ALK and LTK. We show that the previously established LTK ligand FAM150A (AUG-β) is specific for LTK and only weakly binds to ALK. Furthermore, expression of AUG-α stimulates transformation of NIH/3T3 cells expressing ALK, induces IL-3 independent growth of Ba/F3 cells expressing ALK, and is expressed in neuroblastoma, a cancer partly driven by ALK. These experiments reveal the hierarchy and specificity of two cytokines as ligands for ALK and LTK and set the stage for elucidating their roles in development and disease states.

Structure and Sequence Search on Aptamer-Protein Docking

NASA Astrophysics Data System (ADS)

Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

2015-03-01

Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

Characterization of the interaction between furosemide and bovine serum albumin

NASA Astrophysics Data System (ADS)

Zhou, Neng; Liang, Yi-Zeng; Wang, Ping

2008-01-01

The interaction of furosemide (FU), one kind of potent diuretic, with bovine serum albumin (BSA) has been investigated at physiological acidity (pH 7.40) by fluorescent technique. Displacement experiment with site markers and Synchronous fluorescence clearly reveal that there are non-specific binding sites of FU with BSA. This conclusion was supported by the binding studies in the presence of the hydrophobic probe 1-anilinonaphthalene-8-sulfonic acid (ANS) and in different ionic strength. The binding sites number n and binding constant K were measured. The thermodynamic parameters Δ H°, Δ G°, Δ S° at different temperatures were calculated. The effects of other four diuretics, some common metal ions and bioactive components from herbal medicine on the binding are also considered. The results show only bumetanide has strong effect on FU's binding. Moreover, several data processing methods presently used were evaluated with Data of the same set. Quite different results were obtained from these methods suggesting more attention should be paid to the data processing methods.

Characterization of Protein Tyrosine Phosphatase 1B Inhibition by Chlorogenic Acid and Cichoric Acid.

PubMed

Lipchock, James M; Hendrickson, Heidi P; Douglas, Bonnie B; Bird, Kelly E; Ginther, Patrick S; Rivalta, Ivan; Ten, Nicholas S; Batista, Victor S; Loria, J Patrick

2017-01-10

Protein tyrosine phosphatase 1B (PTP1B) is a known regulator of the insulin and leptin signaling pathways and is an active target for the design of inhibitors for the treatment of type II diabetes and obesity. Recently, cichoric acid (CHA) and chlorogenic acid (CGA) were predicted by docking methods to be allosteric inhibitors that bind distal to the active site. However, using a combination of steady-state inhibition kinetics, solution nuclear magnetic resonance experiments, and molecular dynamics simulations, we show that CHA is a competitive inhibitor that binds in the active site of PTP1B. CGA, while a noncompetitive inhibitor, binds in the second aryl phosphate binding site, rather than the predicted benzfuran binding pocket. The molecular dynamics simulations of the apo enzyme and cysteine-phosphoryl intermediate states with and without bound CGA suggest CGA binding inhibits PTP1B by altering hydrogen bonding patterns at the active site. This study provides a mechanistic understanding of the allosteric inhibition of PTP1B.

Effects of flow changes on radiotracer binding: Simultaneous measurement of neuroreceptor binding and cerebral blood flow modulation.

PubMed

Sander, Christin Y; Mandeville, Joseph B; Wey, Hsiao-Ying; Catana, Ciprian; Hooker, Jacob M; Rosen, Bruce R

2017-01-01

The potential effects of changes in blood flow on the delivery and washout of radiotracers has been an ongoing question in PET bolus injection studies. This study provides practical insight into this topic by experimentally measuring cerebral blood flow (CBF) and neuroreceptor binding using simultaneous PET/MRI. Hypercapnic challenges (7% CO 2 ) were administered to non-human primates in order to induce controlled increases in CBF, measured with pseudo-continuous arterial spin labeling. Simultaneously, dopamine D 2 /D 3 receptor binding of [ 11 C]raclopride or [ 18 F]fallypride was monitored with dynamic PET. Experiments showed that neither time activity curves nor quantification of binding through binding potentials ( BP ND ) were measurably affected by CBF increases, which were larger than two-fold. Simulations of experimental procedures showed that even large changes in CBF should have little effect on the time activity curves of radiotracers, given a set of realistic assumptions. The proposed method can be applied to experimentally assess the flow sensitivity of other radiotracers. Results demonstrate that CBF changes, which often occur due to behavioral tasks or pharmacological challenges, do not affect PET [ 11 C]raclopride or [ 18 F]fallypride binding studies and their quantification. The results from this study suggest flow effects may have limited impact on many PET neuroreceptor tracers with similar properties.

The IκBα/NF-κB complex has two hot spots, one at either end of the interface

PubMed Central

Bergqvist, Simon; Ghosh, Gourisankar; Komives, Elizabeth A.

2008-01-01

IκBα binds to and inhibits the transcriptional activity of NF-κB family members via its ankyrin repeat (AR) domain. The binding affinity of IκBα with NF-κB(p50/p65) heterodimers and NF-κB(p65/65) homodimers is in the picomolar range, and in the cell, this results in long half-lives of the complexes. Direct binding experiments have been performed using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) on a series of truncations and mutations in order to understand what regions of the interface are most important for the tight binding affinity of this complex. We previously showed that interactions between residues 305 and 321 of NF-κB(p65) with the first AR of IκBα are critical for the binding energy. Interactions in this region are responsible for more than 7 kcal/mol of the binding energy. Here we show equally drastic consequences for the binding energy occur upon truncation of even a few residues at the C terminus of IκBα. Thus, the interface actually has two hot spots, one at either end of the elongated and large surface of interaction. These results suggest a “squeeze” mechanism that leads to the extremely high affinity of the IκBα•NF-κB complex through stabilization of the ankyrin repeat domain. PMID:18824506

An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features

PubMed Central

Ruiz, Duncan D. A.; Norberto de Souza, Osmar

2015-01-01

Protein receptor conformations, obtained from molecular dynamics (MD) simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD) values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids) and four agglomerative hierarchical methods (Complete linkage, Ward’s, Unweighted Pair Group Method and Weighted Pair Group Method) to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to distill biologically relevant information from MD trajectories, especially for docking purposes. PMID:26218832

An Effective Approach for Clustering InhA Molecular Dynamics Trajectory Using Substrate-Binding Cavity Features.

PubMed

De Paris, Renata; Quevedo, Christian V; Ruiz, Duncan D A; Norberto de Souza, Osmar

2015-01-01

Protein receptor conformations, obtained from molecular dynamics (MD) simulations, have become a promising treatment of its explicit flexibility in molecular docking experiments applied to drug discovery and development. However, incorporating the entire ensemble of MD conformations in docking experiments to screen large candidate compound libraries is currently an unfeasible task. Clustering algorithms have been widely used as a means to reduce such ensembles to a manageable size. Most studies investigate different algorithms using pairwise Root-Mean Square Deviation (RMSD) values for all, or part of the MD conformations. Nevertheless, the RMSD only may not be the most appropriate gauge to cluster conformations when the target receptor has a plastic active site, since they are influenced by changes that occur on other parts of the structure. Hence, we have applied two partitioning methods (k-means and k-medoids) and four agglomerative hierarchical methods (Complete linkage, Ward's, Unweighted Pair Group Method and Weighted Pair Group Method) to analyze and compare the quality of partitions between a data set composed of properties from an enzyme receptor substrate-binding cavity and two data sets created using different RMSD approaches. Ensembles of representative MD conformations were generated by selecting a medoid of each group from all partitions analyzed. We investigated the performance of our new method for evaluating binding conformation of drug candidates to the InhA enzyme, which were performed by cross-docking experiments between a 20 ns MD trajectory and 20 different ligands. Statistical analyses showed that the novel ensemble, which is represented by only 0.48% of the MD conformations, was able to reproduce 75% of all dynamic behaviors within the binding cavity for the docking experiments performed. Moreover, this new approach not only outperforms the other two RMSD-clustering solutions, but it also shows to be a promising strategy to distill biologically relevant information from MD trajectories, especially for docking purposes.

Unbinding Pathways of an Agonist and an Antagonist from the 5-HT3 Receptor

PubMed Central

Thompson, A. J.; Chau, P.-L.; Chan, S. L.; Lummis, S. C. R.

2006-01-01

The binding sites of 5-HT3 and other Cys-loop receptors have been extensively studied, but there are no data on the entry and exit routes of ligands for these sites. Here we have used molecular dynamics simulations to predict the pathway for agonists and antagonists exiting from the 5-HT3 receptor binding site. The data suggest that the unbinding pathway follows a tunnel at the interface of two subunits, which is ∼8 Å long and terminates ∼20 Å above the membrane. The exit routes for an agonist (5-HT) and an antagonist (granisetron) were similar, with trajectories toward the membrane and outward from the ligand binding site. 5-HT appears to form many hydrogen bonds with residues in the unbinding pathway, and experiments show that mutating these residues significantly affects function. The location of the pathway is also supported by docking studies of granisetron, which show a potential binding site for granisetron on the unbinding route. We propose that leaving the binding pocket along this tunnel places the ligands close to the membrane and prevents their immediate reentry into the binding pocket. We anticipate similar exit pathways for other members of the Cys-loop receptor family. PMID:16387779

Comparison of the interaction between lactoferrin and isomeric drugs

NASA Astrophysics Data System (ADS)

Guo, Ming; Lu, Xiaowang; Wang, Yan; Brodelius, Peter E.

2017-02-01

The binding properties of pentacyclic triterpenoid isomeric drugs, i.e. ursolic acid (UA) and oleanolic acid (OA), to bovine lactoferrin (BLF) have been studied by molecule modeling, fluorescence spectroscopy, UV-visible absorbance spectroscopy and infrared spectroscopy (IR). Molecular docking, performed to reveal the possible binding mode or mechanism, suggested that hydrophobic interaction and hydrogen bonding play important roles to stabilize the complex. The results of spectroscopic measurements showed that the two isomeric drugs both strongly quenched the intrinsic fluorescence of BLF through a static quenching procedure although some differences between UA and OA binding strength and non-radiation energy transfer occurred within the molecules. The number of binding sites was 3.44 and 3.10 for UA and OA, respectively, and the efficiency of Förster energy transfer provided a distance of 0.77 and 1.21 nm for UA and OA, respectively. The conformation transformation of BLF affected by the drugs conformed to the ;all-or-none; pattern. In addition, the changes of the ratios of α-helices, β-sheets and β-turns of BLF during the process of the interaction were obtained. The results of the experiments in combination with the calculations showed that there are two modes of pentacyclic triterpenoid binding to BLF instead of one binding mode only governed by the principle of the lowest bonding energy.

Interactions between Human Liver Fatty Acid Binding Protein and Peroxisome Proliferator Activated Receptor Selective Drugs

PubMed Central

Velkov, Tony

2013-01-01

Fatty acid binding proteins (FABPs) act as intracellular shuttles for fatty acids as well as lipophilic xenobiotics to the nucleus, where these ligands are released to a group of nuclear receptors called the peroxisome proliferator activated receptors (PPARs). PPAR mediated gene activation is ultimately involved in maintenance of cellular homeostasis through the transcriptional regulation of metabolic enzymes and transporters that target the activating ligand. Here we show that liver- (L-) FABP displays a high binding affinity for PPAR subtype selective drugs. NMR chemical shift perturbation mapping and proteolytic protection experiments show that the binding of the PPAR subtype selective drugs produces conformational changes that stabilize the portal region of L-FABP. NMR chemical shift perturbation studies also revealed that L-FABP can form a complex with the PPAR ligand binding domain (LBD) of PPARα. This protein-protein interaction may represent a mechanism for facilitating the activation of PPAR transcriptional activity via the direct channeling of ligands between the binding pocket of L-FABP and the PPARαLBD. The role of L-FABP in the delivery of ligands directly to PPARα via this channeling mechanism has important implications for regulatory pathways that mediate xenobiotic responses and host protection in tissues such as the small intestine and the liver where L-FABP is highly expressed. PMID:23476633

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Ligand-promoted protein folding by biased kinetic partitioning.

PubMed

Hingorani, Karan S; Metcalf, Matthew C; Deming, Derrick T; Garman, Scott C; Powers, Evan T; Gierasch, Lila M

2017-04-01

Protein folding in cells occurs in the presence of high concentrations of endogenous binding partners, and exogenous binding partners have been exploited as pharmacological chaperones. A combined mathematical modeling and experimental approach shows that a ligand improves the folding of a destabilized protein by biasing the kinetic partitioning between folding and alternative fates (aggregation or degradation). Computationally predicted inhibition of test protein aggregation and degradation as a function of ligand concentration are validated by experiments in two disparate cellular systems.

Ligand-Promoted Protein Folding by Biased Kinetic Partitioning

PubMed Central

Hingorani, Karan S.; Metcalf, Matthew C.; Deming, Derrick T.; Garman, Scott C.; Powers, Evan T.; Gierasch, Lila M.

2017-01-01

Protein folding in cells occurs in the presence of high concentrations of endogenous binding partners, and exogenous binding partners have been exploited as pharmacological chaperones. A combined mathematical modeling and experimental approach shows that a ligand improves the folding of a destabilized protein by biasing the kinetic partitioning between folding and alternative fates (aggregation or degradation). Computationally predicted inhibition of test protein aggregation and degradation as a function of ligand concentration are validated by experiments in two disparate cellular systems. PMID:28218913

The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

PubMed

Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

2011-04-01

The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

Baicalin promotes the bacteriostatic activity of lysozyme on S. aureus in mammary glands and neutrophilic granulocytes in mice

PubMed Central

Zhang, Zecai; Shen, Peng; Yang, Zhengtao; Zhang, Naisheng

2017-01-01

Staphylococcus aureus causes mastitis as a result of community-acquired or nosocomial infections. Lysozyme (LYSO) is an enzyme that is upregulated in many organisms during the innate immune response against infection by bacterial pathogens. Baicalin is a bioactive flavonoid that can bind to enzymes, often to potentiate their effect. Here we tested the effects of baicalin on the activity of LYSO using the S. aureus mastitis mouse model and neutrophilic granulocyte model of S. aureus infection. In our experiments, S. aureus counts decreased with increasing baicalin concentration. Furthermore, qPCR and western blot analyses showed that LYSO expression was unaffected by baicalin, while fluorescence quenching and UV fluorescence spectral analyses showed that baicalin binds to LYSO. To test whether this binding increased LYSO activity, we assessed LYSO-induced bacteriostasis in the presence of baicalin. Our results showed that LYSO-induced S. aureus bacteriostasis increased with increasing concentrations of baicalin, and that baicalin binding to LYSO synergistically increased the antibacterial activity of LYSO. These results demonstrate that baicalin enhances LYSO-induced bacteriostasis during the innate immune response to S. aureus. They suggest baicalin is a potentially useful therapeutic agent for the treatment of bacterial infections. PMID:28184027

Dual inhibition of human type 4 phosphodiesterase isostates by (R, R)-(+/-)-methyl 3-acetyl-4-[3-(cyclopentyloxy)-4-methoxyphenyl]-3- methyl-1-pyrrolidinecarboxylate.

PubMed

Tian, G; Rocque, W J; Wiseman, J S; Thompson, I Z; Holmes, W D; Domanico, P L; Stafford, J A; Feldman, P L; Luther, M A

1998-05-12

Purified recombinant human type 4 phosphodiesterase B2B (HSPDE4B2B) exists in both a low- and a high-affinity state that bind (R)-rolipram with Kd's of ca. 500 and 1 nM, respectively [Rocque, W. J., Tian, G., Wiseman, J. S., Holmes, W. D., Thompson, I. Z., Willard, D. H., Patel, I. R., Wisely, G. B., Clay, W. C., Kadwell, S. H., Hoffman, C. R., and Luther, M. A. (1997) Biochemistry 36, 14250-14261]. Since the tissue distribution of the two isostates may be significantly different, development of inhibitors that effectively inhibit both forms may be advantageous pharmacologically. In this study, enzyme inhibition and binding of HSPDE4B2B by (R, R)-(+/-)-methyl 3-acetyl-4-[3-(cyclopentyloxy)-4-methoxyphenyl]-3-methyl-1-pyrrolidin ecarboxylate (1), a novel inhibitor of phosphodiesterase 4 (PDE 4), were investigated. Binding experiments demonstrated high-affinity binding of 1 to HSPDE4B2B with a stoichiometry of 1:1. Inhibition of PDE activity showed only a single transition with an observed Ki similar to the apparent Kd determined by the binding experiments. Deletional mutants of HSPDE4B2B, which have been shown to bind (R)-rolipram with low affinity, were shown to interact with 1 with high affinity, indistinguishable from the results obtained with the full-length enzyme. Bound 1 was completely displaced by (R)-rolipram, and the displacement showed a biphasic transition that resembles the biphasic inhibition of HSPDE4B2B by (R)-rolipram. Theoretical analysis of the two transitions exemplified in the interaction of (R)-rolipram with HSPDE4B2B indicated that the two isostates were nonexchangeable. Phosphorylation at serines 487 and 489 on HSPDE4B2B had no effect on the stoichiometry of binding, the affinity for binding, or the inhibition of the enzyme by 1. These data further illustrate the presence of two isostates in PDE 4 as shown previously for (R)-rolipram binding and inhibition. In contrast to (R)-rolipram, where only one of the two isostates of PDE 4 binds with high affinity, 1 is a potent, dual inhibitor of both of the isostates of PDE 4. Kinetic and thermodynamic models describing the interactions between the nonexchangeable isostates of PDE 4 and its ligands are discussed.

Mechanism of Positive Allosteric Modulators Acting on AMPA Receptors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jin,R.; Clark, S.; Weeks, A.

2005-01-01

Ligand-gated ion channels involved in the modulation of synaptic strength are the AMPA, kainate, and NMDA glutamate receptors. Small molecules that potentiate AMPA receptor currents relieve cognitive deficits caused by neurodegenerative diseases such as Alzheimer's disease and show promise in the treatment of depression. Previously, there has been limited understanding of the molecular mechanism of action for AMPA receptor potentiators. Here we present cocrystal structures of the glutamate receptor GluR2 S1S2 ligand-binding domain in complex with aniracetam [1-(4-methoxybenzoyl)-2-pyrrolidinone] or CX614 (pyrrolidino-1, 3-oxazino benzo-1, 4-dioxan-10-one), two AMPA receptor potentiators that preferentially slow AMPA receptor deactivation. Both potentiators bind within the dimermore » interface of the nondesensitized receptor at a common site located on the twofold axis of molecular symmetry. Importantly, the potentiator binding site is adjacent to the 'hinge' in the ligand-binding core 'clamshell' that undergoes conformational rearrangement after glutamate binding. Using rapid solution exchange, patch-clamp electrophysiology experiments, we show that point mutations of residues that interact with potentiators in the cocrystal disrupt potentiator function. We suggest that the potentiators slow deactivation by stabilizing the clamshell in its closed-cleft, glutamate-bound conformation.« less

Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

PubMed Central

Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

2016-01-01

RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

Protocols Utilizing Constant pH Molecular Dynamics to Compute pH-Dependent Binding Free Energies

PubMed Central

2015-01-01

In protein–ligand binding, the electrostatic environments of the two binding partners may vary significantly in bound and unbound states, which may lead to protonation changes upon binding. In cases where ligand binding results in a net uptake or release of protons, the free energy of binding is pH-dependent. Nevertheless, conventional free energy calculations and molecular docking protocols typically do not rigorously account for changes in protonation that may occur upon ligand binding. To address these shortcomings, we present a simple methodology based on Wyman’s binding polynomial formalism to account for the pH dependence of binding free energies and demonstrate its use on cucurbit[7]uril (CB[7]) host–guest systems. Using constant pH molecular dynamics and a reference binding free energy that is taken either from experiment or from thermodynamic integration computations, the pH-dependent binding free energy is determined. This computational protocol accurately captures the large pKa shifts observed experimentally upon CB[7]:guest association and reproduces experimental binding free energies at different levels of pH. We show that incorrect assignment of fixed protonation states in free energy computations can give errors of >2 kcal/mol in these host–guest systems. Use of the methods presented here avoids such errors, thus suggesting their utility in computing proton-linked binding free energies for protein–ligand complexes. PMID:25134690

Thermodynamic Exploration of Eosin-Lysozyme Binding: A Physical Chemistry and Biochemistry Laboratory Experiment

ERIC Educational Resources Information Center

Huisman, Andrew J.; Hartsell, Lydia R.; Krueger, Brent P.; Pikaart, Michael J.

2010-01-01

We developed a modular pair of experiments for use in the undergraduate physical chemistry and biochemistry laboratories. Both experiments examine the thermodynamics of the binding of a small molecule, eosin Y, to the protein lysozyme. The assay for binding is the quenching of lysozyme fluorescence by eosin through resonant energy transfer. In…

Characterization of flavonoid-protein interactions using fluorescence spectroscopy: Binding of pelargonidin to dairy proteins.

PubMed

Arroyo-Maya, Izlia J; Campos-Terán, José; Hernández-Arana, Andrés; McClements, David Julian

2016-12-15

In this study, the interaction between the flavonoid pelargonidin and dairy proteins: β-lactoglobulin (β-LG), whey protein (WPI), and caseinate (CAS) was investigated. Fluorescence experiments demonstrated that pelargonidin quenched milk proteins fluorescence strongly. However, the protein secondary structure was not significantly affected by pelargonidin, as judged from far-UV circular dichroism. Analysis of fluorescence data indicated that pelargonidin-induced quenching does not arise from a dynamical mechanism, but instead is due to protein-ligand binding. Therefore, quenching data were analyzed using the model of independent binding sites. Both β-LG and CAS, but not WPI, showed hyperbolic binding isotherms indicating that these proteins firmly bound pelargonidin at both pH 7.0 and 3.0 (binding constants ca. 1.0×10(5) at 25.0°C). To investigate the underlying thermodynamics, binding constants were determined at 25.0, 35.0, and 45.0°C. These results pointed to binding processes that depend on the structural conformation of the milk proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

Autoradiographic analysis of binding sites for sup 125 I-Bolton-Hunter-substance P in the human eye

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kieselbach, G.F.; Ragaut, R.; Knaus, H.G.

1990-07-01

Substance P is known to exert potent effects in peripheral tissues, and is thought to be important for ocular function. The mechanism of action of substance P in the human eye is not known. As a basis for biochemical characterization specific binding of {sup 125}I-Bolton-Hunter-substance P was demonstrated in the human eye using autoradiographic methods. Biochemical characterization on slide-mounted tissue preparations showed that binding was saturable with a KD of 0.27 +/- 0.1 nmol/l. Specific binding occurred at comparable autoradiographic densities to both human retina and choroid. Substance P and its carboxyterminal fragment, substance P(3-11), were shown to be highlymore » potent in binding competition experiments against {sup 125}I-Bolton-Hunter-substance P. Similar concentrations of substance P(1-9), neurokinin A and neurokinin B failed to significantly alter specific binding of {sup 125}I-Bolton-Hunter-substance P. The results indicate expression of high affinity substance P binding sites in human retina and choroid.« less

VP24 Is a Chitin-Binding Protein Involved in White Spot Syndrome Virus Infection

PubMed Central

Li, Zaipeng; Han, Yali; Xu, Limei

2015-01-01

ABSTRACT Oral ingestion is the major route of infection for the white spot syndrome virus (WSSV). However, the mechanism by which virus particles in the digestive tract invade host cells is unknown. In the present study, we demonstrate that WSSV virions can bind to chitin through one of the major envelope proteins (VP24). Mutagenesis analysis indicated that amino acids (aa) 186 to 200 in the C terminus of VP24 were required for chitin binding. Moreover, the P-VP24186–200 peptide derived from the VP24 chitin binding region significantly inhibited the VP24-chitin interaction and the WSSV-chitin interaction, implying that VP24 participates in WSSV binding to chitin. Oral inoculation experiments showed that P-VP24186–200 treatment reduced the number of virus particles remaining in the digestive tract during the early stage of infection and greatly hindered WSSV proliferation in shrimp. These data indicate that binding of WSSV to chitin through the viral envelope protein VP24 is essential for WSSV per os infection and provide new ideas for preventing WSSV infection in shrimp farms. IMPORTANCE In this study, we show that WSSV can bind to chitin through the envelope protein VP24. The chitin-binding domain of VP24 maps to amino acids 186 to 200 in the C terminus. Binding of WSSV to chitin through the viral envelope protein VP24 is essential for WSSV per os infection. These findings not only extend our knowledge of WSSV infection but also provide new insights into strategies to prevent WSSV infection in shrimp farms. PMID:26512091

Accounting for GC-content bias reduces systematic errors and batch effects in ChIP-seq data.

PubMed

Teng, Mingxiang; Irizarry, Rafael A

2017-11-01

The main application of ChIP-seq technology is the detection of genomic regions that bind to a protein of interest. A large part of functional genomics' public catalogs is based on ChIP-seq data. These catalogs rely on peak calling algorithms that infer protein-binding sites by detecting genomic regions associated with more mapped reads (coverage) than expected by chance, as a result of the experimental protocol's lack of perfect specificity. We find that GC-content bias accounts for substantial variability in the observed coverage for ChIP-seq experiments and that this variability leads to false-positive peak calls. More concerning is that the GC effect varies across experiments, with the effect strong enough to result in a substantial number of peaks called differently when different laboratories perform experiments on the same cell line. However, accounting for GC content bias in ChIP-seq is challenging because the binding sites of interest tend to be more common in high GC-content regions, which confounds real biological signals with unwanted variability. To account for this challenge, we introduce a statistical approach that accounts for GC effects on both nonspecific noise and signal induced by the binding site. The method can be used to account for this bias in binding quantification as well to improve existing peak calling algorithms. We use this approach to show a reduction in false-positive peaks as well as improved consistency across laboratories. © 2017 Teng and Irizarry; Published by Cold Spring Harbor Laboratory Press.

Molecular modeling and multispectroscopic studies of the interaction of mesalamine with bovine serum albumin

NASA Astrophysics Data System (ADS)

Shahabadi, Nahid; Fili, Soraya Moradi

2014-01-01

The interaction of mesalamine (5-aminosalicylic acid (5-ASA)) with bovine serum albumin (BSA) was investigated by fluorescence quenching, absorption spectroscopy, circular dichroism (CD) techniques, and molecular docking. Thermodynamic parameters (ΔH < 0 and ΔS 0) indicated that the hydrogen bond and electrostatic forces played the major role in the binding of 5-ASA to BSA. The results of CD and UV-vis spectroscopy showed that the binding of this drug to BSA induces some conformational changes in BSA. Displacement experiments predicted that the binding of 5-ASA to BSA is located within domain III, Sudlows site 2, that these observations were substantiated by molecular docking studies. In addition, the docking result shows that the 5-ASA in its anionic form mainly interacts with Gln-416 residue through one hydrogen bond between H atom of 5-ASA anion and the adjacent O atom of the hydroxyl group of Gln-416.

Ca(2+)-triggered coelenterazine-binding protein from Renilla as an enzyme-dependent label for binding assay.

PubMed

Krasitskaya, V V; Korneeva, S I; Kudryavtsev, A N; Markova, S V; Stepanyuk, G A; Frank, L A

2011-11-01

The recombinant Ca(2+)-triggered coelenterazine-binding protein (CBP) from Renilla muelleri was investigated as a biospecifically labeled molecule for in vitro assay applications. The protein was shown to be stable in solutions in the frozen state, as well as stable under heating and to chemical modifications. Conjugates with biotin, oligonucleotide, and proteins were obtained and applied as biospecific molecules in a solid-phase microassay. CBP detection was performed with intact (no modifications were made) Renilla luciferase in the presence of calcium, and the detection limit was found to be 75 amol. Model experiments indicate that this approach shows much promise, especially with regard to the development of multianalytical systems.

Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zoghbi, M. E.; Altenberg, G. A.

The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

Assembly of the stator in Escherichia coli ATP synthase. Complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha

PubMed Central

Senior, Alan E.; Muharemagi, Alma; Wilke-Mounts, Susan

2008-01-01

Alpha subunit of Escherichia coli ATP synthase was expressed with a C-terminal 6-His tag and purified. Pure alpha was monomeric, competent in nucleotide binding, and had normal N-terminal sequence. In F1-subunit dissociation/reassociation experiments it supported full reconstitution of ATPase, and reassociated complexes were able to bind to F1-depleted membranes with restoration of ATP-driven proton pumping. Therefore interaction between the stator delta subunit and the N-terminal residue 1-22 region of alpha occurred normally when pure alpha was complexed with other F1 subunits. On the other hand, three different types of experiment showed that no interaction occurred between pure delta and isolated alpha subunit. Unlike in F1, the N-terminal region of isolated alpha was not susceptible to trypsin cleavage. Therefore, during assembly of ATP synthase, complexation of alpha subunit with other F1 subunits is prerequisite for delta subunit binding to the N-terminal region of alpha. We suggest that the N-terminal 1-22 residues of alpha are sequestered in isolated alpha until released by binding of beta to alpha subunit. This prevents 1/1 delta/alpha complexes from forming, and provides a satisfactory explanation of the stoichiometry of one delta per three alpha seen in the F1 sector of ATP synthase, assuming that steric hindrance prevents binding of more than one delta to the alpha3/beta3 hexagon. The cytoplasmic fragment of the b subunit (bsol) did not bind to isolated alpha. It might also be that complexation of alpha with beta subunits is prerequisite for direct binding of stator b subunit to the F1-sector. PMID:17176112

2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

1988-05-01

Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

Occupancy of the Chromophore Binding Site of Opsin Activates Visual Transduction in Rod Photoreceptors

PubMed Central

Kefalov, Vladimir J.; Carter Cornwall, M.; Crouch, Rosalie K.

1999-01-01

The retinal analogue β-ionone was used to investigate possible physiological effects of the noncovalent interaction between rod opsin and its chromophore 11-cis retinal. Isolated salamander rod photoreceptors were exposed to bright light that bleached a significant fraction of their pigment, were allowed to recover to a steady state, and then were exposed to β-ionone. Our experiments show that in bleach-adapted rods β-ionone causes a decrease in light sensitivity and dark current and an acceleration of the dim flash photoresponse and the rate constants of guanylyl cyclase and cGMP phosphodiesterase. Together, these observations indicate that in bleach-adapted rods β-ionone activates phototransduction in the dark. Control experiments showed no effect of β-ionone in either fully dark-adapted or background light-adapted cells, indicating direct interaction of β-ionone with the free opsin produced by bleaching. We speculate that β-ionone binds specifically in the chromophore pocket of opsin to produce a complex that is more catalytically potent than free opsin alone. We hypothesize that a similar reaction may occur in the intact retina during pigment regeneration. We propose a model of rod pigment regeneration in which binding of 11-cis retinal to opsin leads to activation of the complex accompanied by a decrease in light sensitivity. The subsequent covalent attachment of retinal to opsin completely inactivates opsin and leads to the recovery of sensitivity. Our findings resolve the conflict between biochemical and physiological data concerning the effect of the occupancy of the chromophore binding site on the catalytic potency of opsin. We show that binding of β-ionone to rod opsin produces effects opposite to its previously described effects on cone opsin. We propose that this distinction is due to a fundamental difference in the interaction of rod and cone opsins with retinal, which may have implications for the different physiology of the two types of photoreceptors. PMID:10051522

The tautomerization between keto- to phenol-hydrazone induced by anions in the solution

NASA Astrophysics Data System (ADS)

Shang, Xuefang; Yuan, Jianmei; Wang, Yingling; Zhang, Jinlian; Xu, Xiufang

2012-02-01

Two simple anion receptors, 2-[(2-hydroxy-5-nitrophenyl)methylene]hydrazone (1) and 2-[(3,5-dibromo-2-hydroxyphenyl)methylene]hydrazone (2) with -OH binding sites, were synthesized and characterized. The anion binding ability of receptors 1 and 2 with halide anions (F-, Cl-, Br- and I-), AcO- and HPO4- was investigated using visual (naked-eye), UV-vis titration experiments in dry DMSO together with DFT theoretical calculation. The addition of F-, AcO- and HPO4- to the host solution resulted in a red shift of the charge-transfer absorbance band accompanied by a color change from yellow to orange in the naked-eye experiments. Receptor 1 containing a nitro group at the para position and receptor 2 containing two bromine groups at the ortho and para positions both showed strong binding ability for HPO4- ion in the form of phenol-hydrazone. Moreover, receptor 1, induced by anion species in the solution, converted to the form of phenol-hydrazone from keto-hydrazone.

Hydration Changes upon DNA Folding Studied by Osmotic Stress Experiments

PubMed Central

Nakano, Shu-ichi; Yamaguchi, Daisuke; Tateishi-Karimata, Hisae; Miyoshi, Daisuke; Sugimoto, Naoki

2012-01-01

The thermal stability of nucleic acid structures is perturbed under the conditions that mimic the intracellular environment, typically rich in inert components and under osmotic stress. We now describe the thermodynamic stability of DNA oligonucleotide structures in the presence of high background concentrations of neutral cosolutes. Small cosolutes destabilize the basepair structures, and the DNA structures consisting of the same nearest-neighbor composition show similar thermodynamic parameters in the presence of various types of cosolutes. The osmotic stress experiments reveal that water binding to flexible loops, unstable mismatches, and an abasic site upon DNA folding are almost negligible, whereas the binding to stable mismatch pairs is significant. The studies using the basepair-mimic nucleosides and the peptide nucleic acid suggest that the sugar-phosphate backbone and the integrity of the basepair conformation make important contributions to the binding of water molecules to the DNA bases and helical grooves. The study of the DNA hydration provides the basis for understanding and predicting nucleic acid structures in nonaqueous solvent systems. PMID:22735531

Structural and Histone Binding Ability Characterizations of Human PWWP Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hong; Zeng, Hong; Lam, Robert

2013-09-25

The PWWP domain was first identified as a structural motif of 100-130 amino acids in the WHSC1 protein and predicted to be a protein-protein interaction domain. It belongs to the Tudor domain 'Royal Family', which consists of Tudor, chromodomain, MBT and PWWP domains. While Tudor, chromodomain and MBT domains have long been known to bind methylated histones, PWWP was shown to exhibit histone binding ability only until recently. The PWWP domain has been shown to be a DNA binding domain, but sequence analysis and previous structural studies show that the PWWP domain exhibits significant similarity to other 'Royal Family' members,more » implying that the PWWP domain has the potential to bind histones. In order to further explore the function of the PWWP domain, we used the protein family approach to determine the crystal structures of the PWWP domains from seven different human proteins. Our fluorescence polarization binding studies show that PWWP domains have weak histone binding ability, which is also confirmed by our NMR titration experiments. Furthermore, we determined the crystal structures of the BRPF1 PWWP domain in complex with H3K36me3, and HDGF2 PWWP domain in complex with H3K79me3 and H4K20me3. PWWP proteins constitute a new family of methyl lysine histone binders. The PWWP domain consists of three motifs: a canonical {beta}-barrel core, an insertion motif between the second and third {beta}-strands and a C-terminal {alpha}-helix bundle. Both the canonical {beta}-barrel core and the insertion motif are directly involved in histone binding. The PWWP domain has been previously shown to be a DNA binding domain. Therefore, the PWWP domain exhibits dual functions: binding both DNA and methyllysine histones.« less

Object-location binding across a saccade: A retinotopic Spatial Congruency Bias

PubMed Central

Shafer-Skelton, Anna; Kupitz, Colin N.; Golomb, Julie D.

2017-01-01

Despite frequent eye movements that rapidly shift the locations of objects on our retinas, our visual system creates a stable perception of the world. To do this, it must convert eye-centered (retinotopic) input to world-centered (spatiotopic) percepts. Moreover, for successful behavior we must also incorporate information about object features/identities during this updating – a fundamental challenge that remains to be understood. Here we adapted a recent behavioral paradigm, the “Spatial Congruency Bias”, to investigate object-location binding across an eye movement. In two initial baseline experiments, we showed that the Spatial Congruency Bias was present for both gabor and face stimuli in addition to the object stimuli used in the original paradigm. Then, across three main experiments, we found the bias was preserved across an eye movement, but only in retinotopic coordinates: Subjects were more likely to perceive two stimuli as having the same features/identity when they were presented in the same retinotopic location. Strikingly, there was no evidence of location binding in the more ecologically relevant spatiotopic (world-centered) coordinates; the reference frame did not update to spatiotopic even at longer post-saccade delays, nor did it transition to spatiotopic with more complex stimuli (gabors, shapes, and faces all showed a retinotopic Congruency Bias). Our results suggest that object-location binding may be tied to retinotopic coordinates, and that it may need to be re-established following each eye movement rather than being automatically updated to spatiotopic coordinates. PMID:28070793

Perceptual learning shapes multisensory causal inference via two distinct mechanisms

PubMed Central

McGovern, David P.; Roudaia, Eugenie; Newell, Fiona N.; Roach, Neil W.

2016-01-01

To accurately represent the environment, our brains must integrate sensory signals from a common source while segregating those from independent sources. A reasonable strategy for performing this task is to restrict integration to cues that coincide in space and time. However, because multisensory signals are subject to differential transmission and processing delays, the brain must retain a degree of tolerance for temporal discrepancies. Recent research suggests that the width of this ‘temporal binding window’ can be reduced through perceptual learning, however, little is known about the mechanisms underlying these experience-dependent effects. Here, in separate experiments, we measure the temporal and spatial binding windows of human participants before and after training on an audiovisual temporal discrimination task. We show that training leads to two distinct effects on multisensory integration in the form of (i) a specific narrowing of the temporal binding window that does not transfer to spatial binding and (ii) a general reduction in the magnitude of crossmodal interactions across all spatiotemporal disparities. These effects arise naturally from a Bayesian model of causal inference in which learning improves the precision of audiovisual timing estimation, whilst concomitantly decreasing the prior expectation that stimuli emanate from a common source. PMID:27091411

Adolescent social defeat alters markers of adult dopaminergic function.

PubMed

Novick, Andrew M; Forster, Gina L; Tejani-Butt, Shanaz M; Watt, Michael J

2011-08-10

Stressful experiences during adolescence can alter the trajectory of neural development and contribute to psychiatric disorders in adulthood. We previously demonstrated that adolescent male rats exposed to repeated social defeat stress show changes in mesocorticolimbic dopamine content both at baseline and in response to amphetamine when tested in adulthood. In the present study we examined whether markers of adult dopamine function are also compromised by adolescent experience of social defeat. Given that the dopamine transporter as well as dopamine D1 receptors act as regulators of psychostimulant action, are stress sensitive and undergo changes during adolescence, quantitative autoradiography was used to measure [(3)H]-GBR12935 binding to the dopamine transporter and [(3)H]-SCH23390 binding to dopamine D1 receptors, respectively. Our results indicate that social defeat during adolescence led to higher dopamine transporter binding in the infralimbic region of the medial prefrontal cortex and higher dopamine D1 receptor binding in the caudate putamen, while other brain regions analyzed were comparable to controls. Thus it appears that social defeat during adolescence causes specific changes to the adult dopamine system, which may contribute to behavioral alterations and increased drug seeking. Copyright © 2011 Elsevier Inc. All rights reserved.

Perceptual learning shapes multisensory causal inference via two distinct mechanisms.

PubMed

McGovern, David P; Roudaia, Eugenie; Newell, Fiona N; Roach, Neil W

2016-04-19

To accurately represent the environment, our brains must integrate sensory signals from a common source while segregating those from independent sources. A reasonable strategy for performing this task is to restrict integration to cues that coincide in space and time. However, because multisensory signals are subject to differential transmission and processing delays, the brain must retain a degree of tolerance for temporal discrepancies. Recent research suggests that the width of this 'temporal binding window' can be reduced through perceptual learning, however, little is known about the mechanisms underlying these experience-dependent effects. Here, in separate experiments, we measure the temporal and spatial binding windows of human participants before and after training on an audiovisual temporal discrimination task. We show that training leads to two distinct effects on multisensory integration in the form of (i) a specific narrowing of the temporal binding window that does not transfer to spatial binding and (ii) a general reduction in the magnitude of crossmodal interactions across all spatiotemporal disparities. These effects arise naturally from a Bayesian model of causal inference in which learning improves the precision of audiovisual timing estimation, whilst concomitantly decreasing the prior expectation that stimuli emanate from a common source.

Molecular interaction of 2,4-diacetylphloroglucinol (DAPG) with human serum albumin (HSA): The spectroscopic, calorimetric and computational investigation

NASA Astrophysics Data System (ADS)

Pragna Lakshmi, T.; Mondal, Moumita; Ramadas, Krishna; Natarajan, Sakthivel

2017-08-01

Drug molecule interaction with human serum albumin (HSA) affects the distribution and elimination of the drug. The compound, 2,4-diacetylphloroglucinol (DAPG) has been known for its antimicrobial, antiviral, antihelminthic and anticancer properties. However, its interaction with HSA is not yet reported. In this study, the interaction between HSA and DAPG was investigated through steady-state fluorescence, time-resolved fluorescence (TRF), circular dichroism (CD), Fourier transform infrared (FT-IR) spectroscopy, isothermal titration calorimetry (ITC), molecular docking and molecular dynamics simulation (MDS). Fluorescence spectroscopy results showed the strong quenching of intrinsic fluorescence of HSA due to interaction with DAPG, through dynamic quenching mechanism. The compound bound to HSA with reversible and moderate affinity which explained its easy diffusion from circulatory system to target tissue. The thermodynamic parameters from fluorescence spectroscopic data clearly revealed the contribution of hydrophobic forces but, the role of hydrogen bonds was not negligible according to the ITC studies. The interaction was exothermic and spontaneous in nature. Binding with DAPG reduced the helical content of protein suggesting the unfolding of HSA. Site marker fluorescence experiments revealed the change in binding constant of DAPG in the presence of site I (warfarin) but not site II marker (ibuprofen) which confirmed that the DAPG bound to site I. ITC experiments also supported this as site I marker could not bind to HSA-DAPG complex while site II marker was accommodated in the complex. In silico studies further showed the lowest binding affinity and more stability of DAPG in site I than in site II. Thus the data presented in this study confirms the binding of DAPG to the site I of HSA which may help in further understanding of pharmacokinetic properties of DAPG.

Preclinical evaluation of a bispecific low-molecular heterodimer targeting both PSMA and GRPR for improved PET imaging and therapy of prostate cancer.

PubMed

Eder, Matthias; Schäfer, Martin; Bauder-Wüst, Ulrike; Haberkorn, Uwe; Eisenhut, Michael; Kopka, Klaus

2014-05-01

It has recently been reported that metastases of prostate cancer usually show highly heterogeneous or partly lost prostate-specific membrane antigen (PSMA) expression. In order to image and treat both PSMA positive and negative tissues PSMA targeting probes need to be extended by a further specificity. Since prostate cancer cells usually express both PSMA and gastrin-releasing peptide receptor (GRPR) a bispecific low-molecular heterodimeric molecule, addressing both targets at the same time, may significantly improve prostate cancer imaging and therapy. The nonapeptide BZH3 representing the GRPR binding part was combined with the urea-based PSMA inhibitor Glu-urea-Lys(Ahx)-HBED-CC. The syntheses of the compounds were performed according to standard Fmoc-solid phase peptide synthesis. The binding properties were analyzed by competitive cell binding and internalization experiments. The in vivo targeting properties were investigated by means of biodistribution studies. Cell binding experiments revealed high binding affinities to both GRPR and PSMA expressing cell lines. The heterodimer bound with IC50 -values essentially matching the IC50 values of the respective monomers (25.0 ± 5.4 nM for PSMA and 9.0 ± 1.8 nM for GRPR, respectively). In vivo, the heterodimer showed dual targeting of PSMA (5.4%ID/g for PSMA-positive tumors) and GRPR receptors (3.3% ID/g for GRPR-positive tumors) while exhibiting fast pharmacokinetic properties. The clearance from background was comparable to the monomeric PSMA-targeting reference. The heterodimeric molecule is a promising agent for PET imaging of primary and recurrent prostate cancer covering two receptor entities which might lead to an improved diagnostic sensitivity and therapeutic efficiency. © 2014 Wiley Periodicals, Inc.

Receptor-mediated binding of IgE-sensitized rat basophilic leukemia cells to antigen-coated substrates under hydrodynamic flow.

PubMed Central

Tempelman, L A; Hammer, D A

1994-01-01

The physiological function of many cells is dependent on their ability to adhere via receptors to ligand-coated surfaces under fluid flow. We have developed a model experimental system to measure cell adhesion as a function of cell and surface chemistry and fluid flow. Using a parallel-plate flow chamber, we measured the binding of rat basophilic leukemia cells preincubated with anti-dinitrophenol IgE antibody to polyacrylamide gels covalently derivatized with 2,4-dinitrophenol. The rat basophilic leukemia cells' binding behavior is binary: cells are either adherent or continue to travel at their hydrodynamic velocity, and the transition between these two states is abrupt. The spatial location of adherent cells shows cells can adhere many cell diameters down the length of the gel, suggesting that adhesion is a probabilistic process. The majority of experiments were performed in the excess ligand limit in which adhesion depends strongly on the number of receptors but weakly on ligand density. Only 5-fold changes in IgE surface density or in shear rate were necessary to change adhesion from complete to indistinguishable from negative control. Adhesion showed a hyperbolic dependence on shear rate. By performing experiments with two IgE-antigen configurations in which the kinetic rates of receptor-ligand binding are different, we demonstrate that the forward rate of reaction of the receptor-ligand pair is more important than its thermodynamic affinity in the regulation of binding under hydrodynamic flow. In fact, adhesion increases with increasing receptor-ligand reaction rate or decreasing shear rate, and scales with a single dimensionless parameter which compares the relative rates of reaction to fluid shear. Images FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8038394

The Interaction of Streptococcal Enolase with Canine Plasminogen: The Role of Surfaces in Complex Formation

PubMed Central

Balhara, Vinod; Deshmukh, Sasmit S.; Kálmán, László; Kornblatt, Jack A.

2014-01-01

The enolase from Streptococcus pyogenes (Str enolase F137L/E363G) is a homo-octamer shaped like a donut. Plasminogen (Pgn) is a monomeric protein composed of seven discrete separated domains organized into a lock washer. The enolase is known to bind Pgn. In past work we searched for conditions in which the two proteins would bind to one another. The two native proteins in solution would not bind under any of the tried conditions. We found that if the structures were perturbed binding would occur. We stated that only the non-native Str enolase or Pgn would interact such that we could detect binding. We report here the results of a series of dual polarization interferometry (DPI) experiments coupled with atomic force microscopy (AFM), isothermal titration calorimetry (ITC), dynamic light scattering (DLS), and fluorescence. We show that the critical condition for forming stable complexes of the two native proteins involves Str enolase binding to a surface. Surfaces that attract Str enolase are a sufficient condition for binding Pgn. Under certain conditions, Pgn adsorbed to a surface will bind Str enolase. PMID:24520380

Biphasic association of T7 RNA polymerase and a nucleotide analogue, cibacron blue as a model to understand the role of initiating nucleotide in the mechanism of enzyme action.

PubMed

Pai, Sudipta; Das, Mili; Banerjee, Rahul; Dasgupta, Dipak

2011-08-01

T7 RNA polymerase (T7 RNAP) is an enzyme that utilizes ribonucleotides to synthesize the nascent RNA chain in a template-dependent manner. Here we have studied the interaction of T7 RNAP with cibacron blue, an anthraquinone monochlorotriazine dye, its effect on the function of the enzyme and the probable mode of binding of the dye. We have used difference absorption spectroscopy and isothermal titration calorimetry to show that the dye binds T7 RNAP in a biphasic manner. The first phase of the binding is characterized by inactivation of the enzyme. The second binding site overlaps with the common substrate-binding site of the enzyme. We have carried out docking experiment to map the binding site of the dye in the promoter bound protein. Competitive displacement of the dye from the high affinity site by labeled GTP and isothermal titration calorimetry of high affinity GTP bound enzyme with the dye suggests a strong correlation between the high affinity dye binding and the high affinity GTP binding in T7 RNAP reported earlier from our laboratory.

Feature binding in visual short-term memory is unaffected by task-irrelevant changes of location, shape, and color.

PubMed

Logie, Robert H; Brockmole, James R; Jaswal, Snehlata

2011-01-01

Three experiments used a change detection paradigm across a range of study-test intervals to address the respective contributions of location, shape, and color to the formation of bindings of features in sensory memory and visual short-term memory (VSTM). In Experiment 1, location was designated task irrelevant and was randomized between study and test displays. The task was to detect changes in the bindings between shape and color. In Experiments 2 and 3, shape and color, respectively, were task irrelevant and randomized, with bindings tested between location and color (Experiment 2) and location and shape (Experiment 3). At shorter study-test intervals, randomizing location was most disruptive, followed by shape and then color. At longer intervals, randomizing any task-irrelevant feature had no impact on change detection for bindings between features, and location had no special role. Results suggest that location is crucial for initial perceptual binding but loses that special status once representations are formed in VSTM, which operates according to different principles, than do visual attention and perception.

Novel water soluble morpholine substituted Zn(II) phthalocyanine: Synthesis, characterization, DNA/BSA binding, DNA photocleavage and topoisomerase I inhibition.

PubMed

Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit

2017-12-01

In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.

Interactions of poly(amidoamine) dendrimers with human serum albumin: binding constants and mechanisms.

PubMed

Giri, Jyotsnendu; Diallo, Mamadou S; Simpson, André J; Liu, Yi; Goddard, William A; Kumar, Rajeev; Woods, Gwen C

2011-05-24

The interactions of nanomaterials with plasma proteins have a significant impact on their in vivo transport and fate in biological fluids. This article discusses the binding of human serum albumin (HSA) to poly(amidoamine) [PAMAM] dendrimers. We use protein-coated silica particles to measure the HSA binding constants (K(b)) of a homologous series of 19 PAMAM dendrimers in aqueous solutions at physiological pH (7.4) as a function of dendrimer generation, terminal group, and core chemistry. To gain insight into the mechanisms of HSA binding to PAMAM dendrimers, we combined (1)H NMR, saturation transfer difference (STD) NMR, and NMR diffusion ordered spectroscopy (DOSY) of dendrimer-HSA complexes with atomistic molecular dynamics (MD) simulations of dendrimer conformation in aqueous solutions. The binding measurements show that the HSA binding constants (K(b)) of PAMAM dendrimers depend on dendrimer size and terminal group chemistry. The NMR (1)H and DOSY experiments indicate that the interactions between HSA and PAMAM dendrimers are relatively weak. The (1)H NMR STD experiments and MD simulations suggest that the inner shell protons of the dendrimers groups interact more strongly with HSA proteins. These interactions, which are consistently observed for different dendrimer generations (G0-NH(2)vs G4-NH(2)) and terminal groups (G4-NH(2)vs G4-OH with amidoethanol groups), suggest that PAMAM dendrimers adopt backfolded configurations as they form weak complexes with HSA proteins in aqueous solutions at physiological pH (7.4).

In Silico Screening for Inhibitors of P-Glycoprotein That Target the Nucleotide Binding Domains

PubMed Central

Brewer, Frances K.; Follit, Courtney A.; Vogel, Pia D.

2014-01-01

Multidrug resistances and the failure of chemotherapies are often caused by the expression or overexpression of ATP-binding cassette transporter proteins such as the multidrug resistance protein, P-glycoprotein (P-gp). P-gp is expressed in the plasma membrane of many cell types and protects cells from accumulation of toxins. P-gp uses ATP hydrolysis to catalyze the transport of a broad range of mostly hydrophobic compounds across the plasma membrane and out of the cell. During cancer chemotherapy, the administration of therapeutics often selects for cells which overexpress P-gp, thereby creating populations of cancer cells resistant to a variety of chemically unrelated chemotherapeutics. The present study describes extremely high-throughput, massively parallel in silico ligand docking studies aimed at identifying reversible inhibitors of ATP hydrolysis that target the nucleotide-binding domains of P-gp. We used a structural model of human P-gp that we obtained from molecular dynamics experiments as the protein target for ligand docking. We employed a novel approach of subtractive docking experiments that identified ligands that bound predominantly to the nucleotide-binding domains but not the drug-binding domains of P-gp. Four compounds were found that inhibit ATP hydrolysis by P-gp. Using electron spin resonance spectroscopy, we showed that at least three of these compounds affected nucleotide binding to the transporter. These studies represent a successful proof of principle demonstrating the potential of targeted approaches for identifying specific inhibitors of P-gp. PMID:25270578

Participation of cysteine-rich secretory proteins (CRISP) in mammalian sperm-egg interaction.

PubMed

Cohen, Débora J; Busso, Dolores; Da Ros, Vanina; Ellerman, Diego A; Maldera, Julieta A; Goldweic, Nadia; Cuasnicu, Patricia S

2008-01-01

Mammalian fertilization is a complex multi-step process mediated by different molecules present on both gametes. CRISP1 (cysteine-rich secretory protein 1) is an epididymal protein thought to participate in gamete fusion through its binding to egg-complementary sites. Structure-function studies using recombinant fragments of CRISP1 as well as synthetic peptides reveal that its egg-binding ability resides in a 12 amino acid region corresponding to an evolutionary conserved motif of the CRISP family, named Signature 2 (S2). Further experiments analyzing both the ability of other CRISP proteins to bind to the rat egg and the amino acid sequence of their S2 regions show that the amino acid sequence of the S2 is needed for CRISP1 to interact with the egg. CRISP1 appears to be involved in the first step of sperm binding to the zona pellucida, identifying a novel role for this protein in fertilization. The observation that sperm testicular CRISP2 is also able to bind to the egg surface suggests a role for this protein in gamete fusion. Subsequent experiments confirmed the participation of CRISP2 in this step of fertilization and revealed that CRISP1 and CRISP2 interact with common egg surface binding sites. Together, these results suggest a functional cooperation between CRISP1 and CRISP2 to ensure the success of fertilization. These observations contribute to a better understanding of the molecular mechanisms underlying mammalian fertilization.

[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

PubMed Central

Dumont, Yvan; Quirion, Rémi

2000-01-01

GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

Interaction of albumins and heparinoids investigated by affinity capillary electrophoresis and free flow electrophoresis.

PubMed

Mozafari, Mona; El Deeb, Sami; Krull, Friederike; Wildgruber, Robert; Weber, Gerhard; Reiter, Christian G; Wätzig, Hermann

2018-02-01

A fast and precise affinity capillary electrophoresis (ACE) method has been applied to investigate the interactions between two serum albumins (HSA and BSA) and heparinoids. Furthermore, different free flow electrophoresis methods were developed to separate the species which appears owing to interaction of albumins with pentosan polysulfate sodium (PPS) under different experimental conditions. For ACE experiments, the normalized mobility ratios (∆R/R f ), which provided information about the binding strength and the overall charge of the protein-ligand complex, were used to evaluate the binding affinities. ACE experiments were performed at two different temperatures (23 and 37°C). Both BSA and HSA interact more strongly with PPS than with unfractionated and low molecular weight heparins. For PPS, the interactions can already be observed at low mg/L concentrations (3 mg/L), and saturation is already obtained at approximately 20 mg/L. Unfractionated heparin showed almost no interactions with BSA at 23°C, but weak interactions at 37°C at higher heparin concentrations. The additional signals also appeared at higher concentrations at 37°C. Nevertheless, in most cases the binding data were similar at both temperatures. Furthermore, HSA showed a characteristic splitting in two peaks especially after interacting with PPS, which is probably attributable to the formation of two species or conformational change of HSA after interacting with PPS. The free flow electrophoresis methods have confirmed and completed the ACE experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

A solvent-dependent fluorescent detection method for Fe(3+) and Hg(2+) based on a rhodamine B derivative.

PubMed

Li, Xutian; Yin, Yue; Deng, Junjie; Zhong, Huixian; Tang, Jian; Chen, Zhi; Yang, Liting; Ma, Li-Jun

2016-07-01

A new rhodamine B-benzofurazan based fluorescent probe (1) for Fe(3+) and Hg(2+) was synthesized. In aqueous solution containing 30% (v/v) ethanol, probe 1 shows a high selective fluorescent enhancement recognition to Fe(3+) with a binding ratio of 1:1 (probe 1: Fe(3+)), when the concentration of Fe(3+) is less than that of the probe. When the concentration of Fe(3+) is higher than that of the probe, it shows fluorescent "turn-on" response to Fe(3+) by opening the rhodamine spirolactam with a binding ratio of 1:2 (probe 1: Fe(3+)). Furthermore, probe 1 displays a high selectivity and a hypersensitivity (detection limit is 4.4nM) to Hg(2+) with a binding ratio of 1:1 in ethanol. NMR and UV-vis experiments indicate that the different fluorescent recognition signals to Fe(3+) and Hg(2+) are derived from different binding modes of 1-Fe(3+) and 1-Hg(2+). Copyright © 2016 Elsevier B.V. All rights reserved.

DETECTION OF TWO ISOMERIC BINDING CONFIGURATIONS IN A PROTEIN-APTAMER COMPLEX WITH A BIOLOGICAL NANOPORE

PubMed Central

Van Meervelt, Veerle; Soskine, Misha; Maglia, Giovanni

2015-01-01

Protein-DNA interactions play critical roles in biological systems, and they often involve complex mechanisms and dynamics that are not easily measured by ensemble experiments. Recently, we have shown that folded proteins can be internalised inside ClyA nanopores and studied by ionic current recordings at the single-molecule level. Here, we use ClyA nanopores to sample the interaction between the G-quadruplex fold of the thrombin binding aptamer (TBA) and human thrombin (HT). Surprisingly, the internalisation of the HT:TBA complex inside the nanopore induced two types of current blockades with distinguished residual current and lifetime. Using single nucleobase substitutions to TBA we showed that these two types of blockades originate from TBA binding to thrombin with two isomeric orientations. Voltage dependencies and the use of ClyA nanopores with two different diameters allowed assessing the effect of the applied potential and confinement, and revealed that the two binding configurations of TBA to HT display different lifetimes. These results show that the ClyA nanopores might provide a new approach to probe conformational heterogeneity in protein:DNA interactions. PMID:25493908

Structural analysis of Arabidopsis thaliana nucleoside diphosphate kinase-2 for phytochrome-mediated light signaling.

PubMed

Im, Young Jun; Kim, Jeong-Il; Shen, Yu; Na, Young; Han, Yun-Jeong; Kim, Seong-Hee; Song, Pill-Soon; Eom, Soo Hyun

2004-10-22

In plants, nucleoside diphosphate kinases (NDPKs) play a key role in the signaling of both stress and light. However, little is known about the structural elements involved in their function. Of the three NDPKs (NDPK1-NDPK3) expressed in Arabidopsis thaliana, NDPK2 is involved in phytochrome-mediated signal transduction. In this study, we found that the binding of dNDP or NTP to NDPK2 strengthens the interaction significantly between activated phytochrome and NDPK2. To better understand the structural basis of the phytochrome-NDPK2 interaction, we determined the X-ray structures of NDPK1, NDPK2, and dGTP-bound NDPK2 from A.thaliana at 1.8A, 2.6A, and 2.4A, respectively. The structures showed that nucleotide binding caused a slight conformational change in NDPK2 that was confined to helices alphaA and alpha2. This suggests that the presence of nucleotide in the active site and/or the evoked conformational change contributes to the recognition of NDPK2 by activated phytochrome. In vitro binding assays showed that only NDPK2 interacted specifically with the phytochrome and the C-terminal regulatory domain of phytochrome is involved in the interaction. A domain swap experiment between NDPK1 and NDPK2 showed that the variable C-terminal region of NDPK2 is important for the activation by phytochrome. The structure of Arabidopsis NDPK1 and NDPK2 showed that the isoforms share common electrostatic surfaces at the nucleotide-binding site, but the variable C-terminal regions have distinct electrostatic charge distributions. These findings suggest that the binding of nucleotide to NDPK2 plays a regulatory role in phytochrome signaling and that the C-terminal extension of NDPK2 provides a potential binding surface for the specific interaction with phytochromes.

DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

PubMed Central

Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

2017-01-01

APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

PubMed

Volkán-Kacsó, Sándor; Marcus, Rudolph A

2016-10-25

A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

Metal cofactor modulated folding and target recognition of HIV-1 NCp7.

PubMed

Ren, Weitong; Ji, Dongqing; Xu, Xiulian

2018-01-01

The HIV-1 nucleocapsid 7 (NCp7) plays crucial roles in multiple stages of HIV-1 life cycle, and its biological functions rely on the binding of zinc ions. Understanding the molecular mechanism of how the zinc ions modulate the conformational dynamics and functions of the NCp7 is essential for the drug development and HIV-1 treatment. In this work, using a structure-based coarse-grained model, we studied the effects of zinc cofactors on the folding and target RNA(SL3) recognition of the NCp7 by molecular dynamics simulations. After reproducing some key properties of the zinc binding and folding of the NCp7 observed in previous experiments, our simulations revealed several interesting features in the metal ion modulated folding and target recognition. Firstly, we showed that the zinc binding makes the folding transition states of the two zinc fingers less structured, which is in line with the Hammond effect observed typically in mutation, temperature or denaturant induced perturbations to protein structure and stability. Secondly, We showed that there exists mutual interplay between the zinc ion binding and NCp7-target recognition. Binding of zinc ions enhances the affinity between the NCp7 and the target RNA, whereas the formation of the NCp7-RNA complex reshapes the intrinsic energy landscape of the NCp7 and increases the stability and zinc affinity of the two zinc fingers. Thirdly, by characterizing the effects of salt concentrations on the target RNA recognition, we showed that the NCp7 achieves optimal balance between the affinity and binding kinetics near the physiologically relevant salt concentrations. In addition, the effects of zinc binding on the inter-domain conformational flexibility and folding cooperativity of the NCp7 were also discussed.

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

Structure of a Thermobifida fusca lytic polysaccharide monooxygenase and mutagenesis of key residues

DOE PAGES

Kruer-Zerhusen, Nathan; Alahuhta, Markus; Lunin, Vladimir V.; ...

2017-11-30

Auxiliary activity (AA) enzymes are produced by numerous bacterial and fungal species to assist in the degradation of biomass. These enzymes are abundant but have yet to be fully characterized. Here, we report the X-ray structure of Thermobifida fusca AA10A (TfAA10A), investigate mutational characterization of key surface residues near its active site, and explore the importance of the various domains of Thermobifida fusca AA10B (TfAA10B). The structure of TfAA10A is similar to other bacterial LPMOs (lytic polysaccharide monooxygenases), including signs of photo-reduction and a distorted active site, with mixed features showing both type I and II copper coordination. The pointmore » mutation experiments of TfAA10A show that Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for the binding of substrate, but that the X1 module does not affect binding or activity. In TfAA10A, Trp82 and Asn83 are needed for binding, but only Trp82 affects activity. The TfAA10B domain truncation mutants reveal that CBM2 is crucial for substrate binding, but that the X1 module does not affect binding or activity. The structure of TfAA10A is similar to other bacterial lytic polysaccharide monooxygenases with mixed features showing both type I and II copper coordination. The role of LPMOs and the variability of abundance in genomes are not fully explored. LPMOs likely perform initial attacks into crystalline cellulose to allow larger processive cellulases to bind and attack, but the precise nature of their synergistic behavior remains to be definitively characterized.« less

Small ubiquitin-related modifier is secreted and shows cytokine-like activity.

PubMed

Hosono, Hidetaka; Yokosawa, Hideyoshi

2008-05-01

Small ubiquitin-related modifier (SUMO) is a type I ubiquitin-like protein family member and is covalently attached to various target proteins. Through this post-translational modification, SUMO plays important roles in various cellular events. Here, we show that SUMO is secreted from cultured cells in an endoplasmic reticulum (ER)/Golgi-independent manner and that this secretion occurs without covalent binding to target proteins or chain formation. Overexpression experiments using C-terminally truncated mutants of SUMO revealed that the secretion requires the C-terminal sequence. Recombinant SUMO-3 protein was capable of binding to and promoting the proliferation of cultured cells. Thus, we propose that SUMO functions as a cytokine-like molecule extracellularly.

Accurate ensemble molecular dynamics binding free energy ranking of multidrug-resistant HIV-1 proteases.

PubMed

Sadiq, S Kashif; Wright, David W; Kenway, Owain A; Coveney, Peter V

2010-05-24

Accurate calculation of important thermodynamic properties, such as macromolecular binding free energies, is one of the principal goals of molecular dynamics simulations. However, single long simulation frequently produces incorrectly converged quantitative results due to inadequate sampling of conformational space in a feasible wall-clock time. Multiple short (ensemble) simulations have been shown to explore conformational space more effectively than single long simulations, but the two methods have not yet been thermodynamically compared. Here we show that, for end-state binding free energy determination methods, ensemble simulations exhibit significantly enhanced thermodynamic sampling over single long simulations and result in accurate and converged relative binding free energies that are reproducible to within 0.5 kcal/mol. Completely correct ranking is obtained for six HIV-1 protease variants bound to lopinavir with a correlation coefficient of 0.89 and a mean relative deviation from experiment of 0.9 kcal/mol. Multidrug resistance to lopinavir is enthalpically driven and increases through a decrease in the protein-ligand van der Waals interaction, principally due to the V82A/I84V mutation, and an increase in net electrostatic repulsion due to water-mediated disruption of protein-ligand interactions in the catalytic region. Furthermore, we correctly rank, to within 1 kcal/mol of experiment, the substantially increased chemical potency of lopinavir binding to the wild-type protease compared to saquinavir and show that lopinavir takes advantage of a decreased net electrostatic repulsion to confer enhanced binding. Our approach is dependent on the combined use of petascale computing resources and on an automated simulation workflow to attain the required level of sampling and turn around time to obtain the results, which can be as little as three days. This level of performance promotes integration of such methodology with clinical decision support systems for the optimization of patient-specific therapy.

Detection of Specific Solvent Rearrangement Regions of an Enzyme: NMR and ITC Studies with Aminoglycoside Phosphotransferase(3??)-IIIa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozen, C.; Norris, Adrianne; Land, Miriam L

2008-01-01

This work describes differential effects of solvent in complexes of the aminoglycoside phosphotransferase(3¢)-IIIa (APH) with different aminoglycosides and the detection of change in solvent structure at specific sites away from substrates. Binding of kanamycins to APH occurs with a larger negative ¢H in H2O relative to D2O (¢¢H(H2O-D2O) < 0), while the reverse is true for neomycins. Unusually large negative ¢Cp values were observed for binding of aminoglycosides to APH. ¢Cp for the APHneomycin complex was -1.6 kcalâmol-1âdeg-1. A break at 30 C was observed in the APH-kanamycin complex yielding ¢Cp values of -0.7 kcalâmol-1âdeg-1 and -3.8 kcalâmol-1âdeg-1 below andmore » above 30 C, respectively. Neither the change in accessible surface area (¢ASA) nor contributions from heats of ionization were sufficient to explain the large negative ¢Cp values. Most significantly, 15N-1H HSQC experiments showed that temperature-dependent shifts of the backbone amide protons of Leu 88, Ser 91, Cys 98, and Leu143 revealed a break at 30 C only in the APH-kanamycin complex in spectra collected between 21 C and 38 C. These amino acids represent solVent reorganization sites that experience a change in solvent structure in their immediate environment as structurally different ligands bind to the enzyme. These residues were away from the substrate binding site and distributed in three hydrophobic patches in APH. Overall, our results show that a large number of factors affect ¢Cp and binding of structurally different ligand groups cause different solvent structure in the active site as well as differentially affecting specific sites away from the ligand binding site.« less

How much does emotional valence of action outcomes affect temporal binding?

PubMed

Moreton, Joshua; Callan, Mitchell J; Hughes, Gethin

2017-03-01

Temporal binding refers to the compression of the perceived time interval between voluntary actions and their sensory consequences. Research suggests that the emotional content of an action outcome can modulate the effects of temporal binding. We attempted to conceptually replicate these findings using a time interval estimation task and different emotionally-valenced action outcomes (Experiments 1 and 2) than used in previous research. Contrary to previous findings, we found no evidence that temporal binding was affected by the emotional valence of action outcomes. After validating our stimuli for equivalence of perceived emotional valence and arousal (Experiment 3), in Experiment 4 we directly replicated Yoshie and Haggard's (2013) original experiment using sound vocalizations as action outcomes and failed to detect a significant effect of emotion on temporal binding. These studies suggest that the emotional valence of action outcomes exerts little influence on temporal binding. The potential implications of these findings are discussed. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Dynamics, Conformational Entropy, and Frustration in Protein-Protein Interactions Involving an Intrinsically Disordered Protein Domain.

PubMed

Lindström, Ida; Dogan, Jakob

2018-05-18

Intrinsically disordered proteins (IDPs) are abundant in the eukaryotic proteome. However, little is known about the role of subnanosecond dynamics and the conformational entropy that it represents in protein-protein interactions involving IDPs. Using nuclear magnetic resonance side chain and backbone relaxation, stopped-flow kinetics, isothermal titration calorimetry, and computational studies, we have characterized the interaction between the globular TAZ1 domain of the CREB binding protein and the intrinsically disordered transactivation domain of STAT2 (TAD-STAT2). We show that the TAZ1/TAD-STAT2 complex retains considerable subnanosecond motions, with TAD-STAT2 undergoing only a partial disorder-to-order transition. We report here the first experimental determination of the conformational entropy change for both binding partners in an IDP binding interaction and find that the total change even exceeds in magnitude the binding enthalpy and is comparable to the contribution from the hydrophobic effect, demonstrating its importance in the binding energetics. Furthermore, we show that the conformational entropy change for TAZ1 is also instrumental in maintaining a biologically meaningful binding affinity. Strikingly, a spatial clustering of very high amplitude motions and a cluster of more rigid sites in the complex exist, which through computational studies we found to overlap with regions that experience energetic frustration and are less frustrated, respectively. Thus, the residual dynamics in the bound state could be necessary for faster dissociation, which is important for proteins that interact with multiple binding partners.

An additional substrate binding site in a bacterial phenylalanine hydroxylase

PubMed Central

Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

2014-01-01

Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

Specific electrostatic interactions between charged amino acid residues regulate binding of von Willebrand factor to blood platelets.

PubMed

Interlandi, Gianluca; Yakovenko, Olga; Tu, An-Yue; Harris, Jeff; Le, Jennie; Chen, Junmei; López, José A; Thomas, Wendy E

2017-11-10

The plasma protein von Willebrand factor (VWF) is essential for hemostasis initiation at sites of vascular injury. The platelet-binding A1 domain of VWF is connected to the VWF N-terminally located D'D3 domain through a relatively unstructured amino acid sequence, called here the N-terminal linker. This region has previously been shown to inhibit the binding of VWF to the platelet surface receptor glycoprotein Ibα (GpIbα). However, the molecular mechanism underlying the inhibitory function of the N-terminal linker has not been elucidated. Here, we show that an aspartate at position 1261 is the most critical residue of the N-terminal linker for inhibiting binding of the VWF A1 domain to GpIbα on platelets in blood flow. Through a combination of molecular dynamics simulations, mutagenesis, and A1-GpIbα binding experiments, we identified a network of salt bridges between Asp 1261 and the rest of A1 that lock the N-terminal linker in place such that it reduces binding to GpIbα. Mutations aimed at disrupting any of these salt bridges activated binding unless the mutated residue also formed a salt bridge with GpIbα, in which case the mutations inhibited the binding. These results show that interactions between charged amino acid residues are important both to directly stabilize the A1-GpIbα complex and to indirectly destabilize the complex through the N-terminal linker. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

PubMed

Nguyen, T V; Juorio, A V

1989-10-01

The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

Synergistic effect of (+)-pinitol from Saraca asoca with β-lactam antibiotics and studies on the in silico possible mechanism.

PubMed

Ahmad, Furkan; Misra, Laxminarain; Gupta, Vivek Kumar; Darokar, Mahendra Pandurang; Prakash, Om; Khan, Feroz; Shukla, Rakesh

2016-01-01

Saraca asoca bark has been used in the Ayurvedic system of medicine for female urino-genital disorders. We have recently reported the isolation and characterization of several compounds as markers to develop HPLC profiling of its methanol and aqueous methanol extracts. Now, a HPLC-PDA inactive compound, (+)-pinitol has been isolated and characterized from the bark of this medicinally important tree. Pinitol is a well known bioactive compound for a variety of biological activities, including hypoglycemic and anti-inflammatory activities. A process for the isolation of relatively good concentration of (+)-pinitol from S. asoca bark has been developed and its in vitro anti TNF-α and anti-inflammatory activities against carragenan-induced edema confirmed. While conducting experiments on the possible agonistic activity, it was found that (+)-pinitol showed up to eight fold reduction in the doses of β-lactam antibiotics. The mechanism of its agonistic activity was studied by docking experiments which showed that different conformations of (+)-pinitol and antibiotics were actually in the same binding site with no significant change in the binding energy. These docking simulations, thus predict the possible binding mode of studied compounds and probable reason behind the synergistic effect of (+)-pinitol along with β-lactam antibiotics.

Purification and characterization of Lep d I, a major allergen from the mite Lepidoglyphus destructor.

PubMed

Ventas, P; Carreira, J; Polo, F

1992-04-01

A major allergen of the storage mite Lepidoglyphus destructor (Lep d I) has been purified by affinity chromatography using an anti-Lep d I monoclonal antibody. The purity of the protein obtained by this procedure was assessed by reverse-phase HPLC. Lep d I displayed a molecular weight of 14 kD on SDS-PAGE under non-reducing conditions, and 16 kD in the presence of a reducing agent. Analytical IEF revealed a little charge microheterogeneity, showing three bands with pIs 7.6-7.8. Purified Lep d I retained IgE-binding ability, as proved by immunoblotting experiments after SDS-PAGE and RAST with individual sera from L. destructor-sensitive patients. Results from the latter technique demonstrated that 87% of L. destructor-allergic patients had specific IgE to Lep d I, and a good correlation between IgE reactivity with L. destructor extract and Lep d I was found. In addition, RAST inhibition experiments showed that IgE-binding sites on Lep d I are major L. destructor-allergenic determinants, since Lep d I could inhibit up to 75% the binding of specific IgE to L. destructor extract; on the other hand, Lep d I did not cross-react with D. pteronyssinus allergens.

Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

PubMed Central

Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

2012-01-01

Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

A rapid method for selecting suitable animal species for studying pathogen interactions with plasma protein ligands in vivo.

PubMed

Naudin, Clément; Schumski, Ariane; Salo-Ahen, Outi M H; Herwald, Heiko; Smeds, Emanuel

2017-05-01

Species tropism constitutes a serious problem for developing relevant animal models of infection. Human pathogens can express virulence factors that show specific selectivity to human proteins, while their affinity for orthologs from other species can vary significantly. Suitable animal species must be used to analyse whether virulence factors are potential targets for drug development. We developed an assay that rapidly predicts applicable animal species for studying virulence factors binding plasma proteins. We used two well-characterized Staphylococcus aureus proteins, SSL7 and Efb, to develop an ELISA-based inhibition assay using plasma from different animal species. The interaction between SSL7 and human C5 and the binding of Efb to human fibrinogen and human C3 was studied. Affinity experiments and Western blot analyses were used to validate the assay. Human, monkey and cat plasma interfered with binding of SSL7 to human C5. Binding of Efb to human fibrinogen was blocked in human, monkey, gerbil and pig plasma, while human, monkey, gerbil, rabbit, cat and guinea pig plasma inhibited the binding of Efb to human C3. These results emphasize the importance of choosing correct animal models, and thus, our approach is a rapid and cost-effective method that can be used to prevent unnecessary animal experiments. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Analyzing Intracellular Binding and Diffusion with Continuous Fluorescence Photobleaching

PubMed Central

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W.; Knoch, Tobias A.; Waldeck, Waldemar; Langowski, Jörg

2003-01-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of ∼13 s. PMID:12719264

Analyzing intracellular binding and diffusion with continuous fluorescence photobleaching.

PubMed

Wachsmuth, Malte; Weidemann, Thomas; Müller, Gabriele; Hoffmann-Rohrer, Urs W; Knoch, Tobias A; Waldeck, Waldemar; Langowski, Jörg

2003-05-01

Transport and binding of molecules to specific sites are necessary for the assembly and function of ordered supramolecular structures in cells. For analyzing these processes in vivo, we have developed a confocal fluorescence fluctuation microscope that allows both imaging of the spatial distribution of fluorescent molecules with confocal laser scanning microscopy and probing their mobility at specific positions in the cell with fluorescence correlation spectroscopy and continuous fluorescence photobleaching (CP). Because fluorescence correlation spectroscopy is restricted to rapidly diffusing particles and CP to slower processes, these two methods complement each other. For the analysis of binding-related contributions to mobility we have derived analytical expressions for the temporal behavior of CP curves from which the bound fraction and/or the dissociation rate or residence time at binding sites, respectively, can be obtained. In experiments, we investigated HeLa cells expressing different fluorescent proteins: Although enhanced green fluorescent protein (EGFP) shows high mobility, fusions of histone H2B with the yellow fluorescent protein are incorporated into chromatin, and these nuclei exhibit the presence of a stably bound and a freely diffusing species. Nonpermanent binding was found for mTTF-I, a transcription termination factor for RNA polymerase I, fused with EGFP. The cells show fluorescent nucleoli, and binding is transient. CP yields residence times for mTTF-I-EGFP of approximately 13 s.

Redox process is crucial for inhibitory properties of aurintricarboxylic acid against activity of YopH: virulence factor of Yersinia pestis

PubMed Central

Kuban-Jankowska, Alicja; Gorska, Magdalena; Tuszynski, Jack A; Ossowski, Tadeusz; Wozniak, Michal

2015-01-01

YopH is a bacterial protein tyrosine phosphatase, which is essential for the viability and pathogenic virulence of the plague-causing Yersinia sp. bacteria. Inactivation of YopH activity would lead to the loss of bacterial pathogenicity. We have studied the inhibitory properties of aurintricarboxylic acid (ATA) against YopH phosphatase and found that at nanomolar concentrations ATA reversibly decreases the activity of YopH. Computational docking studies indicated that in all binding poses ATA binds in the YopH active site. Molecular dynamics simulations showed that in the predicted binding pose, ATA binds to the essential Cys403 and Arg409 residues in the active site and has a stronger binding affinity than the natural substrate (pTyr). The cyclic voltammetry experiments suggest that ATA reacts remarkably strongly with molecular oxygen. Additionally, the electrochemical reduction of ATA in the presence of a negative potential from −2.0 to 2.5 V generates a current signal, which is observed for hydrogen peroxide. Here we showed that ATA indicates a unique mechanism of YopH inactivation due to a redox process. We proposed that the potent inhibitory properties of ATA are a result of its strong binding in the YopH active site and in situ generation of hydrogen peroxide near catalytic cysteine residue. PMID:26286963

Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

Biosorption of metal ions from aqueous solutions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Jiaping; Yiacoumi, Sotira

1997-01-01

Copper biosorption from aqueous solutions by calcium alginate is reported in this paper. The experimental section includes potentiometric titrations of biosorbents, batch equilibrium and kinetic studies of copper biosorption, as well as fixed-bed biosorption experiments. The potentiometric titration results show that the surface charge increases with decreasing pH. The biosorption of copper strongly depends on solution pH; the metal ion binding increases from 0 to 90 percent in pH ranging from 1.5 to 5.0. In addition, a decrease in ionic strength results in an increase of copper ion removal. Kinetic studies indicate that mass transfer plays an important role inmore » the biosorption rate. Furthermore, a fixed-bed biosorption experiment shows that calcium alginate has a significant capacity for copper ion removal. The two-pK Basic Stem model successfully represents the surface charge and equilibrium biosorption experimental data. The calculation results demonstrate that the copper removal may result from the binding of free copper and its hydroxide with surface functional groups of the biosorbents.« less

Tes, a specific Mena interacting partner, breaks the rules for EVH1 binding.

PubMed

Boëda, Batiste; Briggs, David C; Higgins, Theresa; Garvalov, Boyan K; Fadden, Andrew J; McDonald, Neil Q; Way, Michael

2007-12-28

The intracellular targeting of Ena/VASP family members is achieved via the interaction of their EVH1 domain with FPPPP sequence motifs found in a variety of cytoskeletal proteins, including lamellipodin, vinculin, and zyxin. Here we show that the LIM3 domain of Tes, which lacks the FPPPP motif, binds to the EVH1 domain of Mena, but not to those of VASP or Evl. The structure of the LIM3:EVH1 complex reveals that Tes occludes the FPPPP-binding site and competes with FPPPP-containing proteins for EVH1 binding. Structure-based gain-of-function experiments define the molecular basis for the specificity of the Tes-Mena interaction. Consistent with in vitro observations, the LIM3 domain displaces Mena, but not VASP, from the leading edge and focal adhesions. It also regulates cell migration through a Mena-dependent mechanism. Our observations identify Tes as an atypical EVH1 binding partner and a regulator specific to a single Ena/VASP family member.

Structures of human thymidylate synthase R163K with dUMP, FdUMP and glutathione show asymmetric ligand binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibson, Lydia M.; Celeste, Lesa R.; Lovelace, Leslie L.

Thymidylate synthase (TS) is a well validated target in cancer chemotherapy. Here, a new crystal form of the R163K variant of human TS (hTS) with five subunits per asymmetric part of the unit cell, all with loop 181-197 in the active conformation, is reported. This form allows binding studies by soaking crystals in artificial mother liquors containing ligands that bind in the active site. Using this approach, crystal structures of hTS complexes with FdUMP and dUMP were obtained, indicating that this form should facilitate high-throughput analysis of hTS complexes with drug candidates. Crystal soaking experiments using oxidized glutathione revealed thatmore » hTS binds this ligand. Interestingly, the two types of binding observed are both asymmetric. In one subunit of the physiological dimer covalent modification of the catalytic nucleophile Cys195 takes place, while in another dimer a noncovalent adduct with reduced glutathione is formed in one of the active sites.« less

Membrane interaction of the N-terminal domain of chemokine receptor CXCR1.

PubMed

Haldar, Sourav; Raghuraman, H; Namani, Trishool; Rajarathnam, Krishna; Chattopadhyay, Amitabha

2010-06-01

The N-terminal domain of chemokine receptors constitutes one of the two critical ligand binding sites, and plays important roles by mediating binding affinity, receptor selectivity, and regulating function. In this work, we monitored the organization and dynamics of a 34-mer peptide of the CXC chemokine receptor 1 (CXCR1) N-terminal domain and its interaction with membranes by utilizing a combination of fluorescence-based approaches and surface pressure measurements. Our results show that the CXCR1 N-domain 34-mer peptide binds vesicles of 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and upon binding, the tryptophan residues of the peptide experience motional restriction and exhibit red edge excitation shift (REES) of 19nm. These results are further supported by increase in fluorescence anisotropy and mean fluorescence lifetime upon membrane binding. These results constitute one of the first reports demonstrating membrane interaction of the N-terminal domain of CXCR1 and gain relevance in the context of the emerging role of cellular membranes in chemokine signaling.

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

PubMed Central

Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

1998-01-01

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

Identification of neuronal target genes for CCAAT/Enhancer Binding Proteins

PubMed Central

Kfoury, N.; Kapatos, G.

2009-01-01

CCAAT/Enhancer Binding Proteins (C/EBPs) play pivotal roles in development and plasticity of the nervous system. Identification of the physiological targets of C/EBPs (C/EBP target genes) should therefore provide insight into the underlying biology of these processes. We used unbiased genome-wide mapping to identify 115 C/EBPβ target genes in PC12 cells that include transcription factors, neurotransmitter receptors, ion channels, protein kinases and synaptic vesicle proteins. C/EBPβ binding sites were located primarily within introns, suggesting novel regulatory functions, and were associated with binding sites for other developmentally important transcription factors. Experiments using dominant negatives showed C/EBPβ to repress transcription of a subset of target genes. Target genes in rat brain were subsequently found to preferentially bind C/EBPα, β and δ. Analysis of the hippocampal transcriptome of C/EBPβ knockout mice revealed dysregulation of a high percentage of transcripts identified as C/EBP target genes. These results support the hypothesis that C/EBPs play non-redundant roles in the brain. PMID:19103292

Functional Dynamics of PDZ Binding Domains: A Normal-Mode Analysis

PubMed Central

De Los Rios, Paolo; Cecconi, Fabio; Pretre, Anna; Dietler, Giovanni; Michielin, Olivier; Piazza, Francesco; Juanico, Brice

2005-01-01

Postsynaptic density-95/disks large/zonula occludens-1 (PDZ) domains are relatively small (80–120 residues) protein binding modules central in the organization of receptor clusters and in the association of cellular proteins. Their main function is to bind C-terminals of selected proteins that are recognized through specific amino acids in their carboxyl end. Binding is associated with a deformation of the PDZ native structure and is responsible for dynamical changes in regions not in direct contact with the target. We investigate how this deformation is related to the harmonic dynamics of the PDZ structure and show that one low-frequency collective normal mode, characterized by the concerted movements of different secondary structures, is involved in the binding process. Our results suggest that even minimal structural changes are responsible for communication between distant regions of the protein, in agreement with recent NMR experiments. Thus, PDZ domains are a very clear example of how collective normal modes are able to characterize the relation between function and dynamics of proteins, and to provide indications on the precursors of binding/unbinding events. PMID:15821164

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Binding of nitrogen-containing bisphosphonates (N-BPs) to the Trypanosoma cruzi farnesyl diphosphate synthase homodimer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Chuan-Hsiang; Gabelli, Sandra B.; Oldfield, Eric

Bisphosphonates (BPs) are a class of compounds that have been used extensively in the treatment of osteoporosis and malignancy-related hypercalcemia. Some of these compounds act through inhibition of farnesyl diphosphate synthase (FPPS), a key enzyme in the synthesis of isoprenoids. Recently, nitrogen-containing bisphosphonates (N-BPs) used in bone resorption therapy have been shown to be active against Trypanosoma cruzi, the parasite that causes American trypanosomiasis (Chagas disease), suggesting that they may be used as anti-trypanosomal agents. The crystal structures of TcFPPS in complex with substrate (isopentenyl diphosphate, IPP) and five N-BP inhibitors show that the C-1 hydroxyl and the nitrogen-containing groupsmore » of the inhibitors alter the binding of IPP and the conformation of two TcFPPS residues, Tyr94 and Gln167. Isothermal titration calorimetry experiments suggest that binding of the first N-BPs to the homodimeric TcFPPS changes the binding properties of the second site. This mechanism of binding of N-BPs to TcFPPS is different to that reported for the binding of the same compounds to human FPPS.« less

Binding of intrinsic and extrinsic features in working memory.

PubMed

Ecker, Ullrich K H; Maybery, Murray; Zimmer, Hubert D

2013-02-01

There is ongoing debate concerning the mechanisms of feature binding in working memory. In particular, there is controversy regarding the extent to which these binding processes are automatic. The present article demonstrates that binding mechanisms differ depending on whether the to-be-integrated features are perceived as forming a coherent object. We presented a series of experiments that investigated the binding of color and shape, whereby color was either an intrinsic feature of the shape or an extrinsic feature of the shape's background. Results show that intrinsic color affected shape recognition, even when it was incidentally studied and irrelevant for the recognition task. In contrast, extrinsic color did not affect shape recognition, even when the association of color and shape was encoded and retrievable on demand. This strongly suggests that binding of intrinsic intra-item information but not extrinsic contextual information is obligatory in visual working memory. We highlight links to perception as well as implicit and explicit long-term memory, which suggest that the intrinsic-extrinsic dimension is a principle relevant to multiple domains of human cognition. 2013 APA, all rights reserved

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

PubMed Central

2018-01-01

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the properties of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Last, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site. PMID:29386401

Empirical entropic contributions in computational docking: evaluation in APS reductase complexes.

PubMed

Chang, Max W; Belew, Richard K; Carroll, Kate S; Olson, Arthur J; Goodsell, David S

2008-08-01

The results from reiterated docking experiments may be used to evaluate an empirical vibrational entropy of binding in ligand-protein complexes. We have tested several methods for evaluating the vibrational contribution to binding of 22 nucleotide analogues to the enzyme APS reductase. These include two cluster size methods that measure the probability of finding a particular conformation, a method that estimates the extent of the local energetic well by looking at the scatter of conformations within clustered results, and an RMSD-based method that uses the overall scatter and clustering of all conformations. We have also directly characterized the local energy landscape by randomly sampling around docked conformations. The simple cluster size method shows the best performance, improving the identification of correct conformations in multiple docking experiments. 2008 Wiley Periodicals, Inc.

Study on interaction of mangiferin to insulin and glucagon in ternary system

NASA Astrophysics Data System (ADS)

Lin, Hui; Chen, Rui; Liu, Xiaoyan; Sheng, Fenling; Zhang, Haixia

2010-05-01

The binding of mangiferin to insulin and glucagon was investigated in the presence and absence of another Peptide by optical spectroscopy. Fluorescence titration experiments revealed that mangiferin quenched the intrinsic fluorescence of insulin and glucagon by static quenching. The ratios of binding constants of glucagon-mangiferin to insulin-mangiferin at different temperatures were calculated in "pure" and ternary system, respectively. The results indicated that the Peptides were competitive with each other to act on mangiferin. Values of the thermodynamic parameters and the experiments of pH effect proved that the key interacting forces between mangiferin and the Peptides were hydrophobic interaction. In addition, UV-vis absorption, synchronous fluorescence and Fourier transform infrared measurements showed that the conformation of insulin and glucagon were changed after adding mangiferin.

Analyzing Ligand Depletion in a Saturation Equilibrium Binding Experiment

ERIC Educational Resources Information Center

Claro, Enrique

2006-01-01

I present a proposal for a laboratory practice to generate and analyze data from a saturation equilibrium binding experiment addressed to advanced undergraduate students. [[superscript 3]H]Quinuclidinyl benzilate is a nonselective muscarinic ligand with very high affinity and very low nonspecific binding to brain membranes, which contain a high…

Hot-spot residues at the E9/Im9 interface help binding via different mechanisms.

PubMed

Wong, Sergio E; Baron, Riccardo; McCammon, J Andrew

2008-11-01

Protein-protein association involves many interface interactions, but they do not contribute equally. Ala scanning experiments reveal that only a few mutations significantly lower binding affinity. These key residues, which appear to drive protein-protein association, are called hot-spot residues. Molecular dynamics simulations of the Colicin E9/Im9 complex show Im9 Glu41 and Im9 Ser50, both hot-spots, bind via different mechanisms. The results suggest that Im9 Ser50 restricts Glu41 in a conformation auspicious for salt-bridge formation across the interface. This type of model may be helpful in engineering hot-spot clusters at protein-protein interfaces and, consequently, the design of specificity.

Theoretical and experimental study of organic nano-material for acetate anion based on 1, 10-phenanthroline.

PubMed

Shang, Xuefang; Zhao, Yuan; Wei, Xiaofang; Feng, Yaqian; Li, Xin; Gao, Shuyan; Xu, Xiufang

2015-01-01

New phenanthroline derivatives (1, 2, 3, 4) containing phenol groups have been synthesized and optimized. The nano-material of compound 2 was also developed. Their binding properties were evaluated for various biological anions (F(-), Cl(-), Br(-), I(-), AcO(-) and H(2)PO(4)(-)) by theoretical investigation, UV-vis, fluorescence, (1)HNMR titration experiments and these compounds all showed strong binding ability for AcO(-) without the interference of other anions tested. The anion binding ability could be regularized by electron push-pull properties of the ortho- or para- substituent on benzene. Theoretical investigation analysis revealed the effect of intramolecular hydrogen bond existed between -OH and other atoms in the structure of these compounds.

Brief report: altered horizontal binding of single dots to coherent motion in autism.

PubMed

David, Nicole; Rose, Michael; Schneider, Till R; Vogeley, Kai; Engel, Andreas K

2010-12-01

Individuals with autism often show a fragmented way of perceiving their environment, suggesting a disorder of information integration, possibly due to disrupted communication between brain areas. We investigated thirteen individuals with high-functioning autism (HFA) and thirteen healthy controls using the metastable motion quartet, a stimulus consisting of two dots alternately presented at four locations of a hypothetical square, thereby inducing an apparent motion percept. This percept is vertical or horizontal, the latter requiring binding of motion signals across cerebral hemispheres. Decreasing the horizontal distance between dots could facilitate horizontal percepts. We found evidence for altered horizontal binding in HFA: Individuals with HFA needed stronger facilitation to experience horizontal motion. These data are interpreted in light of reduced cross-hemispheric communication.

Screening of biologically important Zn2 + by a chemosensor with fluorescent turn on-off mechanism

NASA Astrophysics Data System (ADS)

Khan, Tanveer A.; Sheoran, Monika; Nikhil Raj M., Venkata; Jain, Surbhi; Gupta, Diksha; Naik, Sunil G.

2018-01-01

Reported herein the synthesis, characterization and biologically important zinc ion binding propensity of a weakly fluorescent chemosensor, 4-methyl-2,6-bis((E)-(2-(4-phenylthiazol-2-yl)hydrazono)methyl)phenol (1). 1H NMR spectroscopic titration experiment reveals the binding knack of 1 to the essential Zn2 +. The photo-physical studies of 1 exhibit an enhancement in the fluorescence by several folds upon binding with the zinc ions attributed to PET-off process, with a binding constant value of 5.22 × 103 M- 1. 1 exhibits an excellent detection range for Zn2 + with lower detection limit value of 2.31 × 10- 8 M. The selectivity of 1 was studied with various mono and divalent metal cations and it was observed that most cations either quenches the fluorescence or remains unchanged except for Cd2 +, which shows a slight enhancement in fluorescence intensity of 1. The ratiometric displacement of Cd2 + ions by Zn2 + ions shows an excellent selectivity towards in-situ detection of Zn2 + ions. Photo-physical studies also support the reversible binding of 1 to Zn2 + ions having on and off mechanism in presence of EDTA. Such recognition of the biologically important zinc ions finds potential application in live cell imaging.

Monomeric ephrinB2 binding induces allosteric changes in Nipah virus G that precede its full activation.

PubMed

Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S

2017-10-03

Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.

Cigarette smoke-induced reduction in binding of the salivary translocator protein is not mediated by free radicals.

PubMed

Nagler, R; Savulescu, D; Gavish, M

2016-02-01

Oral cancer is the most common malignancy of the head and neck and its main inducer is exposure to cigarette smoke (CS) in the presence of saliva. It is commonly accepted that CS contributes to the pathogenesis of oral cancer via reactive free radicals and volatile aldehydes. The 18 kDa translocator protein (TSPO) is an intracellular receptor involved in proliferation and apoptosis, and has been linked to various types of cancer. The presence of TSPO in human saliva has been linked to oral cancer, and its binding affinity to its ligand is reduced following exposure to CS. In the present study we wished to further investigate the mechanism behind the CS-induced reduction of TSPO binding by exploring the possible mediatory role of reactive oxygen species (ROS) and volatile aldehydes in this process. We first analyzed TSPO binding in control saliva and in saliva exposed to CS in the presence and absence of various antioxidants. These experiments found that TSPO binding ability was not reversed by any of the antioxidants added, suggesting that CS exerts its effect on TSPO via mechanisms that do not involve volatile aldehydes and free radicals tested. Next, we analyzed TSPO binding in saliva following addition of exogenous ROS in the form of H2O2. These experiments found that TSPO binding was enhanced due to the treatment, once again showing that the CS-induced TSPO binding reduction is not mediated by this common form of ROS. However, the previously reported CS-induced reduction in salivary TSPO binding together with the role of TSPO in cells and its link to cancer strongly suggest that TSPO has a critical role in the pathogenesis of CS-induced oral cancer. The importance of further elucidating the mechanisms behind it should be emphasized. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Dispersing Zwitterions into Comb Polymers for Nonviral Transfection: Experiments and Molecular Simulation.

PubMed

Ghobadi, Ahmadreza F; Letteri, Rachel; Parelkar, Sangram S; Zhao, Yue; Chan-Seng, Delphine; Emrick, Todd; Jayaraman, Arthi

2016-02-08

Polymer-based gene delivery vehicles benefit from the presence of hydrophilic groups that mitigate the inherent toxicity of polycations and that provide tunable polymer-DNA binding strength and stable complexes (polyplexes). However, hydrophilic groups screen charge, and as such can reduce cell uptake and transfection efficiency. We report the effect of embedding zwitterionic sulfobetaine (SB) groups in cationic comb polymers, using a combination of experiments and molecular simulations. Ring-opening metathesis polymerization (ROMP) produced comb polymers with tetralysine (K4) and SB pendent groups. Dynamic light scattering, zeta potential measurements, and fluorescence-based experiments, together with coarse-grained molecular dynamics simulations, described the effect of SB groups on the size, shape, surface charge, composition, and DNA binding strength of polyplexes formed using these comb polymers. Experiments and simulations showed that increasing SB composition in the comb polymers decreased polymer-DNA binding strength, while simulations indicated that the SB groups distributed throughout the polyplex. This allows polyplexes to maintain a positive surface charge and provide high levels of gene expression in live cells. Notably, comb polymers with nearly 50 mol % SB form polyplexes that exhibit positive surface charge similarly as polyplexes formed from purely cationic comb polymers, indicating the ability to introduce an appreciable amount of SB functionality without screening surface charge. This integrated simulation-experimental study demonstrates the effectiveness of incorporating zwitterions in polyplexes, while guiding the design of new and effective gene delivery vectors.

Short term memory for single surface features and bindings in ageing: A replication study.

PubMed

Isella, Valeria; Molteni, Federica; Mapelli, Cristina; Ferrarese, Carlo

2015-06-01

In the present study we replicated a previous experiment investigating visuo-spatial short term memory binding in young and older healthy individuals, in the attempt to verify the pattern of impairment that can be observed in normal elderly for short term memory for single items vs short term memory for bindings. Assessing a larger sample size (25 young and 25 older subjects), using a more appropriate measure of accuracy for a change detection task (A'), and adding the evaluation of speed of performance, we confirmed that old normals show a decline in short term memory for bindings of shape and colour that is of comparable extent, and not major, to the decline in memory for single shapes and single colours. The absence of a specific deficit of short term memory for conjunctions of surface features seems to distinguish cognitive ageing from Alzheimer's Disease. Copyright © 2015 Elsevier Inc. All rights reserved.

Zinc(II) binds to the neuroprotective peptide humanin.

PubMed

Armas, Ambar; Sonois, Vanessa; Mothes, Emmanuelle; Mazarguil, Honoré; Faller, Peter

2006-10-01

The abnormal accumulation of the peptide amyloid-beta in the form of senile (or amyloid) plaques is one of the hallmarks of Alzheimer's disease (AD). Zinc ions have been implicated in AD and plaques formation. Recently, the peptide humanin has been discovered. Humanin showed neuroprotective activity against amyloid-beta insults. Here the question investigated is if humanin could interact directly with Zn(II). It is shown that Zn(II) and its substitutes Cd(II)/Co(II) bind to humanin via a thiolate bond from the side chain of the single cysteine at position 8. The low intensity of the d-d bands of Co(II)-humanin indicated an octahedral coordination geometry. Titration experiments suggest that Zn(II) binds to humanin with an apparent affinity in the low muM range. This apparent Zn-binding affinity is in the same order as for amyloid-beta and glutathione and could thus be of physiological relevance.

The development and amino acid binding ability of nano-materials based on azo derivatives: theory and experiment.

PubMed

Shang, Xuefang; Du, Jinge; Yang, Wancai; Liu, Yun; Fu, Zhiyuan; Wei, Xiaofang; Yan, Ruifang; Yao, Ningcong; Guo, Yaping; Zhang, Jinlian; Xu, Xiufang

2014-05-01

Two nano-material-containing azo groups have been designed and developed, and the binding ability of nano-materials with various amino acids has been characterized by UV-vis and fluorescence titrations. Results indicated that two nano-materials showed the strongest binding ability for homocysteine among twenty normal kinds of amino acids (alanine, valine, leucine, isoleucine, methionine, aspartic acid, glutamic acid, arginine, glycine, serine, threonine, asparagine, phenylalanine, histidine, tryptophan, proline, lysine, glutamine, tyrosine and homocysteine). The reason for the high sensitivity for homocysteine was that two nano-materials containing an aldehyde group reacted with SH in homocysteine and afforded very stable thiazolidine derivatives. Theoretical investigation further illustrated the possible binding mode in host-guest interaction and the roles of molecular frontier orbitals in molecular interplay. Thus, the two nano-materials can be used as optical sensors for the detection of homocysteine. Copyright © 2014 Elsevier B.V. All rights reserved.

Characterization of substrate binding of the WW domains in human WWP2 protein.

PubMed

Jiang, Jiahong; Wang, Nan; Jiang, Yafei; Tan, Hongwei; Zheng, Jimin; Chen, Guangju; Jia, Zongchao

2015-07-08

WW domains harbor substrates containing proline-rich motifs, but the substrate specificity and binding mechanism remain elusive for those WW domains less amenable for structural studies, such as human WWP2 (hWWP2). Herein we have employed multiple techniques to investigate the second WW domain (WW2) in hWWP2. Our results show that hWWP2 is a specialized E3 for PPxY motif-containing substrates only and does not recognize other amino acids and phospho-residues. The strongest binding affinity of WW2, and the incompatibility between each WW domain, imply a novel relationship, and our SPR experiment reveals a dynamic binding mode in Class-I WW domains for the first time. The results from alanine-scanning mutagenesis and modeling further point to functionally conserved residues in WW2. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Aluminum binding by humus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benedetti, M.F.; Hiemstra, T.; Riemsdijk, W. van

The need for qualitative and quantitative description of the chemical speciation of Al, in particular and other metal ions in general, is stressed by the increased mobilization of metal ions in water and soils due to acid rain deposition. In this paper we present new data of Al binding to two humic acids. These new data sets and the some previously published data will be analyzed with the NICA-Donnan model using one set of parameters to describe the Al binding to the different humic substances. Once the experimental data is described with the NICA-Donnan approach, we will show the effectmore » of Ca on Al binding and surface speciation as well as the effect of Al on the charge of the humic particles. The parameters derived from the laboratory experiments will be used to describe the variation of the field based Al partition coefficient.« less

Cross-reactivity and epitope analysis of Pru a 1, the major cherry allergen.

PubMed

Scheurer, S; Son, D Y; Boehm, M; Karamloo, F; Franke, S; Hoffmann, A; Haustein, D; Vieths, S

1999-02-01

A high percentage of birch pollen allergic patients experiences food hypersensivity after ingestion of fresh fruits and vegetables. The cross-reactivity of the major allergens of sweet cherry (Pru a 1), apple (Mal d 1), pear (Pyr c 1), celery tuber (Api g 1) and carrot (Dau c 1) is due to structural similarities which are reflected by high amino acid sequence identities with Bet v 1a, the major birch pollen allergen. Apart from a strong cross-reactivity to Bet v 1a, IgE inhibition experiments with Mal d 1, Pru a 1 and Api g 1 demonstrated the presence of common and different epitopes among the tested food allergens. Secondary structure prediction of all investigated allergens indicated the presence of almost identical structural elements. In particular, the 'P-loop' region is a common domain of the pollen related food allergens and of pathogenesis related proteins. To identify the IgE binding epitopes, five overlapping recombinant Pru a 1 fragments representing the entire amino acid sequence with lengths of approximately 60-120 residues were investigated. Weak IgE binding capacity was measured exclusively with Pru a IF4 (1-120) by immunoblotting, whereas none of the fragments showed allergenicity in the rat basophil leukaemia cell mediator release assay. Site-directed mutagenesis experiments with Pru a 1 revealed that amino acid S112 is critical for IgE binding of almost all patients sera tested. This reduced IgE binding was also observed with a single point mutant of Bet v 1a (S112P) and thus indicated serine 112 as an essential residue for preserving the structure of a cross-reactive IgE epitope. Moreover, two Pru a 1 mutants with an altered 'P-loop' region, showed a lowered IgE binding capacity for IgE from a subgroup of allergic patients. The investigation of essential features for preserving cross-reactive IgE-epitopes provides the structural basis for understanding the clinically observed cross-allergenicity between pollen and fruits. Moreover, non-anaphylactic allergen fragments or variants derived from the IgE-inducing pollen allergens may serve as useful tools for a new strategy of specific immunotherapy.

Differential mechanisms of binding of anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA to E. coli RNA polymerase lead to diverse physiological consequences.

PubMed

Sharma, Umender K; Chatterji, Dipankar

2008-05-01

Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, sigma(70), of E. coli. Though both factors are known to interact with the C-terminal region of sigma(70), the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to sigma(70) with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with sigma(70) studied by using the yeast two-hybrid system revealed that region 4 of sigma(70) is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of sigma(70) as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to sigma(70).

Differential Mechanisms of Binding of Anti-Sigma Factors Escherichia coli Rsd and Bacteriophage T4 AsiA to E. coli RNA Polymerase Lead to Diverse Physiological Consequences▿

PubMed Central

Sharma, Umender K.; Chatterji, Dipankar

2008-01-01

Anti-sigma factors Escherichia coli Rsd and bacteriophage T4 AsiA bind to the essential housekeeping sigma factor, σ70, of E. coli. Though both factors are known to interact with the C-terminal region of σ70, the physiological consequences of these interactions are very different. This study was undertaken for the purpose of deciphering the mechanisms by which E. coli Rsd and bacteriophage T4 AsiA inhibit or modulate the activity of E. coli RNA polymerase, which leads to the inhibition of E. coli cell growth to different amounts. It was found that AsiA is the more potent inhibitor of in vivo transcription and thus causes higher inhibition of E. coli cell growth. Measurements of affinity constants by surface plasmon resonance experiments showed that Rsd and AsiA bind to σ70 with similar affinity. Data obtained from in vivo and in vitro binding experiments clearly demonstrated that the major difference between AsiA and Rsd is the ability of AsiA to form a stable ternary complex with RNA polymerase. The binding patterns of AsiA and Rsd with σ70 studied by using the yeast two-hybrid system revealed that region 4 of σ70 is involved in binding to both of these anti-sigma factors; however, Rsd interacts with other regions of σ70 as well. Taken together, these results suggest that the higher inhibition of E. coli growth by AsiA expression is probably due to the ability of the AsiA protein to trap the holoenzyme RNA polymerase rather than its higher binding affinity to σ70. PMID:18359804

A Course-Based Undergraduate Research Experience Investigating p300 Bromodomain Mutations#

PubMed Central

Shanle, Erin K.; Tsun, Ian K.; Strahl, Brian D.

2016-01-01

Course-based undergraduate research experiences (CUREs) provide an opportunity for students to engage in experiments with outcomes that are unknown to both the instructor and students. These experiences allow students and instructors to collaboratively bridge the research laboratory and classroom, and provide research experiences for a large number of students relative to traditional individual mentored research. Here, we describe a molecular biology CURE investigating the impact of clinically relevant mutations found in the bromodomain of the p300 transcriptional regulator on acetylated histone interaction. In the CURE, students identified missense mutations in the p300 bromo-domain using the Catalogue of Somatic Mutations in Cancer (COSMIC) database and hypothesized the effects of the mutation on the acetyl-binding function of the domain. They cloned and purified the mutated bromodomain and performed peptide pulldown assays to define its potential to bind to acetylated histones. Upon completion of the course, students showed increased confidence performing molecular techniques and reported positively on doing a research project in class. In addition, results generated in the classroom were further validated in the research laboratory setting thereby providing a new model for faculty to engage in both course-based and individual undergraduate research experiences. PMID:26537758

A mRNA-Responsive G-Quadruplex-Based Drug Release System

PubMed Central

Yaku, Hidenobu; Murashima, Takashi; Miyoshi, Daisuke; Sugimoto, Naoki

2015-01-01

G-quadruplex-based drug delivery carriers (GDDCs) were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II) phthalocyanine (CuAPC). As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR) mRNA. Structural analysis using circular dichroism (CD) spectroscopy showed that the GDDCs form a (3 + 1) type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM) at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM) at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA. PMID:25905703

Dynamic Consequences of Mutation of Tryptophan 215 in Thrombin.

PubMed

Peacock, Riley B; Davis, Jessie R; Markwick, Phineus R L; Komives, Elizabeth A

2018-05-08

Thrombin normally cleaves fibrinogen to promote coagulation; however, binding of thrombomodulin to thrombin switches the specificity of thrombin toward protein C, triggering the anticoagulation pathway. The W215A thrombin mutant was reported to have decreased activity toward fibrinogen without significant loss of activity toward protein C. To understand how mutation of Trp215 may alter thrombin specificity, hydrogen-deuterium exchange experiments (HDXMS), accelerated molecular dynamics (AMD) simulations, and activity assays were carried out to compare the dynamics of Trp215 mutants with those of wild type (WT) thrombin. Variation in NaCl concentration had no detectable effect on the sodium-binding (220s CT ) loop, but appeared to affect other surface loops. Trp215 mutants showed significant increases in amide exchange in the 170s CT loop consistent with a loss of H-bonding in this loop identified by the AMD simulations. The W215A thrombin showed increased amide exchange in the 220s CT loop and in the N-terminus of the heavy chain. The AMD simulations showed that a transient conformation of the W215A thrombin has a distorted catalytic triad. HDXMS experiments revealed that mutation of Phe227, which engages in a π-stacking interaction with Trp215, also caused significantly increased amide exchange in the 170s CT loop. Activity assays showed that only the F227V mutant had wild type catalytic activity, whereas all other mutants showed markedly lower activity. Taken together, the results explain the reduced pro-coagulant activity of the W215A mutant and demonstrate the allosteric connection between Trp215, the sodium-binding loop, and the active site.

The MTA family proteins as novel histone H3 binding proteins.

PubMed

Wu, Meng; Wang, Lina; Li, Qian; Li, Jiwen; Qin, Jun; Wong, Jiemin

2013-01-03

The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail.

The MTA family proteins as novel histone H3 binding proteins

PubMed Central

2013-01-01

Background The nucleosome remodeling and histone deacetylase complex (Mi2/NRD/NuRD/NURD) has a broad role in regulation of transcription, DNA repair and cell cycle. Previous studies have revealed a specific interaction between NURD and histone H3N-terminal tail in vitro that is not observed for another HDAC1/2-containing complex, Sin3A. However, the subunit(s) responsible for specific binding of H3 by NURD has not been defined. Results In this study, we show among several class I HDAC-containing corepressor complexes only NURD exhibits a substantial H3 tail-binding activity in vitro. We present the evidence that the MTA family proteins within the NURD complex interact directly with H3 tail. Extensive in vitro binding assays mapped the H3 tail-binding domain to the C-terminal region of MTA1 and MTA2. Significantly, although the MTA1 and MTA2 mutant proteins with deletion of the C-terminal H3 tail binding domain were assembled into the endogenous NURD complex when expressed in mammalian cells, the resulting NURD complexes were deficient in binding H3 tail in vitro, indicating that the MTA family proteins are required for the observed specific binding of H3 tail peptide by NURD in vitro. However, chromatin fractionation experiments show that the NURD complexes with impaired MTA1/2-H3 tail binding activity remained to be associated with chromatin in cells. Conclusions Together our study reveals a novel histone H3-binding activity for the MTA family proteins and provides evidence that the MTA family proteins mediate the in vitro specific binding of H3 tail peptide by NURD complex. However, multiple mechanisms are likely to contribute to the chromatin association of NURD complex in cells. Our finding also raises the possibility that the MTA family proteins may exert their diverse biological functions at least in part through their direct interaction with H3 tail. PMID:23286669

Binding of [3H]MSX-2 (3-(3-hydroxypropyl)-7-methyl-8-(m-methoxystyryl)-1-propargylxanthine) to rat striatal membranes--a new, selective antagonist radioligand for A(2A) adenosine receptors.

PubMed

Müller, C E; Maurinsh, J; Sauer, R

2000-01-01

The present study describes the preparation and binding properties of a new, potent, and selective A(2A) adenosine receptor (AR) antagonist radioligand, [3H]3-(3-hydroxypropyl)-7-methyl-8-(m-methoxystyryl)-1-propargy lxanth ine ([3H]MSX-2). [3H]MSX-2 binding to rat striatal membranes was saturable and reversible. Saturation experiments showed that [3H]MSX-2 labeled a single class of binding sites with high affinity (K(d)=8.0 nM) and limited capacity (B(max)=1.16 fmol.mg(-1) of protein). The presence of 100 microM GTP, or 10 mM magnesium chloride, respectively, had no effect on [3H]MSX-2 binding. AR agonists competed with the binding of 1 nM [3H]MSX-2 with the following order of potency: 5'-N-ethylcarboxamidoadenosine (NECA)>2-[4-(carboxyethyl)phenylethylamino]-5'-N-ethylcarboxami doaden osine (CGS-21680)>2-chloroadenosine (2-CADO)>N(6)-cyclopentyladenosine (CPA). AR antagonists showed the following order of potency: 8-(m-bromostyryl)-3, 7-dimethyl-1-propargylxanthine (BS-DMPX)>1, 3-dipropyl-8-cyclopentylxanthine (DPCPX)>(R)-5, 6-dimethyl-7-(1-phenylethyl)-2-(4-pyridyl)-7H-pyrrolo[2, 3-d]pyrimidine-4-amine (SH-128)>3,7-dimethyl-1-propargylxanthine (DMPX)>caffeine. The K(i) values for antagonists were in accordance with data from binding studies with the agonist radioligand [3H]CGS21680, while agonist affinities were 3-7-fold lower. [3H]MSX-2 is a highly selective A(2A) AR antagonist radioligand exhibiting a selectivity of at least two orders of magnitude versus all other AR subtypes. The new radioligand shows high specific radioactivity (85 Ci/mmol, 3150 GBq/mmol) and acceptable nonspecific binding at rat striatal membranes of 20-30%, at 1 nM.

Prediction of the binding mode of N2-phenylguanine derivative inhibitors to herpes simplex virus type 1 thymidine kinase

NASA Astrophysics Data System (ADS)

Gaudio, Anderson Coser; Takahata, Yuji; Richards, William Graham

1998-01-01

The probable binding mode of the herpes simplex virus thymidine kinase (HSV1 TK) N2-[substituted]-phenylguanine inhibitors is proposed. A computational experiment was designed to check some qualitative binding parameters and to calculate the interaction binding energies of alternative binding modes of N2-phenylguanines. The known binding modes of the HSV1 TK natural substrate deoxythymidine and one of its competitive inhibitors ganciclovir were used as templates. Both the qualitative and quantitative parts of the computational experiment indicated that the N2-phenylguanine derivatives bind to the HSV1 TK active site in the deoxythymidine-like binding mode. An experimental observation that N2-phenylguanosine derivatives are not phosphorylated during the interaction with the HSV1 TK gives support to the proposed binding mode.

The Molecular Chaperone TRiC/CCT Binds to the Trp-Asp 40 (WD40) Repeat Protein WDR68 and Promotes Its Folding, Protein Kinase DYRK1A Binding, and Nuclear Accumulation*

PubMed Central

Miyata, Yoshihiko; Shibata, Takeshi; Aoshima, Masato; Tsubata, Takuichi; Nishida, Eisuke

2014-01-01

Trp-Asp (WD) repeat protein 68 (WDR68) is an evolutionarily conserved WD40 repeat protein that binds to several proteins, including dual specificity tyrosine phosphorylation-regulated protein kinase (DYRK1A), MAPK/ERK kinase kinase 1 (MEKK1), and Cullin4-damage-specific DNA-binding protein 1 (CUL4-DDB1). WDR68 affects multiple and diverse physiological functions, such as controlling anthocyanin synthesis in plants, tissue growth in insects, and craniofacial development in vertebrates. However, the biochemical basis and the regulatory mechanism of WDR68 activity remain largely unknown. To better understand the cellular function of WDR68, here we have isolated and identified cellular WDR68 binding partners using a phosphoproteomic approach. More than 200 cellular proteins with wide varieties of biochemical functions were identified as WDR68-binding protein candidates. Eight T-complex protein 1 (TCP1) subunits comprising the molecular chaperone TCP1 ring complex/chaperonin-containing TCP1 (TRiC/CCT) were identified as major WDR68-binding proteins, and phosphorylation sites in both WDR68 and TRiC/CCT were identified. Co-immunoprecipitation experiments confirmed the binding between TRiC/CCT and WDR68. Computer-aided structural analysis suggested that WDR68 forms a seven-bladed β-propeller ring. Experiments with a series of deletion mutants in combination with the structural modeling showed that three of the seven β-propeller blades of WDR68 are essential and sufficient for TRiC/CCT binding. Knockdown of cellular TRiC/CCT by siRNA caused an abnormal WDR68 structure and led to reduction of its DYRK1A-binding activity. Concomitantly, nuclear accumulation of WDR68 was suppressed by the knockdown of TRiC/CCT, and WDR68 formed cellular aggregates when overexpressed in the TRiC/CCT-deficient cells. Altogether, our results demonstrate that the molecular chaperone TRiC/CCT is essential for correct protein folding, DYRK1A binding, and nuclear accumulation of WDR68. PMID:25342745

The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, H.; Grubb, J.H.; Sly, W.S.

1990-10-01

The authors studied the function of the human small (46-kDa) mannose 6-phosphate receptor (SMPR) in transfected mouse L cells that do not express the larger insulin-like growth factor II/mannose 6-phosphate receptor. Cells overexpressing human SMPR were studied for enzyme binding to cell surface receptors, for binding to intracellular receptors in permeabilized cells, and for receptor-mediated endocytosis of recombinant human {beta}-glucuronidase. Specific binding to human SMPR in permeabilized cells showed a pH optimum between pH 6.0 and pH 6.5. Binding was significant in the present of EDTA but was enhanced by added divalent cations. Up to 2.3{percent} of the total functionalmore » receptor could be detected on the cell surface by enzyme binding. They present experiments showing that at very high levels of overexpression, and at pH 6.5, human SMPR mediated the endocytosis of {beta}-glucuronidase. At pH 7.5, the rate of endocytosis was only 14{percent} the rate seen at pH 6.5. Cells overexpressing human SMPR also showed reduced secretion of newly synthesized {beta}-glucuronidase when compared to cells transfected with vector only, suggesting that overexpressed human SMPR can participate in sorting of newly synthesized {beta}-glucuronidase and partially correct the sorting defect in mouse L cells that do not express the insulin-like growth factor II/mannose 6-phosphate receptor.« less

Structural and affinity studies of IgM polyreactive natural autoantibodies.

PubMed

Diaw, L; Magnac, C; Pritsch, O; Buckle, M; Alzari, P M; Dighiero, G

1997-01-15

Natural polyreactive autoantibodies (NAA) are an important component of the normal B cell repertoire. One intriguing characteristic of these Abs is their binding to various dissimilar Ags. It has been generally assumed that these Abs bind the Ags with low affinity, and are encoded by germline genes. We have used surface plasmon resonance to determine binding of avidities, and conducted a structural analysis of five murine monoclonal natural autoantibodies displaying a typical polyreactive binding pattern against cytoskeleton Ags and DNA. We show that 1) all the five Abs bind the different Ags with kinetic constants similar to those observed for immune Abs; 2) they express a restricted set of V(H) and V(L) genes, since the same V(H) gene is expressed by three out of the five, and one particular Vkappa gene was expressed twice. In addition, a single D gene segment was used by three of the five Abs; and 3) they express, in most cases, genes in a close germline configuration. Our amino acid sequence and modeling studies show that the distribution of exposed side chains in the NAA paratopes is close to the general pattern observed in the complementarity-determining regions (CDRs) of variable domains from immune Abs. Although CDR3 regions of the heavy chain have been postulated to play a major role in determining polyreactivity on the basis of recombinatorial experiments, our results failed to show any distinctive particularity of this region in terms of length or charge when compared with classical immune Abs.

Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cosman, M; Zeller, L; Lightstone, F C

2002-01-01

The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

Trace Metal-Humic Complexes in Natural Waters: Insights From Speciation Experiments

NASA Astrophysics Data System (ADS)

Stern, J. C.; Salters, V.; Sonke, J.

2006-12-01

The DOM cycle is intimately linked to the cycling and bioavailability of trace metals in aqueous environments. The presence or absence of DOM in the water column can determined whether trace elements will be present in limited quantities as a nutrient, or in surplus quantities as a toxicant. Humic substances (HS), which represent the refractory products of DOM degradation, strongly affect the speciation of trace metals in natural waters. To simulate metal-HS interactions in nature, experiments must be carried out using trace metal concentrations. Sensitive detection systems such as ICP-MS make working with small (nanomolar) concentrations possible. Capillary electrophoresis coupled with ICP-MS (CE-ICP-MS) has recently been identified as a rapid and accurate method to separate metal species and calculate conditional binding constants (log K_c) of metal-humic complexes. CE-ICP-MS was used to measure partitioning of metals between humic substances and a competing ligand (EDTA) and calculate binding constants of rare earth element (REE) and Th, Hf, and Zr-humic complexes at pH 3.5-8 and ionic strength of 0.1. Equilibrium dialysis ligand exchange (EDLE) experiments to validate the CE-ICP-MS method were performed to separate the metal-HS and metal-EDTA species by partitioning due to size exclusion via diffusion through a 1000 Da membrane. CE-ICP-MS experiments were also conducted to compare binding constants of REE with humic substances of various origin, including soil, peat, and aquatic DOM. Results of our experiments show an increase in log K_c with decrease in ionic radius for REE-humic complexes (the lanthanide contraction effect). Conditional binding constants of tetravalent metal-humic complexes were found to be several orders of magnitude higher than REE-humic complexes, indicating that tetravalent metals have a very strong affinity for humic substances. Because thorium is often used as a proxy for the tetravalent actinides, Th-HS binding constants can allow us to assess the importance of tetravalent actinide-humic complexes in groundwater transport from nuclear repositories. Our results suggest that tetravalent actinide-humic complexes couild be more important to account for in predictive speciation models than previously thought.

In silico screening for inhibitors of p-glycoprotein that target the nucleotide binding domains.

PubMed

Brewer, Frances K; Follit, Courtney A; Vogel, Pia D; Wise, John G

2014-12-01

Multidrug resistances and the failure of chemotherapies are often caused by the expression or overexpression of ATP-binding cassette transporter proteins such as the multidrug resistance protein, P-glycoprotein (P-gp). P-gp is expressed in the plasma membrane of many cell types and protects cells from accumulation of toxins. P-gp uses ATP hydrolysis to catalyze the transport of a broad range of mostly hydrophobic compounds across the plasma membrane and out of the cell. During cancer chemotherapy, the administration of therapeutics often selects for cells which overexpress P-gp, thereby creating populations of cancer cells resistant to a variety of chemically unrelated chemotherapeutics. The present study describes extremely high-throughput, massively parallel in silico ligand docking studies aimed at identifying reversible inhibitors of ATP hydrolysis that target the nucleotide-binding domains of P-gp. We used a structural model of human P-gp that we obtained from molecular dynamics experiments as the protein target for ligand docking. We employed a novel approach of subtractive docking experiments that identified ligands that bound predominantly to the nucleotide-binding domains but not the drug-binding domains of P-gp. Four compounds were found that inhibit ATP hydrolysis by P-gp. Using electron spin resonance spectroscopy, we showed that at least three of these compounds affected nucleotide binding to the transporter. These studies represent a successful proof of principle demonstrating the potential of targeted approaches for identifying specific inhibitors of P-gp. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.

Actin-induced dimerization of palladin promotes actin-bundling

PubMed Central

Vattepu, Ravi; Yadav, Rahul; Beck, Moriah R

2015-01-01

A subset of actin binding proteins is able to form crosslinks between two or more actin filaments, thus producing structures of parallel or networked bundles. These actin crosslinking proteins interact with actin through either bivalent binding or dimerization. We recently identified two binding sites within the actin binding domain of palladin, an actin crosslinking protein that plays an important role in normal cell adhesion and motility during wound healing and embryonic development. In this study, we show that actin induces dimerization of palladin. Furthermore, the extent of dimerization reflects earlier comparisons of actin binding and bundling between different domains of palladin. On the basis of these results we hypothesized that actin binding may promote a conformational change that results in dimerization of palladin, which in turn may drive the crosslinking of actin filaments. The proximal distance between two actin binding sites on crosslinking proteins determines the ultrastructural properties of the filament network, therefore we also explored interdomain interactions using a combination of chemical crosslinking experiments and actin cosedimentation assays. Limited proteolysis data reveals that palladin is less susceptible to enzyme digestion after actin binding. Our results suggest that domain movements in palladin are necessary for interactions with actin and are induced by interactions with actin filaments. Accordingly, we put forth a model linking the structural changes to functional dynamics. PMID:25307943

Hemoadsorption removes tumor necrosis factor, interleukin-6, and interleukin-10, reduces nuclear factor-kappaB DNA binding, and improves short-term survival in lethal endotoxemia.

PubMed

Kellum, John A; Song, Mingchen; Venkataraman, Ramesh

2004-03-01

Previous studies have shown that inflammatory mediators can be removed from the circulation with hemofiltration and that adsorption plays an important role. Because adsorptive capacity of hollow-fiber dialyzers is limited, we sought to determine whether hemoadsorption using high surface area beads would result in greater mediator removal and improved survival in experimental sepsis. Randomized controlled laboratory experiment. University laboratory. Sixty-six adult Sprague-Dawley rats. We conducted two ex vivo and two in vivo experiments. For in vivo experiments, we administered Escherichia coli endotoxin (20 mg/kg) by intravenous infusion and then randomized each animal to receive either hemoadsorption or a sham circuit for 4 hrs. Hemoadsorption was performed for 4 hrs using an arterial-venous circuit and a CytoSorb cartridge containing 10 g of polystyrene divinyl benzene copolymer beads with a biocompatible polyvinylpyrrolidone coating. Survival time was measured to a maximum of 12 hrs. In a separate set of experiments, we studied 12 animals using the same protocol except that we killed all animals at 4 hrs and removed standardized sections of liver for analysis of nuclear factor-kappaB DNA binding. Mean survival time among hemoadsorption-treated animals was 629+/-114 vs. 518+/-120 mins for sham-treated animals (p <.01). Overall survival (defined at 12 hrs) was also significantly better in the hemoadsorption group, seven of 20 vs. one of 20 (p <.05). Plasma interleukin-6 and interleukin-10 concentrations and liver nuclear factor-kappaB DNA binding were significantly reduced by hemoadsorption. Ex vivo experiments showed no endotoxin adsorption but strengthened our in vivo observations by showing rapid adsorption of tumor necrosis factor, interleukin-6, and interleukin-10. Hemoadsorption was associated with reduced inflammation and improved survival in this murine model of septic shock.

The relationship between action-effect monitoring and attention capture.

PubMed

Kumar, Neeraj; Manjaly, Jaison A; Sunny, Meera Mary

2015-02-01

Many recent findings suggest that stimuli that are perceived to be the consequence of one's own actions are processed with priority. According to the preactivation account of intentional binding, predicted consequences are preactivated and hence receive a temporal advantage in processing. The implications of the preactivation account are important for theories of attention capture, as temporal advantage often translates to attention capture. Hence, action might modulate attention capture by feature singletons. Experiment 1 showed that a motion onset and color change captured attention only when it was preceded by an action. Experiment 2 showed that the capture occurs only with predictable, but not with unpredictable, consequences of action. Experiment 3 showed that even when half the display changed color at display transition, they were all prioritized. The results suggest that action modulates attentional control.

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

Face Memory: Implications for theories of binding items to context

PubMed Central

Reder, L. M.; Victoria, L. W.; Manelis, A.; Oates, J. M.; Dutcher, J. M.; Bates, J. T.; Cook, S.; Aizenstein, H. A.; Quinlan, J.; Gyulai, F.

2014-01-01

Two experiments tested the hypothesis that it is easier to bind a stimulus to context when the stimulus already has a stable (i.e., pre-existing) memory representation by comparing episodic memory of faces of celebrities vs. unknown individuals. Each face was superimposed on a picture of a well-known location (e.g., Eiffel Tower) during encoding and at a later unexpected recognition test but the background could change from encoding to test. Although recognition was to be based on the face, irrespective of background, performance was better when encoding context was reinstated. Further, a given background could be shown with many faces ("high fan") or only a few ("low fan") and this variable modulated the value added of context reinstatement. Importantly, manipulations of context only mattered for famous faces. As predicted, these effects were observed in recollection ("Remember") responses not in familiarity (“Know”) responses. Experiment 2 used the same design except that half of the subjects were administered midazolam, a drug that produces temporary anterograde amnesia, prior to encoding faces and backgrounds. Subjects injected with saline (control condition) showed the same pattern as Experiment 1; however subjects injected with midazolam showed a large decrease in the use of the "Remember" responses for famous faces and neither context reinstatement nor background fan affected performance. These results support the view that it is easier to bind stimuli to context when stimuli have a pre-existing, stable memory representation (e.g., faces of people whose identity we know) than when stimuli do not have pre-existing, stable memory representations. PMID:23395827

AZD8797 is an allosteric non-competitive modulator of the human CX3CR1 receptor.

PubMed

Cederblad, Linda; Rosengren, Birgitta; Ryberg, Erik; Hermansson, Nils-Olov

2016-03-01

The chemokine receptor CX3CR1 has been implicated as an attractive therapeutic target in several diseases, including atherosclerosis and diabetes. However, there has been a lack of non-peptide CX3CR1 inhibitors to substantiate these findings. A selective small-molecule inhibitor of CX3CR1, AZD8797, was recently reported and we present here an in-depth in vitro characterization of that molecule. In a flow adhesion assay, AZD8797 antagonized the natural ligand, fractalkine (CX3CL1), in both human whole blood (hWB) and in a B-lymphocyte cell line with IC50 values of 300 and 6 nM respectively. AZD8797 also prevented G-protein activation in a [(35)S]GTPγS (guanosine 5'-[γ-thio]triphosphate) accumulation assay. In contrast, dynamic mass redistribution (DMR) experiments revealed a weak Gαi-dependent AZD8797 agonism. Additionally, AZD8797 positively modulated the CX3CL1 response at sub-micromolar concentrations in a β-arrestin recruitment assay. In equilibrium saturation binding experiments, AZD8797 reduced the maximal binding of (125)I-CX3CL1 without affecting Kd. Kinetic experiments, determining the kon and koff of AZD8797, demonstrated that this was not an artefact of irreversible or insurmountable binding, thus a true non-competitive mechanism. Finally we show that both AZD8797 and GTPγS increase the rate with which CX3CL1 dissociates from CX3CR1 in a similar manner, indicating a connection between AZD8797 and the CX3CR1-bound G-protein. Collectively, these data show that AZD8797 is a non-competitive allosteric modulator of CX3CL1, binding CX3CR1 and effecting G-protein signalling and β-arrestin recruitment in a biased way. © 2016 Authors.

Binding thermodynamics of synthetic dye Allura Red with bovine serum albumin.

PubMed

Lelis, Carini Aparecida; Hudson, Eliara Acipreste; Ferreira, Guilherme Max Dias; Ferreira, Gabriel Max Dias; da Silva, Luis Henrique Mendes; da Silva, Maria do Carmo Hespanhol; Pinto, Maximiliano Soares; Pires, Ana Clarissa Dos Santos

2017-02-15

The interaction between Allura Red and bovine serum albumin (BSA) was studied in vitro at pH 7.4. The fluorescence quenching was classified as static quenching due to the formation of AR-BSA complex, with binding constant (K) ranging from 3.26±0.09 to 8.08±0.0610(4)L.mol(-1), at the warfarin binding site of BSA. This complex formation was driven by increasing entropy. Isothermal titration calorimetric measurements also showed an enthalpic contribution. The Allura Red diffusion coefficient determined by the Taylor-Aris technique corroborated these results because it reduced with increasing BSA concentration. Interfacial tension measurements showed that the AR-BSA complex presented surface activity, since interfacial tension of the water-air interface decreased as the colorant concentration increased. This technique also provided a complexation stoichiometry similar to those obtained by fluorimetric experiments. This work contributes to the knowledge of interactions between BSA and azo colorants under physiological conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.

ADP Regulates SNF1, the Saccharomyces cerevisiae Homolog of AMP-Activated Protein Kinase

PubMed Central

Mayer, Faith V.; Heath, Richard; Underwood, Elizabeth; Sanders, Matthew J.; Carmena, David; McCartney, Rhonda R.; Leiper, Fiona C.; Xiao, Bing; Jing, Chun; Walker, Philip A.; Haire, Lesley F.; Ogrodowicz, Roksana; Martin, Stephen R.; Schmidt, Martin C.; Gamblin, Steven J.; Carling, David

2011-01-01

Summary The SNF1 protein kinase complex plays an essential role in regulating gene expression in response to the level of extracellular glucose in budding yeast. SNF1 shares structural and functional similarities with mammalian AMP-activated protein kinase. Both kinases are activated by phosphorylation on a threonine residue within the activation loop segment of the catalytic subunit. Here we show that ADP is the long-sought metabolite that activates SNF1 in response to glucose limitation by protecting the enzyme against dephosphorylation by Glc7, its physiologically relevant protein phosphatase. We also show that the regulatory subunit of SNF1 has two ADP binding sites. The tighter site binds AMP, ADP, and ATP competitively with NADH, whereas the weaker site does not bind NADH, but is responsible for mediating the protective effect of ADP on dephosphorylation. Mutagenesis experiments suggest that the general mechanism by which ADP protects against dephosphorylation is strongly conserved between SNF1 and AMPK. PMID:22019086

Molecular modeling and multispectroscopic studies of the interaction of mesalamine with bovine serum albumin.

PubMed

Shahabadi, Nahid; Fili, Soraya Moradi

2014-01-24

The interaction of mesalamine (5-aminosalicylic acid (5-ASA)) with bovine serum albumin (BSA) was investigated by fluorescence quenching, absorption spectroscopy, circular dichroism (CD) techniques, and molecular docking. Thermodynamic parameters (ΔH<0 and ΔS 0) indicated that the hydrogen bond and electrostatic forces played the major role in the binding of 5-ASA to BSA. The results of CD and UV-vis spectroscopy showed that the binding of this drug to BSA induces some conformational changes in BSA. Displacement experiments predicted that the binding of 5-ASA to BSA is located within domain III, Sudlows site 2, that these observations were substantiated by molecular docking studies. In addition, the docking result shows that the 5-ASA in its anionic form mainly interacts with Gln-416 residue through one hydrogen bond between H atom of 5-ASA anion and the adjacent O atom of the hydroxyl group of Gln-416. Copyright © 2013 Elsevier B.V. All rights reserved.

Investigation of the binding of Salvianolic acid B to human serum albumin and the effect of metal ions on the binding

NASA Astrophysics Data System (ADS)

Chen, Tingting; Cao, Hui; Zhu, Shajun; Lu, Yapeng; Shang, Yanfang; Wang, Miao; Tang, Yanfeng; Zhu, Li

2011-10-01

The studies on the interaction between HSA and drugs have been an interesting research field in life science, chemistry and clinical medicine. There are also many metal ions present in blood plasma, thus the research about the effect of metal ions on the interaction between drugs and plasma proteins is crucial. In this study, the interaction of Salvianolic acid B (Sal B) with human serum albumin (HSA) was investigated by the steady-state, synchronous fluorescence and circular dichroism (CD) spectroscopies. The results showed that Sal B had a strong ability to quench the intrinsic fluorescence of HSA through a static quenching mechanism. Binding parameters calculated showed that Sal B was bound to HSA with the binding affinities of 10 5 L mol -1. The thermodynamic parameters studies revealed that the binding was characterized by positive enthalpy and positive entropy changes, and hydrophobic interactions were the predominant intermolecular forces to stabilize the complex. The specific binding distance r (2.93 nm) between donor (HSA) and acceptor (Sal B) was obtained according to Förster non-radiative resonance energy transfer theory. The synchronous fluorescence experiment revealed that Sal B cannot lead to the microenvironmental changes around the Tyr and Trp residues of HSA, and the binding site of Sal B on HSA is located in hydrophobic cavity of subdomain IIA. The CD spectroscopy indicated the secondary structure of HSA is not changed in the presence of Sal B. Furthermore, The effect of metal ions (e.g. Zn 2+, Cu 2+, Co 2+, Ni 2+, Fe 3+) on the binding constant of Sal B-HSA complex was also discussed.

Electrostatic Interactions Mediate Binding of Obscurin to Small Ankyrin 1: Biochemical and Molecular Modeling Studies

PubMed Central

Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.

2012-01-01

Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652

Charge effects in the selection of NPF motifs by the EH domain of EHD1.

PubMed

Henry, Gillian D; Corrigan, Daniel J; Dineen, Joseph V; Baleja, James D

2010-04-27

The Eps15 homology (EH) domain is found in proteins associated with endocytosis and vesicle trafficking. EH domains bind to their target proteins through an asparagine-proline-phenylalanine (NPF) motif. We have measured the interaction energetics of the EH domain from EHD1 with peptides derived from two of its binding partners: Rabenosyn-5 (Ac-GPSLNPFDEED-NH(2)) and Rab11-Fip2 (Ac-YESTNPFTAK-NH(2)). Heteronuclear single quantum coherence (HSQC) spectroscopy shows that both peptides bind in the canonical binding pocket of EHD1 EH and induce identical structural changes, yet the affinity of the negatively charged Ac-GPSLNPFDEED-NH(2) (K(a) = 8 x 10(5) M(-1)) is tighter by 2 orders of magnitude. The thermodynamic profiles (DeltaG, DeltaH, DeltaS) were measured for both peptides as a function of temperature. The enthalpies of binding are essentially identical, and the difference in affinity is a consequence of the difference in entropic cost. Ac-GPSLNPFDEED-NH(2) binding is salt-dependent, demonstrating an electrostatic component to the interaction, whereas Ac-YESTNPFTAK-NH(2) binding is independent of salt. Successive replacement of acidic residues in Ac-GPSLNPFDEED-NH(2) with neutral residues showed that all are important. Lysine side chains in EHD1 EH create a region of strong positive surface potential near the NPF binding pocket. Contributions by lysine epsilon-amino groups to complex formation with Ac-GPSLNPFDEED-NH(2) was shown using direct-observe (15)N NMR spectroscopy. These experiments have enabled us to define a new extended interaction motif for EHD proteins, N-P-F-[DE]-[DE]-[DE], which we have used to predict new interaction partners and hence broaden the range of cellular activities involving the EHD proteins.

Epitope mapping of histo blood group antigens bound to norovirus VLPs using STD NMR experiments reveals fine details of molecular recognition.

PubMed

Fiege, Brigitte; Leuthold, Mila; Parra, Francisco; Dalton, Kevin P; Meloncelli, Peter J; Lowary, Todd L; Peters, Thomas

2017-10-01

Attachment of human noroviruses to histo blood group antigens (HBGAs) is thought to be critical for the infection process. Therefore, we have determined binding epitopes of synthetic type 1 to 6 blood group A- and B-tetrasaccharides binding to GII.4 human Norovirus virus like particles (VLPs) using STD NMR experiments. So far, little information is available from crystal structure analysis studies on the interactions of the reducing-end sugars with the protruding domain (P-domain) of the viral coat protein VP1. Here, we show that the reducing-end sugars make notable contacts with the protein surface. The type of glycosidic linkage, and the identity of the sugar at the reducing end modulate HBGA recognition. Most strikingly, type 2 structures yield only very poor saturation transfer indicating impeded binding. This observation is in accordance with previous mass spectrometry based affinity measurements, and can be understood based on recent crystal structure data of a complex of highly homologous GII.4 P-dimers with H-type 2 trisaccharide where the N-acetyl group of the reducing N-acetyl glucosamine residue points towards a loop comprising amino acids Q390 to H395. We suggest that in our case, binding of type 2 A- and B-tetrasaccharides leads to steric conflicts with this loop. In order to identify factors determining L-Fuc recognition, we also synthesized GII.4 VLPs with point mutations D391A and H395A. Prior studies had suggested that these residues, located in a second shell around the L-Fuc binding site, assist L-Fuc binding. STD NMR experiments with L-Fuc and B-trisaccharide in the presence of wild type and mutant VLPs yield virtually identical binding epitopes suggesting that these two mutations do not significantly alter HBGA recognition. Our study emphasizes that recognition of α-(1→2)-linked L-Fuc residues is a conserved feature of GII.4 noroviruses. However, structural variation of the HBGA core structures clearly modulates molecular recognition depending on the genotype.

The Structure of the Metal Transporter Tp34 and its Affinity for Divalent Metal Ions

NASA Astrophysics Data System (ADS)

Knutsen, Gregory; Deka, Ranjit; Brautigam, Chad; Tomchick, Diana; Machius, Mischa; Norgard, Michael

2007-10-01

Tp34 is periplasmic membrane protein of the nonculitvatable spirochete Treponema pallidum, the pathogen of syphillis. It was proposed that Tp34 is a divalent metal transporter, but the identity of the preferred metal ion(s) was unclear. In this study we investigated the ability of divalent metal ions to induce rTp34 dimerization using hydrodynamic techniques and determine the crystal structure of metal bound forms. Using analytical ultracentrifugation sedimentation velocity experiments, we determined that cobalt is superior to nickel at inducing the dimerization of rTp34. rTp34 was crystallized and selected crystals were incubated at a pH 7.5 with CuSO4 and NiSO4. Diffraction experiments were conducted and the processed electron density maps showed that copper was bound to the major metal binding site as well as to three additional minor binding sites. By contrast nickel was only bound to the major metal binding site in one monomer and to three additional minor sites. These results along with previous findings support evidence of Tp34 being involved with metal transport and/or iron utilization.

Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

PubMed Central

Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

1992-01-01

Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

KIRMES: kernel-based identification of regulatory modules in euchromatic sequences.

PubMed

Schultheiss, Sebastian J; Busch, Wolfgang; Lohmann, Jan U; Kohlbacher, Oliver; Rätsch, Gunnar

2009-08-15

Understanding transcriptional regulation is one of the main challenges in computational biology. An important problem is the identification of transcription factor (TF) binding sites in promoter regions of potential TF target genes. It is typically approached by position weight matrix-based motif identification algorithms using Gibbs sampling, or heuristics to extend seed oligos. Such algorithms succeed in identifying single, relatively well-conserved binding sites, but tend to fail when it comes to the identification of combinations of several degenerate binding sites, as those often found in cis-regulatory modules. We propose a new algorithm that combines the benefits of existing motif finding with the ones of support vector machines (SVMs) to find degenerate motifs in order to improve the modeling of regulatory modules. In experiments on microarray data from Arabidopsis thaliana, we were able to show that the newly developed strategy significantly improves the recognition of TF targets. The python source code (open source-licensed under GPL), the data for the experiments and a Galaxy-based web service are available at http://www.fml.mpg.de/raetsch/suppl/kirmes/.

Interaction of Berberine derivative with protein POT1 affect telomere function in cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Nannan; Chen, Siqi; Ma, Yan

Highlights: Black-Right-Pointing-Pointer The protein POT1 plays an important role in telomere protection. Black-Right-Pointing-Pointer Functional POT1 was overexpressed in Escherichia coli for the first time, and purified. Black-Right-Pointing-Pointer Compound Sysu-00692 was found to be the first POT1-binding ligand. Black-Right-Pointing-Pointer Sysu-00692 could interfere with the binding activity of POT1 in vivo. Black-Right-Pointing-Pointer Sysu-00692 had inhibition on telomerase and cell proliferation. -- Abstract: The protein POT1 plays an important role in telomere protection, which is related with telomere elongation and cell immortality. The protein has been recognized as a promising drug target for cancer treatment. In the present study, we cloned, overexpressed inmore » Escherichia coli for the first time, and purified recombinant human POT1. The protein was proved to be active through filter binding assay, FRET and CD experiments. In the initial screening for protein binding ligands using SPR, compound Sysu-00692 was found to bind well with the POT1, which was confirmed with EMSA. Its in vivo activity study showed that compound Sysu-00692 could interfere with the binding between human POT1 and the telomeric DNA through chromatin immunoprecipitation. Besides, the compound showed mild inhibition on telomerase and cell proliferation. As we know, compound Sysu-00692 is the first reported POT1-binding ligand, which could serve as a lead compound for further improvement. This work offered a potentially new approach for drug design for the treatment of cancers.« less

Protein docking prediction using predicted protein-protein interface.

PubMed

Li, Bin; Kihara, Daisuke

2012-01-10

Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

A heteronuclear zero quantum coherence Nz-exchange experiment that resolves resonance overlap and its application to measure the rates of heme binding to the IsdC protein.

PubMed

Robson, Scott A; Peterson, Robert; Bouchard, Louis-S; Villareal, Valerie A; Clubb, Robert T

2010-07-21

Chemical exchange phenomena in NMR spectra can be quantitatively interpreted to measure the rates of ligand binding, as well as conformational and chemical rearrangements. In macromolecules, processes that occur slowly on the chemical shift time scale are frequently studied using 2D heteronuclear ZZ or N(z)-exchange spectroscopy. However, to successfully apply this method, peaks arising from each exchanging species must have unique chemical shifts in both dimensions, a condition that is often not satisfied in protein-ligand binding equilibria for (15)N nuclei. To overcome the problem of (15)N chemical shift degeneracy we developed a heteronuclear zero-quantum (and double-quantum) coherence N(z)-exchange experiment that resolves (15)N chemical shift degeneracy in the indirect dimension. We demonstrate the utility of this new experiment by measuring the heme binding kinetics of the IsdC protein from Staphylococcus aureus. Because of peak overlap, we could not reliably analyze binding kinetics using conventional methods. However, our new experiment resulted in six well-resolved systems that yielded interpretable data. We measured a relatively slow k(off) rate of heme from IsdC (<10 s(-1)), which we interpret as necessary so heme loaded IsdC has time to encounter downstream binding partners to which it passes the heme. The utility of using this new exchange experiment can be easily expanded to (13)C nuclei. We expect our heteronuclear zero-quantum coherence N(z)-exchange experiment will expand the usefulness of exchange spectroscopy to slow chemical exchange events that involve ligand binding.

Binding biological motion and visual features in working memory.

PubMed

Ding, Xiaowei; Zhao, Yangfan; Wu, Fan; Lu, Xiqian; Gao, Zaifeng; Shen, Mowei

2015-06-01

Working memory mechanisms for binding have been examined extensively in the last decade, yet few studies have explored bindings relating to human biological motion (BM). Human BM is the most salient and biologically significant kinetic information encountered in everyday life and is stored independently from other visual features (e.g., colors). The current study explored 3 critical issues of BM-related binding in working memory: (a) how many BM binding units can be retained in working memory, (b) whether involuntarily object-based binding occurs during BM binding, and (c) whether the maintenance of BM bindings in working memory requires attention above and beyond that needed to maintain the constituent dimensions. We isolated motion signals of human BM from non-BM sources by using point-light displays as to-be-memorized BM and presented the participants colored BM in a change detection task. We found that working memory capacity for BM-color bindings is rather low; only 1 or 2 BM-color bindings could be retained in working memory regardless of the presentation manners (Experiments 1-3). Furthermore, no object-based encoding took place for colored BM stimuli regardless of the processed dimensions (Experiments 4 and 5). Central executive attention contributes to the maintenance of BM-color bindings, yet maintaining BM bindings in working memory did not require more central attention than did maintaining the constituent dimensions in working memory (Experiment 6). Overall, these results suggest that keeping BM bindings in working memory is a fairly resource-demanding process, yet central executive attention does not play a special role in this cross-module binding. (c) 2015 APA, all rights reserved).

Superhalogens as building blocks of two-dimensional organic-inorganic hybrid perovskites for optoelectronics applications.

PubMed

Yao, Qiushi; Fang, Hong; Deng, Kaiming; Kan, Erjun; Jena, Puru

2016-10-20

Organic-inorganic hybrid perovskites, well known for their potential as the next generation solar cells, have found another niche application in optoelectronics. This was demonstrated in a recent experiment (L. Dou, et al., Science, 2015, 349, 1518) on atomically thin (C 4 H 9 NH 3 ) 2 PbBr 4 , where, due to quantum confinement, the bandgap and the exciton binding energy are enhanced over their corresponding values in the three-dimensional bulk phase. Using density functional theory we show that when halogen atoms (e.g. I) are sequentially replaced with superhalogen molecules (e.g. BH 4 ) the bandgap and exciton binding energy increase monotonically with the superhalogen content with the exciton binding energy of (C 4 H 9 NH 3 ) 2 Pb(BH 4 ) 4 approaching the value in monolayer black phosphorus. Lead-free admixtures (C 4 H 9 NH 3 ) 2 MI 4-x (BH 4 ) x (M = Sn and Ge; x = 0-4) also show a similar trend. Thus, a combination of quantum confinement and compositional change can be used as an effective strategy to tailor the bandgap and the exciton binding energy of two-dimensional hybrid perovskites, making them promising candidates for optoelectronic applications.

Molecular Binding Contributes to Concentration Dependent Acrolein Deposition in Rat Upper Airways: CFD and Molecular Dynamics Analyses

PubMed Central

Hu, Qin; Si, Xiuhua April

2018-01-01

Existing in vivo experiments show significantly decreased acrolein uptake in rats with increasing inhaled acrolein concentrations. Considering that high-polarity chemicals are prone to bond with each other, it is hypothesized that molecular binding between acrolein and water will contribute to the experimentally observed deposition decrease by decreasing the effective diffusivity. The objective of this study is to quantify the probability of molecular binding for acrolein, as well as its effects on acrolein deposition, using multiscale simulations. An image-based rat airway geometry was used to predict the transport and deposition of acrolein using the chemical species model. The low Reynolds number turbulence model was used to simulate the airflows. Molecular dynamic (MD) simulations were used to study the molecular binding of acrolein in different media and at different acrolein concentrations. MD results show that significant molecular binding can happen between acrolein and water molecules in human and rat airways. With 72 acrolein embedded in 800 water molecules, about 48% of acrolein compounds contain one hydrogen bond and 10% contain two hydrogen bonds, which agreed favorably with previous MD results. The percentage of hydrogen-bonded acrolein compounds is higher at higher acrolein concentrations or in a medium with higher polarity. Computational dosimetry results show that the size increase caused by the molecular binding reduces the effective diffusivity of acrolein and lowers the chemical deposition onto the airway surfaces. This result is consistent with the experimentally observed deposition decrease at higher concentrations. However, this size increase can only explain part of the concentration-dependent variation of the acrolein uptake and acts as a concurrent mechanism with the uptake-limiting tissue ration rate. Intermolecular interactions and associated variation in diffusivity should be considered in future dosimetry modeling of high-polarity chemicals such as acrolein. PMID:29584651

On the interaction of luminol with human serum albumin: Nature and thermodynamics of ligand binding

NASA Astrophysics Data System (ADS)

Moyon, N. Shaemningwar; Mitra, Sivaprasad

2010-09-01

The mechanism and thermodynamic parameters for the binding of luminol (LH 2) with human serum albumin was explored by steady state and picosecond time-resolved fluorescence spectroscopy. It was shown that out of two possible LH 2 conformers present is solution, only one is accessible for binding with HSA. The thermodynamic parameters like enthalpy (Δ H) and entropy (Δ S) change corresponding to the ligand binding process were also estimated by performing the experiment at different temperatures. The ligand replacement experiment with bilirubin confirms that LH 2 binds into the sub-domain IIA of the protein.

Solution structure of the C-terminal X domain of the measles virus phosphoprotein and interaction with the intrinsically disordered C-terminal domain of the nucleoprotein.

PubMed

Gely, Stéphane; Lowry, David F; Bernard, Cédric; Jensen, Malene R; Blackledge, Martin; Costanzo, Stéphanie; Bourhis, Jean-Marie; Darbon, Hervé; Daughdrill, Gary; Longhi, Sonia

2010-01-01

In this report, the solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein (XD, aa 459-507) is described. A dynamic description of the interaction between XD and the disordered C-terminal domain of the nucleocapsid protein, (N(TAIL), aa 401-525), is also presented. XD is an all alpha protein consisting of a three-helix bundle with an up-down-up arrangement of the helices. The solution structure of XD is very similar to the crystal structures of both the free and bound form of XD. One exception is the presence of a highly dynamic loop encompassing XD residues 489-491, which is involved in the embedding of the alpha-helical XD-binding region of N(TAIL). Secondary chemical shift values for full-length N(TAIL) were used to define the precise boundaries of a transient helical segment that coincides with the XD-binding domain, thus shedding light on the pre-recognition state of N(TAIL). Titration experiments with unlabeled XD showed that the transient alpha-helical conformation of N(TAIL) is stabilized upon binding. Lineshape analysis of NMR resonances revealed that residues 483-506 of N(TAIL) are in intermediate exchange with XD, while the 475-482 and 507-525 regions are in fast exchange. The N(TAIL) resonance behavior in the titration experiments is consistent with a complex binding model with more than two states.

RanGTPase regulates the interaction between the inner nuclear membrane proteins, Samp1 and Emerin.

PubMed

Vijayaraghavan, Balaje; Figueroa, Ricardo A; Bergqvist, Cecilia; Gupta, Amit J; Sousa, Paulo; Hallberg, Einar

2018-06-01

Samp1, spindle associated membrane protein 1, is a type II integral membrane protein localized in the inner nuclear membrane. Recent studies have shown that the inner nuclear membrane protein, Emerin and the small monomeric GTPase, Ran are direct binding partners of Samp1. Here we addressed the question whether Ran could regulate the interaction between Samp1 and Emerin in the inner nuclear membrane. To investigate the interaction between Samp1 and Emerin in live cells, we performed FRAP experiments in cells overexpressing YFP-Emerin. We compared the mobility of YFP-Emerin in Samp1 knock out cells and cells overexpressing Samp1. The results showed that the mobility of YFP-Emerin was higher in Samp1 knock out cells and lower in cells overexpressing Samp1, suggesting that Samp1 significantly attenuates the mobility of Emerin in the nuclear envelope. FRAP experiments using tsBN2 cells showed that the mobility of Emerin depends on RanGTP. Consistently, in vitro binding experiments showed that the affinity between Samp1 and Emerin is decreased in the presence of Ran, suggesting that Ran attenuates the interaction between Samp1 and Emerin. This is the first demonstration that Ran can regulate the interaction between two proteins in the nuclear envelope. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Synthesis, structure, DNA/protein binding, and cytotoxic activity of a rhodium(III) complex with 2,6-bis(2-benzimidazolyl)pyridine.

PubMed

Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh

2017-02-15

A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

New Parameters for Higher Accuracy in the Computation of Binding Free Energy Differences upon Alanine Scanning Mutagenesis on Protein-Protein Interfaces.

PubMed

Simões, Inês C M; Costa, Inês P D; Coimbra, João T S; Ramos, Maria J; Fernandes, Pedro A

2017-01-23

Knowing how proteins make stable complexes enables the development of inhibitors to preclude protein-protein (P:P) binding. The identification of the specific interfacial residues that mostly contribute to protein binding, denominated as hot spots, is thus critical. Here, we refine an in silico alanine scanning mutagenesis protocol, based on a residue-dependent dielectric constant version of the Molecular Mechanics/Poisson-Boltzmann Surface Area method. We have used a large data set of structurally diverse P:P complexes to redefine the residue-dependent dielectric constants used in the determination of binding free energies. The accuracy of the method was validated through comparison with experimental data, considering the per-residue P:P binding free energy (ΔΔG binding ) differences upon alanine mutation. Different protocols were tested, i.e., a geometry optimization protocol and three molecular dynamics (MD) protocols: (1) one using explicit water molecules, (2) another with an implicit solvation model, and (3) a third where we have carried out an accelerated MD with explicit water molecules. Using a set of protein dielectric constants (within the range from 1 to 20) we showed that the dielectric constants of 7 for nonpolar and polar residues and 11 for charged residues (and histidine) provide optimal ΔΔG binding predictions. An overall mean unsigned error (MUE) of 1.4 kcal mol -1 relative to the experiment was achieved in 210 mutations only with geometry optimization, which was further reduced with MD simulations (MUE of 1.1 kcal mol -1 for the MD employing explicit solvent). This recalibrated method allows for a better computational identification of hot spots, avoiding expensive and time-consuming experiments or thermodynamic integration/ free energy perturbation/ uBAR calculations, and will hopefully help new drug discovery campaigns in their quest of searching spots of interest for binding small drug-like molecules at P:P interfaces.

Water-soluble Manganese and Iron Mesotetrakis(carboxyl)porphyrin: DNA Binding, Oxidative Cleavage, and Cytotoxic Activities.

PubMed

Shi, Lei; Jiang, Yi-Yu; Jiang, Tao; Yin, Wei; Yang, Jian-Ping; Cao, Man-Li; Fang, Yu-Qi; Liu, Hai-Yang

2017-06-29

Two new water-soluble metal carboxyl porphyrins, manganese (III) meso -tetrakis (carboxyl) porphyrin and iron (III) meso -tetrakis (carboxyl) porphyrin, were synthesized and characterized. Their interactions with ct-DNA were investigated by UV-Vis titration, fluorescence spectra, viscosity measurement and CD spectra. The results showed they can strongly bind to ct-DNA via outside binding mode. Electrophoresis experiments revealed that both complexes can cleave pBR322 DNA efficiently in the presence of hydrogen peroxide, albeit 2-Mn exhibited a little higher efficiency. The inhibitor tests suggest the oxidative DNA cleavage by these two complexes may involve hydroxyl radical active intermediates. Notably, 2-Mn exhibited considerable photocytotoxicity against Hep G2 cell via triggering a significant generation of ROS and causing disruption of MMP after irradiation.

α-Actinin Anchors PSD-95 at Postsynaptic Sites.

PubMed

Matt, Lucas; Kim, Karam; Hergarden, Anne C; Patriarchi, Tommaso; Malik, Zulfiqar A; Park, Deborah K; Chowdhury, Dhrubajyoti; Buonarati, Olivia R; Henderson, Peter B; Gökçek Saraç, Çiğdem; Zhang, Yonghong; Mohapatra, Durga; Horne, Mary C; Ames, James B; Hell, Johannes W

2018-03-07

Despite the central role PSD-95 plays in anchoring postsynaptic AMPARs, how PSD-95 itself is tethered to postsynaptic sites is not well understood. Here we show that the F-actin binding protein α-actinin binds to the very N terminus of PSD-95. Knockdown (KD) of α-actinin phenocopies KD of PSD-95. Mutating lysine at position 10 or lysine at position 11 of PSD-95 to glutamate, or glutamate at position 53 or glutamate and aspartate at positions 213 and 217 of α-actinin, respectively, to lysine impairs, in parallel, PSD-95 binding to α-actinin and postsynaptic localization of PSD-95 and AMPARs. These experiments identify α-actinin as a critical PSD-95 anchor tethering the AMPAR-PSD-95 complex to postsynaptic sites. Copyright © 2018 Elsevier Inc. All rights reserved.

Structural insights into a StART-like domain in Lam4 and its interaction with sterol ligands.

PubMed

Gatta, Alberto T; Sauerwein, Andrea C; Zhuravleva, Anastasia; Levine, Tim P; Matthews, Stephen

2018-01-15

Sterols are essential components of cellular membranes and shape their biophysical properties. The recently discovered family of Lipid transfer proteins Anchored at Membrane contact sites (LAMs) has been suggested to carry out intracellular sterol traffic using StART-like domains. Here, we studied the second StART-like domain of Lam4p from S. cerevisiae by NMR. We show that NMR data are consistent with the StART-like domain structure, and that several functionally important regions within the domain exhibit significant conformational dynamics. NMR titration experiments confirm sterol binding to the canonical sterol-binding site and suggest a role of membrane interactions on the thermodynamics and kinetics of sterol binding. Copyright © 2017 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyn, Rodney K.; Department of Chemistry, University of Ottawa, Ottawa; Kennedy, David C.

Research highlights: {yields} Hepatitis C virus uses lipid droplets (LD) onto which HCV core proteins bind. {yields} HCV core proteins on LDs facilitate viral particle assembly. {yields} We used a novel combination of CARS, two-photon fluorescence, and DIC microscopies. {yields} Particle tracking experiments show that core slowly affects LD localization. {yields} Particle tracking measured the change in speed and directionality of LD movement. -- Abstract: The hepatitis C virus (HCV) is a global health problem, with limited treatment options and no vaccine available. HCV uses components of the host cell to proliferate, including lipid droplets (LD) onto which HCV coremore » proteins bind and facilitate viral particle assembly. We have measured the dynamics of HCV core protein-mediated changes in LDs and rates of LD movement on microtubules using a combination of coherent anti-Stokes Raman scattering (CARS), two-photon fluorescence (TPF), and differential interference contrast (DIC) microscopies. Results show that the HCV core protein induces rapid increases in LD size. Particle tracking experiments show that HCV core protein slowly affects LD localization by controlling the directionality of LD movement on microtubules. These dynamic processes ultimately aid HCV in propagating and the molecules and interactions involved represent novel targets for potential therapeutic intervention.« less

Cor a 14, the allergenic 2S albumin from hazelnut, is highly thermostable and resistant to gastrointestinal digestion

PubMed Central

Pfeifer, Sabine; Bublin, Merima; Dubiela, Pawel; Hummel, Karin; Wortmann, Judith; Hofer, Gerhard; Keller, Walter; Radauer, Christian

2015-01-01

Scope Allergens from nuts frequently induce severe allergic reactions in sensitive individuals. The aim of this study was to elucidate the physicochemical characteristics of natural Cor a 14, the 2S albumin from hazelnut. Methods and results Cor a 14 was purified from raw hazelnuts using a combination of precipitation and chromatographic techniques. The protein was analyzed using gel electrophoresis, MS, and far‐UV circular dichroism (CD) analyses. The immunoglobulin E (IgE) binding of native, heat‐treated, and in vitro digested Cor a 14 was studied. We identified two different Cor a 14 isoforms and showed microclipping at the C‐terminus. CD spectra at room temperature showed the typical characteristics of 2S albumins, and temperatures of more than 80°C were required to start unfolding of Cor a 14 demonstrating its high stability to heat treatment. In vitro digestion experiments revealed that Cor a 14 is resistant to proteolytic degradation. Native and heat‐treated protein was recognized by sera from hazelnut allergic patients. However, denaturation of the allergen led to significantly reduced IgE binding. Conclusion We identified two different isoforms of Cor a 14 displaying high stability under heating and gastric and duodenal conditions. Data from IgE‐binding experiments revealed the existence of both, linear and conformational epitopes. PMID:26178695

Structural study of the Fox-1 RRM protein hydration reveals a role for key water molecules in RRM-RNA recognition

PubMed Central

Blatter, Markus; Cléry, Antoine; Damberger, Fred F.

2017-01-01

Abstract The Fox-1 RNA recognition motif (RRM) domain is an important member of the RRM protein family. We report a 1.8 Å X-ray structure of the free Fox-1 containing six distinct monomers. We use this and the nuclear magnetic resonance (NMR) structure of the Fox-1 protein/RNA complex for molecular dynamics (MD) analyses of the structured hydration. The individual monomers of the X-ray structure show diverse hydration patterns, however, MD excellently reproduces the most occupied hydration sites. Simulations of the protein/RNA complex show hydration consistent with the isolated protein complemented by hydration sites specific to the protein/RNA interface. MD predicts intricate hydration sites with water-binding times extending up to hundreds of nanoseconds. We characterize two of them using NMR spectroscopy, RNA binding with switchSENSE and free-energy calculations of mutant proteins. Both hydration sites are experimentally confirmed and their abolishment reduces the binding free-energy. A quantitative agreement between theory and experiment is achieved for the S155A substitution but not for the S122A mutant. The S155 hydration site is evolutionarily conserved within the RRM domains. In conclusion, MD is an effective tool for predicting and interpreting the hydration patterns of protein/RNA complexes. Hydration is not easily detectable in NMR experiments but can affect stability of protein/RNA complexes. PMID:28505313

Cell–cell adhesion in metazoans relies on evolutionarily conserved features of the α-catenin·β-catenin–binding interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Xiangqiang; Kang, Hyunook; Loveless, Timothy

Stable tissue integrity during embryonic development relies on the function of the cadherin·catenin complex (CCC). The Caenorhabditis elegans CCC is a useful paradigm for analyzing in vivo requirements for specific interactions among the core components of the CCC, and it provides a unique opportunity to examine evolutionarily conserved mechanisms that govern the interaction between α- and β-catenin. HMP-1, unlike its mammalian homolog α-catenin, is constitutively monomeric, and its binding affinity for HMP-2/β-catenin is higher than that of α-catenin for β-catenin. A crystal structure shows that the HMP-1·HMP-2 complex forms a five-helical bundle structure distinct from the structure of the mammalianmore » α-catenin·β-catenin complex. Deletion analysis based on the crystal structure shows that the first helix of HMP-1 is necessary for binding HMP-2 avidly in vitro and for efficient recruitment of HMP-1 to adherens junctions in embryos. HMP-2 Ser-47 and Tyr-69 flank its binding interface with HMP-1, and we show that phosphomimetic mutations at these two sites decrease binding affinity of HMP-1 to HMP-2 by 40–100-fold in vitro. In vivo experiments using HMP-2 S47E and Y69E mutants showed that they are unable to rescue hmp-2(zu364) mutants, suggesting that phosphorylation of HMP-2 on Ser-47 and Tyr-69 could be important for regulating CCC formation in C. elegans. Our data provide novel insights into how cadherin-dependent cell–cell adhesion is modulated in metazoans by conserved elements as well as features unique to specific organisms.« less

Cell–cell adhesion in metazoans relies on evolutionarily conserved features of the α-catenin·β-catenin–binding interface

DOE PAGES

Shao, Xiangqiang; Kang, Hyunook; Loveless, Timothy; ...

2017-08-25

Stable tissue integrity during embryonic development relies on the function of the cadherin·catenin complex (CCC). The Caenorhabditis elegans CCC is a useful paradigm for analyzing in vivo requirements for specific interactions among the core components of the CCC, and it provides a unique opportunity to examine evolutionarily conserved mechanisms that govern the interaction between α- and β-catenin. HMP-1, unlike its mammalian homolog α-catenin, is constitutively monomeric, and its binding affinity for HMP-2/β-catenin is higher than that of α-catenin for β-catenin. A crystal structure shows that the HMP-1·HMP-2 complex forms a five-helical bundle structure distinct from the structure of the mammalianmore » α-catenin·β-catenin complex. Deletion analysis based on the crystal structure shows that the first helix of HMP-1 is necessary for binding HMP-2 avidly in vitro and for efficient recruitment of HMP-1 to adherens junctions in embryos. HMP-2 Ser-47 and Tyr-69 flank its binding interface with HMP-1, and we show that phosphomimetic mutations at these two sites decrease binding affinity of HMP-1 to HMP-2 by 40–100-fold in vitro. In vivo experiments using HMP-2 S47E and Y69E mutants showed that they are unable to rescue hmp-2(zu364) mutants, suggesting that phosphorylation of HMP-2 on Ser-47 and Tyr-69 could be important for regulating CCC formation in C. elegans. Our data provide novel insights into how cadherin-dependent cell–cell adhesion is modulated in metazoans by conserved elements as well as features unique to specific organisms.« less

Growth regulation of the mammalian ocular lens by vitreous humor.

PubMed

Banerjee, A; Parafina, J; Bagchi, M

1992-05-01

Experiments were performed in our laboratory to study the effects of a mammalian 8 kD vitreous humor (VH) factor on the DNA synthesis and mitosis of the epithelial cells of organ cultured rabbit lens. The 8 kD polypeptide factor was purified from mature rabbit vitreous humor by liquid chromatography. Proliferative activities of the epithelial cells of organ cultured lenses were stimulated by 3% rabbit serum. The data from our experiments depicted that the 8 kD VH factor effectively inhibits DNA synthesis and mitosis by the epithelial cells of the organ cultured lens. Our experiments also showed that this 8 kD VH factor can maintain its growth inhibitory activity even when heated for 3 min at 95 degrees C. The growth inhibitory effect of the 8 kD VH factor was dose dependent. Using iodinated vitreal proteins it was demonstrated that the VH proteins are able to enter or bind to lens epithelial cells. The growth inhibitory effect of the 8 kD VH factor was also tested on tissue cultured lens epithelial cells. These experiments showed that the 8 kD VH factor has no growth inhibitory effect on the tissue cultured lens epithelial cells. This experiment has been repeated many times using different concentrations of the factor. These observations suggest that the 8 kD VH factor may have receptors in the lens capsular material (extracellular matrix) and the factor-receptor binding is essential for the growth inhibitory effect.

Interaction of phenazinium dyes with double-stranded poly(A): Spectroscopy and isothermal titration calorimetry studies

NASA Astrophysics Data System (ADS)

Khan, Asma Yasmeen; Saha, Baishakhi; Kumar, Gopinatha Suresh

2014-10-01

A comprehensive study on the binding of phenazinium dyes viz. janus green B, indoine blue, safranine O and phenosafranine with double stranded poly(A) using various spectroscopic and calorimetric techniques is presented. A higher binding of janus green B and indoine blue over safranine O and phenosafranine to poly(A) was observed from all experiments. Intercalative mode of binding of the dyes was inferred from fluorescence polarization anisotropy, iodide quenching and viscosity experiments. Circular dichroism study revealed significant perturbation of the secondary structure of poly(A) on binding of these dyes. Results from isothermal titration calorimetry experiments suggested that the binding was predominantly entropy driven with a minor contribution of enthalpy to the standard molar Gibbs energy. The results presented here may open new opportunities in the application of these dyes as RNA targeted therapeutic agents.

Sex pheromone recognition and characterization of three pheromone-binding proteins in the legume pod borer, Maruca vitrata Fabricius (Lepidoptera: Crambidae)

PubMed Central

Mao, Aping; Zhou, Jing; Bin Mao; Zheng, Ya; Wang, Yufeng; Li, Daiqin; Wang, Pan; Liu, Kaiyu; Wang, Xiaoping; Ai, Hui

2016-01-01

Pheromone-binding proteins (PBPs) are essential for the filtering, binding and transporting of sex pheromones across sensillum lymph to membrane-associated pheromone receptors of moths. In this study, three novel PBP genes were expressed in Escherichia coli to examine their involvement in the sex pheromone perception of Maruca vitrata. Fluorescence binding experiments indicated that MvitPBP1-3 had strong binding affinities with four sex pheromones. Moreover, molecular docking results demonstrated that six amino acid residues of three MvitPBPs were involved in the binding of the sex pheromones. These results suggested that MvitPBP1-3 might play critical roles in the perception of female sex pheromones. Additionally, the binding capacity of MvitPBP3 with the host-plant floral volatiles was high and was similar to that of MvitGOBP2. Furthermore, sequence alignment and docking analysis showed that both MvitGOBP2 and MvitPBP3 possessed an identical key binding site (arginine, R130/R140) and a similar protein pocket structure around the binding cavity. Therefore, we hypothesized that MvitPBP3 and MvitGOBP2 might have synergistic roles in binding different volatile ligands. In combination, the use of synthetic sex pheromones and floral volatiles from host-plant may be used in the exploration for more efficient monitoring and integrated management strategies for the legume pod borer in the field. PMID:27698435

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yen Ting; Buchler, Nicolas E.

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the propertiesmore » of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Finally, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site.« less

Efficient analysis of stochastic gene dynamics in the non-adiabatic regime using piecewise deterministic Markov processes

DOE PAGES

Lin, Yen Ting; Buchler, Nicolas E.

2018-01-31

Single-cell experiments show that gene expression is stochastic and bursty, a feature that can emerge from slow switching between promoter states with different activities. In addition to slow chromatin and/or DNA looping dynamics, one source of long-lived promoter states is the slow binding and unbinding kinetics of transcription factors to promoters, i.e. the non-adiabatic binding regime. Here, we introduce a simple analytical framework, known as a piecewise deterministic Markov process (PDMP), that accurately describes the stochastic dynamics of gene expression in the non-adiabatic regime. We illustrate the utility of the PDMP on a non-trivial dynamical system by analysing the propertiesmore » of a titration-based oscillator in the non-adiabatic limit. We first show how to transform the underlying chemical master equation into a PDMP where the slow transitions between promoter states are stochastic, but whose rates depend upon the faster deterministic dynamics of the transcription factors regulated by these promoters. We show that the PDMP accurately describes the observed periods of stochastic cycles in activator and repressor-based titration oscillators. We then generalize our PDMP analysis to more complicated versions of titration-based oscillators to explain how multiple binding sites lengthen the period and improve coherence. Finally, we show how noise-induced oscillation previously observed in a titration-based oscillator arises from non-adiabatic and discrete binding events at the promoter site.« less

The Extracellular Heme-binding Protein HbpS from the Soil Bacterium Streptomyces reticuli Is an Aquo-cobalamin Binder*

PubMed Central

Ortiz de Orué Lucana, Darío; Fedosov, Sergey N.; Wedderhoff, Ina; Che, Edith N.; Torda, Andrew E.

2014-01-01

The extracellular protein HbpS from Streptomyces reticuli interacts with iron ions and heme. It also acts in concert with the two-component sensing system SenS-SenR in response to oxidative stress. Sequence comparisons suggested that the protein may bind a cobalamin. UV-visible spectroscopy confirmed binding (Kd = 34 μm) to aquo-cobalamin (H2OCbl+) but not to other cobalamins. Competition experiments with the H2OCbl+-coordinating ligand CN− and comparison of mutants identified a histidine residue (His-156) that coordinates the cobalt ion of H2OCbl+ and substitutes for water. HbpS·Cobalamin lacks the Asp-X-His-X-X-Gly motif seen in some cobalamin binding enzymes. Preliminary tests showed that a related HbpS protein from a different species also binds H2OCbl+. Furthermore, analyses of HbpS-heme binding kinetics are consistent with the role of HbpS as a heme-sensor and suggested a role in heme transport. Given the high occurrence of HbpS-like sequences among Gram-positive and Gram-negative bacteria, our findings suggest a great functional versatility among these proteins. PMID:25342754

Lectin-binding histochemistry of non-decalcified growth plate cartilage: a postembedment method for light microscopy of epon-embedded tissue.

PubMed

Farnum, C E; Wilsman, N J

1984-06-01

A postembedment method for the localization of lectin-binding glycoconjugates was developed using Epon-embedded growth plate cartilage from Yucatan miniature swine. By testing a variety of etching, blocking, and incubation procedures, a standard protocol was developed for 1 micron thick sections that allowed visualization of both intracellular and extracellular glycoconjugates with affinity for wheat germ agglutinin and concanavalin A. Both fluorescent and peroxidase techniques were used, and comparisons were made between direct methods and indirect methods using the biotin-avidin bridging system. Differential extracellular lectin binding allowed visualization of interterritorial , territorial, and pericellular matrices. Double labeling experiments showed the precision with which intracellular binding could be localized to specific cytoplasmic compartments, with resolution of binding to the Golgi apparatus, endoplasmic reticulum, and nuclear membrane at the light microscopic level. This method allows the localization of both intracellular and extracellular lectin-binding glycoconjugates using fixation and embedment procedures that are compatible with simultaneous ultrastructural analysis. As such it should have applicability both to the morphological analysis of growth plate organization during normal endochondral ossification, as well as to the diagnostic pathology of matrix abnormalities in disease states of growing cartilage.

Competition effects in cation binding to humic acid: Conditional affinity spectra for fixed total metal concentration conditions

NASA Astrophysics Data System (ADS)

David, Calin; Mongin, Sandrine; Rey-Castro, Carlos; Galceran, Josep; Companys, Encarnació; Garcés, José Luis; Salvador, José; Puy, Jaume; Cecilia, Joan; Lodeiro, Pablo; Mas, Francesc

2010-09-01

Information on the Pb and Cd binding to a purified Aldrich humic acid (HA) is obtained from the influence of different fixed total metal concentrations on the acid-base titrations of this ligand. NICA (Non-Ideal Competitive Adsorption) isotherm has been used for a global quantitative description of the binding, which has then been interpreted by plotting the Conditional Affinity Spectra of the H + binding at fixed total metal concentrations (CAScTM). This new physicochemical tool, here introduced, allows the interpretation of binding results in terms of distributions of proton binding energies. A large increase in the acidity of the phenolic sites as the total metal concentration increases, especially in presence of Pb, is revealed from the shift of the CAScTM towards lower affinities. The variance of the CAScTM distribution, which can be used as a direct measure of the heterogeneity, also shows a significant dependence on the total metal concentration. A discussion of the factors that influence the heterogeneity of the HA under the conditions of each experiment is provided, so that the smoothed pattern exhibited by the titration curves can be justified.

Experimental and DFT studies on DNA binding and photocleavage of two cationic porphyrins. Effects of the introduction of a carboxyphenyl into pyridinium porphyrin.

PubMed

Zhao, Ping; Xu, Lian-Cai; Huang, Jin-Wang; Liu, Jie; Yu, Han-Cheng; Zheng, Kang-Cheng; Ji, Liang-Nian

2008-12-15

The DNA-binding affinities and DNA photocleavage abilities of cationic porphyrin, 5-(4-carboxyphenyl)-10,15,20-tris(4-methylpyridiniumyl)porphyrin (CTMPyP), and its reference compound meso-tetrakis(N-methyl-4-pyridiniumyl)porphyrin (H2TMPyP) have been investigated. The DNA-binding behaviors of the two compounds in NaH2PO4 buffer were compared systematically by using absorption, fluorescence and circular dichroism (CD) spectra, thermal denaturation as well as viscosity measurements. The experimental results show that CTMPyP binds to DNA in an outside binding mode, while H2TMPyP in an intercalative mode. Photocleavage experiments reveal that both two compounds employ 1O2-mediated mechanism in cleaving DNA and H2TMPyP can cleave DNA more efficiently than CTMPyP. Theoretical calculations were carried out with the density functional theory (DFT), and the calculated results indicate that the character and energies of some frontier orbitals of CTMPyP are quite different from those of H2TMPyP. These theoretical results can be used to explain their different DNA-binding modes and affinities to a certain extent.

Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

PubMed Central

Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

2013-01-01

Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

Bacillus subtilis glutamine synthetase regulates its own synthesis by acting as a chaperone to stabilize GlnR-DNA complexes.

PubMed

Fisher, Susan H; Wray, Lewis V

2008-01-22

The Bacillus subtilis GlnR repressor controls gene expression in response to nitrogen availability. Because all GlnR-regulated genes are expressed constitutively in mutants lacking glutamine synthetase (GS), GS is required for repression by GlnR. Feedback-inhibited GS (FBI-GS) was shown to activate GlnR DNA binding with an in vitro electophoretic mobility shift assay (EMSA). The activation of GlnR DNA binding by GS in these experiments depended on the feedback inhibitor glutamine and did not occur with mutant GS proteins defective in regulating GlnR activity in vivo. Although stable GS-GlnR-DNA ternary complexes were not observed in the EMSA experiments, cross-linking experiments showed that a protein-protein interaction occurs between GlnR and FBI-GS. This interaction was reduced in the absence of the feedback inhibitor glutamine and with mutant GS proteins. Because FBI-GS significantly reduced the dissociation rate of the GlnR-DNA complexes, the stability of these complexes is enhanced by FBI-GS. These results argue that FBI-GS acts as a chaperone that activates GlnR DNA binding through a transient protein-protein interaction that stabilizes GlnR-DNA complexes. GS was shown to control the activity of the B. subtilis nitrogen transcription factor TnrA by forming a stable complex between FBI-GS and TnrA that inhibits TnrA DNA binding. Thus, B. subtilis GS is an enzyme with dual catalytic and regulatory functions that uses distinct mechanisms to control the activity of two different transcription factors.

Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

ERIC Educational Resources Information Center

Kugel, Jennifer F.

2008-01-01

An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…

Characterization of high affinity (/sup 3/H)triazolam binding in rat brain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Earle, M.; Concas, A.; Yamamura, H.I.

1986-03-01

The hypnotic Triazolam (TZ), a triazolo (1,4)-benzodiazepine, displays a short physiological half life and has been used for the treatment of insomnia related to anxiety states. Specific binding properties of this recently tritiated TZ were characterized. The authors major objectives were the direct measurement of the temperature dependence and the GABA effect on (/sup 3/H)TZ binding. Saturation studies showed a shift to lower affinity at 37/sup 0/C (K/sub d/ = 0.25 +/- 0.01 nM at O/sup 0/C; K/sub d/ = 1.46 +/- 0.03 nM at 37/sup 0/C) while the B/sub max/ values remained unchanged (1003 +/- 37 fmoles/mg prot. atmore » 0/sup 0/C and 1001 +/- 43 fmoles/mg prot. at 37/sup 0/C). Inhibition studies showed that (/sup 3/H)TZ binding displayed no GABA shift at 0/sup 0/C(K/sub i/ 0.37 +/- 0.03 nM/- GABA and K/sub i/ = 0.55 +/- 0.13 nM/+GABA) but a nearly two-fold shift was apparent at 37/sup 0/C (K/sub i/ = 2.92 +/- 0.2 nM/-GABA; K/sub i/ = 1.37 +/- 0.11 mM/+GABA). These results were also confirmed by saturation studies in the presence or absence of GABA showing a shift to higher affinity in the presence of GABA only at 37/sup 0/C. In Ro 15-1788/(/sup 3/H)TZ competition experiments the presence of GABA did not affect the inhibitory potency of Ro 15-1788 on (/sup 3/H)TZ binding at both temperatures. In conclusion (/sup 3/H)TZ binding showed an extremely high affinity for benzodiazepine receptors. In contrast to reported literature, the findings suggest that TZ interacts with benzodiazepine receptors similar to other benzodiazepine agonists.« less

Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation

PubMed Central

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-01-01

In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325

The structure and binding mode of citrate in the stabilization of gold nanoparticles

NASA Astrophysics Data System (ADS)

Al-Johani, Hind; Abou-Hamad, Edy; Jedidi, Abdesslem; Widdifield, Cory M.; Viger-Gravel, Jasmine; Sangaru, Shiv Shankar; Gajan, David; Anjum, Dalaver H.; Ould-Chikh, Samy; Hedhili, Mohamed Nejib; Gurinov, Andrei; Kelly, Michael J.; El Eter, Mohamad; Cavallo, Luigi; Emsley, Lyndon; Basset, Jean-Marie

2017-09-01

Elucidating the binding mode of carboxylate-containing ligands to gold nanoparticles (AuNPs) is crucial to understand their stabilizing role. A detailed picture of the three-dimensional structure and coordination modes of citrate, acetate, succinate and glutarate to AuNPs is obtained by 13C and 23Na solid-state NMR in combination with computational modelling and electron microscopy. The binding between the carboxylates and the AuNP surface is found to occur in three different modes. These three modes are simultaneously present at low citrate to gold ratios, while a monocarboxylate monodentate (1κO1) mode is favoured at high citrate:gold ratios. The surface AuNP atoms are found to be predominantly in the zero oxidation state after citrate coordination, although trace amounts of Auδ+ are observed. 23Na NMR experiments show that Na+ ions are present near the gold surface, indicating that carboxylate binding occurs as a 2e- L-type interaction for each oxygen atom involved. This approach has broad potential to probe the binding of a variety of ligands to metal nanoparticles.

Diffusing colloidal probes of protein-carbohydrate interactions.

PubMed

Eichmann, Shannon L; Meric, Gulsum; Swavola, Julia C; Bevan, Michael A

2013-02-19

We present diffusing colloidal probe measurements of weak, multivalent, specific protein-polysaccharide interactions mediated by a competing monosaccharide. Specifically, we used integrated evanescent wave and video microscopy methods to monitor the three-dimensional Brownian excursions of conconavilin A (ConA) decorated colloids interacting with dextran-functionalized surfaces in the presence of glucose. Particle trajectories were interpreted as binding lifetime histograms, binding isotherms, and potentials of mean force. Binding lifetimes and isotherms showed clear trends of decreasing ConA-dextran-specific binding with increasing glucose concentration, consistent with expectations. Net potentials were accurately captured by superposition of a short-range, glucose-independent ConA-dextran repulsion and a longer-range, glucose-dependent dextran bridging attraction modeled as a harmonic potential. For glucose concentrations greater than 100 mM, the net ConA-dextran potential was found to have only a nonspecific repulsion, similar to that of bovine serum albumin (BSA) decorated colloids over dextran determined in control experiments. Our results demonstrate the first use of optical microscopy methods to quantify the connections between potentials of mean force and the binding behavior of ConA-decorated colloids on dextran-functionalized surfaces.

Interaction between Saikosaponin D, Paeoniflorin, and Human Serum Albumin.

PubMed

Liang, Guo-Wu; Chen, Yi-Cun; Wang, Yi; Wang, Hong-Mei; Pan, Xiang-Yu; Chen, Pei-Hong; Niu, Qing-Xia

2018-01-27

Saikosaponin D (SSD) and paeoniflorin (PF) are the major active constituents of Bupleuri Radix and Paeonia lactiflora Pall , respectively, and have been widely used in China to treat liver and other diseases for many centuries. We explored the binding of SSD/PF to human serum albumin (HSA) by using fluorospectrophotometry, circular dichroism (CD) and molecular docking. Both SSD and PF produced a conformational change in HSA. Fluorescence quenching was accompanied by a blue shift in the fluorescence spectra. Co-binding of PF and SSD also induced quenching and a conformational change in HSA. The Stern-Volmer equation showed that quenching was dominated by static quenching. The binding constant for ternary interaction was below that for binary interaction. Site-competitive experiments demonstrated that SSD/PF bound to site I (subdomain IIA) and site II (subdomain IIIA) in HSA. Analysis of thermodynamic parameters indicated that hydrogen bonding and van der Waals forces were mostly responsible for the binary association. Also, there was energy transfer upon binary interaction. Molecular docking supported the experimental findings in conformation, binding sites and binding forces.

Structure of the receptor-binding domain of human thrombopoietin determined by complexation with a neutralizing antibody fragment

PubMed Central

Feese, Michael D.; Tamada, Taro; Kato, Yoichi; Maeda, Yoshitake; Hirose, Masako; Matsukura, Yasuko; Shigematsu, Hideki; Muto, Takanori; Matsumoto, Atsushi; Watarai, Hiroshi; Ogami, Kinya; Tahara, Tomoyuki; Kato, Takashi; Miyazaki, Hiroshi; Kuroki, Ryota

2004-01-01

The cytokine thrombopoietin (TPO), the ligand for the hematopoietic receptor c-Mpl, acts as a primary regulator of megakaryocytopoiesis and platelet production. We have determined the crystal structure of the receptor-binding domain of human TPO (hTPO163) to a 2.5-Å resolution by complexation with a neutralizing Fab fragment. The backbone structure of hTPO163 has an antiparallel four-helix bundle fold. The neutralizing Fab mainly recognizes the C–D crossover loop containing the species invariant residue Q111. Titration calorimetric experiments show that hTPO163 interacts with soluble c-Mpl containing the extracellular cytokine receptor homology domains with 1:2 stoichiometry with the binding constants of 3.3 × 109 M–1 and 1.1 × 106 M–1. The presence of the neutralizing Fab did not inhibit binding of hTPO163 to soluble c-Mpl fragments, but the lower-affinity binding disappeared. Together with prior genetic data, these define the structure–function relationships in TPO and the activation scheme of c-Mpl. PMID:14769915

Location and ion-binding of membrane-associated valinomycin, a proton nuclear magnetic resonance study.

PubMed

Meers, P; Feigenson, G W

1988-03-03

Valinomycin, incorporated in small unilamellar vesicles of perdeuterated dimyristoylphosphatidylcholine, reveals several well-resolved 1H-NMR resonances. These resonances were used to examine the location, orientation and ion-binding of membrane-bound valinomycin. The order of affinity of membrane-bound valinomycin for cations is Rb+ greater than K+ greater than Cs+ greater than Ba2+, and binding is sensitive to surface change. The exchange between bound and free forms is fast on the NMR time scale. The intrinsic binding constants, extrapolated to zero anion concentration, are similar to those determined in aqueous solution. Rb+ and K+ show 1:1 binding to valinomycin, whereas the stoichiometry of Cs+ and Ba2+ is not certain. Paramagnetic chemical shift reagents and nitroxide spin label relaxation probes were used to study the location and orientation of valinomycin in the membrane. Despite relatively fast exchange of bound cations, the time average location of the cation-free form of valinomycin is deep within the bilayer under the conditions of these experiments. Upon complexation to K+, valinomycin moves closer to the interfacial region.

The study of zinc ions binding to casein.

PubMed

Pomastowski, P; Sprynskyy, M; Buszewski, B

2014-08-01

The presented research was focused on physicochemical study of casein properties and the kinetics of zinc ions binding to the protein. Moreover, a fast and simple method of casein extraction from cow's milk has been proposed. Casein isoforms, zeta potential (ζ) and particle size of the separated caseins were characterized with the use of capillary electrophoresis, zeta potential analysis and field flow fractionation (FFF) technique, respectively. The kinetics of the metal-binding process was investigated in batch adsorption experiments. Intraparticle diffusion model, first-order and zero-order kinetic models were applied to test the kinetic experimental data. Analysis of changes in infrared bands registered for casein before and after zinc binding was also performed. The obtained results showed that the kinetic process of zinc binding to casein is not homogeneous but is expressed with an initial rapid stage with about 70% of zinc ions immobilized by casein and with a much slower second step. Maximum amount of bound zinc in the experimental conditions was 30.04mgZn/g casein. Copyright © 2014 Elsevier B.V. All rights reserved.

Binding of puerarin to human serum albumin: a spectroscopic analysis and molecular docking.

PubMed

He, Yang; Wang, Yiwei; Tang, Lifei; Liu, Hui; Chen, Wei; Zheng, Zhongliang; Zou, Guolin

2008-03-01

Puerarin is a widely used compound in Chinese traditional medicine and exhibits many pharmacological activities. Binding of puerarin to human serum albumin (HSA) was investigated by ultraviolet absorbance, fluorescence, circular dichroism and molecular docking. Puerarin caused a static quenching of intrinsic fluorescence of HSA, the quenching data was analyzed by Stern-Volmer equation. There was one primary puerarin binding site on HSA with a binding constant of 4.12 x 10(4) M(-1) at 298 K. Thermodynamic analysis by Van Hoff equation found enthalpy change (DeltaH(0)) and entropy change (DeltaS(0)) were -28.01 kJ/mol and -5.63 J/mol K respectively, which indicated the hydrogen bond and Van der Waas interaction were the predominant forces in the binding process. Competitive experiments showed a displacement of warfarin by puerarin, which revealed that the binding site was located at the drug site I. Puerarin was about 2.22 nm far from the tryptophan according to the observed fluorescence resonance energy transfer between HSA and puerarin. Molecular docking suggested the hydrophobic residues such as tyrosine (Tyr) 150, Tyr 148, Tyr 149 and polar residues such as lysine (Lys) 199, Lys 195, arginine 257 and histidine 242 played an important role in the binding reaction.

Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

PubMed Central

Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

2011-01-01

Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

Synthesis, characterization, and first successful monkey imaging studies of metabotropic glutamate receptor subtype 5 (mGluR5) PET radiotracers.

PubMed

Hamill, Terence G; Krause, Stephen; Ryan, Christine; Bonnefous, Celine; Govek, Steve; Seiders, T Jon; Cosford, Nicholas D P; Roppe, Jeffrey; Kamenecka, Ted; Patel, Shil; Gibson, Raymond E; Sanabria, Sandra; Riffel, Kerry; Eng, Waisi; King, Christopher; Yang, Xiaoqing; Green, Mitchell D; O'Malley, Stacey S; Hargreaves, Richard; Burns, H Donald

2005-06-15

Three metabotropic glutamate receptor subtype 5 (mGluR5) PET tracers have been labeled with either carbon-11 or fluorine-18 and their in vitro and in vivo behavior in rhesus monkey has been characterized. Each of these tracers share the common features of high affinity for mGluR5 (0.08-0.23 nM vs. rat mGluR5) and moderate lipophilicity (log P 2.8-3.4). Compound 1b was synthesized using a Suzuki or Stille coupling reaction with [11C]MeI. Compounds 2b and 3b were synthesized by a SNAr reaction using a 3-chlorobenzonitrile precursor. Autoradiographic studies in rhesus monkey brain slices using 2b and 3b showed specific binding in cortex, caudate, putamen, amygdala, hippocampus, most thalamic nuclei, and lower binding in the cerebellum. PET imaging studies in monkey showed that all three tracers readily enter the brain and provide an mGluR5-specific signal in all gray matter regions, including the cerebellum. The specific signal observed in the cerebellum was confirmed by the autoradiographic studies and saturation binding experiments that showed tracer binding in the cerebellum of rhesus monkeys. In vitro metabolism studies using the unlabeled compounds showed that 1a, 2a, and 3a are metabolized slower by human liver microsomes than by monkey liver microsomes. In vivo metabolism studies showed 3b to be long-lived in rhesus plasma with only one other more polar metabolite observed. (c) 2005 Wiley-Liss, Inc.

Inhibition of bacterial DD-peptidases (penicillin-binding proteins) in membranes and in vivo by peptidoglycan-mimetic boronic acids.

PubMed

Dzhekieva, Liudmila; Kumar, Ish; Pratt, R F

2012-04-03

The DD-peptidases or penicillin-binding proteins (PBPs) catalyze the final steps of bacterial peptidoglycan biosynthesis and are inhibited by the β-lactam antibiotics. There is at present a question of whether the active site structure and activity of these enzymes is the same in the solubilized (truncated) DD-peptidase constructs employed in crystallographic and kinetics studies as in membrane-bound holoenzymes. Recent experiments with peptidoglycan-mimetic boronic acids have suggested that these transition state analogue-generating inhibitors may be able to induce reactive conformations of these enzymes and thus inhibit strongly. We have now, therefore, measured the dissociation constants of peptidoglycan-mimetic boronic acids from Escherichia coli and Bacillus subtilis PBPs in membrane preparations and, in the former case, in vivo, by means of competition experiments with the fluorescent penicillin Bocillin Fl. The experiments showed that the boronic acids bound measurably (K(i) < 1 mM) to the low-molecular mass PBPs but not to the high-molecular mass enzymes, both in membrane preparations and in whole cells. In two cases, E. coli PBP2 and PBP5, the dissociation constants obtained were very similar to those obtained with the pure enzymes in homogeneous solution. The boronic acids, therefore, are unable to induce tightly binding conformations of these enzymes in vivo. There is no evidence from these experiments that DD-peptidase inhibitors are more or less effective in vivo than in homogeneous solution.

Effects of autoshaping procedures on 3H-8-OH-DPAT-labeled 5-HT1a binding and 125I-LSD-labeled 5-HT2a binding in rat brain.

PubMed

Tomie, Arthur; Di Poce, Jason; Aguado, Allison; Janes, Amy; Benjamin, Daniel; Pohorecky, Larissa

2003-06-13

Effects of experience with Pavlovian autoshaping procedures on lever-press autoshaping conditioned response (CR) performance and 3H-8-OH-DPAT-labeled binding of 5-HT(1a) receptors as well as 125I-LSD-labeled binding of 5-HT(2a) receptors were evaluated in four groups of male Long-Evans hooded rats. Two groups of rats (Group Paired High CR and Group Paired Low CR) received Pavlovian autoshaping procedures wherein the presentation of a lever (conditioned stimulus, CS) was followed by the response-independent presentation of food (unconditioned stimulus, US). Rats in Group Paired High CR (n=12) showed more rapid CR acquisition and higher asymptotic levels of lever-press autoshaping CR performance relative to rats in Group Low CR (n=12). Group Omission (n=9) received autoshaping with an omission contingency, such that performing the lever-press autoshaping CR resulted in the cancellation the food US, while Group Random (n=9) received presentations of lever CS and food US randomly with respect to one another. Though Groups Omission and Random did not differ in lever-press autoshaping CR performance, Group Omission showed significantly lower levels of 3H-8-OH-DPAT-labeled 5-HT(1a) binding in post-synaptic areas (frontal cortex, septum, caudate putamen), as well as significantly higher plasma corticosterone levels than Group Random. In addition, Group Random showed higher levels of 3H-8-OH-DPAT-labeled 5-HT(1a) binding in pre-synaptic somatodendritic autoreceptors on dorsal raphe nucleus relative to each of the other three groups. Autoradiographic analysis of 125I-LSD-labeled 5-HT(2a) receptor binding revealed no significant differences between Groups Paired High CR and Paired Low CR or between Groups Omission and Random in any brain regions.

Dissociation of binding and learning processes.

PubMed

Moeller, Birte; Frings, Christian

2017-11-01

A single encounter of a stimulus together with a response can result in a short-lived association between the stimulus and the response [sometimes called an event file, see Hommel, Müsseler, Aschersleben, & Prinz, (2001) Behavioral and Brain Sciences, 24, 910-926]. The repetition of stimulus-response pairings typically results in longer lasting learning effects indicating stimulus-response associations (e.g., Logan & Etherton, (1994) Journal of Experimental Psychology: Learning, Memory, and Cognition, 20, 1022-1050]. An important question is whether or not what has been described as stimulus-response binding in action control research is actually identical with an early stage of incidental learning (e.g., binding might be seen as single-trial learning). Here, we present evidence that short-lived binding effects can be distinguished from learning of longer lasting stimulus-response associations. In two experiments, participants always responded to centrally presented target letters that were flanked by response irrelevant distractor letters. Experiment 1 varied whether distractors flanked targets on the horizontal or vertical axis. Binding effects were larger for a horizontal than for a vertical distractor-target configuration, while stimulus configuration did not influence incidental learning of longer lasting stimulus-response associations. In Experiment 2, the duration of the interval between response n - 1 and presentation of display n (500 ms vs. 2000 ms) had opposing influences on binding and learning effects. Both experiments indicate that modulating factors influence stimulus-response binding and incidental learning effects in different ways. We conclude that distinct underlying processes should be assumed for binding and incidental learning effects.

Modulation of DNA-Polyamide Interaction by β-alanine Substitutions: A Study of Positional Effects on Binding Affinity, Kinetics and Thermodynamics

PubMed Central

Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.

2014-01-01

Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096

Multispectroscopic DNA-Binding studies and antimicrobial evaluation of new mixed-ligand Silver(I) complex and nanocomplex: A comparative study

NASA Astrophysics Data System (ADS)

Movahedi, Elaheh; Rezvani, Ali Reza

2018-05-01

A novel mixed-ligand Ag(I) complex, , has been synthesized and characterized by the elemental analysis, IR spectroscopy and 1HNMR. In the formula, dian and phen are N-(4,5-diazafluoren-9-ylidene)aniline and 1,10-phenanthroline, respectively. This complex also has been prepared at nano size by sonochemical technique and characterized by the FTIR and scanning electron microscopy (SEM). To evaluate the biological preferences of the Ag(I) complex and nanocomplex and verify the relationships between the structure and biological function, in vitro DNA binding and antibacterial experiments have been carried out. DNA-complex interaction has been pursued by electronic absorption titration, luminescence titration, competitive binding experiment, effect of ionic strength, thermodynamic studies, viscometric evaluation and circular dichroism spectroscopy in the physiological pH. Each compound displays significant binding trend to the CT-DNA. The mode of binding to the CT-DNA probably is a moderate intercalation mode with the partial insertion of the planar ligands between the base stacks of double-stranded DNA. The relative viscosities and circular dichroism spectra of the CT-DNA with the complex solutions, confirm the intense interactions of the Ag(I) complex and nanocomplex with DNA. An in vitro antibacterial test of the complex and nanocomplex on a series of the Gram-positive bacteria (Staphylococcus aureus, Enterococcus faecalis) and the Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa) shows a remarkable antibacterial feature of the Ag(I) complex. The MIC values (minimum inhibitory concentration) of the compounds compare with silver nitrate and silver sulfadiazine. The bacterial inhibitions of the Ag(I) complex and nanocomplex are agreed to their DNA binding affinities.

Modulation of the conformational state of the SV2A protein by an allosteric mechanism as evidenced by ligand binding assays

PubMed Central

Daniels, V; Wood, M; Leclercq, K; Kaminski, R M; Gillard, M

2013-01-01

Background and Purpose Synaptic vesicle protein 2A (SV2A) is the specific binding site of the anti-epileptic drug levetiracetam (LEV) and its higher affinity analogue UCB30889. Moreover, the protein has been well validated as a target for anticonvulsant therapy. Here, we report the identification of UCB1244283 acting as a SV2A positive allosteric modulator of UCB30889. Experimental Approach UCB1244283 was characterized in vitro using radioligand binding assays with [3H]UCB30889 on recombinant SV2A expressed in HEK cells and on rat cortex. In vivo, the compound was tested in sound-sensitive mice. Key Results Saturation binding experiments in the presence of UCB1244283 demonstrated a fivefold increase in the affinity of [3H]UCB30889 for human recombinant SV2A, combined with a twofold increase of the total number of binding sites. Similar results were obtained on rat cortex. In competition binding experiments, UCB1244283 potentiated the affinity of UCB30889 while the affinity of LEV remained unchanged. UCB1244283 significantly slowed down both the association and dissociation kinetics of [3H]UCB30889. Following i.c.v. administration in sound-sensitive mice, UCB1244283 showed a clear protective effect against both tonic and clonic convulsions. Conclusions and Implications These results indicate that UCB1244283 can modulate the conformation of SV2A, thereby inducing a higher affinity state for UCB30889. Our results also suggest that the conformation of SV2A per se might be an important determinant of its functioning, especially during epileptic seizures. Therefore, agents that act on the conformation of SV2A might hold great potential in the search for new SV2A-based anticonvulsant therapies. PMID:23530581

Triggering nanoparticle surface ligand rearrangement via external stimuli: light-based actuation of biointerfaces

NASA Astrophysics Data System (ADS)

Tang, Zhenghua; Lim, Chang-Keun; Palafox-Hernandez, J. Pablo; Drew, Kurt L. M.; Li, Yue; Swihart, Mark T.; Prasad, Paras N.; Walsh, Tiffany R.; Knecht, Marc R.

2015-08-01

Bio-molecular non-covalent interactions provide a powerful platform for material-specific self-organization in aqueous media. Here, we introduce a strategy that integrates a synthetic optically-responsive motif with a materials-binding peptide to enable remote actuation. Specifically, we linked a photoswitchable azobenzene moiety to either terminus of a Au-binding peptide. We employed these hybrid molecules as capping agents for synthesis of Au nanoparticles. Integrated experiments and molecular simulations showed that the hybrid molecules maintained both of their functions, i.e. binding to Au and optically-triggered reconfiguration. The azobenzene unit was optically switched reversibly between trans and cis states while adsorbed on the particle surface. Upon switching, the conformation of the peptide component of the molecule also changed. This highlights the interplay between the surface adsorption and conformational switching that will be pivotal to the creation of actuatable nanoparticle bio-interfaces, and paves the way toward multifunctional peptide hybrids that can produce stimuli responsive nanoassemblies.Bio-molecular non-covalent interactions provide a powerful platform for material-specific self-organization in aqueous media. Here, we introduce a strategy that integrates a synthetic optically-responsive motif with a materials-binding peptide to enable remote actuation. Specifically, we linked a photoswitchable azobenzene moiety to either terminus of a Au-binding peptide. We employed these hybrid molecules as capping agents for synthesis of Au nanoparticles. Integrated experiments and molecular simulations showed that the hybrid molecules maintained both of their functions, i.e. binding to Au and optically-triggered reconfiguration. The azobenzene unit was optically switched reversibly between trans and cis states while adsorbed on the particle surface. Upon switching, the conformation of the peptide component of the molecule also changed. This highlights the interplay between the surface adsorption and conformational switching that will be pivotal to the creation of actuatable nanoparticle bio-interfaces, and paves the way toward multifunctional peptide hybrids that can produce stimuli responsive nanoassemblies. Electronic supplementary information (ESI) available: Additional modeling analysis, QCM analysis, UV-vis and CD spectroscopy data. See DOI: 10.1039/C5NR02311D

Structural requirements for fibromodulin binding to collagen and the control of type I collagen fibrillogenesis--critical roles for disulphide bonding and the C-terminal region.

PubMed

Font, B; Eichenberger, D; Goldschmidt, D; Boutillon, M M; Hulmes, D J

1998-06-15

Fibromodulin belongs to the family of small, leucine-rich proteoglycans which have been reported to interact with collagens and to inhibit type I collagen fibrillogenesis. Decorin and fibromodulin exhibit a noticeable degree of sequence similarity. However, as previously reported [Font, B., Eichenberger, D., Rosenberg, L. M. & van der Rest, M. (1996) Matrix Biol. 15, 341-348] the domains of these molecules implicated in the interactions with type XII and type XIV collagens are different, these being the dermatan sulphate/chondroitin sulphate chain for decorin and the core protein for fibromodulin. At the present time the fibromodulin domains implicated in the interactions with fibrillar collagens remain unknown. In experiments reported here, we have sought to identify the structural requirements for fibromodulin interaction with collagen and for the control of type I collagen fibrillogenesis. Circular dichroism spectra and fibrillogenesis inhibition studies show that fibromodulin structure and its collagen fibrillogenesis control function are strictly dependent on the presence of intact disulphide bridge(s). In addition, we show that the binding of fibromodulin (or fibromodulin-derived fragments) to type I collagen is not necessarily correlated with fibrillogenesis inhibition. To isolate fibromodulin domains, the native proteoglycan was submitted to mild proteolysis. We have isolated an alpha-chymotrypsin-resistant fragment which contains the bulk of the N-terminal and central region of the molecule including the leucine-rich repeats 4 and 6 reported for decorin to be involved in type I collagen binding. This fragment does not bind to type I collagen. Using enzymes with different specificities, a number of large fragments of fibromodulin were obtained, suggesting a compact structure for this molecule which is relatively resistant to proteolysis. None of these N-glycosylated fragments were able to bind to type I collagen in co-sedimentation experiments. Taken together these results suggest that fibromodulin-type I collagen interactions leading to fibrillogenesis inhibition require more than one binding domain. One of these domains could be the C-terminal end of the molecule containing the disulphide loop which is absent in the chymotrypsin-resistant fragment.

The natural furanone (5Z)-4-bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing-regulated gene expression in Vibrio harveyi by decreasing the DNA-binding activity of the transcriptional regulator protein luxR.

PubMed

Defoirdt, Tom; Miyamoto, Carol M; Wood, Thomas K; Meighen, Edward A; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

2007-10-01

This study aimed at getting a deeper insight in the molecular mechanism by which the natural furanone (5Z)-4-bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing in Vibrio harveyi. Bioluminescence experiments with signal molecule receptor double mutants revealed that the furanone blocks all three channels of the V. harveyi quorum sensing system. In further experiments using mutants with mutations in the quorum sensing signal transduction pathway, the compound was found to block quorum sensing-regulated bioluminescence by interacting with a component located downstream of the Hfq protein. Furthermore, reverse transcriptase real-time polymerase chain reaction with specific primers showed that there was no effect of the furanone on luxR(Vh) mRNA levels in wild-type V. harveyi cells. In contrast, mobility shift assays showed that in the presence of the furanone, significantly lower levels of the LuxR(Vh) response regulator protein were able to bind to its target promoter sequences in wild-type V. harveyi. Finally, tests with purified LuxR(Vh) protein also showed less shifts with furanone-treated LuxR(Vh), whereas the LuxR(Vh) concentration was found not to be altered by the furanone (as determined by SDS-PAGE). Therefore, our data indicate that the furanone blocks quorum sensing in V. harveyi by rendering the quorum sensing master regulator protein LuxR(Vh) unable to bind to the promoter sequences of quorum sensing-regulated genes.

A bacteria antibiotic system in space (23-F ANTIBIO)

NASA Technical Reports Server (NTRS)

Tixador, Rene; Gasset, G.; Eche, B.; Moatti, N.; Lapchine, L.; Woldringh, C.; Toorop, P.; Moatti, J. P.; Delmotte, F.; Tap, G.

1995-01-01

In order to evaluate the effects of weightlessness and cosmic radiations on the bacteria resistance to antibiotics, the Antibio 23F experiment was undertaken onboard Discovery during the 1st International Microgravity Laboratory (IML-1) mission. The effects of various antibiotic concentrations (dihydrostreptomycin) on Escherichia coli growth and cell division behavior were studied. The antibiotic binding was investigated using a radioactive tracer (tritium). The results showed that microgravity did not affect E. coli cells in regards the growth and the cell division. The antibiotic added to the culture medium induced an inhibition of the cultures both in the flight and ground controls. However, the antibiotic was less efficient in flight. The behavior of bacteria was modified, and the exponential growth rate was increased in flight. The incorporation of radioactive antibiotics in flight was comparatively different to ground incorporation, which indicated some perturbations in antibiotic binding. The experiments performed in the 1 g centrifuge did not show any difference in the cultures developed on the static rack, and could support a radiative effect of cosmic radiation to explain the results.

How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

What Do We Learn from Binding Features? Evidence for Multilevel Feature Integration

ERIC Educational Resources Information Center

Colzato, Lorenza S.; Raffone, Antonino; Hommel, Bernhard

2006-01-01

Four experiments were conducted to investigate the relationship between the binding of visual features (as measured by their after-effects on subsequent binding) and the learning of feature-conjunction probabilities. Both binding and learning effects were obtained, but they did not interact. Interestingly, (shape-color) binding effects…

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

PubMed

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

2014-08-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

PubMed Central

Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

2014-01-01

In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

Targeting chromatin binding regulation of constitutively active AR variants to overcome prostate cancer resistance to endocrine-based therapies

PubMed Central

Chan, Siu Chiu; Selth, Luke A.; Li, Yingming; Nyquist, Michael D.; Miao, Lu; Bradner, James E.; Raj, Ganesh V.; Tilley, Wayne D.; Dehm, Scott M.

2015-01-01

Androgen receptor (AR) variants (AR-Vs) expressed in prostate cancer (PCa) lack the AR ligand binding domain (LBD) and function as constitutively active transcription factors. AR-V expression in patient tissues or circulating tumor cells is associated with resistance to AR-targeting endocrine therapies and poor outcomes. Here, we investigated the mechanisms governing chromatin binding of AR-Vs with the goal of identifying therapeutic vulnerabilities. By chromatin immunoprecipitation and sequencing (ChIP-seq) and complementary biochemical experiments, we show that AR-Vs display a binding preference for the same canonical high-affinity androgen response elements (AREs) that are preferentially engaged by AR, albeit with lower affinity. Dimerization was an absolute requirement for constitutive AR-V DNA binding and transcriptional activation. Treatment with the bromodomain and extraterminal (BET) inhibitor JQ1 resulted in inhibition of AR-V chromatin binding and impaired AR-V driven PCa cell growth in vitro and in vivo. Importantly, this was associated with a novel JQ1 action of down-regulating AR-V transcript and protein expression. Overall, this study demonstrates that AR-Vs broadly restore AR chromatin binding events that are otherwise suppressed during endocrine therapy, and provides pre-clinical rationale for BET inhibition as a strategy for inhibiting expression and chromatin binding of AR-Vs in PCa. PMID:25908785

Cargo self-assembly rescues affinity of cell-penetrating peptides to lipid membranes

NASA Astrophysics Data System (ADS)

Weinberger, Andreas; Walter, Vivien; MacEwan, Sarah R.; Schmatko, Tatiana; Muller, Pierre; Schroder, André P.; Chilkoti, Ashutosh; Marques, Carlos M.

2017-03-01

Although cationic cell-penetrating peptides (CPPs) are able to bind to cell membranes, thus promoting cell internalization by active pathways, attachment of cargo molecules to CPPs invariably reduces their cellular uptake. We show here that CPP binding to lipid bilayers, a simple model of the cell membrane, can be recovered by designing cargo molecules that self-assemble into spherical micelles and increase the local interfacial density of CPP on the surface of the cargo. Experiments performed on model giant unilamellar vesicles under a confocal laser scanning microscope show that a family of thermally responsive elastin-like polypeptides that exhibit temperature-triggered micellization can promote temperature triggered attachment of the micelles to membranes, thus rescuing by self-assembly the cargo-induced loss of the CPP affinity to bio-membranes.

Glomerular clusterin is associated with PKC-alpha/beta regulation and good outcome of membranous glomerulonephritis in humans.

PubMed

Rastaldi, M P; Candiano, G; Musante, L; Bruschi, M; Armelloni, S; Rimoldi, L; Tardanico, R; Sanna-Cherchi, S; Cherchi, S Sanna; Ferrario, F; Montinaro, V; Haupt, R; Parodi, S; Carnevali, M L; Allegri, L; Camussi, G; Gesualdo, L; Scolari, F; Ghiggeri, G M

2006-08-01

Mechanisms for human membranous glomerulonephritis (MGN) remain elusive. Most up-to-date concepts still rely on the rat model of Passive Heymann Nephritis that derives from an autoimmune response to glomerular megalin, with complement activation and membrane attack complex assembly. Clusterin has been reported as a megalin ligand in immunodeposits, although its role has not been clarified. We studied renal biopsies of 60 MGN patients by immunohistochemistry utilizing antibodies against clusterin, C5b-9, and phosphorylated-protien kinase C (PKC) isoforms (pPKC). In vitro experiments were performed to investigate the role of clusterin during podocyte damage by MGN serum and define clusterin binding to human podocytes, where megalin is known to be absent. Clusterin, C5b-9, and pPKC-alpha/beta showed highly variable glomerular staining, where high clusterin profiles were inversely correlated to C5b-9 and PKC-alpha/beta expression (P=0.029), and co-localized with the low-density lipoprotein receptor (LDL-R). Glomerular clusterin emerged as the single factor influencing proteinuria at multivariate analysis and was associated with a reduction of proteinuria after a follow-up of 1.5 years (-88.1%, P=0.027). Incubation of podocytes with MGN sera determined strong upregulation of pPKC-alpha/beta that was reverted by pre-incubation with clusterin, serum de-complementation, or protein-A treatment. Preliminary in vitro experiments showed podocyte binding of biotinilated clusterin, co-localization with LDL-R and specific binding inhibition with anti-LDL-R antibodies and with specific ligands. These data suggest a central role for glomerular clusterin in MGN as a modulator of inflammation that potentially influences the clinical outcome. Binding of clusterin to the LDL-R might offer an interpretative key for the pathogenesis of MGN in humans.

Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ

PubMed Central

Saeloh, Dennapa; Wenzel, Michaela; Rungrotmongkol, Thanyada; Hamoen, Leendert Willem

2017-01-01

Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach (in silico), in vitro, and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S)- and (R)-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states). Calculations of free binding energy showed a higher affinity of FtsZ to (S)-rhodomyrtone (−35.92 ± 0.36 kcal mol−1) than the GDP substrate (−23.47 ± 0.25 kcal mol−1) while less affinity was observed in the case of (R)-rhodomyrtone (−18.11 ± 0.11 kcal mol−1). In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance. PMID:28168121

Effects of rhodomyrtone on Gram-positive bacterial tubulin homologue FtsZ.

PubMed

Saeloh, Dennapa; Wenzel, Michaela; Rungrotmongkol, Thanyada; Hamoen, Leendert Willem; Tipmanee, Varomyalin; Voravuthikunchai, Supayang Piyawan

2017-01-01

Rhodomyrtone, a natural antimicrobial compound, displays potent activity against many Gram-positive pathogenic bacteria, comparable to last-defence antibiotics including vancomycin and daptomycin. Our previous studies pointed towards effects of rhodomyrtone on the bacterial membrane and cell wall. In addition, a recent molecular docking study suggested that the compound could competitively bind to the main bacterial cell division protein FtsZ. In this study, we applied a computational approach ( in silico ), in vitro , and in vivo experiments to investigate molecular interactions of rhodomyrtone with FtsZ. Using molecular simulation, FtsZ conformational changes were observed in both (S)- and (R)-rhodomyrtone binding states, compared with the three natural states of FtsZ (ligand-free, GDP-, and GTP-binding states). Calculations of free binding energy showed a higher affinity of FtsZ to (S)-rhodomyrtone (-35.92 ± 0.36 kcal mol -1 ) than the GDP substrate (-23.47 ± 0.25 kcal mol -1 ) while less affinity was observed in the case of (R)-rhodomyrtone (-18.11 ± 0.11 kcal mol -1 ). In vitro experiments further revealed that rhodomyrtone reduced FtsZ polymerization by 36% and inhibited GTPase activity by up to 45%. However, the compound had no effect on FtsZ localization in Bacillus subtilis at inhibitory concentrations and cells also did not elongate after treatment. Higher concentrations of rhodomyrtone did affect localization of FtsZ and also affected localization of its membrane anchor proteins FtsA and SepF, showing that the compound did not specifically inhibit FtsZ but rather impaired multiple divisome proteins. Furthermore, a number of cells adopted a bean-like shape suggesting that rhodomyrtone possibly possesses further targets involved in cell envelope synthesis and/or maintenance.

A course-based undergraduate research experience investigating p300 bromodomain mutations.

PubMed

Shanle, Erin K; Tsun, Ian K; Strahl, Brian D

2016-01-01

Course-based undergraduate research experiences (CUREs) provide an opportunity for students to engage in experiments with outcomes that are unknown to both the instructor and students. These experiences allow students and instructors to collaboratively bridge the research laboratory and classroom, and provide research experiences for a large number of students relative to traditional individual mentored research. Here, we describe a molecular biology CURE investigating the impact of clinically relevant mutations found in the bromodomain of the p300 transcriptional regulator on acetylated histone interaction. In the CURE, students identified missense mutations in the p300 bromodomain using the Catalogue of Somatic Mutations in Cancer (COSMIC) database and hypothesized the effects of the mutation on the acetyl-binding function of the domain. They cloned and purified the mutated bromodomain and performed peptide pulldown assays to define its potential to bind to acetylated histones. Upon completion of the course, students showed increased confidence performing molecular techniques and reported positively on doing a research project in class. In addition, results generated in the classroom were further validated in the research laboratory setting thereby providing a new model for faculty to engage in both course-based and individual undergraduate research experiences. © 2015 The International Union of Biochemistry and Molecular Biology.

Efficacy evaluations of Mimosa pudica tannin isolate (MPT) for its anti-ophidian properties.

PubMed

Ambikabothy, Jamunaa; Ibrahim, Halijah; Ambu, Stephen; Chakravarthi, Srikumar; Awang, Khalijah; Vejayan, Jaya

2011-09-01

Evaluations of the anti-snake venom efficacy of Mimosa pudica tannin isolate (MPT) obtained from root of the plant. MPT was investigated in vitro and in vivo for its efficacy against the venom of Naja kaouthia snake. In vitro: (1) mice injected i.p. with MPT pre-incubated with Naja kaouthia venom at concentrations as low as 0.625 mg/ml showed 100% survival after a 24-h observation period. (2) In the proteomics study, mice injected with MPT pre-incubated with the Naja kaouthia venom showed down-regulation of five serum proteins. (3) In the protein-dye-binding study, the percentage of Bradford dye-protein binding showed a reduction relative to the decrease in MPT concentration used to incubate with the venom. In vivo: the results from the animal studies showed that MPT had no in vivo protection against the Naja kaouthia venom (0.875 mg/kg) in four different rescue modes and in an oral pre-treatment experiment. The study indicated the promising ability of MPT to neutralize the Naja kaouthia venom in in vitro experiments but fell short in its in vivo potential. As such, the use of Mimosa pudica (Mimosaceae) as therapeutics for snake bites is questionable as all the possible in vivo rescue studies and pre-treatment of the active constituents showed no protection against the affected mice. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Conformational analysis of HAMLET, the folding variant of human alpha-lactalbumin associated with apoptosis.

PubMed

Casbarra, Annarita; Birolo, Leila; Infusini, Giuseppe; Dal Piaz, Fabrizio; Svensson, Malin; Pucci, Piero; Svanborg, Catharina; Marino, Gennaro

2004-05-01

A combination of hydrogen/deuterium (H/D) exchange and limited proteolysis experiments coupled to mass spectrometry analysis was used to depict the conformation in solution of HAMLET, the folding variant of human alpha-lactalbumin, complexed to oleic acid, that induces apoptosis in tumor and immature cells. Although near- and far-UV CD and fluorescence spectroscopy were not able to discriminate between HAMLET and apo-alpha-lactalbumin, H/D exchange experiments clearly showed that they correspond to two distinct conformational states, with HAMLET incorporating a greater number of deuterium atoms than the apo and holo forms. Complementary proteolysis experiments revealed that HAMLET and apo are both accessible to proteases in the beta-domain but showed substantial differences in accessibility to proteases at specific sites. The overall results indicated that the conformational changes associated with the release of Ca2+ are not sufficient to induce the HAMLET conformation. Metal depletion might represent the first event to produce a partial unfolding in the beta-domain of alpha-lactalbumin, but some more unfolding is needed to generate the active conformation HAMLET, very likely allowing the protein to bind the C18:1 fatty acid moiety. On the basis of these data, a putative binding site of the oleic acid, which stabilizes the HAMLET conformation, is proposed.

Identification and Functional Characterization of a Novel Acetylcholine-binding Protein from the Marine Annelid Capitella teleta

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCormack, T.; Petrovich,; Mercier, K

2010-01-01

We identified a homologue of the molluscan acetylcholine-binding protein (AChBP) in the marine polychaete Capitella teleta, from the annelid phylum. The amino acid sequence of C. teleta AChBP (ct-AChBP) is 21-30% identical with those of known molluscan AChBPs. Sequence alignments indicate that ct-AChBP has a shortened Cys loop compared to other Cys loop receptors, and a variation on a conserved Cys loop triad, which is associated with ligand binding in other AChBPs and nicotinic ACh receptor (nAChR) {alpha} subunits. Within the D loop of ct-AChBP, a conserved aromatic residue (Tyr or Trp) in nAChRs and molluscan AChBPs, which has beenmore » implicated directly in ligand binding, is substituted with an isoleucine. Mass spectrometry results indicate that Asn122 and Asn216 of ct-AChBP are glycosylated when expressed using HEK293 cells. Small-angle X-ray scattering data suggest that the overall shape of ct-AChBP in the apo or unliganded state is similar to that of homologues with known pentameric crystal structures. NMR experiments show that acetylcholine, nicotine, and {alpha}-bungarotoxin bind to ct-AChBP with high affinity, with KD values of 28.7 {micro}M, 209 nM, and 110 nM, respectively. Choline bound with a lower affinity (K{sub D} = 163 {micro}M). Our finding of a functional AChBP in a marine annelid demonstrates that AChBPs may exhibit variations in hallmark motifs such as ligand-binding residues and Cys loop length and shows conclusively that this neurotransmitter binding protein is not limited to the phylum Mollusca.« less

Searching for transcription factor binding sites in vector spaces

PubMed Central

2012-01-01

Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338

Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

PubMed Central

Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.; Niztayev, A.; Kaptein, R.

2002-01-01

The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5′ incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix–hairpin–helix (HhH) motifs connected by a small connector helix. The UvrC CTD is shown to mediate structure-specific DNA binding. The domain binds to a single-stranded–double-stranded junction DNA, with a strong specificity towards looped duplex DNA that contains at least six unpaired bases per loop (‘bubble DNA’). Using chemical shift perturbation experiments, the DNA-binding surface is mapped to the first hairpin region encompassing the conserved glycine–valine–glycine residues followed by lysine–arginine–arginine, a positively charged surface patch and the second hairpin region consisting of glycine–isoleucine–serine. A model for the protein– DNA complex is proposed that accounts for this specificity. PMID:12426397

Characterization of a Complement-Binding Protein, DRS, from Strains of Streptococcus pyogenes Containing the emm12 and emm55 Genes

PubMed Central

Binks, Michael; Sriprakash, K. S.

2004-01-01

An extracellular protein of Streptococcus pyogenes, streptococcal inhibitor of complement (SIC), and its variant, called DRS (distantly related to SIC), are expressed by some S. pyogenes strains. SIC from type 1 (M1) isolates of S. pyogenes interferes with complement-mediated cell lysis, reportedly via its interaction with complement proteins. In this study we demonstrate that S. pyogenes strains carrying emm12 and emm55 (the genes for the M12 and M55 proteins, respectively) express and secrete DRS. This protein, like SIC, binds to the C6 and C7 complement proteins, and competition enzyme-linked immunosorbent assay experiments demonstrate that DRS competes with SIC for C6 and C7 binding. Similarly, SIC competes with DRS for binding to the complement proteins. Despite this, the recombinant DRS preparation showed no significant effect on complement function, as determined by lysis of sensitized sheep erythrocytes. Furthermore, the presence of DRS is not inhibitory to SIC activity. PMID:15213143

Characterization of a complement-binding protein, DRS, from strains of Streptococcus pyogenes containing the emm12 and emm55 genes.

PubMed

Binks, Michael; Sriprakash, K S

2004-07-01

An extracellular protein of Streptococcus pyogenes, streptococcal inhibitor of complement (SIC), and its variant, called DRS (distantly related to SIC), are expressed by some S. pyogenes strains. SIC from type 1 (M1) isolates of S. pyogenes interferes with complement-mediated cell lysis, reportedly via its interaction with complement proteins. In this study we demonstrate that S. pyogenes strains carrying emm12 and emm55 (the genes for the M12 and M55 proteins, respectively) express and secrete DRS. This protein, like SIC, binds to the C6 and C7 complement proteins, and competition enzyme-linked immunosorbent assay experiments demonstrate that DRS competes with SIC for C6 and C7 binding. Similarly, SIC competes with DRS for binding to the complement proteins. Despite this, the recombinant DRS preparation showed no significant effect on complement function, as determined by lysis of sensitized sheep erythrocytes. Furthermore, the presence of DRS is not inhibitory to SIC activity.

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA

NASA Astrophysics Data System (ADS)

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-01

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging.

Polyreactive Antibodies Plus Complement Enhance the Phagocytosis of Cells Made Apoptotic by UV-Light or HIV

PubMed Central

Zhou, Zhao-hua; Wild, Teresa; Xiong, Ying; Sylvers, Peter; Zhang, Yahong; Zhang, Luxia; Wahl, Larry; Wahl, Sharon M.; Kozlowski, Steven; Notkins, Abner L.

2013-01-01

Polyreactive antibodies are a major component of the natural antibody repertoire and are capable of binding a variety of structurally unrelated antigens. Many of the properties attributed to natural antibodies, in fact, are turning out to be due to polyreactive antibodies. In humans, each day, billions of cells undergo apoptosis. In the present experiments, we show by ImageStream technology that although polyreactive antibodies do not bind to live T cells they bind to both the plasma membrane and cytoplasm of late apoptotic cells, fix complement, generate the anaphylatoxin C5a and increase by as much as 5 fold complement-mediated phagocytosis by macrophages. Of particular importance, T cells undergoing apoptosis following infection with HIV also bind polyreactive antibodies and are phagocytosed. We conclude that the polyreactive antibodies in the natural antibody repertoire contribute in a major way to the clearance of cells made apoptotic by a variety of natural and infectious processes. PMID:23881356

Modeling techniques and fluorescence imaging investigation of the interactions of an anthraquinone derivative with HSA and ctDNA.

PubMed

Fu, Zheng; Cui, Yanrui; Cui, Fengling; Zhang, Guisheng

2016-01-15

A new anthraquinone derivative (AORha) was synthesized. Its interactions with human serum albumin (HSA) and calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopy, UV-visible absorption spectroscopy and molecular modeling. Cell viability assay and cell imaging experiment were performed using cervical cancer cells (HepG2 cells). The fluorescence results revealed that the quenching mechanism was static quenching. At different temperatures (290, 300, 310 K), the binding constants (K) and the number of binding sites (n) were determined, respectively. The positive ΔH and ΔS values showed that the binding of AORha with HSA was hydrophobic force, which was identical with the molecular docking result. Studying the fluorescence spectra, UV spectra and molecular modeling also verified that the binding mode of AORha and ctDNA might be intercalative. When HepG2 cells were treated with AORha, the fluorescence became brighter and turned green, which could be used for bioimaging. Copyright © 2015 Elsevier B.V. All rights reserved.

Solution structure and interactions of the Escherichia coli cell division activator protein CedA.

PubMed

Chen, Ho An; Simpson, Peter; Huyton, Trevor; Roper, David; Matthews, Stephen

2005-05-10

CedA is a protein that is postulated to be involved in the regulation of cell division in Escherichia coli and related organisms; however, little biological data about its possible mode of action are available. Here we present a three-dimensional structure of this protein as determined by NMR spectroscopy. The protein is made up of four antiparallel beta-strands, an alpha-helix, and a large unstructured stretch of residues at the N-terminus. It shows structural similarity to a family of DNA-binding proteins which interact with dsDNA via a three-stranded beta-sheet, suggesting that CedA may be a DNA-binding protein. The putative binding surface of CedA is predominantly positively charged with a number of basic residues surrounding a groove largely dominated by aromatic residues. NMR chemical shift perturbations and gel-shift experiments performed with CedA confirm that the protein binds dsDNA, and its interaction is mediated primarily via the beta-sheet.

Recognition and binding of β-lactam antibiotics to bovine serum albumin by frontal affinity chromatography in combination with spectroscopy and molecular docking.

PubMed

Li, Qian; Zhang, Tianlong; Bian, Liujiao

2016-03-01

Serum albumins are the most abundant carrier proteins in blood plasma and participate in the binding and transportation of various exogenous and endogenous compounds in the body. This work was designed to investigate the recognition and binding of three typical β-lactam antibiotics including penicillin G (Pen G), penicillin V (Pen V) and cefalexin (Cef) with bovine serum albumin (BSA) by frontal affinity chromatography in combination with UV-vis absorption spectra, fluorescence emission spectra, binding site marker competitive experiment and molecular docking under simulated physiological conditions. The results showed that a BSA only bound with one antibiotic molecule in the binding process, and the binding constants for Pen G-BSA, Pen V-BSA and Cef-BSA complexes were 4.22×10(1), 4.86×10(2) and 3.32×10(3) (L/mol), respectively. All the three β-lactam antibiotics were mainly inserted into the subdomain IIA (binding site 1) of BSA by hydrogen bonds and Van der Waals forces. The binding capacity between the antibiotics and BSA was closely related to the functional groups and flexibility of side chains in antibiotics. This study provided an important insight into the molecular recognition and binding interaction of BSA with β-lactam antibiotics, which may be a useful guideline for the innovative clinical medications and new antibiotic designs with effective pharmacological properties. Copyright © 2016 Elsevier B.V. All rights reserved.

The binding sites on human heme oxygenase-1 for cytochrome p450 reductase and biliverdin reductase.

PubMed

Wang, Jinling; de Montellano, Paul R Ortiz

2003-05-30

Human heme oxygenase-1 (hHO-1) catalyzes the NADPH-cytochrome P450 reductase-dependent oxidation of heme to biliverdin, CO, and free iron. The biliverdin is subsequently reduced to bilirubin by biliverdin reductase. Earlier kinetic studies suggested that biliverdin reductase facilitates the release of biliverdin from hHO-1 (Liu, Y., and Ortiz de Montellano, P. R. (2000) J. Biol. Chem. 275, 5297-5307). We have investigated the binding of P450 reductase and biliverdin reductase to truncated, soluble hHO-1 by fluorescence resonance energy transfer and site-specific mutagenesis. P450 reductase and biliverdin reductase bind to truncated hHO-1 with Kd = 0.4 +/- 0.1 and 0.2 +/- 0.1 microm, respectively. FRET experiments indicate that biliverdin reductase and P450 reductase compete for binding to truncated hHO-1. Mutation of surface ionic residues shows that hHO-1 residues Lys18, Lys22, Lys179, Arg183, Arg198, Glu19, Glu127, and Glu190 contribute to the binding of cytochrome P450 reductase. The mutagenesis results and a computational analysis of the protein surfaces partially define the binding site for P450 reductase. An overlapping binding site including Lys18, Lys22, Lys179, Arg183, and Arg185 is similarly defined for biliverdin reductase. These results confirm the binding of biliverdin reductase to hHO-1 and define binding sites of the two reductases.

Substrate Binding Drives Active-Site Closing of Human Blood Group B Galactosyltransferase as Revealed by Hot-Spot Labeling and NMR Spectroscopy Experiments.

PubMed

Weissbach, Sophie; Flügge, Friedemann; Peters, Thomas

2018-05-04

Crystallography has shown that human blood group A (GTA) and B (GTB) glycosyltransferases undergo transitions between "open", "semiclosed", and "closed" conformations upon substrate binding. However, the timescales of the corresponding conformational reorientations are unknown. Crystal structures show that the Trp and Met residues are located at "conformational hot spots" of the enzymes. Therefore, we utilized 15 N side-chain labeling of Trp residues and 13 C-methyl labeling of Met residues to study substrate-induced conformational transitions of GTB. Chemical-shift perturbations (CSPs) of Met and Trp residues in direct contact with substrate ligands reflect binding kinetics, whereas the CSPs of Met and Trp residues at remote sites reflect conformational changes of the enzyme upon substrate binding. Acceptor binding is fast on the chemical-shift timescale with rather small CSPs in the range of less than approximately 20 Hz. Donor binding matches the intermediate exchange regime to yield an estimate for exchange rate constants of approximately 200-300 Hz. Donor or acceptor binding to GTB saturated with acceptor or donor substrate, respectively, is slow (<10 Hz), as are coupled protein motions, reflecting mutual allosteric control of donor and acceptor binding. Remote CSPs suggest that substrate binding drives the enzyme into the closed state required for catalysis. These findings should contribute to better understanding of the mechanism of glycosyl transfer of GTA and GTB. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Measurement of Ligand–Target Residence Times by 1H Relaxation Dispersion NMR Spectroscopy

PubMed Central

2016-01-01

A ligand-observed 1H NMR relaxation experiment is introduced for measuring the binding kinetics of low-molecular-weight compounds to their biomolecular targets. We show that this approach, which does not require any isotope labeling, is applicable to ligand–target systems involving proteins and nucleic acids of variable molecular size. The experiment is particularly useful for the systematic investigation of low affinity molecules with residence times in the micro- to millisecond time regime. PMID:27933946

Theory of long binding events in single-molecule–controlled rotation experiments on F1-ATPase

PubMed Central

Volkán-Kacsó, Sándor; Marcus, Rudolph A.

2017-01-01

The theory of elastic group transfer for the binding and release rate constants for nucleotides in F1-ATPase as a function of the rotor angle is further extended in several respects. (i) A method is described for predicting the experimentally observed lifetime distribution of long binding events in the controlled rotation experiments by taking into account the hydrolysis and synthesis reactions occurring during these events. (ii) A method is also given for treating the long binding events in the experiments and obtaining the rate constants for the hydrolysis and synthesis reactions occurring during these events. (iii) The theory in the previous paper is given in a symmetric form, an extension that simplifies the application of the theory to experiments. It also includes a theory-based correction of the reported “on” and “off” rates by calculating the missed events. A near symmetry of the data about the angle of −40° and a “turnover” in the binding rate data vs. rotor angle for angles greater than ∼40° is also discussed. PMID:28652332

Blocking the Interactions between Calcium-Bound S100A12 Protein and the V Domain of RAGE Using Tranilast

PubMed Central

Chiou, Jian Wei; Fu, Brian

2016-01-01

The receptor for advanced glycation end products (RAGE), a transmembrane receptor in the immunoglobulin superfamily, is involved in several inflammatory processes. RAGE induces cellular signaling pathways upon binding with various ligands, such as advanced glycation end products (AGEs), β-amyloids, and S100 proteins. The solution structure of S100A12 and the V ligand-binding region of RAGE have been reported previously. Using heteronuclear NMR spectroscopy to conduct 1H–15N heteronuclear single quantum coherence (HSQC) titration experiments, we identified and mapped the binding interface between S100A12 and the V domain of RAGE. The NMR chemical shift data were used as the constraints for the High Ambiguity Driven biomolecular DOCKing (HADDOCK) calculation to generate a structural model of the S100A12–V domain complex. In addition, tranilast (an anti-allergic drug) showed strong interaction with S100A12 in the 1H–15N HSQC titration, fluorescence experiments, and WST-1 assay. The results also indicated that tranilast was located at the binding site between S100A12 and the V domain, blocking interaction between these two proteins. Our results provide the mechanistic details for a structural model and reveal a potential precursor for an inhibitor for pro-inflammatory diseases, which could be useful for the development of new drugs. PMID:27598566

Affimer proteins for F-actin: novel affinity reagents that label F-actin in live and fixed cells.

PubMed

Lopata, Anna; Hughes, Ruth; Tiede, Christian; Heissler, Sarah M; Sellers, James R; Knight, Peter J; Tomlinson, Darren; Peckham, Michelle

2018-04-26

Imaging the actin cytoskeleton in cells uses a wide range of approaches. Typically, a fluorescent derivative of the small cyclic peptide phalloidin is used to image F-actin in fixed cells. Lifeact and F-tractin are popular for imaging the cytoskeleton in live cells. Here we characterised novel affinity reagents called Affimers that specifically bind to F-actin in vitro to determine if they are suitable alternatives as eGFP-fusion proteins, to label actin in live cells, or for labeling F-actin in fixed cells. In vitro experiments showed that 3 out of the 4 Affimers (Affimers 6, 14 and 24) tested bind tightly to purified F-actin, and appear to have overlapping binding sites. As eGFP-fusion proteins, the same 3 Affimers label F-actin in live cells. FRAP experiments suggest that eGFP-Affimer 6 behaves most similarly to F-tractin and Lifeact. However, it does not colocalise with mCherry-actin in dynamic ruffles, and may preferentially bind stable actin filaments. All 4 Affimers label F-actin in methanol fixed cells, while only Affimer 14 labels F-actin after paraformaldehyde fixation. eGFP-Affimer 6 has potential for use in selectively imaging the stable actin cytoskeleton in live cells, while all 4 Affimers are strong alternatives to phalloidin for labelling F-actin in fixed cells.

Identification of protein–protein interfaces by decreased amide proton solvent accessibility

PubMed Central

Mandell, Jeffrey G.; Falick, Arnold M.; Komives, Elizabeth A.

1998-01-01

Matrix-assisted laser desorption ionization–time-of-flight mass spectrometry was used to identify peptic fragments from protein complexes that retained deuterium under hydrogen exchange conditions due to decreased solvent accessibility at the interface of the complex. Short deuteration times allowed preferential labeling of rapidly exchanging surface amides so that primarily solvent accessibility changes and not conformational changes were detected. A single mass spectrum of the peptic digest mixture was analyzed to determine the deuterium content of all proteolytic fragments of the protein. The protein–protein interface was reliably indicated by those peptides that retained more deuterons in the complex compared with control experiments in which only one protein was present. The method was used to identify the kinase inhibitor [PKI(5–24)] and ATP-binding sites in the cyclic-AMP-dependent protein kinase. Three overlapping peptides identified the ATP-binding site, three overlapping peptides identified the glycine-rich loop, and two peptides identified the PKI(5–24)-binding site. A complex of unknown structure also was analyzed, human α-thrombin bound to an 83-aa fragment of human thrombomodulin [TMEGF(4–5)]. Five peptides from thrombin showed significantly decreased solvent accessibility in the complex. Three peptides identified the anion-binding exosite I, confirming ligand competition experiments. Two peptides identified a new region of thrombin near the active site providing a potential mechanism of how thrombomodulin alters thrombin substrate specificity. PMID:9843953

Conformational selection in protein binding and function

PubMed Central

Weikl, Thomas R; Paul, Fabian

2014-01-01

Protein binding and function often involves conformational changes. Advanced nuclear magnetic resonance (NMR) experiments indicate that these conformational changes can occur in the absence of ligand molecules (or with bound ligands), and that the ligands may “select” protein conformations for binding (or unbinding). In this review, we argue that this conformational selection requires transition times for ligand binding and unbinding that are small compared to the dwell times of proteins in different conformations, which is plausible for small ligand molecules. Such a separation of timescales leads to a decoupling and temporal ordering of binding/unbinding events and conformational changes. We propose that conformational-selection and induced-change processes (such as induced fit) are two sides of the same coin, because the temporal ordering is reversed in binding and unbinding direction. Conformational-selection processes can be characterized by a conformational excitation that occurs prior to a binding or unbinding event, while induced-change processes exhibit a characteristic conformational relaxation that occurs after a binding or unbinding event. We discuss how the ordering of events can be determined from relaxation rates and effective on- and off-rates determined in mixing experiments, and from the conformational exchange rates measured in advanced NMR or single-molecule fluorescence resonance energy transfer experiments. For larger ligand molecules such as peptides, conformational changes and binding events can be intricately coupled and exhibit aspects of conformational-selection and induced-change processes in both binding and unbinding direction. PMID:25155241

De novo design of a transmembrane Zn²⁺-transporting four-helix bundle.

PubMed

Joh, Nathan H; Wang, Tuo; Bhate, Manasi P; Acharya, Rudresh; Wu, Yibing; Grabe, Michael; Hong, Mei; Grigoryan, Gevorg; DeGrado, William F

2014-12-19

The design of functional membrane proteins from first principles represents a grand challenge in chemistry and structural biology. Here, we report the design of a membrane-spanning, four-helical bundle that transports first-row transition metal ions Zn(2+) and Co(2+), but not Ca(2+), across membranes. The conduction path was designed to contain two di-metal binding sites that bind with negative cooperativity. X-ray crystallography and solid-state and solution nuclear magnetic resonance indicate that the overall helical bundle is formed from two tightly interacting pairs of helices, which form individual domains that interact weakly along a more dynamic interface. Vesicle flux experiments show that as Zn(2+) ions diffuse down their concentration gradients, protons are antiported. These experiments illustrate the feasibility of designing membrane proteins with predefined structural and dynamic properties. Copyright © 2014, American Association for the Advancement of Science.

Potent haloperidol derivatives covalently binding to the dopamine D2 receptor.

PubMed

Schwalbe, Tobias; Kaindl, Jonas; Hübner, Harald; Gmeiner, Peter

2017-10-01

The dopamine D 2 receptor (D 2 R) is a common drug target for the treatment of a variety of neurological disorders including schizophrenia. Structure based design of subtype selective D 2 R antagonists requires high resolution crystal structures of the receptor and pharmacological tools promoting a better understanding of the protein-ligand interactions. Recently, we reported the development of a chemically activated dopamine derivative (FAUC150) designed to covalently bind the L94C mutant of the dopamine D 2 receptor. Using FAUC150 as a template, we elaborated the design and synthesis of irreversible analogs of the potent antipsychotic drug haloperidol forming covalent D 2 R-ligand complexes. The disulfide- and Michael acceptor-functionalized compounds showed significant receptor affinity and an irreversible binding profile in radioligand depletion experiments. Copyright © 2017 Elsevier Ltd. All rights reserved.

The design of high affinity human PD-1 mutants by using molecular dynamics simulations (MD).

PubMed

Du, Jiangfeng; Qin, Yaping; Wu, Yahong; Zhao, Wenshan; Zhai, Wenjie; Qi, Yuanming; Wang, Chuchu; Gao, Yanfeng

2018-06-07

Programmed cell death protein 1 (PD-1), a negative co-stimulatory molecule, plays crucial roles in immune escape. Blockade of the interaction between PD-1 and PD-L1 shows exciting clinical responses in a fraction of cancer patients and the success makes PD-1 as a valuable target in immune checkpoint therapy. For the rational design of PD-1 targeting modulators, the ligand binding mechanism of PD-1 should be well understood in prior. In this study, we applied 50 ns molecular dynamics simulations to observe the structural properties of PD-1 molecule in both apo and ligand bound states, and we studied the structural features of PD-1 in human and mouse respectively. The results showed that the apo hPD-1 was more flexible than that in PD-L1 bound state. We unexpectedly found that K135 was important for binding energy although it was not at the binding interface. Moreover, the residues which stabilized the interactions with PD-L1 were distinguished. Taking the dynamic features of these residues into account, we identified several residual sites where mutations may gain the function of ligand binding. The in vitro binding experiments revealed the mutants M70I, S87 W, A129L, A132L, and K135 M were better in ligand binding than the wild type PD-1. The structural information from MD simulation combined with in silico mutagenesis provides guidance to design engineered PD-1 mutants to modulate the PD-1/PD-L1 pathway.

Understanding the stereospecific interactions of 3-deoxyphosphatidylinositol derivatives with the PTEN phosphatase domain

PubMed Central

Wang, Qin; Wei, Yang; Mottamal, Madhusoodanan; Roberts, Mary F.; Krilov, Goran

2011-01-01

PTEN is an important control element of PI3K/AKT signaling involved in controlling the processes of embryonic development, cell migration and apoptosis. While its dysfunction is implicated in a large fraction of cancers, PTEN activity in the same pathway may also contribute to metabolic syndromes such as diabetes. In those cases, selective inhibitors of PTEN may be useful. A new class of chiral PTEN inhibitors based on the 3-deoxy-phosphatidylinositol derivatives was recently identified [Wang et al. (2008) J. Am. Chem. Soc. 130, 7746]. However, lack of detailed understanding of protein-ligand interactions has hampered efforts to develop effective agonists or antagonists of PTEN. Here, we use computational modeling to characterize the interactions of the diverse 3-deoxyphosphatidylinositol inhibitors with the PTEN protein. We show that, while each of the compounds binds with the inositol headgroup inserting into the proposed active site of the PTEN phosphatase domain, hydrogen bonding restrictions lead to distinct binding geometries for ligand pairs of opposite chirality. We furthermore demonstrate that the binding modes differ primarily in the orientation of acyl tails of the ligands and that the activity of the compounds is primarily controlled by the effectiveness of tail-protein contacts. These findings are confirmed by binding affinity calculations which are in good agreement with experiment. Finally, we show that while more potent D-series ligands bind in a manner similar to that of the native substrate, an alternate hydrophobic pocket suitable for binding the opposite chirality L-series inhibitors exists, offering the possibility of designing highly selective PTEN- targeting compounds. PMID:20538496

Neuroscience: toward unbinding the binding problem.

PubMed

Whitney, David

2009-03-24

How the brain 'binds' information to create a coherent perceptual experience is an enduring question. Recent research in the psychophysics of perceptual binding and developments in fMRI analysis techniques are bringing us closer to an understanding of how the brain solves the binding problem.

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Competitive binding experiments can reduce the false positive results of affinity-based ultrafiltration-HPLC: A case study for identification of potent xanthine oxidase inhibitors from Perilla frutescens extract.

PubMed

Wang, Zhiqiang; Kwon, Shin Hwa; Hwang, Seung Hwan; Kang, Young-Hee; Lee, Jae-Yong; Lim, Soon Sung

2017-03-24

The purpose of this study was to assess the possibility of using competitive binding experiments with ultrafiltration-HPLC analysis to identify potent xanthine oxidase (XO) inhibitors from the Perilla frutescens extract as an attempt to reduce the number of false positive results. To isolate the enzyme-ligand complex from unbound compounds, the P. frutescens extract was either incubated in the absence of XO, in the presence of XO, or with the active site blocked XO before the ultrafiltration was performed. Allopurinaol was used as the XO active site blocker. The unbound compounds were subjected to HPLC analysis. The degree of total binding (TBD) and degree of specific binding (SBD) of each compound were calculated using the peak areas. TBD represents the binding affinities of compounds from the P. frutescens extract for the XO binding site. SBD represents the XO competitive binding between allopurinol and ligands from the extract samples. Two criteria were applied to select putative targets that could help avoid false positives. These include TBD>30% and SBD>10%. Using that approach, kaempferol-3-O-rutinoside, rosmarinic acid, methyl-rosmarinic acid, apigenin, and 4',5,7-trimethoxyflavone were identified, from total 11 compounds, as potent XO inhibitors. Finally, apigenin, 4',5,7-trimethoxyflavone, and luteolin were XO inhibitors verified through an XO inhibition assay and structural simulation of the complex. These results showed that the newly developed strategy has the advantage that the number of targets identified via ultrafiltration-HPLC can be narrowed from many false positives. However, not all false positives can be eliminated with this approach. Some potent inhibitors might also be excluded with the use of this method. The limitations of this method are also discussed herein. Copyright © 2017 Elsevier B.V. All rights reserved.

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

PubMed

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-01

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

Complexes of lutein with bovine and caprine caseins and their impact on lutein chemical stability in emulsion systems: Effect of arabinogalactan.

PubMed

Mora-Gutierrez, A; Attaie, R; Núñez de González, M T; Jung, Y; Woldesenbet, S; Marquez, S A

2018-01-01

Lutein is an important xanthophyll carotenoid with many benefits to human health. Factors affecting the application of lutein as a functional ingredient in low-fat dairy-like beverages (pH 6.0-7.0) are not well understood. The interactions of bovine and caprine caseins with hydrophobic lutein were studied using UV/visible spectroscopy as well as fluorescence. Our studies confirmed that the aqueous solubility of lutein is improved after binding with bovine and caprine caseins. The rates of lutein solubilization by the binding to bovine and caprine caseins were as follows: caprine α S1 -II-casein 34%, caprine α S1 -I-casein 10%, and bovine casein 7% at 100 μM lutein. Fluorescence of the protein was quenched on binding supporting complex formation. The fluorescence experiments showed that the binding involves tryptophan residues and some nonspecific interactions. Scatchard plots of lutein binding to the caseins demonstrated competitive binding between the caseins and their sites of interaction with lutein. Competition experiments suggest that caprine α S1 -II casein will bind a larger number of lutein molecules with higher affinity than other caseins. The chemical stability of lutein was largely dependent on casein type and significant increases occurred in the chemical stability of lutein with the following pattern: caprine α S1 -II-casein > caprine α S1 -I-casein > bovine casein. Addition of arabinogalactan to lutein-enriched emulsions increases the chemical stability of lutein-casein complexes during storage under accelerated photo-oxidation conditions at 25°C. Therefore, caprine α S1 -II-casein alone and in combination with arabinogalactan can have important applications in the beverage industry as carrier of this xanthophyll carotenoid (lutein). Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

[Study on the interaction of doxycycline with human serum albumin].

PubMed

Hu, Tao-Ying; Chen, Lin; Liu, Ying

2014-05-01

The present study was designed to investigate the interaction of doxycycline (DC) with human serum albumin (HSA) by the inner filter effects, displacement experiments and molecular docking methods, based on classic multi-spectroscopy. With fluorescence quenching method at 298 and 310 K, the binding constants Ka, were determined to be 2. 73 X 10(5) and 0. 74X 10(5) L mol-1, respectively, and there was one binding site between DC and HSA, indicating that the binding of DC to HSA was strong, and the quenching mechanism was a static quenching. The thermodynamic parameters (enthalpy change, AH and enthropy change, delta S) were calculated to be -83. 55 kJ mol-1 and -176. 31 J mol-1 K-1 via the Vant' Hoff equation, which indicated that the interaction of DC with HSA was driven mainly by hydrogen bonding and van der Waals forces. Based on the Föster's theory of non-radiation energy transfer, the specific binding distance between Trp-214 (acceptor) and DC (donor) was 4. 98 nm, which was similar to the result confirmed by molecular docking. Through displacement experiments, sub-domain IIA of HSA was assigned to possess the high-affinity binding site of DC. Three-dimensional fluorescence spectra indicated that the binding of DC to HSA induced the conformation change of HSA and increased the disclosure of some part of hydrophobic regions that had been buried before. The results of FTIR spectroscopy showed that DC bound to HSA led to the slight unfolding of the polypeptide chain of HSA. Furthermore, the binding details between DC and HSA were further confirmed by molecular docking methods, which revealed that DC was bound at sub-domain IIA through multiple interactions, such as hydrophobic effect, polar forces and pi-pi interactions. The experimental results provide theoretical basis and reliable data for the study of the interaction between small drug molecule and human serum albumin

The Binding Constant of Estradiol to Bovine Serum Albumin: An Upper-Level Experiment Utilizing Tritium-Labeled Estradiol and Liquid Scintillation Counting

ERIC Educational Resources Information Center

Peihong Liang; Adhyaru, Bhavin; Pearson, Wright L.; Williams, Kathryn R.

2006-01-01

The experiment used [to the third power]H-labeled estradiol to determine the binding constant of estradiol to bovine serum albumin. Estradiol must complex with serum proteins for the transport in the blood stream because of its low solubility in aqueous systems and estradiol-protein binding constant, where K[subscript B] is important to understand…

Probing electrostatic interactions and ligand binding in aspartyl-tRNA synthetase through site-directed mutagenesis and computer simulations.

PubMed

Thompson, Damien; Lazennec, Christine; Plateau, Pierre; Simonson, Thomas

2008-05-15

Faithful genetic code translation requires that each aminoacyl-tRNA synthetase recognise its cognate amino acid ligand specifically. Aspartyl-tRNA synthetase (AspRS) distinguishes between its negatively-charged Asp substrate and two competitors, neutral Asn and di-negative succinate, using a complex network of electrostatic interactions. Here, we used molecular dynamics simulations and site-directed mutagenesis experiments to probe these interactions further. We attempt to decrease the Asp/Asn binding free energy difference via single, double and triple mutations that reduce the net positive charge in the active site of Escherichia coli AspRS. Earlier, Glutamine 199 was changed to a negatively-charged glutamate, giving a computed reduction in Asp affinity in good agreement with experiment. Here, Lysine 198 was changed to a neutral leucine; then, Lys198 and Gln199 were mutated simultaneously. Both mutants are predicted to have reduced Asp binding and improved Asn binding, but the changes are insufficient to overcome the initial, high specificity of the native enzyme, which retains a preference for Asp. Probing the aminoacyl-adenylation reaction through pyrophosphate exchange experiments, we found no detectable activity for the mutant enzymes, indicating weaker Asp binding and/or poorer transition state stabilization. The simulations show that the mutations' effect is partly offset by proton uptake by a nearby histidine. Therefore, we performed additional simulations where the nearby Histidines 448 and 449 were mutated to neutral or negative residues: (Lys198Leu, His448Gln, His449Gln), and (Lys198Leu, His448Glu, His449Gln). This led to unexpected conformational changes and loss of active site preorganization, suggesting that the AspRS active site has a limited structural tolerance for electrostatic modifications. The data give insights into the complex electrostatic network in the AspRS active site and illustrate the difficulty in engineering charged-to-neutral changes of the preferred ligand. 2007 Wiley-Liss, Inc.

Fluorenone based fluorescent probe for selective "turn-on" detection of pyrophosphate and alanine

NASA Astrophysics Data System (ADS)

Daniel Thangadurai, T.; Nithya, I.; Manjubaashini, N.; Bhuvanesh, N.; Bharathi, G.; Nandhakumar, R.; Nataraj, D.

2018-06-01

To sense biologically important entities with different size and dimensions, a fluorenone based fluorescent receptor was designed and synthesized. Probe 1 displayed a distinct fluorescence enhancement emission at 565 nm for pyrophosphate and 530 nm for alanine in polar solvent. The fluorescence titration experiments confirm 1:1 stoichiometric ratio with high-binding constant and very low limit of detection (LoD) values. Receptor 1 showed a highly selective and sensitive recognition to HP2O73 - and to alanine over other competitive anions and amino acids. In addition, the fluorescence lifetime measurement and reversible binding study results support the practical importance of 1.

Anti-tumor Study of Chondroitin Sulfate-Methotrexate Nanogels

NASA Astrophysics Data System (ADS)

Wang, Jinyu; Zhao, Weibo; Chen, Haixiao; Qin, An; Zhu, Peizhi

2017-10-01

Self-assembly nanogels (NGs) were formed by bioconjugating methotrexate (MTX) with chondroitin sulfate (CS). MTX-CS NGs can greatly enhance the solubility and improve the delivery efficacy of MTX due to the CD44 binding property of CS. Vivo experiments revealed that MTX-CS NGs showed less toxicity than MTX. MTX-CS NGs can improve the anti-tumor effect while reducing the side effects of MTX. Due to their CD44 binding property, chondroitin sulfate-drug conjugates could be a promising and efficient platform for improving the solubility of sparingly soluble drug molecules as well as targeted delivery to cancer cells and tumor tissues.

Bead-based microfluidic immunoassay for diagnosis of Johne's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wadhwa, Ashutosh; Foote, Robert; Shaw, Robert W

2012-01-01

Microfluidics technology offers a platform for development of point-of-care diagnostic devices for various infectious diseases. In this study, we examined whether serodiagnosis of Johne s disease (JD) can be conducted in a bead-based microfluidic assay system. Magnetic micro-beads were coated with antigens of the causative agent of JD, Mycobacterium avium subsp. paratuberculosis. The antigen-coated beads were incubated with serum samples of JD-positive or negative serum samples and then with a fluorescently-labeled secondary antibody (SAB). To confirm binding of serum antibodies to the antigen, the beads were subjected to flow cytometric analysis. Different conditions (dilutions of serum and SAB, types ofmore » SAB, and types of magnetic beads) were optimized for a great degree of differentiation between the JD-negative and JD-positive samples. Using the optimized conditions, we tested a well-classified set of 155 serum samples from JD negative and JD-positive cattle by using the bead-based flow cytometric assay. Of 105 JD-positive samples, 63 samples (60%) showed higher antibody binding levels than a cut-off value determined by using antibody binding levels of JD-negative samples. In contrast, only 43-49 JD-positive samples showed higher antibody binding levels than the cut-off value when the samples were tested by commercially-available immunoassays. Microfluidic assays were performed by magnetically immobilizing a number of beads within a microchannel of a glass microchip and detecting antibody on the collected beads by laser-induced fluorescence. Antigen-coated magnetic beads treated with bovine serum sample and fluorescently-labeled SAB were loaded into a microchannel to measure the fluorescence (reflecting level of antibody binding) on the beads in the microfluidic system. When the results of five bovine serum samples obtained with the system were compared to those obtained with the flow cytometer, a high level of correlation (linear regression, r2 = 0.994) was observed. In a further experiment, we magnetically immobilized antigen-coated beads in a microchannel, reacted the beads with serum and SAB in the channel, and detected antibody binding to the beads in the microfluidic system. A strong antibody binding in JD-positive serum was detected, whereas there was only negligible binding in negative control experiments. Our data suggest that the bead-based microfluidic system may form a basis for development of an on-site serodiagnosis of JD. Key Words: Mycobacterium avium ssp. paratuberculosis, Johne s disease, microfluidics, lab-on-a-chip.« less

Analysis of cell flux in the parallel plate flow chamber: implications for cell capture studies.

PubMed Central

Munn, L L; Melder, R J; Jain, R K

1994-01-01

The parallel plate flow chamber provides a controlled environment for determinations of the shear stress at which cells in suspension can bind to endothelial cell monolayers. By decreasing the flow rate of cell-containing media over the monolayer and assessing the number of cells bound at each wall shear stress, the relationship between shear force and binding efficiency can be determined. The rate of binding should depend on the delivery of cells to the surface as well as the intrinsic cell-surface interactions; thus, only if the cell flux to the surface is known can the resulting binding curves be interpreted correctly. We present the development and validation of a mathematical model based on the sedimentation rate and velocity profile in the chamber for the delivery of cells from a flowing suspension to the chamber surface. Our results show that the flux depends on the bulk cell concentration, the distance from the entrance point, and the flow rate of the cell-containing medium. The model was then used in a normalization procedure for experiments in which T cells attach to TNF-alpha-stimulated HUVEC monolayers, showing that a threshold for adhesion occurs at a shear stress of about 3 dyn/cm2. Images FIGURE 1 FIGURE 2 PMID:7948702

NanoESI mass spectrometry of Rubisco and Rubisco activase structures and their interactions with nucleotides and sugar phosphates.

PubMed

Blayney, Michelle J; Whitney, Spencer M; Beck, Jennifer L

2011-09-01

Ribulose bisphosphate carboxylase/oxygenase (Rubisco) is the protein that is responsible for the fixation of carbon dioxide in photosynthesis. Inhibitory sugar phosphate molecules, which can include its substrate ribulose-1,5-bisphosphate (RuBP), can bind to Rubisco catalytic sites and inhibit catalysis. These are removed by interaction with Rubisco activase (RA) via an ATP hydrolytic reaction. Here we show the first nanoESI mass spectra of the hexadecameric Rubisco and of RA from a higher plant (tobacco). The spectra of recombinant, purified RA revealed polydispersity in its oligomeric forms (up to hexamer) and that ADP was bound. ADP was removed by dialysis against a high ionic strength solution and nucleotide binding experiments showed that ADP bound more tightly to RA than AMP-PNP (a non-hydrolysable ATP analog). There was evidence that there may be two nucleotide binding sites per RA monomer. The oligomerization capacity of mutant and wild-type tobacco RA up to hexamers is analogous to the subunit stoichiometry for other AAA+ enzymes. This suggests assembly of RA into hexamers is likely the most active conformation for removing inhibitory sugar phosphate molecules from Rubisco to enable its catalytic competency. Stoichiometric binding of RuBP or carboxyarabinitol bisphosphate (CABP) to each of the eight catalytic sites of Rubisco was observed.

High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors

PubMed Central

Campagnola, Grace; Gong, Peng; Peersen, Olve B.

2011-01-01

Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674

Selective binding and oligomerization of the murine granulocyte colony-stimulating factor receptor by a low molecular weight, nonpeptidyl ligand.

PubMed

Doyle, Michael L; Tian, Shin-Shay; Miller, Stephen G; Kessler, Linda; Baker, Audrey E; Brigham-Burke, Michael R; Dillon, Susan B; Duffy, Kevin J; Keenan, Richard M; Lehr, Ruth; Rosen, Jon; Schneeweis, Lumelle A; Trill, John; Young, Peter R; Luengo, Juan I; Lamb, Peter

2003-03-14

Granulocyte colony-stimulating factor regulates neutrophil production by binding to a specific receptor, the granulocyte colony-stimulating factor receptor, expressed on cells of the granulocytic lineage. Recombinant forms of granulocyte colony-stimulating factor are used clinically to treat neutropenias. As part of an effort to develop granulocyte colony-stimulating factor mimics with the potential for oral bioavailability, we previously identified a nonpeptidyl small molecule (SB-247464) that selectively activates murine granulocyte colony-stimulating factor signal transduction pathways and promotes neutrophil formation in vivo. To elucidate the mechanism of action of SB-247464, a series of cell-based and biochemical assays were performed. The activity of SB-247464 is strictly dependent on the presence of zinc ions. Titration microcalorimetry experiments using a soluble murine granulocyte colony-stimulating factor receptor construct show that SB-247464 binds to the extracellular domain of the receptor in a zinc ion-dependent manner. Analytical ultracentrifugation studies demonstrate that SB-247464 induces self-association of the N-terminal three-domain fragment in a manner that is consistent with dimerization. SB-247464 induces internalization of granulocyte colony-stimulating factor receptor on intact cells, consistent with a mechanism involving receptor oligomerization. These data show that small nonpeptidyl compounds are capable of selectively binding and inducing productive oligomerization of cytokine receptors.

The expression of nifB gene from Herbaspirillum seropedicae is dependent upon the NifA and RpoN proteins.

PubMed

Rego, Fabiane G M; Pedrosa, Fábio O; Chubatsu, Leda S; Yates, M Geoffrey; Wassem, Roseli; Steffens, Maria B R; Rigo, Liu U; Souza, Emanuel M

2006-12-01

The putative nifB promoter region of Herbaspirillum seropedicae contained two sequences homologous to NifA-binding site and a -24/-12 type promoter. A nifB::lacZ fusion was assayed in the backgrounds of both Escherichia coli and H. seropedicae. In E. coli, the expression of nifB::lacZ occurred only in the presence of functional rpoN and Klebsiella pneumoniae nifA genes. In addition, the integration host factor (IHF) stimulated the expression of the nifB::lacZ fusion in this background. In H. seropedicae, nifB expression occurred only in the absence of ammonium and under low levels of oxygen, and it was shown to be strictly dependent on NifA. DNA band shift experiments showed that purified K. pneumoniae RpoN and E. coli IHF proteins were capable of binding to the nifB promoter region, and in vivo dimethylsulfate footprinting showed that NifA binds to both NifA-binding sites. These results strongly suggest that the expression of the nifB promoter of H. seropedicae is dependent on the NifA and RpoN proteins and that the IHF protein stimulates NifA activation of nifB promoter.

CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data

PubMed Central

O'Connor, Timothy; Bodén, Mikael

2017-01-01

Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599

Midbody Targeting of the ESCRT Machinery by a Noncanonical Coiled Coil in CEP55

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Hyung Ho; Elia, Natalie; Ghirlando, Rodolfo

2008-11-14

The ESCRT (endosomal sorting complex required for transport) machinery is required for the scission of membrane necks in processes including the budding of HIV-1 and cytokinesis. An essential step in cytokinesis is recruitment of the ESCRT-I complex and the ESCRT-associated protein ALIX to the midbody (the structure that tethers two daughter cells) by the protein CEP55. Biochemical experiments show that peptides from ALIX and the ESCRT-I subunit TSG101 compete for binding to the ESCRT and ALIX-binding region (EABR) of CEP55. We solved the crystal structure of EABR bound to an ALIX peptide at a resolution of 2.0 angstroms. The structuremore » shows that EABR forms an aberrant dimeric parallel coiled coil. Bulky and charged residues at the interface of the two central heptad repeats create asymmetry and a single binding site for an ALIX or TSG101 peptide. Both ALIX and ESCRT-I are required for cytokinesis, which suggests that multiple CEP55 dimers are required for function.« less

Carbachol dimers as homobivalent modulators of muscarinic receptors.

PubMed

Matucci, Rosanna; Nesi, Marta; Martino, Maria Vittoria; Bellucci, Cristina; Manetti, Dina; Ciuti, Elisa; Mazzolari, Angelica; Dei, Silvia; Guandalini, Luca; Teodori, Elisabetta; Vistoli, Giulio; Romanelli, Maria Novella

2016-05-15

A series of homodimers of the well-known cholinergic agonist carbachol have been synthesized, showing the two agonist units symmetrically connected through a methylene chain of variable length. The new compounds have been tested on the five cloned muscarinic receptors (hM1-5) expressed in CHO cells by means of equilibrium binding studies, showing an increase in affinity by rising the number of methylene units up to 7 and 9. Functional experiments on guinea-pig ileum and assessment of ERK1/2 phosphorylation on hM1, hM2 and hM3 on CHO cells have shown that the new compounds are endowed with muscarinic antagonistic properties. Kinetic binding studies have revealed that some of the tested compounds are able to slow the rate of dissociation of NMS, suggesting a bitopic behavior. Docking simulations, performed on the hM1 and hM2 receptors, give a sound rationalization of the experimental data revealing how these compounds are able to interact with both orthosteric and allosteric binding sites depending on the length of their connecting chain. Copyright © 2016 Elsevier Inc. All rights reserved.

Binding constants of membrane-anchored receptors and ligands depend strongly on the nanoscale roughness of membranes.

PubMed

Hu, Jinglei; Lipowsky, Reinhard; Weikl, Thomas R

2013-09-17

Cell adhesion and the adhesion of vesicles to the membranes of cells or organelles are pivotal for immune responses, tissue formation, and cell signaling. The adhesion processes depend sensitively on the binding constant of the membrane-anchored receptor and ligand proteins that mediate adhesion, but this constant is difficult to measure in experiments. We have investigated the binding of membrane-anchored receptor and ligand proteins with molecular dynamics simulations. We find that the binding constant of the anchored proteins strongly decreases with the membrane roughness caused by thermally excited membrane shape fluctuations on nanoscales. We present a theory that explains the roughness dependence of the binding constant for the anchored proteins from membrane confinement and that relates this constant to the binding constant of soluble proteins without membrane anchors. Because the binding constant of soluble proteins is readily accessible in experiments, our results provide a useful route to compute the binding constant of membrane-anchored receptor and ligand proteins.

M[superscript 2+]•EDTA Binding Affinities: A Modern Experiment in Thermodynamics for the Physical Chemistry Laboratory

ERIC Educational Resources Information Center

O'Brien, Leah C.; Root, Hannah B.; Wei, Chin-Chuan; Jensen, Drake; Shabestary, Nahid; De Meo, Cristina; Eder, Douglas J.

2015-01-01

Isothermal titration calorimetry was used to experimentally determine thermodynamic values for the ethylenediaminetetraacetic acid (EDTA)(aq) + M[superscript 2+](aq) reactions (M[superscript 2+] = Ca[superscript 2+] and Mg[superscript 2+]). Students showed that for reactions in a N-(2-hydroxyethyl)piperazine-N"-ethanesulfonic acid (HEPES)…

Binding and Inhibition in Working Memory: Individual and Age Differences in Short-Term Recognition

ERIC Educational Resources Information Center

Oberauer, Klaus

2005-01-01

Two studies investigated the relationship between working memory capacity (WMC), adult age, and the resolution of conflict between familiarity and recollection in short-term recognition tasks. Experiment 1 showed a specific deficit of young adults with low WMC in rejecting intrusion probes (i.e., highly familiar probes) in a modified Sternberg…

The contribution of perceptual factors and training on varying audiovisual integration capacity.

PubMed

Wilbiks, Jonathan M P; Dyson, Benjamin J

2018-06-01

The suggestion that the capacity of audiovisual integration has an upper limit of 1 was challenged in 4 experiments using perceptual factors and training to enhance the binding of auditory and visual information. Participants were required to note a number of specific visual dot locations that changed in polarity when a critical auditory stimulus was presented, under relatively fast (200-ms stimulus onset asynchrony [SOA]) and slow (700-ms SOA) rates of presentation. In Experiment 1, transient cross-modal congruency between the brightness of polarity change and pitch of the auditory tone was manipulated. In Experiment 2, sustained chunking was enabled on certain trials by connecting varying dot locations with vertices. In Experiment 3, training was employed to determine if capacity would increase through repeated experience with an intermediate presentation rate (450 ms). Estimates of audiovisual integration capacity (K) were larger than 1 during cross-modal congruency at slow presentation rates (Experiment 1), during perceptual chunking at slow and fast presentation rates (Experiment 2), and, during an intermediate presentation rate posttraining (Experiment 3). Finally, Experiment 4 showed a linear increase in K using SOAs ranging from 100 to 600 ms, suggestive of quantitative rather than qualitative changes in the mechanisms in audiovisual integration as a function of presentation rate. The data compromise the suggestion that the capacity of audiovisual integration is limited to 1 and suggest that the ability to bind sounds to sights is contingent on individual and environmental factors. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Control of interference during working memory updating.

PubMed

Szmalec, Arnaud; Verbruggen, Frederick; Vandierendonck, André; Kemps, Eva

2011-02-01

The current study examined the nature of the processes underlying working memory updating. In 4 experiments using the n-back paradigm, the authors demonstrate that continuous updating of items in working memory prevents strong binding of those items to their contexts in working memory, and hence leads to an increased susceptibility to proactive interference. Results of Experiments 1 and 2 show that this interference reflects a competition between a process that reveals the degree of familiarity of an item and a context-sensitive recollection process that depends on the strength of bindings in working memory. Experiment 3 further clarifies the origins of interference during updating by demonstrating that even items that are semantically related to the updated working memory contents but that have not been maintained in working memory before cause proactive interference. Finally, the results of Experiment 4 indicate that the occurrence of interference leads to top-down behavioral adjustments that prioritize recollection over familiarity assessment. The implications of these findings for the construct validity of the n-back task, for the control processes involved in working memory updating, and for the concept of executive control more generally are discussed. (c) 2010 APA, all rights reserved.

When the Wedding March becomes sad: Semantic memory impairment for music in the semantic variant of primary progressive aphasia.

PubMed

Macoir, Joël; Berubé-Lalancette, Sarah; Wilson, Maximiliano A; Laforce, Robert; Hudon, Carol; Gravel, Pierre; Potvin, Olivier; Duchesne, Simon; Monetta, Laura

2016-12-01

Music can induce particular emotions and activate semantic knowledge. In the semantic variant of primary progressive aphasia (svPPA), semantic memory is impaired as a result of anterior temporal lobe (ATL) atrophy. Semantics is responsible for the encoding and retrieval of factual knowledge about music, including associative and emotional attributes. In the present study, we report the performance of two individuals with svPPA in three experiments. NG with bilateral ATL atrophy and ND with atrophy largely restricted to the left ATL. Experiment 1 assessed the recognition of musical excerpts and both patients were unimpaired. Experiment 2 studied the emotions conveyed by music and only NG showed impaired performance. Experiment 3 tested the association of semantic concepts to musical excerpts and both patients were impaired. These results suggest that the right ATL seems essential for the recognition of emotions conveyed by music and that the left ATL is involved in binding music to semantics. They are in line with the notion that the ATLs are devoted to the binding of different modality-specific properties and suggest that they are also differentially involved in the processing of factual and emotional knowledge associated with music.

Hydrophobic fluorescent probes introduce artifacts into single molecule tracking experiments due to non-specific binding.

PubMed

Zanetti-Domingues, Laura C; Tynan, Christopher J; Rolfe, Daniel J; Clarke, David T; Martin-Fernandez, Marisa

2013-01-01

Single-molecule techniques are powerful tools to investigate the structure and dynamics of macromolecular complexes; however, data quality can suffer because of weak specific signal, background noise and dye bleaching and blinking. It is less well-known, but equally important, that non-specific binding of probe to substrates results in a large number of immobile fluorescent molecules, introducing significant artifacts in live cell experiments. Following from our previous work in which we investigated glass coating substrates and demonstrated that the main contribution to this non-specific probe adhesion comes from the dye, we carried out a systematic investigation of how different dye chemistries influence the behaviour of spectrally similar fluorescent probes. Single-molecule brightness, bleaching and probe mobility on the surface of live breast cancer cells cultured on a non-adhesive substrate were assessed for anti-EGFR affibody conjugates with 14 different dyes from 5 different manufacturers, belonging to 3 spectrally homogeneous bands (491 nm, 561 nm and 638 nm laser lines excitation). Our results indicate that, as well as influencing their photophysical properties, dye chemistry has a strong influence on the propensity of dye-protein conjugates to adhere non-specifically to the substrate. In particular, hydrophobicity has a strong influence on interactions with the substrate, with hydrophobic dyes showing much greater levels of binding. Crucially, high levels of non-specific substrate binding result in calculated diffusion coefficients significantly lower than the true values. We conclude that the physic-chemical properties of the dyes should be considered carefully when planning single-molecule experiments. Favourable dye characteristics such as photostability and brightness can be offset by the propensity of a conjugate for non-specific adhesion.

Hydrophobic Fluorescent Probes Introduce Artifacts into Single Molecule Tracking Experiments Due to Non-Specific Binding

PubMed Central

Rolfe, Daniel J.; Clarke, David T.; Martin-Fernandez, Marisa

2013-01-01

Single-molecule techniques are powerful tools to investigate the structure and dynamics of macromolecular complexes; however, data quality can suffer because of weak specific signal, background noise and dye bleaching and blinking. It is less well-known, but equally important, that non-specific binding of probe to substrates results in a large number of immobile fluorescent molecules, introducing significant artifacts in live cell experiments. Following from our previous work in which we investigated glass coating substrates and demonstrated that the main contribution to this non-specific probe adhesion comes from the dye, we carried out a systematic investigation of how different dye chemistries influence the behaviour of spectrally similar fluorescent probes. Single-molecule brightness, bleaching and probe mobility on the surface of live breast cancer cells cultured on a non-adhesive substrate were assessed for anti-EGFR affibody conjugates with 14 different dyes from 5 different manufacturers, belonging to 3 spectrally homogeneous bands (491 nm, 561 nm and 638 nm laser lines excitation). Our results indicate that, as well as influencing their photophysical properties, dye chemistry has a strong influence on the propensity of dye-protein conjugates to adhere non-specifically to the substrate. In particular, hydrophobicity has a strong influence on interactions with the substrate, with hydrophobic dyes showing much greater levels of binding. Crucially, high levels of non-specific substrate binding result in calculated diffusion coefficients significantly lower than the true values. We conclude that the physic-chemical properties of the dyes should be considered carefully when planning single-molecule experiments. Favourable dye characteristics such as photostability and brightness can be offset by the propensity of a conjugate for non-specific adhesion. PMID:24066121

Relational and conjunctive binding functions dissociate in short-term memory.

PubMed

Parra, Mario A; Fabi, Katia; Luzzi, Simona; Cubelli, Roberto; Hernandez Valdez, Maria; Della Sala, Sergio

2015-02-01

Remembering complex events requires binding features within unified objects (conjunctions) and holding associations between objects (relations). Recent studies suggest that the two functions dissociate in long-term memory (LTM). Less is known about their functional organization in short-term memory (STM). The present study investigated this issue in patient AE affected by a stroke which caused damage to brain regions known to be relevant for relational functions both in LTM and in STM (i.e., the hippocampus). The assessment involved a battery of standard neuropsychological tasks and STM binding tasks. One STM binding task (Experiment 1) presented common objects and common colors forming either pairs (relations) or integrated objects (conjunctions). Free recall of relations or conjunctions was assessed. A second STM binding task used random polygons and non-primary colors instead (Experiment 2). Memory was assessed by selecting the features that made up the relations or the conjunctions from a set of single polygons and a set of single colors. The neuropsychological assessment revealed impaired delayed memory in AE. AE's pronounced relational STM binding deficits contrasted with his completely preserved conjunctive binding functions in both Experiments 1 and 2. Only 2.35% and 1.14% of the population were expected to have a discrepancy more extreme than that presented by AE in Experiments 1 and 2, respectively. Processing relations and conjunctions of very elementary nonspatial features in STM led to dissociating performances in AE. These findings may inform current theories of memory decline such as those linked to cognitive aging.

Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

PubMed Central

Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

2015-01-01

Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

High-Density IgE Recognition of the Major Grass Pollen Allergen Phl p 1 Revealed with Single-Chain IgE Antibody Fragments Obtained by Combinatorial Cloning

PubMed Central

Madritsch, Christoph; Gadermaier, Elisabeth; Roder, Uwe W.; Lupinek, Christian; Valenta, Rudolf; Flicker, Sabine

2015-01-01

The timothy grass pollen allergen Phl p 1 belongs to the group 1 of highly cross-reactive grass pollen allergens with a molecular mass of ~25–30 kDa. Group 1 allergens are recognized by >95% of grass pollen allergic patients. We investigated the IgE recognition of Phl p 1 using allergen-specific IgE-derived single-chain variable Ab fragments (IgE-ScFvs) isolated from a combinatorial library constructed from PBMCs of a grass pollen–allergic patient. IgE-ScFvs reacted with recombinant Phl p 1 and natural group 1 grass pollen allergens. Using synthetic Phl p 1–derived peptides, the binding sites of two ScFvs were mapped to the N terminus of the allergen. In surface plasmon resonance experiments they showed comparable high-affinity binding to Phl p 1 as a complete human IgE-derived Ab recognizing the allergens’ C terminus. In a set of surface plasmon resonance experiments simultaneous allergen recognition of all three binders was demonstrated. Even in the presence of the three binders, allergic patients’ polyclonal IgE reacted with Phl p 1, indicating high-density IgE recognition of the Phl p 1 allergen. Our results show that multiple IgE Abs can bind with high density to Phl p 1, which may explain the high allergenic activity and sensitizing capacity of this allergen. PMID:25637023

70-kDa Heat Shock Cognate Protein hsc70 Mediates Calmodulin-dependent Nuclear Import of the Sex-determining Factor SRY*

PubMed Central

Kaur, Gurpreet; Lieu, Kim G.; Jans, David A.

2013-01-01

We recently showed that the developmentally important family of SOX (SRY (sex determining region on the Y chromosome)-related high mobility group (HMG) box) proteins require the calcium-binding protein calmodulin (CaM) for optimal nuclear accumulation, with clinical mutations in SRY that specifically impair nuclear accumulation via this pathway resulting in XY sex reversal. However, the mechanism by which CaM facilitates nuclear accumulation is unknown. Here, we show, for the first time, that the 70-kDa heat shock cognate protein hsc70 plays a key role in CaM-dependent nuclear import of SRY. Using a reconstituted nuclear import assay, we show that antibodies to hsc70 significantly reduce nuclear accumulation of wild type SRY and mutant derivatives thereof that retain CaM-dependent nuclear import, with an increased rate of nuclear accumulation upon addition of both CaM and hsc70, in contrast to an SRY mutant derivative with impaired CaM binding. siRNA knockdown of hsc70 in intact cells showed similar results, indicating clear dependence upon hsc70 for CaM-dependent nuclear import. Analysis using the technique of fluorescence recovery after photobleaching indicated that hsc70 is required for the maximal rate of SRY nuclear import in living cells but has no impact upon SRY nuclear retention/nuclear dynamics. Finally, we demonstrate direct binding of hsc70 to the SRY·CaM complex, with immunoprecipitation experiments from cell extracts showing association of hsc70 with wild type SRY, but not with a mutant derivative with impaired CaM binding, dependent on Ca2+. Our novel findings strongly implicate hsc70 in CaM-dependent nuclear import of SRY. PMID:23235156

On the role of humic acids' carboxyl groups in the binding of charged organic compounds.

PubMed

Smilek, Jiří; Sedláček, Petr; Kalina, Michal; Klučáková, Martina

2015-11-01

Interactions of humic acids (HAs) with two cationic dyes (methylene blue and rhodamine 6G) were studied using a unique combination of diffusion and partitioning studies in HAs, containing hydrogels and batch sorption experiments. In order to investigate the involvement of carboxyl groups of HAs in these interactions, all experiments were performed for both, the original lignite HAs and HAs with selectively methylated carboxyls. The results of the diffusion experiments confirm that the interactions between the solute and humic substances have a strong impact on the rate of diffusion process. Surprisingly, the effect is almost equally approved for original and methylated HAs. On the other hand, the results of batch sorption experiments show strong improvement of the sorption capacity (methylated HAs), which is explained by changed morphology of alkylated HAs. The comparison of the results of diffusion and adsorption experiments shows that the diffusion experiments simulate the transport of solutes in natural humics containing environment more reasonably. Copyright © 2015 Elsevier Ltd. All rights reserved.

Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2

PubMed Central

Vogel, Simon M.; Bauer, Matthias R.; Joerger, Andreas C.; Wilcken, Rainer; Brandt, Tobias; Veprintsev, Dmitry B.; Rutherford, Trevor J.; Fersht, Alan R.; Boeckler, Frank M.

2012-01-01

The proteins MDM2 and MDM4 are key negative regulators of the tumor suppressor protein p53, which are frequently upregulated in cancer cells. They inhibit the transactivation activity of p53 by binding separately or in concert to its transactivation domain. MDM2 is also a ubiquitin ligase that leads to the degradation of p53. Accordingly, MDM2 and MDM4 are important targets for drugs to inhibit their binding to p53. We found from in silico screening and confirmed by experiment that lithocholic acid (LCA) binds to the p53 binding sites of both MDM2 and MDM4 with a fivefold preference for MDM4. LCA is an endogenous steroidal bile acid, variously reported to have both carcinogenic and apoptotic activities. The comparison of LCA effects on apoptosis in HCT116 p53+/+ vs. p53-/- cells shows a predominantly p53-mediated induction of caspase-3/7. The dissociation constants are in the μM region, but only modest inhibition of binding of MDM2 and MDM4 is required to negate their upregulation because they have to compete with transcriptional coactivator p300 for binding to p53. Binding was weakened by structural changes in LCA, and so it may be a natural ligand of MDM2 and MDM4, raising the possibility that MDM proteins may be sensors for specific steroids. PMID:23035244

Ligand recognition by RAR and RXR receptors: binding and selectivity.

PubMed

Sussman, Fredy; de Lera, Angel R

2005-10-06

Fundamental biological functions, most notably embriogenesis, cell growth, cell differentiation, and cell apoptosis, are in part regulated by a complex genomic network that starts with the binding (and activation) of retinoids to their cognate receptors, members of the superfamily of nuclear receptors. We have studied ligand recognition of retinoic receptors (RXRalpha and RARgamma) using a molecular-mechanics-based docking method. The protocol used in this work is able to rank the affinity of pairs of ligands for a single retinoid receptor, the highest values corresponding to those that adapt better to the shape of the binding site and generate the optimal set of electrostatic and apolar interactions with the receptor. Moreover, our studies shed light onto some of the energetic contributions to retinoid receptor ligand selectivity. In this regard we show that there is a difference in polarity between the binding site regions that anchor the carboxylate in RAR and RXR, which translates itself into large differences in the energy of interaction of both receptors with the same ligand. We observe that the latter energy change is canceled off by the solvation energy penalty upon binding. This energy compensation is borne out as well by experiments that address the effect of site-directed mutagenesis on ligand binding to RARgamma. The hypothesis that the difference in binding site polarity might be exploited to build RXR-selective ligands is tested with some compounds having a thiazolidinedione anchoring group.

Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study

PubMed Central

Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua

2011-01-01

Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570

The effect of Berberine on the secondary structure of human serum albumin

NASA Astrophysics Data System (ADS)

Li, Ying; He, WenYing; Tian, Jianniao; Tang, Jianghong; Hu, Zhide; Chen, Xingguo

2005-05-01

The presence of several high affinity binding sites on human serum albumin (HSA) makes it a possible target for many drugs. This study is designed to examine the effect of Berberine (an ancient Chinese drug used for antimicrobial, antiplasmodial, antidiarrheal and cardiovascular) on the solution structure of HSA using fluorescence, Fourier transform infrared (FT-IR), circular dichroism (CD) spectroscopic methods. The fluorescence spectroscopic results show that the fluorescence intensity of HSA was significantly decreased in the presence of Berberine. The Scatchard's plots indicated that the binding of Berberine to HSA at 296, 303, 318 K is characterized by one binding site with the binding constant is 4.071(±0.128)×10 4, 3.741(±0.089)×10 4, 3.454(±0.110)×10 4 M -1, respectively. The protein conformation is altered (FT-IR and CD data) with reductions of α-helices from 54 to 47% for free HSA to 45-32% and with increases of turn structure5% for free HSA to 18% in the presence of Berberine. The binding process was exothermic, enthalpy driven and spontaneous, as indicated by the thermodynamic analyses, Berberine bound to HSA was mainly based on hydrophobic interaction and electrostatic interaction cannot be excluded from the binding. Furthermore, the displace experiments indicate that Berberine can bind to the subdomain IIA, that is, high affinity site (site II).

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells.

PubMed

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A; Twiss, Jeffery L; Heise, Tilman

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5' untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5' UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality.

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells

PubMed Central

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A.; Twiss, Jeffery L.

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5’ untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5’ UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality. PMID:27224031

Age-related differences in associative memory: the role of sensory decline.

PubMed

Naveh-Benjamin, Moshe; Kilb, Angela

2014-09-01

Numerous studies show age-related decline in episodic memory. One of the explanations for this decline points to older adults' deficit in associative memory, reflecting the difficulties they have in binding features of episodes into cohesive entities and retrieving these bindings. Here, we evaluate the degree to which this deficit may be mediated by sensory loss associated with increased age. In 2 experiments, young adults studied word pairs that were degraded at encoding either visually (Experiment 1) or auditorily (Experiment 2). We then tested their memory for both the component words and the associations with recognition tests. For both experiments, young adults under nondegraded conditions showed an advantage in associative over item memory, relative to a group of older adults. In contrast, under perceptually degraded conditions younger adults performed similarly to the older adults who were tested under nondegraded conditions. More specifically, under perceptual degradation, young adults' associative memory declined and their component memory improved somewhat, resulting in an associative deficit, similar to that shown by older adults. This evidence is consistent with a sensory acuity decline in old age being one mediator in the associative deficit of older adults. These results broaden our understanding of age-related memory changes and how sensory and cognitive processes interact to shape these changes. The theoretical implications of these results are discussed with respect to mechanisms underlying age-related changes in episodic memory and resource tradeoffs in the encoding of component and associative memory. PsycINFO Database Record (c) 2014 APA, all rights reserved.

Contacts between the factor TUF and RPG sequences.

PubMed

Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

1990-08-25

The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

Thermometric sensing of nitrofurantoin by noncovalently imprinted polymers containing two complementary functional monomers.

PubMed

Athikomrattanakul, Umporn; Gajovic-Eichelmann, Nenad; Scheller, Frieder W

2011-10-15

Molecularly imprinted polymers (MIPs) for nitrofurantoin (NFT) recognition addressing in parallel of two complementary functional groups were created using a noncovalent imprinting approach. Specific tailor-made functional monomers were synthesized: a diaminopyridine derivative as the receptor for the imide residue and three (thio)urea derivatives for the interaction with the nitro group of NFT. A significantly improved binding of NFT to the new MIPs was revealed from the imprinting factor, efficiency of binding, affinity constants and maximum binding number as compared to previously reported MIPs, which addressed either the imide or the nitro residue. Substances possessing only one functionality (either the imide group or nitro group) showed significantly weaker binding to the new imprinted polymers than NFT. However, the compounds lacking both functionalities binds extremely weak to all imprinted polymers. The new imprinted polymers were applied in a flow-through thermistor in organic solvent for the first time. The MIP-thermistor allows the detection of NFT down to a concentration of 5 μM in acetonitrile + 0.2% dimethyl sulfoxide (DMSO). The imprinting factor of 3.91 at 0.1 mM of NFT as obtained by thermistor measurements is well comparable to the value obtained by batch binding experiments. © 2011 American Chemical Society

Functional and Selective Bacterial Interfaces Using Cross-Scaffold Gold Binding Peptides

NASA Astrophysics Data System (ADS)

Adams, Bryn L.; Hurley, Margaret M.; Jahnke, Justin P.; Stratis-Cullum, Dimitra N.

2015-11-01

We investigated the functional and selective activity of three phage-derived gold-binding peptides on the Escherichia coli ( E. coli) bacterial cell surface display scaffold (eCPX) for the first time. Gold-binding peptides, p3-Au12 (LKAHLPPSRLPS), p8#9 (VSGSSPDS), and Midas-2 (TGTSVLIATPYV), were compared side-by-side through experiment and simulation. All exhibited strong binding to an evaporated gold film, with approximately a 4-log difference in binding between each peptide and the control sample. The increased affinity for gold was also confirmed by direct visualization of samples using Scanning Electron Microscopy (SEM). Peptide dynamics in solution were performed to analyze innate structure, and all three were found to have a high degree of flexibility. Preferential binding to gold over silicon for all three peptides was demonstrated, with up to four orders of magnitude selectivity exhibited by p3-Au12. The selectivity was also clearly evident through SEM analysis of the boundary between the gold film and silicon substrate. Functional activity of bound E. coli cells was further demonstrated by stimulating filamentation and all three peptides were characterized as prolific relative to control samples. This work shows great promise towards functional and active bacterial-hybrid gold surfaces and the potential to enable the next generation living material interfaces.

Interactions between G-actin and myosin subfragment 1: immunochemical probing of the NH2-terminal segment on actin.

PubMed

DasGupta, G; White, J; Cheung, P; Reisler, E

1990-09-11

The role of the N-terminal segment of actin in myosin-induced polymerization of G-actin was studied by using peptide antibodies directed against the first seven N-terminal residues of alpha-skeletal actin. Light scattering, fluorescence, and analytical ultracentrifugation experiments showed that the Fab fragments of these antibodies inhibited the polymerization of G-actin by myosin subfragment 1 (S-1) by inhibiting the binding of these proteins to each other. Fluorescence measurements using actin labeled with pyrenyliodoacetamide revealed that Fab inhibited the initial step in the binding of S-1 to G-actin. It is deduced from these results and from other literature data that the initial contact between G-actin and S-1 involves residues 1-7 on actin and residues 633-642 on the S-1 heavy chain. This interaction appears to be of major importance for the binding of S-1 and G-actin. The presence of additional myosin contact sites on G-actin was indicated by concentration-dependent recovery of S-1 binding to G-actin without displacement of Fab. The reduced Fab inhibition of S-1 binding to polymerizing and polymerized actin is consistent with the tightening of acto-S-1 binding at these sites or the creation of new sites upon formation of F-actin.

Lead-binding capacity of calcium pectates with different molecular weight.

PubMed

Khotimchenko, Maksim; Makarova, Ksenia; Khozhaenko, Elena; Kovalev, Valeri

2017-04-01

Nowadays, heavy metal contamination of environment is considered as a serious threat to public health because of toxicity of these pollutants and the lack of effective materials with metal-binding properties. Some biopolymers such as pectins were proposed for removal of metal ions from industrial water disposals. Chemical structure of pectins is quite variable and substantially affects their metal binding properties. In this work, relationship between molecular weight and Pb(II)-binding capacity of calcium pectates was investigated in a batch sorption system. The results showed that all pectate samples are able to form complexes with Pb(II) ions. The effects of contact time, pH of the media and equilibrium metal concentration on metal-binding process were tested in experiments. The equilibrium time min required for uptake of Pb(II) by pectate compounds was found to be 60min. Langmuir and Freundlich models were applied for description of interactions between pectates and metal ions. Binding capacity of low molecular pectate was highest among all the samples tested. Langmuir model was figured out to be the best fit within the whole range of pH values. These results demonstrate that calcium pectate with low molecular weight is more promising agent for elimination of Pb(II) ions from contaminated wastewaters. Copyright © 2017 Elsevier B.V. All rights reserved.

Shrimp arginine kinase being a binding protein of WSSV envelope protein VP31

NASA Astrophysics Data System (ADS)

Ma, Cuiyan; Gao, Qiang; Liang, Yan; Li, Chen; Liu, Chao; Huang, Jie

2016-11-01

Viral entry into the host is the earliest stage of infection in the viral life cycle in which attachment proteins play a key role. VP31 (WSV340/WSSV396), an envelope protein of white spot syndrome virus (WSSV), contains an Arg-Gly-Asp (RGD) peptide domain known as a cellular attachment site. At present, the process of VP31 interacting with shrimp host cells has not been explored. Therefore, the VP31 gene was cloned into pET30a (+), expressed in Escherichia coli strain BL21 and purified with immobilized metal ion affinity chromatography. Four gill cellular proteins of shrimp ( Fenneropenaeus chinensis) were pulled down by an affinity column coupled with recombinant VP31 (rVP31), and the amino acid sequences were identified with MALDI-TOF/TOF mass spectrometry. Hemocyanin, beta-actin, arginine kinase (AK), and an unknown protein were suggested as the putative VP31 receptor proteins. SDS-PAGE showed that AK is the predominant binding protein of VP31. An i n vitro binding activity experiment indicated that recombinant AK's (rAK) binding activity with rVP31 is comparable to that with the same amount of WSSV. These results suggested that AK, as a member of the phosphagen kinase family, plays a role in WSSV infection. This is the first evidence showing that AK is a binding protein of VP31. Further studies on this topic will elucidate WSSV infection mechanism in the future.

Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.

PubMed

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-12-01

In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Binding of DNA-bending non-histone proteins destabilizes regular 30-nm chromatin structure

PubMed Central

Bajpai, Gaurav; Jain, Ishutesh; Inamdar, Mandar M.; Das, Dibyendu; Padinhateeri, Ranjith

2017-01-01

Why most of the in vivo experiments do not find the 30-nm chromatin fiber, well studied in vitro, is a puzzle. Two basic physical inputs that are crucial for understanding the structure of the 30-nm fiber are the stiffness of the linker DNA and the relative orientations of the DNA entering/exiting nucleosomes. Based on these inputs we simulate chromatin structure and show that the presence of non-histone proteins, which bind and locally bend linker DNA, destroys any regular higher order structures (e.g., zig-zag). Accounting for the bending geometry of proteins like nhp6 and HMG-B, our theory predicts phase-diagram for the chromatin structure as a function of DNA-bending non-histone protein density and mean linker DNA length. For a wide range of linker lengths, we show that as we vary one parameter, that is, the fraction of bent linker region due to non-histone proteins, the steady-state structure will show a transition from zig-zag to an irregular structure—a structure that is reminiscent of what is observed in experiments recently. Our theory can explain the recent in vivo observation of irregular chromatin having co-existence of finite fraction of the next-neighbor (i + 2) and neighbor (i + 1) nucleosome interactions. PMID:28135276

Utilization of ICP/OES for the determination of trace metal binding to different humic fractions.

PubMed

de la Rosa, G; Peralta-Videa, J R; Gardea-Torresdey, J L

2003-02-28

In this study, the use of inductively coupled plasma/optical emission spectrometry (ICP/OES) to determine multi-metal binding to three biomasses, Sphagnum peat moss, humin and humic acids is reported. All the investigations were performed under part per billion (ppb) concentrations. Batch pH profile experiments were performed using multi-metal solutions of Cd(II), Cu(II), Pb(II), Ni(II), Cr(III) and Cr(VI). The results showed that at pH 2 and 3, the metal affinity of the three biomasses exposed to the multi-metal solution that included Cr(III) presented the following order: Cu(II), Pb(II)>Ni(II)>Cr(III)>Cd(II). On the other hand, when Cr(VI) was in the heavy metal mixture, Sphagnum peat moss and humin showed the following affinity: Cu(II), Pb(II)>Ni(II)>Cr(VI)>Cd(II); however, the affinity of the humic acids was: Cu(II)>Pb(II), Cr(VI)>Ni(II)>Cd(II). The results demonstrated that pH values of 4 and 5 were the most favorable for the heavy metal binding process. At pH 5, all the metals, except for Cr(VI), were bound between 90 and 100% to the three biomasses. However, the binding capacity of humic acids decreased at pH 6 in the presence of Cr(VI). The results showed that the ICP/OES permits the determination of heavy metal binding to organic matter at ppb concentration. These results will be very useful in understanding the role of humic substances in the fate and transport of heavy metals, and thus could provide information to develop new methodologies for the removal of low concentrations of toxic heavy metals from contaminated waters.

The second Cu(II)-binding site in a proton-rich environment interferes with the aggregation of amyloid-beta(1-40) into amyloid fibrils.

PubMed

Jun, Sangmi; Gillespie, Joel R; Shin, Byong-kyu; Saxena, Sunil

2009-11-17

The overall morphology and Cu(II) ion coordination for the aggregated amyloid-beta(1-40) [Abeta(1-40)] in N-ethylmorpholine (NEM) buffer are affected by Cu(II) ion concentration. This effect is investigated by transmission electron microscopy (TEM), atomic force microscopy (AFM), and electron spin echo envelope modulation (ESEEM) spectroscopy. At lower than equimolar concentrations of Cu(II) ions, fibrillar aggregates of Abeta(1-40) are observed. At these concentrations of Cu(II), the monomeric and fibrillar Abeta(1-40) ESEEM data indicate that the Cu(II) ion is coordinated by histidine residues. For aggregated Abeta(1-40) at a Cu(II):Abeta molar ratio of 2:1, TEM and AFM images show both linear fibrils and granular amorphous aggregates. The ESEEM spectra show that the multi-histidine coordination for Cu(II) ion partially breaks up and becomes exposed to water or exchangeable protons of the peptide at a higher Cu(II) concentration. Since the continuous-wave electron spin resonance results also suggest two copper-binding sites in Abeta(1-40), the proton ESEEM peak may arise from the second copper-binding site, which may be significantly involved in the formation of granular amorphous aggregates. Thioflavin T fluorescence and circular dichroism experiments also show that Cu(II) inhibits the formation of fibrils and induces a nonfibrillar beta-sheet conformation. Therefore, we propose that Abeta(1-40) has a second copper-binding site in a proton-rich environment and the second binding Cu(II) ion interferes with a conformational transition into amyloid fibrils, inducing the formation of granular amorphous aggregates.

A novel carbohydrate-binding surface layer protein from the hyperthermophilic archaeon Pyrococcus horikoshii.

PubMed

Goda, Shuichiro; Koga, Tomoyuki; Yamashita, Kenichiro; Kuriura, Ryo; Ueda, Toshifumi

2018-04-08

In Archaea and Bacteria, surface layer (S-layer) proteins form the cell envelope and are involved in cell protection. In the present study, a putative S-layer protein was purified from the crude extract of Pyrococcus horikoshii using affinity chromatography. The S-layer gene was cloned and expressed in Escherichia coli. Isothermal titration calorimetry analyses showed that the S-layer protein bound N-acetylglucosamine and induced agglutination of the gram-positive bacterium Micrococcus lysodeikticus. The protein comprised a 21-mer structure, with a molecular mass of 1,340 kDa, as determined using small-angle X-ray scattering. This protein showed high thermal stability, with a midpoint of thermal denaturation of 79 °C in dynamic light scattering experiments. This is the first description of the carbohydrate-binding archaeal S-layer protein and its characteristics.

Four nucleocytoplasmic-shuttling proteins and p53 interact specifically with the YB-NLS and are involved in anticancer reagent-induced nuclear localization of YB-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Toru; Ohashi, Sachiyo; Kobayashi, Shunsuke

In cancer cells, anticancer reagents often trigger nuclear accumulation of YB-1, which participates in the progression of cancer malignancy. YB-1 has a non-canonical nuclear localization signal (YB-NLS). Here we found that four nucleocytoplasmic-shuttling RNA-binding proteins and p53 interact specifically with the YB-NLS and co-accumulate with YB-1 in the nucleus of actinomycin D-treated cells. To elucidate the roles of these YB-NLS-binding proteins, we performed a dominant-negative experiment in which a large excess of YB-NLS interacts with the YB-NLS-binding proteins, and showed inhibitory effects on actinomycin D-induced nuclear transport of endogenous YB-1 and subsequent MDR1 gene expression. Furthermore, the YB-NLS-expressing cells weremore » also found to show increased drug sensitivity. Our results suggest that these YB-NLS-associating proteins are key factors for nuclear translocation/accumulation of YB-1 in cancer cells. - Highlights: • Four nucleocytoplasmic-shuttling proteins and p53 associate with YB-NLS. • They showed nuclear co-accumulation with YB-1 in actinomycin D-treated cells. • Overexpression of YB-NLS was carried out to take YB-NLS-binding proteins from YB-1. • YB-NLS inhibited actinomycin D-induced nuclear localization of endogenous YB-1. • YB-NLS suppressed actinomycin D-induced expression of MDR1.« less

Nicotinic Receptor Transduction Zone: Invariant Arginine Couples to Multiple Electron-Rich Residues

PubMed Central

Mukhtasimova, Nuriya; Sine, Steven M.

2013-01-01

Summary Gating of the muscle-type acetylcholine receptor (AChR) channel depends on communication between the ACh-binding site and the remote ion channel. A key region for this communication is located within the structural transition zone between the ligand-binding and pore domains. Here, stemming from β-strand 10 of the binding domain, the invariant αArg209 lodges within the hydrophobic interior of the subunit and is essential for rapid and efficient channel gating. Previous charge-reversal experiments showed that the contribution of αArg209 to channel gating depends strongly on αGlu45, also within this region. Here we determine whether the contribution of αArg209 to channel gating depends on additional anionic or electron-rich residues in this region. Also, to reconcile diverging findings in the literature, we compare the dependence of αArg209 on αGlu45 in AChRs from different species, and compare the full agonist ACh with the weak agonist choline. Our findings reveal that the contribution of αArg209 to channel gating depends on additional nearby electron-rich residues, consistent with both electrostatic and steric contributions. Furthermore, αArg209 and αGlu45 show a strong interdependence in both human and mouse AChRs, whereas the functional consequences of the mutation αE45R depend on the agonist. The emerging picture shows a multifaceted network of interdependent residues that are required for communication between the ligand-binding and pore domains. PMID:23442857

Glucose monitoring using a polymer brush modified polypropylene hollow fiber-based hydraulic flow sensor.

PubMed

Fortin, Nicolas; Klok, Harm-Anton

2015-03-04

Tight regulation of blood glucose levels of diabetic patients requires durable and robust continuous glucose sensing schemes. This manuscript reports the fabrication of ultrathin, phenylboronic acid (PBA) functionalized polymer brushes that swell upon glucose binding and which were integrated as the sensing interface in a new polypropylene hollow fiber (PPHF)-based hydraulic flow glucose sensor prototype. The polymer brushes were prepared via surface-initiated atom transfer radical polymerization of sodium methacrylate followed by postpolymerization modification with 3-aminophenyl boronic acid. In a first series of experiments, the glucose-response of PBA-functionalized poly(methacrylic acid) (PMAA) brushes grafted from planar silicon surfaces was investigated by quartz crystal microbalance with dissipation (QCM-D) and atomic force microscopy (AFM) experiments. The QCM-D experiments revealed a more or less linear change of the frequency shift for glucose concentrations up to ∼10 mM and demonstrated that glucose binding was completely reversible for up to seven switching cycles. The AFM experiments indicated that glucose binding was accompanied by an increase in the film thickness of the PBA functionalized PMAA brushes. The PBA functionalized PMAA brushes were subsequently grafted from the surface of PPHF membranes. The hydraulic permeability of these porous fibers depends on the thickness and swelling of the PMAA brush coating. PBA functionalized brush-coated PPHFs showed a decrease in flux upon exposure to glucose, which is consistent with swelling of the brush coating. Because they avoid the use of enzymes and do not rely on an electrochemical transduction scheme, these PPHF-based hydraulic flow sensors could represent an interesting alternative class of continuous glucose sensors.

FRET-based binding assay between a fluorescent cAMP analogue and a cyclic nucleotide-binding domain tagged with a CFP.

PubMed

Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya

2017-09-01

The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.

Towards the elucidation of molecular determinants of cooperativity in the liver bile acid binding protein.

PubMed

Pedò, Massimo; D'Onofrio, Mariapina; Ferranti, Pasquale; Molinari, Henriette; Assfalg, Michael

2009-11-15

Bile acid binding proteins (BABPs) are cytosolic lipid chaperones contributing to the maintenance of bile acid homeostasis and functional distribution within the cell. Liver BABPs act in parallel with ileal transporters to ensure vectorial transport of bile salts in hepatocytes and enterocytes, respectively. We describe the investigation of ligand binding to liver BABP, an essential step in the understanding of intracellular bile salt transport. Binding site occupancies were monitored in NMR titration experiments using (15)N-labelled ligand, while the relative populations of differently bound BABP forms were assessed by mass spectrometry. This site-specific information allowed the determination of intrinsic thermodynamic parameters and the identification of an extremely high cooperativity between two binding sites. Protein-observed NMR experiments revealed a global structural rearrangement which suggests an allosteric mechanism at the basis of the observed cooperativity. The view of a molecular tool capable of buffering against significant concentrations of free bile salts in a large range of solution conditions emerges from the observed pH-dependence of binding. We set to determine the molecular determinants of cooperativity by analysing the binding properties of a protein containing a mutated internal histidine. Both mass spectrometry and NMR experiments are consistent with an overall decreased binding affinity of the mutant, while the measured diffusion coefficients of ligand species reveal that the affinity loss concerns essentially one of the two binding sites. We therefore identified a mutation able to disrupt energetic communication functional to efficient binding and conclude that the buried histidine establishes contacts that stabilize the ternary complex. 2009 Wiley-Liss, Inc.

The cellular RNA-binding protein EAP recognizes a conserved stem-loop in the Epstein-Barr virus small RNA EBER 1.

PubMed Central

Toczyski, D P; Steitz, J A

1993-01-01

EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232

The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding[W][OA

PubMed Central

Cesari, Stella; Thilliez, Gaëtan; Ribot, Cécile; Chalvon, Véronique; Michel, Corinne; Jauneau, Alain; Rivas, Susana; Alaux, Ludovic; Kanzaki, Hiroyuki; Okuyama, Yudai; Morel, Jean-Benoit; Fournier, Elisabeth; Tharreau, Didier; Terauchi, Ryohei; Kroj, Thomas

2013-01-01

Resistance (R) proteins recognize pathogen avirulence (Avr) proteins by direct or indirect binding and are multidomain proteins generally carrying a nucleotide binding (NB) and a leucine-rich repeat (LRR) domain. Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia, indicating that the corresponding R proteins possess dual recognition specificity. For RGA5, two alternative transcripts, RGA5-A and RGA5-B, were identified. Genetic analysis showed that only RGA5-A confers resistance, while RGA5-B is inactive. Yeast two-hybrid, coimmunoprecipitation, and fluorescence resonance energy transfer–fluorescence lifetime imaging experiments revealed direct binding of AVR-Pia and AVR1-CO39 to RGA5-A, providing evidence for the recognition of multiple Avr proteins by direct binding to a single R protein. Direct binding seems to be required for resistance as an inactive AVR-Pia allele did not bind RGA5-A. A small Avr interaction domain with homology to the Avr recognition domain in the rice R protein Pik-1 was identified in the C terminus of RGA5-A. This reveals a mode of Avr protein recognition through direct binding to a novel, non-LRR interaction domain. PMID:23548743

A simple and efficient method to enhance audiovisual binding tendencies

PubMed Central

Wozny, David R.; Shams, Ladan

2017-01-01

Individuals vary in their tendency to bind signals from multiple senses. For the same set of sights and sounds, one individual may frequently integrate multisensory signals and experience a unified percept, whereas another individual may rarely bind them and often experience two distinct sensations. Thus, while this binding/integration tendency is specific to each individual, it is not clear how plastic this tendency is in adulthood, and how sensory experiences may cause it to change. Here, we conducted an exploratory investigation which provides evidence that (1) the brain’s tendency to bind in spatial perception is plastic, (2) that it can change following brief exposure to simple audiovisual stimuli, and (3) that exposure to temporally synchronous, spatially discrepant stimuli provides the most effective method to modify it. These results can inform current theories about how the brain updates its internal model of the surrounding sensory world, as well as future investigations seeking to increase integration tendencies. PMID:28462016

An Undergraduate Laboratory Experiment that Utilizes a Glass Fiber Filter Assay to Determine the Steroid Specificity and Equilibrium Binding Properties of Glucocorticoid Receptors.

ERIC Educational Resources Information Center

John, Nancy J.; Firestone, Gary L.

1987-01-01

Describes two complementary laboratory exercises that use the glass fiber assay to assess receptor specificity and hormone binding affinity in rat liver cytoplasmic extracts. Details the methods, materials and protocol of the experiments. Discusses the basic concepts illustrated and the feasibility of using the experiments at the undergraduate…

Reversible surface binding of cadmium and lead by lactic acid and bifidobacteria.

PubMed

Teemu, Halttunen; Seppo, Salminen; Jussi, Meriluoto; Raija, Tahvonen; Kalle, Lertola

2008-07-15

Extensive cadmium and lead contamination of water has been reported to occur locally as a result of human activities. Lactic acid bacteria have been reported to remove cadmium and lead from water. The aim of this work was to clarify the mechanisms of cadmium and lead removal from water. In addition, the effect of other metals, reversibility of binding and recyclability of the biomass was assessed. Based on our earlier data, the two most promising lactic acid bacteria, Lactobacillus fermentum ME3 and Bifidobacterium longum 46, were selected for these experiments. The results showed that the presence of other cationic metals and blocking of carboxyl and phosphoryl groups reduced cadmium and lead removal. These results suggest involvement of electrostatic interactions in cadmium and lead removal, and support our earlier findings. Transmission electron micrographs showed large deposits of lead on the bacterial surface suggesting formation of metallic lead precipitates. Both cadmium and lead removal were reversible processes established by full recovery of removed metal after desorption with dilute solutions of EDTA and HNO(3). Resorption capacity of both biomasses tested was reduced after regeneration with 10 mM EDTA and 15 mM HNO(3). Taken together, the results suggest involvement of several reversible mechanisms such as ion exchange and precipitation in cadmium and lead binding by lactic acid bacteria. The results show that specific lactic acid bacteria have the potential for removal of cadmium and lead from water although reduction in resorption capacity after regeneration of the biomass may form a problem. Since the studies so far have mainly focused on removal of single metals from pure water, metal removal in conditions of natural waters should be assessed in further experiments.

From small sweeteners to sweet proteins: anatomy of the binding sites of the human T1R2_T1R3 receptor.

PubMed

Morini, Gabriella; Bassoli, Angela; Temussi, Piero A

2005-08-25

The sweet taste receptor, a heterodimeric G protein coupled receptor (GPCR) protein, formed by the T1R2 and T1R3 subunits, recognizes several sweet compounds including carbohydrates, amino acids, peptides, proteins, and synthetic sweeteners. Its similarity with the metabotropic glutamate mGluR1 receptor allowed us to build homology models. All possible dimers formed by combinations of the human T1R2 and T1R3 subunits, modeled on the A (closed) or B (open) chains of the extracellular ligand binding domain of the mGluR1 template, yield four ligand binding sites for low-molecular-weight sweeteners. These sites were probed by docking a set of molecules representative of all classes of sweet compounds and calculating the free energy of ligand binding. These sites are not easily accessible to sweet proteins, but docking experiments in silico showed that sweet proteins can bind to a secondary site without entering the deep cleft. Our models account for many experimental observations on the tastes of sweeteners, including sweetness synergy, and can help to design new sweeteners.

Interaction between the phage HK022 Nun protein and the nut RNA of phage lambda.

PubMed

Chattopadhyay, S; Hung, S C; Stuart, A C; Palmer, A G; Garcia-Mena, J; Das, A; Gottesman, M E

1995-12-19

The nun gene product of prophage HK022 excludes phage lambda infection by blocking the expression of genes downstream from the lambda nut sequence. The Nun protein functions both by competing with lambda N transcription-antitermination protein and by actively inducing transcription termination on the lambda chromosome. We demonstrate that Nun binds directly to a stem-loop structure within nut RNA, boxB, which is also the target for the N antiterminator. The two proteins show comparable affinities for boxB and they compete with each other. Their interactions with boxB are similar, as shown by RNase protection experiments, NMR spectroscopy, and analysis of boxB mutants. Each protein binds the 5' strand of the boxB stem and the adjacent loop. The stem does not melt upon the binding of Nun or N, as the 3' strand remains sensitive to a double-strand-specific RNase. The binding of RNA partially protects Nun from proteolysis and changes its NMR spectra. Evidently, although Nun and N bind to the same surface of boxB RNA, their respective complexes interact differently with RNA polymerase, inducing transcription termination or antitermination, respectively.

Gold Binding by Native and Chemically Modified Hops Biomasses

PubMed Central

López, M. Laura; Peralta-Videa, J. R.; de la Rosa, G.; Armendáriz, V.; Herrera, I.; Troiani, H.; Henning, J.

2005-01-01

Heavy metals from mining, smelting operations and other industrial processing facilities pollute wastewaters worldwide. Extraction of metals from industrial effluents has been widely studied due to the economic advantages and the relative ease of technical implementation. Consequently, the search for new and improved methodologies for the recovery of gold has increased. In this particular research, the use of cone hops biomass (Humulus lupulus) was investigated as a new option for gold recovery. The results showed that the gold binding to native hops biomass was pH dependent from pH 2 to pH 6, with a maximum percentage binding at pH 3. Time dependency studies demonstrated that Au(III) binding to native and modified cone hops biomasses was found to be time independent at pH 2 while at pH 5, it was time dependent. Capacity experiments demonstrated that at pH 2, esterified hops biomass bound 33.4 mg Au/g of biomass, while native and hydrolyzed hops biomasses bound 28.2 and 12.0 mg Au/g of biomass, respectively. However, at pH 5 the binding capacities were 38.9, 37.8 and 11.4 mg of Au per gram of native, esterified and hydrolyzed hops biomasses, respectively. PMID:18365087

Chemical modification of protein A chromatography ligands with polyethylene glycol. I: Effects on IgG adsorption equilibrium, kinetics, and transport.

PubMed

Weinberg, Justin; Zhang, Shaojie; Crews, Gillian; Carta, Giorgio; Przybycien, Todd

2018-04-20

Chemical modification of Protein A (ProA) chromatography ligands with polyethylene glycol (PEGylation) has been proposed as a strategy to increase the process selectivity and resin robustness by providing the ligand with a steric repulsion barrier against non-specific binding. This article comprises a comprehensive study of IgG adsorption and transport in Repligen CaptivA PriMAB resin with PEGylated ProA ligands that are modified using 5.2 and 21.5 kDa PEG chains. We studied the impact of the molecular weight of the PEG as well as the extent of PEGylation for the 5.2 kDa PEG modification. In all cases, PEGylation of ProA ligands decreases the resin average pore size, particle porosity, and static binding capacity for IgG proportional to the volume of conjugated PEG in the resin. Resin batch uptake experiments conducted in bulk via a stirred-tank system and with individual resin particles under confocal laser scanning microscopy suggests that PEGylation introduces heterogeneity into IgG binding kinetics: a fraction of the IgG binding sites are transformed from typical fast association kinetic behavior to slow kinetic behavior. pH gradient elution experiments of an IgG molecule on the modified resins show an increase in IgG elution pH for all modified resins, implying a decrease in IgG-ProA binding affinity on modification. Despite losses in static binding capacity for all resins with PEGylated ligands, the loss of dynamic binding capacity at 10% breakthrough (DBC 10% ) ranged more broadly from almost 0-47% depending on the PEG molecular weight and the extent of PEGylation. Minimal losses in DBC 10% were observed with a low extent of PEGylation with a smaller molecular weight PEG, while higher losses were observed at higher extents of PEGylation and with higher molecular weight PEG due to decreased static binding capacity and increased mass transfer resistance. This work provides insight into the practical implications for resin performance if PEGylation is considered as a strategy for selectivity enhancement in affinity chromatography with macromolecular ligands. Copyright © 2018 Elsevier B.V. All rights reserved.

A high pressure study of calmodulin-ligand interactions using small-angle X-ray and elastic incoherent neutron scattering.

PubMed

Cinar, Süleyman; Al-Ayoubi, Samy; Sternemann, Christian; Peters, Judith; Winter, Roland; Czeslik, Claus

2018-01-31

Calmodulin (CaM) is a Ca 2+ sensor and mediates Ca 2+ signaling through binding of numerous target ligands. The binding of ligands by Ca 2+ -saturated CaM (holo-CaM) is governed by attractive hydrophobic and electrostatic interactions that are weakened under high pressure in aqueous solutions. Moreover, the potential formation of void volumes upon ligand binding creates a further source of pressure sensitivity. Hence, high pressure is a suitable thermodynamic variable to probe protein-ligand interactions. In this study, we compare the binding of two different ligands to holo-CaM as a function of pressure by using X-ray and neutron scattering techniques. The two ligands are the farnesylated hypervariable region (HVR) of the K-Ras4B protein, which is a natural binding partner of holo-CaM, and the antagonist trifluoperazine (TFP), which is known to inhibit holo-CaM activity. From small-angle X-ray scattering experiments performed up to 3000 bar, we observe a pressure-induced partial unfolding of the free holo-CaM in the absence of ligands, where the two lobes of the dumbbell-shaped protein are slightly swelled. In contrast, upon binding TFP, holo-CaM forms a closed globular conformation, which is pressure stable at least up to 3000 bar. The HVR of K-Ras4B shows a different binding behavior, and the data suggest the dissociation of the holo-CaM/HVR complex under high pressure, probably due to a less dense protein contact of the HVR as compared to TFP. The elastic incoherent neutron scattering experiments corroborate these findings. Below 2000 bar, pressure induces enhanced atomic fluctuations in both holo-CaM/ligand complexes, but those of the holo-CaM/HVR complex seem to be larger. Thus, the inhibition of holo-CaM by TFP is supported by a low-volume ligand binding, albeit this is not associated with a rigidification of the complex structure on the sub-ns Å-scale.

Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

PubMed

Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

2011-11-14

The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

The complexity of minocycline serum protein binding.

PubMed

Zhou, Jian; Tran, Brian T; Tam, Vincent H

2017-06-01

Serum protein binding is critical for understanding the pharmacology of antimicrobial agents. Tigecycline and eravacycline were previously reported to have atypical non-linear protein binding; the percentage of free fraction decreased with increasing total concentration. In this study, we extended the investigation to other tetracyclines and examined the factors that might impact protein binding. Different minocycline concentrations (0.5-50 mg/L) and perfusion media (saline, 0.1 M HEPES buffer and 0.1 and 1 M PBS) were examined by in vitro microdialysis. After equilibration, two dialysate samples were taken from each experiment and the respective antimicrobial agent concentrations were analysed by validated LC-MS/MS methods. For comparison, the serum protein bindings of doxycycline and levofloxacin were also determined. The free fraction of minocycline decreased with increasing total concentration, and the results depended on the perfusion media used. The trends of minocycline protein binding in mouse and human sera were similar. In addition, serum protein binding of doxycycline showed the same concentration-dependent trend as minocycline, while the results of levofloxacin were concentration independent. The serum protein bindings of minocycline and doxycycline are negatively correlated with their total concentrations. It is possible that all tetracyclines share the same pharmacological property. Moreover, the specific perfusion media used could also impact the results of microdialysis. Additional studies are warranted to understand the mechanism(s) and clinical implications of serum protein binding of tetracyclines. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Native Hydrophobic Binding Interactions at the Transition State for Association between the TAZ1 Domain of CBP and the Disordered TAD-STAT2 Are Not a Requirement.

PubMed

Lindström, Ida; Dogan, Jakob

2017-08-15

A significant fraction of the eukaryotic proteome consists of proteins that are either partially or completely disordered under native-like conditions. Intrinsically disordered proteins (IDPs) are common in protein-protein interactions and are involved in numerous cellular processes. Although many proteins have been identified as disordered, much less is known about the binding mechanisms of the coupled binding and folding reactions involving IDPs. Here we have analyzed the rate-limiting transition state for binding between the TAZ1 domain of CREB binding protein and the intrinsically disordered transactivation domain of STAT2 (TAD-STAT2) by site-directed mutagenesis and kinetic experiments (Φ-value analysis) and found that the native protein-protein binding interface is not formed at the transition state for binding. Instead, native hydrophobic binding interactions form late, after the rate-limiting barrier has been crossed. The association rate constant in the absence of electrostatic enhancement was determined to be rather high. This is consistent with the Φ-value analysis, which showed that there are few or no obligatory native contacts. Also, linear free energy relationships clearly demonstrate that native interactions are cooperatively formed, a scenario that has usually been observed for proteins that fold according to the so-called nucleation-condensation mechanism. Thus, native hydrophobic binding interactions at the rate-limiting transition state for association between TAD-STAT2 and TAZ1 are not a requirement, which is generally in agreement with previous findings on other IDP systems and might be a common mechanism for IDPs.

Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing.

PubMed

Morozov, Giora I; Zhao, Huaying; Mage, Michael G; Boyd, Lisa F; Jiang, Jiansheng; Dolan, Michael A; Venna, Ramesh; Norcross, Michael A; McMurtrey, Curtis P; Hildebrand, William; Schuck, Peter; Natarajan, Kannan; Margulies, David H

2016-02-23

Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8(+) T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities of TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.

Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morozov, Giora I.; Zhao, Huaying; Mage, Michael G.

Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8 + T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities ofmore » TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.« less

Unmatter Plasma revisited

NASA Astrophysics Data System (ADS)

Smarandache, Florentin

2017-10-01

Unmmatter Plasma is a novel form of plasma, exclusively made of matter and its antimatter counterpart. The electron-positron beam plasma was generated in the laboratory in the beginning of 2015. This experimental fact shows that unmatter, a new form of matter that is formed by matter and antimatter bind together (mathematically predicted since 2004) really exists. That is the electron-positron plasma experiment of 2015 is the experimentum crucis verifying the mathematically predicted unmatter. Unmatter is formed by combinations of matter and antimatter that bind together, or by long-range mixture of matter and antimatter forming a weakly-coupled phase. Binding and bound state means that the interaction is sufficiently strong to tie together the particles of a system, therefore hindering them from becoming free. For example, a usual liquid is a bound state of molecules, while a gas is an un-bounded where the molecules can move freely in successive collisions.

Synthesis of native-like crosslinked duplex RNA and study of its properties.

PubMed

Onizuka, Kazumitsu; Hazemi, Madoka E; Thomas, Justin M; Monteleone, Leanna R; Yamada, Ken; Imoto, Shuhei; Beal, Peter A; Nagatsugi, Fumi

2017-04-01

A variety of enzymes have been found to interact with double-stranded RNA (dsRNA) in order to carry out its functions. We have endeavored to prepare the covalently crosslinked native-like duplex RNA, which could be useful for biochemical studies and RNA nanotechnology. In this study, the interstrand covalently linked duplex RNA was formed by a crosslinking reaction between vinylpurine (VP) and the target cytosine or uracil in RNA. We measured melting temperatures and CD spectra to identify the properties of the VP crosslinked duplex RNA. The crosslinking formation increased the thermodynamic stability without disturbing the natural conformation of dsRNA. In addition, a competitive binding experiment with the duplex RNA binding enzyme, ADAR2, showed the crosslinked dsRNA bound the protein with nearly the same binding affinity as the natural dsRNA, confirming that it has finely preserved the natural traits of duplex RNA. Copyright © 2017. Published by Elsevier Ltd.

Extreme disorder in an ultrahigh-affinity protein complex

NASA Astrophysics Data System (ADS)

Borgia, Alessandro; Borgia, Madeleine B.; Bugge, Katrine; Kissling, Vera M.; Heidarsson, Pétur O.; Fernandes, Catarina B.; Sottini, Andrea; Soranno, Andrea; Buholzer, Karin J.; Nettels, Daniel; Kragelund, Birthe B.; Best, Robert B.; Schuler, Benjamin

2018-03-01

Molecular communication in biology is mediated by protein interactions. According to the current paradigm, the specificity and affinity required for these interactions are encoded in the precise complementarity of binding interfaces. Even proteins that are disordered under physiological conditions or that contain large unstructured regions commonly interact with well-structured binding sites on other biomolecules. Here we demonstrate the existence of an unexpected interaction mechanism: the two intrinsically disordered human proteins histone H1 and its nuclear chaperone prothymosin-α associate in a complex with picomolar affinity, but fully retain their structural disorder, long-range flexibility and highly dynamic character. On the basis of closely integrated experiments and molecular simulations, we show that the interaction can be explained by the large opposite net charge of the two proteins, without requiring defined binding sites or interactions between specific individual residues. Proteome-wide sequence analysis suggests that this interaction mechanism may be abundant in eukaryotes.

Self-Reference Acts as a Golden Thread in Binding.

PubMed

Sui, Jie

2016-07-01

In a recent article in this journal, Glyn Humphreys and I proposed a model of how self-reference enhances binding in perception and cognition [1]. We showed that self-reference changes particular functional processes; notably, self-reference increases binding between the features of stimuli and between different stages of processing. Lane and colleagues [2] provide an interesting comment on our article that suggests our theory of self-reference is compatible with Dennett's philosophical perspective on the narrative nature of the self. Although the nature of the self has attracted the attention of both philosophers and scientists, the two disciplines have generated different perspectives on the functions of the self, largely due to their different methodologies. For example, Dennett argues that the self is constituted through human narration on experience [3]. By contrast, work from psychologists and cognitive neuroscientists focuses on the functional and neural mechanisms of self-reference. Copyright © 2016 Elsevier Ltd. All rights reserved.

The role of van der Waals interaction in the tilted binding of amine molecules to the Au(111) surface

NASA Astrophysics Data System (ADS)

Le, Duy; Aminpour, Maral; Kiejna, Adam; Rahman, Talat S.

2012-06-01

We present the results of ab initio electronic structure calculations for the adsorption characteristics of three amine molecules on Au(111), which show that the inclusion of van der Waals interactions between the isolated molecule and the surface leads in general to good agreement with experimental data on the binding energies. Each molecule, however, adsorbs with a small tilt angle (between -5 and 9°). For the specific case of 1,4-diaminobenzene (BDA) our calculations reproduce the larger tilt angle (close to 24°) measured by photoemission experiments, when intermolecular (van der Waals) interactions (for about 8% coverage) are included. These results point not only to the important contribution of van der Waals interactions to molecule-surface binding energy, but also that of intermolecular interactions, often considered secondary to that between the molecule and the surface, in determining the adsorption geometry and pattern formation.

The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.

PubMed

Higashitsuji, Hiroaki; Higashitsuji, Hisako; Itoh, Katsuhiko; Sakurai, Toshiharu; Nagao, Toshikazu; Sumitomo, Yasuhiko; Sumitomo, Haruhiko; Masuda, Tomoko; Dawson, Simon; Shimada, Yutaka; Mayer, R John; Fujita, Jun

2005-07-01

Gankyrin is an ankyrin repeat oncoprotein commonly overexpressed in hepatocellular carcinomas. Gankyrin interacts with the S6 proteasomal ATPase and accelerates the degradation of the tumor suppressor Rb. We show here that gankyrin has an antiapoptotic activity in cells exposed to DNA damaging agents. Downregulation of gankyrin induces apoptosis in cells with wild-type p53. In vitro and in vivo experiments revealed that gankyrin binds to Mdm2, facilitating p53-Mdm2 binding, and increases ubiquitylation and degradation of p53. Gankyrin also enhances Mdm2 autoubiquitylation in the absence of p53. Downregulation of gankyrin reduced amounts of Mdm2 and p53 associated with the 26S proteasome. Thus, gankyrin is a cofactor that increases the activities of Mdm2 on p53 and probably targets polyubiquitylated p53 into the 26S proteasome.

Interaction of TAPBPR, a tapasin homolog, with MHC-I molecules promotes peptide editing

DOE PAGES

Morozov, Giora I.; Zhao, Huaying; Mage, Michael G.; ...

2016-02-11

Peptide loading of major histocompatibility complex class I (MHC-I) molecules is central to antigen presentation, self-tolerance, and CD8 + T-cell activation. TAP binding protein, related (TAPBPR), a widely expressed tapasin homolog, is not part of the classical MHC-I peptide-loading complex (PLC). Using recombinant MHC-I molecules, we show that TAPBPR binds HLA-A*02:01 and several other MHC-I molecules that are either peptide-free or loaded with low-affinity peptides. Fluorescence polarization experiments establish that TAPBPR augments peptide binding by MHC-I. The TAPBPR/MHC-I interaction is reversed by specific peptides, related to their affinity. Mutational and small-angle X-ray scattering (SAXS) studies confirm the structural similarities ofmore » TAPBPR with tapasin. These results support a role of TAPBPR in stabilizing peptide-receptive conformation(s) of MHC-I, permitting peptide editing.« less

Dynein's Network of Chemomechanical Motor Cycles

NASA Astrophysics Data System (ADS)

Shen, Weibo; Wang, Ziqing; Wang, Guodong

2012-07-01

An eight-state network model of dynein's chemomechanical motor cycles is developed, in which the states of an effective single dynein head are represented by the number of ATP binding at the primary site and the number of ATP binding at other three secondary sites. The binding and unbinding of ATP, as well as the hydrolysis of ATP and the reverse process, are characterized by transition rates between certain states. Our results show that the stall force of dynein increases fast with ATP up to 1 mM ATP, beyond which it increases slowly to a saturated value, and that load and ATP concentration can adjust the step size of dynein, i.e., dynein can shift gears according to conditions. These results are in agreement with experiments [R. Mallik, B. C. Carter, S. A. Lex, S. J. King and S. P. Gross, Nature 427, 649 (2004)].

Fluorescent studies on the interaction of DNA and ternary lanthanide complexes with cinnamic acid-phenanthroline and antibacterial activities testing.

PubMed

Sun, Hui-Juan; Wang, Ai-Ling; Chu, Hai-Bin; Zhao, Yong-Liang

2015-03-01

Twelve lanthanide complexes with cinnamate (cin(-) ) and 1,10-phenanthroline (phen) were synthesized and characterized. Their compositions were assumed to be RE(cin)3 phen (RE(3+)  = La(3+) , Pr(3+) , Nd(3+) , Sm(3+) , Eu(3+) , Gd(3+) , Tb(3+) , Dy(3+) , Ho(3+) , Tm(3+) , Yb(3+) , Lu(3+) ). The interaction mode between the complexes and DNA was investigated by fluorescence quenching experiment. The results indicated the complexes could bind to DNA and the main binding mode is intercalative binding. The fluorescence quenching constants of the complexes increased from La(cin)3 phen to Lu(cin)3 phen. Additionally, the antibacterial activity testing showed that the complexes exhibited excellent antibacterial ability against Escherichia coli, and the changes of antibacterial ability are in agreement with that of the fluorescence quenching constants. Copyright © 2014 John Wiley & Sons, Ltd.

Synthesis and crystal structure determination of copper(II)-complex: In vitro DNA and HSA binding, pBR322 plasmid cleavage, cell imaging and cytotoxic studies.

PubMed

Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh

2014-08-18

New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

The role of attention in item-item binding in visual working memory.

PubMed

Peterson, Dwight J; Naveh-Benjamin, Moshe

2017-09-01

An important yet unresolved question regarding visual working memory (VWM) relates to whether or not binding processes within VWM require additional attentional resources compared with processing solely the individual components comprising these bindings. Previous findings indicate that binding of surface features (e.g., colored shapes) within VWM is not demanding of resources beyond what is required for single features. However, it is possible that other types of binding, such as the binding of complex, distinct items (e.g., faces and scenes), in VWM may require additional resources. In 3 experiments, we examined VWM item-item binding performance under no load, articulatory suppression, and backward counting using a modified change detection task. Binding performance declined to a greater extent than single-item performance under higher compared with lower levels of concurrent load. The findings from each of these experiments indicate that processing item-item bindings within VWM requires a greater amount of attentional resources compared with single items. These findings also highlight an important distinction between the role of attention in item-item binding within VWM and previous studies of long-term memory (LTM) where declines in single-item and binding test performance are similar under divided attention. The current findings provide novel evidence that the specific type of binding is an important determining factor regarding whether or not VWM binding processes require attention. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Great interactions: How binding incorrect partners can teach us about protein recognition and function.

PubMed

Vamparys, Lydie; Laurent, Benoist; Carbone, Alessandra; Sacquin-Mora, Sophie

2016-10-01

Protein-protein interactions play a key part in most biological processes and understanding their mechanism is a fundamental problem leading to numerous practical applications. The prediction of protein binding sites in particular is of paramount importance since proteins now represent a major class of therapeutic targets. Amongst others methods, docking simulations between two proteins known to interact can be a useful tool for the prediction of likely binding patches on a protein surface. From the analysis of the protein interfaces generated by a massive cross-docking experiment using the 168 proteins of the Docking Benchmark 2.0, where all possible protein pairs, and not only experimental ones, have been docked together, we show that it is also possible to predict a protein's binding residues without having any prior knowledge regarding its potential interaction partners. Evaluating the performance of cross-docking predictions using the area under the specificity-sensitivity ROC curve (AUC) leads to an AUC value of 0.77 for the complete benchmark (compared to the 0.5 AUC value obtained for random predictions). Furthermore, a new clustering analysis performed on the binding patches that are scattered on the protein surface show that their distribution and growth will depend on the protein's functional group. Finally, in several cases, the binding-site predictions resulting from the cross-docking simulations will lead to the identification of an alternate interface, which corresponds to the interaction with a biomolecular partner that is not included in the original benchmark. Proteins 2016; 84:1408-1421. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.

The Phosphorylation of Vascular Endothelial Growth Factor Receptor-2 (VEGFR-2) by Engineered Surfaces with Electrostatically or Covalently Immobilized VEGF

PubMed Central

Anderson, Sean M.; Chen, Tom T.; Iruela-Arispe, M. Luisa; Segura, Tatiana

2010-01-01

Growth factors are a class of signaling proteins that direct cell fate through interaction with cell surface receptors. Although a myriad of possible cell fates stem from a growth factor binding to its receptor, the signaling cascades that result in one fate over another are still being elucidated. One possible mechanism by which nature modulates growth factor signaling is through the method of presentation of the growth factor – soluble or immobilized (matrix bound). Here we present the methodology to study signaling of soluble versus immobilized VEGF through VEGFR-2. We have designed a strategy to covalently immobilize VEGF using its heparin-binding domain to orient the molecule (bind) and a secondary functional group to mediate covalent binding (lock). This bind-and-lock approach aims to allow VEGF to assume a bioactive orientation before covalent immobilization. Surface plasmon resonance (SPR) demonstrated heparin and VEGF binding with surface densities of 60 ng/cm2 and 100 pg/cm2, respectively. ELISA experiments confirmed VEGF surface density and showed that electrostatically bound VEGF releases in cell medium and heparin solutions while covalently bound VEGF remains immobilized. Electrostatically bound VEGF and covalently bound VEGF phosphorylate VEGFR-2 in both VEGFR-2 transfected cells and VEGFR-2 endogenously producing cells. HUVECs plated on VEGF functionalized surfaces showed different morphologies between surface-bound VEGF and soluble VEGF. The surfaces synthesized in these studies allow for the study of VEGF/VEGFR-2 signaling induced by covalently bound, electrostatically bound, and soluble VEGF and may provide further insight into the design of materials for the generation of a mature and stable vasculature. PMID:19540581

In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

PubMed

Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

2018-01-01

DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

Using new hetero-spectral two-dimensional correlation analyses and synchrotron-radiation-based spectromicroscopy to characterize binding of Cu to soil dissolved organic matter.

PubMed

Sun, Fusheng; Li, Yaqing; Wang, Xiang; Chi, Zhilai; Yu, Guanghui

2017-04-01

Understanding the binding characteristics of copper (Cu) to different functional groups in soil dissolved organic matter (DOM) is important to explore Cu toxicity, bioavailability and ultimate fate in the environment. However, the methods used to explore such binding characteristics are still limited. Here, two-dimensional correlation spectroscopy (2DCOS) integrated with Fourier transform infrared (FTIR), 29 Si nuclear magnetic resonance (NMR), 27 Al NMR, and synchrotron-radiation-based FTIR spectromicroscopy were used to explore the binding characteristics of Cu to soil DOM as part of a long-term (23 years) fertilization experiment. Compared with no fertilization and inorganic fertilization (NPK), long-term pig manure fertilization (M) treatment significantly increased the concentration of total and bioavailable Cu in soils. Furthermore, hetero-spectral 2DCOS analyses demonstrated that the binding characteristics of Cu onto functional groups in soil DOM were modified by fertilization regimes. In the NPK treatment, Cu was bound to aliphatic C, whereas in the manure treatment SiO groups had higher affinity toward Cu than aliphatic C. Also, the sequence of binding of functional groups to Cu was modified by the fertilization treatments. Moreover, synchrotron-radiation-based FTIR spectromicroscopy showed that Cu, clay minerals and sesquioxides, and C functional groups were heterogeneously distributed at the micro-scale. Specifically, clay-OH as well as mineral elements had a distribution pattern similar to Cu, but certain (but not all) C forms showed a distribution pattern inconsistent with that of Cu. The combination of synchrotron radiation spectromicroscopy and 2DCOS is a useful tool in exploring the interactions among heavy metals, minerals and organic components in soils. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Role of Genome Accessibility in Transcription Factor Binding in Bacteria.

PubMed

Gomes, Antonio L C; Wang, Harris H

2016-04-01

ChIP-seq enables genome-scale identification of regulatory regions that govern gene expression. However, the biological insights generated from ChIP-seq analysis have been limited to predictions of binding sites and cooperative interactions. Furthermore, ChIP-seq data often poorly correlate with in vitro measurements or predicted motifs, highlighting that binding affinity alone is insufficient to explain transcription factor (TF)-binding in vivo. One possibility is that binding sites are not equally accessible across the genome. A more comprehensive biophysical representation of TF-binding is required to improve our ability to understand, predict, and alter gene expression. Here, we show that genome accessibility is a key parameter that impacts TF-binding in bacteria. We developed a thermodynamic model that parameterizes ChIP-seq coverage in terms of genome accessibility and binding affinity. The role of genome accessibility is validated using a large-scale ChIP-seq dataset of the M. tuberculosis regulatory network. We find that accounting for genome accessibility led to a model that explains 63% of the ChIP-seq profile variance, while a model based in motif score alone explains only 35% of the variance. Moreover, our framework enables de novo ChIP-seq peak prediction and is useful for inferring TF-binding peaks in new experimental conditions by reducing the need for additional experiments. We observe that the genome is more accessible in intergenic regions, and that increased accessibility is positively correlated with gene expression and anti-correlated with distance to the origin of replication. Our biophysically motivated model provides a more comprehensive description of TF-binding in vivo from first principles towards a better representation of gene regulation in silico, with promising applications in systems biology.

Opposing intermolecular tuning of Ca2+ affinity for Calmodulin by its target peptides

NASA Astrophysics Data System (ADS)

Cheung, Margaret

We investigated the impact of bound calmodulin (CaM)-target compound structure on the affinity of calcium (Ca2+) by integrating coarse-grained models and all-atomistic simulations with non-equilibrium physics. We focused on binding between CaM and two specific targets, Ca2+/CaM-dependent protein kinase II (CaMKII) and neurogranin (Ng), as they both regulate CaM-dependent Ca2+ signaling pathways in neurons. It was shown experimentally that Ca2+/CaM binds to the CaMKII peptide with higher affinity than the Ng peptide. The binding of CaMKII peptide to CaM in return increases the Ca2+ affinity for CaM. However, this reciprocal relation was not observed in the Ng peptide, which binds to Ca2+-free CaM or Ca2+/CaM with similar binding affinity. Unlike CaM-CaMKII peptide that allowed structure determination by crystallography, the structural description of CaM-Ng peptide is unknown due to low binding affinity, therefore, we computationally generated an ensemble of CaM-Ng peptide structures by matching the changes in the chemical shifts of CaM upon Ng peptide binding from nuclear magnetic resonance experiments. We computed the changes in Ca2+ affinity for CaM with and without binding targets in atomistic models using Jarzynski's equality. We discovered the molecular underpinnings of lowered affinity of Ca2+ for CaM in the presence of Ng by showing that the N-terminal acidic region of Ng peptide pries open the β-sheet structure between the Ca2+ binding loops particularly at C-domain of CaM, enabling Ca2+release. In contrast, CaMKII increases Ca2+ affinity for the C-domain of CaM by stabilizing the two Ca2+ binding loops.

Myopodin is an F-actin bundling protein with multiple independent actin-binding regions.

PubMed

Linnemann, Anja; Vakeel, Padmanabhan; Bezerra, Eduardo; Orfanos, Zacharias; Djinović-Carugo, Kristina; van der Ven, Peter F M; Kirfel, Gregor; Fürst, Dieter O

2013-02-01

The assembly of striated muscle myofibrils is a multistep process in which a variety of proteins is involved. One of the first and most important steps in myofibrillogenesis is the arrangement of thin myofilaments into ordered I-Z-I brushes, requiring the coordinated activity of numerous actin binding proteins. The early expression of myopodin prior to sarcomeric α-actinin, as well as its binding to actin, α-actinin and filamin indicate an important role for this protein in actin cytoskeleton remodelling with the precise function of myopodin in this process yet remaining to be resolved. While myopodin was previously described as a protein capable of cross-linking actin filaments into thick bundles upon transient transfections, it has remained unclear whether myopodin alone is capable of bundling actin, or if additional proteins are involved. We have therefore investigated the in vitro actin binding properties of myopodin. High speed cosedimentation assays with skeletal muscle actin confirmed direct binding of myopodin to F-actin and showed that this interaction is mediated by at least two independent actin binding sites, found in all myopodin isoforms identified to date. Furthermore, low-speed cosedimentation assays revealed that not only full length myopodin, but also the fragment containing only the second binding site, bundles microfilaments in the absence of accessory proteins. Ultrastructural analysis demonstrated that this bundling activity resembled that of α-actinin. Biochemical experiments revealed that bundling was not achieved by myopodin's ability to dimerize, indicating the presence of two individual F-actin binding sites within the second binding segment. Thus full length myopodin contains at least three F-actin binding sites. These data provide further understanding of the mechanisms by which myopodin contributes to actin reorganization during myofibril assembly.

Contingency blindness: location-identity binding mismatches obscure awareness of spatial contingencies and produce profound interference in visual working memory.

PubMed

Fiacconi, Chris M; Milliken, Bruce

2012-08-01

The purpose of the present study was to highlight the role of location-identity binding mismatches in obscuring explicit awareness of a strong contingency. In a spatial-priming procedure, we introduced a high likelihood of location-repeat trials. Experiments 1, 2a, and 2b demonstrated that participants' explicit awareness of this contingency was heavily influenced by the local match in location-identity bindings. In Experiment 3, we sought to determine why location-identity binding mismatches produce such low levels of contingency awareness. Our results suggest that binding mismatches can interfere substantially with visual-memory performance. We attribute the low levels of contingency awareness to participants' inability to remember the critical location-identity binding in the prime on a trial-to-trial basis. These results imply a close interplay between object files and visual working memory.

Nature of the high-binding-energy dip in the low-temperature photoemission spectra of Bi2Sr2CaCu2O8+δ

NASA Astrophysics Data System (ADS)

Dessau, D. S.; Shen, Z.-X.; Wells, B. O.; King, D. M.; Spicer, W. E.; Arko, A. J.; Lombardo, L. W.; Mitzi, D. B.; Kapitulnik, A.

1992-03-01

At the transition to superconductivity, an anomalous high-binding-energy (~=-90 meV) dip appears in the low-temperature photoemission spectra taken along the Γ-M¯ high-symmetry direction of Bi2Sr2CaCu2O8+δ. This paper details experiments which further characterize the energy and k-space dependence of this dip structure. The dip occurs over a wide portion of the Γ-M¯ zone diagonal (110), yet shows minimal energy dispersion. In the spectra taken along the Γ-X zone edge (100), the dip is very weak or not present. We show that these results imply that the dip is not an artifact dependent on the experiment or special features of the band structure and therefore is an intrinsic feature of the superconducting state of Bi2Sr2CaCu2O8+δ. The behavior of the normal-state bands along Γ-M¯ in relation to the local-density-approximation prediction of a Bi-O-based electron ``pocket'' is also discussed, with our data explained most naturally if the Bi-O band remains above the Fermi level for all k.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quennet, Marcel, E-mail: marcel.quennet@fu-berlin.de; Institut für Chemie und Biochemie, Freie Universität Berlin, Takustraße 3, 14195 Berlin; Ritscher, Anna

In this work the Cu/Zn order-disorder transition in Cu{sub 2}ZnSnS{sub 4} kesterites on Wyckoff positions 2c and 2d was investigated by a structural and electronic analysis in theory and experiment. For experimental investigations stoichiometric samples with different Cu/Zn order, annealed in the temperature range of 473–623 K and afterwards quenched, were used. The optical gaps were determined using the Derivation of Absorption Spectrum Fitting (DASF) method. Furthermore, the order-disorder transition was examined by DFT calculations for a closer analysis of the origins of the reduced band gap, showing a good agreement with experimental data with respect to structural and electronicmore » properties. Our studies show a slight increase of lattice parameter c in the kesterite lattice with increasing disorder. Additionally, a reduced band gap was observed with increasing disorder, which is an effect of newly occurring binding motifs in the disordered kesterite structure. - Highlights: • Experimental and theoretical investigation on the order-disorder transition in kesterites. • Slight enlargements of lattice constants due to disorder in experiment and theory. • Strong band gap fluctuations with decreasing order. • Electronic structure deviations due to changing binding motifs. • Disorder as possible main source of low open-circuit voltages.« less

Mannan-Binding Lectin Inhibits Candida albicans-Induced Cellular Responses in PMA-Activated THP-1 Cells through Toll-Like Receptor 2 and Toll-Like Receptor 4

PubMed Central

Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun

2013-01-01

Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778

Crossmodal Statistical Binding of Temporal Information and Stimuli Properties Recalibrates Perception of Visual Apparent Motion

PubMed Central

Zhang, Yi; Chen, Lihan

2016-01-01

Recent studies of brain plasticity that pertain to time perception have shown that fast training of temporal discrimination in one modality, for example, the auditory modality, can improve performance of temporal discrimination in another modality, such as the visual modality. We here examined whether the perception of visual Ternus motion could be recalibrated through fast crossmodal statistical binding of temporal information and stimuli properties binding. We conducted two experiments, composed of three sessions each: pre-test, learning, and post-test. In both the pre-test and the post-test, participants classified the Ternus display as either “element motion” or “group motion.” For the training session in Experiment 1, we constructed two types of temporal structures, in which two consecutively presented sound beeps were dominantly (80%) flanked by one leading visual Ternus frame and by one lagging visual Ternus frame (VAAV) or dominantly inserted by two Ternus visual frames (AVVA). Participants were required to respond which interval (auditory vs. visual) was longer. In Experiment 2, we presented only a single auditory–visual pair but with similar temporal configurations as in Experiment 1, and asked participants to perform an audio–visual temporal order judgment. The results of these two experiments support that statistical binding of temporal information and stimuli properties can quickly and selectively recalibrate the sensitivity of perceiving visual motion, according to the protocols of the specific bindings. PMID:27065910

Scanpath memory binding: multiple read-out experiments

NASA Astrophysics Data System (ADS)

Stark, Lawrence W.; Privitera, Claudio M.; Yang, Huiyang; Azzariti, Michela; Ho, Yeuk F.; Chan, Angie; Krischer, Christof; Weinberger, Adam

1999-05-01

The scanpath theory proposed that an internal spatial- cognitive model controls perception and the active looking eye movements, EMs, of the scanpath sequence. Evidence for this came from new quantitative methods, experiments with ambiguous figures and visual imagery and from MRI studies, all on cooperating human subjects. Besides recording EMs, we introduce other experimental techniques wherein the subject must depend upon memory bindings as in visual imagery, but may call upon other motor behaviors than EMs to read-out the remembered patterns. How is the internal model distributed and operationally assembled. The concept of binding speaks to the assigning of values for the model and its execution in various parts of the brain. Current neurological information helps to localize different aspects of the spatial-cognitive model in the brain. We suppose that there are several levels of 'binding' -- semantic or symbolic binding, structural binding for the spatial locations of the regions-of-interest and sequential binding for the dynamic execution program that yields the sequence of EMs. Our aim is to dissect out respective contributions of these different forms of binding.

The Solution Structure, Binding Properties, and Dynamics of the Bacterial Siderophore-binding Protein FepB*

PubMed Central

Chu, Byron C. H.; Otten, Renee; Krewulak, Karla D.; Mulder, Frans A. A.; Vogel, Hans J.

2014-01-01

The periplasmic binding protein (PBP) FepB plays a key role in transporting the catecholate siderophore ferric enterobactin from the outer to the inner membrane in Gram-negative bacteria. The solution structures of the 34-kDa apo- and holo-FepB from Escherichia coli, solved by NMR, represent the first solution structures determined for the type III class of PBPs. Unlike type I and II PBPs, which undergo large “Venus flytrap” conformational changes upon ligand binding, both forms of FepB maintain similar overall folds; however, binding of the ligand is accompanied by significant loop movements. Reverse methyl cross-saturation experiments corroborated chemical shift perturbation results and uniquely defined the binding pocket for gallium enterobactin (GaEnt). NMR relaxation experiments indicated that a flexible loop (residues 225–250) adopted a more rigid and extended conformation upon ligand binding, which positioned residues for optimal interactions with the ligand and the cytoplasmic membrane ABC transporter (FepCD), respectively. In conclusion, this work highlights the pivotal role that structural dynamics plays in ligand binding and transporter interactions in type III PBPs. PMID:25173704

Noncovalent PEGylation through Protein-Polyelectrolyte Interaction: Kinetic Experiment and Molecular Dynamics Simulation.

PubMed

Kurinomaru, Takaaki; Kuwada, Kengo; Tomita, Shunsuke; Kameda, Tomoshi; Shiraki, Kentaro

2017-07-20

Noncovalent binding of polyethylene glycol (PEG) to a protein surface is a unique protein handling technique to control protein function and stability. A diblock copolymer containing PEG and polyelectrolyte chains (PEGylated polyelectrolyte) is a promising candidate for noncovalent attachment of PEG to a protein surface because of the binding through multiple electrostatic interactions without protein denaturation. To obtain a deeper understanding of protein-polyelectrolyte interaction at the molecular level, we investigated the manner in which cationic PEGylated polyelectrolyte binds to anionic α-amylase in enzyme kinetic experiments and molecular dynamics (MD) simulations. Cationic PEG-block-poly(N,N-dimethylaminoethyl) (PEG-b-PAMA) inhibited the enzyme activity of anionic α-amylase due to binding of PAMA chains. Enzyme kinetics revealed that the inhibition of α-amylase activity by PEG-b-PAMA is noncompetitive inhibition manner. In MD simulations, the PEG-b-PAMA molecule was initially located at six different placements of the x-, y-, and z-axis ±20 Å from the center of α-amylase, which showed that the PEG-b-PAMA nonspecifically bound to the α-amylase surface, corresponding to the noncompetitive inhibition manner that stems from the polymer binding to an enzyme surface other than the active site. In addition, the enzyme activity of α-amylase in the presence of PEG-b-PAMA was not inhibited by increasing the ionic strength, consistent with the MD simulation; i.e., PEG-b-PAMA did not interact with α-amylase in high ionic strength conditions. The results reported in this paper suggest that enzyme inhibition by PEGylated polyelectrolyte can be attributed to the random electrostatic interaction between protein and polyelectrolyte.

99mTc-HYNIC-(tricine/EDDA)-FROP peptide for MCF-7 breast tumor targeting and imaging.

PubMed

Ahmadpour, Sajjad; Noaparast, Zohreh; Abedi, Seyed Mohammad; Hosseinimehr, Seyed Jalal

2018-02-19

Breast cancer is the most common malignancy among women in the world. Development of novel tumor-specific radiopharmaceuticals for early breast tumor diagnosis is highly desirable. In this study we developed 99m Tc-HYNIC-(tricine/EDDA)-Lys-FROP peptide with the ability of specific binding to MCF-7 breast tumor. The FROP-1 peptide was conjugated with the bifunctional chelator hydrazinonicotinamide (HYNIC) and labeled with 99m Tc using tricine/EDDA co-ligand. The cellular specific binding of 99m Tc-HYNIC-FROP was evaluated on different cell lines as well as with blocking experiment on MCF-7 (human breast adenocarcinoma). The tumor targeting and imaging of this labeled peptide were performed on MCF-7 tumor bearing mice. Radiochemical purity for 99m Tc-HYNIC-(tricine/EDDA)-FROP was 99% which was determined with ITLC method. This radiolabeled peptide showed high stability in normal saline and serum about 98% which was monitored with HPLC method. In saturation binding experiments, the binding constant (K d ) to MCF-7 cells was determined to be 158 nM. Biodistribution results revealed that the 99m Tc-HYNIC-FROP was mainly exerted from urinary route. The maximum tumor uptake was found after 30 min post injection (p.i.); however maximum tumor/muscle ratio was seen at 15 min p.i. The tumor uptake of this labeled peptide was specific and blocked by co-injection of excess FROP. According to the planar gamma imaging result, tumor was clearly visible due to the tumor uptake of 99m Tc-HYNIC-(tricine/EDDA)-FROP in mouse after 15 min p.i. The 99m Tc-HYNIC-(tricine/EDDA)-FROP is considered a promising probe with high specific binding to MCF-7 breast cancer cells.

Role of Microbial Exopolymeric Substances (EPS) on Chromium Sorption and Transport in Heterogeneous Subsurface Soils: I. Cr(III) Complexation with EPS in Aqueous Solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Kantar; H Demiray; N Dogan

2011-12-31

Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less

Role of microbial exopolymeric substances (EPS) on chromium sorption and transport in heterogeneous subsurface soils: I. Cr(III) complexation with EPS in aqueous solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kantar, C.; Dodge, C.; Demiray, H.

2011-01-26

Chromium (III) binding by exopolymeric substances (EPS) isolated from Pseudomonas putida P18, Pseudomonas aeruginosa P16 and Pseudomonas stutzeri P40 strains were investigated by the determination of conditional stability constants and the concentration of functional groups using the ion-exchange experiments and potentiometric titrations. Spectroscopic (EXAFS) analysis was also used to obtain information on the nature of Cr(III) binding with EPS functional groups. The data from ion-exchange experiments and potentiometric titrations were evaluated using a non-electrostatic discrete ligand approach. The modeling results show that the acid/base properties of EPSs can be best characterized by invoking four different types of acid functional groupsmore » with arbitrarily assigned pK{sub a} values of 4, 6, 8 and 10. The analysis of ion-exchange data using the discrete ligand approach suggests that while the Cr binding by EPS from P. aeruginosa can be successfully described based on a reaction stoichiometry of 1:2 between Cr(III) and HL{sub 2} monoprotic ligands, the accurate description of Cr binding by EPSs extracted from P. putida and P. stutzeri requires postulation of 1:1 Cr(III)-ligand complexes with HL{sub 2} and HL{sub 3} monoprotic ligands, respectively. These results indicate that the carboxyl and/or phosphoric acid sites contribute to Cr(III) binding by microbial EPS, as also confirmed by EXAFS analysis performed in the current study. Overall, this study highlights the need for incorporation of Cr-EPS interactions into transport and speciation models to more accurately assess microbial Cr(VI) reduction and chromium transport in subsurface systems, including microbial reactive treatment barriers.« less

A specific l-tri-iodothyronine-binding protein in the cytosol fraction of human breast adipose tissue

PubMed Central

Rao, Marie Luise; Rao, Govind S.

1982-01-01

1. Binding of l-tri-[125I]iodothyronine to the cytosol fraction of normal human female breast adipose tissue was investigated by the charcoal adsorption method. Equilibrium of binding was reached after 120s at 25°C. 2. The l-tri-[125I]iodothyronine-binding component is a protein; this was confirmed by experiments in which binding was totally lost after heating the cytosol fraction for 10min at 100°C and in which binding was diminished after treatment with proteolytic enzymes and with thiol-group-blocking reagents. The binding protein was stable at −38°C for several months. 3. It displayed saturability, high affinity (apparent Kd 3.28nm) and a single class of binding sites. 4. High specificity for l-tri-iodothyronine and l-3,5-di-iodo-3′-isopropylthyronine was observed, whereas other iodothyronines were less effective in displacing l-tri-[125I]-iodothyronine from its binding site. 5. The binding of the hormone by the cytosol fraction did not show a pH optimum. 6. When cytosol fractions of adipose tissue from different females were subjected to radioimmunoassay for the determination of thyroxine-binding globulin a value of 0.304±0.11μg/mg of cytosol protein (mean±s.d., n=4) was obtained; the mean concentration in plasma was 0.309±0.07μg/mg of plasma protein (mean±s.d., n=3). 7. The Ka value of 6.3×108m−1 of l-tri-[125I]iodothyronine for binding to plasma, the similar thermalinactivation profiles of binding and the reactivity to thiol-group-blocking reagents were some properties common between the binding components from the cytosol fraction and plasma. 8. These results suggest that the cytosol fraction of human female breast adipose tissue contains thyroxine-binding globulin; the protein that binds l-tri-[125I]iodothyronine with high affinity and specificity appears to be similar to thyroxine-binding globulin. PMID:6289813

Lifetimes and stabilities of familiar explosives molecular adduct complexes during ion mobility measurements

PubMed Central

McKenzie, Alan; DeBord, John Daniel; Ridgeway, Mark; Park, Melvin; Eiceman, Gary; Fernandez-Lima, Francisco

2015-01-01

Trapped ion mobility spectrometry coupled to mass spectrometry (TIMS-MS) was utilized for the separation and identification of familiar explosives in complex mixtures. For the first time, molecular adduct complex lifetimes, relative stability, binding energies and candidate structures are reported for familiar explosives. Experimental and theoretical results showed that the adduct size and reactivity, complex binding energy and the explosive structure tailors the stability of the molecular adduct complex. TIMS flexibility to adapt the mobility separation as a function of the molecular adduct complex stability (i.e., short or long IMS experiments / low or high IMS resolution) permits targeted measurements of explosives in complex mixtures with higher confidence levels. PMID:26153567

Species B adenovirus serotypes 3, 7, 11 and 35 share similar binding sites on the membrane cofactor protein CD46 receptor.

PubMed

Fleischli, Christoph; Sirena, Dominique; Lesage, Guillaume; Havenga, Menzo J E; Cattaneo, Roberto; Greber, Urs F; Hemmi, Silvio

2007-11-01

We recently characterized the domains of the human cofactor protein CD46 involved in binding species B2 adenovirus (Ad) serotype 35. Here, the CD46 binding determinants are mapped for the species B1 Ad serotypes 3 and 7 and for the species B2 Ad11. Ad3, 7 and 11 bound and transduced CD46-positive rodent BHK cells at levels similar to Ad35. By using antibody-blocking experiments, hybrid CD46-CD4 receptor constructs and CD46 single point mutants, it is shown that Ad3, 7 and 11 share many of the Ad35-binding features on CD46. Both CD46 short consensus repeat domains SCR I and SCR II were necessary and sufficient for optimal binding and transgene expression, provided that they were positioned at an appropriate distance from the cell membrane. Similar to Ad35, most of the putative binding residues of Ad3, 7 and 11 were located on the same glycan-free, solvent-exposed face of the SCR I or SCR II domains, largely overlapping with the binding surface of the recently solved fiber knob Ad11-SCR I-II three-dimensional structure. Differences between species B1 and B2 Ads were documented with competition experiments based on anti-CD46 antibodies directed against epitopes flanking the putative Ad-binding sites, and with competition experiments based on soluble CD46 protein. It is concluded that the B1 and B2 species of Ad engage CD46 through similar binding surfaces.

Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

PubMed

Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

2014-04-18

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

PubMed Central

2015-01-01

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

Activation and binding in verbal working memory: a dual-process model for the recognition of nonwords.

PubMed

Oberauer, Klaus; Lange, Elke B

2009-02-01

The article presents a mathematical model of short-term recognition based on dual-process models and the three-component theory of working memory [Oberauer, K. (2002). Access to information in working memory: Exploring the focus of attention. Journal of Experimental Psychology: Learning, Memory, and Cognition, 28, 411-421]. Familiarity arises from activated representations in long-term memory, ignoring their relations; recollection retrieves bindings in the capacity-limited component of working memory. In three experiments participants encoded two short lists of nonwords for immediate recognition, one of which was then cued as irrelevant. Probes from the irrelevant list were rejected more slowly than new probes; this was also found with probes recombining letters of irrelevant nonwords, suggesting that familiarity arises from individual letters independent of their relations. When asked to accept probes whose letters were all in the relevant list, regardless of their conjunction, participants accepted probes preserving the original conjunctions faster than recombinations, showing that recollection accessed feature bindings automatically. The model fit the data best when familiarity depended only on matching letters, whereas recollection used binding information.

Conformational Response of 30S-bound IF3 to A-Site Binders Streptomycin and Kanamycin

PubMed Central

Chulluncuy, Roberto; Espiche, Carlos; Nakamoto, Jose Alberto; Fabbretti, Attilio; Milón, Pohl

2016-01-01

Aminoglycoside antibiotics are widely used to treat infectious diseases. Among them, streptomycin and kanamycin (and derivatives) are of importance to battle multidrug-resistant (MDR) Mycobacterium tuberculosis. Both drugs bind the small ribosomal subunit (30S) and inhibit protein synthesis. Genetic, structural, and biochemical studies indicate that local and long-range conformational rearrangements of the 30S subunit account for this inhibition. Here, we use intramolecular FRET between the C- and N-terminus domains of the flexible IF3 to monitor real-time perturbations of their binding sites on the 30S platform. Steady and pre-steady state binding experiments show that both aminoglycosides bring IF3 domains apart, promoting an elongated state of the factor. Binding of Initiation Factor IF1 triggers closure of IF3 bound to the 30S complex, while both aminoglycosides revert the IF1-dependent conformation. Our results uncover dynamic perturbations across the 30S subunit, from the A-site to the platform, and suggest that both aminoglycosides could interfere with prokaryotic translation initiation by modulating the interaction between IF3 domains with the 30S platform. PMID:27983590

Structure and DNA-binding of meiosis-specific protein Hop2

NASA Astrophysics Data System (ADS)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

Integration Method of Emphatic Motions and Adverbial Expressions with Scalar Parameters for Robotic Motion Coaching System

NASA Astrophysics Data System (ADS)

Okuno, Keisuke; Inamura, Tetsunari

A robotic coaching system can improve humans' learning performance of motions by intelligent usage of emphatic motions and adverbial expressions according to user reactions. In robotics, however, method to control both the motions and the expressions and how to bind them had not been adequately discussed from an engineering point of view. In this paper, we propose a method for controlling and binding emphatic motions and adverbial expressions by using two scalar parameters in a phase space. In the phase space, variety of motion patterns and verbal expressions are connected and can be expressed as static points. We show the feasibility of the proposing method through experiments of actual sport coaching tasks for beginners. From the results of participants' improvements in motion learning, we confirmed the feasibility of the methods to control and bind emphatic motions and adverbial expressions, as well as confirmed contribution of the emphatic motions and positive correlation of adverbial expressions for participants' improvements in motion learning. Based on the results, we introduce a hypothesis that individually optimized method for binding adverbial expression is required.

Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

PubMed Central

Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

2012-01-01

KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

Molecular modeling and spectroscopic studies on the interaction of the chiral drug venlafaxine hydrochloride with bovine serum albumin

NASA Astrophysics Data System (ADS)

Shahabadi, Nahid; Hadidi, Saba

2014-03-01

This study was designed to examine the interaction of racemic antidepressant drug "S,R-venlafaxine hydrochloride (VEN)" with bovine serum albumin (BSA) under physiological conditions. The mechanism of interaction was studied by spectroscopic techniques combination with molecular modeling. Stern-Volmer analysis of fluorescence quenching data shows the presence of the static quenching mechanism. The thermodynamic parameters indicated that the hydrogen bonding and weak van der Waals interactions are the predominant intermolecular forces stabilizing the complex. The number of binding sites (n) was calculated. Through the site marker competitive experiment, VEN was confirmed to be located in subdomain IIIA of BSA. The binding distance (r = 4.93 nm) between the donor BSA and acceptor VEN was obtained according to Förster's non-radiative energy transfer theory. According to UV-vis spectra and CD data binding of VEN leaded to conformational changes of BSA. Molecular docking simulations of S and R-VEN revealed that both isomers have similar interaction and the same binding sites, from this point of view S and R isomers are equal.

Chloroplast Hsp93 Directly Binds to Transit Peptides at an Early Stage of the Preprotein Import Process1[OPEN

PubMed Central

Huang, Po-Kai; Chan, Po-Ting; Chen, Lih-Jen

2016-01-01

Three stromal chaperone ATPases, cpHsc70, Hsp90C, and Hsp93, are present in the chloroplast translocon, but none has been shown to directly bind preproteins in vivo during import, so it remains unclear whether any function as a preprotein-translocating motor and whether they have different functions during the import process. Here, using protein crosslinking followed by ionic detergent solubilization, we show that Hsp93 directly binds to the transit peptides of various preproteins undergoing active import into chloroplasts. Hsp93 also binds to the mature region of a preprotein. A time course study of import, followed by coimmunoprecipitation experiments, confirmed that Hsp93 is present in the same complexes as preproteins at an early stage when preproteins are being processed to the mature size. In contrast, cpHsc70 is present in the same complexes as preproteins at both the early stage and a later stage after the transit peptide has been removed, suggesting that cpHsc70, but not Hsp93, is important in translocating processed mature proteins across the envelope. PMID:26676256

Linear Precision Glycomacromolecules with Varying Interligand Spacing and Linker Functionalities Binding to Concanavalin A and the Bacterial Lectin FimH.

PubMed

Igde, Sinaida; Röblitz, Susanna; Müller, Anne; Kolbe, Katharina; Boden, Sophia; Fessele, Claudia; Lindhorst, Thisbe K; Weber, Marcus; Hartmann, Laura

2017-12-01

A series of precision glycomacromolecules is prepared following previously established solid phase synthesis allowing for controlled variations of interligand spacing and the overall number of carbohydrate ligands. In addition, now also different linkers are installed between the carbohydrate ligand and the macromolecular scaffold. The lectin binding behavior of these glycomacromolecules is then evaluated in isothermal titration calorimetry (ITC) and kinITC experiments using the lectin Concanavalin A (Con A) in its dimeric and tetrameric form. The results indicate that both sterical and statistical effects impact lectin binding of precision glycomacromolecules. Moreover, ITC results show that highest affinity toward Con A can be achieved with an ethyl phenyl linker, which parallels earlier findings with the bacterial lectin FimH. In this way, a first set of glycomacromolecule structures is selected for testing in a bacterial adhesion-inhibition study. Here, the findings point to a one-sugar binding mode mainly affected by sterical restraints of the nonbinding parts of the respective glycomacromolecule. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rules for the recognition of dilysine retrieval motifs by coatomer

PubMed Central

Ma, Wenfu; Goldberg, Jonathan

2013-01-01

Cytoplasmic dilysine motifs on transmembrane proteins are captured by coatomer α-COP and β′-COP subunits and packaged into COPI-coated vesicles for Golgi-to-ER retrieval. Numerous ER/Golgi proteins contain K(x)Kxx motifs, but the rules for their recognition are unclear. We present crystal structures of α-COP and β′-COP bound to a series of naturally occurring retrieval motifs—encompassing KKxx, KxKxx and non-canonical RKxx and viral KxHxx sequences. Binding experiments show that α-COP and β′-COP have generally the same specificity for KKxx and KxKxx, but only β′-COP recognizes the RKxx signal. Dilysine motif recognition involves lysine side-chain interactions with two acidic patches. Surprisingly, however, KKxx and KxKxx motifs bind differently, with their lysine residues transposed at the binding patches. We derive rules for retrieval motif recognition from key structural features: the reversed binding modes, the recognition of the C-terminal carboxylate group which enforces lysine positional context, and the tolerance of the acidic patches for non-lysine residues. PMID:23481256

Binding behaviors of p-sulfonatocalix[4]arene with gemini guests.

PubMed

Zhao, Hong-Xia; Guo, Dong-Sheng; Liu, Yu

2013-02-14

A dozen of homoditopic cations, possessing different spacer lengths and rigidities, as well as sizes, shapes, and charges of terminal groups, were synthesized as candidate gemini guests for the complexation of p-sulfonatocalix[4]arenes (SC4A). The 12 gemini guests are divided into five species according to the different terminal groups: imidazolium (G1-G3), pyridinium (G4-G6), quinolinium (G7), viologen (G8-G11), and 1,4-diazabicyclo[2.2.2]octane (DBO, G12). Their binding structures and stoichiometries with SC4A were examined by NMR spectroscopy, which is helpful to construct diverse highly ordered assemblies. The obtained results show that the length of the linkers, as well as the charge numbers on the end groups have a pronounced effect on the binding stoichiometry, whereas the size and shape of the terminal groups have no significant influence. Furthermore, both the stability constants and thermodynamic parameters of SC4A with the terminal subunits were determined by the isothermal titration calorimetry experiments, which are valuable to understand the binding behavior, giving quantitatively deep insight.

Crystal structures of ryanodine receptor SPRY1 and tandem-repeat domains reveal a critical FKBP12 binding determinant

NASA Astrophysics Data System (ADS)

Yuchi, Zhiguang; Yuen, Siobhan M. Wong King; Lau, Kelvin; Underhill, Ainsley Q.; Cornea, Razvan L.; Fessenden, James D.; van Petegem, Filip

2015-08-01

Ryanodine receptors (RyRs) form calcium release channels located in the membranes of the sarcoplasmic and endoplasmic reticulum. RyRs play a major role in excitation-contraction coupling and other Ca2+-dependent signalling events, and consist of several globular domains that together form a large assembly. Here we describe the crystal structures of the SPRY1 and tandem-repeat domains at 1.2-1.5 Å resolution, which reveal several structural elements not detected in recent cryo-EM reconstructions of RyRs. The cryo-EM studies disagree on the position of SPRY domains, which had been proposed based on homology modelling. Computational docking of the crystal structures, combined with FRET studies, show that the SPRY1 domain is located next to FK506-binding protein (FKBP). Molecular dynamics flexible fitting and mutagenesis experiments suggest a hydrophobic cluster within SPRY1 that is crucial for FKBP binding. A RyR1 disease mutation, N760D, appears to directly impact FKBP binding through interfering with SPRY1 folding.

Prenatal Stress as a Risk-and an Opportunity-Factor.

PubMed

Hartman, Sarah; Freeman, Sara M; Bales, Karen L; Belsky, Jay

2018-04-01

Two separate lines of research indicate (a) that prenatal stress is associated with heightened behavioral and physiological reactivity and (b) that these postnatal phenotypes are associated with increased susceptibility to both positive and negative developmental experiences. Therefore, prenatal stress may increase sensitivity to the rearing environment. We tested this hypothesis by manipulating prenatal stress and rearing-environment quality, using a cross-fostering paradigm, in prairie voles. Results showed that prenatally stressed voles, as adults, displayed the highest behavioral and physiological reactivity when cross-fostered to low-contact (i.e., low-quality) rearing but the lowest behavioral and physiological reactivity when cross-fostered to high-contact (i.e., high-quality) rearing; non-prenatally stressed voles showed no effect of rearing condition. Additionally, while neither prenatal stress nor rearing condition affected oxytocin receptor binding, prenatally stressed voles cross-fostered to high-contact rearing showed the highest vasopressin-1a receptor binding in the amygdala. Results indicate that prenatal stress induces greater environmental sensitivity, making it both a risk and an opportunity factor.

Single molecule junction conductance and binding geometry

NASA Astrophysics Data System (ADS)

Kamenetska, Maria

This Thesis addresses the fundamental problem of controlling transport through a metal-organic interface by studying electronic and mechanical properties of single organic molecule-metal junctions. Using a Scanning Tunneling Microscope (STM) we image, probe energy-level alignment and perform STM-based break junction (BJ) measurements on molecules bound to a gold surface. Using Scanning Tunneling Microscope-based break-junction (STM-BJ) techniques, we explore the effect of binding geometry on single-molecule conductance by varying the structure of the molecules, metal-molecule binding chemistry and by applying sub-nanometer manipulation control to the junction. These experiments are performed both in ambient conditions and in ultra high vacuum (UHV) at cryogenic temperatures. First, using STM imaging and scanning tunneling spectroscopy (STS) measurements we explore binding configurations and electronic properties of an amine-terminated benzene derivative on gold. We find that details of metal-molecule binding affect energy-level alignment at the interface. Next, using the STM-BJ technique, we form and rupture metal-molecule-metal junctions ˜104 times to obtain conductance-vs-extension curves and extract most likely conductance values for each molecule. With these measurements, we demonstrated that the control of junction conductance is possible through a choice of metal-molecule binding chemistry and sub-nanometer positioning. First, we show that molecules terminated with amines, sulfides and phosphines bind selectively on gold and therefore demonstrate constant conductance levels even as the junction is elongated and the metal-molecule attachment point is modified. Such well-defined conductance is also obtained with paracyclophane molecules which bind to gold directly through the pi system. Next, we are able to create metal-molecule-metal junctions with more than one reproducible conductance signatures that can be accessed by changing junction geometry. In the case of pyridine-linked molecules, conductance can be reliably switched between two distinct conductance states using sub-nanometer mechanical manipulation. Using a methyl sulfide linker attached to an oligoene backbone, we are able to create a 3-nm-long molecular potentiometer, whose resistance can be tuned exponentially with Angstom-scale modulations in metal-molecule configuration. These experiments points to a new paradigm for attaining reproducible electrical characteristics of metal-organic devices which involves controlling linker-metal chemistry rather than fabricating identically structured metal-molecule interfaces. By choosing a linker group which is either insensitive to or responds reproducibly to changes in metal-molecule configuration, one can design single molecule devices with functionality more complex than a simple resistor. These ambient temperature experiments were combined with UHV conductance measurements performed in a commercial STM on amine-terminated benzene derivatives which conduct through a non-resonant tunneling mechanism, at temperatures varying from 5 to 300 Kelvin. Our results indicate that while amine-gold binding remains selective irrespective of environment, conductance is not temperature independent, in contrast to what is expected for a tunneling mechanism. Furthermore, using temperature-dependent measurements in ambient conditions we find that HOMO-conducting amines and LUMO-conducting pyridines show opposite dependence of conductance on temperature. These results indicate that energy-level alignment between the molecule and the electrodes changes as a result of varying electrode structure at different temperatures. We find that temperature can serve as a knob with which to tune transport properties of single molecule-metal junctions.

Characterization of the [125I]-neurokinin A binding site in the circular muscle of human colon

PubMed Central

Warner, Fiona J; Comis, Alfio; Miller, Robert C; Burcher, Elizabeth

1999-01-01

Neurokinin A (NKA) is a potent contractile agonist of human colon circular muscle. These responses are mediated predominantly through tachykinin NK2 receptors. In the present study, the NK2 receptor radioligand [125I]-NKA has been used to characterize binding sites in this tissue, using tachykinin agonists and antagonists. 125INKA labelled a single, high affinity binding site. Specific binding (95% of total binding) of [125I]-NKA was saturable (KD 0.47±0.05 nM), of high capacity (Bmax 2.1±0.1 fmol mg−1 wet weight tissue) and reversible (kinetically derived KD 0.36±0.07 nM). The rank order of agonists competing for the [125I]-NKA binding site was neuropeptide γ (NPγ)≥NKA≥[Lys5,MeLeu9,Nle10]NKA (4–10) (NK2 agonist)>>substance P (SP)>neurokinin B (NKB)≥[Pro9]SP (NK1 agonist)>>senktide (NK3 agonist), indicating binding to an NK2 site. The nonpeptide selective NK2 antagonist SR48968 showed higher affinity for the [125I]-NKA site than selective peptide NK2 antagonists. The rank order of potency for NK2 antagonists was SR48968≥MEN11420>GR94800≥MEN10627>MEN10376≥R396. The NK1 antagonist SR140333 was a weak competitor. The competition curve for SP could be resolved into two sites. When experiments were repeated in the presence of SR140333 (0.1 μM), the curve for SP became monophasic and showed a significant shift to the right, whereas curves to NKA and NKB were unaffected. In conclusion, binding of the radioligand [125I]-NKA to membranes from circular muscle is predominantly to the NK2 receptor. There may be a small component of binding to the NK1 receptor. The NK2 receptor mediates circular muscle contraction, whereas the role of the NK1 receptor in circular muscle is unclear. PMID:10455255

The Determination of Vitamin D-Dependent Calcium Binding Protein in Chick Intesting: An Undergraduate Biochemistry Laboratory Experiment.

ERIC Educational Resources Information Center

Lessard, George M.

1980-01-01

Described is an experiment used in an undergraduate biochemistry laboratory involving inducing rickets in chicks and correlating the disease to a reduction in vitamin D-dependent calcium binding protein. Techniques involved are hormone induction, protein isolation, and radioisotope methodology. (Author/DS)

Memory Meets Control in Hippocampal and Striatal Binding of Stimuli, Responses, and Attentional Control States

PubMed Central

Brashier, Nadia M.

2015-01-01

The human brain encodes experience in an integrative fashion by binding together the various features of an event (i.e., stimuli and responses) into memory “event files.” A subsequent reoccurrence of an event feature can then cue the retrieval of the memory file to “prime” cognition and action. Intriguingly, recent behavioral studies indicate that, in addition to linking concrete stimulus and response features, event coding may also incorporate more abstract, “internal” event features such as attentional control states. In the present study, we used fMRI in healthy human volunteers to determine the neural mechanisms supporting this type of holistic event binding. Specifically, we combined fMRI with a task protocol that dissociated the expression of event feature-binding effects pertaining to concrete stimulus and response features, stimulus categories, and attentional control demands. Using multivariate neural pattern classification, we show that the hippocampus and putamen integrate event attributes across all of these levels in conjunction with other regions representing concrete-feature-selective (primarily visual cortex), category-selective (posterior frontal cortex), and control demand-selective (insula, caudate, anterior cingulate, and parietal cortex) event information. Together, these results suggest that the hippocampus and putamen are involved in binding together holistic event memories that link physical stimulus and response characteristics with internal representations of stimulus categories and attentional control states. These bindings then presumably afford shortcuts to adaptive information processing and response selection in the face of recurring events. SIGNIFICANCE STATEMENT Memory binds together the different features of our experience, such as an observed stimulus and concurrent motor responses, into so-called event files. Recent behavioral studies suggest that the observer's internal attentional state might also become integrated into the event memory. Here, we used fMRI to determine the brain areas responsible for binding together event information pertaining to concrete stimulus and response features, stimulus categories, and internal attentional control states. We found that neural signals in the hippocampus and putamen contained information about all of these event attributes and could predict behavioral priming effects stemming from these features. Therefore, medial temporal lobe and dorsal striatum structures appear to be involved in binding internal control states to event memories. PMID:26538657

Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

NASA Astrophysics Data System (ADS)

Djordjevic, Marko

2005-11-01

Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely resembles temperate phages, such as lambda. It, however, encodes its own T7-like RNA polymerase (characteristic of virulent phages), whose role in gene expression was unclear. Our analysis resulted in quantitative understanding of the role of both host and phage RNA polymerase, and in the identification of the previously unknown promoter sequence for Xp10 RNA polymerase. More generally, an increasing number of phage genomes are being sequenced every year, and we expect that methods of quantitative data analysis that we introduced will provide an efficient way to study gene expression strategies of novel bacterial viruses.

Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

2011-07-08

Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

Neonicotinoid Binding, Toxicity and Expression of Nicotinic Acetylcholine Receptor Subunits in the Aphid Acyrthosiphon pisum

PubMed Central

Taillebois, Emiliane; Beloula, Abdelhamid; Quinchard, Sophie; Jaubert-Possamai, Stéphanie; Daguin, Antoine; Servent, Denis; Tagu, Denis

2014-01-01

Neonicotinoid insecticides act on nicotinic acetylcholine receptor and are particularly effective against sucking pests. They are widely used in crops protection to fight against aphids, which cause severe damage. In the present study we evaluated the susceptibility of the pea aphid Acyrthosiphon pisum to the commonly used neonicotinoid insecticides imidacloprid (IMI), thiamethoxam (TMX) and clothianidin (CLT). Binding studies on aphid membrane preparations revealed the existence of high and low-affinity binding sites for [3H]-IMI (Kd of 0.16±0.04 nM and 41.7±5.9 nM) and for the nicotinic antagonist [125I]-α-bungarotoxin (Kd of 0.008±0.002 nM and 1.135±0.213 nM). Competitive binding experiments demonstrated that TMX displayed a higher affinity than IMI for [125I]-α-bungarotoxin binding sites while CLT affinity was similar for both [125I]-α-bungarotoxin and [3H]-IMI binding sites. Interestingly, toxicological studies revealed that at 48 h, IMI (LC50 = 0.038 µg/ml) and TMX (LC50 = 0.034 µg/ml) were more toxic than CLT (LC50 = 0.118 µg/ml). The effect of TMX could be associated to its metabolite CLT as demonstrated by HPLC/MS analysis. In addition, we found that aphid larvae treated either with IMI, TMX or CLT showed a strong variation of nAChR subunit expression. Using semi-quantitative PCR experiments, we detected for all insecticides an increase of Apisumα10 and Apisumβ1 expressions levels, whereas Apisumβ2 expression decreased. Moreover, some other receptor subunits seemed to be differently regulated according to the insecticide used. Finally, we also demonstrated that nAChR subunit expression differed during pea aphid development. Altogether these results highlight species specificity that should be taken into account in pest management strategies. PMID:24801634