Jeyaseelan, S; Kannan, M S; Briggs, R E; Thumbikat, P; Maheswaran, S K
2001-10-01
The leukotoxin (LktA) produced by Mannheimia haemolytica binds to bovine lymphocyte function-associated antigen 1 (LFA-1) and induces biological effects in bovine leukocytes in a cellular and species-specific fashion. We have previously shown that LktA also binds to porcine LFA-1 without eliciting any effects. These findings suggest that the specificity of LktA effects must entail both binding to LFA-1 and activation of signaling pathways which are present in bovine leukocytes. However, the signaling pathways leading to biological effects upon LktA binding to LFA-1 have not been characterized. In this context, several reports have indicated that ligand binding to LFA-1 results in activation of a nonreceptor tyrosine kinase (NRTK) signaling cascade. We designed experiments with the following objectives: (i) to determine whether LktA binding to LFA-1 leads to activation of NRTKs, (ii) to examine whether LktA-induced NRTK activation is target cell specific, and (iii) to determine whether LktA-induced NRTK activation is required for biological effects. We used a biologically inactive mutant leukotoxin (DeltaLktA) for comparison with LktA. Our results indicate that LktA induces tyrosine phosphorylation (TP) of the CD18 tail of LFA-1 in bovine leukocytes. The DeltaLktA mutant does not induce TP of the CD18 tail, albeit binding to bovine LFA-1. LktA-induced TP of the CD18 tail was attenuated by an NRTK inhibitor, herbimycin A; a phosphatidylinositol 3'-kinase (PI 3-kinase) inhibitor, wortmannin; and a Src kinase inhibitor, PP2, in a concentration-dependent manner. Furthermore, LktA induces TP of the CD18 tail in bovine, but not porcine, leukocytes. Moreover, LktA-induced intracellular calcium ([Ca2+]i) elevation was also inhibited by herbimycin A, wortmannin, and PP2. Thus, our data represent the first evidence that binding of LktA to bovine LFA-1 induces a species-specific NRTK signaling cascade involving PI 3-kinase and Src kinases and that this signaling cascade is required for LktA-induced biological effects.
Jeyaseelan, S.; Kannan, M. S.; Briggs, R. E.; Thumbikat, P.; Maheswaran, S. K.
2001-01-01
The leukotoxin (LktA) produced by Mannheimia haemolytica binds to bovine lymphocyte function-associated antigen 1 (LFA-1) and induces biological effects in bovine leukocytes in a cellular and species-specific fashion. We have previously shown that LktA also binds to porcine LFA-1 without eliciting any effects. These findings suggest that the specificity of LktA effects must entail both binding to LFA-1 and activation of signaling pathways which are present in bovine leukocytes. However, the signaling pathways leading to biological effects upon LktA binding to LFA-1 have not been characterized. In this context, several reports have indicated that ligand binding to LFA-1 results in activation of a nonreceptor tyrosine kinase (NRTK) signaling cascade. We designed experiments with the following objectives: (i) to determine whether LktA binding to LFA-1 leads to activation of NRTKs, (ii) to examine whether LktA-induced NRTK activation is target cell specific, and (iii) to determine whether LktA-induced NRTK activation is required for biological effects. We used a biologically inactive mutant leukotoxin (ΔLktA) for comparison with LktA. Our results indicate that LktA induces tyrosine phosphorylation (TP) of the CD18 tail of LFA-1 in bovine leukocytes. The ΔLktA mutant does not induce TP of the CD18 tail, albeit binding to bovine LFA-1. LktA-induced TP of the CD18 tail was attenuated by an NRTK inhibitor, herbimycin A; a phosphatidylinositol 3′-kinase (PI 3-kinase) inhibitor, wortmannin; and a Src kinase inhibitor, PP2, in a concentration-dependent manner. Furthermore, LktA induces TP of the CD18 tail in bovine, but not porcine, leukocytes. Moreover, LktA-induced intracellular calcium ([Ca2+]i) elevation was also inhibited by herbimycin A, wortmannin, and PP2. Thus, our data represent the first evidence that binding of LktA to bovine LFA-1 induces a species-specific NRTK signaling cascade involving PI 3-kinase and Src kinases and that this signaling cascade is required for LktA-induced biological effects. PMID:11553552
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji
2014-01-17
Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains amore » highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsou, T.-C.; Yeh, S.C.; Tsai, F.-Y.
2007-06-01
We investigated the regulatory role of glutathione in tumor necrosis factor-alpha (TNF-{alpha})-induced vascular endothelial dysfunction as evaluated by using vascular endothelial adhesion molecule expression and monocyte-endothelial monolayer binding. Since TNF-{alpha} induces various biological effects on vascular cells, TNF-{alpha} dosage could be a determinant factor directing vascular cells into different biological fates. Based on the adhesion molecule expression patterns responding to different TNF-{alpha} concentrations, we adopted the lower TNF-{alpha} (0.2 ng/ml) to rule out the possible involvement of other TNF-{alpha}-induced biological effects. Inhibition of glutathione synthesis by L-buthionine-(S,R)-sulfoximine (BSO) resulted in down-regulations of the TNF-{alpha}-induced adhesion molecule expression and monocyte-endothelial monolayermore » binding. BSO attenuated the TNF-{alpha}-induced nuclear factor-kappaB (NF-{kappa}B) activation, however, with no detectable effect on AP-1 and its related mitogen-activated protein kinases (MAPKs). Deletion of an AP-1 binding site in intercellular adhesion molecule-1 (ICAM-1) promoter totally abolished its constitutive promoter activity and its responsiveness to TNF-{alpha}. Inhibition of ERK, JNK, or NF-{kappa}B attenuates TNF-{alpha}-induced ICAM-1 promoter activation and monocyte-endothelial monolayer binding. Our study indicates that TNF-{alpha} induces adhesion molecule expression and monocyte-endothelial monolayer binding mainly via activation of NF-{kappa}B in a glutathione-sensitive manner. We also demonstrated that intracellular glutathione does not modulate the activation of MAPKs and/or their downstream AP-1 induced by lower TNF-{alpha}. Although AP-1 activation by the lower TNF-{alpha} was not detected in our systems, we could not rule out the possible involvement of transiently activated MAPKs/AP-1 in the regulation of TNF-{alpha}-induced adhesion molecule expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Lianying; College of Life Science, Dezhou University, Dezhou 253023; Ren, Xiao-Min
2014-09-15
Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group.more » For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.« less
Locked and proteolysis-based transcription activator-like effector (TALE) regulation.
Lonzarić, Jan; Lebar, Tina; Majerle, Andreja; Manček-Keber, Mateja; Jerala, Roman
2016-02-18
Development of orthogonal, designable and adjustable transcriptional regulators is an important goal of synthetic biology. Their activity has been typically modulated through stimulus-induced oligomerization or interaction between the DNA-binding and activation/repression domain. We exploited a feature of the designable Transcription activator-like effector (TALE) DNA-binding domain that it winds around the DNA which allows to topologically prevent it from binding by intramolecular cyclization. This new approach was investigated through noncovalent ligand-induced cyclization or through a covalent split intein cyclization strategy, where the topological inhibition of DNA binding by cyclization and its restoration by a proteolytic release of the topologic constraint was expected. We show that locked TALEs indeed have diminished DNA binding and regain full transcriptional activity by stimulation with the rapamycin ligand or site-specific proteolysis of the peptide linker, with much higher level of activation than rapamycin-induced heterodimerization. Additionally, we demonstrated reversibility, activation of genomic targets and implemented logic gates based on combinations of protein cyclization, proteolytic cleavage and ligand-induced dimerization, where the strongest fold induction was achieved by the proteolytic cleavage of a repression domain from a linear TALE. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jeeyun; Im, Young-Hyuck; Jung, Hae Hyun
2005-08-26
The A549 cells, non-small cell lung cancer cell line from human, were resistant to interferon (IFN)-{alpha} treatment. The IFN-{alpha}-treated A549 cells showed increase in protein expression levels of NF-{kappa}B and COX-2. IFN-{alpha} induced NF-{kappa}B binding activity within 30 min and this increased binding activity was markedly suppressed with inclusion of curcumin. Curcumin also inhibited IFN-{alpha}-induced COX-2 expression in A549 cells. Within 10 min, IFN-{alpha} rapidly induced the binding activity of a {gamma}-{sup 32}P-labeled consensus GAS oligonucleotide probe, which was profoundly reversed by curcumin. Taken together, IFN-{alpha}-induced activations of NF-{kappa}B and COX-2 were inhibited by the addition of curcumin in A549more » cells.« less
Ma, Tengfei; Peng, Yingjie; Huang, Wei; Ding, Jianping
2017-01-01
Human NAD-dependent isocitrate dehydrogenase catalyzes the decarboxylation of isocitrate (ICT) into α-ketoglutarate in the Krebs cycle. It exists as the α2βγ heterotetramer composed of the αβ and αγ heterodimers. Previously, we have demonstrated biochemically that the α2βγ heterotetramer and αγ heterodimer can be allosterically activated by citrate (CIT) and ADP. In this work, we report the crystal structures of the αγ heterodimer with the γ subunit bound without or with different activators. Structural analyses show that CIT, ADP and Mg2+ bind adjacent to each other at the allosteric site. The CIT binding induces conformational changes at the allosteric site, which are transmitted to the active site through the heterodimer interface, leading to stabilization of the ICT binding at the active site and thus activation of the enzyme. The ADP binding induces no further conformational changes but enhances the CIT binding through Mg2+-mediated interactions, yielding a synergistic activation effect. ICT can also bind to the CIT-binding subsite, which induces similar conformational changes but exhibits a weaker activation effect. The functional roles of the key residues are verified by mutagenesis, kinetic and structural studies. Our structural and functional data together reveal the molecular mechanism of the allosteric regulation of the αγ heterodimer. PMID:28098230
NF-κB DNA-binding activity in embryos responding to a teratogen, cyclophosphamide
Torchinsky, Arkady; Lishanski, Lucy; Wolstein, Orit; Shepshelovich, Jeanne; Orenstein, Hasida; Savion, Shoshana; Zaslavsky, Zeev; Carp, Howard; Brill, Alexander; Dikstein, Rivka; Toder, Vladimir; Fein, Amos
2002-01-01
Background The Rel/NF-κB transcription factors have been shown to regulate apoptosis in different cell types, acting as inducers or blockers in a stimuli- and cell type-dependent fashion. One of the Rel/NF-κB subunits, RelA, has been shown to be crucial for normal embryonic development, in which it functions in the embryonic liver as a protector against TNFα-induced physiological apoptosis. This study assesses whether NF-κB may be involved in the embryo's response to teratogens. Fot this, we evaluated how NF-KappaB DNA binding activity in embryonic organs demonstraiting differential sensitivity to a reference teratogen, cyclophosphamide, correlates with dysmorphic events induced by the teratogen at the cellular level (excessive apoptosis) and at the organ level (structural anomalies). Results The embryonic brain and liver were used as target organs. We observed that the Cyclophosphamide-induced excessive apoptosis in the brain, followed by the formation of severe craniofacial structural anomalies, was accompanied by suppression of NF-κB DNA-binding activity as well as by a significant and lasting increase in the activity of caspases 3 and 8. However, in the liver, in which cyclophosphamide induced transient apoptosis was not followed by dysmorphogenesis, no suppression of NF-κB DNA-binding activity was registered and the level of active caspases 3 and 8 was significantly lower than in the brain. It has also been observed that both the brain and liver became much more sensitive to the CP-induced teratogenic insult if the embryos were exposed to a combined treatment with the teratogen and sodium salicylate that suppressed NF-κB DNA-binding activity in these organs. Conclusion The results of this study demonstrate that suppression of NF-κB DNA-binding activity in embryos responding to the teratogenic insult may be associated with their decreased resistance to this insult. They also suggest that teratogens may suppress NF-κB DNA-binding activity in the embryonic tissues in an organ type- and dose-dependent fashion. PMID:11893254
Modeling Shear Induced Von Willebrand Factor Binding to Collagen
NASA Astrophysics Data System (ADS)
Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong
2017-11-01
Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).
DNA-binding activity of TNF-{alpha} inducing protein from Helicobacter pylori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuzuhara, T.; Suganuma, M.; Oka, K.
2007-11-03
Tumor necrosis factor-{alpha} (TNF-{alpha}) inducing protein (Tip{alpha}) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-{alpha} and chemokine genes and activation of nuclear factor-{kappa}B. Since Tip{alpha} enters gastric cancer cells, the Tip{alpha} binding molecules in the cells should be investigated. The direct DNA-binding activity of Tip{alpha} was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tip{alpha} and DNA, revealed that the affinity of Tip{alpha} for (dGdC)10 is 2400 times stronger than that of del-Tip{alpha}, an inactive Tip{alpha}. This suggestsmore » a strong correlation between DNA-binding activity and carcinogenic activity of Tip{alpha}. And the DNA-binding activity of Tip{alpha} was first demonstrated with a molecule secreted from H. pylori.« less
Stein, B; Rahmsdorf, H J; Steffen, A; Litfin, M; Herrlich, P
1989-01-01
UV irradiation of human and murine cells enhances the transcription of several genes. Here we report on the primary target of relevant UV absorption, on pathways leading to gene activation, and on the elements receiving the UV-induced signal in the human immunodeficiency virus type 1 (HIV-1) long terminal repeat, in the gene coding for collagenase, and in the cellular oncogene fos. In order to induce the expression of genes. UV radiation needs to be absorbed by DNA and to cause DNA damage of the kind that cannot be repaired by cells from patients with xeroderma pigmentosum group A. UV-induced activation of the three genes is mediated by the major enhancer elements (located between nucleotide positions -105 and -79 of HIV-1, between positions -72 and -65 of the collagenase gene, and between positions -320 and -299 of fos). These elements share no apparent sequence motif and bind different trans-acting proteins; a member of the NF kappa B family binds to the HIV-1 enhancer, the heterodimer of Jun and Fos (AP-1) binds to the collagenase enhancer, and the serum response factors p67 and p62 bind to fos. DNA-binding activities of the factors recognizing the HIV-1 and collagenase enhancers are augmented in extracts from UV-treated cells. The increase in activity is due to posttranslational modification. While AP-1 resides in the nucleus and must be modulated there, NF kappa B is activated in the cytoplasm, indicating the existence of a cytoplasmic signal transduction pathway triggered by UV-induced DNA damage. In addition to activation, new synthesis of AP-1 is induced by UV radiation. Images PMID:2557547
Miyake, Zenshi; Takekawa, Mutsuhiro; Ge, Qingyuan; Saito, Haruo
2007-04-01
The mitogen-activated protein kinase (MAPK) module, composed of a MAPK, a MAPK kinase (MAPKK), and a MAPKK kinase (MAPKKK), is a cellular signaling device that is conserved throughout the eukaryotic world. In mammalian cells, various extracellular stresses activate two major subfamilies of MAPKs, namely, the Jun N-terminal kinases and the p38/stress-activated MAPK (SAPK). MTK1 (also called MEKK4) is a stress-responsive MAPKKK that is bound to and activated by the stress-inducible GADD45 family of proteins (GADD45alpha/beta/gamma). Here, we dissected the molecular mechanism of MTK1 activation by GADD45 proteins. The MTK1 N terminus bound to its C-terminal segment, thereby inhibiting the C-terminal kinase domain. This N-C interaction was disrupted by the binding of GADD45 to the MTK1 N-terminal GADD45-binding site. GADD45 binding also induced MTK1 dimerization via a dimerization domain containing a coiled-coil motif, which is essential for the trans autophosphorylation of MTK1 at Thr-1493 in the kinase activation loop. An MTK1 alanine substitution mutant at Thr-1493 has a severely reduced activity. Thus, we conclude that GADD45 binding induces MTK1 N-C dissociation, dimerization, and autophosphorylation at Thr-1493, leading to the activation of the kinase catalytic domain. Constitutively active MTK1 mutants induced the same events, but in the absence of GADD45.
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Consonni, Sarah V; Gloerich, Martijn; Spanjaard, Emma; Bos, Johannes L
2012-03-06
Epac1 is a cAMP-regulated guanine nucleotide exchange factor for the small G protein Rap. Upon cAMP binding, Epac1 undergoes a conformational change that results in its release from autoinhibition. In addition, cAMP induces the translocation of Epac1 from the cytosol to the plasma membrane. This relocalization of Epac1 is required for efficient activation of plasma membrane-located Rap and for cAMP-induced cell adhesion. This translocation requires the Dishevelled, Egl-10, Pleckstrin (DEP) domain, but the molecular entity that serves as the plasma membrane anchor and the possible mechanism of regulated binding remains elusive. Here we show that Epac1 binds directly to phosphatidic acid. Similar to the cAMP-induced Epac1 translocation, this binding is regulated by cAMP and requires the DEP domain. Furthermore, depletion of phosphatidic acid by inhibition of phospholipase D1 prevents cAMP-induced translocation of Epac1 as well as the subsequent activation of Rap at the plasma membrane. Finally, mutation of a single basic residue within a polybasic stretch of the DEP domain, which abolishes translocation, also prevents binding to phosphatidic acid. From these results we conclude that cAMP induces a conformational change in Epac1 that enables DEP domain-mediated binding to phosphatidic acid, resulting in the tethering of Epac1 at the plasma membrane and subsequent activation of Rap.
An unfolded protein-induced conformational switch activates mammalian IRE1
Acosta-Alvear, Diego; Nguyen, Hieu T; Lee, Crystal P; Chu, Feixia
2017-01-01
The unfolded protein response (UPR) adjusts the cell’s protein folding capacity in the endoplasmic reticulum (ER) according to need. IRE1 is the most conserved UPR sensor in eukaryotic cells. It has remained controversial, however, whether mammalian and yeast IRE1 use a common mechanism for ER stress sensing. Here, we show that similar to yeast, human IRE1α’s ER-lumenal domain (hIRE1α LD) binds peptides with a characteristic amino acid bias. Peptides and unfolded proteins bind to hIRE1α LD’s MHC-like groove and induce allosteric changes that lead to its oligomerization. Mutation of a hydrophobic patch at the oligomerization interface decoupled peptide binding to hIRE1α LD from its oligomerization, yet retained peptide-induced allosteric coupling within the domain. Importantly, impairing oligomerization of hIRE1α LD abolished IRE1’s activity in living cells. Our results provide evidence for a unifying mechanism of IRE1 activation that relies on unfolded protein binding-induced oligomerization. PMID:28971800
Mutant botrocetin-2 inhibits von Willebrand factor-induced platelet agglutination.
Matsui, T; Hori, A; Hamako, J; Matsushita, F; Ozeki, Y; Sakurai, Y; Hayakawa, M; Matsumoto, M; Fujimura, Y
2017-03-01
Essentials Botrocetin-2 (Bot2) binds to von Willebrand factor (VWF) and induces platelet agglutination. We identified Bot2 residues that are required for binding to VWF and glycoprotein (GP) Ib. We produced a mutant Bot2 that binds to VWF but inhibits platelet agglutination. Mutant Bot2 could be used as a potential anti-thrombotic reagent to block VWF-GPIb interaction. Background Botrocetin-2 (Bot2) is a botrocetin-like protein composed of α and β subunits that have been cloned from the snake Bothrops jararaca. Bot2 binds specifically to von Willebrand factor (VWF), and the complex induces glycoprotein (GP) Ib-dependent platelet agglutination. Objectives To exploit Bot2's VWF-binding capacity in order to attempt to create a mutant Bot2 that binds to VWF but inhibits platelet agglutination. Methods and Results Several point mutations were introduced into Bot2 cDNA, and the recombinant protein (recombinant Bot2 [rBot2]) was purified on an anti-botrocetin column. The mutant rBot2 with either Ala at Asp70 in the β subunit (Aspβ70Ala), or Argβ115Ala and Lysβ117Ala, showed reduced platelet agglutination-inducing activity. rBot2 with Aspβ70Ala showed little binding activity towards immobilized VWF on an ELISA plate, whereas rBot2 with Argβ115Ala/Lysβ117Ala showed reduced binding activity towards GPIb (glycocalicin) after forming a complex with VWF. rBot2 point-mutated to oppositely charged Glu at both Argβ115 and Lysβ117 showed normal binding activity towards VWF but no platelet-agglutinating activity. Furthermore, this doubly mutated protein inhibited ristocetin-induced or high shear stress-induced platelet aggregation, and restrained thrombus formation under flow conditions. Conclusions Asp70 in the β subunit of botrocetin is important for VWF binding, and Arg115 and Lys117 in the β subunit are essential for interaction with GPIb. Doubly mutated rBot2, with Argβ115Glu and Lysβ117Glu, repels GPIb and might have potential as an antithrombotic reagent that specifically blocks VWF function. This is the first report on an artificial botrocetin that can inhibit the VWF-GPIb interaction. © 2017 International Society on Thrombosis and Haemostasis.
Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A; Manna, Sunil K
2010-02-19
The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor kappaB (NF-kappaB) and also expression of NF-kappaB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-kappaB (IkappaB alpha) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IkappaB alpha kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-kappaB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy.
Thoh, Maikho; Kumar, Pankaj; Nagarajaram, Hampathalu A.; Manna, Sunil K.
2010-01-01
The role of azadirachtin, an active component of a medicinal plant Neem (Azadirachta indica), on TNF-induced cell signaling in human cell lines was investigated. Azadirachtin blocks TNF-induced activation of nuclear factor κB (NF-κB) and also expression of NF-κB-dependent genes such as adhesion molecules and cyclooxygenase 2. Azadirachtin inhibits the inhibitory subunit of NF-κB (IκBα) phosphorylation and thereby its degradation and RelA (p65) nuclear translocation. It blocks IκBα kinase (IKK) activity ex vivo, but not in vitro. Surprisingly, azadirachtin blocks NF-κB DNA binding activity in transfected cells with TNF receptor-associated factor (TRAF)2, TNF receptor-associated death domain (TRADD), IKK, or p65, but not with TNFR, suggesting its effect is at the TNFR level. Azadirachtin blocks binding of TNF, but not IL-1, IL-4, IL-8, or TNF-related apoptosis-inducing ligand (TRAIL) with its respective receptors. Anti-TNFR antibody or TNF protects azadirachtin-mediated down-regulation of TNFRs. Further, in silico data suggest that azadirachtin strongly binds in the TNF binding site of TNFR. Overall, our data suggest that azadirachtin modulates cell surface TNFRs thereby decreasing TNF-induced biological responses. Thus, azadirachtin exerts an anti-inflammatory response by a novel pathway, which may be beneficial for anti-inflammatory therapy. PMID:20018848
Zhang, Chao; Zhao, Mei; Zhang, Quan-Wu; Gao, Feng-Hou
2016-01-01
Recent research found that Tiron was an effective antioxidant that could act as the intracellular reactive oxygen species (ROS) scavenger or alleviate the acute toxic metal overload in vivo. In this study, we investigated the inhibitory effect of Tiron on matrix metalloproteinase (MMP)-1 and MMP-3 expression in human dermal fibroblast cells. Western blot and ELISA analysis revealed that Tiron inhibited ultraviolet B (UVB)-induced protein expression of MMP-1 and MMP-3. Real-time quantitative PCR confirmed that Tiron could inhibit UVB-induced mRNA expression of MMP-1 and MMP-3. Furthermore, Tiron significantly blocked UVB-induced activation of the MAPK signaling pathway and activator protein (AP)-1 in the downstream of this transduction pathway in fibroblasts. Through the AP-1 binding site mutation, it was found that Tiron could inhibit AP-1-induced upregulation of MMP-1 and MMP-3 expression through blocking AP-1 binding to the AP-1 binding sites in the MMP-1 and MMP-3 promoter region. In conclusion, Tiron may be a novel antioxidant for preventing and treating skin photoaging UV-induced. PMID:27486852
Chemosensitization by a non-apoptogenic heat shock protein 70-binding apoptosis inducing factor mutant
Abstract
HSP70 inhibits apoptosis by neutralizing the caspase activator Apaf-1 and by interacting with apoptosis inducing factor (AIF), a mitochondrial flavoprotein wh...
Yang, Jianbin; Zhao, Dongfang; Wang, Hongpo; Shao, Feng; Wang, Wenjun; Sun, Ruili; Ling, Mingzhi; Zhai, Jingjing; Song, Shijun
2013-01-01
Background Candida albicans (C. albicans), the most common human fungal pathogen, can cause fatal systemic infections under certain circumstances. Mannan-binding lectin (MBL),a member of the collectin family in the C-type lectin superfamily, is an important serum component associated with innate immunity. Toll-like receptors (TLRs) are expressed extensively, and have been shown to be involved in C. albicans-induced cellular responses. We first examined whether MBL modulated heat-killed (HK) C. albicans-induced cellular responses in phorbol 12-myristate 13-acetate (PMA)-activated human THP-1 macrophages. We then investigated the possible mechanisms of its inhibitory effect. Methodology/Principal Finding Enzyme-linked immunosorbent assay (ELISA) and reverse transcriptasepolymerase chain reaction (RT-PCR) analysis showed that MBL at higher concentrations (10–20 µg/ml) significantly attenuated C. albicans-induced chemokine (e.g., IL-8) and proinflammatory cytokine (e.g., TNF-α) production from PMA-activated THP-1 cells at both protein and mRNA levels. Electrophoretic mobility shift assay (EMSA) and Western blot (WB) analysis showed that MBL could inhibit C. albicans-induced nuclear factor-κB (NF-κB) DNA binding and its translocation in PMA-activated THP-1 cells. MBL could directly bind to PMA-activated THP-1 cells in the presence of Ca2+, and this binding decreased TLR2 and TLR4 expressions in C. albicans-induced THP-1 macrophages. Furthermore, the binding could be partially inhibited by both anti-TLR2 monoclonal antibody (clone TL2.1) and anti-TLR4 monoclonal antibody (clone HTA125). In addition, co-immunoprecipitation experiments and microtiter wells assay showed that MBL could directly bind to the recombinant soluble form of extracellular TLR2 domain (sTLR2) and sTLR4. Conclusions/Significance Our study demonstrates that MBL can affect proinflammatory cytokine and chemokine expressions by modifying C. albicans-/TLR-signaling pathways. This study supports an important role for MBL on the regulation of C. albicans-induced cellular responses. PMID:24391778
Transcriptional switches in the control of macronutrient metabolism.
Wise, Alan
2008-06-01
This review shows how some transcription factors respond to alterations in macronutrients. Carbohydrates induce enzymes for their metabolism and fatty acid synthesis. Fatty acids reduce carbohydrate processing, induce enzymes for their metabolism, and increase both gluconeogenesis and storage of fat. Fat stores help control carbohydrate uptake by other cells. The following main transcription factors are discussed: carbohydrate response element-binding protein; sterol regulatory element-binding protein-1c, cyclic AMP response element-binding protein, peroxisome proliferator-activated receptor-alpha, and peroxisome proliferator-activated receptor-gamma.
Shoelson, S E; Sivaraja, M; Williams, K P; Hu, P; Schlessinger, J; Weiss, M A
1993-01-01
SH2 (src-homology 2) domains define a newly recognized binding motif that mediates the physical association of target phosphotyrosyl proteins with downstream effector enzymes. An example of such phosphoprotein-effector coupling is provided by the association of phosphatidylinositol 3-kinase (PI 3-kinase) with specific phosphorylation sites within the PDGF receptor, the c-Src/polyoma virus middle T antigen complex and the insulin receptor substrate IRS-1. Notably, phosphoprotein association with the SH2 domains of p85 also stimulates an increase in catalytic activity of the PI 3-kinase p110 subunit, which can be mimicked by phosphopeptides corresponding to targeted phosphoprotein phosphorylation sites. To investigate how phosphoprotein binding to the p85 SH2 domain stimulates p110 catalytic activation, we have examined the differential effects of phosphotyrosine and PDGF receptor-, IRS-1- and c-Src-derived phosphopeptides on the conformation of an isolated SH2 domain of PI 3-kinase. Although phosphotyrosine and both activating and non-activating phosphopeptides bind to the SH2 domain, activating phosphopeptides bind with higher affinity and induce a qualitatively distinct conformational change as monitored by CD and NMR spectroscopy. Amide proton exchange and protease protection assays further show that high affinity, specific phosphopeptide binding induces non-local dynamic SH2 domain stabilization. Based on these findings we propose that specific phosphoprotein binding to the p85 subunit induces a change in SH2 domain structure which is transmitted to the p110 subunit and regulates enzymatic activity by an allosteric mechanism. Images PMID:8382612
Miyake, Zenshi; Takekawa, Mutsuhiro; Ge, Qingyuan; Saito, Haruo
2007-01-01
The mitogen-activated protein kinase (MAPK) module, composed of a MAPK, a MAPK kinase (MAPKK), and a MAPKK kinase (MAPKKK), is a cellular signaling device that is conserved throughout the eukaryotic world. In mammalian cells, various extracellular stresses activate two major subfamilies of MAPKs, namely, the Jun N-terminal kinases and the p38/stress-activated MAPK (SAPK). MTK1 (also called MEKK4) is a stress-responsive MAPKKK that is bound to and activated by the stress-inducible GADD45 family of proteins (GADD45α/β/γ). Here, we dissected the molecular mechanism of MTK1 activation by GADD45 proteins. The MTK1 N terminus bound to its C-terminal segment, thereby inhibiting the C-terminal kinase domain. This N-C interaction was disrupted by the binding of GADD45 to the MTK1 N-terminal GADD45-binding site. GADD45 binding also induced MTK1 dimerization via a dimerization domain containing a coiled-coil motif, which is essential for the trans autophosphorylation of MTK1 at Thr-1493 in the kinase activation loop. An MTK1 alanine substitution mutant at Thr-1493 has a severely reduced activity. Thus, we conclude that GADD45 binding induces MTK1 N-C dissociation, dimerization, and autophosphorylation at Thr-1493, leading to the activation of the kinase catalytic domain. Constitutively active MTK1 mutants induced the same events, but in the absence of GADD45. PMID:17242196
Identification of an inducible regulator of c-myb expression during T-cell activation.
Phan, S C; Feeley, B; Withers, D; Boxer, L M
1996-01-01
Resting T cells express very low levels of c-Myb protein. During T-cell activation, c-myb expression is induced and much of the increase in expression occurs at the transcriptional level. We identified a region of the c-myb 5' flanking sequence that increased c-myb expression during T-cell activation. In vivo footprinting by ligation-mediated PCR was performed to correlate in vivo protein binding with functional activity. A protein footprint was visible over this region of the c-myb 5' flanking sequence in activated T cells but not in unactivated T cells. An electrophoretic mobility shift assay (EMSA) with nuclear extract from activated T cells and an oligonucleotide of this binding site demonstrated a new protein-DNA complex, referred to as CMAT for c-myb in activated T cells; this complex was not present in unactivated T cells. Because the binding site showed some sequence similarity with the nuclear factor of activated T cells (NFAT) binding site, we compared the kinetics of induction of the two binding complexes and the molecular masses of the two proteins. Studies of the kinetics of induction showed that the NFAT EMSA binding complex appeared earlier than the CMAT complex. The NFAT protein migrated more slowly in a sodium dodecyl sulfate-polyacrylamide gel than the CMAT protein did. In addition, an antibody against NFAT did not cross-react with the CMAT protein. The appearance of the CMAT binding complex was inhibited by both cyclosporin A and rapamycin. The CMAT protein appears to be a novel inducible protein involved in the regulation of c-myb expression during T-cell activation. PMID:8628306
Wong, Joyce J W; Young, Tracy A; Zhang, Jiayan; Liu, Shiheng; Leser, George P; Komives, Elizabeth A; Lamb, Robert A; Zhou, Z Hong; Salafsky, Joshua; Jardetzky, Theodore S
2017-10-03
Nipah virus is an emergent paramyxovirus that causes deadly encephalitis and respiratory infections in humans. Two glycoproteins coordinate the infection of host cells, an attachment protein (G), which binds to cell surface receptors, and a fusion (F) protein, which carries out the process of virus-cell membrane fusion. The G protein binds to ephrin B2/3 receptors, inducing G conformational changes that trigger F protein refolding. Using an optical approach based on second harmonic generation, we show that monomeric and dimeric receptors activate distinct conformational changes in G. The monomeric receptor-induced changes are not detected by conformation-sensitive monoclonal antibodies or through electron microscopy analysis of G:ephrinB2 complexes. However, hydrogen/deuterium exchange experiments confirm the second harmonic generation observations and reveal allosteric changes in the G receptor binding and F-activating stalk domains, providing insights into the pathway of receptor-activated virus entry.Nipah virus causes encephalitis in humans. Here the authors use a multidisciplinary approach to study the binding of the viral attachment protein G to its host receptor ephrinB2 and show that monomeric and dimeric receptors activate distinct conformational changes in G and discuss implications for receptor-activated virus entry.
Aleyasin, Hossein; Karuppagounder, Saravanan S; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L; Riggins, Gregory J; Gazaryan, Irina; Starkov, Anatoly A; Andersen, Julie K; Ratan, Rajiv R
2015-01-10
Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21(cip1/waf1), in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke.
Ryter, Stefan W; Xi, Sichuan; Hartsfield, Cynthia L; Choi, Augustine M K
2002-08-01
Hypoxia induces the stress protein heme oxygenase-1 (HO-1), which participates in cellular adaptation. The molecular pathways that regulate ho-1 gene expression under hypoxia may involve mitogen activated protein kinase (MAPK) signaling and reactive oxygen. Hypoxia (8 h) increased HO-1 mRNA in rat pulmonary aortic endothelial cells (PAEC), and also activated both extracellular signal-regulated kinase 1 (ERK1)/ERK2 and p38 MAPK pathways. The role of these kinases in hypoxia-induced ho-1 gene expression was examined using chemical inhibitors of these pathways. Surprisingly, SB203580, an inhibitor of p38 MAPK, and PD98059, an inhibitor of mitogen-activated protein kinase kinase (MEK1), strongly enhanced hypoxia-induced HO-1 mRNA expression in PAEC. UO126, a MEK1/2 inhibitor, enhanced HO-1 expression in PAEC under normoxia, but not hypoxia. Diphenylene iodonium, an inhibitor of NADPH oxidase, also induced the expression of HO-1 in PAEC under both normoxia and hypoxia. Similar results were observed in aortic vascular smooth muscle cells. Furthermore, hypoxia induced activator protein (AP-1) DNA-binding activity in PAEC. Pretreatment with SB203580 and PD98059 enhanced AP-1 binding activity under hypoxia in PAEC; UO126 stimulated AP-1 binding under normoxia, whereas diphenylene iodonium stimulated AP-1 binding under normoxia and hypoxia. These results suggest a relationship between MAPK and hypoxic regulation of ho-1 in vascular cells, involving AP-1.
Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin
2006-01-01
The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918
Structural Basis for Activation of Fatty Acid-binding Protein 4
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gillilan,R.; Ayers, S.; Noy, N.
2007-01-01
Fatty acid-binding protein 4 (FABP4) delivers ligands from the cytosol to the nuclear receptor PPAR{gamma} in the nucleus, thereby enhancing the transcriptional activity of the receptor. Notably, FABP4 binds multiple ligands with a similar affinity but its nuclear translocation is activated only by specific compounds. To gain insight into the structural features that underlie the ligand-specificity in activation of the nuclear import of FABP4, we solved the crystal structures of the protein complexed with two compounds that induce its nuclear translocation, and compared these to the apo-protein and to FABP4 structures bound to non-activating ligands. Examination of these structures indicatesmore » that activation coincides with closure of a portal loop phenylalanine side-chain, contraction of the binding pocket, a subtle shift in a helical domain containing the nuclear localization signal of the protein, and a resultant change in oligomeric state that exposes the nuclear localization signal to the solution. Comparisons of backbone displacements induced by activating ligands with a measure of mobility derived from translation, libration, screw (TLS) refinement, and with a composite of slowest normal modes of the apo state suggest that the helical motion associated with the activation of the protein is part of the repertoire of the equilibrium motions of the apo-protein, i.e. that ligand binding does not induce the activated configuration but serves to stabilize it. Nuclear import of FABP4 can thus be understood in terms of the pre-existing equilibrium hypothesis of ligand binding.« less
Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong
2016-12-06
Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.
Calmodulin fishing with a structurally disordered bait triggers CyaA catalysis
O’Brien, Darragh P.; Durand, Dominique; Voegele, Alexis; Hourdel, Véronique; Davi, Marilyne; Chamot-Rooke, Julia; Vachette, Patrice; Brier, Sébastien; Ladant, Daniel
2017-01-01
Once translocated into the cytosol of target cells, the catalytic domain (AC) of the adenylate cyclase toxin (CyaA), a major virulence factor of Bordetella pertussis, is potently activated by binding calmodulin (CaM) to produce supraphysiological levels of cAMP, inducing cell death. Using a combination of small-angle X-ray scattering (SAXS), hydrogen/deuterium exchange mass spectrometry (HDX-MS), and synchrotron radiation circular dichroism (SR-CD), we show that, in the absence of CaM, AC exhibits significant structural disorder, and a 75-residue-long stretch within AC undergoes a disorder-to-order transition upon CaM binding. Beyond this local folding, CaM binding induces long-range allosteric effects that stabilize the distant catalytic site, whilst preserving catalytic loop flexibility. We propose that the high enzymatic activity of AC is due to a tight balance between the CaM-induced decrease of structural flexibility around the catalytic site and the preservation of catalytic loop flexibility, allowing for fast substrate binding and product release. The CaM-induced dampening of AC conformational disorder is likely relevant to other CaM-activated enzymes. PMID:29287065
Grigorov, I; Lazić, T; Cvetković, I; Milosavljević, T; Petrović, M
2001-01-01
Transcription of the rat gene encoding haptoglobin (Hp) is highly induced during acute phase (AP) response which has been previously shown to be mediated by inducible STAT3 member of the Signal Transducer and Activators of Transcription (STATs) family proteins. In this study, we observed that under normal but not in the turpentine induced AP conditions, another member of the STAT family proteins, STAT5b is expressed and binds to the hormone regulatory element (HRE) of the rat Hp gene. We found that the nuclear amounts of constitutively active STAT5b in rat liver decreased significantly with time of turpentine treatment as opposed to that of cytosol STAT5b, suggesting possible export of constitutive STAT5b from the nucleus. Nuclear accumulation and binding of inducible STAT3 proteins to the rat Hp gene HRE following turpentine treatment implicated that STAT5b negatively regulates Hp gene expression during normal conditions.
Csermely, P; Szamel, M; Resch, K; Somogyi, J
1988-05-15
In the primary structure of protein kinase C, the presence of a putative metal-binding site has been suggested (Parker, P.J., Coussens, L., Totty, N., Rhee, L., Young, S., Chen, E., Stabel, S., Waterfield, M.D., and Ullrich, A. (1986) Science 233, 853-859). In the present report, we demonstrate that the most abundant intracellular heavy metal, zinc, can increase the activity of cytosolic protein kinase C. Zinc reversibly binds the enzyme to plasma membranes, and it may contribute to the calcium-induced binding as well. The intracellular heavy metal chelator N,N,N',N'-tetrakis(2-pyridylmethyl) ethylenediamine prevents the phorbol ester- and antigen-induced translocation of protein kinase C. This effect can be totally reversed by the concomitant addition of Zn2+, while Fe2+ and Mn2+ are only partially counteractive. Our results suggest that zinc can activate protein kinase C and contributes to its binding to plasma membranes in T lymphocytes induced by Ca2+, phorbol ester, or antigen.
Haga, Sanae; Kanno, Akira; Ozawa, Takeaki; Morita, Naoki; Asano, Mami; Ozaki, Michitaka
2017-07-21
Liver injury is often observed in various pathological conditions including posthepatectomy state and cancer chemotherapy. It occurs mainly as a consequence of the combined necrotic and apoptotic types of cell death. In order to study liver/hepatocyte injury by necrotic type of cell death, we studied signal-regulated necrosis (necroptosis) by newly developing an optic probe detecting receptor-interacting protein (RIP)1/RIP3 binding, an essential process for necroptosis induction. In the mouse hepatocyte cell line, TIB-73 cells, TNF-a/cycloheximide (T/C) induced RIP1/3 binding only when caspase activity was suppressed by z-VAD-fmk (zVAD), a caspase-specific inhibitor. T/C/zVADinduced RIP1/3-binding was inhibited by necrostatin-1 (Nec-1), an allosteric inhibitor of RIP1. The reduced cell survival by T/C/zVAD was improved by Nec-1. These facts indicate that T/C induces necroptosis of hepatocytes when apoptotic pathway is inhibited/unavailable. FasL also induced cell death which was only partially inhibited by zVAD, indicating the possible involvement of necroptosis other than apoptosis. FasL activated caspase-3 and, similarly, induced RIP1/3-binding when caspases were inactivated. Interestingly, FasL-induced RIP1/3 binding was significantly suppressed by the antioxidants, Trolox and N-acetyl cysteine (NAC), suggesting the involvement of reactive oxygen species (ROS) in FasL-induced necroptotic cellular processes. H₂O₂, by itself, induced RIP1/3 binding that was suppressed by Nec-1, but not by zVAD. Hypoxia induced RIP1/3 binding after reoxygenation, which was suppressed by Nec-1 or by the antioxidants. Cell death induced by hypoxia/reoxygenation (H/R) was also improved by Nec-1. Similar to H₂O₂, H/R did not require caspase inhibition for RIP1/3 binding, suggesting the involvement of a caspase-independent mechanism for non-ligand induced and/or redox-mediated necroptosis. These data indicate that ROS induce necroptosis, and mediate the FasL- and hypoxia-induced necroptosis via a molecular mechanism that differs from a conventional caspase-dependent pathway. In conclusion, necroptosis is potentially involved in liver/hepatocyte injury induced by oxidative stress and FasL, other than apoptosis.
Iwanowicz, Edwin J; Kimball, S David; Lin, James; Lau, Wan; Han, W-C; Wang, Tammy C; Roberts, Daniel G M; Schumacher, W A; Ogletree, Martin L; Seiler, Steven M
2002-11-04
A series of retro-binding inhibitors of human alpha-thrombin was prepared to elucidate structure-activity relationships (SAR) and optimize in vivo performance. Compounds 9 and 11, orally active inhibitors of thrombin catalytic activity, were identified to be efficacious in a thrombin-induced lethality model in mice.
Hung, Yu-Chun; Hsu, Chun-Chieh; Chung, Ching-Hu; Huang, Tur-Fu
2016-07-01
In addition to antiplatelet activity, disintegrin, a small-mass RGD-containing polypeptide, has been shown to exert anti-inflammatory effects but the mechanism involved remains unclear. In this study, we report that trimucrin, a disintegrin from the venom of Trimeresurus mucrosquamatus, inhibits lipopolysaccharide (LPS)-induced stimulation of THP-1 and RAW 264.7 cells. We also investigate the underlying mechanism. Trimucrin decreased the release of proinflammatory cytokines including tumor necrosis factor α (TNFα), interleukin-6 (IL-6), nitric oxide, and reactive oxygen species (ROS), and inhibited the adhesion and migration of LPS-activated phagocytes. Trimucrin significantly blocked the expression of nuclear factor kappaB (NF-κB)-related downstream inducible enzymes such as inducible nitric oxide synthase (iNOS) and COX-2. In addition, its anti-inflammatory effect was associated with the decreased mitogen-activated protein kinase (MAPK) phosphorylation. Furthermore, trimucrin concentration dependently inhibited LPS-induced phosphorylation of focal adhesion kinase (FAK), PI3K, and Akt. Trimucrin also reversed the DNA-binding activity of NF-κB by suppressing the LPS-induced nuclear translocation of p65 and the cytosolic IκB release. Flow cytometric analyses showed that trimucrin bound to cells in a concentration-dependent manner. The anti-αVβ3 mAb also specifically decreased the binding of fluorescein isothiocyanate (FITC)-conjugated trimucrin. Binding assays demonstrated that integrin αVβ3 was the binding site for trimucrin on THP-1 and RAW 264.7 cells. In conclusion, we showed that trimucrin decreases the inflammatory reaction through the attenuation of iNOS expression and nitric oxide (NO) production by blocking MAP kinase and the NF-κB activation in LPS-stimulated THP-1 and RAW 264.7 cells.
Abou-Kandil, Ammar; Eisa, Nora; Jabareen, Azhar; Huleihel, Mahmoud
2016-01-01
ABSTRACT The activated estrogen (E2) receptor α (ERα) is a potent transcription factor that is involved in the activation of various genes by 2 different pathways; a classical and non-classical. In classical pathway, ERα binds directly to E2-responsive elements (EREs) located in the appropriate genes promoters and stimulates their transcription. However, in non-classical pathway, the ERα can indirectly bind with promoters and enhance their activity. For instance, ERα activates BRCA1 expression by interacting with jun/fos complex bound to the AP-1 site in BRCA1 promoter. Interference with the expression and/or functions of BRCA1, leads to high risk of breast or/and ovarian cancer. HTLV-1Tax was found to strongly inhibit BRCA1 expression by preventing the binding of E2–ERα complex to BRCA1 promoter. Here we examined Tax effect on ERα induced activation of genes by the classical pathway by testing its influence on E2-induced expression of ERE promoter-driven luciferase reporter (ERE-Luc). Our findings showed that E2 profoundly stimulated this reporter expression and that HTLV-1Tax significantly induced this stimulation. This result is highly interesting because in our previous study Tax was found to strongly block the E2-ERα-mediated activation of BRCA1 expression. ERα was found to produce a big complex by recruiting various cofactors in the nucleus before binding to the ERE region. We also found that only part of the reqruited cofactors are required for the transcriptional activity of ERα complex. Chip assay revealed that the binding of Tax to the ERα complex, did not interfere with its link to ERE region. PMID:27420286
Wang, Mingyong; Chen, Yue; Zhang, Yani; Zhang, Liyun; Lu, Xiao; Chen, Zhengliang
2011-01-01
Mannan-binding lectin (MBL) plays a key role in the lectin pathway of complement activation and can influence cytokine expression. Toll-like receptor 4 (TLR4) is expressed extensively and has been demonstrated to be involved in lipopolysaccharide (LPS)-induced signaling. We first sought to determine whether MBL exposure could modulate LPS-induced inflammatory cytokine secretion and nuclear factor-κB (NF-κB) activity by using the monocytoid cell line THP-1. We then investigated the possible mechanisms underlying any observed regulatory effect. Using ELISA and reverse transcriptase polymerase chain reaction (RT-PCR) analysis, we found that at both the protein and mRNA levels, treatment with MBL suppresses LPS-induced tumor-necrosis factor (TNF)-α and IL-12 production in THP-1 cells. An electrophoretic mobility shift assay and western blot analysis revealed that MBL treatment can inhibit LPS-induced NF-κB DNA binding and translocation in THP-1 cells. While the binding of MBL to THP-1 cells was evident at physiological calcium concentrations, this binding occurred optimally in response to supraphysiological calcium concentrations. This binding can be partly inhibited by treatment with either a soluble form of recombinant TLR4 extracellular domain or anti-TLR4 monoclonal antibody (HTA125). Activation of THP-1 cells by LPS treatment resulted in increased MBL binding. We also observed that MBL could directly bind to the extracellular domain of TLR4 in a dose-dependent manner, and this interaction could attenuate the binding of LPS to cell surfaces. Taken together, these data suggest that MBL may affect cytokine expression through modulation of LPS-/TLR-signaling pathways. These findings suggest that MBL may play an important role in both immune regulation and the signaling pathways involved in cytokine networks. PMID:21383675
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Xi; Zhou, Xixi; Du, Libo
2014-01-15
Inhibition of DNA repair is a recognized mechanism for arsenic enhancement of ultraviolet radiation-induced DNA damage and carcinogenesis. Poly(ADP-ribose) polymerase-1 (PARP-1), a zinc finger DNA repair protein, has been identified as a sensitive molecular target for arsenic. The zinc finger domains of PARP-1 protein function as a critical structure in DNA recognition and binding. Since cellular poly(ADP-ribosyl)ation capacity has been positively correlated with zinc status in cells, we hypothesize that arsenite binding-induced zinc loss from PARP-1 is equivalent to zinc deficiency in reducing PARP-1 activity, leading to inhibition of DNA repair. To test this hypothesis, we compared the effects ofmore » arsenite exposure with zinc deficiency, created by using the membrane-permeable zinc chelator TPEN, on 8-OHdG formation, PARP-1 activity and zinc binding to PARP-1 in HaCat cells. Our results show that arsenite exposure and zinc deficiency had similar effects on PARP-1 protein, whereas supplemental zinc reversed these effects. To investigate the molecular mechanism of zinc loss induced by arsenite, ICP-AES, near UV spectroscopy, fluorescence, and circular dichroism spectroscopy were utilized to examine arsenite binding and occupation of a peptide representing the first zinc finger of PARP-1. We found that arsenite binding as well as zinc loss altered the conformation of zinc finger structure which functionally leads to PARP-1 inhibition. These findings suggest that arsenite binding to PARP-1 protein created similar adverse biological effects as zinc deficiency, which establishes the molecular mechanism for zinc supplementation as a potentially effective treatment to reverse the detrimental outcomes of arsenic exposure. - Highlights: • Arsenite binding is equivalent to zinc deficiency in reducing PARP-1 function. • Zinc reverses arsenic inhibition of PARP-1 activity and enhancement of DNA damage. • Arsenite binding and zinc loss alter the conformation of zinc finger structure.« less
Aleyasin, Hossein; Karuppagounder, Saravanan S.; Kumar, Amit; Sleiman, Sama; Basso, Manuela; Ma, Thong; Siddiq, Ambreena; Chinta, Shankar J.; Brochier, Camille; Langley, Brett; Haskew-Layton, Renee; Bane, Susan L.; Riggins, Gregory J.; Gazaryan, Irina; Starkov, Anatoly A.; Andersen, Julie K.
2015-01-01
Abstract Aims: Pharmacological activation of the adaptive response to hypoxia is a therapeutic strategy of growing interest for neurological conditions, including stroke, Huntington's disease, and Parkinson's disease. We screened a drug library with known safety in humans using a hippocampal neuroblast line expressing a reporter of hypoxia-inducible factor (HIF)-dependent transcription. Results: Our screen identified more than 40 compounds with the ability to induce hypoxia response element-driven luciferase activity as well or better than deferoxamine, a canonical activator of hypoxic adaptation. Among the chemical entities identified, the antihelminthic benzimidazoles represented one pharmacophore that appeared multiple times in our screen. Secondary assays confirmed that antihelminthics stabilized the transcriptional activator HIF-1α and induced expression of a known HIF target gene, p21cip1/waf1, in post-mitotic cortical neurons. The on-target effect of these agents in stimulating hypoxic signaling was binding to free tubulin. Moreover, antihelminthic benzimidazoles also abrogated oxidative stress-induced death in vitro, and this on-target effect also involves binding to free tubulin. Innovation and Conclusions: These studies demonstrate that tubulin-binding drugs can activate a component of the hypoxic adaptive response, specifically the stabilization of HIF-1α and its downstream targets. Tubulin-binding drugs, including antihelminthic benzimidazoles, also abrogate oxidative neuronal death in primary neurons. Given their safety in humans and known ability to penetrate into the central nervous system, antihelminthic benzimidazoles may be considered viable candidates for treating diseases associated with oxidative neuronal death, including stroke. Antioxid. Redox Signal. 22, 121–134. PMID:24766300
Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.
2014-01-01
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477
Valente, Anthony J.; Yoshida, Tadashi; Murthy, Subramanyam N.; Sakamuri, Siva S. V. P.; Katsuyama, Masato; Clark, Robert A.; Delafontaine, Patrice
2012-01-01
The redox-sensitive transcription factors NF-κB and activator protein-1 (AP-1) are critical mediators of ANG II signaling. The promitogenic and promigratory factor interleukin (IL)-18 is an NF-κB- and AP-1-responsive gene. Therefore, we investigated whether ANG II-mediated smooth muscle cell (SMC) migration and proliferation involve IL-18. ANG II induced rat carotid artery SMC migration and proliferation and IL-18 and metalloproteinase (MMP)-9 expression via ANG II type 1 (AT1) receptor. ANG II-induced superoxide generation, NF-κB and AP-1 activation, and IL-18 and MMP-9 induction were all markedly attenuated by losartan, diphenyleneiodonium chloride (DPI), and Nox1 knockdown. Similar to ANG II, addition of IL-18 also induced superoxide generation, activated NF-κB and AP-1, and stimulated SMC migration and proliferation, in part via Nox1, and both ANG II and IL-18 induced NOX1 transcription in an AP-1-dependent manner. AT1 physically associates with Nox1 in SMC, and ANG II enhanced this binding. Interestingly, exogenous IL-18 neither induced AT1 binding to Nox1 nor enhanced the ANG II-induced increase in AT1/Nox1 binding. Importantly, IL-18 knockdown, or pretreatment with IL-18 neutralizing antibodies, or IL-18 binding protein, all attenuated the migratory and mitogenic effects of ANG II. Continuous infusion of ANG II for 7 days induced carotid artery hyperplasia in rats via AT1 and was associated with increased AT1/Nox1 binding (despite lower AT1 levels); increased DPI-inhibitable superoxide production; increased phospho-IKKβ, JNK, p65, and c-Jun; and induction of IL-18 and MMP-9 in endothelium-denuded carotid arteries. These results indicate that IL-18 amplifies the ANG II-induced, redox-dependent inflammatory cascades by activating similar promitogenic and promigratory signal transduction pathways. The ANG II/Nox1/IL-18 pathway may be critical in hyperplastic vascular diseases, including atherosclerosis and restenosis. PMID:22636674
NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya
2010-12-03
Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network.more » To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pujari, Radha; Eligar, Sachin M.; Kumar, Natesh
2012-03-23
Highlights: Black-Right-Pointing-Pointer RBL, a potent mitogenic and complex N-glycan specific lectin binds to CD45 on PBMC. Black-Right-Pointing-Pointer RBL triggers CD45-mediated signaling involved in activation of p38MAPK and STAT-5. Black-Right-Pointing-Pointer Inhibition of CD45 PTPase signaling blocks RBL-induced ZAP70 phosphorylation. Black-Right-Pointing-Pointer RBL-CD45 mediated signaling is crucial for RBL-induced immunodulatory activities. -- Abstract: We earlier reported the mitogenic and immunostimulatory activities of Rhizoctonia bataticola lectin (RBL), purified from phytopathogenic fungus R. bataticola in human PBMC. The lectin demonstrates specificity towards glycoproteins containing complex N-glycans. Since CD45-protein tyrosine phosphatase that abundantly expresses N-glycans is important in T-cell signaling, the study aimed to investigate themore » involvement of CD45 in the immunomodulatory activities of RBL. Flowcytometry and confocal microscopy studies revealed that RBL exhibited binding to PBMC and colocalized with CD45. The binding was comparable in cells expressing different CD45 isoforms-RA, -RB and -RO. CD45 blocking antibody reduced the binding and proliferation of PBMC induced by RBL. CD45-PTPase inhibitor dephostatin inhibited RBL-induced proliferation, expression of CD25 and pZAP-70. RBL-induced secretion of Th1/Th2 cytokines were significantly inhibited in presence of dephostatin. Also, dephostatin blocked phosphorylation of p38MAPK and STAT-5 that was crucial for the biological functions of RBL. The study demonstrates the involvement of CD45-mediated signaling in RBL-induced PBMC proliferation and Th1/Th2 cytokine secretion through activation of p38MAPK and STAT-5.« less
Staphylococcal enterotoxins bind H-2Db molecules on macrophages
NASA Technical Reports Server (NTRS)
Beharka, A. A.; Iandolo, J. J.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)
1995-01-01
We screened a panel of monoclonal antibodies against selected macrophage cell surface molecules for their ability to inhibit enterotoxin binding to major histocompatibility complex class II-negative C2D (H-2b) macrophages. Two monoclonal antibodies, HB36 and TIB126, that are specific for the alpha 2 domain of major histocompatibility complex class I, blocked staphylococcal enterotoxins A and B (SEA and SEB, respectively) binding to C2D macrophages in a specific and concentration-dependent manner. Inhibitory activities were haplotype-specific in that SEA and SEB binding to H-2k or H-2d macrophages was not inhibited by either monoclonal antibody. HB36, but not TIB126, inhibited enterotoxin-induced secretion of cytokines by H-2b macrophages. Lastly, passive protection of D-galactosamine-sensitized C2D mice by injection with HB36 antibody prevented SEB-induced death. Therefore, SEA and SEB binding to the alpha 2 domain of the H-2Db molecule induces biological activity and has physiological consequences.
Fernández, L; Flores-Morales, A; Lahuna, O; Sliva, D; Norstedt, G; Haldosén, L A; Mode, A; Gustafsson, J A
1998-04-01
Signal transducers and activators of transcription (Stat) proteins are latent cytoplasmic transcription factors that are tyrosine phosphorylated by Janus kinases (Jak) in response to GH and other cytokines. GH activates Stat5 by a mechanism that involves tyrosine phosphorylation and nuclear translocation. However, the mechanisms that turn off the GH-activated Jak2/Stat5 pathway are unknown. Continuous exposure to GH of BRL-4 cells, a rat hepatoma cell line stably transfected with rat GH receptor, induces a rapid but transient activation of Jak2 and Stat5. GH-induced Stat5 DNA-binding activity was detected after 2 min and reached a maximum at 10 min. Continued exposure to GH resulted in a desensitization characterized by 1) a rapid decrease in Stat5 DNA-binding activity. The rate of decrease of activity was rapid up to 1 h of GH treatment, and the remaining activity declined slowly thereafter. The activity of Stat5 present after 5 h is still higher than the control levels and almost 10-20% with respect to maximal activity at 10 min; and 2) the inability of further GH treatment to reinduce activation of Stat5. In contrast, with transient exposures of BRL-4 cells to GH, Stat5 DNA-binding activity could repeatedly be induced. GH-induced Jak2 and Stat5 activities were independent of ongoing protein synthesis. However, Jak2 tyrosine phosphorylation and Stat5 DNA-binding activity were prolonged for at least 4 h in the presence of cycloheximide, which suggests that the maintenance of desensitization requires ongoing protein synthesis. Furthermore, inhibition of protein synthesis potentiated GH-induced transcriptional activity in BRL-4 cells transiently transfected with SPIGLE1CAT, a reporter plasmid activated by Stat5. GH-induced Jak2 and Stat5 activation were not affected by D609 or mepacrine, both inhibitors of phospholipase C. However, in the presence of D609 and mepacrine, GH maintained prolonged Jak2 and Stat5 activation. Transactivation of SPIGLE1 by GH was potentiated by mepacrine and D609 but not by the phospholipase A2 inhibitor AACOCF3. Thus, a regulatory circuit of GH-induced transcription through the Jak2/Stat5-signaling pathway includes a prompt GH-induced activation of Jak2/Stat5 followed by a negative regulatory response; ongoing protein synthesis and intracellular signaling pathways, where phospholipase C activity is involved, play a critical role to desensitize the GH-activated Jak2/Stat5-signaling pathway.
Grot, Stéphanie; Leclerc, Marie-Eve; Luck, David
2018-05-23
We designed an fMRI study to pinpoint the neural correlates of active and passive binding in working memory. Participants were instructed to memorize three words and three spatial locations. In the passive binding condition, words and spatial locations were directly presented as bound. Conversely, in the active binding condition, words and spatial locations were presented as separated, and participants were directed to intentionally create associations between them. Our results showed that participants performed better on passive binding relative to active binding. FMRI analysis revealed that both binding conditions induced greater activity within the hippocampus. Additionally, our analyses divulged regions specifically engaged in passive and active binding. Altogether, these data allow us to propose the hippocampus as a central candidate for working memory binding. When needed, a frontal-parietal network can contribute to the rearrangement of information. These findings may inform theories of working memory binding. Copyright © 2018. Published by Elsevier B.V.
Nie, Mei; Balda, Maria S.; Matter, Karl
2012-01-01
A central component of the cellular stress response is p21WAF1/CIP1, which regulates cell proliferation, survival, and differentiation. Inflammation and cell stress often up-regulate p21 posttranscriptionally by regulatory mechanisms that are poorly understood. ZO-1–associated nucleic acid binding protein (ZONAB)/DbpA is a Y-box transcription factor that is regulated by components of intercellular junctions that are affected by cytokines and tissue damage. We therefore asked whether ZONAB activation is part of the cellular stress response. Here, we demonstrate that ZONAB promotes cell survival in response to proinflammatory, hyperosmotic, and cytotoxic stress and that stress-induced ZONAB activation involves the Rho regulator GEF-H1. Unexpectedly, stress-induced ZONAB activation does not stimulate ZONAB’s activity as a transcription factor but leads to the posttranscriptional up-regulation of p21 protein and mRNA. Up-regulation is mediated by ZONAB binding to specific sites in the 3′-untranslated region of the p21 mRNA, resulting in mRNA stabilization and enhanced translation. Binding of ZONAB to mRNA is activated by GEF-H1 via Rho stimulation and also mediates Ras-induced p21 expression. We thus identify a unique type of stress and Rho signaling activated pathway that drives mRNA stabilization and translation and links the cellular stress response to p21 expression and cell survival. PMID:22711822
Zheng, Jie; Lou, Jessica R.; Zhang, Xiao-Xi; Benbrook, Doris M.; Hanigan, Marie H.; Lind, Stuart E.; Ding, Wei-Qun
2013-01-01
A variety of metal-binding compounds have been found to exert anti-cancer activity. We postulated that N-acetylcysteine (NAC), which is a membrane-permeable metal-binding compound, might have anti-cancer activity in the presence of metals. We found that NAC/Cu(II) significantly alters growth and induces apoptosis in human cancer lines, yet NAC/Zn(II) and NAC/Fe(III) do not. We further confirmed that this cytotoxicity of NAC/Cu(II) is attributed to reactive oxygen species (ROS). These findings indicate that the combination of Cu(II) and thiols generates cytotoxic ROS that induce apoptosis in cancer cells. They also indicate a fourth class of anti-neoplastic metal-binding compounds, the “ROS generator”. PMID:20667650
Liu, Dali; Yumoto, Hiromichi; Hirota, Katsuhiko; Murakami, Keiji; Takahashi, Kanako; Hirao, Kouji; Matsuo, Takashi; Ohkura, Kazuto; Nagamune, Hideaki; Miyake, Yoichiro
2008-01-01
Streptococcus intermedius is a commensal associated with serious, deep-seated purulent infections in major organs, such as the brain and liver. Histone-like DNA binding protein (HLP) is an accessory architectural protein in a variety of bacterial cellular processes. In this study, we investigated the mechanisms of pro-inflammatory cytokine inductions in THP-1 cells by stimulation with recombinant HLP of S. intermedius (rSi-HLP). rSi-HLP stimulation-induced production of pro-inflammatory cytokines (IL-8, IL-1 beta and TNF-alpha) occurred in a time- and dose-dependent manner. In contrast with the heat-stable activity of DNA binding, the induction activity of rSi-HLP was heat-unstable. In subsequent studies, rSi-HLP acted cooperatively with lipoteichoic acid, the synthetic Toll-like receptor 2 agonist, Pam3CSK4, and the cytosolic nucleotide binding oligomerization domain 2 receptor agonist, muramyldipeptide. Furthermore, Western blot and blocking assays with specific inhibitors showed that rSi-HLP stimulation induced the activation of cell signal transduction pathways, extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK). In addition to its physiological role in bacterial growth through DNA binding, these results indicate that Si-HLP can trigger a cascade of events that induce pro-inflammatory responses via ERK1/2 and JNK signal pathways, and suggest that bacterial HLP may contribute to the activation of host innate immunity during bacterial infection.
Song, Kyu Young; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.
2016-01-01
Expression of the mu-opioid receptor (MOR) protein is controlled by extensive transcriptional and post-transcriptional processing. MOR gene expression has previously been shown to be altered by a post-transcriptional mechanism involving the MOR mRNA untranslated region (UTR). Here, we demonstrate for the first time the role of heterogeneous nuclear ribonucleic acids (hnRNA)-binding protein (hnRNP) K and poly(C)-binding protein 1 (PCBP1) as post-transcriptional inducers in MOR gene regulation. In the absence of morphine, a significant level of MOR mRNA is sustained in its resting state and partitions in the translationally inactive polysomal fraction. Morphine stimulation activates the downstream targets hnRNP K and PCPB1 and induces partitioning of the MOR mRNA to the translationally active fraction. Using reporter and ligand binding assays, as well as RNA EMSA, we reveal potential RNP binding sites located in the 5′-untranslated region of human MOR mRNA. In addition, we also found that morphine-induced RNPs could regulate MOR expression. Our results establish the role of hnRNP K and PCPB1 in the translational control of morphine-induced MOR expression in human neuroblastoma (NMB) cells as well as cells stably expressing MOR (NMB1). PMID:27292014
Structural Requirements For Bone Sialoprotein Binding And Modulation Of Matrix Metalloproteinase-2
Jain, Alka; Karadag, Abdullah; Fisher, Larry W.; Fedarko, Neal S.
2008-01-01
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2′s propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation. PMID:18729384
Structural requirements for bone sialoprotein binding and modulation of matrix metalloproteinase-2.
Jain, Alka; Karadag, Abdullah; Fisher, Larry W; Fedarko, Neal S
2008-09-23
Bone sialoprotein (BSP) has been shown to induce limited gelatinase activity in latent matrix metalloproteinase-2 (MMP-2) without removal of the propeptide and to restore enzymatic activity to MMP-2 previously inhibited by tissue inhibitor of matrix metalloproteinase-2 (TIMP2). The current study identifies structural domains in human BSP and MMP-2 that contribute to these interactions. The 26 amino acid domain encoded by exon 4 of BSP is shown by a series of binding and activity assays to be involved in the displacement of MMP-2's propeptide from the active site and thereby inducing the protease activity. Binding assays in conjunction with enzyme activity assays demonstrate that both amino- and carboxy-terminal domains of BSP contribute to restoration of activity to TIMP2-inhibited MMP-2, while the MMP-2 hemopexin domain is not required for reactivation.
Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H
2014-05-23
Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla
2006-11-01
The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.
Yu, Zhanyang; Zhang, Yu; Liu, Ning; Yuan, Jing; Lin, Li; Zhuge, Qichuan; Xiao, Jian; Wang, Xiaoying
2016-07-01
Neuroglobin (Ngb) is a tissue globin specifically expressed in brain neurons. Recent studies by our laboratory and others have demonstrated that Ngb is protective against stroke and related neurological disorders, but the mechanisms remain poorly understood. We previously identified cytochrome c1 (Cyc1) as an Ngb-interacting molecule by yeast two-hybrid screening. Cyc1 is a subunit of mitochondria complex III, which is a component of mitochondrial respiratory chain and a major source of reactive oxygen species (ROS) production under both physiological and pathological conditions. In this study, we for the first time defined Ngb-Cyc1 binding, and investigated its roles in oxygen-glucose deprivation (OGD)/reoxygenation-induced neurotoxicity and ROS production in primary neurons. Immunocytochemistry and co-immunoprecipitation validated Ngb-Cyc1 binding, which was significantly increased by OGD and Ngb overexpression. We found 4 h OGD with/without 4 h reoxygenation significantly increased complex III activity, but this activity elevation was significantly attenuated in three groups of neurons: Ngb overexpression, specific complex III inhibitor stigmatellin, or stigmatellin plus Ngb overexpression, whereas there was no significant differences between these three groups, suggesting Ngb-Cyc1 binding may function in suppressing OGD-mediated complex III activity elevation. Importantly, these three groups of neurons also showed significant decreases in OGD-induced superoxide anion generation and neurotoxicity. These results suggest that Ngb can bind to mitochondrial complex III subunit Cyc1, leading to suppression of OGD-mediated complex III activity and subsequent ROS production elevation, and eventually reduction of OGD-induced neurotoxicity. This molecular signaling cascade may be at least part of the mechanisms of Ngb neuroprotection against OGD-induced neurotoxicity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Ling; Reinach, Peter; Lu, Luo
2005-11-15
Tumor necrosis factor (TNF-{alpha}) in various cell types induces either cell death or mitogenesis through different signaling pathways. In the present study, we determined in human corneal epithelial cells how TNF-{alpha} also promotes cell survival. Human corneal epithelial (HCE) cells were cultured in DMEM/F-12 medium containing 10% FBS. TNF-{alpha} stimulation induced activation of a voltage-gated K{sup +} channel detected by measuring single channel activity using patch clamp techniques. The effect of TNF-{alpha} on downstream events included NF{kappa}B nuclear translocation and increases in DNA binding activities, but did not elicit ERK, JNK, or p38 limb signaling activation. TNF-{alpha} induced increases inmore » p21 expression resulting in partial cell cycle attenuation in the G{sub 1} phase. Cell cycle progression was also mapped by flow cytometer analysis. Blockade of TNF-{alpha}-induced K{sup +} channel activity effectively prevented NF{kappa}B nuclear translocation and binding to DNA, diminishing the cell-survival protective effect of TNF-{alpha}. In conclusion, TNF-{alpha} promotes survival of HCE cells through sequential stimulation of K{sup +} channel and NF{kappa}B activities. This response to TNF-{alpha} is dependent on stimulating K{sup +} channel activity because following suppression of K{sup +} channel activity TNF-{alpha} failed to activate NF{kappa}B nuclear translocation and binding to nuclear DNA.« less
Zhang, Zecai; Shen, Peng; Yang, Zhengtao; Zhang, Naisheng
2017-01-01
Staphylococcus aureus causes mastitis as a result of community-acquired or nosocomial infections. Lysozyme (LYSO) is an enzyme that is upregulated in many organisms during the innate immune response against infection by bacterial pathogens. Baicalin is a bioactive flavonoid that can bind to enzymes, often to potentiate their effect. Here we tested the effects of baicalin on the activity of LYSO using the S. aureus mastitis mouse model and neutrophilic granulocyte model of S. aureus infection. In our experiments, S. aureus counts decreased with increasing baicalin concentration. Furthermore, qPCR and western blot analyses showed that LYSO expression was unaffected by baicalin, while fluorescence quenching and UV fluorescence spectral analyses showed that baicalin binds to LYSO. To test whether this binding increased LYSO activity, we assessed LYSO-induced bacteriostasis in the presence of baicalin. Our results showed that LYSO-induced S. aureus bacteriostasis increased with increasing concentrations of baicalin, and that baicalin binding to LYSO synergistically increased the antibacterial activity of LYSO. These results demonstrate that baicalin enhances LYSO-induced bacteriostasis during the innate immune response to S. aureus. They suggest baicalin is a potentially useful therapeutic agent for the treatment of bacterial infections. PMID:28184027
Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.
Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie
2016-06-28
Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.
Bidasee, Keshore R; Nallani, Karuna; Besch, Henry R; Dincer, U Deniz
2003-06-01
In a previous study, we showed that after 6 weeks of streptozotocin-induced diabetes (6D), expression of type 2 ryanodine receptor calcium-release channels (RyR2) did not change significantly in rat hearts. However, the ability of this protein to bind [3H]ryanodine was compromised. Loss in activity therefore resulted from diabetes-induced increases in post-translational modifications on RyR2. In the present study, the effects of diabetes on one type of modification, namely, changes in oxidative state of reactive sulfhydryls was investigated. RyR2 protein from 6D bound 42.3 +/- 7.6 less [3H]ryanodine than RyR2 from controls (6C). The loss in binding was minimized with 2 weeks of insulin treatment initiated after 4 weeks of diabetes (77.8 +/- 5.5% of 6C). Pretreating RyR2 from 6D with 2 mM dithiothreitol in vitro increases [3H]ryanodine binding by 60.8 +/- 5.3%. Dithiothreitol pretreatment of RyR2 from 6C increased [3H]ryanodine binding by 16.8 +/- 4.3%. The reagent pyrocoll interacts with distinct classes of free sulfhydryl groups on 6C RyR2 to induce two major effects. At concentrations < or = 10 microM, it deactivates RyR2 (decreases [3H]ryanodine binding), whereas at higher concentrations it activates them (increases [3H]ryanodine binding). This reagent was unable to activate RyR2 from 6D. Although RyR2 from insulin-treated animals was deactivated by low concentrations of pyrocoll, it was only partially activated at higher concentrations. These data suggest that the dysfunction of RyR2 induced by diabetes may be due in part to formation of disulfide bonds between adjacent sulfhydryl groups and that these changes were attenuated with insulin treatment.
Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei
2012-07-04
Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.
A PARP1-ERK2 synergism is required for the induction of LTP
Visochek, L.; Grigoryan, G.; Kalal, A.; Milshtein-Parush, H.; Gazit, N.; Slutsky, I.; Yeheskel, A.; Shainberg, A.; Castiel, A.; Seger, R.; Langelier, M. F.; Dantzer, F.; Pascal, J. M.; Segal, M.; Cohen-Armon, M.
2016-01-01
Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence. PMID:27121568
A PARP1-ERK2 synergism is required for the induction of LTP.
Visochek, L; Grigoryan, G; Kalal, A; Milshtein-Parush, H; Gazit, N; Slutsky, I; Yeheskel, A; Shainberg, A; Castiel, A; Seger, R; Langelier, M F; Dantzer, F; Pascal, J M; Segal, M; Cohen-Armon, M
2016-04-28
Unexpectedly, a post-translational modification of DNA-binding proteins, initiating the cell response to single-strand DNA damage, was also required for long-term memory acquisition in a variety of learning paradigms. Our findings disclose a molecular mechanism based on PARP1-Erk synergism, which may underlie this phenomenon. A stimulation induced PARP1 binding to phosphorylated Erk2 in the chromatin of cerebral neurons caused Erk-induced PARP1 activation, rendering transcription factors and promoters of immediate early genes (IEG) accessible to PARP1-bound phosphorylated Erk2. Thus, Erk-induced PARP1 activation mediated IEG expression implicated in long-term memory. PARP1 inhibition, silencing, or genetic deletion abrogated stimulation-induced Erk-recruitment to IEG promoters, gene expression and LTP generation in hippocampal CA3-CA1-connections. Moreover, a predominant binding of PARP1 to single-strand DNA breaks, occluding its Erk binding sites, suppressed IEG expression and prevented the generation of LTP. These findings outline a PARP1-dependent mechanism required for LTP generation, which may be implicated in long-term memory acquisition and in its deterioration in senescence.
Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen
2018-05-05
Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.
Yunn, Na-Oh; Koh, Ara; Han, Seungmin; Lim, Jong Hun; Park, Sehoon; Lee, Jiyoun; Kim, Eui; Jang, Sung Key; Berggren, Per-Olof; Ryu, Sung Ho
2015-01-01
Due to their high affinity and specificity, aptamers have been widely used as effective inhibitors in clinical applications. However, the ability to activate protein function through aptamer-protein interaction has not been well-elucidated. To investigate their potential as target-specific agonists, we used SELEX to generate aptamers to the insulin receptor (IR) and identified an agonistic aptamer named IR-A48 that specifically binds to IR, but not to IGF-1 receptor. Despite its capacity to stimulate IR autophosphorylation, similar to insulin, we found that IR-A48 not only binds to an allosteric site distinct from the insulin binding site, but also preferentially induces Y1150 phosphorylation in the IR kinase domain. Moreover, Y1150-biased phosphorylation induced by IR-A48 selectively activates specific signaling pathways downstream of IR. In contrast to insulin-mediated activation of IR, IR-A48 binding has little effect on the MAPK pathway and proliferation of cancer cells. Instead, AKT S473 phosphorylation is highly stimulated by IR-A48, resulting in increased glucose uptake both in vitro and in vivo. Here, we present IR-A48 as a biased agonist able to selectively induce the metabolic activity of IR through allosteric binding. Furthermore, our study also suggests that aptamers can be a promising tool for developing artificial biased agonists to targeted receptors. PMID:26245346
Jiang, Xukai; Wang, Yuying; Xu, Limei; Chen, Guanjun; Wang, Lushan
2017-09-09
The role of protein dynamics in enzyme catalysis is one of the most active areas in current enzymological research. Here, using endoglucanase Cel5A from Thermobifida fusca (TfCel5A) as a model, we applied molecular dynamics simulations to explore the dynamic behavior of the enzyme upon substrate binding. The collective motions of the active site revealed that the mechanism of TfCel5A substrate binding can likely be described by the conformational-selection model; however, we observed that the conformations of active site residues changed differently along with substrate binding. Although most active site residues retained their native conformational ensemble, some (Tyr163 and Glu355) generated newly induced conformations, whereas others (Phe162 and Tyr189) exhibited shifts in the equilibration of their conformational distributions. These results showed that TfCel5A substrate binding relied on a hybrid mechanism involving induced fit and conformational selection. Interestingly, we found that TfCel5A active site could only partly rebalance its conformational dynamics upon substrate dissociation within the same simulation time, which implies that the conformational rebalance upon substrate dissociation is likely more difficult than the conformational selection upon substrate binding at least in the view of the time required. Our findings offer new insight into enzyme catalysis and potential applications for future protein engineering. Copyright © 2017 Elsevier Inc. All rights reserved.
Yu, Yang; Cui, Yingjie; Zhao, Yanan; Liu, Shuai; Song, Guohua; Jiao, Peng; Li, Bin; Luo, Tian; Guo, Shoudong; Zhang, Xiangjian; Wang, Hao; Jiang, Xian-Cheng; Qin, Shucun
2016-02-09
Phospholipid transfer protein (PLTP) participates in high density lipoprotein (HDL) metabolism. Increased plasma PLTP activity was observed in lipopolysaccharide (LPS) triggered acute inflammatory diseases. This study aimed to determine the exact role of PLTP in LPS induced inflammation. HDL pool size was shrunk both in PLTP deficient mice (PLTP-/-) and PLTP transgenic mice (PLTP-Tg). PLTP displayed a strong protective effect on lethal endotoxemia in mice survival study. Furthermore, after LPS stimulation, the expression of pro-inflammatory cytokines were increased in bone marrow derived macrophage (BMDM) from PLTP-/-, while decreased in BMDM from PLTP-Tg compared with BMDM from wild-type mice (WT). Moreover, LPS induced nuclear factor kappa-B (NFκB) activation was enhanced in PLTP-/- BMDM or PLTP knockdown RAW264.7. Conversely, PLTP overexpression countered the NFκB activation in LPS challenged BMDM. Additionally, the activation of toll like receptor 4 (TLR4) induced by LPS showed no alteration in PLTP-/- BMDM. Finally, PLTP could bind to LPS, attenuate the pro-inflammatory effects of LPS, and improve the cell viability in vitro. To sum up, these findings elucidated that PLTP repressed LPS induced inflammation due to extracellular LPS binding capability, and the protective effects were not related to HDL pool size in mice.
Lee, Young-Rae; Noh, Eun-Mi; Han, Ji-Hey; Kim, Jeong-Mi; Hwang, Bo-Mi; Kim, Byeong-Soo; Lee, Sung-Ho; Jung, Sung Hoo; Youn, Hyun Jo; Chung, Eun Yong; Kim, Jong-Suk
2013-04-01
Sulforaphane [1-isothiocyanato-4-(methylsulfinyl)-butane] is an isothiocyanate found in some cruciferous vegetables, especially broccoli. Sulforaphane has been shown to display anti-cancer properties against various cancer cell lines. Matrix metalloproteinase-9 (MMP-9), which degrades the extracellular matrix (ECM), plays an important role in cancer cell invasion. In this study, we investigated the effect of sulforaphane on 12-O-tetradecanoyl phorbol-13-acetate (TPA)-induced MMP-9 expression and cell invasion in MCF-7 cells. TPA-induced MMP-9 expression and cell invasion were decreased by sulforaphane treatment. TPA substantially increased NF-κB and AP-1 DNA binding activity. Pre-treatment with sulforaphane inhibited TPA-stimulated NF-κB binding activity, but not AP-1 binding activity. In addition, we found that sulforaphane suppressed NF-κB activation, by inhibiting phosphorylation of IκB in TPA-treated MCF-7 cells. In this study, we demonstrated that the inhibition of TPA-induced MMP-9 expression and cell invasion by sulforaphane was mediated by the suppression of the NF-κB pathway in MCF-7 cells.
Lee, Young-Rae; Noh, Eun-Mi; Han, Ji-Hey; Kim, Jeong-Mi; Hwang, Bo-Mi; Kim, Byeong-Soo; Lee, Sung-Ho; Jung, Sung Hoo; Youn, Hyun Jo; Chung, Eun Yong; Kim, Jong-Suk
2013-01-01
Sulforaphane [1-isothiocyanato-4-(methylsulfinyl)-butane] is an isothiocyanate found in some cruciferous vegetables, especially broccoli. Sulforaphane has been shown to display anti-cancer properties against various cancer cell lines. Matrix metalloproteinase-9 (MMP-9), which degrades the extracellular matrix (ECM), plays an important role in cancer cell invasion. In this study, we investigated the effect of sulforaphane on 12-O-tetradecanoyl phorbol-13-acetate (TPA)-induced MMP-9 expression and cell invasion in MCF-7 cells. TPA-induced MMP-9 expression and cell invasion were decreased by sulforaphane treatment. TPA substantially increased NF-κB and AP-1 DNA binding activity. Pre-treatment with sulforaphane inhibited TPA-stimulated NF-κB binding activity, but not AP-1 binding activity. In addition, we found that sulforaphane suppressed NF-κB activation, by inhibiting phosphorylation of IκB in TPA-treated MCF-7 cells. In this study, we demonstrated that the inhibition of TPA-induced MMP-9 expression and cell invasion by sulforaphane was mediated by the suppression of the NF-κB pathway in MCF-7 cells. [BMB Reports 2013; 46(4): 201-206] PMID:23615261
Sugamori, Yasutaka; Mise‐Omata, Setsuko; Maeda, Chizuko; Aoki, Shigeki; Tabata, Yasuhiko; Murali, Ramachandran; Yasuda, Hisataka; Udagawa, Nobuyuki; Suzuki, Hiroshi; Honma, Masashi
2016-01-01
Both W9 and OP3‐4 were known to bind the receptor activator of NF‐κB ligand (RANKL), inhibiting osteoclastogenesis. Recently, both peptides were shown to stimulate osteoblast differentiation; however, the mechanism underlying the activity of these peptides remains to be clarified. A primary osteoblast culture showed that rapamycin, an mTORC1 inhibitor, which was recently demonstrated to be an important serine/threonine kinase for bone formation, inhibited the peptide‐induced alkaline phosphatase activity. Furthermore, both peptides promoted the phosphorylation of Akt and S6K1, an upstream molecule of mTORC1 and the effector molecule of mTORC1, respectively. In the in vivo calvarial defect model, W9 and OP3‐4 accelerated BMP‐2‐induced bone formation to a similar extent, which was confirmed by histomorphometric analyses using fluorescence images of undecalcified sections. Our data suggest that these RANKL‐binding peptides could stimulate the mTORC1 activity, which might play a role in the acceleration of BMP‐2‐induced bone regeneration by the RANKL‐binding peptides. PMID:27345003
Alite, Christian; Humphrey, Suzanne; Donderis, Jordi; Maiques, Elisa; Ciges-Tomas, J Rafael; Penadés, José R; Marina, Alberto
2017-09-11
The trimeric staphylococcal phage-encoded dUTPases (Duts) are signalling molecules that induce the cycle of some Staphylococcal pathogenicity islands (SaPIs) by binding to the SaPI-encoded Stl repressor. To perform this regulatory role, these Duts require an extra motif VI, as well as the Dut conserved motifs IV and V. While the apo form of Dut is required for the interaction with the Stl repressor, usually only those Duts with normal enzymatic activity can induce the SaPI cycle. To understand the link between the enzymatic activities and inducing capacities of the Dut protein, we analysed the structural, biochemical and physiological characteristics of the Dut80α D95E mutant, which loses the SaPI cycle induction capacity despite retaining enzymatic activity. Asp95 is located at the threefold central channel of the trimeric Dut where it chelates a divalent ion. Here, using state-of-the-art techniques, we demonstrate that D95E mutation has an epistatic effect on the motifs involved in Stl binding. Thus, ion binding in the central channel correlates with the capacity of motif V to twist and order in the SaPI-inducing disposition, while the tip of motif VI is disturbed. These alterations in turn reduce the affinity for the Stl repressor and the capacity to induce the SaPI cycle.
Sahoo, Binay K; Zaidi, Adeel H; Gupta, Pankaj; Mokhamatam, Raveendra B; Raviprakash, Nune; Mahali, Sidhartha K; Manna, Sunil K
2015-10-05
Mangiferin, a C-glycosyl xanthone, has shown anti-inflammatory, antioxidant, and anti-tumorigenic activities. In the present study, we investigated the molecular mechanism for the antioxidant property of mangiferin. Considering the role of nuclear transcription factor kappa B (NF-κB) in inflammation and tumorigenesis, we hypothesized that modulating its activity will be a viable therapeutic target in regulating the redox-sensitive ailments. Our results show that mangiferin blocks several inducers, such as tumor necrosis factor (TNF), lypopolysaccharide (LPS), phorbol-12-myristate-13-acetate (PMA) or hydrogen peroxide (H2O2) mediated NF-κB activation via inhibition of reactive oxygen species generation. In silico docking studies predicted strong binding energy of mangiferin to the active site of catalase (-9.13 kcal/mol), but not with other oxidases such as myeloperoxidase, glutathione peroxidase, or inducible nitric oxide synthase. Mangiferin increased activity of catalase by 44%, but had no effect on myeloperoxidase activity in vitro. Fluorescence spectroscopy further revealed the binding of mangiferin to catalase at the single site with binding constant and binding affinity of 3.1×10(-7) M(-1) and 1.046 respectively. Mangiferin also inhibits TNF-induced lipid peroxidation and thereby protects apoptosis. Hence, mangiferin with its ability to inhibit NF-κB and increase the catalase activity may prove to be a potent therapeutic. Copyright © 2015 Elsevier B.V. All rights reserved.
Hatalski, Carolyn G.; Baram, Tallie Z.
2012-01-01
The cAMP-regulatory element (CRE) binding protein (CREB) functions as a trans-acting regulator of genes containing the CRE sequence in their promoter. These include a number of critical genes, such as CRF, involved in the hypothalamic response to stressful stimuli in the adult. The ability of the developing rat (during the first 2 postnatal weeks) to mount the full complement of this stress response has been questioned. We have previously demonstrated the stress-induced up-regulation of the transcription of hypothalamic CRF during the second postnatal week in the rat. The focus of the current study was to explore the mechanism of transcriptional regulation in response to stress through the physiological induction of transcriptional trans-activators that bind to the CRE in the developing rat brain. CRE-binding activity was detected via gel shift analysis in extracts from both the hypothalamus and the cerebral cortex of the developing rat. CREB was identified in these extracts by Western blot analysis and was shown to be the major contributor to the CRE-binding activity by gel shift analysis with two specific antibodies directed against CREB. After acute hypothermic stress, the abundance of CRE-binding activity (but not of total immunoreactive CREB), increased in hypothalamic extracts. This enhanced CRE-binding activity was blocked by an antiserum directed against CREB and was accompanied by an apparent increase in CREB phosphorylation. These results indicate that posttranslational enhancement of CRE-binding activity is likely to constitute an important mechanism for up-regulation of genes possessing the CRE sequence in the developing rat hypothalamus by adverse external signals. PMID:9415405
Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E
1991-01-01
The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879
Oh, So-Young; Shin, Jung-Ho; Roe, Jung-Hye
2007-01-01
Organic hydroperoxide resistance in bacteria is achieved primarily through reducing oxidized membrane lipids. The soil-inhabiting aerobic bacterium Streptomyces coelicolor contains three paralogous genes for organic hydroperoxide resistance: ohrA, ohrB, and ohrC. The ohrA gene is transcribed divergently from ohrR, which encodes a putative regulator of MarR family. Both the ohrA and ohrR genes were induced highly by various organic hydroperoxides. The ohrA gene was induced through removal of repression by OhrR, whereas the ohrR gene was induced through activation by OhrR. Reduced OhrR bound to the ohrA-ohrR intergenic region, which contains a central (primary) and two adjacent (secondary) inverted-repeat motifs that overlap with promoter elements. Organic peroxide decreased the binding affinity of OhrR for the primary site, with a concomitant decrease in cooperative binding to the adjacent secondary sites. The single cysteine C28 in OhrR was involved in sensing oxidants, as determined by substitution mutagenesis. The C28S mutant of OhrR bound to the intergenic region without any change in binding affinity in response to organic peroxides. These results lead us to propose a model for the dual action of OhrR as a repressor and an activator in S. coelicolor. Under reduced conditions, OhrR binds cooperatively to the intergenic region, repressing transcription from both genes. Upon oxidation, the binding affinity of OhrR decreases, with a concomitant loss of cooperative binding, which allows RNA polymerase to bind to both the ohrA and ohrR promoters. The loosely bound oxidized OhrR can further activate transcription from the ohrR promoter. PMID:17586628
NASA Technical Reports Server (NTRS)
Kim, Soo-Hwan; Roux, Stanley J.
2003-01-01
Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.
Montgomery, H J; Romanov, V; Guillemette, J G
2000-02-18
Neuronal nitric-oxide synthase (NOS) and endothelial NOS are constitutive NOS isoforms that are activated by binding calmodulin in response to elevated intracellular calcium. In contrast, the inducible NOS isoform binds calmodulin at low basal levels of calcium in resting cells. Primary sequence comparisons show that each constitutive NOS isozyme contains a polypeptide segment within its reductase domain, which is absent in the inducible NOS enzyme. To study a possible link between the presence of these additional polypeptide segments in constitutive NOS enzymes and their calcium-dependent calmodulin activation, three deletion mutants were created. The putative inhibitory insert was removed from the FMN binding regions of the neuronal NOS holoenzyme and from two truncated neuronal NOS reductase enzymes in which the calmodulin binding region was either included or deleted. All three mutant enzymes showed reduced incorporation of FMN and required reconstitution with exogenous FMN for activity. The combined removal of both the calmodulin binding domain and the putative inhibitory insert did not result in a calmodulin-independent neuronal NOS reductase. Thus, although the putative inhibitory element has an effect on the calcium-dependent calmodulin activation of neuronal NOS, it does not have the properties of the typical autoinhibitory domain found in calmodulin-activated enzymes.
Khomenko, Tetyana; Deng, Xiaoming; Ahluwalia, Amrita; Tarnawski, Andrzej; Patel, Khushin N; Sandor, Zsuzsanna; Szabo, Sandor
2014-02-01
Signal transducer and activator of transcription 3 (STAT3) is a transcription factor that directly upregulates VEGF, Ref-1, p21, and anti-apoptotic genes such as Bcl-xL. In this study, we hypothesized that STAT3 signaling is activated and provides a critical protective role that is required for enterocyte survival during the early phases of cysteamine-induced duodenal ulcers. We studied the effect of inhibition of STAT3 activity on cysteamine-induced duodenal ulcers in rats and egr-1 knockout mice using STAT3/DNA binding assay, immunohistochemistry, immunoblot, and quantitative reverse transcriptase PCR analyses. We found that G-quartet oligodeoxynucleotides T40214, a specific inhibitor of STAT3/DNA binding, aggravated cysteamine-induced duodenal ulcers in rats 2.8-fold (p < 0.05). In the pre-ulcerogenic stage, cysteamine induced STAT3 tyrosine phosphorylation, its translocation to nuclei, an increased expression and nuclear translocation of importin α and β in the rat duodenal mucosa. Cysteamine enhanced the binding of STAT3 to its DNA consensus sequences at 6, 12, and 24 h after cysteamine by 1.5-, 1.8-, and 3.5-fold, respectively, and activated the expression of STAT3 target genes such as VEGF, Bcl-xL, Ref-1, and STAT3-induced feedback inhibitor, a suppressor of cytokine signaling 3. We also demonstrated that egr-1 knockout mice, which are more susceptible to cysteamine-induced duodenal ulcers, had lower levels of STAT3 expression, its phosphorylation, expression of importin α or β, and STAT3/DNA binding than wild-type mice in response to cysteamine. Thus, STAT3 represents an important new molecular mechanism in experimental duodenal ulceration.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
Stratton, Amanda; Ericksen, Matthew; Harris, Travis V; Symmonds, Nick; Silverstein, Todd P
2017-02-01
The toxicity of mercury is often attributed to its tight binding to cysteine thiolate anions in vital enzymes. To test our hypothesis that Hg(II) binding to histidine could be a significant factor in mercury's toxic effects, we studied the enzyme chymotrypsin, which lacks free cysteine thiols; we found that chymotrypsin is not only inhibited, but also denatured by Hg(II). We followed the aggregation of denatured enzyme by the increase in visible absorbance due to light scattering. Hg(II)-induced chymotrypsin precipitation increased dramatically above pH 6.5, and free imidazole inhibited this precipitation, implicating histidine-Hg(II) binding in the process of chymotrypsin denaturation/aggregation. Diethylpyrocarbonate (DEPC) blocked chymotrypsin's two histidines (his 40 and his 57 ) quickly and completely, with an IC 50 of 35 ± 6 µM. DEPC at 350 µM reduced the hydrolytic activity of chymotrypsin by 90%, suggesting that low concentrations of DEPC react with his 57 at the active site catalytic triad; furthermore, DEPC below 400 µM enhanced the Hg(II)-induced precipitation of chymotrypsin. We conclude that his 57 reacts readily with DEPC, causing enzyme inhibition and enhancement of Hg(II)-induced aggregation. Above 500 µM, DEPC inhibited Hg(II)-induced precipitation, and [DEPC] >2.5 mM completely protected chymotrypsin against precipitation. This suggests that his 40 reacts less readily with DEPC, and that chymotrypsin denaturation is caused by Hg(II) binding specifically to the his 40 residue. Finally, we show that Hg(II)-histidine binding may trigger hemoglobin aggregation as well. Because of results with these two enzymes, we suggest that metal-histidine binding may be key to understanding all heavy metal-induced protein aggregation. © 2017 The Protein Society.
Cross, F R; Levine, K
2000-01-01
We showed recently that a screen for mutant CDC28 with improved binding to a defective Cln2p G1 cyclin yielded a spectrum of mutations similar to those yielded by a screen for intragenic suppressors of the requirement for activation loop phosphorylation (T169E suppressors). Recombination among these mutations yielded CDC28 mutants that bypassed the G1 cyclin requirement. Here we analyze further the interrelationship between T169E suppression, interaction with defective cyclin, and G1 cyclin bypass. DNA shuffling of mutations from the various screens and recombination onto a T169E-encoding 3' end yielded CDC28 mutants with strong T169E suppression. Some of the strongest T169E suppressors could suppress the defective Cln2p G1 cyclin even while retaining T169E. The strong T169E suppressors did not exhibit bypass of the G1 cyclin requirement but did so when T169E was reverted to T. These results suggested that for these mutants, activation loop phosphorylation and cyclin binding might be alternative means of activation rather than independent requirements for activation (as with wild type). These results suggest mechanistic overlap between the conformational shift induced by cyclin binding and that induced by activation loop phosphorylation. This conclusion was supported by analysis of suppressors of a mutation in the Cdk phosphothreonine-binding pocket created by cyclin binding. PMID:10747052
Rational design and validation of a vanilloid-sensitive TRPV2 ion channel
Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie
2016-01-01
Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359
Ramos, Gerardo; Kazimi, Nasser; Nghiem, Dat X; Walterscheid, Jeffrey P; Ullrich, Stephen E
2004-03-15
Applying military jet fuel (JP-8) or commercial jet fuel (Jet-A) to the skin of mice suppresses the immune response in a dose-dependent manner. The release of biological response modifiers, particularly prostaglandin E2 (PGE2), is a critical step in activating immune suppression. Previous studies have shown that injecting selective cyclooxygenase-2 inhibitors into jet fuel-treated mice blocks immune suppression. Because the inflammatory phospholipid mediator, platelet-activating factor (PAF), up-regulates cyclooxygenase-2 production and PGE2 synthesis by keratinocytes, we tested the hypothesis that PAF-receptor binding plays a role in jet fuel-induced immune suppression. Treating keratinocyte cultures with PAF and/or jet fuel (JP-8 and Jet-A) stimulates PGE2 secretion. Jet fuel-induced PGE2 production was suppressed by treating the keratinocytes with specific PAF-receptor antagonists. Injecting mice with PAF, or treating the skin of the mice with JP-8, or Jet-A, induced immune suppression. Jet fuel-induced immune suppression was blocked when the jet fuel-treated mice were injected with PAF-receptor antagonists before treatment. Jet fuel treatment has been reported to activate oxidative stress and treating the mice with anti-oxidants (Vitamins C, or E or beta-hydroxy toluene), before jet fuel application, interfered with immune suppression. These findings confirm previous studies showing that PAF-receptor binding can modulate immune function. Furthermore, they suggest that PAF-receptor binding may be an early event in the induction of immune suppression by immunotoxic environmental agents that target the skin.
E-p-Methoxycinnamic acid protects cultured neuronal cells against neurotoxicity induced by glutamate
Kim, So Ra; Sung, Sang Hyun; Jang, Young Pyo; Markelonis, George J; Oh, Tae H; Kim, Young Choong
2002-01-01
We previously reported that four new phenylpropanoid glycosides and six known cinnamate derivatives isolated from roots of Scrophularia buergeriana Miquel (Scrophulariaceae) protected cultured cortical neurons from neurotoxicity induced by glutamate. Here, we have investigated the structure-activity relationships in the phenylpropanoids using our primary culture system. The α,β-unsaturated ester moiety and the para-methoxy group in the phenylpropanoids appeared to play a vital role in neuroprotective activity. This suggested that E-p-methoxycinnamic acid (E-p-MCA) might be a crucial component for their neuroprotective activity within the phenylpropanoid compounds. E-p-MCA significantly attenuated glutamate-induced neurotoxicity when added prior to an excitotoxic glutamate challenge. The neuroprotective activity of E-p-MCA appeared to be more effective in protecting neurons against neurotoxicity induced by NMDA than from that induced by kainic acid. E-p-MCA inhibited the binding of [propyl-2,3-3H]-CGP39653 and [2-3H]-glycine to their respective binding sites on rat cortical membranes. However, even high concentrations of E-p-MCA failed to inhibit completely [propyl-2,3-3H]-CGP39653 and [2-3H]-glycine binding. Indeed, E-p-MCA diminished the calcium influx that routinely accompanies glutamate-induced neurotoxicity, and inhibited the subsequent overproduction of nitric oxide and cellular peroxide in glutamate-injured neurons. Thus, our results suggest that E-p-MCA exerts significant protective effects against neurodegeneration induced by glutamate in primary cultures of cortical neurons by an action suggestive of partial glutamatergic antagonism. PMID:11877337
The Scaffold Protein TANK/I-TRAF Inhibits NF-κB Activation by Recruiting Polo-like Kinase 1
Zhang, Wanqiao; Zhang, Ying; Yuan, Yanzhi; Guan, Wei; Jin, Chaozhi; Chen, Hui; Wang, Xiaohui
2010-01-01
TANK/I-TRAF is a TRAF-binding protein that negatively regulates NF-κB activation. The underlying mechanism of this activity remains unclear. Here we show that TANK directly interacts with PLK1, a conserved cell cycle–regulated kinase. PLK1 inhibits NF-κB transcriptional activation induced by TNF-α, IL-1β, or several activators, but not by nuclear transcription factor p65. PLK1 expression reduces the DNA-binding activity of NF-κB induced by TNF-α. Moreover, endogenous activation of PLK1 reduces the TNF-induced phosphorylation of endogenous IκBα. PLK1 is bound to NEMO (IKKγ) through TANK to form a ternary complex in vivo. We describe a new regulatory mechanism for PLK1: PLK1 negatively regulates TNF-induced IKK activation by inhibiting the ubiquitination of NEMO. These findings reveal that the scaffold protein TANK recruits PLK1 to negatively regulate NF-κB activation and provide direct evidence that PLK1 is required for the repression function of TANK. PMID:20484576
Adhesion signaling promotes protease‑driven polyploidization of glioblastoma cells.
Mercapide, Javier; Lorico, Aurelio
2014-11-01
An increase in ploidy (polyploidization) causes genomic instability in cancer. However, the determinants for the increased DNA content of cancer cells have not yet been fully elucidated. In the present study, we investigated whether adhesion induces polyploidization in human U87MG glioblastoma cells. For this purpose, we employed expression vectors that reported transcriptional activation by signaling networks implicated in cancer. Signaling activation induced by intercellular integrin binding elicited both extracellular signal‑regulated kinase (ERK) and Notch target transcription. Upon the prolonged activation of both ERK and Notch target transcription induced by integrin binding to adhesion protein, cell cultures accumulated polyploid cells, as determined by cell DNA content distribution analysis and the quantification of polynucleated cells. This linked the transcriptional activation induced by integrin adhesion to the increased frequency of polyploidization. Accordingly, the inhibition of signaling decreased the extent of polyploidization mediated by protease‑driven intracellular invasion. Therefore, the findings of this study indicate that integrin adhesion induces polyploidization through the stimulation of glioblastoma cell invasiveness.
Tsukamoto, Hiroki; Takeuchi, Shino; Kubota, Kanae; Kobayashi, Yohei; Kozakai, Sao; Ukai, Ippo; Shichiku, Ayumi; Okubo, Misaki; Numasaki, Muneo; Kanemitsu, Yoshitomi; Matsumoto, Yotaro; Nochi, Tomonori; Watanabe, Kouichi; Aso, Hisashi; Tomioka, Yoshihisa
2018-05-14
Toll-like receptor 4 (TLR4) is an indispensable immune receptor for lipopolysaccharide (LPS), a major component of the Gram-negative bacterial cell wall. Following LPS stimulation, TLR4 transmits the signal from the cell surface and becomes internalized in an endosome. However, the spatial regulation of TLR4 signaling is not fully understood. Here, we investigated the mechanisms of LPS-induced TLR4 internalization and clarified the roles of the extracellular LPS-binding molecules, LPS-binding protein (LBP), and glycerophosphatidylinositol-anchored protein (CD14). LPS stimulation of CD14-expressing cells induced TLR4 internalization in the presence of serum, and an inhibitory anti-LBP mAb blocked its internalization. Addition of LBP to serum-free cultures restored LPS-induced TLR4 internalization to comparable levels of serum. The secretory form of the CD14 (sCD14) induced internalization but required a much higher concentration than LBP. An inhibitory anti-sCD14 mAb was ineffective for serum-mediated internalization. LBP lacking the domain for LPS transfer to CD14 and a CD14 mutant with reduced LPS binding both attenuated TLR4 internalization. Accordingly, LBP is an essential serum molecule for TLR4 internalization, and its LPS transfer to membrane-anchored CD14 (mCD14) is a prerequisite. LBP induced the LPS-stimulated phosphorylation of TBK1, IKKϵ, and IRF3, leading to IFN-β expression. However, LPS-stimulated late activation of NFκB or necroptosis were not affected. Collectively, our results indicate that LBP controls LPS-induced TLR4 internalization, which induces TLR adaptor molecule 1 (TRIF)-dependent activation of the TBK1-IKKϵ-IRF3-IFN-β pathway. In summary, we showed that LBP-mediated LPS transfer to mCD14 is required for serum-dependent TLR4 internalization and activation of the TRIF pathway. Copyright © 2018, The American Society for Biochemistry and Molecular Biology.
PHOSPHOLIPASE Cβ CONNECTS G PROTEIN SIGNALING WITH RNA INTERFERENCE
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2015-01-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (RISC) (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentration can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. PMID:26746047
Haendeler, Judith; Dröse, Stefan; Büchner, Nicole; Jakob, Sascha; Altschmied, Joachim; Goy, Christine; Spyridopoulos, Ioakim; Zeiher, Andreas M; Brandt, Ulrich; Dimmeler, Stefanie
2009-06-01
The enzyme telomerase and its catalytic subunit the telomerase reverse transcriptase (TERT) are important for maintenance of telomere length in the nucleus. Recent studies provided evidence for a mitochondrial localization of TERT. Therefore, we investigated the exact localization of TERT within the mitochondria and its function. Here, we demonstrate that TERT is localized in the matrix of the mitochondria. TERT binds to mitochondrial DNA at the coding regions for ND1 and ND2. Binding of TERT to mitochondrial DNA protects against ethidium bromide-induced damage. TERT increases overall respiratory chain activity, which is most pronounced at complex I and dependent on the reverse transcriptase activity of the enzyme. Moreover, mitochondrial reactive oxygen species are increased after genetic ablation of TERT by shRNA. Mitochondrially targeted TERT and not wild-type TERT revealed the most prominent protective effect on H(2)O(2)-induced apoptosis. Lung fibroblasts from 6-month-old TERT(-/-) mice (F2 generation) showed increased sensitivity toward UVB radiation and heart mitochondria exhibited significantly reduced respiratory chain activity already under basal conditions, demonstrating the protective function of TERT in vivo. Mitochondrial TERT exerts a novel protective function by binding to mitochondrial DNA, increasing respiratory chain activity and protecting against oxidative stress-induced damage.
Phospholipase Cβ connects G protein signaling with RNA interference.
Scarlata, Suzanne; Garwain, Osama; Williams, Leo; Burguera, Imanol Gonzalez; Rosati, Barbara; Sahu, Shriya; Guo, Yuanjian; Philip, Finly; Golebiewska, Urszula
2016-05-01
Phosphoinositide-specific-phospholipase Cβ (PLCβ) is the main effector of Gαq stimulation which is coupled to receptors that bind acetylcholine, bradykinin, dopamine, angiotensin II as well as other hormones and neurotransmitters. Using a yeast two-hybrid and other approaches, we have recently found that the same region of PLCβ that binds Gαq also interacts with Component 3 Promoter of RNA induced silencing complex (C3PO), which is required for efficient activity of the RNA-induced silencing complex. In purified form, C3PO competes with Gαq for PLCβ binding and at high concentrations can quench PLCβ activation. Additionally, we have found that the binding of PLCβ to C3PO inhibits its nuclease activity leading to reversal of RNA-induced silencing of specific genes. In cells, we found that PLCβ distributes between the plasma membrane where it localizes with Gαq, and in the cytosol where it localizes with C3PO. When cells are actively processing small interfering RNAs the interaction between PLCβ and C3PO gets stronger and leads to changes in the cellular distribution of PLCβ. The magnitude of attenuation is specific for different silencing RNAs. Our studies imply a direct link between calcium responses mediated through Gαq and post-transcriptional gene regulation through PLCβ. Copyright © 2015 Elsevier Ltd. All rights reserved.
Eisenstein, Barry I.; Ofek, Itzhak; Beachey, Edwin H.
1979-01-01
When Escherichia coli was grown in sublethal concentrations of streptomycin, mannose binding activity and epithelial cell adherence of the E. coli cultures at stationary phase were significantly reduced in the drug-grown organisms. In a strain whose minimal inhibitory concentrations was 30 μg/ml, the percentage of reduction in mannose binding activity was dose related over a range of concentrations between 0.5 and 10 μg/ml streptomycin. Concomitant with the drug-induced suppression of mannose binding activity, antigenic and ultrastructural alterations on the surface of the drug-grown organisms were observed by agglutination tests and electron microscopy, respectively. The streptomycin effect was reversible, required actively growing organisms, and was most apparent in the early log-phase of growth. High doses of antibiotic were ineffective when added to cultures which had acquired mannose binding activity. An isogenic derivative with high-level resistance to streptomycin was obtained as a single-step mutation from the test E. coli strain. Whereas the isogenic mutant possessed mannose binding activity and adhering ability similar to the parent strain, it was resistant to the streptomycin-induced suppression of the two activities at enormous concentrations (up to 10,000 μg/ml) of streptomycin. Taken together the results suggest that the suppression of epithelial cell adherence and mannose binding activity of E. coli grown in sublethal concentrations of streptomycin is a result of classic mechanisms of drug action upon the bacterial ribosome. The results support the possibility that antibiotics may act through mechanisms other than inhibition of growth and bacterial killing to eradicate bacteria from mucosal surfaces. Images PMID:376556
Phospholipase C-gamma 1 binding to intracellular receptors for activated protein kinase C.
Disatnik, M H; Hernandez-Sotomayor, S M; Jones, G; Carpenter, G; Mochly-Rosen, D
1994-01-18
Phospholipase C-gamma 1 (PLC-gamma 1; EC 3.1.4.11) hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate and is activated in response to growth factor stimulation and tyrosine phosphorylation. Concomitantly, the enzyme translocates from the cytosol to the particulate cell fraction. A similar process of activation-induced translocation from the cytosol to the cell particulate fraction has also been described for protein kinase C (PKC). We have previously shown that activated PKC binds to specific receptor proteins, receptors for activated C kinase, or RACKs, of approximately 30 kDa. Here, we show that PLC-gamma 1 bound to these RACKs and inhibited subsequent PKC binding to RACKs. However, unlike PKC, the binding of PLC-gamma 1 to RACKs did not require phospholipids and calcium. After epidermal growth factor treatment of intact A-431 cells, the binding of PLC-gamma 1 to RACKs increased as compared with PLC-gamma 1 from control cells. This increase in PLC-gamma 1 binding to RACKs was due to the phosphorylation of PLC-gamma 1. Additional data indicated that PLC-gamma 1 binds to RACKs in solution; epidermal growth factor receptor-dependent PLC-gamma 1 phosphorylation and activation decreased in the presence of RACKs. It is possible that, in vivo, PLC-gamma 1 associates with RACKs or with other PLC-gamma 1-specific anchoring proteins in the particulate cell fraction. Since a PKC C2 homologous region is present in PLC-gamma 1, the C2 region may mediate the activation-induced translocation of the enzyme to the cell particulate fraction and the anchoring protein-PLC-gamma 1 complex may be the active translocated form of PLC-gamma 1.
Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia
2012-01-01
The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731
Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia
2012-04-06
The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.
NF-κB is required for dengue virus NS5-induced RANTES expression.
Khunchai, Sasiprapa; Junking, Mutita; Suttitheptumrong, Aroonroong; Kooptiwut, Suwattanee; Haegeman, Guy; Limjindaporn, Thawornchai; Yenchitsomanus, Pa-Thai
2015-02-02
Dengue virus (DENV) infection associates with renal disorders. Patients with dengue hemorrhagic fever and acute kidney injury have a high mortality rate. Increased levels of cytokines may contribute to the pathogenesis of DENV-induced kidney injury. Currently, molecular mechanisms how DENV induces kidney cell injury has not been thoroughly investigated. Excessive cytokine production may be involved in this process. Using human cytokine RT(2) Profiler PCR array, 14 genes including IP-10, RANTES, IL-8, CXCL-9 and MIP-1β were up-regulated more than 2 folds in DENV-infected HEK 293 cells compared to that of mock-infected HEK 293 cells. In the present study, RANTES was suppressed by the NF-κB inhibitor, compound A (CpdA), in DENV-infected HEK 293 cells implying the role of NF-κB in RANTES expression. Chromatin immunoprecipitation (ChIP) assay showed that NF-κB binds more efficiently to its binding sites on the RANTES promoter in NS5-transfected HEK 293 cells than in HEK 293 cells expressing the vector lacking NS5 gene. To further examine whether the NS5-activated RANTES promoter is mediated through NF-κB, the two NF-κB binding sites on the RANTES promoter were mutated and this promoter was coupled to the luciferase cDNA. The result showed that when both binding sites of NF-κB in the RANTES promoter were mutated, the ability of NS5 to induce the luciferase activity was significantly decreased. Therefore, DENV NS5 activates RANTES production by increasing NF-κB binding to its binding sites on the RANTES promoter. Copyright © 2014 Elsevier B.V. All rights reserved.
dsRNA binding properties of RDE-4 and TRBP reflect their distinct roles in RNAi.
Parker, Greg S; Maity, Tuhin Subhra; Bass, Brenda L
2008-12-26
Double-stranded RNA (dsRNA)-binding proteins facilitate Dicer functions in RNA interference. Caenorhabditis elegans RDE-4 facilitates cleavage of long dsRNA to small interfering RNA (siRNA), while human trans-activation response RNA-binding protein (TRBP) functions downstream to pass siRNA to the RNA-induced silencing complex. We show that these distinct in vivo roles are reflected in in vitro binding properties. RDE-4 preferentially binds long dsRNA, while TRBP binds siRNA with an affinity that is independent of dsRNA length. These properties are mechanistically based on the fact that RDE-4 binds cooperatively, via contributions from multiple domains, while TRBP binds noncooperatively. Our studies offer a paradigm for how dsRNA-binding proteins, which are not sequence specific, discern dsRNA length. Additionally, analyses of the ability of RDE-4 deletion constructs and RDE-4/TRBP chimeras to reconstitute Dicer activity suggest RDE-4 promotes activity using its dsRNA-binding motif 2 to bind dsRNA, its linker region to interact with Dicer, and its C-terminus for Dicer activation.
Sanjay, Archana; Miyazaki, Tsuyoshi; Itzstein, Cecile; Purev, Enkhtsetseg; Horne, William C; Baron, Roland
2006-12-01
Cbl is an adaptor protein and ubiquitin ligase that binds and is phosphorylated by the nonreceptor tyrosine kinase Src. We previously showed that the primary interaction between Src and Cbl is mediated by the Src homology domain 3 (SH3) of Src binding to proline-rich sequences of Cbl. The peptide Cbl RDLPPPPPPDRP(540-551), which corresponds to residues 540-551 of Cbl, inhibited the binding of a GST-Src SH3 fusion protein to Cbl, whereas RDLAPPAPPPDR(540-551) did not, suggesting that Src binds to this site on Cbl in a class I orientation. Mutating prolines 543-548 reduced Src binding to the Cbl 479-636 fragment significantly more than mutating the prolines in the PPVPPR(494-499) motif, which was previously reported to bind Src SH3. Mutating Cbl prolines 543-548 to alanines substantially reduced Src binding to Cbl, Src-induced phosphorylation of Cbl, and the inhibition of Src kinase activity by Cbl. Expressing the mutated Cbl in osteoclasts induced a moderate reduction in bone-resorbing activity and increased amounts of Src protein. In contrast, disabling the tyrosine kinase-binding domain of full-length Cbl by mutating glycine 306 to glutamic acid, and thereby preventing the previously described binding of the tyrosine kinase-binding domain to the Src phosphotyrosine 416, had no effect on Cbl phosphorylation, the inhibition of Src activity by full-length Cbl, or bone resorption. These data indicate that the Cbl RDLPPPP(540-546) sequence is a functionally important binding site for Src.
Yeo, Alan T; Chennamadhavuni, Spandan; Whitty, Adrian; Porco, John A; Gilmore, Thomas D
2015-04-23
Increased activity of transcription factor NF-κB has been implicated in many B-cell lymphomas. We investigated effects of synthetic compound calafianin monomer (CM101) on biochemical and biological properties of NF-κB. In human 293 cells, CM101 selectively inhibited DNA binding by overexpressed NF-κB subunits REL (human c-Rel) and p65 as compared to NF-κB p50, and inhibition of REL and p65 DNA binding by CM101 required a conserved cysteine residue. CM101 also inhibited DNA binding by REL in human B-lymphoma cell lines, and the sensitivity of several B-lymphoma cell lines to CM101-induced proliferation arrest and apoptosis correlated with levels of cellular and nuclear REL. CM101 treatment induced both phosphorylation and decreased expression of anti-apoptotic protein Bcl-XL, a REL target gene product, in sensitive B-lymphoma cell lines. Ectopic expression of Bcl-XL protected SUDHL-2 B-lymphoma cells against CM101-induced apoptosis, and overexpression of a transforming mutant of REL decreased the sensitivity of BJAB B-lymphoma cells to CM101-induced apoptosis. Lipopolysaccharide-induced activation of NF-κB signaling upstream components occurred in RAW264.7 macrophages at CM101 concentrations that blocked NF-κB DNA binding. Direct inhibitors of REL may be useful for treating B-cell lymphomas in which REL is active, and may inhibit B-lymphoma cell growth at doses that do not affect some immune-related responses in normal cells.
Altered G Protein Coupling in Olfactory Neuroepithelial Cells From Patients With Schizophrenia
Borgmann-Winter, Karin E.; Wang, Hoau-Yan; Ray, Rabindranath; Willis, Brooke R.; Moberg, Paul J.; Rawson, Nancy E.; Gur, Raquel E.; Turetsky, Bruce I.; Hahn, Chang-Gyu
2016-01-01
Increasing evidence suggests that olfactory dysfunction is an endophenotype of schizophrenia, and thus the olfactory system can be studied both in relation to this sensory dysfunction and also as a means of examining pathophysiologic mechanisms of schizophrenia. In this study, we examined human olfactory neuroepithelial (ON) biopsy tissues and their in vitro culture cells for ligand-induced guanine nucleotide-binding protein (G protein) activation and downstream signaling. We assessed the binding of a nonhydrolyzable GTP analogue [35S]GTPγS binding to specific G protein subtypes in response to odorants, dopamine, or serotonin in ON cell membranes from matched schizophrenia-control subjects. In response to odorant mixtures, we found decreased [35S]GTPγS binding to Gαs/olf in schizophrenia patients. These changes were not mediated by mRNA expression of key molecules of G protein coupling, including adenylate cyclase III (ACIII), protein kinase A (PKA), protein kinase Cγ (PKCγ), or Gαs or Gαolf in ON cells or ON biopsy tissues. In contrast, dopamine (DA)- and serotonin (5HT)-induced S35-GTPγS binding to Gαs/olf and Gαq/11 were significantly increased in schizophrenia cases, while these parameters were strikingly reduced by in vitro treatment with antipsychotics. Patients with schizophrenia exhibit increases in electrolfactogram (EOG) recordings, suggesting enhanced odorant-induced activation. Our results of decreased odorant-induced G protein activation may point further downstream for underlying mechanisms for increased EOG measures. Increased G protein activation in response to DA and 5HT may suggest increased postreceptor DA or 5HT signaling as an additional mechanism of dopaminergic or serotonergic dysregulation in schizophrenia. PMID:26373539
Ke, Changshu; Zhang, Guiping; Xiao, Juanjuan; Wu, Dan; Zeng, Xiaoyu; Chen, Jingwen; Guo, Jinguang; Zhou, Jie; Shi, Fei; Zhu, Feng
2016-01-01
Skin inflammation, and skin cancer induced by excessive solar ultraviolet (SUV) is a great threat to human health. SUV induced skin inflammation through activating p38 mitogen-activated protein kinase (p38) and c-Jun N-termeinal kinases (JNKs). T-LAK cell-originated protein kinase (TOPK) plays an important role in this process. Herein, the clinical data showed TOPK, phospho-p38, phospho-JNKs were highly expressed in human solar dermatitis. Ex vivo studies showed that SUV induced the phosphorylation of p38 and JNKs in HaCat and JB6 cells in a dose and time dependent manner. Molecule docking model indicated cefradine, an FDA-approved cephalosporin antibiotic, directly binds with TOPK. The result of in vitro binding assay verified cefradine can directly bind with TOPK. In vitro kinase results showed cefradine can inhibit TOPK activity. Ex vivo studies further showed cefradine inhibited SUV-induced the phosphorylation level of p38, JNKs and H2AX through inhibiting TOPK activity in a dose and time dependent manner, and cefradine inhibited the secretion of IL6 and TNF-α in HaCat and JB6 cells. In vivo studies showed that cefradine down-regulated SUV-induced the phosphorylation of p38, JNKs and H2AX and inhibited the secretion of IL6 and TNF-α in Babl/c mice. These results indicated that cefradine can inhibit SUV-induced skin inflammation by blocking TOPK signaling pathway, and TOPK is an effective target for suppressing inflammation induced by SUV irradiation. PMID:27016423
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morrison, W.J.; Offner, H.; Vandenbark, A.A.
1989-01-01
The binding of different gangliosides to rat T-helper lymphocytes was characterized under conditions that decrease CD4 expression on different mammalian T-helper lymphoctyes. Saturation binding by monosialylated ({sub 3}H)-GM{sub 1} to rat T-lymphocytes was time- and temperature-dependent, had a dissociation constant (K{sub D}) of 2.2 {plus minus} 1.4 {mu}M and a binding capacity near 2 fmoles/cell. Competitive inhibition of ({sup 3}H)- GM{sub 1} binding demonstrated a structural-activity related to the number of unconstrained sialic acid moieties on GM{sub 1}-congeneric gangliosides. A comparison between the results of these binding studies and gangliosides-induced decrease of CD4 expression demonstrated that every aspect of ({supmore » 3}H)-GM{sub 1} binding concurs with ganglioside modulation of CD4 expression. It is concluded that the specific decrease of CD4 expression induced by pretreatment with gangliosides involves the initial process of gangliosides binding to specific sites on CD4{sup {double dagger}} T-helper lymphocytes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Belanger, Adam J.; Luo Zhengyu; Vincent, Karen A.
2007-12-21
In response to cellular hypoxia, cardiomyocytes adapt to consume less oxygen by shifting ATP production from mitochondrial fatty acid {beta}-oxidation to glycolysis. The transcriptional activation of glucose transporters and glycolytic enzymes by hypoxia is mediated by hypoxia-inducible factor 1 (HIF-1). In this study, we examined whether HIF-1 was involved in the suppression of mitochondrial fatty acid {beta}-oxidation in hypoxic cardiomyocytes. We showed that either hypoxia or adenovirus-mediated expression of a constitutively stable hybrid form (HIF-1{alpha}/VP16) suppressed mitochondrial fatty acid metabolism, as indicated by an accumulation of intracellular neutral lipid. Both treatments also reduced the mRNA levels of muscle carnitine palmitoyltransferasemore » I which catalyzes the rate-limiting step in the mitochondrial import of fatty acids for {beta}-oxidation. Furthermore, adenovirus-mediated expression of HIF-1{alpha}/VP16 in cardiomyocytes under normoxic conditions also mimicked the reduction in the DNA binding activity of peroxisome proliferator-activated receptor {alpha} (PPAR{alpha})/retinoid X receptor (RXR), in the presence or absence of a PPAR{alpha} ligand. These results suggest that HIF-1 may be involved in hypoxia-induced suppression of fatty acid metabolism in cardiomyocytes by reducing the DNA binding activity of PPAR{alpha}/RXR.« less
Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie
2017-05-11
Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.
Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie
2017-01-01
Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mϕ) direct trauma-induced inflammation, and Mϕ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mϕ and the subsequent regulation of Mϕ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)–TLR4–MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mϕ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mϕ. However, autophagy activation also suppressed Mϕ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mϕ homeostasis in response to trauma. PMID:28492546
2011-06-03
reduces hemorrhage-induced injuries. In our laboratory we have shown that geldanamycin, a natural product from the bacterium Streptomyces ...product produced by Streptomyces hygroscopicus that binds with high affinity to the ATP binding pocket of HSP-90 [9, 10]. 17-DMAG is water soluble, less
Mamais, Adamantios; Chia, Ruth; Beilina, Alexandra; Hauser, David N.; Hall, Christine; Lewis, Patrick A.; Cookson, Mark R.; Bandopadhyay, Rina
2014-01-01
Mutations in the gene encoding leucine-rich repeat kinase 2 (LRRK2) are a common genetic cause of Parkinson disease, but the mechanisms whereby LRRK2 is regulated are unknown. Phosphorylation of LRRK2 at Ser910/Ser935 mediates interaction with 14-3-3. Pharmacological inhibition of its kinase activity abolishes Ser910/Ser935 phosphorylation and 14-3-3 binding, and this effect is also mimicked by pathogenic mutations. However, physiological situations where dephosphorylation occurs have not been defined. Here, we show that arsenite or H2O2-induced stresses promote loss of Ser910/Ser935 phosphorylation, which is reversed by phosphatase inhibition. Arsenite-induced dephosphorylation is accompanied by loss of 14-3-3 binding and is observed in wild type, G2019S, and kinase-dead D2017A LRRK2. Arsenite stress stimulates LRRK2 self-association and association with protein phosphatase 1α, decreases kinase activity and GTP binding in vitro, and induces translocation of LRRK2 to centrosomes. Our data indicate that signaling events induced by arsenite and oxidative stress may regulate LRRK2 function. PMID:24942733
Pahan, Kalipada; Jana, Malabendu; Liu, Xiaojuan; Taylor, Bradley S.; Wood, Charles; Fischer, Susan M.
2007-01-01
Gemfibrozil, a lipid-lowering drug, inhibited cytokine-induced production of NO and the expression of inducible nitric-oxide synthase (iNOS) in human U373MG astroglial cells and primary astrocytes. Similar to gemfibrozil, clofibrate, another fibrate drug, also inhibited the expression of iNOS. Inhibition of human iNOS promoter-driven luciferase activity by gemfibrozil in cytokine-stimulated U373MG astroglial cells suggests that this compound inhibits the transcription of iNOS. Since gemfibrozil is known to activate peroxisome proliferator-activated receptor-α (PPAR-α), we investigated the role of PPAR-α in gemfibrozil-mediated inhibition of iNOS. Gemfibrozil induced peroxisome proliferator-responsive element (PPRE)-dependent luciferase activity, which was inhibited by the expression of ΔhPPAR-α, the dominant-negative mutant of human PPAR-α. However, ΔhPPAR-α was unable to abrogate gemfibrozil-mediated inhibition of iNOS suggesting that gemfibrozil inhibits iNOS independent of PPAR-α. The human iNOS promoter contains consensus sequences for the binding of transcription factors, including interferon-γ (IFN-γ) regulatory factor-1 (IRF-1) binding to interferon-stimulated responsive element (ISRE), signal transducer and activator of transcription (STAT) binding to γ-activation site (GAS), nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and CCAAT/enhancer-binding protein β (C/EBPβ); therefore, we investigated the effect of gemfibrozil on the activation of these transcription factors. The combination of interleukin (IL)-1β and IFN-γ induced the activation of NF-κB, AP-1, C/EBPβ, and GAS but not that of ISRE, suggesting that IRF-1 may not be involved in cytokine-induced expression of iNOS in human astrocytes. Interestingly, gemfibrozil strongly inhibited the activation of NF-κB, AP-1, and C/EBPβ but not that of GAS in cytokine-stimulated astroglial cells. These results suggest that gemfibrozil inhibits the induction of iNOS probably by inhibiting the activation of NF-κB, AP-1, and C/EBPβ and that gemfibrozil, a prescribed drug for humans, may further find its therapeutic use in neuroinflammatory diseases. PMID:12244038
Marino, Michael; Banerjee, Manidipa; Jonquières, Renaud; Cossart, Pascale; Ghosh, Partho
2002-01-01
InlB, a surface-localized protein of Listeria monocytogenes, induces phagocytosis in non-phagocytic mammalian cells by activating Met, a receptor tyrosine kinase. InlB also binds glycosaminoglycans and the protein gC1q-R, two additional host ligands implicated in invasion. We present the structure of InlB, revealing a highly elongated molecule with leucine-rich repeats that bind Met at one end, and GW domains that dissociably bind the bacterial surface at the other. Surprisingly, the GW domains are seen to resemble SH3 domains. Despite this, GW domains are unlikely to act as functional mimics of SH3 domains since their potential proline-binding sites are blocked or destroyed. However, we do show that the GW domains, in addition to binding glycosaminoglycans, bind gC1q-R specifically, and that this binding requires release of InlB from the bacterial surface. Dissociable attachment to the bacterial surface via the GW domains may be responsible for restricting Met activation to a small, localized area of the host cell and for coupling InlB-induced host membrane dynamics with bacterial proximity during invasion. PMID:12411480
Ajmal, Mohammad Rehan; Chaturvedi, Sumit Kumar; Zaidi, Nida; Alam, Parvez; Zaman, Masihuz; Siddiqi, Mohammad Khursheed; Nusrat, Saima; Jamal, Mohammad Sarwar; Mahmoud, Mohamed H; Badr, Gamal; Khan, Rizwan Hasan
2017-08-01
The present study details the binding process of clofazimine to hen egg white lysozyme (HEWL) using spectroscopy, dynamic light scattering, transmission electron microscopy (TEM), and molecular docking techniques. Clofazimine binds to the protein with binding constant (K b ) in the order of 1.57 × 10 4 at 298 K. Binding process is spontaneous and exothermic. Molecular docking results suggested the involvement of hydrogen bonding and hydrophobic interactions in the binding process. Bacterial cell lytic activity in the presence of clofazimine increased to more than 40% of the value obtained with HEWL only. Interaction of the drug with HEWL induced ordered secondary structure in the protein and molecular compaction. Clofazimine also effectively inhibited the sodium dodecyl sulfate (SDS) induced amyloid formation in HEWL and caused disaggregation of preformed fibrils, reinforcing the notion that there is involvement of hydrophobic interactions and hydrogen bonding in the binding process of clofazimine with HEWL and clofazimine destabilizes the mature fibrils. Further, TEM images confirmed that fibrillar species were absent in the samples where amyloid induction was performed in the presence of clofazimine. As clofazimine is a drug less explored for the inhibition of fibril formation of the proteins, this study reports the inhibition of SDS-induced amyloid formation of HEWL by clofazimine, which will help in the development of clofazimine-related molecules for the treatment of amyloidosis.
Redfern, Andrew D.; Colley, Shane M.; Beveridge, Dianne J.; Ikeda, Naoya; Epis, Michael R.; Li, Xia; Foulds, Charles E.; Stuart, Lisa M.; Barker, Andrew; Russell, Victoria J.; Ramsay, Kerry; Kobelke, Simon J.; Li, Xiaotao; Hatchell, Esme C.; Payne, Christine; Giles, Keith M.; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B.; O’Malley, Bert W.; Leedman, Peter J.
2013-01-01
The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing. PMID:23550157
Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J
2013-04-16
The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.
NASA Astrophysics Data System (ADS)
Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D'Amelio, Nicola; Gervasio, Francesco Luigi
2016-04-01
Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe.
van Weering, David H. J.; de Rooij, Johan; Marte, Barbara; Downward, Julian; Bos, Johannes L.; Burgering, Boudewijn M. T.
1998-01-01
Regulation of phosphoinositide 3-kinase (PI 3-kinase) can occur by binding of the regulatory p85 subunit to tyrosine-phosphorylated proteins and by binding of the p110 catalytic subunit to activated Ras. However, the way in which these regulatory mechanisms act to regulate PI 3-kinase in vivo is unclear. Here we show that several growth factors (basic fibroblast growth factor [bFGF], platelet-derived growth factor [PDGF], and epidermal growth factor [EGF; to activate an EGF receptor-Ret chimeric receptor]) all activate PI 3-kinase in vivo in the neuroectoderm-derived cell line SKF5. However, these growth factors differ in their ability to activate PI 3-kinase-dependent signaling. PDGF and EGF(Ret) treatment induced PI 3-kinase-dependent lamellipodium formation and protein kinase B (PKB) activation. In contrast, bFGF did not induce lamellipodium formation but activated PKB, albeit to a small extent. PDGF and EGF(Ret) stimulation resulted in binding of p85 to tyrosine-phosphorylated proteins and strong Ras activation. bFGF, however, induced only strong activation of Ras. In addition, while RasAsn17 abolished bFGF activation of PKB, PDGF- and EGF(Ret)-induced PKB activation was only partially inhibited and lamellipodium formation was unaffected. Interestingly, in contrast to activation of only endogenous Ras (bFGF), ectopic expression of activated Ras did result in lamellipodium formation. From this we conclude that, in vivo, p85 and Ras synergize to activate PI 3-kinase and that strong activation of only endogenous Ras exerts a small effect on PI 3-kinase activity, sufficient for PKB activation but not lamellipodium formation. This differential sensitivity to PI 3-kinase activation could be explained by our finding that PKB activation and lamellipodium formation are independent PI 3-kinase-induced events. PMID:9528752
Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse
Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.
2014-01-01
Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037
Fay, Jonathan F; Farrens, David L
2012-09-28
Allosteric ligands that modulate how G protein-coupled receptors respond to traditional orthosteric drugs are an exciting and rapidly expanding field of pharmacology. An allosteric ligand for the cannabinoid receptor CB1, Org 27569, exhibits an intriguing effect; it increases agonist binding, yet blocks agonist-induced CB1 signaling. Here we explored the mechanism behind this behavior, using a site-directed fluorescence labeling approach. Our results show that Org 27569 blocks conformational changes in CB1 that accompany G protein binding and/or activation, and thus inhibit formation of a fully active CB1 structure. The underlying mechanism behind this behavior is that simultaneous binding of Org 27569 produces a unique agonist-bound conformation, one that may resemble an intermediate structure formed on the pathway to full receptor activation.
Rodríguez-Calvo, Ricardo; Serrano, Lucía; Coll, Teresa; Moullan, Norman; Sánchez, Rosa M; Merlos, Manuel; Palomer, Xavier; Laguna, Juan C; Michalik, Liliane; Wahli, Walter; Vázquez-Carrera, Manuel
2008-08-01
Chronic activation of the nuclear factor-kappaB (NF-kappaB) in white adipose tissue leads to increased production of pro-inflammatory cytokines, which are involved in the development of insulin resistance. It is presently unknown whether peroxisome proliferator-activated receptor (PPAR) beta/delta activation prevents inflammation in adipocytes. First, we examined whether the PPARbeta/delta agonist GW501516 prevents lipopolysaccharide (LPS)-induced cytokine production in differentiated 3T3-L1 adipocytes. Treatment with GW501516 blocked LPS-induced IL-6 expression and secretion by adipocytes and the subsequent activation of the signal transducer and activator of transcription 3 (STAT3)-Suppressor of cytokine signaling 3 (SOCS3) pathway. This effect was associated with the capacity of GW501516 to impede LPS-induced NF-kappaB activation. Second, in in vivo studies, white adipose tissue from Zucker diabetic fatty (ZDF) rats, compared with that of lean rats, showed reduced PPARbeta/delta expression and PPAR DNA-binding activity, which was accompanied by enhanced IL-6 expression and NF-kappaB DNA-binding activity. Furthermore, IL-6 expression and NF-kappaB DNA-binding activity was higher in white adipose tissue from PPARbeta/delta-null mice than in wild-type mice. Because mitogen-activated protein kinase-extracellular signal-related kinase (ERK)1/2 (MEK1/2) is involved in LPS-induced NF-kappaB activation in adipocytes, we explored whether PPARbeta/delta prevented NF-kappaB activation by inhibiting this pathway. Interestingly, GW501516 prevented ERK1/2 phosphorylation by LPS. Furthermore, white adipose tissue from animal showing constitutively increased NF-kappaB activity, such as ZDF rats and PPARbeta/delta-null mice, also showed enhanced phospho-ERK1/2 levels. These findings indicate that activation of PPARbeta/delta inhibits enhanced cytokine production in adipocytes by preventing NF-kappaB activation via ERK1/2, an effect that may help prevent insulin resistance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garg, Himanshu; Joshi, Anjali; Tompkins, Wayne A.
2004-12-20
Feline Immunodeficiency Virus (FIV) is a lentivirus that causes immunodeficiency in cats, which parallels HIV-1-induced immunodeficiency in humans. It has been established that HIV envelope (Env) glycoprotein mediates T cell loss via a mechanism that requires CXCR4 binding. The Env glycoprotein of FIV, similar to HIV, requires CXCR4 binding for viral entry, as well as inducing membrane fusion leading to syncytia formation. However, the role of FIV Env in T cell loss and the molecular mechanisms governing this process have not been elucidated. We studied the role of Env glycoprotein in FIV-mediated T cell apoptosis in an in vitro model.more » Our studies demonstrate that membrane-expressed FIV Env induces apoptosis in activated feline peripheral blood mononuclear cells (PBMC) by a mechanism that requires CXCR4 binding, as the process was inhibited by CXCR4 antagonist AMD3100 in a dose-dependent manner. Interestingly, studies regarding the role of CD134, the recently identified primary receptor of FIV, suggest that binding to CD134 may not be important for induction of apoptosis in PBMC. However, inhibiting Env-mediated fusion post CXCR4 binding by FIV gp41-specific fusion inhibitor also inhibited apoptosis. Under similar conditions, a fusion-defective gp41 mutant was unable to induce apoptosis in activated PBMC. Our findings are the first report suggesting the potential of FIV Env to mediate apoptosis in bystander cells by a process that is dependent on gp41 function.« less
Glucose Enhances Basal or Melanocortin-Induced cAMP-Response Element Activity in Hypothalamic Cells
Wicht, Kristina; Boekhoff, Ingrid; Glas, Evi; Lauffer, Lisa; Mückter, Harald; Gudermann, Thomas
2016-01-01
Melanocyte-stimulating hormone (MSH)-induced activation of the cAMP-response element (CRE) via the CRE-binding protein in hypothalamic cells promotes expression of TRH and thereby restricts food intake and increases energy expenditure. Glucose also induces central anorexigenic effects by acting on hypothalamic neurons, but the underlying mechanisms are not completely understood. It has been proposed that glucose activates the CRE-binding protein-regulated transcriptional coactivator 2 (CRTC-2) in hypothalamic neurons by inhibition of AMP-activated protein kinases (AMPKs), but whether glucose directly affects hypothalamic CRE activity has not yet been shown. Hence, we dissected effects of glucose on basal and MSH-induced CRE activation in terms of kinetics, affinity, and desensitization in murine, hypothalamic mHypoA-2/10-CRE cells that stably express a CRE-dependent reporter gene construct. Physiologically relevant increases in extracellular glucose enhanced basal or MSH-induced CRE-dependent gene transcription, whereas prolonged elevated glucose concentrations reduced the sensitivity of mHypoA-2/10-CRE cells towards glucose. Glucose also induced CRCT-2 translocation into the nucleus and the AMPK activator metformin decreased basal and glucose-induced CRE activity, suggesting a role for AMPK/CRTC-2 in glucose-induced CRE activation. Accordingly, small interfering RNA-induced down-regulation of CRTC-2 expression decreased glucose-induced CRE-dependent reporter activation. Of note, glucose also induced expression of TRH, suggesting that glucose might affect the hypothalamic-pituitary-thyroid axis via the regulation of hypothalamic CRE activity. These findings significantly advance our knowledge about the impact of glucose on hypothalamic signaling and suggest that TRH release might account for the central anorexigenic effects of glucose and could represent a new molecular link between hyperglycaemia and thyroid dysfunction. PMID:27144291
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Reddy, V. S.; Golovkin, M.
2000-01-01
Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.
Dimerization of glycoprotein Ibα is not sufficient to induce platelet clearance.
Liang, X; Syed, A K; Russell, S R; Ware, J; Li, R
2016-02-01
ESSENTIALS: Many anti-glycoprotein (GP)Ibα antibodies induce platelet clearance in a dimer-dependent manner. Characterization of monoclonal antibodies that bind the mechanosensitive domain (MSD) of GPIbα. An anti-MSD antibody binds two copies of GPIbα in platelets but does not induce platelet clearance. The prevailing clustering model of GPIbα signaling is incorrect or needs revision. The mechanism of platelet clearance is not clear. Many antibodies binding the membrane-distal ligand-binding domain of glycoprotein (GP)Ibα induce rapid clearance of platelets and acute thrombocytopenia, which requires the bifurcated antibody structure. It was thought that binding of these antibodies induced lateral dimerization or clustering of GPIbα in the plasma membrane, which leads to downstream signaling and platelet clearance. However, many antibodies targeting GPIbβ and GPIX, which are associated with GPIbα in the GPIb-IX complex, do not induce platelet clearance, which is in contradiction to the clustering model. To test whether dimerization or clustering of GPIbα is sufficient to transmit the signal that leads to platelet clearance. We have recently raised several mAbs targeting the mechanosensitive domain (MSD) of GPIbα. Binding of these anti-MSD antibodies was characterized with biochemical methods. Their ability to stimulate platelets and induce platelet clearance in mice was assessed. Infusion of anti-MSD antibodies does not cause thrombocytopenia in mice. These antibodies show no detectable effects on platelet activation and aggregation in vitro. Further biochemical investigation showed that the anti-MSD antibody 3D1 binds two copies of GPIbα on the platelet surface. Therefore, lateral dimerization of GPIbα induced by antibody binding is not sufficient to initiate GPIb-IX signaling and induce platelet clearance. Our results suggest that a factor other than or in addition to clustering of GPIbα is required to induce platelet clearance. © 2015 International Society on Thrombosis and Haemostasis.
Blancato, Víctor S.; Pagliai, Fernando A.; Magni, Christian; Gonzalez, Claudio F.; Lorca, Graciela L.
2016-01-01
The regulator of citrate metabolism, CitO, from Enterococcus faecalis belongs to the FCD family within the GntR superfamily. In the presence of citrate, CitO binds to cis-acting sequences located upstream of the cit promoters inducing the expression of genes involved in citrate utilization. The quantification of the molecular binding affinities, performed by isothermal titration calorimetry (ITC), indicated that CitO has a high affinity for citrate (KD = 1.2 ± 0.2 μM), while it did not recognize other metabolic intermediates. Based on a structural model of CitO where a putative small molecule and a metal binding site were identified, it was hypothesized that the metal ion is required for citrate binding. In agreement with this model, citrate binding to CitO sharply decreased when the protein was incubated with EDTA. This effect was reverted by the addition of Ni2+, and Zn2+ to a lesser extent. Structure-based site-directed mutagenesis was conducted and it was found that changes to alanine in residues Arg97 and His191 resulted in decreased binding affinities for citrate, as determined by EMSA and ITC. Further assays using lacZ fusions confirmed that these residues in CitO are involved in sensing citrate in vivo. These results indicate that the molecular modifications induced by a ligand and a metal binding in the C-terminal domain of CitO are required for optimal DNA binding activity, and consequently, transcriptional activation. PMID:26903980
Kawabata, Fuminori; Kawabata, Yuko; Liang, Ruojun; Nishimura, Shotaro; Tabata, Shoji
2017-01-01
Postprandial hyperglycemia is a risk factor for cardiovascular diseases. It has been reported that intragastric administration of allyl isothiocyanate (AITC), which is one of the pungent ingredients of wasabi and horseradish but it is not included in hot chili pepper, increased carbohydrate oxidation and reduced postprandial increase of blood glucose via transient receptor potential vanilloid 1 (TRPV1)in mice. However, the action site of AITC on TRPV1 for increasing carbohydrate oxidation is unclear. Both mammalian and chicken TRPV1 (cTRPV1) are activated by heat and acid, but unlike its mammalian counterpart, cTRPV1 is only faintly activated by capsaicin. This difference is due to the 8 chicken-specific amino acid residues around transmembrane 3, which is the main site of capsaicin-binding in rat TRPV1. Moreover, AITC-induced activation of mouse TRPV1 (mTRPV1) is largely dependent on S513, a residue that is involved in capsaicin-binding. Thus, we hypothesized that the increase of carbohydrate oxidation by AITC in mammals is induced by the binding of AITC to the capsaicin-binding site of TRPV1. In this study, we performed a comparative study using chickens and mice, since chickens are thought to partly lack the capsaicin-binding site of TRPV1. We examined the effects of AITC on the respiratory quotient (RQ), the index of carbohydrate oxidation and fat oxidation, in chickens and mice. Respiratory gas analysis revealed that AITC does not increase the RQ in chickens, and Ca 2+ imaging methods and a whole cell-patch clamp analysis showed that AITC does not activate cTRPV1. These results implied that the capsaicin-binding site is an important region for increasing carbohydrate oxidation by AITC administration in animals.
SMAD3 augments FoxO3-induced MuRF-1 promoter activity in a DNA-binding-dependent manner
Bollinger, Lance M.; Witczak, Carol A.; Houmard, Joseph A.
2014-01-01
Muscle-specific RING finger-1 (MuRF-1), a ubiquitin ligase and key regulator of proteasome-dependent protein degradation, is highly expressed during skeletal muscle atrophy. The transcription factor forkhead box O3 (FoxO3) induces MuRF-1 expression, but the direct role of other major atrophy-related transcription factors, such as SMAD3, is largely unknown. The goal of this study was to determine whether SMAD3 individually regulates, or with FoxO3 coordinately regulates, MuRF-1 expression. In cultured myotubes or human embryonic kidney cells, MuRF-1 mRNA content and promoter activity were increased by FoxO3 but not by SMAD3 overexpression. However, FoxO3 and SMAD3 coexpression synergistically increased MuRF-1 mRNA and promoter activity. Mutation of the SMAD-binding element (SBE) in the proximal MuRF-1 promoter or overexpression of a SMAD3 DNA-binding mutant attenuated FoxO3-dependent MuRF-1 promoter activation, showing that SMAD binding to DNA is required for optimal activation of FoxO3-induced transcription of MuRF-1. Using chromatin immunoprecipitation, SMAD3 DNA binding increased FoxO3 abundance and SBE mutation reduced FoxO3 abundance on the MuRF-1 promoter. Furthermore, SMAD3 overexpression dose-dependently increased FoxO3 protein content, and coexpression of FoxO3 and SMAD3 synergistically increased FoxO-dependent gene transcription [assessed with a FoxO response element (FRE)-driven reporter]. Collectively, these results show that SMAD3 regulates transcription of MuRF-1 by increasing FoxO3 binding at a conserved FRE-SBE motif within the proximal promoter region, and by increasing FoxO3 protein content and transcriptional activity. These data are the first to indicate that two major transcription factors regulating protein degradation, FoxO3 and SMAD3, converge to coordinately and directly regulate transcription of MuRF-1. PMID:24920680
Lee, Ji-Sook; Kim, In Sik
2010-06-01
Leukotactin-1 (Lkn-1)/CCL15 is a CC chemokine that binds to the CCR1 and CCR3. Lkn-1 functions as an essential factor in the migration of monocytes, lymphocytes, and neutrophils. Although eosinophils express both receptors, the role of Lkn-1 in immature eosinophils remains to be elucidated. In this present study, we investigated the contribution of the CCR1-binding chemokines to chemotactic activity and in the differentiation in the human eosinophilic leukemia cell line EoL-1. Lkn-1 induced the stronger migration of EoL-1 cells than other CCR1-binding chemokines such as RANTES/CCL5, MIP-1alpha/CCL3 and HCC-4/CCL16. Lkn-1-induced chemotaxis was inhibited by pertussis toxin, an inhibitor of G(i)/G(o) protein; U73122, an inhibitor of phospholipase C and rottlerin, an inhibitor of protein kinase C delta (PKCdelta). Lkn-1 increased PKCdelta activity, which was partially blocked by the pertussis toxin and U73122. Lkn-1 enhanced the butyric acid-induced differentiation via PKCdelta after binding to the increased CCR1 because Lkn-1 caused EoL-1 cells to change morphologically into mature eosinophil-like cells. Likewise, Lkn-1 increased the expression of both eosinophil peroxidase (EPO) and the major basic protein (MBP). PKCdelta activation due to Lkn-1 is involved in migration, as well as the butyric acid-induced differentiation. This finding contributes to an understanding of CC chemokines in eosinophil biology and to the development of novel therapies for the treatment of eosinophilic disorders. This study suggests the pivotal roles of Lkn-1 in the regulation of the movement and development of eosinophils.
Berberine-induced autophagic cell death by elevating GRP78 levels in cancer cells.
La, Xiaoqin; Zhang, Lichao; Li, Zhuoyu; Yang, Peng; Wang, Yingying
2017-03-28
Berberine, an isoquinoline alkaloid extracted from Coptidis Rhizoma, has been shown to induce cancer cell autophagic death. Glucose regulated protein 78 (GRP78) is associated with stress-induced autophagy. However, the related mechanisms between berberine-induced cancer cell autophagy and GRP78 remain to be elucidated. Here, we report that berberine can induce autophagic cancer cell death by elevating levels of GRP78. These results further demonstrated that berberine enhanced GRP78 by suppression of ubiquitination / proteasomal degradation of GRP78 and activation of ATF6. Moreover, fluorescence spectrum assay revealed that berberine could bind to GRP78 and form complexes. Finally, co-IP analysis showed that the ability of GRP78 to bind to VPS34 was increased with berberine treatment. Taken together, our results suggest that berberine induces autophagic cancer cell death via enhancing GRP78 levels and the ability of GRP78 to bind to VPS34.
Berberine-induced autophagic cell death by elevating GRP78 levels in cancer cells
Li, Zhuoyu; Yang, Peng; Wang, Yingying
2017-01-01
Berberine, an isoquinoline alkaloid extracted from Coptidis Rhizoma, has been shown to induce cancer cell autophagic death. Glucose regulated protein 78 (GRP78) is associated with stress-induced autophagy. However, the related mechanisms between berberine-induced cancer cell autophagy and GRP78 remain to be elucidated. Here, we report that berberine can induce autophagic cancer cell death by elevating levels of GRP78. These results further demonstrated that berberine enhanced GRP78 by suppression of ubiquitination / proteasomal degradation of GRP78 and activation of ATF6. Moreover, fluorescence spectrum assay revealed that berberine could bind to GRP78 and form complexes. Finally, co-IP analysis showed that the ability of GRP78 to bind to VPS34 was increased with berberine treatment. Taken together, our results suggest that berberine induces autophagic cancer cell death via enhancing GRP78 levels and the ability of GRP78 to bind to VPS34. PMID:28157699
Batbayar, Sainkhuu; Kim, Mi Jeong; Kim, Ha Won
2011-01-01
Beta-Glucan of medicinal Lingzhi or Reishi mushroom, Ganoderma lucidum (BGG), possesses immunostimulatory and anti-tumor activities. Innate immune cells are activated by the binding of beta-glucan to the dectin-1 receptor. The present study investigated the immunostimulating activities of BGG, including binding to dectin-1, secretion of cytokines and reactive oxygen species, and induction of Toll-like receptors (TLRs) in RAW264.7 mouse macrophages. Reverse transcription-polymerase chain reaction and flow cytometry were used for the cytokine and TLR analyses. A mouse inflammation antibody array was used for protein-level cytokine analysis. BGG bound to dectin-1 and induced RAW264.7 cell secretion of several cytokines, including granulocyte colony-stimulating factor, interleukin (IL)-6, regulated upon activation normal T cell expressed and secreted (RANTES), tissue inhibitor of metalloproteinase-1, and tumor necrosis factor-alpha. The secretion of these cytokines was further increased by the addition of lipopolysaccharide (LPS). BGG also induced both nitric oxide and inducible nitric oxide synthase (iNOS). Treatment with an inhibitor of nuclear factor-kappa B (NF-kappaB) reduced the induction of IL-1, IL-6, and iNOS in a concentration-dependent manner. Expressions of TLR2, TLR4, and TLR6 were increased by BGG treatment, and addition of LPS induced further induction of TLR4 and TLR6. Our result indicates that BGG induces macrophage secretion of inflammatory cytokines, which can be potentiated by the presence of LPS, likely by binding to dectin-1 and TLR-2/6 receptors, which activate NF-kappaB and prompt the secretion of cytokines.
Wu, Sheng-Hua; Wang, Ming-Jie; Lü, Jing; Chen, Xiao-Qing
2017-01-01
Previous studies have reported that lipoxin A4 (LXA4) may exert a renoprotective effect on ischemia/reperfusion injury in various animal models. The underlying mechanism of LXA4-induced renoprotection during ischemia/reperfusion injury remains to be elucidated. The present study investigated LXA4-induced protection on renal tubular cells subjected to hypoxia/reoxygenation (H/R) injury, and determined the effects of peroxisome proliferator-activated receptor-γ (PPARγ) and heme oxygenase-1 (HO-1) on LXA4 treatment. HK-2 human tubular epithelial cells exposed to H/R injury were pretreated with LXA4, signal molecule inhibitors or the HO-1 inhibitor zinc protoporphyrin-IX, or were transfected with PPARγ small interfering RNA (siRNA) or nuclear factor E2-related factor 2 (Nrf2) siRNA. The protein and mRNA expression levels of PPARγ and HO-1 were analyzed using western blotting and reverse transcription-quantitative polymerase chain reaction. Binding activity of Nrf2 to the HO-1 E1 enhancer was determined using chromatin immunoprecipitation. Nrf2 binding to the HO-1 antioxidant responsive element (ARE) was assessed using electrophoretic mobility shift assay. Preincubation of cells with LXA4 exposed to H/R injury led to a decreased production of inducible nitrogen oxide synthase, malondialdehyde, γ-glutamyl transpeptidase, leucine aminopeptidase and N-acetyl-β-glucosaminidase. In addition, LXA4 pretreatment increased cell viability, protein and mRNA expression levels of PPARγ and HO-1 and PPARγ and HO-1 promoter activity. SB20358 is a p38 mitogen-activated protein kinase (p38 MAPK) pathway inhibitor, which reduced LXA4-induced PPARγ expression levels. LXA4 treatment upregulated p38 MAPK activation, Nrf2 nuclear translocation and increased binding activity of Nrf2 to HO-1 ARE and E1 enhancer in cells exposed to H/R injury. Transfection of the cells with PPARγ siRNA reduced the LXA4-induced Nrf2 translocation. Transfection of the cells with PPARγ siRNA or Nrf2 siRNA also reduced the LXA4-induced increase in HO-1 expression. In conclusion, LXA4-induced protection of renal tubular cells against H/R injury was associated with the induction of PPARγ and HO-1, via activation of the p38 MAPK pathway, as well as Nrf2 nuclear translocation and binding to HO-1 ARE and E1 enhancer. Therefore, LXA4-induced renoprotection is associated with activation of the p38 MAPK/PPARγ/Nrf2-ARE/HO-1 pathway. PMID:28259922
Kojima, Reiji; Ohno, Tatsukuni; Iikura, Motoyasu; Niki, Toshiro; Hirashima, Mitsuomi; Iwaya, Keichi; Tsuda, Hitoshi; Nonoyama, Shigeaki; Matsuda, Akio; Saito, Hirohisa; Matsumoto, Kenji; Nakae, Susumu
2014-01-01
Galectin-9 (Gal-9), a lectin having a β-galactoside-binding domain, can induce apoptosis of Th1 cells by binding to TIM-3. In addition, Gal-9 inhibits IgE/Ag-mediated degranulation of mast cell/basophilic cell lines by binding to IgE, thus blocking IgE/Ag complex formation. However, the role of Gal-9 in mast cell function in the absence of IgE is not fully understood. Here, we found that recombinant Gal-9 directly induced phosphorylation of Erk1/2 but not p38 MAPK in a human mast cell line, HMC-1, which does not express FcεRI. Gal-9 induced apoptosis and inhibited PMA/ionomycin-mediated degranulation of HMC-1 cells. On the other hand, Gal-9 induced cytokine and/or chemokine production by HMC-1 cells, dependent on activation of ERK1/2 but not p38 MAPK. In addition, the lectin activity of Gal-9 was required for Gal-9-mediated cytokine secretion by HMC-1 cells. These observations suggest that Gal-9 has dual properties as both a regulator and an activator of mast cells.
Aghazadeh, Yasaman; Rone, Malena B.; Blonder, Josip; Ye, Xiaoying; Veenstra, Timothy D.; Hales, D. Buck; Culty, Martine; Papadopoulos, Vassilios
2012-01-01
Cholesterol is the sole precursor of steroid hormones in the body. The import of cholesterol to the inner mitochondrial membrane, the rate-limiting step in steroid biosynthesis, relies on the formation of a protein complex that assembles at the outer mitochondrial membrane called the transduceosome. The transduceosome contains several mitochondrial and cytosolic components, including the steroidogenic acute regulatory protein (STAR). Human chorionic gonadotropin (hCG) induces de novo synthesis of STAR, a process shown to parallel maximal steroid production. In the hCG-dependent steroidogenic MA-10 mouse Leydig cell line, the 14-3-3γ protein was identified in native mitochondrial complexes by mass spectrometry and immunoblotting, and its levels increased in response to hCG treatment. The 14-3-3 proteins bind and regulate the activity of many proteins, acting via target protein activation, modification and localization. In MA-10 cells, cAMP induces 14-3-3γ expression parallel to STAR expression. Silencing of 14-3-3γ expression potentiates hormone-induced steroidogenesis. Binding motifs of 14-3-3γ were identified in components of the transduceosome, including STAR. Immunoprecipitation studies demonstrate a hormone-dependent interaction between 14-3-3γ and STAR that coincides with reduced 14-3-3γ homodimerization. The binding site of 14-3-3γ on STAR was identified to be Ser-194 in the STAR-related sterol binding lipid transfer (START) domain, the site phosphorylated in response to hCG. Taken together, these results demonstrate that 14-3-3γ negatively regulates steroidogenesis by binding to Ser-194 of STAR, thus keeping STAR in an unfolded state, unable to induce maximal steroidogenesis. Over time 14-3-3γ homodimerizes and dissociates from STAR, allowing this protein to induce maximal mitochondrial steroid formation. PMID:22427666
Choi, Hyong Woo; Manohar, Murli; Manosalva, Patricia; Tian, Miaoying; Moreau, Magali; Klessig, Daniel F.
2016-01-01
Damage-associated molecular pattern molecules (DAMPs) signal the presence of tissue damage to induce immune responses in plants and animals. Here, we report that High Mobility Group Box 3 (HMGB3) is a novel plant DAMP. Extracellular HMGB3, through receptor-like kinases BAK1 and BKK1, induced hallmark innate immune responses, including i) MAPK activation, ii) defense-related gene expression, iii) callose deposition, and iv) enhanced resistance to Botrytis cinerea. Infection by necrotrophic B. cinerea released HMGB3 into the extracellular space (apoplast). Silencing HMGBs enhanced susceptibility to B. cinerea, while HMGB3 injection into apoplast restored resistance. Like its human counterpart, HMGB3 binds salicylic acid (SA), which results in inhibition of its DAMP activity. An SA-binding site mutant of HMGB3 retained its DAMP activity, which was no longer inhibited by SA, consistent with its reduced SA-binding activity. These results provide cross-kingdom evidence that HMGB proteins function as DAMPs and that SA is their conserved inhibitor. PMID:27007252
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
OxLDL or TLR2-induced cytokine response is enhanced by oxLDL-independent novel domain on mouse CD35
USDA-ARS?s Scientific Manuscript database
OxLDL binding to CD36 is shown to result in macrophage activation and foam cell formation that have been implicated in atherosclerosis. However, CD36 has also been shown to induce inflammatory response to other ligands besides oxLDL. During the course of blocking CD36 oxLDL binding function using an...
Small Molecule-Induced Allosteric Activation of the Vibrio Cholerae RTX Cysteine Protease Domain
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lupardus, P.J.; Shen, A.; Bogyo, M.
2009-05-19
Vibrio cholerae RTX (repeats in toxin) is an actin-disrupting toxin that is autoprocessed by an internal cysteine protease domain (CPD). The RTX CPD is efficiently activated by the eukaryote-specific small molecule inositol hexakisphosphate (InsP{sub 6}), and we present the 2.1 angstrom structure of the RTX CPD in complex with InsP{sub 6}. InsP{sub 6} binds to a conserved basic cleft that is distant from the protease active site. Biochemical and kinetic analyses of CPD mutants indicate that InsP{sub 6} binding induces an allosteric switch that leads to the autoprocessing and intracellular release of toxin-effector domains.
Madabhushi, Sri R; Shang, Chengwei; Dayananda, Kannayakanahalli M; Rittenhouse-Olson, Kate; Murphy, Mary; Ryan, Thomas E; Montgomery, Robert R; Neelamegham, Sriram
2012-05-17
Noncovalent association between the von Willebrand factor (VWF) propeptide (VWFpp) and mature VWF aids N-terminal multimerization and protein compartmentalization in storage granules. This association is currently thought to dissipate after secretion into blood. In the present study, we examined this proposition by quantifying the affinity and kinetics of VWFpp binding to mature VWF using surface plasmon resonance and by developing novel anti-VWF D'D3 mAbs. Our results show that the only binding site for VWFpp in mature VWF is in its D'D3 domain. At pH 6.2 and 10mM Ca(2+), conditions mimicking intracellular compartments, VWFpp-VWF binding occurs with high affinity (K(D) = 0.2nM, k(off) = 8 × 10(-5) s(-1)). Significant, albeit weaker, binding (K(D) = 25nM, k(off) = 4 × 10(-3) s(-1)) occurs under physiologic conditions of pH 7.4 and 2.5mM Ca(2+). This interaction was also observed in human plasma (K(D) = 50nM). The addition of recombinant VWFpp in both flow-chamber-based platelet adhesion assays and viscometer-based shear-induced platelet aggregation and activation studies reduced platelet adhesion and activation partially. Anti-D'D3 mAb DD3.1, which blocks VWFpp binding to VWF-D'D3, also abrogated platelet adhesion, as shown by shear-induced platelet aggregation and activation studies. Our data demonstrate that VWFpp binding to mature VWF occurs in the circulation, which can regulate the hemostatic potential of VWF by reducing VWF binding to platelet GpIbα.
Peptidyl Prolyl Isomerase PIN1 Directly Binds to and Stabilizes Hypoxia-Inducible Factor-1α
Han, Hyeong-jun; Kwon, Nayoung; Choi, Min-A; Jung, Kyung Oh; Piao, Juan-Yu; Ngo, Hoang Kieu Chi; Kim, Su-Jung; Kim, Do-Hee; Chung, June-Key; Cha, Young-Nam; Youn, Hyewon; Choi, Bu Young; Min, Sang-Hyun; Surh, Young-Joon
2016-01-01
Peptidyl prolyl isomerase (PIN1) regulates the functional activity of a subset of phosphoproteins through binding to phosphorylated Ser/Thr-Pro motifs and subsequently isomerization of the phosphorylated bonds. Interestingly, PIN1 is overexpressed in many types of malignancies including breast, prostate, lung and colon cancers. However, its oncogenic functions have not been fully elucidated. Here, we report that PIN1 directly interacts with hypoxia-inducible factor (HIF)-1α in human colon cancer (HCT116) cells. PIN1 binding to HIF-1α occurred in a phosphorylation-dependent manner. We also found that PIN1 interacted with HIF-1α at both exogenous and endogenous levels. Notably, PIN1 binding stabilized the HIF-1α protein, given that their levels were significantly increased under hypoxic conditions. The stabilization of HIF-1α resulted in increased transcriptional activity, consequently upregulating expression of vascular endothelial growth factor, a major contributor to angiogenesis. Silencing of PIN1 or pharmacologic inhibition of its activity abrogated the angiogenesis. By utilizing a bioluminescence imaging technique, we were able to demonstrate that PIN1 inhibition dramatically reduced the tumor volume in a subcutaneous mouse xenograft model and angiogenesis as well as hypoxia-induced transcriptional activity of HIF-1α. These results suggest that PIN1 interacting with HIF-1α is a potential cancer chemopreventive and therapeutic target. PMID:26784107
POWELL, SHARLA L.; GÖDECKE, TANJA; NIKOLIC, DEJAN; CHEN, SHAO-NONG; AHN, SOYOUN; DIETZ, BIRGIT; FARNSWORTH, NORMAN R.; VAN BREEMEN, RICHARD B.; LANKIN, DAVID; PAULI, GUIDO F.; BOLTON, JUDY L.
2013-01-01
Cimicifuga racemosa(L.) Nutt. (syn. Actaea racemosa L., black cohosh) is used to relieve menopausal hot flashes, although clinical studies have provided conflicting data, and the active constituent(s) and mechanism(s) of action remain unknown. Since serotonergic receptors and transporters are involved with thermoregulation, black cohosh and its phytoconstituents were evaluated for serotonergic activity using 5-HT7 receptor binding, cAMP induction, and serotonin selective reuptake inhibitor (SSRI) assays. Crude extracts displayed 5-HT7 receptor binding activity and induced cAMP production. Fractionation of the methanol extract lead to isolation of phenolic acids and identification of Nω-methylserotonin by LC/MS-MS. Cimicifuga triterpenoids and phenolic acids bound weakly to the 5-HT7 receptor with no cAMP or SSRI activity. In contrast, Nω-methylserotonin showed 5-HT7 receptor binding (IC50 23 pM), induced cAMP (EC50 22 nM), and blocked serotonin reuptake (IC50 490 nM). These data suggest Nω-methylserotonin may be responsible for the serotonergic activity of black cohosh. PMID:19049296
Shen, Miaoqing; Bunaciu, Rodica P; Congleton, Johanna; Jensen, Holly A; Sayam, Lavanya G; Varner, Jeffrey D; Yen, Andrew
2011-12-01
All-trans retinoic acid (RA) and interferons (IFNs) have efficacy in treating certain leukemias and lymphomas, respectively, motivating interest in their mechanism of action to improve therapy. Both RA and IFNs induce interferon regulatory factor-1 (IRF-1). We find that in HL-60 myeloblastic leukemia cells which undergo mitogen activated protien kinase (MAPK)-dependent myeloid differentiation in response to RA, IRF-1 propels differentiation. RA induces MAPK-dependent expression of IRF-1. IRF-1 binds c-Cbl, a MAPK related adaptor. Ectopic IRF-1 expression causes CD38 expression and activation of the Raf/MEK/ERK axis, and enhances RA-induced differentiation by augmenting CD38, CD11b, respiratory burst and G0 arrest. Ectopic IRF-1 expression also decreases the activity of aldehyde dehydrogenase 1, a stem cell marker, and enhances RA-induced ALDH1 down-regulation. Interestingly, expression of aryl hydrocarbon receptor (AhR), which is RA-induced and known to down-regulate Oct4 and drive RA-induced differentiation, also enhances IRF-1 expression. The data are consistent with a model whereby IRF-1 acts downstream of RA and AhR to enhance Raf/MEK/ERK activation and propel differentiation.
Expanded RNA-binding activities of mammalian Argonaute 2
Tan, Grace S.; Garchow, Barry G.; Liu, Xuhang; Yeung, Jennifer; Morris, John P.; Cuellar, Trinna L.; McManus, Michael T.; Kiriakidou, Marianthi
2009-01-01
Mammalian Argonaute 2 (Ago2) protein associates with microRNAs (miRNAs) or small interfering RNAs (siRNAs) forming RNA-induced silencing complexes (RISCs/miRNPs). In the present work, we characterize the RNA-binding and nucleolytic activity of recombinant mouse Ago2. Our studies show that recombinant mouse Ago2 binds efficiently to miRNAs forming active RISC. Surprisingly, we find that recombinant mouse Ago2 forms active RISC using pre-miRNAs or long unstructured single stranded RNAs as guides. Furthermore, we demonstrate that, in vivo, endogenous human Ago2 binds directly to pre-miRNAs independently of Dicer, and that Ago2:pre-miRNA complexes are found both in the cytoplasm and in the nucleus of human cells. PMID:19808937
DOE Office of Scientific and Technical Information (OSTI.GOV)
Labbe, G.; Descatoire, V.; Beaune, P.
Incubation of rat liver microsomes with (3H)methoxsalen and NADPH resulted in the covalent binding of a methoxsalen intermediate to proteins comigrating with cytochromes P-450 UT-A, PB-B/D, ISF-G and PCN-E. Binding was increased by pretreatments with phenobarbital, beta-naphthoflavone (beta NF) and dexamethasone. Such pretreatments also increased the loss of CO-binding capacity either after administration of methoxsalen, or after incubation of hepatic microsomes with methoxsalen and NADPH. Immunoprecipitation of the methoxsalen metabolite-protein adducts in phenobarbital-induced microsomes was moderate with anti-UT-A antibodies, but marked with anti-PB-B/D and anti-PCN-E antibodies. Immunoprecipitation was observed also with anti-ISF-G (anti-beta NF-B) antibodies in beta NF-induced microsomes. Methoxsalenmore » (0.25 mM) inhibited markedly the benzphetamine demethylase activity of phenobarbital-induced microsomes and the erythromycin demethylase activity of dexamethasone-induced microsomes. Whereas methoxsalen itself did not produce any binding spectrum, in contrast either in vivo administration of methoxsalen or incubation in vitro with methoxsalen and NADPH resulted in a low-to-high spin conversion of cytochrome P-450 as suggested by the appearance of a spectrum analogous to a type I binding spectrum. This low-to-high spin conversion was apparently due to a methoxsalen intermediate (probably, covalently bound to the protein and preventing partial sixth ligation of the iron). We conclude that suicide inactivation of cytochrome P-450 by methoxsalen is related to the covalent binding of a methoxsalen intermediate to the protein moiety of several cytochrome P-450 isoenzymes (including UT-A, PB-B/D, PCN-E as well as ISF-G and/or beta NF-B).« less
Kimura, Ryuichiro; Senba, Masachika; Cutler, Samuel J; Ralph, Stephen J; Xiao, Gutian; Mori, Naoki
2013-01-01
Human T cell leukemia virus type I (HTLV-I) is the etiologic agent of adult T cell leukemia (ATL) and various inflammatory disorders including HTLV-I-associated myelopathy/tropical spastic paraparesis. HTLV-I oncoprotein Tax is known to cause permanent activation of many cellular transcription factors including nuclear factor-κB (NF-κB), cyclic adenosine 3′,5′-monophosphate response element-binding protein, and activator protein 1 (AP-1). Here, we show that NF-κB-binding cofactor inhibitor of NF-κB-ζ (IκB-ζ) is constitutively expressed in HTLV-I-infected T cell lines and ATL cells, and Tax transactivates the IκB-ζ gene, mainly through NF-κB. Microarray analysis of IκB-ζ-expressing uninfected T cells demonstrated that IκB-ζ induced the expression of NF-κB. and interferon-regulatory genes such as B cell CLL/lymphoma 3 (Bcl3), guanylate-binding protein 1, and signal transducer and activator of transcription 1. The transcriptional activation domain, nuclear localization signal, and NF-κB-binding domain of IκB-ζ were required for Bcl3 induction, and IκB-ζ synergistically enhanced Tax-induced Bcl3 transactivation in an NF-κB-dependent manner. Interestingly, IκB-ζ inhibited Tax-induced NF-κB, AP-1 activation, and HTLV-I transcription. Furthermore, IκB-ζ interacted with Tax in vitro and this interaction was also observed in an HTLV-I-transformed T cell line. These results suggest that IκB-ζ modulates Tax-dependent and Tax-independent gene transcription in T cells. The function of IκB-ζ may be of significance in ATL genesis and pathogenesis of HTLV-I-associated diseases. PMID:24027435
Xu, Weidong; Angelis, Konstantina; Danielpour, David; Haddad, Maher M.; Bischof, Oliver; Campisi, Judith; Stavnezer, Ed; Medrano, Estela E.
2000-01-01
The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type β transforming growth factor (TGF-β) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-β. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-β-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-β-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-β-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-β-mediated growth inhibition in a prostate-derived epithelial cell line. PMID:10811875
Xu, W; Angelis, K; Danielpour, D; Haddad, M M; Bischof, O; Campisi, J; Stavnezer, E; Medrano, E E
2000-05-23
The c-ski protooncogene encodes a transcription factor that binds DNA only in association with other proteins. To identify co-binding proteins, we performed a yeast two-hybrid screen. The results of the screen and subsequent co-immunoprecipitation studies identified Smad2 and Smad3, two transcriptional activators that mediate the type beta transforming growth factor (TGF-beta) response, as Ski-interacting proteins. In Ski-transformed cells, all of the Ski protein was found in Smad3-containing complexes that accumulated in the nucleus in the absence of added TGF-beta. DNA binding assays showed that Ski, Smad2, Smad3, and Smad4 form a complex with the Smad/Ski binding element GTCTAGAC (SBE). Ski repressed TGF-beta-induced expression of 3TP-Lux, the natural plasminogen activator inhibitor 1 promoter and of reporter genes driven by the SBE and the related CAGA element. In addition, Ski repressed a TGF-beta-inducible promoter containing AP-1 (TRE) elements activated by a combination of Smads, Fos, and/or Jun proteins. Ski also repressed synergistic activation of promoters by combinations of Smad proteins but failed to repress in the absence of Smad4. Thus, Ski acts in opposition to TGF-beta-induced transcriptional activation by functioning as a Smad-dependent co-repressor. The biological relevance of this transcriptional repression was established by showing that overexpression of Ski abolished TGF-beta-mediated growth inhibition in a prostate-derived epithelial cell line.
Kim, Byung Hak; Hong, Seong Su; Kwon, Soon Woo; Lee, Hwa Young; Sung, Hyeran; Lee, In-Jeong; Hwang, Bang Yeon; Song, Sukgil; Lee, Chong-Kil; Chung, Daehyun; Ahn, Byeongwoo; Nam, Sang-Yoon; Han, Sang-Bae; Kim, Youngsoo
2008-11-01
Diarctigenin was previously isolated as an inhibitor of nitric oxide (NO) production in macrophages from the seeds of Arctium lappa used as an alternative medicine for the treatment of inflammatory disorders. However, little is known about the molecular basis of these effects. Here, we demonstrated that diarctigenin inhibited the production of NO, prostaglandin E(2), tumor necrosis factor-alpha, and interleukin (IL)-1beta and IL-6 with IC(50) values of 6 to 12 miciroM in zymosan- or lipopolysaccharide-(LPS) activated macrophages. Diarctigenin attenuated zymosan-induced mRNA synthesis of inducible NO synthase (iNOS) and also inhibited promoter activities of iNOS and cytokine genes in the cells. Because nuclear factor (NF)-kappaB plays a pivotal role in inflammatory gene transcription, we next investigated the effect of diarctigenin on NF-kappaB activation. Diarctigenin inhibited the transcriptional activity and DNA binding ability of NF-kappaB in zymosan-activated macrophages but did not affect the degradation and phosphorylation of inhibitory kappaB (IkappaB) proteins. Moreover, diarctigenin suppressed expression vector NF-kappaB p65-elicited NF-kappaB activation and also iNOS promoter activity, indicating that the compound could directly target an NF-kappa-activating signal cascade downstream of IkappaB degradation and inhibit NF-kappaB-regulated iNOS expression. Diarctigenin also inhibited the in vitro DNA binding ability of NF-kappaB but did not affect the nuclear import of NF-kappaB p65 in the cells. Taken together, diarctigenin down-regulated zymosan- or LPS-induced inflammatory gene transcription in macrophages, which was due to direct inhibition of the DNA binding ability of NF-kappaB. Finally, this study provides a pharmacological potential of diarctigenin in the NF-kappaB-associated inflammatory disorders.
Hormone activation induces nucleosome positioning in vivo
Belikov, Sergey; Gelius, Birgitta; Almouzni, Geneviève; Wrange, Örjan
2000-01-01
The mouse mammary tumor virus (MMTV) promoter is induced by glucocorticoid hormone. A robust hormone- and receptor-dependent activation could be reproduced in Xenopus laevis oocytes. The homogeneous response in this system allowed a detailed analysis of the transition in chromatin structure following hormone activation. This revealed two novel findings: hormone activation led to the establishment of specific translational positioning of nucleosomes despite the lack of significant positioning in the inactive state; and, in the active promoter, a subnucleosomal particle encompassing the glucocorticoid receptor (GR)-binding region was detected. The presence of only a single GR-binding site was sufficient for the structural transition to occur. Both basal promoter elements and ongoing transcription were dispensable. These data reveal a stepwise process in the transcriptional activation by glucocorticoid hormone. PMID:10698943
Buchborn, Tobias; Schröder, Helmut; Dieterich, Daniela C; Grecksch, Gisela; Höllt, Volker
2015-03-15
Serotonergic hallucinogens, such as lysergic acid diethylamide (LSD) and dimethoxy-bromoamphetamine (DOB), provoke stereotype-like shaking behaviour in rodents, which is hypothesised to engage frontocortical glutamate receptor activation secondary to serotonin2A (5-HT2A) related glutamate release. Challenging this hypothesis, we here investigate whether tolerance to LSD and DOB correlates with frontocortical adaptations of 5-HT2A and/or overall-glutamate binding sites. LSD and DOB (0.025 and 0.25 mg/kg, i.p.) induce a ketanserin-sensitive (0.5 mg/kg, i.p., 30-min pretreatment) increase in shaking behaviour (including head twitches and wet dog shakes), which with repeated application (7× in 4 ds) is undermined by tolerance. Tolerance to DOB, as indexed by DOB-sensitive [(3)H]spiroperidol and DOB induced [(35)S]GTP-gamma-S binding, is accompanied by a frontocortical decrease in 5-HT2A binding sites and 5-HT2 signalling, respectively; glutamate-sensitive [(3)H]glutamate binding sites, in contrast, remain unchanged. As to LSD, 5-HT2 signalling and 5-HT2A binding, respectively, are not or only marginally affected, yet [(3)H]glutamate binding is significantly decreased. Correlation analysis interrelates tolerance to DOB to the reduced 5-HT2A (r=.80) as well as the unchanged [(3)H]glutamate binding sites (r=.84); tolerance to LSD, as opposed, shares variance with the reduction in [(3)H]glutamate binding sites only (r=.86). Given that DOB and LSD both induce tolerance, one correlating with 5-HT2A, the other with glutamate receptor adaptations, it might be inferred that tolerance can arise at either level. That is, if a hallucinogen (like LSD in our study) fails to induce 5-HT2A (down-)regulation, glutamate receptors (activated postsynaptic to 5-HT2A related glutamate release) might instead adapt and thus prevent further overstimulation of the cortex. Copyright © 2014 Elsevier B.V. All rights reserved.
Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.
Bischoff, F R; Krebber, H; Smirnova, E; Dong, W; Ponstingl, H
1995-01-01
RCC1 (the regulator of chromosome condensation) stimulates guanine nucleotide dissociation on the Ras-related nuclear protein Ran. Both polypeptides are components of a regulatory pathway that has been implicated in regulating DNA replication, onset of and exit from mitosis, mRNA processing and transport, and import of proteins into the nucleus. In a search for further members of the RCC1-Ran signal pathway, we have identified proteins of 23, 45 and 300 kDa which tightly bind to Ran-GTP but not Ran-GDP. The purified soluble 23 kDa Ran binding protein RanBP1 does not activate RanGTPase, but increases GTP hydrolysis induced by the RanGTPase-activating protein RanGAP1 by an order of magnitude. In the absence of RanGAP, it strongly inhibits RCC1-induced exchange of Ran-bound GTP. In addition, it forms a stable complex with nucleotide-free RCC1-Ran. With these properties, it differs markedly from guanine diphosphate dissociation inhibitors which preferentially prevent the exchange of protein-bound GDP and in some cases were shown to inhibit GAP-induced GTP hydrolysis. RanBP1 is the first member of a new class of proteins regulating the binding and hydrolysis of GTP by Ras-related proteins. Images PMID:7882974
Specific binding of PCBP1 to heavily oxidized RNA to induce cell death.
Ishii, Takashi; Hayakawa, Hiroshi; Igawa, Tatsuhiro; Sekiguchi, Takeshi; Sekiguchi, Mutsuo
2018-06-26
In aerobically growing cells, the guanine base of RNA is oxidized to 8-oxo-7,8-dihydroguanine (8-oxoG), which induces alteration in their gene expression. We previously demonstrated that the human AUF1 protein binds to 8-oxoG in RNA to induce the selective degradation of oxidized messenger RNA. We herein report that the poly(C)-binding protein PCBP1 binds to more severely oxidized RNA to activate apoptosis-related reactions. While AUF1 binds to oligoribonucleotides carrying a single 8-oxoG, PCBP1 does not bind to such oligoribonucleotides but instead binds firmly to oligoribonucleotides in which two 8-oxoG residues are located nearby. PCBP1-deficient cells, constructed from the human HeLa S3 line using the CRISPR-Cas9 system, exhibited higher survival rates than HeLa S3 cells when small doses of hydrogen peroxide were applied. The levels of caspase-3 activation and PARP-1 cleavage in the PCBP1-deficient cells were significantly lower than those in wild-type cells. The structure-function relationship of PCBP1 was established with the use of PCBP1 mutant proteins in which the conserved KH domains were defective. Human cells appear to possess two distinct mechanisms, one controlled by AUF1 and the other by PCBP1, with the former functioning when messenger RNA is moderately oxidized and the latter operating when the RNA is more severely damaged.
Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor
Kuban-Jankowska, Alicja; Sahu, Kamlesh K.; Gorska, Magdalena; Tuszynski, Jack A.; Wozniak, Michal
2016-01-01
Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding. PMID:26735581
Chicoric acid binds to two sites and decreases the activity of the YopH bacterial virulence factor.
Kuban-Jankowska, Alicja; Sahu, Kamlesh K; Gorska, Magdalena; Tuszynski, Jack A; Wozniak, Michal
2016-01-19
Chicoric acid (CA) is a phenolic compound present in dietary supplements with a large spectrum of biological properties reported ranging from antioxidant, to antiviral, to immunostimulatory properties. Due to the fact that chicoric acid promotes phagocytic activity and was reported as an allosteric inhibitor of the PTP1B phosphatase, we examined the effect of CA on YopH phosphatase from pathogenic bacteria, which block phagocytic processes of a host cell. We performed computational studies of chicoric acid binding to YopH as well as validation experiments with recombinant enzymes. In addition, we performed similar studies for caffeic and chlorogenic acids to compare the results. Docking experiments demonstrated that, from the tested compounds, only CA binds to both catalytic and secondary binding sites of YopH. Our experimental results showed that CA reduces activity of recombinant YopH phosphatase from Yersinia enterocolitica and human CD45 phosphatase. The inhibition caused by CA was irreversible and did not induce oxidation of catalytic cysteine. We proposed that inactivation of YopH induced by CA is involved with allosteric inhibition by interacting with essential regions responsible for ligand binding.
Empty conformers of HLA-B preferentially bind CD8 and regulate CD8+ T cell function.
Geng, Jie; Altman, John D; Krishnakumar, Sujatha; Raghavan, Malini
2018-05-09
When complexed with antigenic peptides, human leukocyte antigen (HLA) class I (HLA-I) molecules initiate CD8 + T cell responses via interaction with the T cell receptor (TCR) and co-receptor CD8. Peptides are generally critical for the stable cell surface expression of HLA-I molecules. However, for HLA-I alleles such as HLA-B*35:01, peptide-deficient (empty) heterodimers are thermostable and detectable on the cell surface. Additionally, peptide-deficient HLA-B*35:01 tetramers preferentially bind CD8 and to a majority of blood-derived CD8 + T cells via a CD8-dependent binding mode. Further functional studies reveal that peptide-deficient conformers of HLA-B*35:01 do not directly activate CD8 + T cells, but accumulate at the immunological synapse in antigen-induced responses, and enhance cognate peptide-induced cell adhesion and CD8 + T cell activation. Together, these findings indicate that HLA-I peptide occupancy influences CD8 binding affinity, and reveal a new set of regulators of CD8 + T cell activation, mediated by the binding of empty HLA-I to CD8. © 2018, Geng et al.
Muramyl peptides in mammalian tissues and their effects at the cellular level.
Karnovsky, M L
1986-10-01
Muramyl peptides (MPs), presumably breakdown products of bacterial cell walls, have been found in the brain, liver, and kidney of the rat. They exert multiple physiological effects on higher animals as immunoadjuvants, activators of macrophages, pyrogens, antitumor agents, inducers of contractility of smooth muscle, and promoters of slow-wave sleep, as well as nonspecific protectors of animals against infection. Structure-function relationships of these substances have been extensively studied, especially with respect to somnogenicity. In the role an intact muramyl ring is required, and the 1,6-anhydro form is active. The presence of free carboxyls or amides on the glutamyl and diaminopimelyl entities have important effects. The stereochemistry is crucial: the alanine adjacent to the N-acetylmuramyl entity must be L, and the glutamate must be D. Studies were carried out with murine macrophages to establish mechanisms of action of these glycopeptides. There are two populations of binding sites for MPs on those cells. When compounds of different structure are compared, binding ability correlates with pyrogenic and somnogenic activity. Serotonin competes with these agents for binding sites. Binding of that substance induces at least one macrophage response characteristic of the binding of MP.
Zhu, Jun; Gianni, Maurizio; Kopf, Eliezer; Honoré, Nicole; Chelbi-Alix, Mounira; Koken, Marcel; Quignon, Frédérique; Rochette-Egly, Cécile; de Thé, Hugues
1999-01-01
Analyzing the pathways by which retinoic acid (RA) induces promyelocytic leukemia/retinoic acid receptor α (PML/RARα) catabolism in acute promyelocytic leukemia (APL), we found that, in addition to caspase-mediated PML/RARα cleavage, RA triggers degradation of both PML/RARα and RARα. Similarly, in non-APL cells, RA directly targeted RARα and RARα fusions to the proteasome degradation pathway. Activation of either RARα or RXRα by specific agonists induced degradation of both proteins. Conversely, a mutation in RARα that abolishes heterodimer formation and DNA binding, blocked both RARα and RXRα degradation. Mutations in the RARα DNA-binding domain or AF-2 transcriptional activation region also impaired RARα catabolism. Hence, our results link transcriptional activation to receptor catabolism and suggest that transcriptional up-regulation of nuclear receptors by their ligands may be a feedback mechanism allowing sustained target-gene activation. PMID:10611294
Tsao, Nina; Cheng, Miao-Hui; Yang, Hsiu-Chen; Wang, Yu-Chieh; Liu, Yi-Ling; Kuo, Chih-Feng
2013-01-01
Streptococcal pyrogenic exotoxin B (SPE B), a cysteine protease, is an important virulence factor in group A streptococcal (GAS) infection. SPE B binds and cleaves antibody isotypes and further impairs the immune system by inhibiting complement activation. In this study, we examined the antibody-binding site of SPE B and used it to block SPE B actions during GAS infection. We constructed different segments of the spe B gene and induced them to express different recombinant fragments of SPE B. Using an enzyme-linked immunosorbent assay (ELISA), we found that residues 345-398 of the C-terminal domain of SPE B (rSPE B(345-398)), but not the N-terminal domain, was the major binding site for antibody isotypes. Using a competitive ELISA, we also found that rSPE B(345-398) bound to the Fc portion of IgG. The in vitro functional assays indicate that rSPE B(345-398) not only interfered with cleavage of antibody isotypes but also interfered with SPE B-induced inhibition of complement activation. Immunization of BALB/c mice using rSPE B(345-398) was able to induce production of a high titer of anti-rSPE B(345-398) antibodies and efficiently protected mice from GAS-induced death. These findings suggest that SPE B uses its C-terminal domain to bind the Fc portion of IgG and that immunization of mice with this binding domain (rSPE B(345-398)) could protect mice from GAS infection.
A regulatory network to segregate the identity of neuronal subtypes.
Lee, Seunghee; Lee, Bora; Joshi, Kaumudi; Pfaff, Samuel L; Lee, Jae W; Lee, Soo-Kyung
2008-06-01
Spinal motor neurons (MNs) and V2 interneurons (V2-INs) are specified by two related LIM-complexes, MN-hexamer and V2-tetramer, respectively. Here we show how multiple parallel and complementary feedback loops are integrated to assign these two cell fates accurately. While MN-hexamer response elements (REs) are specific to MN-hexamer, V2-tetramer-REs can bind both LIM-complexes. In embryonic MNs, however, two factors cooperatively suppress the aberrant activation of V2-tetramer-REs. First, LMO4 blocks V2-tetramer assembly. Second, MN-hexamer induces a repressor, Hb9, which binds V2-tetramer-REs and suppresses their activation. V2-INs use a similar approach; V2-tetramer induces a repressor, Chx10, which binds MN-hexamer-REs and blocks their activation. Thus, our study uncovers a regulatory network to segregate related cell fates, which involves reciprocal feedforward gene regulatory loops.
Cockerill, Peter N
2016-12-01
Gene expression programs are largely regulated by the tissue-specific expression of lineage-defining transcription factors or by the inducible expression of transcription factors in response to specific stimuli. Here I will review our own work over the last 20 years to show how specific activation signals also lead to the wide-spread re-distribution of pre-existing constitutive transcription factors to sites undergoing chromatin reorganization. I will summarize studies showing that activation of kinase signaling pathways creates open chromatin regions that recruit pre-existing factors which were previously unable to bind to closed chromatin. As models I will draw upon genes activated or primed by receptor signaling in memory T cells, and genes activated by cytokine receptor mutations in acute myeloid leukemia. I also summarize a hit-and-run model of stable epigenetic reprograming in memory T cells, mediated by transient Activator Protein 1 (AP-1) binding, which enables the accelerated activation of inducible enhancers.
Sun, Chengliang; Lu, Lingli; Yu, Yan; Liu, Lijuan; Hu, Yan; Ye, Yiquan; Jin, Chongwei; Lin, Xianyong
2016-01-01
Nitric oxide (NO) is an important bioactive molecule involved in cell wall metabolism, which has been recognized as a major target of aluminium (Al) toxicity. We have investigated the effects of Al-induced NO production on cell wall composition and the subsequent Al-binding capacity in roots of an Al-sensitive cultivar of wheat (Triticum aestivum L. cv. Yang-5). We found that Al exposure induced NO accumulation in the root tips. Eliminating NO production with an NO scavenger (cPTIO) significantly alleviated the Al-induced inhibition of root growth and thus reduced Al accumulation. Elimination of NO, however, did not significantly affect malate efflux or rhizosphere pH changes under Al exposure. Levels of cell wall polysaccharides (pectin, hemicelluloses 1, and hemicelluloses 2) and pectin methylesterase activity, as well as pectin demethylation in the root apex, significantly increased under Al treatment. Exogenous cPTIO application significantly decreased pectin methylesterase activity and increased the degree of methylation of pectin in the root cell wall, thus decreasing the Al-binding capacity of pectin. These results suggest that the Al-induced enhanced production of NO decreases cell wall pectin methylation, thus increasing the Al-binding capacity of pectin and negatively regulating Al tolerance in wheat. PMID:26663393
Jana, Pradipta; Maiti, Smarajit; Kahn, Nighat N; Sinha, Asru K
2015-04-01
Estriol, an oestrogen, at 0.6 nmol/l was reported to inhibit ADP-induced platelet aggregation through nitric oxide synthesis. As nitric oxide has been reported to cause fibrinolysis due to the activation of plasminogen to plasmin, the role of estriol as a fibrinolytic agent was investigated. Also, the mechanism of estriol-induced nitric oxide synthesis in anucleated platelets was investigated. The estriol-induced lysis of platelet-rich plasma (PRP) clot was determined by photography of the clot lysis and by the assay of fibrin degradation products in the lysate and was obtained by SDS-PAGE. Nitric oxide was determined by methemoglobin method. The platelet membrane protein was isolated from the platelets by using Triton X-100 (0.05% v/v). The binding of estriol to the protein was determined by Scatchard plot by using an ELISA for estriol. Estriol at 0.6 nmol/l was found to lyse the clotted PRP due to fibrinolysis that produced fibrin degradation products in the lysate. The amino acid analysis of the platelet membrane protein, which resembles with nitric oxide synthase (NOS) activity, was activated nearly 10-fold over the control in the presence of estriol and was identified to be a human serum albumin precursor (Mr. 69 kDa) that binds to estriol with Kd1 of 6.0 × 10 mol/l and 39 ± 2 molecules of estriol bound the NOS molecule. The estriol-induced nitric oxide is capable of inducing fibrinolysis of the clotted PRP. The binding of estriol to platelet membrane NOS activated the enzyme in the absence of DNA in the platelet.
Laine, David; Trescol-Biémont, Marie-Claude; Longhi, Sonia; Libeau, Geneviève; Marie, Julien C.; Vidalain, Pierre-Olivier; Azocar, Olga; Diallo, Adama; Canard, Bruno; Rabourdin-Combe, Chantal; Valentin, Hélène
2003-01-01
During acute measles virus (MV) infection, an efficient immune response occurs, followed by a transient but profound immunosuppression. MV nucleoprotein (MV-N) has been reported to induce both cellular and humoral immune responses and paradoxically to account for immunosuppression. Thus far, this latter activity has been attributed to MV-N binding to human and murine FcγRII. Here, we show that apoptosis of MV-infected human thymic epithelial cells (TEC) allows the release of MV-N in the extracellular compartment. This extracellular N is then able to bind either to MV-infected or uninfected TEC. We show that recombinant MV-N specifically binds to a membrane protein receptor, different from FcγRII, highly expressed on the cell surface of TEC. This new receptor is referred to as nucleoprotein receptor (NR). In addition, different Ns from other MV-related morbilliviruses can also bind to FcγRII and/or NR. We show that the region of MV-N responsible for binding to NR maps to the C-terminal fragment (NTAIL). Binding of MV-N to NR on TEC triggers sustained calcium influx and inhibits spontaneous cell proliferation by arresting cells in the G0 and G1 phases of the cell cycle. Finally, MV-N binds to both constitutively expressed NR on a large spectrum of cells from different species and to human activated T cells, leading to suppression of their proliferation. These results provide evidence that MV-N, after release in the extracellular compartment, binds to NR and thereby plays a role in MV-induced immunosuppression. PMID:14557619
da Costa, M H; Chaimovich, H
1997-09-01
Limited proteolysis of fatty acid-free bovine serum albumin by pepsin yields several well characterized peptides, one of which (P9, M(r) 9,000), induces fusion of small unilamellar vesicles (SUV) of phosphatidylcholine at pH 3.6. Circular dichroism (CD) of P9 solutions confirmed that the peptide undergoes a reversible transition between pH 7 and pH 3.6. The spectral changes observed with CD suggest that in the low pH conformation there is a decrease in the alpha-helical contents and an exposure of hydrophobic residues. CD and differential ultraviolet spectroscopy demonstrated that P9 binds to micelles of hexadecylphosphorylcholine and the binding produces changes in the tertiary structure of the peptide. Reduction and carboxymethylation of the two disulfide bridges of P9 produced loss of the ability to induce fusion of SUV, although the reduced peptide binds to vesicles, induces loss of entrapped marker and produces vesicle disruption. In the active form P9 exposes hydrophobic groups, one amphiphilic alpha-helix and requires the integrity of the disulfide bridge-stabilized tertiary structure.
Dux4 induces cell cycle arrest at G1 phase through upregulation of p21 expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Hongliang; Wang, Zhaoxia; Jin, Suqin
2014-03-28
Highlights: • Dux4 induced TE671 cell proliferation defect and G1 phase arrest. • Dux4 upregulated p21 expression without activating p53. • Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. • Sp1 binding site was required for Dux4-induced p21 promoter activation. - Abstract: It has been implicated that Dux4 plays crucial roles in development of facioscapulohumeral dystrophy. But the underlying myopathic mechanisms and related down-stream events of this retrogene were far from clear. Here, we reported that overexpression of Dux4 in a cell model TE671 reduced cell proliferation rate, and increased G1 phase accumulation. We also determined themore » impact of Dux4 on p53/p21 signal pathway, which controls the checkpoint in cell cycle progression. Overexpression of Dux4 increased p21 mRNA and protein level, while expression of p53, phospho-p53 remained unchanged. Silencing p21 rescued Dux4 mediated proliferation defect and cell cycle arrest. Furthermore, we demonstrated that enhanced Dux4 expression increased p21 promoter activity and elevated expression of Sp1 transcription factor. Mutation of Sp1 binding site decreased dux4 induced p21 promoter activation. Chromatin immunoprecipitation (ChIP) assays confirmed the Dux4-induced binding of Sp1 to p21 promoter in vivo. These results suggest that Dux4 might induce proliferation inhibition and G1 phase arrest through upregulation of p21.« less
Blazka, M E; Germolec, D R; Simeonova, P; Bruccoleri, A; Pennypacker, K R; Luster, M I
Nuclear transcription factors, such as NF-kB and NF-IL6, are believed to play an important role in regulating the expression of genes that encode for products involved in tissue damage and inflammation and, thus, may represent early biomarkers for chemical toxicities. In the present study changes in DNA binding activity of these factors were examined in livers of mice administered hepatotoxic doses of acetaminophen (APAP). NF-kB and NF-IL6 DNA binding occurred constitutively in control mouse liver. However, within 4 hr following administration of hepatotoxic doses of APAP, their binding activities were transiently lost and is in contrast to AP-1 transcription factor where activation occurs under similar conditions. These changes corresponded with increased release of inflammatory mediators (IL-6, serum amyloid A) and increased levels of enzymatic markers of hepatocyte damage. Similarly, treatment of mice with gadolinium chloride, an inhibitor of Kupffer cell activation and known to protect against APAP-induced hepatotoxicity, reduced the observed pathophysiological response in the liver while altering the APAP-associated changes in NF-kB DNA binding activity. NF-kB was found predominantly in parenchymal and endothelial cells and was composed primarily of relatively inactive p50 homodimer subunits in control liver. Taken together, these studies suggest that hepatotoxicity is associated with early and complex changes in DNA binding activities of specific transcription factors. In particular, NF-kB and NF-IL6 may serve as negative regulators of hepatocyte-derived inflammatory mediators and is analogous to that previously observed in certain other cell systems such as B lymphocytes.
Wang, Feng; Zhou, Xixi; Liu, Wenlan; Sun, Xi; Chen, Chen; Hudson, Laurie G; Jian Liu, Ke
2013-08-01
Arsenic enhances the genotoxicity of other carcinogenic agents such as ultraviolet radiation and benzo[a]pyrene. Recent reports suggest that inhibition of DNA repair is an important aspect of arsenic cocarcinogenesis, and DNA repair proteins such as poly(ADP ribose) polymerase (PARP)-1 are direct molecular targets of arsenic. Although arsenic has been shown to generate reactive oxygen/nitrogen species (ROS/RNS), little is known about the role of arsenic-induced ROS/RNS in the mechanism underlying arsenic inhibition of DNA repair. We report herein that arsenite-generated ROS/RNS inhibits PARP-1 activity in cells. Cellular exposure to arsenite, as well as hydrogen peroxide and NONOate (nitric oxide donor), decreased PARP-1 zinc content, enzymatic activity, and PARP-1 DNA binding. Furthermore, the effects of arsenite on PARP-1 activity, DNA binding, and zinc content were partially reversed by the antioxidant ascorbic acid, catalase, and the NOS inhibitor, aminoguanidine. Most importantly, arsenite incubation with purified PARP-1 protein in vitro did not alter PARP-1 activity or DNA-binding ability, whereas hydrogen peroxide or NONOate retained PARP-1 inhibitory activity. These results strongly suggest that cellular generation of ROS/RNS plays an important role in arsenite inhibition of PARP-1 activity, leading to the loss of PARP-1 DNA-binding ability and enzymatic activity. Copyright © 2013 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Pengxiang; Nedelcu, Daniel; Watanabe, Miyako
In vertebrates, sterols are necessary for Hedgehog signaling, a pathway critical in embryogenesis and cancer. Sterols activate the membrane protein Smoothened by binding its extracellular, cysteine-rich domain (CRD). Major unanswered questions concern the nature of the endogenous, activating sterol and the mechanism by which it regulates Smoothened. We report crystal structures of CRD complexed with sterols and alone, revealing that sterols induce a dramatic conformational change of the binding site, which is sufficient for Smoothened activation and is unique among CRD-containing receptors. We demonstrate that Hedgehog signaling requires sterol binding to Smoothened and define key residues for sterol recognition andmore » activity. We also show that cholesterol itself binds and activates Smoothened. Furthermore, the effect of oxysterols is abolished in Smoothened mutants that retain activation by cholesterol and Hedgehog. We propose that the endogenous Smoothened activator is cholesterol, not oxysterols, and that vertebrate Hedgehog signaling controls Smoothened by regulating its access to cholesterol.« less
Abdulkhalek, Samar; Amith, Schammim Ray; Franchuk, Susan L.; Jayanth, Preethi; Guo, Merry; Finlay, Trisha; Gilmour, Alanna; Guzzo, Christina; Gee, Katrina; Beyaert, Rudi; Szewczuk, Myron R.
2011-01-01
The signaling pathways of mammalian Toll-like receptors (TLRs) are well characterized, but the precise mechanism(s) by which TLRs are activated upon ligand binding remains poorly defined. Recently, we reported a novel membrane sialidase-controlling mechanism that depends on ligand binding to its TLR to induce mammalian neuraminidase-1 (Neu1) activity, to influence receptor desialylation, and subsequently to induce TLR receptor activation and the production of nitric oxide and proinflammatory cytokines in dendritic and macrophage cells. The α-2,3-sialyl residue of TLR was identified as the specific target for hydrolysis by Neu1. Here, we report a membrane signaling paradigm initiated by endotoxin lipopolysaccharide (LPS) binding to TLR4 to potentiate G protein-coupled receptor (GPCR) signaling via membrane Gαi subunit proteins and matrix metalloproteinase-9 (MMP9) activation to induce Neu1. Central to this process is that a Neu1-MMP9 complex is bound to TLR4 on the cell surface of naive macrophage cells. Specific inhibition of MMP9 and GPCR Gαi-signaling proteins blocks LPS-induced Neu1 activity and NFκB activation. Silencing MMP9 mRNA using lentivirus MMP9 shRNA transduction or siRNA transfection of macrophage cells and MMP9 knock-out primary macrophage cells significantly reduced Neu1 activity and NFκB activation associated with LPS-treated cells. These findings uncover a molecular organizational signaling platform of a novel Neu1 and MMP9 cross-talk in alliance with TLR4 on the cell surface that is essential for ligand activation of TLRs and subsequent cellular signaling. PMID:21873432
Salazar, Luz Mary; Bermúdez, Adriana; Patarroyo, Manuel E
2008-07-18
SERA protein is a leading candidate molecule to be included in an antimalarial vaccine. Conserved high activity binding peptides (HABP) binding to red blood cells (RBC) have been identified in this protein. One of them (6762) localising in the 18-kDa C-terminal fragment was used to induce protective immunity with negative result. Critical RBC binding residues (assessed by glycine-analogue scanning) were replaced by others having the same mass, volume and surface but different polarity, rendering some of them immunogenic as assessed by antibody production against the parasite or its proteins and protection-inducing against challenge with a highly infectious Aotus monkey-adapted Plasmodium falciparum strain. A shift in binding to purified HLA-DR allelic molecules from the same haplotype and in their reading register was found, suggesting that modified molecules had adopted a different (1)H NMR 3D structure allowing a better fit into the MHCII-pept-TCR complex, thereby representing a new mechanism for inducing immune protection.
EGFR oligomerization organizes kinase-active dimers into competent signalling platforms
Needham, Sarah R.; Roberts, Selene K.; Arkhipov, Anton; Mysore, Venkatesh P.; Tynan, Christopher J.; Zanetti-Domingues, Laura C.; Kim, Eric T.; Losasso, Valeria; Korovesis, Dimitrios; Hirsch, Michael; Rolfe, Daniel J.; Clarke, David T.; Winn, Martyn D.; Lajevardipour, Alireza; Clayton, Andrew H. A.; Pike, Linda J.; Perani, Michela; Parker, Peter J.; Shan, Yibing; Shaw, David E.; Martin-Fernandez, Marisa L.
2016-01-01
Epidermal growth factor receptor (EGFR) signalling is activated by ligand-induced receptor dimerization. Notably, ligand binding also induces EGFR oligomerization, but the structures and functions of the oligomers are poorly understood. Here, we use fluorophore localization imaging with photobleaching to probe the structure of EGFR oligomers. We find that at physiological epidermal growth factor (EGF) concentrations, EGFR assembles into oligomers, as indicated by pairwise distances of receptor-bound fluorophore-conjugated EGF ligands. The pairwise ligand distances correspond well with the predictions of our structural model of the oligomers constructed from molecular dynamics simulations. The model suggests that oligomerization is mediated extracellularly by unoccupied ligand-binding sites and that oligomerization organizes kinase-active dimers in ways optimal for auto-phosphorylation in trans between neighbouring dimers. We argue that ligand-induced oligomerization is essential to the regulation of EGFR signalling. PMID:27796308
Gao, C; Jokerst, R; Gondipalli, P; Cai, S R; Kennedy, S; Flye, M W; Ponder, K P
1999-12-01
The liver regenerates by replication of differentiated hepatocytes after damage or removal of part of the liver. Although several growth factors and signaling pathways are activated during regeneration, it is unclear as to which of these are essential for hepatocyte replication. We show here that low- (1 mg/kg) and high- (10 mg/kg) dose hepatocyte growth factor (HGF) induced replication of 2.1% and 11.1% of hepatocytes in rats, respectively. Lipopolysaccharide (LPS), an inducer of the acute phase response, augmented hepatocyte replication in response to low- and high-dose HGF by 4- and 2-fold, respectively. HGF alone induced moderate levels of c-Jun-N-terminal kinase (JNK) and p44/p42 mitogen-activated protein kinase (MAPK), resulting in moderate levels of AP-1-DNA binding activity. The combination of LPS + HGF increased JNK and AP-1-DNA binding activity more than levels seen with LPS or HGF alone. The activation of Stat3 that was observed after administration of LPS + HGF, but not HGF alone, could contribute to increased transcription of AP-1 components. Because phosphorylation of the c-Jun component of AP-1 by JNK increases its ability to activate transcription, the AP-1 in hepatocytes from animals treated with LPS + HGF may be more active than in rats treated with LPS or HGF alone. LPS may contribute to hepatocyte replication by potentiating the effect of HGF on the activation of both AP-1-DNA binding and transcriptional activity.
Peroxisome proliferator-activated receptors (PPARs) are nuclear hormone receptors that function as ligand-activated transcription factors regulating lipid metabolism and homeostasis. In addition to their ability to regulate PPAR-mediated gene transcription, PPARalpha and gamma li...
Andújar, I; Recio, MC; Bacelli, T; Giner, RM; Ríos, JL
2010-01-01
Background and purpose: In the present paper we studied the effect of shikonin on ear oedema induced by 12-O-tetradecanoylphorbol-13-acetate (TPA), and determined the mechanisms through which shikonin might exert its topical anti-inflammatory action. Experimental approach: Acute ear oedema was induced in mice by topical application of TPA. The in vitro assays used macrophages RAW 264.7 cells stimulated with lipopolysaccharide. Cyclooxygenase-2, inducible nitric oxide synthase, protein kinase Cα, extracellular signal-regulated protein kinase (ERK), phosphorylated ERK (pERK), c-Jun N-terminal kinase (JNK), pJNK, p38, p-p38, p65, p-p65, inhibitor protein of nuclear factor-κB (NF-κB) (IκBα) and pIκBα were measured by Western blotting, activation and binding of NF-κB to DNA was detected by reporter gene and electrophoretic mobility shift assay, respectively, and NF-κB p65 localization was detected by immunocytochemistry. Key results: Shikonin reduced the oedema (inhibitory dose 50 = 1.0 mg per ear), the expression of cyclooxygenase-2 (70%) and of inducible nitric oxide synthase (100%) in vivo. It significantly decreased TPA-induced translocation of protein kinase Cα, the phosphorylation and activation of ERK, the nuclear translocation of NF-κB and the TPA-induced NF-κB-DNA-binding activity in mouse skin. Moreover, in RAW 264.7 cells, shikonin significantly inhibited the binding of NF-κB to DNA in a dose-dependent manner and the nuclear translocation of p65. Conclusions and implications: Shikonin exerted its topical anti-inflammatory action by interfering with the degradation of IκBα, thus inhibiting the activation of NF-κB. PMID:20423347
GSK3 controls axon growth via CLASP-mediated regulation of growth cone microtubules
Hur, Eun-Mi; Saijilafu; Lee, Byoung Dae; Kim, Seong-Jin; Xu, Wen-Lin; Zhou, Feng-Quan
2011-01-01
Suppression of glycogen synthase kinase 3 (GSK3) activity in neurons yields pleiotropic outcomes, causing both axon growth promotion and inhibition. Previous studies have suggested that specific GSK3 substrates, such as adenomatous polyposis coli (APC) and collapsin response mediator protein 2 (CRMP2), support axon growth by regulating the stability of axonal microtubules (MTs), but the substrate(s) and mechanisms conveying axon growth inhibition remain elusive. Here we show that CLIP (cytoplasmic linker protein)-associated protein (CLASP), originally identified as a MT plus end-binding protein, displays both plus end-binding and lattice-binding activities in nerve growth cones, and reveal that the two MT-binding activities regulate axon growth in an opposing manner: The lattice-binding activity mediates axon growth inhibition induced by suppression of GSK3 activity via preventing MT protrusion into the growth cone periphery, whereas the plus end-binding property supports axon extension via stabilizing the growing ends of axonal MTs. We propose a model in which CLASP transduces GSK3 activity levels to differentially control axon growth by coordinating the stability and configuration of growth cone MTs. PMID:21937714
Helledie, T; Antonius, M; Sorensen, R V; Hertzel, A V; Bernlohr, D A; Kølvraa, S; Kristiansen, K; Mandrup, S
2000-11-01
Peroxisome proliferator-activated receptors (PPARs) are activated by a variety of fatty acids, eicosanoids, and hypolipidemic and insulin-sensitizing drugs. Many of these compounds bind avidly to members of a family of small lipid-binding proteins, the fatty acid-binding proteins (FABPs). Fatty acids are activated to CoA esters, which bind with high affinity to the acyl-CoA-binding protein (ACBP). Thus, the availability of known and potential PPAR ligands may be regulated by lipid-binding proteins. In this report we show by transient transfection of CV-1 cells that coexpression of ACBP and adipocyte lipid-binding protein (ALBP) exerts a ligand- and PPAR subtype-specific attenuation of PPAR-mediated trans-activation, suggesting that lipid-binding proteins, when expressed at high levels, may function as negative regulators of PPAR activation by certain ligands. Expression of ACBP, ALBP, and keratinocyte lipid-binding protein (KLBP) is induced during adipocyte differentiation, a process during which PPARgamma plays a prominent role. We present evidence that endogenous ACBP, ALBP, and KLBP not only localize to the cytoplasm but also exhibit a prominent nuclear localization in 3T3-L1 adipocytes. In addition, forced expression of ACBP, ALBP, and KLBP in CV-1 cells resulted in a substantial accumulation of all three proteins in the nucleus. These results suggest that lipid-binding proteins, contrary to the general assumption, may exert their action in the nucleus as well as in the cytoplasm.
Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.
Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N
2014-06-01
The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.
Dávila, David; Jiménez-Mateos, Eva M.; Mooney, Claire M.; Velasco, Guillermo; Henshall, David C.; Prehn, Jochen H. M.
2014-01-01
Neurons face a changeable microenvironment and therefore need mechanisms that allow rapid switch on/off of their cytoprotective and apoptosis-inducing signaling pathways. Cellular mechanisms that control apoptosis activation include the regulation of pro/antiapoptotic mRNAs through their 3′-untranslated region (UTR). This region holds binding elements for RNA-binding proteins, which can control mRNA translation. Here we demonstrate that heat shock protein 27 (Hsp27) prevents oxidative stress–induced cell death in cerebellar granule neurons by specific regulation of the mRNA for the proapoptotic BH3-only protein, Bim. Hsp27 depletion induced by oxidative stress using hydrogen peroxide (H2O2) correlated with bim gene activation and subsequent neuronal death, whereas enhanced Hsp27 expression prevented these. This effect could not be explained by proteasomal degradation of Bim or bim promoter inhibition; however, it was associated with a specific increase in the levels of bim mRNA and with its binding to Hsp27. Finally, we determined that enhanced Hsp27 expression in neurons exposed to H2O2 or glutamate prevented the translation of a reporter plasmid where bim-3′UTR mRNA sequence was cloned downstream of a luciferase gene. These results suggest that repression of bim mRNA translation through binding to the 3′UTR constitutes a novel cytoprotective mechanism of Hsp27 during stress in neurons. PMID:25187648
Conformational changes in the M2 muscarinic receptor induced by membrane voltage and agonist binding
Navarro-Polanco, Ricardo A; Galindo, Eloy G Moreno; Ferrer-Villada, Tania; Arias, Marcelo; Rigby, J Ryan; Sánchez-Chapula, José A; Tristani-Firouzi, Martin
2011-01-01
Abstract The ability to sense transmembrane voltage is a central feature of many membrane proteins, most notably voltage-gated ion channels. Gating current measurements provide valuable information on protein conformational changes induced by voltage. The recent observation that muscarinic G-protein-coupled receptors (GPCRs) generate gating currents confirms their intrinsic capacity to sense the membrane electrical field. Here, we studied the effect of voltage on agonist activation of M2 muscarinic receptors (M2R) in atrial myocytes and how agonist binding alters M2R gating currents. Membrane depolarization decreased the potency of acetylcholine (ACh), but increased the potency and efficacy of pilocarpine (Pilo), as measured by ACh-activated K+ current, IKACh. Voltage-induced conformational changes in M2R were modified in a ligand-selective manner: ACh reduced gating charge displacement while Pilo increased the amount of charge displaced. Thus, these ligands manifest opposite voltage-dependent IKACh modulation and exert opposite effects on M2R gating charge displacement. Finally, mutations in the putative ligand binding site perturbed the movement of the M2R voltage sensor. Our data suggest that changes in voltage induce conformational changes in the ligand binding site that alter the agonist–receptor interaction in a ligand-dependent manner. Voltage-dependent GPCR modulation has important implications for cellular signalling in excitable tissues. Gating current measurement allows for the tracking of subtle conformational changes in the receptor that accompany agonist binding and changes in membrane voltage. PMID:21282291
Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J
2016-10-01
During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xu, Jialin; Department of Biomedical and Pharmaceutical Sciences, University of Rhode Island, Kingston, RI 02881; Shimpi, Prajakta
PFOS is a chemical of nearly ubiquitous exposure in humans. Recent studies have associated PFOS exposure to adipose tissue-related effects. The present study was to determine whether PFOS alters the process of adipogenesis and regulates insulin-stimulated glucose uptake in mouse and human preadipocytes. In murine-derived 3T3-L1 preadipocytes, PFOS enhanced hormone-induced differentiation to adipocytes and adipogenic gene expression, increased insulin-stimulated glucose uptake at concentrations ranging from 10 to 100 μM, and enhanced Glucose transporter type 4 and Insulin receptor substrate-1 expression. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2), NAD(P)H dehydrogenase, quinone 1 and Glutamate-cysteine ligase, catalytic subunit were significantly induced in 3T3-L1more » cells treated with PFOS, along with a robust induction of Antioxidant Response Element (ARE) reporter in mouse embryonic fibroblasts isolated from ARE-hPAP transgenic mice by PFOS treatment. Chromatin immunoprecipitation assays further illustrated that PFOS increased Nrf2 binding to ARE sites in mouse Nqo1 promoter, suggesting that PFOS activated Nrf2 signaling in murine-derived preadipocytes. Additionally, PFOS administration in mice (100 μg/kg/day) induced adipogenic gene expression and activated Nrf2 signaling in epididymal white adipose tissue. Moreover, the treatment on human visceral preadipocytes illustrated that PFOS (5 and 50 μM) promoted adipogenesis and increased cellular lipid accumulation. It was observed that PFOS increased Nrf2 binding to ARE sites in association with Nrf2 signaling activation, induction of Peroxisome proliferator-activated receptor γ and CCAAT/enhancer-binding protein α expression, and increased adipogenesis. This study points to a potential role of PFOS in dysregulation of adipose tissue expandability, and warrants further investigations on the adverse effects of persistent pollutants on human health. - Highlights: • PFOS induces adipogenesis in association with increased Pparγ and Cebpα mRNA expression. • PFOS increases ARE binding activity and activates Nrf2 signaling. • PFOS increases insulin-stimulated glucose uptake.« less
Xu, Lu; Sterling, Carol R.
2009-01-01
Tyrosine hydroxylase (TH) plays a critical role in maintaining the appropriate concentrations of catecholamine neurotransmitters in brain and periphery, particularly during long-term stress, long-term drug treatment, or neurodegenerative diseases. Its expression is controlled by both transcriptional and post-transcriptional mechanisms. In a previous report, we showed that treatment of rat midbrain slice explant cultures or mouse MN9D cells with cAMP analog or forskolin leads to induction of TH protein without concomitant induction of TH mRNA. We further showed that cAMP activates mechanisms that regulate TH mRNA translation via cis-acting sequences within its 3′-untranslated region (UTR). In the present report, we extend these studies to show that MN9D cytoplasmic proteins bind to the same TH mRNA 3′-UTR domain that is required for the cAMP response. RNase T1 mapping demonstrates binding of proteins to a 27-nucleotide polypyrimidine-rich sequence within this domain. A specific mutation within the polypyrimidine-rich sequence inhibits protein binding and cAMP-mediated translational activation. UV-cross-linking studies identify a ∼44-kDa protein as a major TH mRNA 3′-UTR binding factor, and cAMP induces the 40- to 42-kDa poly(C)-binding protein-2 (PCBP2) in MN9D cells. We show that PCBP2 binds to the TH mRNA 3′-UTR domain that participates in the cAMP response. Overexpression of PCBP2 induces TH protein without concomitant induction of TH mRNA. These results support a model in which cAMP induces PCBP2, leading to increased interaction with its cognate polypyrimidine binding site in the TH mRNA 3′-UTR. This increased interaction presumably plays a role in the activation of TH mRNA translation by cAMP in dopaminergic neurons. PMID:19620256
Imaging of Ras/Raf activity induced by low energy laser irradiation in living cell using FRET
NASA Astrophysics Data System (ADS)
Wang, Fang; Chen, Tong-Sheng; Xing, Da
2005-01-01
Ras/Raf signaling pathway is an important signaling pathway that governs cell proliferation, differential and apoptosis. Low-energy laser irradiation (LELI) was found to modulate various processes. Generally, cell proliferation is induced by low doses LELI and apoptosis is induced by high doses LELI. Mechanism of biological effect of LELI has not been clear. Recently, activation of MEK (mitogen-activated protein kinase) and ERK (extracellular-signal-regulated kinase), which are downstream protein kinases of Ras/Raf, are observed during LELI-induced cell proliferation by immunoprecipitation and western blot analysis. RaichuRas reporter consisting of fusions of H-ras, the Ras-binding domain of Raf (RafRBD), a cyan fluorescent protein (CFP) and a yellow fluorescent protein (YFP). Therefore, intramolecular binding of GTP-Ras to RafRBD brings CFP close to YFP and increases FRET between CFP and YFP. Human lung adenocarcinoma cell line (ASTC-a-1) was transfected with the plasmid (pRaichuRas) and then treated with LELI at dose of 60J/cm2. Effect of LELI on Ras/Raf in physiological condition of living cells was observed by fluorescence resonance energy transfer (FRET) technique during lung adenocarcinoma cell apoptosis induced by high dose (60J/cm2) LELI. Experimental results showed that after high dose LELI treatment, the binding of Ras and Raf decreases obviously, Ras/Raf signaling pathway deregulates and cell apoptosis occurs.
Hayafune, Masahiro; Berisio, Rita; Marchetti, Roberta; Silipo, Alba; Kayama, Miyu; Desaki, Yoshitake; Arima, Sakiko; Squeglia, Flavia; Ruggiero, Alessia; Tokuyasu, Ken; Molinaro, Antonio; Kaku, Hanae; Shibuya, Naoto
2014-01-01
Perception of microbe-associated molecular patterns (MAMPs) through pattern recognition receptors (PRRs) triggers various defense responses in plants. This MAMP-triggered immunity plays a major role in the plant resistance against various pathogens. To clarify the molecular basis of the specific recognition of chitin oligosaccharides by the rice PRR, CEBiP (chitin-elicitor binding protein), as well as the formation and activation of the receptor complex, biochemical, NMR spectroscopic, and computational studies were performed. Deletion and domain-swapping experiments showed that the central lysine motif in the ectodomain of CEBiP is essential for the binding of chitin oligosaccharides. Epitope mapping by NMR spectroscopy indicated the preferential binding of longer-chain chitin oligosaccharides, such as heptamer-octamer, to CEBiP, and also the importance of N-acetyl groups for the binding. Molecular modeling/docking studies clarified the molecular interaction between CEBiP and chitin oligosaccharides and indicated the importance of Ile122 in the central lysine motif region for ligand binding, a notion supported by site-directed mutagenesis. Based on these results, it was indicated that two CEBiP molecules simultaneously bind to one chitin oligosaccharide from the opposite side, resulting in the dimerization of CEBiP. The model was further supported by the observations that the addition of (GlcNAc)8 induced dimerization of the ectodomain of CEBiP in vitro, and the dimerization and (GlcNAc)8-induced reactive oxygen generation were also inhibited by a unique oligosaccharide, (GlcNβ1,4GlcNAc)4, which is supposed to have N-acetyl groups only on one side of the molecule. Based on these observations, we proposed a hypothetical model for the ligand-induced activation of a receptor complex, involving both CEBiP and Oryza sativa chitin-elicitor receptor kinase-1. PMID:24395781
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Won Seok; Chang, Jai Won; Han, Nam Jeong
The role of spleen tyrosine kinase (Syk) in high glucose-induced intracellular signal transduction has yet to be elucidated. We investigated whether Syk is implicated in high glucose-induced transforming growth factor-{beta}1 (TGF-{beta}1) up-regulation in cultured human proximal tubular epithelial cells (HK-2 cell). High glucose increased TGF-{beta}1 gene expression through Syk, extracellular signal-regulated kinase (ERK), AP-1 and NF-{kappa}B. High glucose-induced AP-1 DNA binding activity was decreased by Syk inhibitors and U0126 (an ERK inhibitor). Syk inhibitors suppressed high glucose-induced ERK activation, whereas U0126 had no effect on Syk activation. High glucose-induced NF-{kappa}B DNA binding activity was also decreased by Syk inhibitors. Highmore » glucose increased nuclear translocation of p65 without serine phosphorylation of I{kappa}B{alpha} and without degradation of I{kappa}B{alpha}, but with an increase in tyrosine phosphorylation of I{kappa}B{alpha} that may account for the activation of NF-{kappa}B. Both Syk inhibitors and Syk-siRNA attenuated high glucose-induced I{kappa}B{alpha} tyrosine phosphorylation and p65 nuclear translocation. Depletion of p21-activated kinase 2 (Pak2) by transfection of Pak2-siRNA abolished high glucose-induced Syk activation. In summary, high glucose-induced TGF-{beta}1 gene transcription occurred through Pak2, Syk and subsequent ERK/AP-1 and NF-{kappa}B pathways. This suggests that Syk might be implicated in the diabetic kidney disease.« less
Culmsee, Carsten; Siewe, Jan; Junker, Vera; Retiounskaia, Marina; Schwarz, Stephanie; Camandola, Simonetta; El-Metainy, Shahira; Behnke, Hagen; Mattson, Mark P; Krieglstein, Josef
2003-09-17
The tumor suppressor and transcription factor p53 is a key modulator of cellular stress responses, and activation of p53 precedes apoptosis in many cell types. Controversial reports exist on the role of the transcription factor nuclear factor-kappaB (NF-kappaB) in p53-mediated apoptosis, depending on the cell type and experimental conditions. Therefore, we sought to elucidate the role of NF-kappaB in p53-mediated neuron death. In cultured neurons DNA damaging compounds induced activation of p53, whereas NF-kappaB activity declined significantly. The p53 inhibitor pifithrin-alpha (PFT) preserved NF-kappaB activity and protected neurons against apoptosis. Immunoprecipitation experiments revealed enhanced p53 binding to the transcriptional cofactor p300 after induction of DNA damage, whereas binding of p300 to NF-kappaB was reduced. In contrast, PFT blocked the interaction of p53 with the cofactor, whereas NF-kappaB binding to p300 was enhanced. Most interestingly, similar results were observed after oxygen glucose deprivation in cultured neurons and in ischemic brain tissue. Ischemia-induced repression of NF-kappaB activity was prevented and brain damage was reduced by the p53 inhibitor PFT in a dose-dependent manner. It is concluded that a balanced competitive interaction of p53 and NF-kappaB with the transcriptional cofactor p300 exists in neurons. Exposure of neurons to lethal stress activates p53 and disrupts NF-kappaB binding to p300, thereby blocking NF-kappaB-mediated survival signaling. Inhibitors of p53 provide pronounced neuroprotective effects because they block p53-mediated induction of cell death and concomitantly enhance NF-kappaB-induced survival signaling.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harford, N.; De Wilde, M.
1987-05-19
A recombinant DNA molecule is described comprising at least a portion coding for subunits A and B of cholera toxin, or a fragment or derivative of the portion wherein the fragment or derivative codes for a polypeptide have an activity which can induce an immune response to subunit A; can induce an immune response to subunit A and cause epithelial cell penetration and the enzymatic effect leading to net loss of fluid into the gut lumen; can bind to the membrane receptor for the B subunit of cholera toxin; can induce an immune response to subunit B; can induce anmore » immune response to subunit B and bind to the membrane receptor; or has a combination of the activities.« less
Engineering antigens for in situ erythrocyte binding induces T-cell deletion.
Kontos, Stephan; Kourtis, Iraklis C; Dane, Karen Y; Hubbell, Jeffrey A
2013-01-02
Antigens derived from apoptotic cell debris can drive clonal T-cell deletion or anergy, and antigens chemically coupled ex vivo to apoptotic cell surfaces have been shown correspondingly to induce tolerance on infusion. Reasoning that a large number of erythrocytes become apoptotic (eryptotic) and are cleared each day, we engineered two different antigen constructs to target the antigen to erythrocyte cell surfaces after i.v. injection, one using a conjugate with an erythrocyte-binding peptide and another using a fusion with an antibody fragment, both targeting the erythrocyte-specific cell surface marker glycophorin A. Here, we show that erythrocyte-binding antigen is collected much more efficiently than free antigen by splenic and hepatic immune cell populations and hepatocytes, and that it induces antigen-specific deletional responses in CD4(+) and CD8(+) T cells. We further validated T-cell deletion driven by erythrocyte-binding antigens using a transgenic islet β cell-reactive CD4(+) T-cell adoptive transfer model of autoimmune type 1 diabetes: Treatment with the peptide antigen fused to an erythrocyte-binding antibody fragment completely prevented diabetes onset induced by the activated, autoreactive CD4(+) T cells. Thus, we report a translatable modular biomolecular approach with which to engineer antigens for targeted binding to erythrocyte cell surfaces to induce antigen-specific CD4(+) and CD8(+) T-cell deletion toward exogenous antigens and autoantigens.
Regulation of uterine progesterone receptors by the nonsteroidal anti-androgen hydroxyflutamide
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandrasekhar, Y.; Armstrong, D.T.
1991-07-01
The authors have recently reported that the anti-androgen hydroxyflutamide causes delayed implantation and exhibits antideciduogenic activity in the rat. The present experiments were conducted to examine whether hydroxyflutamide binds to the uterine progesterone receptors and/or alters the progesterone binding sites in the uterus. Cytosol and nuclear fractions from decidualized rat uterus were incubated with (3H)-R5020 without or with increasing concentrations of radioinert R5020, RU486, dihydrotestosterone, or hydroxyflutamide. From the log-dose inhibition curves, the relative binding affinity of both hydroxyflutamide and dihydrotestosterone was less than 0.1% and 2%, compared with R5020 (100%) for displacing (3H)-R5020 bound to uterine cytosol and nuclearmore » fractions, respectively. Injection of estradiol-17 beta (1 microgram/rat) to ovariectomized prepubertal rats induced a 1.85-fold increase in uterine weight by 24 h. Hydroxyflutamide at 2.5 or 5.0 mg did not significantly alter the estrogen-induced increase in uterine weight. Compared to vehicle alone, estrogen induced an approximately 5-fold increase in uterine cytosolic progesterone binding sites. Hydroxyflutamide at both 2.5- and 5.0-mg doses significantly attenuated the estrogen-induced elevation in uterine progesterone binding sites. These studies demonstrate that hydroxyflutamide does not bind with high affinity to progesterone receptors, but suppresses the estrogen-induced elevation in progesterone receptor levels in the uterus.« less
Aging-induced changes in brain regional serotonin receptor binding: Effect of Carnosine.
Banerjee, S; Poddar, M K
2016-04-05
Monoamine neurotransmitter, serotonin (5-HT) has its own specific receptors in both pre- and post-synapse. In the present study the role of carnosine on aging-induced changes of [(3)H]-5-HT receptor binding in different brain regions in a rat model was studied. The results showed that during aging (18 and 24 months) the [(3)H]-5-HT receptor binding was reduced in hippocampus, hypothalamus and pons-medulla with a decrease in their both Bmax and KD but in cerebral cortex the [(3)H]-5-HT binding was increased with the increase of its only Bmax. The aging-induced changes in [(3)H]-5-HT receptor binding with carnosine (2.0 μg/kg/day, intrathecally, for 21 consecutive days) attenuated in (a) 24-month-aged rats irrespective of the brain regions with the attenuation of its Bmax except hypothalamus where both Bmax and KD were significantly attenuated, (b) hippocampus and hypothalamus of 18-month-aged rats with the attenuation of its Bmax, and restored toward the [(3)H]-5-HT receptor binding that observed in 4-month-young rats. The decrease in pons-medullary [(3)H]-5-HT binding including its Bmax of 18-month-aged rats was promoted with carnosine without any significant change in its cerebral cortex. The [(3)H]-5-HT receptor binding with the same dosages of carnosine in 4-month-young rats (a) increased in the cerebral cortex and hippocampus with the increase in their only Bmax whereas (b) decreased in hypothalamus and pons-medulla with a decrease in their both Bmax and KD. These results suggest that carnosine treatment may (a) play a preventive role in aging-induced brain region-specific changes in serotonergic activity (b) not be worthy in 4-month-young rats in relation to the brain regional serotonergic activity. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Fay, Jonathan F.; Farrens, David L.
2015-01-01
G protein-coupled receptors (GPCRs) are surprisingly flexible molecules that can do much more than simply turn on G proteins. Some even exhibit biased signaling, wherein the same receptor preferentially activates different G-protein or arrestin signaling pathways depending on the type of ligand bound. Why this behavior occurs is still unclear, but it can happen with both traditional ligands and ligands that bind allosterically outside the orthosteric receptor binding pocket. Here, we looked for structural mechanisms underlying these phenomena in the marijuana receptor CB1. Our work focused on the allosteric ligand Org 27569, which has an unusual effect on CB1—it simultaneously increases agonist binding, decreases G-protein activation, and induces biased signaling. Using classical pharmacological binding studies, we find that Org 27569 binds to a unique allosteric site on CB1 and show that it can act alone (without need for agonist cobinding). Through mutagenesis studies, we find that the ability of Org 27569 to bind is related to how much receptor is in an active conformation that can couple with G protein. Using these data, we estimated the energy differences between the inactive and active states. Finally, site-directed fluorescence labeling studies show the CB1 structure stabilized by Org 27569 is different and unique from that stabilized by antagonist or agonist. Specifically, transmembrane helix 6 (TM6) movements associated with G-protein activation are blocked, but at the same time, helix 8/TM7 movements are enhanced, suggesting a possible mechanism for the ability of Org 27569 to induce biased signaling. PMID:26100912
A photocleavable rapamycin conjugate for spatiotemporal control of small GTPase activity.
Umeda, Nobuhiro; Ueno, Tasuku; Pohlmeyer, Christopher; Nagano, Tetsuo; Inoue, Takanari
2011-01-12
We developed a novel method to spatiotemporally control the activity of signaling molecules. A newly synthesized photocaged rapamycin derivative induced rapid dimerization of FKBP (FK-506 binding protein) and FRB (FKBP-rapamycin binding protein) upon UV irradiation. With this system and the spatially confined UV irradiation, we achieved subcellularly localized activation of Rac, a member of small GTPases. Our technique offers a powerful approach to studies of dynamic intracellular signaling events.
Cichocki, Michal; Paluszczak, Jaroslaw; Szaefer, Hanna; Piechowiak, Adriana; Rimando, Agnes M; Baer-Dubowska, Wanda
2008-06-01
Resveratrol, a phytoalexin present in grapes, has been reported to inhibit multistage mouse skin carcinogenesis. Recent studies showed that topically applied resveratrol significantly inhibited cyclooxygenase-2 (COX-2) expression and activation of nuclear factor-kappaB (NF-kappaB) induced by tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) in mouse epidermis. The aim of the present study was to further explore the effect of resveratrol on TPA-induced signaling pathways in mouse epidermis and to compare with its dimethylether, pterostilbene. Resveratrol and pterostilbene significantly reduced activator protein 1 (AP-1) and NF-kappaB activation. In the case of AP-1, the binding of c-Jun subunit was particularly affected, while only slight effect on c-Fos binding to TPA-responsive element (AP-1 binding consensus sequence) (TRE) site was observed. Both stilbenes inhibited the activation of NF-kappaB by blocking the translocation of p65 to the nucleus and increasing the retention of IkappaBa in the cytosol. The latter might be related to decreased activity of IkappaB kinase and/or proteasome 20S. Reduced activation of transcription factors decreased the expression and activity of COX-2 and inducible nitric oxide synthase (iNOS). In most assays, pterostilbene was either equally or significantly more potent than resveratrol. Pterostilbene might show higher biological activity due to its possible better bioavailability, since substitution of hydroxy with methoxy group increases lipophilicity.
Dead bacteria reverse antibiotic-induced host defense impairment in burns.
Chen, Lee-Wei; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei
2014-10-01
Burn patients can incur high rates of hospital-acquired infections. The mechanism of antibiotic exposure on inducing infection vulnerability has not been determined. This study aimed to examine the effects of antibiotic treatment on host defense mechanisms. First we treated C57/BL6 mice with combined antibiotic treatment after 30% to 35% total body surface area burn. Animals were sacrificed at 48 hours after sham or thermal injury treatment. Bacterial counts in intestinal lumen and mucosa were measured. Next, we treated animals with or without oral dead Escherichia coli or Staphylococcus aureus supplementation to stimulate Toll-like receptor in the intestinal mucosa. Toll-like receptor 4, antibacterial protein expression, nuclear factor (NF)-κB DNA-binding activity, and bacteria-killing activity in the intestinal mucosa; intestinal permeability; bacterial translocation to mesenteric lymph nodes; Klebsiella pneumoniae translocation; interleukin-6 in the blood; and phagocytic activity of alveolar macrophages, were assessed. Thermal injury increased microflora and NF-κB DNA-binding activity of the intestine. Systemic antibiotic treatment decreased gut microflora and increased bacterial translocation to mesenteric lymph nodes, intestinal permeability, and interleukin-6 levels in the blood. Antibiotic treatment also decreased bacteria-killing activity in intestinal mucosa and phagocytic activity of alveolar macrophages. Oral dead E coli and S aureus supplementation induced NF-κB DNA-binding activity, Toll-like receptor 4, and antibacterial protein expression of the intestinal mucosa. Taken together with the fact that dead bacteria reversed antibiotic-induced K pneumoniae translocation and intestinal and pulmonary defense impairment, we conclude that combined antibiotic treatment results in systemic host defense impairment in burns through the decrease in intestinal flora. We suggest that dead bacteria supplementation could induce nondefensin protein expression and reverse antibiotic-induced gut and lung defense impairment in burn patients. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.
Modulation of activation-loop phosphorylation by JAK inhibitors is binding mode dependent
Bonenfant, Débora; Rubert, Joëlle; Vangrevelinghe, Eric; Scheufler, Clemens; Marque, Fanny; Régnier, Catherine H.; De Pover, Alain; Ryckelynck, Hugues; Bhagwat, Neha; Koppikar, Priya; Goel, Aviva; Wyder, Lorenza; Tavares, Gisele; Baffert, Fabienne; Pissot-Soldermann, Carole; Manley, Paul W.; Gaul, Christoph; Voshol, Hans; Levine, Ross L.; Sellers, William R.; Hofmann, Francesco; Radimerski, Thomas
2016-01-01
JAK inhibitors are being developed for the treatment of rheumatoid arthritis, psoriasis, myeloproliferative neoplasms and leukemias. Most of these drugs target the ATP-binding pocket and stabilize the active conformation of the JAK kinases. This type-I binding mode leads to an increase in JAK activation-loop phosphorylation, despite blockade of kinase function. Here we report that stabilizing the inactive state via type-II inhibition acts in the opposite manner, leading to a loss of activation-loop phosphorylation. We used X-ray crystallography to corroborate the binding mode and report for the first time the crystal structure of the JAK2 kinase domain in an inactive conformation. Importantly, JAK inhibitor-induced activation-loop phosphorylation requires receptor interaction, as well as intact kinase and pseudokinase domains. Hence, depending on the respective conformation stabilized by a JAK inhibitor, hyperphosphorylation of the activation-loop may or may not be elicited. PMID:22684457
Molecular mechanisms of immunosuppression by cyclosporins.
Zenke, G; Baumann, G; Wenger, R; Hiestand, P; Quesniaux, V; Andersen, E; Schreier, M H
1993-06-23
Despite the successful clinical application of the immunosuppressive drug cyclosporin A (CsA, Sandimmun), its precise mechanism of action in the process of T cell activation remains elusive. CsA binds to the high-affinity cytosolic receptor cyclophilin whose peptidyl-prolyl cis-trans isomerase activity is inhibited upon binding. The linkage of this effect with the inhibition of the T cell receptor-mediated signal transduction pathway, which leads to a suppression of lymphokine gene transcription, is still unclear. We analyzed the relationship between cyclophilin-binding and immunosuppressive activity (e.g., effect on IL-2 transcription) of cyclosporin derivatives in vitro. The results show that binding to cyclophilin is required, but not sufficient for immunosuppression. Cyclosporin analogues which completely lack immunosuppressive activity but fully retained their cyclophilin-binding capacity antagonize the immunosuppressive activity of CsA. These derivatives inhibit the isomerase activity of cyclophilin, which clearly demonstrates that inhibition of the cyclophilin isomerase activity does not lead to immunosuppression. In analogy to the other immunosuppressants of microbial origin, FK-506 and rapamycin, a specific structure of the "effector" domain of CsA, which is unrelated to the cyclophilin-binding domain, determines the biological activity. In the nucleus, CsA interferes with the DNA-binding of inducible transcription factors to their respective DNA motifs within lymphokine promoters by affecting intracellular translocation of transcription factor subunits.
Deciphering structure-activity relationships in a series of Tat/TAR inhibitors.
Pascale, Lise; González, Alejandro López; Di Giorgio, Audrey; Gaysinski, Marc; Teixido Closa, Jordi; Tejedor, Roger Estrada; Azoulay, Stéphane; Patino, Nadia
2016-11-01
A series of pentameric "Polyamide Amino Acids" (PAAs) compounds derived from the same trimeric precursor have been synthesized and investigated as HIV TAR RNA ligands, in the absence and in the presence of a Tat fragment. All PAAs bind TAR with similar sub-micromolar affinities but their ability to compete efficiently with the Tat fragment strongly differs, IC50 ranging from 35 nM to >2 μM. While NMR and CD studies reveal that all PAA interact with TAR at the same site and induce globally the same RNA conformational change upon binding, a comparative thermodynamic study of PAA/TAR equilibria highlights distinct TAR binding modes for Tat competitor and non-competitor PAAs. This led us to suggest two distinct interaction modes that have been further validated by molecular modeling studies. While the binding of Tat competitor PAAs induces a contraction at the TAR bulge region, the binding of non-competitor ones widens it. This could account for the distinct PAA ability to compete with Tat fragment. Our work illustrates how comparative thermodynamic studies of a series of RNA ligands of same chemical family are of value for understanding their binding modes and for rationalizing structure-activity relationships.
Conformation changes in the Glutamate receptor as studied by LRET
NASA Astrophysics Data System (ADS)
Jayaraman, Vasanthi
2009-03-01
Glutamate receptors are the primary mediators of excitatory neurotransmission in the mammalian central nervous system. Glutamate binding to an extracellular ligand binding domain initiates a series of conformational changes that results in the formation of cation selective transmembrane ion channels that ultimately desensitize. We have used luminescence resonance energy transfer to determine the conformational changes that underlie the allosteric process of glutamate mediated gating in the receptor. These investigations showed that agonist binding induced cleft closure in the ligand binding domain confirming that this change observed in the isolated ligand binding domain of the receptor is one of the mechanisms by which agonist mediates activation. The LRET investigations also allowed a study of the conformational changes between the subunits. The apo state of the protein showed a dimer interface that was open. The dimer interface was brought together only in the activated state, suggesting that cleft closure drives the formation of the contacts at dimer interface, which in turn transiently stabilizes the open channel. At longer times, the stress induced by the transmembrane segments, ultimately drives the breakdown of the interface, leading to channel closure and receptor desensitization.
Resetca, Diana; Haftchenary, Sina; Gunning, Patrick T; Wilson, Derek J
2014-11-21
The activity of the transcription factor signal transducer and activator of transcription 3 (STAT3) is dysregulated in a number of hematological and solid malignancies. Development of pharmacological STAT3 Src homology 2 (SH2) domain interaction inhibitors holds great promise for cancer therapy, and a novel class of salicylic acid-based STAT3 dimerization inhibitors that includes orally bioavailable drug candidates has been recently developed. The compounds SF-1-066 and BP-1-102 are predicted to bind to the STAT3 SH2 domain. However, given the highly unstructured and dynamic nature of the SH2 domain, experimental confirmation of this prediction was elusive. We have interrogated the protein-ligand interaction of STAT3 with these small molecule inhibitors by means of time-resolved electrospray ionization hydrogen-deuterium exchange mass spectrometry. Analysis of site-specific evolution of deuterium uptake induced by the complexation of STAT3 with SF-1-066 or BP-1-102 under physiological conditions enabled the mapping of the in silico predicted inhibitor binding site to the STAT3 SH2 domain. The binding of both inhibitors to the SH2 domain resulted in significant local decreases in dynamics, consistent with solvent exclusion at the inhibitor binding site and increased rigidity of the inhibitor-complexed SH2 domain. Interestingly, inhibitor binding induced hot spots of allosteric perturbations outside of the SH2 domain, manifesting mainly as increased deuterium uptake, in regions of STAT3 important for DNA binding and nuclear localization. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Du, Yiqun; Teng, Xiaoyan; Wang, Na; Zhang, Xin; Chen, Jianfeng; Ding, Peipei; Qiao, Qian; Wang, Qingkai; Zhang, Long; Yang, Chaoqun; Yang, Zhangmin; Chu, Yiwei; Du, Xiang; Zhou, Xuhui; Hu, Weiguo
2014-01-31
The complement system can be activated spontaneously for immune surveillance or induced to clear invading pathogens, in which the membrane attack complex (MAC, C5b-9) plays a critical role. CD59 is the sole membrane complement regulatory protein (mCRP) that restricts MAC assembly. CD59, therefore, protects innocent host cells from attacks by the complement system, and host cells require the constitutive and inducible expression of CD59 to protect themselves from deleterious destruction by complement. However, the mechanisms that underlie CD59 regulation remain largely unknown. In this study we demonstrate that the widely expressed transcription factor Sp1 may regulate the constitutive expression of CD59, whereas CREB-binding protein (CBP)/p300 bridge NF-κB and CREB, which surprisingly functions as an enhancer-binding protein to induce the up-regulation of CD59 during in lipopolysaccharide (LPS)-triggered complement activation, thus conferring host defense against further MAC-mediated destruction. Moreover, individual treatment with LPS, TNF-α, and the complement activation products (sublytic MAC (SC5b-9) and C5a) could increase the expression of CD59 mainly by activating NF-κB and CREB signaling pathways. Together, our findings identify a novel gene regulation mechanism involving CBP/p300, NF-κB, and CREB; this mechanism suggests potential drug targets for controlling various complement-related human diseases.
Dettmar, Anne K.; Binder, Elisabeth; Greiner, Friederike R.; Liebau, Max C.; Kurschat, Christine E.; Jungraithmayr, Therese C.; Saleem, Moin A.; Schmitt, Claus-Peter; Feifel, Elisabeth; Orth-Höller, Dorothea; Kemper, Markus J.; Pepys, Mark; Würzner, Reinhard
2014-01-01
Hemolytic uremic syndrome (HUS) is mainly induced by Shiga toxin 2 (Stx2)-producing Escherichia coli. Proteinuria can occur in the early phase of the disease, and its persistence determines the renal prognosis. Stx2 may injure podocytes and induce proteinuria. Human serum amyloid P component (SAP), a member of the pentraxin family, has been shown to protect against Stx2-induced lethality in mice in vivo, presumably by specific binding to the toxin. We therefore tested the hypothesis that SAP can protect against Stx2-induced injury of human podocytes. To elucidate the mechanisms underlying podocyte injury in HUS-associated proteinuria, we assessed Stx2-induced activation of mitogen-activated protein kinases (MAPKs) and apoptosis in immortalized human podocytes and evaluated the impact of SAP on Stx2-induced damage. Human podocytes express Stx2-binding globotriaosylceramide 3. Stx2 applied to cultured podocytes was internalized and then activated p38α MAPK and c-Jun N-terminal kinase (JNK), important signaling steps in cell differentiation and apoptosis. Stx2 also activated caspase 3, resulting in an increased level of apoptosis. Coincubation of podocytes with SAP and Stx2 mitigated the effects of Stx2 and induced upregulation of antiapoptotic Bcl2. These data suggest that podocytes are a target of Stx2 and that SAP protects podocytes against Stx2-induced injury. SAP may therefore be a useful therapeutic option. PMID:24566618
Rodríguez-Calvo, Ricardo; Serrano, Lucía; Coll, Teresa; Moullan, Norman; Sánchez, Rosa M.; Merlos, Manuel; Palomer, Xavier; Laguna, Juan C.; Michalik, Liliane; Wahli, Walter; Vázquez-Carrera, Manuel
2008-01-01
OBJECTIVE—Chronic activation of the nuclear factor-κB (NF-κB) in white adipose tissue leads to increased production of pro-inflammatory cytokines, which are involved in the development of insulin resistance. It is presently unknown whether peroxisome proliferator–activated receptor (PPAR) β/δ activation prevents inflammation in adipocytes. RESEARCH DESIGN AND METHODS AND RESULTS—First, we examined whether the PPARβ/δ agonist GW501516 prevents lipopolysaccharide (LPS)-induced cytokine production in differentiated 3T3-L1 adipocytes. Treatment with GW501516 blocked LPS-induced IL-6 expression and secretion by adipocytes and the subsequent activation of the signal transducer and activator of transcription 3 (STAT3)–Suppressor of cytokine signaling 3 (SOCS3) pathway. This effect was associated with the capacity of GW501516 to impede LPS-induced NF-κB activation. Second, in in vivo studies, white adipose tissue from Zucker diabetic fatty (ZDF) rats, compared with that of lean rats, showed reduced PPARβ/δ expression and PPAR DNA-binding activity, which was accompanied by enhanced IL-6 expression and NF-κB DNA-binding activity. Furthermore, IL-6 expression and NF-κB DNA-binding activity was higher in white adipose tissue from PPARβ/δ-null mice than in wild-type mice. Because mitogen-activated protein kinase–extracellular signal–related kinase (ERK)1/2 (MEK1/2) is involved in LPS-induced NF-κB activation in adipocytes, we explored whether PPARβ/δ prevented NF-κB activation by inhibiting this pathway. Interestingly, GW501516 prevented ERK1/2 phosphorylation by LPS. Furthermore, white adipose tissue from animal showing constitutively increased NF-κB activity, such as ZDF rats and PPARβ/δ-null mice, also showed enhanced phospho-ERK1/2 levels. CONCLUSIONS—These findings indicate that activation of PPARβ/δ inhibits enhanced cytokine production in adipocytes by preventing NF-κB activation via ERK1/2, an effect that may help prevent insulin resistance. PMID:18443198
The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages
Daniel, Bence; Hah, Nasun; Horvath, Attila; Czimmerer, Zsolt; Poliska, Szilard; Gyuris, Tibor; Keirsse, Jiri; Gysemans, Conny; Van Ginderachter, Jo A.; Balint, Balint L.; Evans, Ronald M.; Barta, Endre; Nagy, Laszlo
2014-01-01
RXR signaling is predicted to have a major impact in macrophages, but neither the biological consequence nor the genomic basis of its ligand activation is known. Comprehensive genome-wide studies were carried out to map liganded RXR-mediated transcriptional changes, active binding sites, and cistromic interactions in the context of the macrophage genome architecture. The macrophage RXR cistrome has 5200 genomic binding sites, which are not impacted by ligand. Active enhancers are characterized by PU.1 binding, an increase of enhancer RNA, and P300 recruitment. Using these features, 387 liganded RXR-bound enhancers were linked to 226 genes, which predominantly reside in CTCF/cohesin-limited functional domains. These findings were molecularly validated using chromosome conformation capture (3C) and 3C combined with sequencing (3C-seq), and we show that selected long-range enhancers communicate with promoters via stable or RXR-induced loops and that some of the enhancers interact with each other, forming an interchromosomal network. A set of angiogenic genes, including Vegfa, has liganded RXR-controlled enhancers and provides the macrophage with a novel inducible program. PMID:25030696
Schmidt, A; Vogel, R; Holloway, M K; Rutledge, S J; Friedman, O; Yang, Z; Rodan, G A; Friedman, E
1999-09-10
LXR and PPAR receptors belong to the nuclear receptor superfamily of transcriptional activating factors. Using ligand-dependent transcription assays, we found that 5-tetradecyloxy-2-furancarboxylic acid (TOFA) transactivates chimeric receptors composed of the glucocorticoid receptor DNA binding domain and the ligand binding regions of PPARalpha, PPARbeta (NUC-1) and LXRbeta (NER) receptors. In the same assays, ligands for PPARs (oleic acid, WY-14643 and L-631,033) and LXRs (hydroxycholesterols) maintain their respective receptor selectivity. TOFA and hydroxycholesterols also stimulate transcription from a minimal fibrinogen promoter that is under the control of AP-1 or NF-kappaB transcription factor binding sites. In addition to their effects on transcription, these LXRbeta activators induce neuronal differentiation in rat pheochromocytoma cells. TOFA and the natural LXR agonist, 22 (R)-hydroxycholesterol, stimulate neurite outgrowth in 55 and 28% of cells, respectively. No neurite outgrowth was induced by the related 22(S)-hydroxycholesterol, which does not activate the LXR family. These results suggest that the hydroxycholesterol signaling pathway has a complex effect on transcription that mediates the activity of TOFA and hydroxycholesterol on neuronal differentiation in pheochromocytoma cells.
Schauwecker, Suzanne M; Kim, J Julie; Licht, Jonathan D; Clevenger, Charles V
2017-02-10
The hormone prolactin (PRL) contributes to breast cancer pathogenesis through various signaling pathways, one of the most notable being the JAK2/signal transducer and activator of transcription 5 (STAT5) pathway. PRL-induced activation of the transcription factor STAT5 results in the up-regulation of numerous genes implicated in breast cancer pathogenesis. However, the molecular mechanisms that enable STAT5 to access the promoters of these genes are not well understood. Here, we show that PRL signaling induces chromatin decompaction at promoter DNA, corresponding with STAT5 binding. The chromatin-modifying protein high mobility group nucleosomal binding domain 2 (HMGN2) specifically promotes STAT5 accessibility at promoter DNA by facilitating the dissociation of the linker histone H1 in response to PRL. Knockdown of H1 rescues the decrease in PRL-induced transcription following HMGN2 knockdown, and it does so by allowing increased STAT5 recruitment. Moreover, H1 and STAT5 are shown to function antagonistically in regulating PRL-induced transcription as well as breast cancer cell biology. While reduced STAT5 activation results in decreased PRL-induced transcription and cell proliferation, knockdown of H1 rescues both of these effects. Taken together, we elucidate a novel mechanism whereby the linker histone H1 prevents STAT5 binding at promoter DNA, and the PRL-induced dissociation of H1 mediated by HMGN2 is necessary to allow full STAT5 recruitment and promote the biological effects of PRL signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Schauwecker, Suzanne M.; Kim, J. Julie; Licht, Jonathan D.; Clevenger, Charles V.
2017-01-01
The hormone prolactin (PRL) contributes to breast cancer pathogenesis through various signaling pathways, one of the most notable being the JAK2/signal transducer and activator of transcription 5 (STAT5) pathway. PRL-induced activation of the transcription factor STAT5 results in the up-regulation of numerous genes implicated in breast cancer pathogenesis. However, the molecular mechanisms that enable STAT5 to access the promoters of these genes are not well understood. Here, we show that PRL signaling induces chromatin decompaction at promoter DNA, corresponding with STAT5 binding. The chromatin-modifying protein high mobility group nucleosomal binding domain 2 (HMGN2) specifically promotes STAT5 accessibility at promoter DNA by facilitating the dissociation of the linker histone H1 in response to PRL. Knockdown of H1 rescues the decrease in PRL-induced transcription following HMGN2 knockdown, and it does so by allowing increased STAT5 recruitment. Moreover, H1 and STAT5 are shown to function antagonistically in regulating PRL-induced transcription as well as breast cancer cell biology. While reduced STAT5 activation results in decreased PRL-induced transcription and cell proliferation, knockdown of H1 rescues both of these effects. Taken together, we elucidate a novel mechanism whereby the linker histone H1 prevents STAT5 binding at promoter DNA, and the PRL-induced dissociation of H1 mediated by HMGN2 is necessary to allow full STAT5 recruitment and promote the biological effects of PRL signaling. PMID:28035005
Gumy, Christel; Chandsawangbhuwana, Charlie; Dzyakanchuk, Anna A; Kratschmar, Denise V; Baker, Michael E; Odermatt, Alex
2008-01-01
Organotins are highly toxic and widely distributed environmental chemicals. Dibutyltin (DBT) is used as stabilizer in the production of polyvinyl chloride plastics, and it is also the major metabolite formed from tributyltin (TBT) in vivo. DBT is immunotoxic, however, the responsible targets remain to be defined. Due to the importance of glucocorticoids in immune-modulation, we investigated whether DBT could interfere with glucocorticoid receptor (GR) function. We used HEK-293 cells transiently transfected with human GR as well as rat H4IIE hepatoma cells and native human macrophages and human THP-1 macrophages expressing endogenous receptor to study organotin effects on GR function. Docking of organotins was used to investigate the binding mechanism. We found that nanomolar concentrations of DBT, but not other organotins tested, inhibit ligand binding to GR and its transcriptional activity. Docking analysis indicated that DBT inhibits GR activation allosterically by inserting into a site close to the steroid-binding pocket, which disrupts a key interaction between the A-ring of the glucocorticoid and the GR. DBT inhibited glucocorticoid-induced expression of phosphoenolpyruvate carboxykinase (PEPCK) and tyrosine-aminotransferase (TAT) and abolished the glucocorticoid-mediated transrepression of TNF-alpha-induced NF-kappaB activity. Moreover, DBT abrogated the glucocorticoid-mediated suppression of interleukin-6 (IL-6) and TNF-alpha production in lipopolysaccharide (LPS)-stimulated native human macrophages and human THP-1 macrophages. DBT inhibits ligand binding to GR and subsequent activation of the receptor. By blocking GR activation, DBT may disturb metabolic functions and modulation of the immune system, providing an explanation for some of the toxic effects of this organotin.
Ectopically tethered CP190 induces large-scale chromatin decondensation
NASA Astrophysics Data System (ADS)
Ahanger, Sajad H.; Günther, Katharina; Weth, Oliver; Bartkuhn, Marek; Bhonde, Ramesh R.; Shouche, Yogesh S.; Renkawitz, Rainer
2014-01-01
Insulator mediated alteration in higher-order chromatin and/or nucleosome organization is an important aspect of epigenetic gene regulation. Recent studies have suggested a key role for CP190 in such processes. In this study, we analysed the effects of ectopically tethered insulator factors on chromatin structure and found that CP190 induces large-scale decondensation when targeted to a condensed lacO array in mammalian and Drosophila cells. In contrast, dCTCF alone, is unable to cause such a decondensation, however, when CP190 is present, dCTCF recruits it to the lacO array and mediates chromatin unfolding. The CP190 induced opening of chromatin may not be correlated with transcriptional activation, as binding of CP190 does not enhance luciferase activity in reporter assays. We propose that CP190 may mediate histone modification and chromatin remodelling activity to induce an open chromatin state by its direct recruitment or targeting by a DNA binding factor such as dCTCF.
Choi, Shin Ae; Kim, Steven J; Chung, Kwang Chul
2006-10-02
Huntingtin interacting protein-1 (Hip1) is known to be associated with the N-terminal domain of huntingtin. Although Hip1 can induce apoptosis, the exact upstream signal transduction pathways have not been clarified yet. In the present study, we examined whether activation of intrinsic and/or extrinsic apoptotic pathways occurs during Hip1-mediated neuronal cell death. Overexpression of Hip1 induced cell death through caspase-3 activation in immortalized hippocampal neuroprogenitor cells. Interestingly, proteolytic processing of Hip1 into partial fragments was observed in response to Hip1 transfection and apoptosis-inducing drugs. Moreover, Hip1 was found to directly bind to and activate caspase-9. This promoted cytosolic release of cytochrome c and apoptosis-inducing factor via mitochondrial membrane perturbation. Furthermore, Hip1 could directly bind to Apaf-1, suggesting that the neurotoxic signals of Hip1 transmit through the intrinsic mitochondrial apoptotic pathways and the formation of apoptosome complex.
Nishigaki, Kazuo; Hanson, Charlotte; Ohashi, Takashi; Spadaccini, Angelo; Ruscetti, Sandra
2006-01-01
Infection of mice with Friend spleen focus-forming virus (SFFV) results in a multistage erythroleukemia. In the first stage, the SFFV envelope glycoprotein interacts with the erythropoietin receptor and a short form of the receptor tyrosine kinase sf-Stk, resulting in constitutive activation of signal transducing molecules and the development of erythropoietin (Epo)-independent erythroid hyperplasia and polycythemia. The second stage results from the outgrowth of a rare virus-infected erythroid cell that expresses nonphysiological levels of the myeloid transcription factor PU.1. These cells exhibit a differentiation block and can be grown as murine erythroleukemia (MEL) cell lines. In this study, we examined SFFV MEL cells to determine whether their transformed phenotype was associated with a block in the activation of any Epo signal-transducing molecules. Our studies indicate that Epo- or SFFV-induced activation of STAT1/3 DNA binding activity is blocked in SFFV MEL cells. The block is at the level of tyrosine phosphorylation of STAT1, although Jak2 phosphorylation is not blocked in these cells. In contrast to Epo, alpha interferon can induce STAT1 phosphorylation and DNA binding in SFFV MEL cells. The SFFV-transformed cells were shown to express elevated levels of the hematopoietic phosphatase SHP-1, and treatment of the cells with a phosphatase inhibitor restored STAT1 tyrosine phosphorylation. MEL cells derived from Friend murine leukemia virus (MuLV) or ME26 MuLV-infected mice, which do not express PU.1, express lower levels of SHP-1 and are not blocked in STAT1/3 DNA-binding activity. Our studies suggest that SFFV-infected erythroid cells become transformed when differentiation signals activated by STAT1/3 are blocked due to high SHP-1 levels induced by inappropriate expression of the PU.1 protein. PMID:16731906
Efavirenz directly modulates the oestrogen receptor and induces breast cancer cell growth.
Sikora, M J; Rae, J M; Johnson, M D; Desta, Z
2010-10-01
Efavirenz-based HIV therapy is associated with breast hypertrophy and gynaecomastia. Here, we tested the hypothesis that efavirenz induces gynaecomastia through direct binding and modulation of the oestrogen receptor (ER). To determine the effect of efavirenz on growth, the oestrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under oestrogen-free conditions in the presence or absence of the anti-oestrogen ICI 182,780. Cells treated with 17β-oestradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure the ER binding affinity of efavirenz. Efavirenz induced growth in MCF-7 cells with an estimated effective concentration for half-maximal growth (EC(50)) of 15.7 μM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to the ER [inhibitory concentration for half maximal binding (IC(50)) of ∼52 μM] at a roughly 1000-fold higher concentration than observed with 17β-oestradiol. Our data suggest that efavirenz-induced gynaecomastia may be caused, at least in part, by drug-induced ER activation in breast tissues.
Bonaterra, Gabriel A; Driscoll, David; Schwarzbach, Hans; Kinscherf, Ralf
2017-03-15
Parenteral nutrition is often a mandatory therapeutic strategy for cases of septicemia. Likewise, therapeutic application of anti-oxidants, anti-inflammatory therapy, and endotoxin lowering, by removal or inactivation, might be beneficial to ameliorate the systemic inflammatory response during the acute phases of critical illness. Concerning anti-inflammatory properties in this setting, omega-3 fatty acids of marine origin have been frequently described. This study investigated the anti-inflammatory and LPS-inactivating properties of krill oil (KO)-in-water emulsion in human macrophages in vitro. Differentiated THP-1 macrophages were activated using specific ultrapure-LPS that binds only on the toll-like receptor 4 (TLR4) in order to determine the inhibitory properties of the KO emulsion on the LPS-binding capacity, and the subsequent release of TNF-α. KO emulsion inhibited the macrophage binding of LPS to the TLR4 by 50% (at 12.5 µg/mL) and 75% (at 25 µg/mL), whereas, at 50 µg/mL, completely abolished the LPS binding. Moreover, KO (12.5 µg/mL, 25 µg/mL, or 50 µg/mL) also inhibited (30%, 40%, or 75%, respectively) the TNF-α release after activation with 0.01 µg/mL LPS in comparison with LPS treatment alone. KO emulsion influences the LPS-induced pro-inflammatory activation of macrophages, possibly due to inactivation of the LPS binding capacity.
FBI-1, a factor that binds to the HIV-1 inducer of short transcripts (IST), is a POZ domain protein.
Morrison, D J; Pendergrast, P S; Stavropoulos, P; Colmenares, S U; Kobayashi, R; Hernandez, N
1999-01-01
The HIV-1 promoter directs the synthesis of two classes of transcripts, short, non-polyadenylated transcripts and full-length, polyadenylated transcripts. The synthesis of short transcripts is activated by a bipartite DNA element, the inducer of short transcripts or IST, located downstream of the HIV-1 transcriptional start site, while the synthesis of full-length transcripts is activated by the viral activator Tat. Tat binds to the RNA element TAR, which is encoded largely between the two IST half-elements. Upon activation by Tat, the synthesis of short RNAs is repressed. We have previously purified a factor called FBI-1 (for factor that binds to IST) whose binding to wild-type and mutated ISTs correlated well with the abilities of these ISTs to direct the synthesis of short transcripts. Here, we report the cloning of cDNAs encoding FBI-1. FBI-1 contains a POZ domain at its N-terminus and four Krüppel-type zinc fingers at its C-terminus. The C-terminus is sufficient for specific binding, and FBI-1 can form homomers through its POZ domain and, in vivo, through its zinc finger domain as well. In addition, FBI-1 associates with Tat, suggesting that repression of the short transcripts by Tat may be mediated through interactions between the two factors. PMID:9973611
FBI-1, a factor that binds to the HIV-1 inducer of short transcripts (IST), is a POZ domain protein.
Morrison, D J; Pendergrast, P S; Stavropoulos, P; Colmenares, S U; Kobayashi, R; Hernandez, N
1999-03-01
The HIV-1 promoter directs the synthesis of two classes of transcripts, short, non-polyadenylated transcripts and full-length, polyadenylated transcripts. The synthesis of short transcripts is activated by a bipartite DNA element, the inducer of short transcripts or IST, located downstream of the HIV-1 transcriptional start site, while the synthesis of full-length transcripts is activated by the viral activator Tat. Tat binds to the RNA element TAR, which is encoded largely between the two IST half-elements. Upon activation by Tat, the synthesis of short RNAs is repressed. We have previously purified a factor called FBI-1 (for factor that binds to IST) whose binding to wild-type and mutated ISTs correlated well with the abilities of these ISTs to direct the synthesis of short transcripts. Here, we report the cloning of cDNAs encoding FBI-1. FBI-1 contains a POZ domain at its N-terminus and four Krüppel-type zinc fingers at its C-terminus. The C-terminus is sufficient for specific binding, and FBI-1 can form homomers through its POZ domain and, in vivo, through its zinc finger domain as well. In addition, FBI-1 associates with Tat, suggesting that repression of the short transcripts by Tat may be mediated through interactions between the two factors.
Ho, Hsu-Tso; Fan, Li; Nowicka-Sans, Beata; McAuliffe, Brian; Li, Chang-Ben; Yamanaka, Gregory; Zhou, Nannan; Fang, Hua; Dicker, Ira; Dalterio, Richard; Gong, Yi-Fei; Wang, Tao; Yin, Zhiwei; Ueda, Yasutsugu; Matiskella, John; Kadow, John; Clapham, Paul; Robinson, James; Colonno, Richard; Lin, Pin-Fang
2006-04-01
BMS-488043 is a small-molecule human immunodeficiency virus type 1 (HIV-1) CD4 attachment inhibitor with demonstrated clinical efficacy. The compound inhibits soluble CD4 (sCD4) binding to the 11 distinct HIV envelope gp120 proteins surveyed. Binding of BMS-488043 and that of sCD4 to gp120 are mutually exclusive, since increased concentrations of one can completely block the binding of the other without affecting the maximal gp120 binding capacity. Similarly, BMS-488043 inhibited virion envelope trimers from binding to sCD4-immunoglobulin G (IgG), with decreasing inhibition as the sCD4-IgG concentration increased, and BMS-488043 blocked the sCD4-induced exposure of the gp41 groove in virions. In both virion binding assays, BMS-488043 was active only when added prior to sCD4. Collectively, these results indicate that obstruction of gp120-sCD4 interactions is the primary inhibition mechanism of this compound and that compound interaction with envelope must precede CD4 binding. By three independent approaches, BMS-488043 was further shown to induce conformational changes within gp120 in both the CD4 and CCR5 binding regions. These changes likely prevent gp120-CD4 interactions and downstream entry events. However, BMS-488043 could only partially inhibit CD4 binding to an HIV variant containing a specific envelope truncation and altered gp120 conformation, despite effectively inhibiting the pseudotyped virus infection. Taken together, BMS-488043 inhibits viral entry primarily through altering the envelope conformation and preventing CD4 binding, and other downstream entry events could also be inhibited as a result of these induced conformational changes.
Ionic regulation of the cardiac sodium-calcium exchanger.
Reeves, John P; Condrescu, Madalina
2008-01-01
The Na(+)-Ca(2+) exchanger (NCX) links transmembrane movements of Ca(2+) ions to the reciprocal movement of Na(+) ions. It normally functions primarily as a Ca(2+) efflux mechanism in excitable tissues such as the heart, but it can also mediate Ca(2+) influx under certain conditions. Na(+) and Ca(2+) ions exert complex regulatory effects on NCX activity. Ca(2+) binds to two regulatory sites in the exchanger's central hydrophilic domain, and this interaction is normally essential for activation of exchange activity. High cytosolic Na(+) concentrations, however, can induce a constitutive activity that by-passes the need for allosteric Ca(2+) activation. Constitutive NCX activity can also be induced by high levels of phopshotidylinositol-4,5-bisphosphate (PIP₂) and by mutations affecting the regulatory calcium binding domains. In addition to promoting constitutive activity, high cytosolic Na(+) concentrations also induce an inactivated state of the exchanger (Na(+)-dependent inactivation) that becomes dominant when cytosolic pH and PIP₂ levels fall. Na(+)-dependent inactivation may provide a means of protecting cells from Ca(2+) overload due to NCX-mediated Ca(2+) influx during ischemia.
Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.
2012-01-01
IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yue-Ming; Lin, Wenwei; Chai, Sergio C.
2013-10-01
Activation of the pregnane X receptor (PXR) and subsequently its target genes, including those encoding drug transporters and metabolizing enzymes, while playing substantial roles in xenobiotic detoxification, might cause undesired drug-drug interactions. Recently, an increased awareness has been given to dietary components for potential induction of diet–drug interactions through activation of PXR. Here, we studied, whether piperine (PIP), a major component extracted from the widely-used daily spice black pepper, could induce PXR-mediated expression of cytochrome P450 3A4 (CYP3A4) and multidrug resistance protein 1 (MDR1). Our results showed that PIP activated human PXR (hPXR)-mediated CYP3A4 and MDR1 expression in human hepatocytes,more » intestine cells, and a mouse model; PIP activated hPXR by recruiting its coactivator SRC-1 in both cellular and cell-free systems; PIP bound to the hPXR ligand binding domain in a competitive ligand binding assay in vitro. The dichotomous effects of PIP on induction of CYP3A4 and MDR1 expression observed here and inhibition of their activity reported elsewhere challenges the potential use of PIP as a bioavailability enhancer and suggests that caution should be taken in PIP consumption during drug treatment in patients, particularly those who favor daily pepper spice or rely on certain pepper remedies. - Highlights: • Piperine induces PXR-mediated CYP3A4 and MDR1 expression. • Piperine activates PXR by binding to PXR and recruiting coactivator SRC-1. • Piperine induces PXR activation in vivo. • Caution should be taken in piperine consumption during drug treatment.« less
Involvement of estrogen receptor variant ER-alpha36, not GPR30, in nongenomic estrogen signaling.
Kang, Lianguo; Zhang, Xintian; Xie, Yan; Tu, Yaping; Wang, Dong; Liu, Zhenming; Wang, Zhao-Yi
2010-04-01
Accumulating evidence suggested that an orphan G protein-coupled receptor (GPR)30, mediates nongenomic responses to estrogen. The present study was performed to investigate the molecular mechanisms underlying GPR30 function. We found that knockdown of GPR30 expression in breast cancer SK-BR-3 cells down-regulated the expression levels of estrogen receptor (ER)-alpha36, a variant of ER-alpha. Introduction of a GPR30 expression vector into GPR30 nonexpressing cells induced endogenous ER-alpha36 expression, and cotransfection assay demonstrated that GPR30 activated the promoter activity of ER-alpha36 via an activator protein 1 binding site. Both 17beta-estradiol (E2) and G1, a compound reported to be a selective GPR30 agonist, increased the phosphorylation levels of the MAPK/ERK1/2 in SK-BR-3 cells, which could be blocked by an anti-ER-alpha36-specific antibody against its ligand-binding domain. G1 induced activities mediated by ER-alpha36, such as transcription activation activity of a VP16-ER-alpha36 fusion protein and activation of the MAPK/ERK1/2 in ER-alpha36-expressing cells. ER-alpha36-expressing cells, but not the nonexpressing cells, displayed high-affinity, specific E2 and G1 binding, and E2- and G1-induced intracellular Ca(2+) mobilization only in ER-alpha36 expressing cells. Taken together, our results demonstrated that previously reported activities of GPR30 in response to estrogen were through its ability to induce ER-alpha36 expression. The selective G protein-coupled receptor (GPR)30 agonist G1 actually interacts with ER-alpha36. Thus, the ER-alpha variant ER-alpha36, not GPR30, is involved in nongenomic estrogen signaling.
Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Lee, Kyoung-Tae; Choi, Yung Hyun; Moon, Sung-Kwon; Kim, Wun-Jae; Kim, Gi-Young
2015-10-01
Although acetylshikonin (ACS) is known to have antioxidant and antitumor activities, whether ACS regulates the expression of proinflammatory mediators in lipopolysaccharide (LPS)-stimulated microglial cells remains unclear. In this study, it was found that ACS isolated from Lithospermum erythrorhizon inhibits LPS-induced nitric oxide (NO) and prostaglandin E2 (PGE2) release by suppressing the expression of inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2) in BV2 microglial cells. Furthermore, ACS reduced the LPS-induced DNA-binding activity of nuclear factor-κB (NF-κB) and subsequently suppressed iNOS and COX-2 expression. Consistent with these data, ACS attenuated the phosphorylation of PI3K and Akt and suppressed the DNA-binding activity of NF-κB by inducing the generation of reactive oxygen species (ROS) in LPS-stimulated cells. In addition, ACS enhanced heme oxygenase-1 (HO-1) expression via nuclear factor-erythroid 2-related factor 2 (Nrf2) activation. Zinc protoporphyrin, a specific HO-1 inhibitor, partially attenuated the antagonistic effects of ACS on LPS-induced NO and PGE2 production. By contrast, the presence of cobalt protoporphyrin, a specific HO-1 inducer, potently suppressed LPS-induced NO and PGE2 production. These data indicate that ACS downregulates proinflammatory mediators such as NO and PGE2 by suppressing PI3K/Akt-dependent NF-κB activity induced by ROS as well as inducing Nrf2-dependent HO-1 activity. Taken together, ACS might be a good candidate to regulate LPS-mediated inflammatory diseases.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oberdisse, E.; Lapetina, E.G.
1987-05-14
Guanosine 5'-O-thiotriphosphate (GTP gamma S) and thrombin stimulate the activity of phospholipase C in platelets that have been permeabilized with saponin and whose inositol phospholipids have been prelabeled with (/sup 3/H)inositol. Ca/sup 2 +/ has opposite effects on the formation of (/sup 3/H)inositol phosphates induced by thrombin or GTP gamma S. While the action of GTP gamma S on the formation of (/sup 3/H)inositol phosphates is inhibited by Ca/sup 2 +/, action of thrombin is stimulated by Ca/sup 2 +/. Guanosine 5'-O-(2-thiodiphosphate) (GDP beta S), which inhibits the function of GTP-binding proteins, also inhibits the effect of GTP gamma Smore » on phospholipase C stimulation but, surprisingly, increases the effect of thrombin. Ca/sup 2 +/ increases the inhibitory effect of GDP beta S on GTP gamma S activation of phospholipase C, but Ca/sup 2 +/ further enhances the stimulatory effect of GDP beta S on the thrombin activation of phospholipase C. This indicates that two mechanisms are responsible for the activation of phospholipase C in platelets. A GTP-binding protein is responsible for regulation of phospholipase C induced by GTP gamma S, while the effect of thrombin on the stimulation of phospholipase C is independent of GTP-binding proteins. However, the effect of thrombin may be modulated by the action of an inhibitory GTP-binding protein.« less
Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene
2015-10-15
Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chen, Rui; Xu, Min; Hogg, Richard T.; Li, Jiwen; Little, Bertis; Gerard, Robert D.; Garcia, Joseph A.
2012-01-01
Hypoxia-inducible factors (HIFs) are oxygen-sensitive transcription factors. HIF-1α plays a prominent role in hypoxic gene induction. HIF-2α target genes are more restricted but include erythropoietin (Epo), one of the most highly hypoxia-inducible genes in mammals. We previously reported that HIF-2α is acetylated during hypoxia but is rapidly deacetylated by the stress-responsive deacetylase Sirtuin 1. We now demonstrate that the lysine acetyltransferases cAMP-response element-binding protein-binding protein (CBP) and p300 are required for efficient Epo induction during hypoxia. However, despite close structural similarity, the roles of CBP and p300 differ in HIF signaling. CBP acetylates HIF-2α, is a major coactivator for HIF-2-mediated Epo induction, and is required for Sirt1 augmentation of HIF-2 signaling during hypoxia in Hep3B cells. In comparison, p300 is a major contributor for HIF-1 signaling as indicated by induction of Pgk1. Whereas CBP can bind with HIF-2α independent of the HIF-2α C-terminal activation domain via enzyme/substrate interactions, p300 only complexes with HIF-2α through the C-terminal activation domain. Maximal CBP/HIF-2 signaling requires intact CBP acetyltransferase activity in both Hep3B cells as well as in mice. PMID:22807441
Khan, Mohammad Imran; Adhami, Vaqar Mustafa; Lall, Rahul Kumar; Sechi, Mario; Joshi, Dinesh C.; Haidar, Omar M.; Syed, Deeba Nadeem; Siddiqui, Imtiaz Ahmad; Chiu, Shing-Yan; Mukhtar, Hasan
2014-01-01
Epithelial-to-mesenchymal transition (EMT) plays an important role in prostate cancer (PCa) metastasis. The transcription/translation regulatory Y-box binding protein-1 (YB-1) is known to be associated with cancer metastasis. We observed that YB-1 expression increased with tumor grade and showed an inverse relationship with E-cadherin in a human PCa tissue array. Forced YB-1 expression induced a mesenchymal morphology that was associated with down regulation of epithelial markers. Silencing of YB-1 reversed mesenchymal features and decreased cell proliferation, migration and invasion in PCa cells. YB-1 is activated directly via Akt mediated phosphorylation at Ser102 within the cold shock domain (CSD). We next identified fisetin as an inhibitor of YB-1 activation. Computational docking and molecular dynamics suggested that fisetin binds on the residues from β1 - β4 strands of CSD, hindering Akt's interaction with YB-1. Calculated free binding energy ranged from −11.9845 to −9.6273 kcal/mol. Plasmon Surface Resonance studies showed that fisetin binds to YB-1 with an affinity of approximately 35 μM, with both slow association and dissociation. Fisetin also inhibited EGF induced YB-1 phosphorylation and markers of EMT both in vitro and in vivo. Collectively our data suggest that YB-1 induces EMT in PCa and identify fisetin as an inhibitor of its activation. PMID:24770864
Saito, Kosuke; Moore, Rick; Negishi, Masahiko
2013-03-01
KCNK1, a member of the family of two-pore K(+) ion channels, is specifically induced in the livers of male mice after phenobarbital treatment. Here, we have determined the molecular mechanism of this male-specific activation of the Kcnk1 gene and characterized KCNK1 as a phenobarbital-inducible antihyperplasia factor. Upon activation by phenobarbital, nuclear receptor CAR binds the 97-bp response element (-2441/-2345) within the Kcnk1 promoter. This binding is observed in the livers of male mice, but not in the livers of female mice and requires the pituitary gland, because hypophysectomy abrogates it. Hyperplasia further progressed in the livers of Kcnk1 ( -/- ) male mice compared with those of Kcnk1 ( +/+ ) males after phenobarbital treatment. Thus, KCNK1 suppresses phenobarbital-induced hyperplasia. These results indicate that phenobarbital treatment induces KCNK1 to elicit a male-specific and growth-suppressing signal. Thus, KCNK1 and Kcnk1 ( -/- ) mice provide an experimental tool for further investigation into the molecular mechanism of CAR-mediated promotion of the development of hepatocellular carcinoma in mice.
Bettridge, John; Na, Chan Hyun; Desiderio, Stephen
2017-01-01
V(D)J recombination is initiated by the recombination-activating gene (RAG) recombinase, consisting of RAG-1 and RAG-2 subunits. The susceptibility of gene segments to cleavage by RAG is associated with histone modifications characteristic of active chromatin, including trimethylation of histone H3 at lysine 4 (H3K4me3). Binding of H3K4me3 by a plant homeodomain (PHD) in RAG-2 stimulates substrate binding and catalysis, which are functions of RAG-1. This has suggested an allosteric mechanism in which information regarding occupancy of the RAG-2 PHD is transmitted to RAG-1. To determine whether the conformational distribution of RAG is altered by H3K4me3, we mapped changes in solvent accessibility of cysteine thiols by differential isotopic chemical footprinting. Binding of H3K4me3 to the RAG-2 PHD induces conformational changes in RAG-1 within a DNA-binding domain and in the ZnH2 domain, which acts as a scaffold for the catalytic center. Thus, engagement of H3K4me3 by the RAG-2 PHD is associated with dynamic conformational changes in RAG-1, consistent with allosteric control by active chromatin. PMID:28174273
RNA-binding proteins regulate the expression of the immune activating ligand MICB
Nachmani, Daphna; Gutschner, Tony; Reches, Adi
2014-01-01
The recognition of stress-induced ligands by the activating receptor NKG2D expressed on cytotoxic lymphocytes is crucial for the prevention and containment of various diseases and is also one of the best-studied examples of how danger is sensed by the immune system. Still, however, the mechanisms leading to the expression of the NKG2D ligands are far from being completely understood. Here, we use an unbiased and systematic RNA pull-down approach combined with mass spectrometry to identify six RNA-binding proteins (RBPs) that bind and regulate the expression of MICB, one of the major stress-induced ligands of NKG2D. We further demonstrate that at least two of the identified RBPs function during genotoxic stress. Our data provide insights into stress recognition and hopefully open new therapeutic venues. PMID:24924487
Muñoz, Yenny; Garrido, Argelia; Valladares, Luis
2009-03-01
Several dietary intervention studies examining the health effect of soy isoflavones allude to the importance of equol in establishing the cardiovascular response to soy protein. Although, the specific mechanism by which this action occurs has not been established. The aim of this study was to investigate the inhibitory effect of soy-isoflavones and the metabolite of daidzein, equol, on agonist-induced platelet responses dependent on thromboxane A(2) (TxA(2)) receptor. Competitive radioligand binding assay was used to screen for affinity of these compounds to the TxA(2) receptor. The effect of equol on platelet activation, evaluate through of release of the ATP, by analogs of TxA(2) was analyzed. The effect of equol on platelet aggregation was investigated with ADP, U46619 (a TxA(2) mimic) and the calcium ionophore A23187. The data showed that aglycone isoflavones and equol bind to TxA(2) receptor in the micromol/L range, whereas their glucoside derivates had very low binding activity for this receptor. Under equilibrium conditions, the following order of the relative affinity in inhibiting [(3)H]-SQ29585 binding was: equol>genistein>daidzein>glycitein>genistin, daidzin, glycitin. Equol interaction was reversible and competitive for labeled-SQ29548 with not apparent decrease in the number of TxA(2) binding sites. In addition, from platelet activation studies, equol effectively inhibited ATP secretion elicited by the TxA(2) analog U46619. On the other hand, equol inhibited the platelet aggregation induced by U46619 and A23187, while it failed to inhibit that induced by ADP. The aglycone isoflavones from soy, and particularly equol, have been found to have biological effects attributable to thromboxane A(2) receptor antagonism. These findings may help elucidate how dietary isoflavone modulate platelet function and explain why soy-rich foods are claimed to have beneficial effects in the prevention of thrombotic events.
Smith, M R; Greene, W C
1991-01-01
The Tax oncoprotein of the type I human T cell leukemia virus (HTLV-I) activates transcription of cellular and viral genes through at least two different transcription factor pathways. Tax activates transcription of the c-fos proto-oncogene by a mechanism that appears to involve members of the cAMP response element binding protein (CREB) and activating transcription factor (ATF) family of DNA-binding proteins. Tax also induces the nuclear expression of the NF-kappa B family of rel oncogene-related enhancer-binding proteins. We have investigated the potential role of these CREB/ATF and NF-kappa B/Rel transcription factors in Tax-mediated transformation by analyzing the oncogenic potential of Tax mutants that functionally segregate these two pathways of transactivation. Rat fibroblasts (Rat2) stably expressing either the wild-type Tax protein or a Tax mutant selectively deficient in the ability to induce NF-kappa B/Rel demonstrated marked changes in morphology and growth characteristics including the ability to form tumors in athymic mice. In contrast, Rat2 cells stably expressing a Tax mutant selectively deficient in the ability to activate transcription through CREB/ATF demonstrated no detectable changes in morphology or growth characteristics. These results suggest that transcriptional activation through the CREB/ATF pathway may play an important role in Tax-mediated cellular transformation. Images PMID:1832173
NASA Astrophysics Data System (ADS)
Saavedra-Vélez, Margarita Virginia; Correa-Basurto, José; Matus, Myrna H.; Gasca-Pérez, Eloy; Bello, Martiniano; Cuevas-Hernández, Roberto; García-Rodríguez, Rosa Virginia; Trujillo-Ferrara, José; Ramos-Morales, Fernando Rafael
2014-12-01
The aim of this study was to identify compounds that possess anticonvulsant activity by using a pentylenetetrazol (PTZ)-induced seizure model. Theoretical studies of a set of ligands, explored the binding affinities of the ligands for the GABAA receptor (GABAAR), including some benzodiazepines. The ligands satisfy the Lipinski rules and contain a pharmacophore core that has been previously reported to be a GABAAR activator. To select the ligands with the best physicochemical properties, all of the compounds were analyzed by quantum mechanics and the energies of the highest occupied molecular orbital and lowest unoccupied molecular orbital were determined. Docking calculations between the ligands and the GABAAR were used to identify the complexes with the highest Gibbs binding energies. The identified compound D1 (dibenzo( b,f)(1,4)diazocine-6,11(5H,12H)-dione) was synthesized, experimentally tested, and the GABAAR-D1 complex was submitted to 12-ns-long molecular dynamics (MD) simulations to corroborate the binding conformation obtained by docking techniques. MD simulations were also used to analyze the decomposition of the Gibbs binding energy of the residues involved in the stabilization of the complex. To validate our theoretical results, molecular docking and MD simulations were also performed for three reference compounds that are currently in commercial use: clonazepam (CLZ), zolpidem and eszopiclone. The theoretical results show that the GABAAR-D1, and GABAAR-CLZ complexes bind to the benzodiazepine binding site, share a similar map of binding residues, and have similar Gibbs binding energies and entropic components. Experimental studies using a PTZ-induced seizure model showed that D1 possesses similar activity to CLZ, which corroborates the predicted binding free energy identified by theoretical calculations.
Matsubara, Naoko; Imamura, Akihiro; Yonemizu, Tatsuya; Akatsu, Chizuru; Yang, Hongrui; Ueki, Akiharu; Watanabe, Natsuki; Abdu-Allah, Hajjaj; Numoto, Nobutaka; Takematsu, Hiromu; Kitazume, Shinobu; Tedder, Thomas F.; Marth, Jamey D.; Ito, Nobutoshi; Ando, Hiromune; Ishida, Hideharu; Kiso, Makoto; Tsubata, Takeshi
2018-01-01
Sialic acid-binding immunoglobulin-like lectins (Siglecs) are expressed in various immune cells and most of them carry signaling functions. High-affinity synthetic sialoside ligands have been developed for various Siglecs. Therapeutic potentials of the nanoparticles and compounds that contain multiple numbers of these sialosides and other reagents such as toxins and antigens have been demonstrated. However, whether immune responses can be regulated by monomeric sialoside ligands has not yet been known. CD22 (also known as Siglec-2) is an inhibitory molecule preferentially expressed in B lymphocytes (B cells) and is constitutively bound and functionally regulated by α2,6 sialic acids expressed on the same cell (cis-ligands). Here, we developed synthetic sialosides GSC718 and GSC839 that bind to CD22 with high affinity (IC50 ~100 nM), and inhibit ligand binding of CD22. When B cells are activated by B cell antigen receptor (BCR) ligation, both GSC718 and GSC839 downregulate proliferation of B cells, and this regulation requires both CD22 and α2,6 sialic acids. This result suggests that these sialosides regulate BCR ligation-induced B cell activation by reversing endogenous ligand-mediated regulation of CD22. By contrast, GSC718 and GSC839 augment B cell proliferation induced by TLR ligands or CD40 ligation, and this augmentation requires CD22 but not α2,6 sialic acids. Thus, these sialosides appear to enhance B cell activation by directly suppressing the inhibitory function of CD22 independently of endogenous ligand-mediated regulation. Moreover, GSC839 augments B cell proliferation that depends on both BCR ligation and CD40 ligation as is the case for in vivo B cell responses to antigens, and enhanced antibody production to the extent comparable to CpG oligonuleotides or a small amount of alum. Although these known adjuvants induce production of the inflammatory cytokines or accumulation of inflammatory cells, CD22-binding sialosides do not. Thus, synthetic sialosides that bind to CD22 with high-affinity modulate B cell activation through endogenous ligand-dependent and independent pathways, and carry an adjuvant activity without inducing inflammation. PMID:29725338
Matsubara, Naoko; Imamura, Akihiro; Yonemizu, Tatsuya; Akatsu, Chizuru; Yang, Hongrui; Ueki, Akiharu; Watanabe, Natsuki; Abdu-Allah, Hajjaj; Numoto, Nobutaka; Takematsu, Hiromu; Kitazume, Shinobu; Tedder, Thomas F; Marth, Jamey D; Ito, Nobutoshi; Ando, Hiromune; Ishida, Hideharu; Kiso, Makoto; Tsubata, Takeshi
2018-01-01
Sialic acid-binding immunoglobulin-like lectins (Siglecs) are expressed in various immune cells and most of them carry signaling functions. High-affinity synthetic sialoside ligands have been developed for various Siglecs. Therapeutic potentials of the nanoparticles and compounds that contain multiple numbers of these sialosides and other reagents such as toxins and antigens have been demonstrated. However, whether immune responses can be regulated by monomeric sialoside ligands has not yet been known. CD22 (also known as Siglec-2) is an inhibitory molecule preferentially expressed in B lymphocytes (B cells) and is constitutively bound and functionally regulated by α2,6 sialic acids expressed on the same cell (cis-ligands). Here, we developed synthetic sialosides GSC718 and GSC839 that bind to CD22 with high affinity (IC 50 ~100 nM), and inhibit ligand binding of CD22. When B cells are activated by B cell antigen receptor (BCR) ligation, both GSC718 and GSC839 downregulate proliferation of B cells, and this regulation requires both CD22 and α2,6 sialic acids. This result suggests that these sialosides regulate BCR ligation-induced B cell activation by reversing endogenous ligand-mediated regulation of CD22. By contrast, GSC718 and GSC839 augment B cell proliferation induced by TLR ligands or CD40 ligation, and this augmentation requires CD22 but not α2,6 sialic acids. Thus, these sialosides appear to enhance B cell activation by directly suppressing the inhibitory function of CD22 independently of endogenous ligand-mediated regulation. Moreover, GSC839 augments B cell proliferation that depends on both BCR ligation and CD40 ligation as is the case for in vivo B cell responses to antigens, and enhanced antibody production to the extent comparable to CpG oligonuleotides or a small amount of alum. Although these known adjuvants induce production of the inflammatory cytokines or accumulation of inflammatory cells, CD22-binding sialosides do not. Thus, synthetic sialosides that bind to CD22 with high-affinity modulate B cell activation through endogenous ligand-dependent and independent pathways, and carry an adjuvant activity without inducing inflammation.
Hiramatsu, Hirotsugu; Takeuchi, Katsuyuki; Takeuchi, Hideo
2013-04-02
The pH dependence of the β-galactoside binding activity of human galectin-1 (hGal-1) was investigated by fluorescence spectroscopy using lactose as a ligand. The obtained binding constant Kb was 2.94 ± 0.10 mM(-1) at pH 7.5. The Kb value decreased at acidic pH with a midpoint of transition at pH 6.0 ± 0.1. To elucidate the molecular mechanism of the pH dependence, we investigated the structures of hGal-1 and its two His mutants (H44Q and H52Q) using fluorescence, circular dichroism, UV absorption, and UV resonance Raman spectroscopy. Analysis of the spectra has shown that the pKa values of His44 and His52 are 5.7 ± 0.2 and 6.3 ± 0.1, respectively. The protonation of His52 below pH 6.3 induces a small change in secondary structure and partly reduces the galactoside binding activity. On the other hand, the protonation of His44 below pH 5.7 exerts a cation-π interaction with Trp68 and largely diminishes the galactoside binding activity. With reference to the literature X-ray structures at pH 7.0 and 5.6, protonated His52 is proposed to move slightly away from the galactoside-binding region with a partial unfolding of the β-strand containing His52. On the other hand, protonated His44 becomes unable to form a hydrogen bond with galactoside and additionally induces a reorientation and/or displacement of Trp68 through cation-π interaction, leading to a loosening of the galactoside-binding pocket. These structural changes associated with His protonation are likely to be the origin of the pH dependence of the galactoside binding activity of hGal-1.
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather; ...
2017-10-30
Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt‐Middleton, Heather; Hillson, Nathan J.; Deutsch, Samuel; Keasling, Jay D.
2017-01-01
Abstract Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain. PMID:29084380
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather
Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less
Reverse Induced Fit-Driven MAS-Downstream Transduction: Looking for Metabotropic Agonists.
Pernomian, Larissa; Gomes, Mayara S; de Paula da Silva, Carlos H Tomich; Rosa, Joaquin M C
2017-01-01
Protective effects of MAS activation have spurred clinical interests in developing MAS agonists. However, current bases that drive this process preclude that physiological concentrations of peptide MAS agonists induce an atypical signaling that does not reach the metabotropic efficacy of constitutive activation. Canonical activation of MAS-coupled G proteins is only achieved by supraphysiological concentrations of peptide MAS agonists or physiological concentrations of chemically modified analogues. These pleiotropic differences are because of two overlapped binding domains: one non-metabotropic site that recognizes peptide agonists and one metabotropic domain that recognizes modified analogues. It is feasible that supraphysiological concentrations of peptide MAS agonists undergo to chemical modifications required for binding to metabotropic domain. Receptor oligomerization enhances pharmacological parameters coupled to metabotropic signaling. The formation of receptor-signalosome complex makes the transduction of agonists more adaptive. Considering the recent identification of MAS-signalosome, we aimed to postulate the reverse induced fit hypothesis in which MAS-signalosome would trigger chemical modifications required for agonists bind to MAS metabotropic domain. Here we cover rational perspectives for developing novel metabotropic MAS agonists in the view of the reverse induced-fit hypothesis. Predicting a 3D model of MAS metabotropic domain may guide the screening of chemical modifications required for metabotropic efficacy. Pharmacophore-based virtual screening would select potential metabotropic MAS agonists from virtual libraries from human proteome. Rational perspectives that consider reverse induced fit hypothesis during MAS activation for developing metabotropic MAS agonists represents the best approach in providing MAS ligands with constitutive efficacy at physiological concentrations. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Sidorova, Yulia A; Perepechaeva, Maria L; Pivovarova, Elena N; Markel, Arkady L; Lyakhovich, Vyacheslav V; Grishanova, Alevtina Y
2016-01-01
Oxidative reactions that are catalyzed by cytochromes P450 1A (CYP1A) lead to formation of carcinogenic derivatives of arylamines and polycyclic aromatic hydrocarbons (PAHs), such as the widespread environmental pollutant benzo(α)pyrene (BP). These compounds upregulate CYP1A at the transcriptional level via an arylhydrocarbon receptor (AhR)-dependent signaling pathway. Because of the involvement of AhR-dependent genes in chemically induced carcinogenesis, suppression of this signaling pathway could prevent tumor formation and/or progression. Here we show that menadione (a water-soluble analog of vitamin K3) inhibits BP-induced expression and enzymatic activity of both CYP1A1 and CYP1A2 in vivo (in the rat liver) and BP-induced activity of CYP1A1 in vitro. Coadministration of BP and menadione reduced DNA-binding activity of AhR and increased DNA-binding activity of transcription factors Oct-1 and CCAAT/enhancer binding protein (C/EBP), which are known to be involved in negative regulation of AhR-dependent genes, in vivo. Expression of another factor involved in downregulation of CYP1A-pAhR repressor (AhRR)-was lower in the liver of the rats treated with BP and menadione, indicating that the inhibitory effect of menadione on CYP1A is not mediated by this protein. Furthermore, menadione was well tolerated by the animals: no signs of acute toxicity were detected by visual examination or by assessment of weight gain dynamics or liver function. Taken together, our results suggest that menadione can be used in further studies on animal models of chemically induced carcinogenesis because menadione may suppress tumor formation and possibly progression.
Pivovarova, Elena N.; Markel, Arkady L.; Lyakhovich, Vyacheslav V.; Grishanova, Alevtina Y.
2016-01-01
Oxidative reactions that are catalyzed by cytochromes P450 1A (CYP1A) lead to formation of carcinogenic derivatives of arylamines and polycyclic aromatic hydrocarbons (PAHs), such as the widespread environmental pollutant benzo(α)pyrene (BP). These compounds upregulate CYP1A at the transcriptional level via an arylhydrocarbon receptor (AhR)-dependent signaling pathway. Because of the involvement of AhR-dependent genes in chemically induced carcinogenesis, suppression of this signaling pathway could prevent tumor formation and/or progression. Here we show that menadione (a water-soluble analog of vitamin K3) inhibits BP-induced expression and enzymatic activity of both CYP1A1 and CYP1A2 in vivo (in the rat liver) and BP-induced activity of CYP1A1 in vitro. Coadministration of BP and menadione reduced DNA-binding activity of AhR and increased DNA-binding activity of transcription factors Oct-1 and CCAAT/enhancer binding protein (C/EBP), which are known to be involved in negative regulation of AhR-dependent genes, in vivo. Expression of another factor involved in downregulation of CYP1A—pAhR repressor (AhRR)—was lower in the liver of the rats treated with BP and menadione, indicating that the inhibitory effect of menadione on CYP1A is not mediated by this protein. Furthermore, menadione was well tolerated by the animals: no signs of acute toxicity were detected by visual examination or by assessment of weight gain dynamics or liver function. Taken together, our results suggest that menadione can be used in further studies on animal models of chemically induced carcinogenesis because menadione may suppress tumor formation and possibly progression. PMID:27167070
Burk, O; Piedade, R; Ghebreghiorghis, L; Fait, JT; Nussler, AK; Gil, JP; Windshügel, B; Schwab, M
2012-01-01
BACKGROUND AND PURPOSE Widespread resistance to antimalarial drugs requires combination therapies with increasing risk of pharmacokinetic drug–drug interactions. Here, we explore the capacity of antimalarial drugs to induce drug metabolism via activation of constitutive androstane receptors (CAR) by ligand binding. EXPERIMENTAL APPROACH A total of 21 selected antimalarials and 11 major metabolites were screened for binding to CAR isoforms using cellular and in vitro CAR-coactivator interaction assays, combined with in silico molecular docking. Identified ligands were further characterized by cell-based assays and primary human hepatocytes were used to elucidate induction of gene expression. KEY RESULTS Only two artemisinin derivatives arteether and artemether, the metabolite deoxyartemisinin and artemisinin itself demonstrated agonist binding to the major isoforms CAR1 and CAR3, while arteether and artemether were also inverse agonists of CAR2. Dihydroartemisinin and artesunate acted as weak inverse agonists of CAR1. While arteether showed the highest activities in vitro, it was less active than artemisinin in inducing hepatic CYP3A4 gene expression in hepatocytes. CONCLUSIONS AND IMPLICATIONS Artemisinin derivatives and metabolites differentially affect the activities of CAR isoforms and of the pregnane X receptor (PXR). This negates a common effect of these drugs on CAR/PXR-dependent induction of drug metabolism and further provides an explanation for artemisinin consistently inducing cytochrome P450 genes in vivo, whereas arteether and artemether do not. All these drugs are metabolized very rapidly, but only artemisinin is converted to an enzyme-inducing metabolite. For better understanding of pharmacokinetic drug–drug interaction possibilities, the inducing properties of artemisinin metabolites should be considered. PMID:22577882
Laskar, Amaj A; Khan, Masood A; Rahmani, Arshad H; Fatima, Sana; Younus, Hina
2016-08-01
Some reports indicate that thymoquinone (TQ), the main constituent of Nigella sativa seeds, is hepatoprotective. The aim of this study was to determine whether TQ is able to bind directly to bilirubin, and whether TQ or liposomal formulation of TQ (Lip-TQ) can reduce cyclophosphamide (CYP)-induced liver toxicity, serum bilirubin level in mice. The binding of TQ with bilirubin was studied by UV-VIS, fluorescence and Near-UV CD spectroscopy. Inhibition of binding of bilirubin to erythrocytes by TQ was also examined. To increase the in vivo efficacy, Lip-TQ was prepared and used against CYP-induced toxicity. The protective role of TQ or Lip-TQ against CYP-induced toxicity was assessed by determining the liver function parameters, the levels of superoxide dismutase (SOD) and catalase (CAT), and histological studies. It was found that TQ binds to bilirubin and significantly inhibits the binding of bilirubin to erythrocytes. Lip-TQ (10 mg/kg) significantly reduced the levels of aspartate transaminase (AST) from 254 ± 48 to 66 ± 18 IU/L (P < 0.001), alanine transaminase (ALT) from 142 ± 28 to 47.8 ± 16 IU/L (P < 0.05) and serum bilirubin from 2.8 ± 0.50 to 1.24 ± 0.30 mg/dl (P < 0.05). Treatment with Lip-TQ reduced the CYP-induced inflammation and hemorrhage in liver tissues. Moreover, treatment with free or Lip-TQ protected the activity of SOD and CAT in CYP-injected mice. Therefore, TQ can reduce the level of bilirubin in systemic circulation in disease conditions that lead to hyperbilirubinemia and liver toxicity and hence may be used as a supplement in the treatment of liver ailments. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Ribosomal proteins L5 and L11 co-operatively inactivate c-Myc via RNA-induced silencing complex.
Liao, J-M; Zhou, X; Gatignol, A; Lu, H
2014-10-09
Oncogene MYC is highly expressed in many human cancers and functions as a global regulator of ribosome biogenesis. Previously, we reported that ribosomal protein (RP) L11 binds to c-Myc and inhibits its transcriptional activity in response to ribosomal stress. Here, we show that RPL5, co-operatively with RPL11, guides the RNA-induced silencing complex (RISC) to c-Myc mRNA and mediates the degradation of the mRNA, consequently leading to inhibition of c-Myc activity. Knocking down of RPL5 induced c-Myc expression at both mRNA and protein levels, whereas overexpression of RPL5 suppressed c-Myc expression and activity. Immunoprecipitation revealed that RPL5 binds to 3'UTR of c-Myc mRNA and two subunits of RISC, TRBP (HIV-1 TAR RNA-binding protein) and Ago2, mediating the targeting of c-Myc mRNA by miRNAs. Interestingly, RPL5 and RPL11 co-resided on c-Myc mRNA and suppressed c-Myc expression co-operatively. These findings uncover a mechanism by which these two RPs can co-operatively suppress c-Myc expression, allowing a tightly controlled ribosome biogenesis in cells.
Rutin inhibits B[a]PDE-induced cyclooxygenase-2 expression by targeting EGFR kinase activity.
Choi, Seunghwan; Lim, Tae-Gyu; Hwang, Mun Kyung; Kim, Yoon-A; Kim, Jiyoung; Kang, Nam Joo; Jang, Tae Su; Park, Jun-Seong; Yeom, Myeong Hun; Lee, Ki Won
2013-11-15
Rutin is a well-known flavonoid that exists in various natural sources. Accumulative studies have represented the biological effects of rutin, such as anti-oxidative and anti-inflammatory effects. However, the underlying mechanisms of rutin and its direct targets are not understood. We investigated whether rutin reduced B[a]PDE-induced-COX-2 expression. The transactivation of AP-1 and NF-κB were inhibited by rutin. Rutin also attenuated B[a]PDE-induced Raf/MEK/ERK and Akt activation, but had no effect on the phosphorylation of EGFR. An in vitro kinase assay revealed rutin suppressed EGFR kinase activity. We also confirmed direct binding between rutin and EGFR, and found that the binding was regressed by ATP. The EGFR inhibitor also inhibited the B[a]PDE-induced MEK/ERK and Akt signaling pathways and subsequently, suppressed COX-2 expression and promoter activity, in addition to suppressing the transactivation of AP-1 and NF-κB. In EGFR(-/-)mouse embryonic fibroblast cells, B[a]PDE-induced COX-2 expression was also diminished. Collectively, rutin inhibits B[a]PDE-induced COX-2 expression by suppressing the Raf/MEK/ERK and Akt signaling pathways. EGFR appeared to be the direct target of rutin. Copyright © 2013 Elsevier Inc. All rights reserved.
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F; Hur, Man-Wook
2008-10-24
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation.
Fukuchi, Junichi; Hiipakka, Richard A; Kokontis, John M; Nishimura, Kazuhiro; Igarashi, Kazuei; Liao, Shutsung
2004-07-16
Identification of the polyamine transporter gene will be useful for modulating polyamine accumulation in cells and should be a good target for controlling cell proliferation. Polyamine transport activity in mammalian cells is critical for accumulation of the polyamine analog methylglyoxal bis(guanylhydrazone) (MGBG) that induces apoptosis, although a gene responsible for transport activity has not been identified. Using a retroviral gene trap screen, we generated MGBG-resistant Chinese hamster ovary (CHO) cells to identify genes involved in polyamine transport activity. One gene identified by the method encodes TATA-binding protein-associated factor 7 (TAF7), which functions not only as one of the TAFs, but also a coactivator for c-Jun. TAF7-deficient cells had decreased capacity for polyamine uptake (20% of CHO cells), decreased AP-1 activation, as well as resistance to MGBG-induced apoptosis. Stable expression of TAF7 in TAF7-deficient cells restored transport activity (55% of CHO cells), AP-1 gene transactivation (100% of CHO cells), and sensitivity to MGBG-induced apoptosis. Overexpression of TAF7 in CHO cells did not increase transport activity, suggesting that TAF7 may be involved in the maintenance of basal activity. c-Jun NH2-terminal kinase inhibitors blocked MGBG-induced apoptosis without alteration of polyamine transport. Decreased TAF7 expression, by RNA interference, in androgen-independent human prostate cancer LN-CaP104-R1 cells resulted in lower polyamine transport activity (25% of control) and resistance to MGBG-induced growth arrest. Taken together, these results reveal a physiological function of TAF7 as a basal regulator for mammalian polyamine transport activity and MGBG-induced apoptosis.
Principles of antibody-mediated TNF receptor activation
Wajant, H
2015-01-01
From the beginning of research on receptors of the tumor necrosis factor (TNF) receptor superfamily (TNFRSF), agonistic antibodies have been used to stimulate TNFRSF receptors in vitro and in vivo. Indeed, CD95, one of the first cloned TNFRSF receptors, was solely identified as the target of cell death-inducing antibodies. Early on, it became evident from in vitro studies that valency and Fcγ receptor (FcγR) binding of antibodies targeting TNFRSF receptors can be of crucial relevance for agonistic activity. TNFRSF receptor-specific antibodies of the IgM subclass and secondary cross-linked or aggregation prone dimeric antibodies typically display superior agonistic activity compared with dimeric antibodies. Likewise, anchoring of antibodies to cell surface-expressed FcγRs potentiate their ability to trigger TNFRSF receptor signaling. However, only recently has the relevance of oligomerization and FcγR binding for the in vivo activity of antibody-induced TNFRSF receptor activation been straightforwardly demonstrated in vivo. This review discusses the crucial role of oligomerization and/or FcγR binding for antibody-mediated TNFRSF receptor stimulation in light of current models of TNFRSF receptor activation and especially the overwhelming relevance of these issues for the rational development of therapeutic TNFRSF receptor-targeting antibodies. PMID:26292758
Wang, Li Hua; Yang, Xiao Yi; Zhang, Xiaohu; Mihalic, Kelly; Xiao, Weihua; Farrar, William L
2003-05-01
Breast cancer, the most common malignancy in women, has been demonstrated to be associated with the steroid hormone estrogen and its receptor (ER), a ligand-activated transcription factor. Therefore, we developed a phosphorothiolate cis-element decoy against the estrogen response element (ERE decoy) to target disruption of ER DNA binding and transcriptional activity. Here, we showed that the ERE decoy potently ablated the 17beta-estrogen-inducible cell proliferation and induced apoptosis of human breast carcinoma cells by functionally affecting expression of c-fos gene and AP-1 luciferase gene reporter activity. Specificity of the decoy was demonstrated by its ability to directly block ER binding to a cis-element probe and transactivation. Moreover, the decoy failed to inhibit ER-mediated mitogen-activated protein kinase signaling pathways and cell growth of ER-negative breast cancer cells. Taken together, these data suggest that estrogen-mediated cell growth of breast cancer cells can be preferentially restricted via targeted disruption of ER at the level of DNA binding by a novel and specific decoy strategy applied to steroid nuclear receptors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Mi Hee; Kang, Dong Woo; Jung, Yunjin
2013-12-06
Highlights: •We found CAFÉ, a natural product that suppresses expression and activity of PLD1. •CAPE decreased PLD1 expression by inhibiting NFκB transactivation. •CAPE rapidly inhibited PLD activity via its binding to a Cys837 of PLD1. •PLD1 downregulation by CAPE inhibited invasion and proliferation of glioma cells. -- Abstract: Upregulation of phospholipase D (PLD) is functionally linked with oncogenic signals and tumorigenesis. Caffeic acid phenethyl ester (CAPE) is an active compound of propolis extract that exhibits anti-proliferative, anti-inflammatory, anti-oxidant, and antineoplastic properties. In this study, we demonstrated that CAPE suppressed the expression of PLD1 at the transcriptional level via inhibition ofmore » binding of NFκB to PLD1 promoter. Moreover, CAPE, but not its analogs, bound to a Cys837 residue of PLD1 and inhibited enzymatic activity of PLD. CAPE also decreased activation of matrix metalloproteinases-2 induced by phosphatidic acid, a product of PLD activity. Ultimately, CAPE-induced downregulation of PLD1 suppressed invasion and proliferation of glioma cells. Taken together, the results of this study indicate that CAPE might contribute to anti-neoplastic effect by targeting PLD1.« less
Lee, Jue-Yeon; Seo, Yoo-Na; Park, Hyun-Jung; Park, Yoon-Jeong; Chung, Chong-Pyoung
2012-03-23
A heparin-binding peptide (HBP) sequence from human heparin-binding epidermal growth factor-like growth factor (HB-EGF) was identified and was shown to exhibit cell penetration activity. This cell penetration induced an anti-inflammatory reaction in lipopolysaccharide (LPS)-treated RAW 264.7 macrophages. HBP penetrated the cell membrane during the 10 min treatment and reduced the LPS-induced production of nitric oxide (NO), inducible nitric oxide synthase (iNOS), and cytokines (TNF-α and IL-6) in a concentration-dependent manner. Additionally, HBP inhibited the LPS-induced upregulation of cytokines, including TNF-α and IL-6, and decreased the interstitial infiltration of polymorphonuclear leukocytes in a lung inflammation model. HBP inhibited NF-κB-dependent inflammatory responses by directly blocking the phosphorylation and degradation of IκBα and by subsequently inhibiting the nuclear translocation of the p65 subunit of NF-κB. Taken together, this novel HBP may be potentially useful candidate for anti-inflammatory treatments and can be combined with other drugs of interest to transport attached molecules into cells. Copyright © 2012 Elsevier Inc. All rights reserved.
Chronology of UPR activation in skeletal muscle adaptations to chronic contractile activity
Memme, Jonathan M.; Oliveira, Ashley N.
2016-01-01
The mitochondrial and endoplasmic reticulum unfolded protein responses (UPRmt and UPRER) are important for cellular homeostasis during stimulus-induced increases in protein synthesis. Exercise triggers the synthesis of mitochondrial proteins, regulated in part by peroxisome proliferator activator receptor-γ coactivator 1α (PGC-1α). To investigate the role of the UPR in exercise-induced adaptations, we subjected rats to 3 h of chronic contractile activity (CCA) for 1, 2, 3, 5, or 7 days followed by 3 h of recovery. Mitochondrial biogenesis signaling, through PGC-1α mRNA, increased 14-fold after 1 day of CCA. This resulted in 10–32% increases in cytochrome c oxidase activity, indicative of mitochondrial content, between days 3 and 7, as well as increases in the autophagic degradation of p62 and microtubule-associated proteins 1A/1B light chain 3A (LC3)-II protein. Before these adaptations, the UPRER transcripts activating transcription factor-4, spliced X-box-binding protein 1, and binding immunoglobulin protein were elevated (1.3- to 3.8-fold) at days 1–3, while CCAAT/enhancer-binding protein homologous protein (CHOP) and chaperones binding immunoglobulin protein and heat shock protein (HSP) 70 were elevated at mRNA and protein levels (1.5- to 3.9-fold) at days 1–7 of CCA. The mitochondrial chaperones 10-kDa chaperonin, HSP60, and 75-kDa mitochondrial HSP, the protease ATP-dependent Clp protease proteolytic subunit, and the regulatory protein sirtuin-3 of the UPRmt were concurrently induced 10–80% between days 1 and 7. To test the role of the UPR in CCA-induced remodeling, we treated animals with the endoplasmic reticulum stress suppressor tauroursodeoxycholic acid and subjected them to 2 or 7 days of CCA. Tauroursodeoxycholic acid attenuated CHOP and HSP70 protein induction; however, this failed to impact mitochondrial remodeling. Our data indicate that signaling to the UPR is rapidly activated following acute contractile activity, that this is attenuated with repeated bouts, and that the UPR is involved in chronic adaptations to CCA; however, this appears to be independent of CHOP signaling. PMID:27122157
Sharma, Rajendra; Sharma, Abha; Dwivedi, Seema; Zimniak, Piotr; Awasthi, Sanjay; Awasthi, Yogesh C.
2008-01-01
Previously, we have shown that 4-hydroxynonenal (4-HNE) induces Fas-mediated apoptosis in HLE B-3 cells through a pathway which is independent of FasL, FADD, procaspase8-and DISC (Li, J. et al. Biochemistry, 45, 12253-12264). The involvement of Daxx has also been suggested in this pathway but its role is not clear. Here, we report that Daxx plays an important regulatory role during 4-HNE induced, Fas-mediated apoptosis in Jurkat cells. 4-HNE induces Fas-dependent apoptosis in procaspase8 deficient Jurkat cells via the activation of ASK1, JNK and caspase3 and the apoptosis can be inhibited by masking Fas with the antagonistic anti-Fas antibodies. We demonstrate that 4-HNE exposure to Jurkat cells leads to the induction of both Fas and Daxx. 4-HNE binds to both Fas and Daxx and promotes the export of Daxx from nucleus to cytosol where it binds to Fas and inhibits apoptosis. Depletion of Daxx results in increase in the activation of ASK1, JNK, and caspase3 along with exacerbation of 4-HNE-induced apoptosis suggesting that Daxx inhibits apoptosis by binding to Fas. 4-HNE-induced translocation of the Daxx is also accompanied with the activation of the transcription factor HSF1. Results of these studies are consistent with a model in which by interacting with Fas, 4-HNE promotes pro-apoptotic signaling via ASK1, JNK and caspase3. In parallel, 4-HNE induces Daxx and promotes its export from the nucleus to cytosol where it interacts with Fas to self-limit the extent of apoptosis by inhibiting the downstream pro-apoptotic signaling. Cytoplasmic translocation of Daxx also results in up-regulation of HSF1 associated stress responsive genes. PMID:18069800
Efavirenz directly modulates estrogen receptor and induces breast cancer cell growth
Sikora, Matthew J.; Rae, James M.; Johnson, Michael D.; Desta, Zeruesenay
2010-01-01
Objectives Efavirenz-based HIV therapy is associated with breast hypertrophy and gynecomastia. Here, we tested the hypothesis that efavirenz induces gynecomastia through direct binding and modulation of estrogen receptor (ER). Methods To determine the effect of efavirenz on growth, the estrogen-dependent, ER-positive breast cancer cell lines MCF-7, T47D and ZR-75-1 were treated with efavirenz under estrogen-free conditions in the presence or absence of the anti-estrogen ICI 182,780. Cells treated with 17β-estradiol in the absence or presence of ICI 182,780 served as positive and negative controls, respectively. Cellular growth was assayed using the crystal violet staining method and an in vitro receptor binding assay was used to measure efavirenz’s ER binding affinity. Results Efavirenz induced growth in MCF-7 cells with an estimated EC50 of 15.7µM. This growth was reversed by ICI 182,780. Further, efavirenz binds directly to ER (IC50 of ~52µM) at roughly 1000-fold higher concentration than observed with E2. Conclusions Our data suggest that efavirenz-induced gynecomastia may be due, at least in part, to drug-induced ER activation in breast tissues. PMID:20408889
Jang, Hyo-Min; Kang, Geum-Dan; Van Le, Thi Kim; Lim, Su-Min; Jang, Dae-Sik; Kim, Dong-Hyun
2017-04-01
The roots of Abrus precatorius (AP, Fabaceae) have traditionally been used in Vietnam and China for the treatment of inflammatory diseases such as stomatitis, asthma, bronchitis, and hepatitis. Therefore, in this study, we isolated 4-methoxylonchocarpin (ML), an anti-inflammatory compound present in AP, and studied its anti-inflammatory effects in mice with 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced colitis. In lipopolysaccharide (LPS)-stimulated macrophages, ML was found to inhibit nuclear factor (NF)-κB activation and tumor necrosis factor (TNF) and interleukin (IL)-6 expression by inhibiting LPS binding to Toll-like receptor 4 (TLR4) in vitro. Oral administration of ML in mice with TNBS-induced colitis suppressed colon shortening and colonic myeloperoxidase activity. ML treatment significantly inhibited the activation of nuclear factor (NF)-κB and phosphorylation of transforming growth factor β-activated kinase 1 in the colon. Treatment with ML also inhibited TNBS-induced expression of IL-1β, IL-17A, and TNF. While ML reduced the TNBS-induced expression of M1 macrophage markers such as arginase-2 and TNF, it was found to increase the expression of M2 macrophage markers such as arginase-1 and IL-10. In conclusion, oral administration of ML attenuated colitis in mice by inhibiting the binding of LPS to TLR4 on immune cells and increasing the polarization of M1 macrophages to M2 macrophages. Copyright © 2017 Elsevier B.V. All rights reserved.
Bax Activates Endophilin B1 Oligomerization and Lipid Membrane Vesiculation*
Rostovtseva, Tatiana K.; Boukari, Hacène; Antignani, Antonella; Shiu, Brian; Banerjee, Soojay; Neutzner, Albert; Youle, Richard J.
2009-01-01
Endophilins participate in membrane scission events that occur during endocytosis and intracellular organelle biogenesis through the combined activity of an N-terminal BAR domain that interacts with membranes and a C-terminal SH3 domain that mediates protein binding. Endophilin B1 (Endo B1) was identified to bind Bax, a Bcl-2 family member that promotes apoptosis, through yeast two-hybrid protein screens. Although Endo B1 does not bind Bax in healthy cells, during apoptosis, Endo B1 interacts transiently with Bax and promotes cytochrome c release from mitochondria. To explore the molecular mechanism of action of Endo B1, we have analyzed its interaction with Bax in cell-free systems. Purified recombinant Endo B1 in solution displays a Stokes radius indicating a tetrameric quarternary structure. However, when incubated with purified Bax, it assembles into oligomers more than 4-fold greater in molecular weight. Although Endo B1 oligomerization is induced by Bax, Bax does not stably associate with the high molecular weight Endo B1 complex. Endo B1 oligomerization requires its C-terminal Src homology 3 domain and is not induced by Bcl-xL. Endo B1 combined with Bax reduces the size and changes the morphology of giant unilamellar vesicles by inducing massive vesiculation of liposomes. This activity of purified Bax protein to induce cell-free assembly of Endo B1 may reflect its activity in cells that regulates apoptosis and/or mitochondrial fusion. PMID:19805544
Flt3 is a target of coumestrol in protecting against UVB-induced skin photoaging.
Park, Gaeun; Baek, Sohee; Kim, Jong-Eun; Lim, Tae-gyu; Lee, Charles C; Yang, Hee; Kang, Young-Gyu; Park, Jun Seong; Augustin, Martin; Mrosek, Michael; Lee, Chang Yong; Dong, Zigang; Huber, Robert; Lee, Ki Won
2015-12-01
While skin aging is a naturally occurring process by senescence, exposure to ultraviolet (UV) radiation accelerates wrinkle formation and sagging of skin. UV induces skin aging by degrading collagen via activating matrix metalloproteinases (MMPs). In this study, we show that coumestrol, a metabolite of the soybean isoflavone daidzein, has a preventive effect on skin photoaging in three-dimensional human skin equivalent model. Coumestrol inhibited UVB-induced MMP-1 expression and activity. Whole human kinase profiling assay identified FLT3 kinase as a novel target protein of coumestrol in UVB-induced signaling pathway in skin. Coumestrol suppresses FLT3 kinase activity, and subsequently, Ras/MEK/ERK and Akt/p70 ribosomal S6 kinase pathway. This suppresses AP-1 activity and in turn, diminishes MMP-1 gene transcription. Using X-ray crystallography, the binding of coumestrol to FLT3 was defined and implied ATP-competitive inhibition. Residues Lys644 and Phe830 showed local changes to accommodate coumestrol in the ATP-binding pocket. 4-APIA, a pharmacological inhibitor of FLT3, inhibited MMP-1 expression and induced signal transduction changes similar to coumestrol. Taken together, coumestrol inhibits UVB-induced MMP-1 expression by suppressing FLT3 kinase activity. These findings suggest that coumestrol is a novel dietary compound with potential application in preventing and improving UVB-associated skin aging. Copyright © 2015 Elsevier Inc. All rights reserved.
ERIC Educational Resources Information Center
Porte, Yves; Buhot, Marie Christine; Mons, Nicole E.
2008-01-01
We investigated the spatio-temporal dynamics of learning-induced cAMP response element-binding protein activation/phosphorylation (pCREB) in mice trained in a spatial reference memory task in the water maze. Using immunohistochemistry, we examined pCREB immunoreactivity (pCREB-ir) in hippocampal CA1 and CA3 and related brain structures. During the…
Binding Mode Analysis of Zerumbone to Key Signal Proteins in the Tumor Necrosis Factor Pathway
Fatima, Ayesha; Abdul, Ahmad Bustamam Hj.; Abdullah, Rasedee; Karjiban, Roghayeh Abedi; Lee, Vannajan Sanghiran
2015-01-01
Breast cancer is the second most common cancer among women worldwide. Several signaling pathways have been implicated as causative and progression agents. The tumor necrosis factor (TNF) α protein plays a dual role in promoting and inhibiting cancer depending largely on the pathway initiated by the binding of the protein to its receptor. Zerumbone, an active constituent of Zingiber zerumbet, Smith, is known to act on the tumor necrosis factor pathway upregulating tumour necrosis factor related apoptosis inducing ligand (TRAIL) death receptors and inducing apoptosis in cancer cells. Zerumbone is a sesquiterpene that is able to penetrate into the hydrophobic pockets of proteins to exert its inhibiting activity with several proteins. We found a good binding with the tumor necrosis factor, kinase κB (IKKβ) and the Nuclear factor κB (NF-κB) component proteins along the TNF pathway. Our results suggest that zerumbone can exert its apoptotic activities by inhibiting the cytoplasmic proteins. It inhibits the IKKβ kinase that activates the NF-κB and also binds to the NF-κB complex in the TNF pathway. Blocking both proteins can lead to inhibition of cell proliferating proteins to be downregulated and possibly ultimate induction of apoptosis. PMID:25629232
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators. PMID:28301511
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators.
Liu, Chune; Yang, Zhihong; Wu, Jianguo; Zhang, Li; Lee, Sangmin; Shin, Dong-Ju; Tran, Melanie; Wang, Li
2018-05-01
H19 is an imprinted long noncoding RNA abundantly expressed in embryonic liver and repressed after birth. We show that H19 serves as a lipid sensor by synergizing with the RNA-binding polypyrimidine tract-binding protein 1 (PTBP1) to modulate hepatic metabolic homeostasis. H19 RNA interacts with PTBP1 to facilitate its association with sterol regulatory element-binding protein 1c mRNA and protein, leading to increased stability and nuclear transcriptional activity. H19 and PTBP1 are up-regulated by fatty acids in hepatocytes and in diet-induced fatty liver, which further augments lipid accumulation. Ectopic expression of H19 induces steatosis and pushes the liver into a "pseudo-fed" state in response to fasting by promoting sterol regulatory element-binding protein 1c protein cleavage and nuclear translocation. Deletion of H19 or knockdown of PTBP1 abolishes high-fat and high-sucrose diet-induced steatosis. Our study unveils an H19/PTBP1/sterol regulatory element-binding protein 1 feedforward amplifying signaling pathway to exacerbate the development of fatty liver. (Hepatology 2018;67:1768-1783). © 2017 by the American Association for the Study of Liver Diseases.
A bimodal activation mechanism underlies scorpion toxin–induced pain
Yang, Shilong; Yang, Fan; Zhang, Bei; Lee, Bo Hyun; Li, Bowen; Luo, Lei; Zheng, Jie; Lai, Ren
2017-01-01
Venomous animals use peptide toxins for hunting and self-defense. To achieve these goals, toxins need to bind to their targets with high affinity due to the small amount that a single bite or sting can deliver. The scorpion toxin BmP01 is linked to sting-induced excruciating pain; however, the reported minimum concentrations for activating TRPV1 channel or inhibiting voltage-gated potassium (Kv) channels (both in the micromolar range) appear too high to be biologically relevant. We show that the effective concentration of BmP01 is highly pH-dependent—it increases by about 10-fold in inhibiting Kv channels upon a 1-U drop in pH but decreases more than 100-fold in activating TRPV1. Mechanistic investigation revealed that BmP01 binds to one of the two proton-binding sites on TRPV1 and, together with a proton, uses a one-two punch approach to strongly activate the nociceptive channel. Because most animal venoms are acidic, proton-facilitated synergistic action may represent a general strategy for maximizing toxin potency. PMID:28782041
Chen, Ying-Jung; Chang, Long-Sen
2015-10-01
The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.
Doxycycline exerted neuroprotective activity by enhancing the activation of neuropeptide GPCR PAC1.
Yu, Rongjie; Zheng, Lijun; Cui, Yue; Zhang, Huahua; Ye, Heng
2016-04-01
Doxycycline has significant neuroprotective effect with anti-inflammatory and anti-apoptotic activity. We found for the first time that doxycycline specially promoted the proliferation of Chinese hamster ovary (CHO) cells with high expression of neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) preferring G protein-coupled receptor (GPCR), PACAP receptor 1(PAC1) and induced the internalization of PAC1 tagged with yellow fluorescent protein (YFP) indicating doxycycline interacted with PAC1. The homology modeling of PAC1 and molecular docking of doxycycline with PAC1 showed the theoretical binding of doxycycline to PAC1 at the site where PACAP(30-37) recognized. The competition binding assay and PAC1 site-specific mutation of Asp116, which formed two hydrogen bonds with Dox, confirmed the binding of doxycycline to PAC1 imitating PACAP(30-37). Doxycycline (100 ng/mL) significantly promoted the proliferative activities of vasoactive intestinal polypeptide (VIP) and oligopeptide HSDGIF responsible for the activation of PAC1 in PAC1-CHO cells, indicating that doxycycline facilitated the binding and the activation of PAC1 imitating PACAP(28-38). In Neuro2a cells with endogenous expression of PAC1 and its ligands, doxycycline not only promoted the proliferation of Neuro2a cells but also protected the cells from scopolamine induced apoptosis, which was inhibited by cAMP-PKA signal pathway inhibitor H-89, PAC1 shRNA or PACAP antagonist PACAP(6-38). The in vivo study showed long-term treatment with doxycycline (100ug/kg) had significant effect against scopolamine induced amnesia, and the synergetic anti-apoptotic, anti-oxidative and neuroprotective effect of doxycycline with VIP was more efficient than doxycycline alone or VIP alone, indicating doxycycline enhanced the activation of PAC1 in vivo effectively. Furthermore, doxycycline analogue minocycline also had similar theoretically binding site on PAC1 to doxycycline and displayed corresponding similar activity on PAC1 to doxycycline. All these results confirmed for the first time that doxycycline specially targeted PAC1 imitating PACAP(30-37) and acted as an enhancer by facilitating the subsequent ligand binding and the activation of PAC1. The confirmation of PAC1 as a novel molecular target of doxycycline and the novel mechanism by which doxycycline enhances the activity of PAC1 will help further clinical development of doxycycline as novel therapy for nervous system diseases such as neurodegenerative diseases targeting PAC1. Copyright © 2015 Elsevier Ltd. All rights reserved.
ABFs, a family of ABA-responsive element binding factors.
Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y
2000-01-21
Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.
Lu, Yuqin; Zhou, Wenyu; Feng, Yue; Li, Yao; Liu, Ke; Liu, Lizhong; Lin, Dongxu; He, Zhendan; Wu, Xuli
2017-06-01
Acteoside, the predominant polyphenol of small-leaved kudingcha, the Chinese tea, has various biological activities. In this study, we examined the acyl migration of acteoside to isoacteoside with high-temperature treatment of acteoside. The inhibitory effects of acyl-migrated acteoside and acteoside on α-amylase were investigated, as were their binding interaction with α-amylase. The binding of acteoside and isoacteoside to α-amylase was investigated by using the fluorescence spectra assay, circular dichroism, and protein-ligand docking studies. Acteoside was more effective than preheated acteoside and isoacteoside in inhibiting α-amylase activity. Acteoside and isoacteoside binding to α-amylase may induce conformational changes to α-amylase, and the binding site of acteoside and isoacteoside being near the active site pocket of α-amylase may explain the decreased activity of α-amylase. The different affinities and binding sites of acteoside and isoacteoside for α-amylase resulted in different inhibition rates, which may be due to structural differences between acteoside and isoacteoside.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen Jun; Shaikh, Zahir A., E-mail: ZShaikh@uri.ed
Kidney is the primary target organ in chronic cadmium (Cd) toxicity, and oxidative stress plays an important role in this process. The nuclear transcription factor Nrf2 binds to antioxidant response elements (AREs) and regulates genes involved in protecting cells from oxidative damage. Whether kidney cells respond to Cd by activating Nrf2 is unknown. This study was designed to examine the Cd-induced activation of Nrf2 transcriptional activity in a stable rat kidney cell line, NRK-52E, and to investigate the protection this might offer against apoptosis. The cells were treated with 5-20 muM CdCl{sub 2} for 5 h, followed by a recoverymore » period of up to 24 h. A concentration-dependent increase (up to 2.9-fold) in the level of reactive oxygen species was noted upon termination of 5-h Cd treatment. The Nrf2-ARE binding activity also increased and peaked (6.1-fold) at 10 muM Cd concentration. Time-course study revealed that the binding activity increased at 1 h of Cd treatment and peaked 2 h post Cd treatment. Apoptosis was detected 6 h post treatment with Cd and a concentration- and time-dependent increase in the apoptotic cell population occurred during the next 18 h. Over-expression of Nrf2 by transient transfection conferred resistance against Cd-induced apoptosis. Conversely, suppression of Nrf2 expression by specific siRNA resulted in greater sensitivity of the cells to Cd by decreasing the levels of two antioxidant enzymes, hemeoxygenase-1 and glutamate-cysteine ligase. Taken together, these results suggest that in kidney cells the activation of Nrf2 is an adaptive intracellular response to Cd-induced oxidative stress, and that Nrf2 is protective against Cd-induced apoptosis.« less
NASA Astrophysics Data System (ADS)
Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun
2015-07-01
Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.
Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun
2015-07-16
Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway.
Ethanol-induced changes in Poly (ADP ribose) Polymerase and neuronal developmental gene expression
Gavin, David P.; Kusumo, Handojo; Sharma, Rajiv P.; Guizzetti, Marina
2016-01-01
Prenatal alcohol exposure has profound effects on neuronal growth and development. Poly-ADP Ribose Polymerase (PARP) enzymes are perhaps unique in the field of epigenetics in that they directly participate in histone modifications, transcription factor modifications, DNA methylation/demethylation and are highly inducible by ethanol. It was our hypothesis that ethanol would induce PARP enzymatic activity leading to alterations in neurodevelopmental gene expression. Mouse E18 cortical neurons were treated with ethanol, PARP inhibitors, and nuclear hormone receptor transcription factor PPARγ agonists and antagonists. Subsequently, we measured PARP activity and changes in Bdnf, OKSM (Oct4, Klf4, Sox2, c-Myc), DNA methylating/demethylating factors, and Pparγ mRNA expression, promoter 5-methylcytosine (5MC) and 5-hydroxymethylcytosine (5HMC), and PPARγ promoter binding. We found that ethanol reduced Bdnf4, 9a, and Klf4 mRNA expression, and increased c-Myc expression. These changes were reversed with a PARP inhibitor. In agreement with its role in DNA demethylation PARP inhibition increased 5MC levels at the c-Myc promoter. In addition, we found that elevated PARP enzymatic activity reduced PPARγ promoter binding, and this corresponded to decreased Bdnf and Klf4 mRNA expression. Our results suggest that PARP participates in DNA demethylation and reduces PPARγ promoter binding. The current study underscores the importance of PARP in ethanol-induced changes to neurodevelopmental gene expression. PMID:27497606
Ethanol-induced changes in poly (ADP ribose) polymerase and neuronal developmental gene expression.
Gavin, David P; Kusumo, Handojo; Sharma, Rajiv P; Guizzetti, Marina
2016-11-01
Prenatal alcohol exposure has profound effects on neuronal growth and development. Poly-ADP Ribose Polymerase (PARP) enzymes are perhaps unique in the field of epigenetics in that they directly participate in histone modifications, transcription factor modifications, DNA methylation/demethylation and are highly inducible by ethanol. It was our hypothesis that ethanol would induce PARP enzymatic activity leading to alterations in neurodevelopmental gene expression. Mouse E18 cortical neurons were treated with ethanol, PARP inhibitors, and nuclear hormone receptor transcription factor PPARγ agonists and antagonists. Subsequently, we measured PARP activity and changes in Bdnf, OKSM (Oct4, Klf4, Sox2, c-Myc), DNA methylating/demethylating factors, and Pparγ mRNA expression, promoter 5-methylcytosine (5MC) and 5-hydroxymethylcytosine (5HMC), and PPARγ promoter binding. We found that ethanol reduced Bdnf4, 9a, and Klf4 mRNA expression, and increased c-Myc expression. These changes were reversed with a PARP inhibitor. In agreement with its role in DNA demethylation PARP inhibition increased 5MC levels at the c-Myc promoter. In addition, we found that inhibition of PARP enzymatic activity increased PPARγ promoter binding, and this corresponded to increased Bdnf and Klf4 mRNA expression. Our results suggest that PARP participates in DNA demethylation and reduces PPARγ promoter binding. The current study underscores the importance of PARP in ethanol-induced changes to neurodevelopmental gene expression. Published by Elsevier Ltd.
Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins
Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.
2009-01-01
Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796
Lakshmi, Sowmya P.; Reddy, Aravind T.; Reddy, Raju C.
2017-01-01
Transforming growth factor β (TGF-β) contributes to wound healing and, when dysregulated, to pathological fibrosis. TGF-β and the anti-fibrotic nuclear hormone receptor peroxisome proliferator-activated receptor γ (PPARγ) repress each other’s expression, and such PPARγ downregulation is prominent in fibrosis and mediated, via previously unknown SMAD-signaling mechanisms. Here we show that TGF-β induces association of SMAD3 with both SMAD4, needed for translocation of the complex into the nucleus, and the essential context-sensitive corepressors E2F4 and p107. The complex mediates TGF-β-induced repression by binding to regulatory elements in the target promoter. In the PPARG promoter, we found that the SMAD3-SMAD4 complex binds both to a previously unknown consensus TGF-β inhibitory element (TIE) and also to canonical SMAD-binding elements (SBEs). Furthermore, the TIE and SBEs independently mediated partial repression of PPARG transcription, the first demonstration of a TIE and SBEs functioning within the same promoter. Also, TGF-β-treated fibroblasts contained SMAD complexes that activated a SMAD target gene in addition to those repressing PPARG transcription, the first finding of such dual activity within the same cell. These findings describe in detail novel mechanisms by which TGF-β represses PPARG transcription, thereby facilitating its own pro-fibrotic activity. PMID:28100650
Gumy, Christel; Chandsawangbhuwana, Charlie; Dzyakanchuk, Anna A.; Kratschmar, Denise V.; Baker, Michael E.; Odermatt, Alex
2008-01-01
Background Organotins are highly toxic and widely distributed environmental chemicals. Dibutyltin (DBT) is used as stabilizer in the production of polyvinyl chloride plastics, and it is also the major metabolite formed from tributyltin (TBT) in vivo. DBT is immunotoxic, however, the responsible targets remain to be defined. Due to the importance of glucocorticoids in immune-modulation, we investigated whether DBT could interfere with glucocorticoid receptor (GR) function. Methodology We used HEK-293 cells transiently transfected with human GR as well as rat H4IIE hepatoma cells and native human macrophages and human THP-1 macrophages expressing endogenous receptor to study organotin effects on GR function. Docking of organotins was used to investigate the binding mechanism. Principal Findings We found that nanomolar concentrations of DBT, but not other organotins tested, inhibit ligand binding to GR and its transcriptional activity. Docking analysis indicated that DBT inhibits GR activation allosterically by inserting into a site close to the steroid-binding pocket, which disrupts a key interaction between the A-ring of the glucocorticoid and the GR. DBT inhibited glucocorticoid-induced expression of phosphoenolpyruvate carboxykinase (PEPCK) and tyrosine-aminotransferase (TAT) and abolished the glucocorticoid-mediated transrepression of TNF-α-induced NF-κB activity. Moreover, DBT abrogated the glucocorticoid-mediated suppression of interleukin-6 (IL-6) and TNF-α production in lipopolysaccharide (LPS)-stimulated native human macrophages and human THP-1 macrophages. Conclusions DBT inhibits ligand binding to GR and subsequent activation of the receptor. By blocking GR activation, DBT may disturb metabolic functions and modulation of the immune system, providing an explanation for some of the toxic effects of this organotin. PMID:18958157
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
The Aryl Hydrocarbon Receptor Binds to E2F1 and Inhibits E2F1-induced Apoptosis
Marlowe, Jennifer L.; Fan, Yunxia; Chang, Xiaoqing; Peng, Li; Knudsen, Erik S.; Xia, Ying
2008-01-01
Cellular stress by DNA damage induces checkpoint kinase-2 (CHK2)-mediated phosphorylation and stabilization of the E2F1 transcription factor, leading to induction of apoptosis by activation of a subset of proapoptotic E2F1 target genes, including Apaf1 and p73. This report characterizes an interaction between the aryl hydrocarbon (Ah) receptor (AHR), a ligand-activated transcription factor, and E2F1 that results in the attenuation of E2F1-mediated apoptosis. In Ahr−/− fibroblasts stably transfected with a doxycycline-regulated AHR expression vector, inhibition of AHR expression causes a significant elevation of oxidative stress, γH2A.X histone phosphorylation, and E2F1-dependent apoptosis, which can be blocked by small interfering RNA-mediated knockdown of E2F1 expression. In contrast, ligand-dependent AHR activation protects these cells from etoposide-induced cell death. In cells expressing both proteins, AHR and E2F1 interact independently of the retinoblastoma protein (RB), because AHR and E2F1 coimmunoprecipitate from extracts of RB-negative cells. Additionally, chromatin immunoprecipitation assays indicate that AHR and E2F1 bind to the Apaf1 promoter at a region containing a consensus E2F1 binding site but no AHR binding sites. AHR activation represses Apaf1 and TAp73 mRNA induction by a constitutively active CHK2 expression vector. Furthermore, AHR overexpression blocks the transcriptional induction of Apaf1 and p73 and the accumulation of sub-G0/G1 cells resulting from ectopic overexpression of E2F1. These results point to a proproliferative, antiapoptotic function of the Ah receptor that likely plays a role in tumor progression. PMID:18524851
Barcelona, Pablo F.
2015-01-01
Nerve growth factor (NGF) is generated from a precursor, proNGF, that is proteolytically processed. NGF preferentially binds a trophic tyrosine kinase receptor, TrkA, while proNGF binds a neurotrophin receptor (NTR), p75NTR, that can have neurotoxic activity. Previously, we along with others showed that the soluble protein α2-macroglobulin (α2M) is neurotoxic. Toxicity is due in part to α2M binding to NGF and inhibiting trophic activity, presumably by preventing NGF binding to TrkA. However, the mechanisms remained unclear. Here, we show ex vivo and in vivo three mechanisms for α2M neurotoxicity. First, unexpectedly the α2M-NGF complexes do bind TrkA receptors but do not induce TrkA dimerization or activation, resulting in deficient trophic support. Second, α2M makes stable complexes with proNGF, conveying resistance to proteolysis that results in more proNGF and less NGF. Third, α2M-proNGF complexes bind p75NTR and are more potent agonists than free proNGF, inducing tumor necrosis factor alpha (TNF-α) production. Hence, α2M regulates proNGF/p75NTR positively and mature NGF/TrkA negatively, causing neuronal death ex vivo. These three mechanisms are operative in vivo, and α2M causes neurodegeneration in a p75NTR- and proNGF-dependent manner. α2M could be exploited as a therapeutic target, or as a modifier of neurotrophin signals. PMID:26217017
Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin
2015-01-01
Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047
Zamolodchikov, Daria
2012-01-01
Alzheimer disease is characterized by the presence of increased levels of the β-amyloid peptide (Aβ) in the brain parenchyma and cerebral blood vessels. This accumulated Aβ can bind to fibrin(ogen) and render fibrin clots more resistant to degradation. Here, we demonstrate that Aβ42 specifically binds to fibrin and induces a tighter fibrin network characterized by thinner fibers and increased resistance to lysis. However, Aβ42-induced structural changes cannot be the sole mechanism of delayed lysis because Aβ overlaid on normal preformed clots also binds to fibrin and delays lysis without altering clot structure. In this regard, we show that Aβ interferes with the binding of plasminogen to fibrin, which could impair plasmin generation and fibrin degradation. Indeed, plasmin generation by tissue plasminogen activator (tPA), but not streptokinase, is slowed in fibrin clots containing Aβ42, and clot lysis by plasmin, but not trypsin, is delayed. Notably, plasmin and tPA activities, as well as tPA-dependent generation of plasmin in solution, are not decreased in the presence of Aβ42. Our results indicate the existence of 2 mechanisms of Aβ42 involvement in delayed fibrinolysis: (1) through the induction of a tighter fibrin network composed of thinner fibers, and (2) through inhibition of plasmin(ogen)–fibrin binding. PMID:22238323
The transcription factor DREAM represses A20 and mediates inflammation
Tiruppathi, Chinnaswamy; Soni, Dheeraj; Wang, Dong-Mei; Xue, Jiaping; Singh, Vandana; Thippegowda, Prabhakar B.; Cheppudira, Bopaiah P.; Mishra, Rakesh K.; DebRoy, Auditi; Qian, Zhijian; Bachmaier, Kurt; Zhao, Youyang; Christman, John W.; Vogel, Stephen M.; Ma, Averil; Malik, Asrar B.
2014-01-01
Here we show that the transcription-repressor DREAM binds to the A20 promoter to repress the expression of A20, the deubiquitinase suppressing inflammatory NF-κB signaling. DREAM-deficient (Dream−/−) mice displayed persistent and unchecked A20 expression in response to endotoxin. DREAM functioned by transcriptionally repressing A20 through binding to downstream regulatory elements (DREs). In contrast, USF1 binding to the DRE-associated E-box domain activated A20 expression in response to inflammatory stimuli. These studies define the critical opposing functions of DREAM and USF1 in inhibiting and inducing A20 expression, respectively, and thereby the strength of NF-κB signaling. Targeting of DREAM to induce USF1-mediated A20 expression is therefore a potential anti-inflammatory strategy in diseases such as acute lung injury associated with unconstrained NF-κB activity. PMID:24487321
Brzoska, Tomasz; Tanaka-Murakami, Aki; Suzuki, Yuko; Sano, Hideto; Kanayama, Naohiro; Urano, Tetsumei
2015-01-01
The fibrinolytic system plays a pivotal role in the regulation of hemostasis; however, it remains unclear how and when the system is triggered to induce thrombolysis. Using intra-vital confocal fluorescence microscopy, we investigated the process of plasminogen binding to laser-induced platelet-rich microthrombi generated in the mesenteric vein of transgenic mice expressing green fluorescent protein (GFP). The accumulation of GFP-expressing platelets as well as exogenously infused Alexa Fluor 568-labeled Glu-plasminogen (Glu-plg) on the injured vessel wall was assessed by measuring the increase in the corresponding fluorescence intensities. Glu-plg accumulated in a time-dependent manner in the center of the microthrombus, where phosphatidylserine is exposed on platelet surfaces and fibrin formation takes place. The rates of binding of Glu-plg in the presence of ε-aminocaproic acid and carboxypeptidase B, as well as the rates of binding of mini-plasminogen lacking kringle domains 1-4 and lysine binding sites, were significantly lower than that of Glu-plg alone, suggesting that the binding was dependent on lysine binding sites. Furthermore, aprotinin significantly suppressed the accumulation of Glu-plg, suggesting that endogenously generated plasmin activity is a prerequisite for the accumulation. In spite of the endogenous generation of plasmin and accumulation of Glu-plg in the center of microthrombi, the microthrombi did not change in size during the 2-hour observation period. When human tissue plasminogen activator was administered intravenously, Glu-plg further accumulated and the microthrombi were lysed. Glu-plg appeared to accumulate in the center of microthrombi in the early phase of microthrombus formation, and plasmin activity and lysine binding sites were required for this accumulation. PMID:25806939
Lan, Hongxiang; Liu, Yong; Bell, Michal I; Gurevich, Vsevolod V; Neve, Kim A
2009-01-01
Arrestins mediate G protein-coupled receptor desensitization, internalization, and signaling. Dopamine D(2) and D(3) receptors have similar structures but distinct characteristics of interaction with arrestins. The goals of this study were to compare arrestin-binding determinants in D(2) and D(3) receptors other than phosphorylation sites and to create a D(2) receptor that is deficient in arrestin binding. We first assessed the ability of purified arrestins to bind to glutathione transferase (GST) fusion proteins containing the receptor third intracellular loops (IC3). Arrestin3 bound to IC3 of both D(2) and D(3) receptors, with the affinity and localization of the binding site indistinguishable between the receptor subtypes. Mutagenesis of the GST-IC3 fusion proteins identified an important determinant of the binding of arrestin3 in the N-terminal region of IC3. Alanine mutations of this determinant (IYIV212-215) in the full-length D(2) receptor generated a signaling-biased receptor with intact ligand binding and G-protein coupling and activation, but deficient in receptor-mediated arrestin3 translocation to the membrane, agonist-induced receptor internalization, and agonist-induced desensitization in human embryonic kidney 293 cells. This mutation also decreased arrestin-dependent activation of extracellular signal-regulated kinases. The finding that nonphosphorylated D(2)-IC3 and D(3)-IC3 have similar affinity for arrestin is consistent with previous suggestions that the differential effects of D(2) and D(3) receptor activation on membrane translocation of arrestin and receptor internalization are due, at least in part, to differential phosphorylation of the receptors. In addition, these results imply that the sequence IYIV212-215 at the N terminus of IC3 of the D(2) receptor is a key element of the arrestin binding site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB
Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria
2016-01-01
Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114
Domonkos, Celesztina; Fitos, Ilona; Visy, Júlia; Zsila, Ferenc
2013-12-02
Harmane and norharmane are representative members of the large group of natural β-carboline alkaloids featured with diverse pharmacological activities. In blood, these agents are transported by human serum albumin (HSA) which has a profound impact on the pharmacokinetic and pharmacodynamic properties of many therapeutic drugs and xenobiotics. By combination of various spectroscopic methods, the present contribution is aimed to elucidate how nonesterified fatty acids (FAs), the primary endogenous ligands of HSA, affect the binding properties of harmane and norharmane. Analysis of induced circular dichroism (CD) and fluorescence spectroscopic data indicates the inclusion of the neutral form of both molecules into the binding pocket of subdomain IIIA, which hosts two FA binding sites, too. The induced CD and UV absorption spectra of harmane and norharmane exhibit peculiar changes upon addition of FAs, suggesting the formation of ternary complexes in which the lipid ligands significantly alter the binding mode of the alkaloids via cooperative allosteric mechanism. To our knowledge, it is the first instance of the demonstration of drug-FA cobinding at site IIIA. In line with these results, molecular docking calculations showed two distinct binding positions of norharmane within subdomain IIIA. The profound increase in the affinity constants of β-carbolines estimated in the presence of FAs predicts that the unbound, pharmacologically active serum fraction of these compounds strongly depends on the actual lipid binding profile of HSA.
Labib, Rola M; Youssef, Fadia S; Ashour, Mohamed L; Abdel-Daim, Mohamed M; Ross, Samir A
2017-08-29
The chemical composition of Pinus roxburghii bark essential oil (PRO) was qualitatively and quantitatively determined using GC/FID and GC/MS. The anti-inflammatory activity was assessed in vitro by evaluating the binding percentages on the cannabinoids and opioids receptors. Bleomycin (BLM)-induced pulmonary inflammation in albino mice was adopted to assess PRO anti-inflammatory efficacy in vivo. In silico molecular modelling of its major components was performed on human glucocorticoids receptor (GR). Seventy-five components were identified in which longifolene (33.13%) and palmitic acid (9.34%) constituted the predominant components. No binding was observed on cannabinoid receptor type 1 (CB1), whereas mild binding was observed on cannabinoid receptor type 2 (CB2), delta , kappa , and mu receptors accounting for 2.9%, 6.9%, 10.9% and 22% binding. A significant in vivo activity was evidenced by reduction of the elevated malondialdehyde (MDA), nitric oxide (NO), myeloperoxidase (MPO), interleukin-6 (IL-6), and tumor necrosis factor- α (TNF- α ) levels by 55.56%, 55.66%, 64.64%, 58.85% and 77.78% with concomitant elevation of superoxide dismutase (SOD) and catalase (CAT) activities comparable to BLM-treated group at 100 mg/kg body weight. In silico studies showed that palmitic acid exerted the fittest binding. PRO could serve as a potent anti-inflammatory natural candidate that should be supported by further clinical trials.
Bonaterra, Gabriel A.; Driscoll, David; Schwarzbach, Hans; Kinscherf, Ralf
2017-01-01
Background: Parenteral nutrition is often a mandatory therapeutic strategy for cases of septicemia. Likewise, therapeutic application of anti-oxidants, anti-inflammatory therapy, and endotoxin lowering, by removal or inactivation, might be beneficial to ameliorate the systemic inflammatory response during the acute phases of critical illness. Concerning anti-inflammatory properties in this setting, omega-3 fatty acids of marine origin have been frequently described. This study investigated the anti-inflammatory and LPS-inactivating properties of krill oil (KO)-in-water emulsion in human macrophages in vitro. Materials and Methods: Differentiated THP-1 macrophages were activated using specific ultrapure-LPS that binds only on the toll-like receptor 4 (TLR4) in order to determine the inhibitory properties of the KO emulsion on the LPS-binding capacity, and the subsequent release of TNF-α. Results: KO emulsion inhibited the macrophage binding of LPS to the TLR4 by 50% (at 12.5 µg/mL) and 75% (at 25 µg/mL), whereas, at 50 µg/mL, completely abolished the LPS binding. Moreover, KO (12.5 µg/mL, 25 µg/mL, or 50 µg/mL) also inhibited (30%, 40%, or 75%, respectively) the TNF-α release after activation with 0.01 µg/mL LPS in comparison with LPS treatment alone. Conclusion: KO emulsion influences the LPS-induced pro-inflammatory activation of macrophages, possibly due to inactivation of the LPS binding capacity. PMID:28294970
hnRNP L controls HPV16 RNA polyadenylation and splicing in an Akt kinase-dependent manner
Kajitani, Naoko; Glahder, Jacob; Wu, Chengjun; Yu, Haoran; Nilsson, Kersti
2017-01-01
Abstract Inhibition of the Akt kinase activates HPV16 late gene expression by reducing HPV16 early polyadenylation and by activating HPV16 late L1 mRNA splicing. We identified ‘hot spots’ for RNA binding proteins at the early polyA signal and at splice sites on HPV16 late mRNAs. We observed that hnRNP L was associated with sequences at all HPV16 late splice sites and at the early polyA signal. Akt kinase inhibition resulted in hnRNP L dephosphorylation and reduced association of hnRNP L with HPV16 mRNAs. This was accompanied by an increased binding of U2AF65 and Sam68 to HPV16 mRNAs. Furthermore, siRNA knock-down of hnRNP L or Akt induced HPV16 gene expression. Treatment of HPV16 immortalized keratinocytes with Akt kinase inhibitor reduced hnRNP L binding to HPV16 mRNAs and induced HPV16 L1 mRNA production. Finally, deletion of the hnRNP L binding sites in HPV16 subgenomic expression plasmids resulted in activation of HPV16 late gene expression. In conclusion, the Akt kinase inhibits HPV16 late gene expression at the level of RNA processing by controlling the RNA-binding protein hnRNP L. We speculate that Akt kinase activity upholds an intracellular milieu that favours HPV16 early gene expression and suppresses HPV16 late gene expression. PMID:28934469
Doyle, Michael L; Tian, Shin-Shay; Miller, Stephen G; Kessler, Linda; Baker, Audrey E; Brigham-Burke, Michael R; Dillon, Susan B; Duffy, Kevin J; Keenan, Richard M; Lehr, Ruth; Rosen, Jon; Schneeweis, Lumelle A; Trill, John; Young, Peter R; Luengo, Juan I; Lamb, Peter
2003-03-14
Granulocyte colony-stimulating factor regulates neutrophil production by binding to a specific receptor, the granulocyte colony-stimulating factor receptor, expressed on cells of the granulocytic lineage. Recombinant forms of granulocyte colony-stimulating factor are used clinically to treat neutropenias. As part of an effort to develop granulocyte colony-stimulating factor mimics with the potential for oral bioavailability, we previously identified a nonpeptidyl small molecule (SB-247464) that selectively activates murine granulocyte colony-stimulating factor signal transduction pathways and promotes neutrophil formation in vivo. To elucidate the mechanism of action of SB-247464, a series of cell-based and biochemical assays were performed. The activity of SB-247464 is strictly dependent on the presence of zinc ions. Titration microcalorimetry experiments using a soluble murine granulocyte colony-stimulating factor receptor construct show that SB-247464 binds to the extracellular domain of the receptor in a zinc ion-dependent manner. Analytical ultracentrifugation studies demonstrate that SB-247464 induces self-association of the N-terminal three-domain fragment in a manner that is consistent with dimerization. SB-247464 induces internalization of granulocyte colony-stimulating factor receptor on intact cells, consistent with a mechanism involving receptor oligomerization. These data show that small nonpeptidyl compounds are capable of selectively binding and inducing productive oligomerization of cytokine receptors.
Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.
Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K
2012-11-01
Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.
Activation of Elongation Factor G by Phosphate Analogues
Salsi, Enea; Farah, Elie
2016-01-01
EF-G is a universally conserved translational GTPase that promotes the translocation of tRNA and mRNA through the ribosome. EF-G binds to the ribosome in a GTP-bound form and subsequently catalyzes GTP hydrolysis. The contribution of the ribosome-stimulated GTP hydrolysis by EF-G to tRNA/mRNA translocation remains debated. Here, we show that while EF-G•GDP does not stably bind to the ribosome and induce translocation, EFG• GDP in complex with phosphate group analogues BeF3− and AlF4− promotes the translocation of tRNA and mRNA. Furthermore, the rates of mRNA translocation induced by EF-G in the presence of GTP and a non-hydrolysable analogue of GTP, GDP•BeF3−are similar. Our results are consistent with the model suggesting that GTP hydrolysis is not directly coupled to mRNA/tRNA translocation. Hence, GTP binding is required to induce the activated, translocation-competent conformation of EF-G while GTP hydrolysis triggers EF-G release from the ribosome. PMID:27063503
Intercellular Adhesion Molecule-5 Induces Dendritic Outgrowth by Homophilic Adhesion
Tian, Li; Nyman, Henrietta; Kilgannon, Patrick; Yoshihara, Yoshihiro; Mori, Kensaku; Andersson, Leif C.; Kaukinen, Sami; Rauvala, Heikki; Gallatin, W. Michael; Gahmberg, Carl G.
2000-01-01
Intercellular adhesion molecule-5 (ICAM-5) is a dendritically polarized membrane glycoprotein in telencephalic neurons, which shows heterophilic binding to leukocyte β2-integrins. Here, we show that the human ICAM-5 protein interacts in a homophilic manner through the binding of the immunoglobulin domain 1 to domains 4–5. Surface coated ICAM-5-Fc promoted dendritic outgrowth and arborization of ICAM- 5–expressing hippocampal neurons. During dendritogenesis in developing rat brain, ICAM-5 was in monomer form, whereas in mature neurons it migrated as a high molecular weight complex. The findings indicate that its homophilic binding activity was regulated by nonmonomer/monomer transition. Thus, ICAM-5 displays two types of adhesion activity, homophilic binding between neurons and heterophilic binding between neurons and leukocytes. PMID:10893271
Wang, Tongtong; Zhang, Xiujuan; Chen, Yu; Cui, Beibei; Li, Delong; Zhao, Xiaomin; Zhang, Wenlong; Chang, Lingling; Tong, Dewen
2016-01-01
Porcine circovirus type 2 (PCV2) infection caused PCV2-associated diseases (PCVAD) is one of the major emerging immunosuppression diseases in pig industry. In this study, we investigated how PCV2 inoculation increases interleukin (IL)-10 expression in porcine alveolar macrophages (PAMs). PCV2 inoculation significantly upregulated IL-10 expression compared with PCV1. Upon initial PCV2 inoculation, PI3K/Akt cooperated with NF-κB pathways to promote IL-10 transcription via p50, CREB and Ap1 transcription factors, whereas inhibition of PI3K/Akt activation blocked Ap1 and CREB binding to the il10 promoter, and decreased the binding level of NF-κB1 p50 with il10 promoter, leading to great reduction in early IL-10 transcription. In the later phase of inoculation, PCV2 further activated p38 MAPK and ERK pathways to enhance IL-10 production by promoting Sp1 binding to the il10 promoter. For PCV2-induced IL-10 production in macrophages, PCV2 capsid protein Cap, but not the replicase Rep or ORF3, was the critical component. Cap activated PI3K/Akt, p38 MAPK, and ERK signaling pathways to enhance IL-10 expression. In the whole process, gC1qR mediated PCV2-induced PI3K/Akt and p38 MAPK activation to enhance IL-10 induction by interaction with Cap. Depletion of gC1qR blocked PI3K/Akt and p38 MAPK activation, resulting in significant decrease in IL-10 production in PCV2-inoculated cells. Thus, gC1qR might be a critical functional receptor for PCV2-induced IL-10 production. Taken together, these data demonstrated that Cap protein binding with host gC1qR induction of PI3K/Akt and p38 MAPK signalings activation is a critical process in enhancing PCV2-induced IL-10 production in porcine alveolar macrophages. PMID:26883107
Flevaris, Panagiotis; Li, Zhenyu; Zhang, Guoying; Zheng, Yi; Liu, Junling
2009-01-01
Mitogen-activated protein kinases (MAPK), p38, and extracellular stimuli-responsive kinase (ERK), are acutely but transiently activated in platelets by platelet agonists, and the agonist-induced platelet MAPK activation is inhibited by ligand binding to the integrin αIIbβ3. Here we show that, although the activation of MAPK, as indicated by MAPK phosphorylation, is initially inhibited after ligand binding to integrin αIIbβ3, integrin outside-insignaling results in a late but sustained activation of MAPKs in platelets. Furthermore, we show that the early agonist-induced MAPK activation and the late integrin-mediated MAPK activation play distinct roles in different stages of platelet activation. Agonist-induced MAPK activation primarily plays an important role in stimulating secretion of platelet granules, while integrin-mediated MAPK activation is important in facilitating clot retraction. The stimulatory role of MAPK in clot retraction is mediated by stimulating myosin light chain (MLC) phosphorylation. Importantly, integrin-dependent MAPK activation, MAPK-dependent MLC phosphorylation, and clot retraction are inhibited by a Rac1 inhibitor and in Rac1 knockout platelets, indicating that integrin-induced activation of MAPK and MLC and subsequent clot retraction is Rac1-dependent. Thus, our results reveal 2 different activation mechanisms of MAPKs that are involved in distinct aspects of platelet function and a novel Rac1-MAPK–dependent cell retractile signaling pathway. PMID:18957688
Hwang, Daniel H; Kim, Jeong-A; Lee, Joo Young
2016-08-15
Saturated fatty acids can activate Toll-like receptor 2 (TLR2) and TLR4 but polyunsaturated fatty acids, particularly docosahexaenoic acid (DHA) inhibit the activation. Lipopolysaccharides (LPS) and lipopetides, ligands for TLR4 and TLR2, respectively, are acylated by saturated fatty acids. Removal of these fatty acids results in loss of their ligand activity suggesting that the saturated fatty acyl moieties are required for the receptor activation. X-ray crystallographic studies revealed that these saturated fatty acyl groups of the ligands directly occupy hydrophobic lipid binding domains of the receptors (or co-receptor) and induce the dimerization which is prerequisite for the receptor activation. Saturated fatty acids also induce the dimerization and translocation of TLR4 and TLR2 into lipid rafts in plasma membrane and this process is inhibited by DHA. Whether saturated fatty acids induce the dimerization of the receptors by interacting with these lipid binding domains is not known. Many experimental results suggest that saturated fatty acids promote the formation of lipid rafts and recruitment of TLRs into lipid rafts leading to ligand independent dimerization of the receptors. Such a mode of ligand independent receptor activation defies the conventional concept of ligand induced receptor activation; however, this may enable diverse non-microbial molecules with endogenous and dietary origins to modulate TLR-mediated immune responses. Emerging experimental evidence reveals that TLRs play a key role in bridging diet-induced endocrine and metabolic changes to immune responses. Published by Elsevier B.V.
Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen
2017-01-01
RING-BETWEENRING-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR is Parkin, mutations in which lead to early onset hereditary Parkinsonism. Parkin and other RBRs share a catalytic RBR module, but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during activation of Parkin. However, current data on active RBRs are in the absence of regulatory domains. Therefore, how individual RBRs are activated, and whether they share a common mechanism remains unclear. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces a movement in the IBR domain to reveal a cryptic ubiquitin binding site. Mutation of this site negatively impacts on Parkin’s activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, suggesting a role for interdomain association in RBR ligase mechanism. PMID:28414322
Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen
2017-05-01
RING-between-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR ligase is Parkin, mutations in which lead to early-onset hereditary Parkinsonism. Parkin and other RBR ligases share a catalytic RBR module but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during Parkin activation. However, current data on active RBR ligases reflect the absence of regulatory domains. Therefore, it remains unclear how individual RBR ligases are activated, and whether they share a common mechanism. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces movement in the 'in-between RING' (IBR) domain to reveal a cryptic ubiquitin-binding site. Mutation of this site negatively affects Parkin's activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, which suggests a role for interdomain association in the RBR ligase mechanism.
CXCL4 is a novel nickel-binding protein and augments nickel allergy.
Kuroishi, T; Bando, K; Tanaka, Y; Shishido, K; Kinbara, M; Ogawa, T; Muramoto, K; Endo, Y; Sugawara, S
2017-08-01
Nickel (Ni) is the most frequent metal allergen and induces a TH 1 -dependent type-IV allergy. Although Ni 2+ is considered to bind to endogenous proteins, it currently remains unclear whether these Ni-binding proteins are involved in Ni allergy in vivo. We previously reported the adjuvant effects of lipopolysaccharide (LPS) in a Ni allergy mouse model. As LPS induces a number of inflammatory mediators, we hypothesized that Ni-binding protein(s) are also induced by LPS. The objective of this study was to purify and identify Ni-binding protein(s) from serum taken from LPS-injected mice (referred as LPS serum) and examined the augmenting effects of these Ni-binding protein(s) on Ni allergy in an in vivo model. BALB/cA mice were sensitized with an i.p. injection of NiCl 2 and LPS. Ten days after sensitization, mice were challenged with NiCl 2 by an i.d. injection into ear pinnae. Ni-binding protein(s) were purified by Ni-affinity column chromatography and gel filtration. Lipopolysaccharide serum, but not serum taken from saline-injected mice, augmented ear swelling induced by Ni-allergic inflammation. Ni-binding, but not non-binding fraction, purified from LPS serum augmented Ni-allergic inflammation. Mass spectrometry and Western blotting detected CXCL4 in the active fraction. A batch analysis with Ni-sepharose and a surface plasmon resonance analysis revealed direct binding between CXCL4 and Ni 2+ . Recombinant CXCL4 augmented Ni-allergic inflammation and exerted adjuvant effects at the sensitization phase. These results indicate that CXCL4 is a novel Ni-binding protein that augments Ni allergy at the elicitation and sensitization phases. This is the first study to demonstrate that the Ni-binding protein augments Ni allergy in vivo. © 2017 John Wiley & Sons Ltd.
Fukushima, Toshiaki; Nakamura, Yusaku; Yamanaka, Daisuke; Shibano, Takashi; Chida, Kazuhiro; Minami, Shiro; Asano, Tomoichiro; Hakuno, Fumihiko; Takahashi, Shin-Ichiro
2012-01-01
Continuous stimulation of cells with insulin-like growth factors (IGFs) in G1 phase is a well established requirement for IGF-induced cell proliferation; however, the molecular components of this prolonged signaling pathway that is essential for cell cycle progression from G1 to S phase are unclear. IGF-I activates IGF-I receptor (IGF-IR) tyrosine kinase, followed by phosphorylation of substrates such as insulin receptor substrates (IRS) leading to binding of signaling molecules containing SH2 domains, including phosphatidylinositol 3-kinase (PI3K) to IRS and activation of the downstream signaling pathways. In this study, we found prolonged (>9 h) association of PI3K with IGF-IR induced by IGF-I stimulation. PI3K activity was present in this complex in thyrocytes and fibroblasts, although tyrosine phosphorylation of IRS was not yet evident after 9 h of IGF-I stimulation. IGF-I withdrawal in mid-G1 phase impaired the association of PI3K with IGF-IR and suppressed DNA synthesis the same as when PI3K inhibitor was added. Furthermore, we demonstrated that Tyr1316-X-X-Met of IGF-IR functioned as a PI3K binding sequence when this tyrosine is phosphorylated. We then analyzed IGF signaling and proliferation of IGF-IR−/− fibroblasts expressing exogenous mutant IGF-IR in which Tyr1316 was substituted with Phe (Y1316F). In these cells, IGF-I stimulation induced tyrosine phosphorylation of IGF-IR and IRS-1/2, but mutated IGF-IR failed to bind PI3K and to induce maximal phosphorylation of GSK3β and cell proliferation in response to IGF-I. Based on these results, we concluded that PI3K activity bound to IGF-IR, which is continuously sustained by IGF-I stimulation, is required for IGF-I-induced cell proliferation. PMID:22767591
Rotenone Activates Phagocyte NADPH Oxidase through Binding to Its Membrane Subunit gp91phox
Zhou, Hui; Zhang, Feng; Chen, Shih-heng; Zhang, Dan; Wilson, Belinda; Hong, Jau-shyong; Gao, Hui-Ming
2011-01-01
Rotenone, a widely used pesticide, reproduces Parkinsonism in rodents and associates with increased risk for Parkinson’s disease. We previously reported rotenone increased superoxide production through stimulating microglial phagocyte NADPH oxidase (PHOX). The present study identified a novel mechanism by which rotenone activates PHOX. Ligand-binding assay revealed that rotenone directly bound to membrane gp91phox, the catalytic subunit of PHOX; such binding was inhibited by diphenyleneiodonium, a PHOX inhibitor with a binding site on gp91phox. Functional studies showed both membrane and cytosolic subunits were required for rotenone-induced superoxide production in cell-free systems, intact phagocytes, and COS7 cells transfected with membrane subunits (gp91phox/p22phox) and cytosolic subunits (p67phox and p47phox). Rotenone-elicited extracellular superoxide release in p47phox-deficient macrophages suggested rotenone enabled to activate PHOX through a p47phox-independent mechanism. Increased membrane translocation of p67phox, elevated binding of p67phox to rotenone-treated membrane fractions, and co-immunoprecipitation of p67phox and gp91phox in rotenone-treated wild-type and p47phox-deficient macrophages indicated p67phox played a critical role in rotenone-induced PHOX activation via its direct interaction with gp91phox. Rac1, a Rho-like small GTPase, enhanced p67phox-gp91phox interaction; Rac1 inhibition decreased rotenone-elicited superoxide release. In conclusion, rotenone directly interacted with gp91phox; such an interaction triggered membrane translocation of p67phox, leading to PHOX activation and superoxide production. PMID:22094225
Surfactants reduce platelet-bubble and platelet-platelet binding induced by in vitro air embolism.
Eckmann, David M; Armstead, Stephen C; Mardini, Feras
2005-12-01
The effect of gas bubbles on platelet behavior is poorly characterized. The authors assessed platelet-bubble and platelet-platelet binding in platelet-rich plasma in the presence and absence of bubbles and three surface-active compounds. Platelet-rich plasma was prepared from blood drawn from 16 volunteers. Experimental groups were surfactant alone, sparging (microbubble embolization) alone, sparging with surfactant, and neither sparging nor surfactant. The surfactants were Pluronic F-127 (Molecular Probes, Eugene, OR), Perftoran (OJSC SPC Perftoran, Moscow, Russia), and Dow Corning Antifoam 1510US (Dow Corning, Midland, MI). Videomicroscopy images of specimens drawn through rectangular glass microcapillaries on an inverted microscope and Coulter counter measurements were used to assess platelet-bubble and platelet-platelet binding, respectively, in calcium-free and recalcified samples. Histamine-induced and adenosine diphosphate-induced platelet-platelet binding were measured in unsparged samples. Differences between groups were considered significant for P < 0.05 using analysis of variance and the Bonferroni correction. Sixty to 100 platelets adhered to bubbles in sparged, surfactant-free samples. With sparging and surfactant, few platelets adhered to bubbles. Numbers of platelet singlets and multimers not adherent to bubbles were different (P < 0.05) compared both with unsparged samples and sparged samples without surfactant. No significant platelet-platelet binding occurred in uncalcified, sparged samples, although 20-30 platelets adhered to bubbles. Without sparging, histamine and adenosine diphosphate provoked platelet-platelet binding with and without surfactants present. Sparging causes platelets to bind to air bubbles and each other. Surfactants added before sparging attenuate platelet-bubble and platelet-platelet binding. Surfactants may have a clinical role in attenuating gas embolism-induced platelet-bubble and platelet-platelet binding.
Stieglitz, Kimberly A.; Pastra-Landis, Styliani C.; Xia, Jiarong; Tsuruta, Hiro; Kantrowitz, Evan R.
2005-01-01
Modeling of the tetrahedral intermediate within the active site of Escherichia coli aspartate transcarbamoylase revealed a specific interaction with the side chain of Gln137, an interaction not previously observed in the structure of the X-ray enzyme in the presence of N-phosphonacetyl-L-aspartate (PALA). Previous site-specific mutagenesis experiments showed that when Gln137 was replaced by alanine, the resulting mutant enzyme (Q137A) exhibited approximately 50-fold less activity than the wild-type enzyme, exhibited no homotropic cooperativity, and the binding of both carbamoyl phosphate and aspartate were extremely compromised. To elucidate the structural alterations in the mutant enzyme that might lead to such pronounced changes in kinetic and binding properties, the Q137A enzyme was studied by time-resolved small-angle X-ray scattering and its structure was determined in the presence of PALA to 2.7Å resolution. Time-resolved small-angle X-ray scattering established that the natural substrates, carbamoyl phosphate and L-aspartate, do not induce in the Q137A enzyme the same conformational changes as observed for the wild-type enzyme, although the scattering pattern of the Q137A and wild-type enzymes in the presence of PALA were identical. The overall structure of the Q137A enzyme is similar to that of the R-state structure of wild-type enzyme with PALA bound. However, there are differences in the manner by which the Q137A enzyme coordinates PALA, especially in the side chain positions of Arg105 and His134. The replacement of Gln137 by Ala also has a dramatic effect on the electrostatics of the active site. These data taken together suggest that the side chain of Gln137 in the wild-type enzyme is required for the binding of carbamoyl phosphate in the proper orientation so as to induce conformational changes required for the creation of the high-affinity aspartate binding site. The inability of carbamoyl phosphate to create the high-affinity binding site in the Q137A enzyme results in an enzyme locked in the low activity low affinity T state. These results emphasize the absolute requirement of the binding of carbamoyl phosphate for the creation of the high-affinity aspartate binding site and for inducing the homotropic cooperativity in aspartate transcarbamoylase. PMID:15890205
Kleckner, Ian R.; McElroy, Craig A.; Kuzmic, Petr; Gollnick, Paul; Foster, Mark P.
2014-01-01
The trp RNA-binding Attenuation Protein (TRAP) assembles into an 11-fold symmetric ring that regulates transcription and translation of trp-mRNA in bacilli via heterotropic allosteric activation by the amino acid tryptophan (Trp). Whereas nuclear magnetic resonance studies have revealed that Trp-induced activation coincides with both μs-ms rigidification and local structural changes in TRAP, the pathway of binding of the 11 Trp ligands to the TRAP ring remains unclear. Moreover, because each of eleven bound Trp molecules is completely surrounded by protein, its release requires flexibility of Trp-bound (holo) TRAP. Here, we used stopped-flow fluorescence to study the kinetics of Trp binding by Bacillus stearothermophilus TRAP over a range of temperatures and we observed well-separated kinetic steps. These data were analyzed using non-linear least-squares fitting of several two- and three-step models. We found that a model with two binding steps best describes the data, although the structural equivalence of the binding sites in TRAP implies a fundamental change in the time-dependent structure of the TRAP rings upon Trp binding. Application of the two binding step model reveals that Trp binding is much slower than the diffusion limit, suggesting a gating mechanism that depends on the dynamics of apo TRAP. These data also reveal that Trp dissociation from the second binding mode is much slower than after the first Trp binding mode, revealing insight into the mechanism for positive homotropic allostery, or cooperativity. Temperature dependent analyses reveal that both binding modes imbue increases in bondedness and order toward a more compressed active state. These results provide insight into mechanisms of cooperative TRAP activation, and underscore the importance of protein dynamics for ligand binding, ligand release, protein activation, and allostery. PMID:24224873
14-3-3 proteins mediate inhibitory effects of cAMP on salt-inducible kinases (SIKs).
Sonntag, Tim; Vaughan, Joan M; Montminy, Marc
2018-02-01
The salt-inducible kinase (SIK) family regulates cellular gene expression via the phosphorylation of cAMP-regulated transcriptional coactivators (CRTCs) and class IIA histone deacetylases, which are sequestered in the cytoplasm by phosphorylation-dependent 14-3-3 interactions. SIK activity toward these substrates is inhibited by increases in cAMP signaling, although the underlying mechanism is unclear. Here, we show that the protein kinase A (PKA)-dependent phosphorylation of SIKs inhibits their catalytic activity by inducing 14-3-3 protein binding. SIK1 and SIK3 contain two functional PKA/14-3-3 sites, while SIK2 has four. In keeping with the dimeric nature of 14-3-3s, the presence of multiple binding sites within target proteins dramatically increases binding affinity. As a result, loss of a single 14-3-3-binding site in SIK1 and SIK3 abolished 14-3-3 association and rendered them insensitive to cAMP. In contrast, mutation of three sites in SIK2 was necessary to fully block cAMP regulation. Superimposed on the effects of PKA phosphorylation and 14-3-3 association, an evolutionary conserved domain in SIK1 and SIK2 (the so called RK-rich region; 595-624 in hSIK2) is also required for the inhibition of SIK2 activity. Collectively, these results point to a dual role for 14-3-3 proteins in repressing a family of Ser/Thr kinases as well as their substrates. © 2017 Federation of European Biochemical Societies.
PtdIns(3,4,5)P3 binding is necessary for WAVE2-induced formation of lamellipodia.
Oikawa, Tsukasa; Yamaguchi, Hideki; Itoh, Toshiki; Kato, Masayoshi; Ijuin, Takeshi; Yamazaki, Daisuke; Suetsugu, Shiro; Takenawa, Tadaomi
2004-05-01
Polarized cell movement is triggered by the development of a PtdIns(3,4,5)P(3) gradient at the membrane, which is followed by rearrangement of the actin cytoskeleton. The WASP family verprolin homologous protein (WAVE) is essential for lamellipodium formation at the leading edge by activating the Arp2/3 complex downstream of Rac GTPase. Here, we report that WAVE2 binds to PtdIns(3,4,5)P(3) through its basic domain. The amino-terminal portion of WAVE2, which includes the PtdIns(3,4,5)P(3)-binding sequence, was localized at the leading edge of lamellipodia induced by an active form of Rac (RacDA) or by treatment with platelet-derived growth factor (PDGF). Production of PtdIns(3,4,5)P(3) at the cell membrane by myristoylated phosphatidylinositol-3-OH kinase (PI(3)K) is sufficient to recruit WAVE2 in the presence of dominant-negative Rac and latrunculin, demonstrating that PtdIns(3,4,5)P(3) alone is able to recruit WAVE2. Expression of a full-length mutant of WAVE2 that lacks the lipid-binding activity inhibited proper formation of lamellipodia induced by RacDA. These results suggest that one of the products of PI(3)K, PtdIns(3,4,5)P(3), recruits WAVE2 to the polarized membrane and that this recruitment is essential for lamellipodium formation at the leading edge.
Increased phencyclidine-induced hyperactivity following cortical cholinergic denervation.
Mattsson, Anna; Lindqvist, Eva; Ogren, Sven Ove; Olson, Lars
2005-11-07
Altered cholinergic function is considered as a potential contributing factor in the pathogenesis of schizophrenia. We hypothesize that cortical cholinergic denervation may result in changes in glutamatergic activity. Therefore, we lesioned the cholinergic corticopetal projections by local infusion of 192 IgG-saporin into the nucleus basalis magnocellularis of rats. Possible effects of this lesion on glutamatergic systems were examined by phencyclidine-induced locomotor activity, and also by N-methyl-D-aspartate receptor binding. We find that cholinergic lesioning of neocortex leads to enhanced sensitivity to phencyclidine in the form of a dramatic increase in horizontal activity. Further, N-methyl-D-aspartate receptor binding is unaffected in denervated rats. These results suggest that aberrations in cholinergic function might lead to glutamatergic dysfunctions, which might be of relevance for the pathophysiology for schizophrenia.
Li, Wencheng; Liu, Jiao; Hammond, Sean L.; Tjalkens, Ronald B.; Saifudeen, Zubaida
2015-01-01
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet and supplied 0.9% saline as the drinking solution to C57BL/6J mice. Sham pellet-implanted mice that were provided regular drinking water served as controls. Concurrently, mice were intracerebroventricularly infused with the AT1R blocker losartan, angiotensin-converting-enzyme inhibitor captopril, or artificial cerebrospinal fluid for 3 wk. Intracerebroventricular infusion of losartan or captopril attenuated DOCA-salt-induced PRR mRNA elevation in the paraventricular nucleus of the hypothalamus, suggesting a role for ANG II/AT1R signaling in regulating PRR expression during DOCA-salt hypertension. To test which ANG II/AT1R downstream transcription factors were involved in PRR regulation, we treated Neuro-2A cells with ANG II with or without CREB (cAMP response element-binding protein) or AP-1 (activator protein-1) inhibitors, or CREB siRNA. CREB and AP-1 inhibitors, as well as CREB knockdown abolished ANG II-induced increases in PRR levels. ANG II also induced PRR upregulation in primary cultured neurons. Chromatin immunoprecipitation assays revealed that ANG II treatment increased CREB binding to the endogenous PRR promoter in both cultured neurons and hypothalamic tissues of DOCA-salt hypertensive mice. This increase in CREB activity was reversed by AT1R blockade. Collectively, these findings indicate that ANG II acts via AT1R to upregulate PRR expression both in cultured cells and in DOCA-salt hypertensive mice by increasing CREB binding to the PRR promoter. PMID:25994957
Wang, Wei-Jan; Li, Chien-Feng; Chu, Yu-Yi; Wang, Yu-Hui; Hour, Tzyh-Chyuan; Yen, Chia-Jui; Chang, Wen-Chang; Wang, Ju-Ming
2017-01-15
Cisplatin (CDDP) is frequently used in combination chemotherapy with paclitaxel for treating urothelial carcinoma of the urinary bladder (UCUB). CDDP cross-resistance has been suggested to develop with paclitaxel, thus hindering successful UCUB treatment. Therefore, elucidating the mechanisms underlying CDDP-induced anticancer drug resistance is imperative and may provide an insight in developing novel therapeutic strategy. Loss-of-function assays were performed to elucidate the role of the EGFR and STAT3 in CDDP-induced CCAAT/enhancer-binding protein delta (CEBPD) expression in UCUB cells. Reporter and in vivo DNA-binding assays were employed to determine whether CEBPD directly regulates ATP binding cassette subfamily B member 1 (ABCB1) and ATP binding cassette subfamily C member 2 (ABCC2) activation. Finally, a xenograft animal assay was used to examine the abilities of gefitinib and S3I-201 (a STAT3 inhibitor) to reverse CDDP and paclitaxel sensitivity. CEBPD expression was maintained in postoperative chemotherapy patients, and this expression was induced by CDDP even in CDDP-resistant UCUB cells. Upon CDDP treatment, CEBPD activated ABCB1 and ABCC2. Furthermore, the EGFR/STAT3 pathway contributed to CDDP-induced CEBPD expression in UCUB cells. Gefitinib and S3I-201 treatment significantly reduced the expression of CEBPD and enhanced the sensitivity of CDDP-resistant UCUB cells to CDDP and paclitaxel. Our results revealed the risk of CEBPD activation in CDDP-resistant UCUB cells and suggested a therapeutic strategy for patients with UCUB or UCUB resisted to CDDP and paclitaxel by combination with either gefitinib or S3I-201. Clin Cancer Res; 23(2); 503-13. ©2016 AACR. ©2016 American Association for Cancer Research.
Huang, Jianhua; Li, Li; Yuan, Weifeng; Zheng, Linxin
2016-01-01
The aim of the present study is to investigate the protective effects and relevant mechanisms exerted by NEMO-binding domain peptide (NBD) against lipopolysaccharide- (LPS-) induced acute lung injury (ALI) in mice. The ALI model was induced by intratracheally administered atomized LPS (5 mg/kg) to BABL/c mice. Half an hour before LPS administration, we treated the mice with increasing concentrations of intratracheally administered NBD or saline aerosol. Two hours after LPS administration, each group of mice was sacrificed. We observed that NBD pretreatment significantly attenuated LPS-induced lung histopathological injury in a dose-dependent manner. Western blotting established that NBD pretreatment obviously attenuated LPS-induced IκB-α and NF-κBp65 activation and NOX1, NOX2, and NOX4 overexpression. Furthermore, NBD pretreatment increased SOD and T-AOC activity and decreased MDA levels in lung tissue. In addition, NBD also inhibited TNF-α and IL-1β secretion in BALF after LPS challenge. In conclusion, NBD protects against LPS-induced ALI in mice. PMID:27956761
HIV-1, HTLV-I and the interleukin-2 receptor: insights into transcriptional control.
Böhnlein, E; Lowenthal, J W; Wano, Y; Franza, B R; Ballard, D W; Greene, W C
1989-01-01
In this study, we present direct evidence for the binding of the inducible cellular protein, HIVEN86A, to a 12-bp element present in the IL-2R alpha promoter. This element shares significant sequence similarity with the NF-kappa B binding sites present in the HIV-1 and kappa immunoglobulin enhancers. Transient transfection studies indicate that this kappa B element is both necessary and sufficient to confer tax or mitogen inducibility to a heterologous promoter. As summarized schematically in Fig. 5, the findings suggest that the HIVEN86A protein may play a central role in the activation of cellular genes required for T-cell growth, specifically the IL-2R alpha gene. In addition, the induced HIVEN86A protein also binds to a similar sequence present in the HIV-1 LTR leading to enhanced viral gene expression and ultimately T-cell death. Thus, mitogen activation of the HIV-1 LTR appears to involve the same inducible transcription factor(s) that normally regulates IL-2R alpha gene expression and T-cell growth. These findings further underscore the importance of the state of T-cell activation in the regulation of HIV-1 replication. Our results also demonstrate that HIVEN86A is induced by the tax protein of HTLV-I. Thus, in HTLV-I infected cells, normally the tight control of the transient expression of the IL-2R alpha gene is lost. The constitutive high-level display of IL-2 receptors may play a role in leukemic transformation mediated by HTLV-I (ATL). Apparently by the same mechanism, the tax protein also activates the HIV-1 LTR through the induction of HIVEN86A.(ABSTRACT TRUNCATED AT 250 WORDS)
Assanasen, Chatchawin; Mineo, Chieko; Seetharam, Divya; Yuhanna, Ivan S.; Marcel, Yves L.; Connelly, Margery A.; Williams, David L.; de la Llera-Moya, Margarita; Shaul, Philip W.; Silver, David L.
2005-01-01
The binding of HDL to scavenger receptor–BI (SR-BI) mediates cholesterol movement. HDL also induces multiple cellular signals, which in endothelium occur through SR-BI and converge to activate eNOS. To determine the molecular basis of a signaling event induced by HDL, we examined the proximal mechanisms in HDL activation of eNOS. In endothelial cells, HDL and methyl-β-cyclodextrin caused comparable eNOS activation, whereas cholesterol-loaded methyl-β-cyclodextrin had no effect. Phosphatidylcholine-loaded HDL caused greater stimulation than native HDL, and blocking antibody against SR-BI, which prevents cholesterol efflux, prevented eNOS activation. In a reconstitution model in COS-M6 cells, wild-type SR-BI mediated eNOS activation by both HDL and small unilamellar vesicles (SUVs), whereas the SR-BI mutant AVI, which is incapable of efflux to SUV, transmitted signal by only HDL. In addition, eNOS activation by methyl-β-cyclodextrin was SR-BI dependent. Studies of mutant and chimeric class B scavenger receptors revealed that the C-terminal cytoplasmic PDZ-interacting domain and the C-terminal transmembrane domains of SR-BI are both necessary for HDL signaling. Furthermore, we demonstrated direct binding of cholesterol to the C-terminal transmembrane domain using a photoactivated derivative of cholesterol. Thus, HDL signaling requires cholesterol binding and efflux and C-terminal domains of SR-BI, and SR-BI serves as a cholesterol sensor on the plasma membrane. PMID:15841181
Chemically induced and light-independent cryptochrome photoreceptor activation.
Rosenfeldt, Gesa; Viana, Rafael Muñoz; Mootz, Henning D; von Arnim, Albrecht G; Batschauer, Alfred
2008-01-01
The cryptochrome photoreceptors of higher plants are dimeric proteins. Their N-terminal photosensory domain mediates dimerization, and the unique C-terminal extension (CCT) mediates signaling. We made use of the human FK506-binding protein (FKBP) that binds with high affinity to rapamycin or rapamycin analogs (rapalogs). The FKBP-rapamycin complex is recognized by another protein, FRB, thus allowing rapamycin-induced dimerization of two target proteins. Here we demonstrate by bioluminescence resonance energy transfer (BRET) assays the applicability of this regulated dimerization system to plants. Furthermore, we show that fusion proteins consisting of the C-terminal domain of Arabidopsis cryptochrome 2 fused to FKBP and FRB and coexpressed in Arabidopsis cells specifically induce the expression of cryptochrome-controlled reporter and endogenous genes in darkness upon incubation with the rapalog. These results demonstrate that the activation of cryptochrome signal transduction can be chemically induced in a dose-dependent fashion and uncoupled from the light signal, and provide the groundwork for gain-of-function experiments to study specifically the role of photoreceptors in darkness or in signaling cross-talk even under light conditions that activate members of all photoreceptor families.
Seib, Kate L; Brunelli, Brunella; Brogioni, Barbara; Palumbo, Emmanuelle; Bambini, Stefania; Muzzi, Alessandro; DiMarcello, Federica; Marchi, Sara; van der Ende, Arie; Aricó, Beatrice; Savino, Silvana; Scarselli, Maria; Comanducci, Maurizio; Rappuoli, Rino; Giuliani, Marzia M; Pizza, Mariagrazia
2011-02-01
Neisseria meningitidis is a commensal of the human nasopharynx but is also a major cause of septicemia and meningitis. The meningococcal factor H binding protein (fHbp) binds human factor H (fH), enabling downregulation of complement activation on the bacterial surface. fHbp is a component of two serogroup B meningococcal vaccines currently in clinical development. Here we characterize 12 fHbp subvariants for their level of surface exposure and ability to bind fH, to mediate serum resistance, and to induce bactericidal antibodies. Flow cytometry and Western analysis revealed that all strains examined expressed fHbp on their surface to different extents and bound fH in an fHbp-dependent manner. However, differences in fH binding did not always correlate with the level of fHbp expression, indicating that this is not the only factor affecting the amount of fH bound. To overcome the issue of strain variability in fHbp expression, the MC58ΔfHbp strain was genetically engineered to express different subvariants from a constitutive heterologous promoter. These recombinant strains were characterized for fH binding, and the data confirmed that each subvariant binds different levels of fH. Surface plasmon resonance revealed differences in the stability of the fHbp-fH complexes that ranged over 2 orders of magnitude, indicating that differences in residues between and within variant groups can influence fH binding. Interestingly, the level of survival in human sera of recombinant MC58 strains expressing diverse subvariants did not correlate with the level of fH binding, suggesting that the interaction of fHbp with fH is not the only function of fHbp that influences serum resistance. Furthermore, cross-reactive bactericidal activity was seen within each variant group, although the degree of activity varied, suggesting that amino acid differences within each variant group influence the bactericidal antibody response.
Mutations that abolish the ability of Ha-Ras to associate with Raf-1.
Shirouzu, M; Koide, H; Fujita-Yoshigaki, J; Oshio, H; Toyama, Y; Yamasaki, K; Fuhrman, S A; Villafranca, E; Kaziro, Y; Yokoyama, S
1994-08-01
Recent studies have revealed that Ras can associate physically with Raf. In the present study, we tested 34 mutants of Ha-Ras carrying substitution(s) in the region of residues 23-71 for their ability to associate with Raf-1. Mouse Ba/F3 cell lysates were incubated with each mutant Ras protein, in either the guanosine 5'-[gamma-thio]triphosphate (GTP gamma S)- or the guanosine 5'-[beta-thio]diphosphate (GDP beta S)-bound form, and the anti-Ras antibody Y13-238. The immunoprecipitates were analysed for the presence of Raf-1 by Western blotting with an anti-Raf-1 antibody. Six mutants of Ras, E31K, P34G, T35S, D38N, D57A and A59T, failed to bind Raf-1. Mutations N26G, V29A, S39A, Y40W, R41A, V44A, V45E, L56A and T58A partially reduced the ability to bind Raf-1. All the other mutants could associate with Raf-1 with nearly the same efficiency as that of wild-type Ras. Thus, the Raf-I-binding ability of Ras appears to be affected by mutations in the N-terminal region, and in particular, by those in and neighboring the effector region (residues 32-40) and in the region (residues 56-59) flanking the N-terminal of Switch II. The abilities to bind Raf-1 and to induce neurite outgrowth of pheochromocytoma (PC) 12 cells correlate to each other for 22 Ras mutants. However, mutation A59T, which does not reduce the neurite-inducing or transforming activities, abolishes the ability to bind Raf-1. In contrast, mutations Y32F, K42A and L53A, which impair the neurite-inducing activity of Ras, have no effect on the Ras.Raf-1 association. Partially reduced Raf-1-binding ability was observed for mutants V29A, S39A, Y40W, R41A, V44A, L56A and T58A, which exhibit full neurite-inducing activity, and also for mutant V45E, which has no activity of neurite induction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patarroyo, Manuel E., E-mail: mepatarr@mail.com; Universidad Nacional de Colombia, Bogota; Cifuentes, Gladys
Based on the 3D X-ray crystallographic structures of relevant proteins of the malaria parasite involved in invasion to host cells and 3D NMR structures of High Activity Binding Peptides (HABPs) and their respective analogues, it was found that HABPs are rendered into highly immunogenic and sterile immunity inducers in the Aotus experimental model by modifying those amino acids that establish H-bonds with other HABPs or binding to host's cells. This finding adds striking and novel physicochemical principles, at the atomic level, for a logical and rational vaccine development methodology against infectious disease, among them malaria.
Succinyl-CoA Synthetase is a Phosphate Target for the Activation of Mitochondrial Metabolism
Phillips, Darci; Aponte, Angel M.; French, Stephanie A.; Chess, David J.; Balaban, Robert S.
2009-01-01
Succinyl-CoA synthetase (SCS) is the only mitochondrial enzyme capable of ATP production via substrate level phosphorylation in the absence of oxygen, but it also plays a key role in the citric acid cycle, ketone metabolism and heme synthesis. Inorganic phosphate (Pi) is a signaling molecule capable of activating oxidative phosphorylation at several sites, including NADH generation and as a substrate for ATP formation. In this study it was shown that Pi-binds porcine heart SCS α-subunit (SCSα) in a non-covalent manner and enhances its enzymatic activity, thereby providing a new target for Pi-activation in mitochondria. Coupling 32P-labeling of intact mitochondria with SDS gel electrophoresis revealed that 32P-labeling of SCSα was enhanced in substrate-depleted mitochondria. Using mitochondrial extracts and purified bacterial SCS (BSCS) it was shown that this enhanced 32P-labeling resulted from a simple binding of 32P, not covalent protein phosphorylation. The ability of SCSα to retain its 32P throughout the SDS denaturing gel process was unique over the entire mitochondrial proteome. In vitro studies also revealed a Pi-induced activation of SCS activity by more than 2-fold when mitochondrial extracts and purified BSCS were incubated with mM concentrations of Pi. Since 32P-binding to SCSα was increased in substrate-depleted mitochondria, where matrix Pi concentration is increased, we conclude that SCS activation by Pi-binding represents another mitochondrial target for the Pi-induced activation of oxidative phosphorylation and anaerobic ATP production in energy-limited mitochondria. PMID:19527071
Kranenburg, Onno; Poland, Mieke; van Horck, Francis P. G.; Drechsel, David; Hall, Alan; Moolenaar, Wouter H.
1999-01-01
Neuronal cells undergo rapid growth cone collapse, neurite retraction, and cell rounding in response to certain G protein–coupled receptor agonists such as lysophosphatidic acid (LPA). These shape changes are driven by Rho-mediated contraction of the actomyosin-based cytoskeleton. To date, however, detection of Rho activation has been hampered by the lack of a suitable assay. Furthermore, the nature of the G protein(s) mediating LPA-induced neurite retraction remains unknown. We have developed a Rho activation assay that is based on the specific binding of active RhoA to its downstream effector Rho-kinase (ROK). A fusion protein of GST and the Rho-binding domain of ROK pulls down activated but not inactive RhoA from cell lysates. Using GST-ROK, we show that in N1E-115 neuronal cells LPA activates endogenous RhoA within 30 s, concomitant with growth cone collapse. Maximal activation occurs after 3 min when neurite retraction is complete and the actin cytoskeleton is fully contracted. LPA-induced RhoA activation is completely inhibited by tyrosine kinase inhibitors (tyrphostin 47 and genistein). Activated Gα12 and Gα13 subunits mimic LPA both in activating RhoA and in inducing RhoA-mediated cytoskeletal contraction, thereby preventing neurite outgrowth. We conclude that in neuronal cells, LPA activates RhoA to induce growth cone collapse and neurite retraction through a G12/13-initiated pathway that involves protein-tyrosine kinase activity. PMID:10359601
Effect of TPA and HTLV-1 Tax on BRCA1 and ERE controlled genes expression.
Jabareen, Azhar; Abu-Jaafar, Aya; Abou-Kandil, Ammar; Huleihel, Mahmoud
2017-07-18
Interference with the expression and/or functions of the multifunctional tumor suppressor BRCA1 leads to a high risk of breast and ovarian cancers. BRCA1 expression is usually activated by the estrogen (E2) liganded ERα receptor. Activated ERα is considered as a potent transcription factor which activates various genes expression by 2 pathways. A classical pathway, ERα binds directly to E2-responsive elements (EREs) in the promoters of the responsive genes and a non-classical pathway where ERα indirectly binds with the appropriate gene promoter. In our previous study, HTLV-1Tax was found to strongly inhibit ERα induced BRCA1 expression while stimulating ERα induced ERE dependent genes. TPA is a strong PKC activator which found to induce the expression of HTLV-1. Here we examined the effect of TPA on the expression of BRCA1 and genes controlled by ERE region in MCF-7 cells and on Tax activity on these genes. Our results showed strong stimulatory effect of TPA on both BRCA1 and ERE expression without treatment with E2. Tax did not show any significant effect on these TPA activities. It seems that TPA activation of BRCA1 and ERE expression is dependent on PKC activity but not through the NFκB pathway. However, 53BP1 may be involved in this TPA activity because its overexpression significantly reduced the TPA stimulatory effect on BRCA1 and ERE expression. Additionally, our Chip assay results probably exclude possible involvement of ERα pathway in this TPA activity because TPA did not interfere with the binding of ERα to both BRCA1 promoter and ERE region.
Negishi, Masahiko
2013-01-01
KCNK1, a member of the family of two-pore K+ ion channels, is specifically induced in the livers of male mice after phenobarbital treatment. Here, we have determined the molecular mechanism of this male-specific activation of the Kcnk1 gene and characterized KCNK1 as a phenobarbital-inducible antihyperplasia factor. Upon activation by phenobarbital, nuclear receptor CAR binds the 97-bp response element (−2441/−2345) within the Kcnk1 promoter. This binding is observed in the livers of male mice, but not in the livers of female mice and requires the pituitary gland, because hypophysectomy abrogates it. Hyperplasia further progressed in the livers of Kcnk1 −/− male mice compared with those of Kcnk1 +/+ males after phenobarbital treatment. Thus, KCNK1 suppresses phenobarbital-induced hyperplasia. These results indicate that phenobarbital treatment induces KCNK1 to elicit a male-specific and growth-suppressing signal. Thus, KCNK1 and Kcnk1 −/− mice provide an experimental tool for further investigation into the molecular mechanism of CAR-mediated promotion of the development of hepatocellular carcinoma in mice. PMID:23291559
Panneer Selvam, Shanmugam; Roth, Braden M; Nganga, Rose; Kim, Jisun; Cooley, Marion A; Helke, Kristi L; Smith, Charles D; Ogretmen, Besim
2018-05-10
Telomerase activation protects cells from telomere damage by delaying senescence and inducing cell immortalization, whereas telomerase inhibition mediates rapid senescence or apoptosis. However, the cellular mechanisms that determine telomere damage-dependent senescence versus apoptosis induction are largely unknown. Here, we demonstrate that telomerase instability mediated by silencing of sphingosine kinase 2 (SPHK2) and sphingosine 1-phosphate (S1P), which binds and stabilizes telomerase, induces telomere damage-dependent caspase-3 activation and apoptosis, but not senescence, in p16-deficient lung cancer cells or tumors. These outcomes were prevented by knockdown of a tumor-suppressor protein, transcription factor 21 (TCF21), or by ectopic expression of WT human telomerase reverse transcriptase (hTERT), but not mutant hTERT with altered S1P binding. Interestingly, SphK2-deficient mice exhibited accelerated aging and telomerase instability that increased telomere damage and senescence via p16 activation especially in testes tissues, but not in apoptosis. Moreover, p16 silencing in SphK2-/- mouse embryonic fibroblasts activated caspase-3 and apoptosis without inducing senescence. Further, ectopic WT p16 expression in p16-deficient A549 lung cancer cells prevented TCF21 and caspase-3 activation, and resulted in senescence in response to SphK2/S1P inhibition and telomere damage. Mechanistically, a p16 mutant with impaired [MS2] caspase-3 association did not prevent telomere damage-induced apoptosis, indicating that an association between p16 and caspase-3 proteins forces senescence induction by inhibiting caspase-3 activation and apoptosis.[MS3] These results suggest that p16 plays a direct role in telomere damage-dependent senescence by limiting apoptosis via binding to caspase-3, revealing a direct link between telomere damage-dependent senescence and apoptosis with regards to aging and cancer. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Krishnamurthy, Karthikeyan; Vedam, Kaushik; Kanagasabai, Ragu; Druhan, Lawrence J.; Ilangovan, Govindasamy
2012-01-01
Heat-shock factor 1 (HSF-1), a transcription factor for heat-shock proteins (HSPs), is known to interfere with the transcriptional activity of many oncogenic factors. In the present work, we have discovered that HSF-1 ablation induced the multidrug resistance gene, MDR1b, in the heart and increased the expression of P-glycoprotein (P-gp, ABCB1), an ATP binding cassette that is usually associated with multidrug-resistant cancer cells. The increase in P-gp enhanced the extrusion of doxorubicin (Dox) to alleviate Dox-induced heart failure and reduce mortality in mice. Dox-induced left ventricular (LV) dysfunction was significantly reduced in HSF-1−/− mice. DNA-binding activity of NF-κB was higher in HSF-1−/− mice. IκB, the NF-κB inhibitor, was depleted due to enhanced IκB kinase (IKK)-α activity. In parallel, MDR1b gene expression and a large increase in P-gp and lowering Dox loading were observed in HSF-1−/− mouse hearts. Moreover, application of the P-gp antagonist, verapamil, increased Dox loading in HSF-1−/− cardiomyocytes, deteriorated cardiac function in HSF-1−/− mice, and decreased survival. MDR1 promoter activity was higher in HSF-1−/− cardiomyocytes, whereas a mutant MDR1 promoter with heat-shock element (HSE) mutation showed increased activity only in HSF-1+/+ cardiomyocytes. However, deletion of HSE and NF-κB binding sites diminished luminescence in both HSF-1+/+ and HSF-1−/− cardiomyocytes, suggesting that HSF-1 inhibits MDR1 activity in the heart. Thus, because high levels of HSF-1 are attributed to poor prognosis of cancer, systemic down-regulation of HSF-1 before chemotherapy is a potential therapeutic approach to ameliorate the chemotherapy-induced cardiotoxicity and enhance cancer prognosis. PMID:22615365
USDA-ARS?s Scientific Manuscript database
Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...
Putting Neutrophils in Motion | Center for Cancer Research
During chemotaxis, immune cells such as neutrophils orient themselves and move along a chemical gradient that is induced by chemicals called chemoattractants. Chemoattractants bind to specific G-protein linked receptors to put things in motion. The binding triggers the dissociation of the Gα-subunit from the Gβγ-subunit, which activate several downstream signaling cascades.
Peroxidase activity in cotton cell culture infected with Verticillium dahliae
USDA-ARS?s Scientific Manuscript database
In our studies with cotton, we have shown that the plant’s induced anionic peroxidases bind to chitin, which is a component of the cell wall of the plant pathogenic fungus Verticillium dahliae. In binding to the cell wall surface, they disrupt the integrity of the pathogen’s cell wall. Thus, these...
Replication Stress and Mitotic Dysfunction in Cells Expressing Simian Virus 40 Large T Antigen
Hu, Liang; Filippakis, Harilaos; Huang, Haomin; Yen, Timothy J.
2013-01-01
We previously demonstrated that simian virus 40 (SV40) large T antigen (LT) binds to the Bub1 kinase, a key regulator of the spindle checkpoint and chromosome segregation. Bub1 mutations or altered expression patterns are linked to chromosome missegregation and are considered to be a driving force in some human cancers. Here we report that LT, dependent on Bub1 binding, causes micronuclei, lagging chromatin, and anaphase bridges, which are hallmarks of chromosomal instability (CIN) and Bub1 insufficiency. Using time-lapse microscopy, we demonstrate that LT imposes a Bub1 binding-dependent delay in the metaphase-to-anaphase transition. Kinetochore fibers reveal that LT, via Bub1 binding, causes aberrant kinetochore (KT)-microtubule (MT) attachments and a shortened interkinetochore distance, consistent with a lack of tension. Previously, we showed that LT also induces the DNA damage response (DDR) via Bub1 binding. Using inducible LT cell lines, we show that an activated DDR was observed before the appearance of anaphase bridges and micronuclei. Furthermore, LT induction in serum-starved cells demonstrated γ-H2AX accumulation in cells that had not yet entered mitosis. Thus, DDR activation can occur independently of chromosome segregation defects. Replication stress pathways may be responsible, because signatures of replication stress were observed, which were attenuated by exogenous supplementation with nucleosides. Our observations allow us to propose a model that explains and integrates the diverse manifestations of genomic instability induced by LT. PMID:24067972
Le Coq, Johanne; Pavlovsky, Alexander; Malik, Radhika; Sanishvili, Ruslan; Xu, Chengfu; Viola, Ronald E.
2009-01-01
Canavan disease is a fatal neurological disorder caused by the malfunctioning of a single metabolic enzyme, aspartoacylase, that catalyzes the deacetylation of N-acetyl-l-aspartate to produce l-aspartate and acetate. The structure of human brain aspartoacylase has been determined in complex with a stable tetrahedral intermediate analogue, N-phosphonomethyl-l-aspartate. This potent inhibitor forms multiple interactions between each of its heteroatoms and the substrate binding groups arrayed within the active site. The binding of the catalytic intermediate analogue induces the conformational ordering of several substrate binding groups, thereby setting up the active site for catalysis. The highly ordered binding of this inhibitor has allowed assignments to be made for substrate binding groups and provides strong support for a carboxypeptidase-type mechanism for the hydrolysis of the amide bond of the substrate, N-acetyl-l-aspartate. PMID:18293939
Le Coq, Johanne; Pavlovsky, Alexander; Malik, Radhika; Sanishvili, Ruslan; Xu, Chengfu; Viola, Ronald E
2008-03-18
Canavan disease is a fatal neurological disorder caused by the malfunctioning of a single metabolic enzyme, aspartoacylase, that catalyzes the deacetylation of N-acetyl-L-aspartate to produce L-aspartate and acetate. The structure of human brain aspartoacylase has been determined in complex with a stable tetrahedral intermediate analogue, N-phosphonomethyl-L-aspartate. This potent inhibitor forms multiple interactions between each of its heteroatoms and the substrate binding groups arrayed within the active site. The binding of the catalytic intermediate analogue induces the conformational ordering of several substrate binding groups, thereby setting up the active site for catalysis. The highly ordered binding of this inhibitor has allowed assignments to be made for substrate binding groups and provides strong support for a carboxypeptidase-type mechanism for the hydrolysis of the amide bond of the substrate, N-acetyl- l-aspartate.
SMOC Binds to Pro-EGF, but Does Not Induce Erk Phosphorylation via the EGFR.
Thomas, J Terrig; Chhuy-Hy, Lina; Andrykovich, Kristin R; Moos, Malcolm
2016-01-01
In an attempt to identify the cell-associated protein(s) through which SMOC (Secreted Modular Calcium binding protein) induces mitogen-activated protein kinase (MAPK) signaling, the epidermal growth factor receptor (EGFR) became a candidate. However, although in 32D/EGFR cells, the EGFR was phosphorylated in the presence of a commercially available human SMOC-1 (hSMOC-1), only minimal phosphorylation was observed in the presence of Xenopus SMOC-1 (XSMOC-1) or human SMOC-2. Analysis of the commercial hSMOC-1 product demonstrated the presence of pro-EGF as an impurity. When the pro-EGF was removed, only minimal EGFR activation was observed, indicating that SMOC does not signal primarily through EGFR and its receptor remains unidentified. Investigation of SMOC/pro-EGF binding affinity revealed a strong interaction that does not require the C-terminal extracellular calcium-binding (EC) domain of SMOC or the EGF domain of pro-EGF. SMOC does not appear to potentiate or inhibit MAPK signaling in response to pro-EGF, but the interaction could provide a mechanism for retaining soluble pro-EGF at the cell surface.
Structural basis for the mutual antagonism of cAMP and TRIP8b in regulating HCN channel function
Saponaro, Andrea; Pauleta, Sofia R.; Cantini, Francesca; Matzapetakis, Manolis; Hammann, Christian; Donadoni, Chiara; Hu, Lei; Thiel, Gerhard; Banci, Lucia; Santoro, Bina; Moroni, Anna
2014-01-01
cAMP signaling in the brain mediates several higher order neural processes. Hyperpolarization-activated cyclic nucleotide-gated (HCN) channels directly bind cAMP through their cytoplasmic cyclic nucleotide binding domain (CNBD), thus playing a unique role in brain function. Neuronal HCN channels are also regulated by tetratricopeptide repeat-containing Rab8b interacting protein (TRIP8b), an auxiliary subunit that antagonizes the effects of cAMP by interacting with the channel CNBD. To unravel the molecular mechanisms underlying the dual regulation of HCN channel activity by cAMP/TRIP8b, we determined the NMR solution structure of the HCN2 channel CNBD in the cAMP-free form and mapped on it the TRIP8b interaction site. We reconstruct here the full conformational changes induced by cAMP binding to the HCN channel CNBD. Our results show that TRIP8b does not compete with cAMP for the same binding region; rather, it exerts its inhibitory action through an allosteric mechanism, preventing the cAMP-induced conformational changes in the HCN channel CNBD. PMID:25197093
Djeghader, Ahmed; Gotthard, Guillaume; Suh, Andrew; Gonzalez, Daniel; Scott, Ken; Chabriere, Eric; Elias, Mikael
2013-01-01
In prokaryotes, phosphate starvation induces the expression of numerous phosphate-responsive genes, such as the pst operon including the high-affinity phosphate-binding protein (PBP or pstS) and alkaline phosphatases such as PhoA. This response increases the cellular inorganic phosphate import efficiency. Notably, some Pseudomonas species secrete, via a type-2 secretion system, a phosphate-binding protein dubbed LapA endowed with phosphatase activity. Here, the expression, purification, crystallization and X-ray data collection at 0.87 Å resolution of LapA are described. Combined with biochemical and enzymatic characterization, the structure of this intriguing phosphate-binding protein will help to elucidate the molecular origin of its phosphatase activity and to decipher its putative role in phosphate uptake. PMID:24100568
CCCTC-binding Factor Mediates Effects of Glucose On Beta Cell Survival
Tsui, Shanli; Dai, Wei; Lu, Luo
2013-01-01
Objectives Pancreatic islet β-cell survival is important in regulating insulin activities and maintaining glucose homeostasis. Recently, Pax6 has been shown to be essential for many vital functions in β-cells, though the molecular mechanisms of its regulation in β-cells remain unclear. The present study investigates the novel effects of glucose- and insulin-induced CTCF activity on Pax6 gene expression as well as the subsequent effects of insulin-activated signaling pathways on β-cell proliferation. Material and methods Pancreatic β-TC-1-6 cells were cultured in DMEM medium and stimulated with high concentrations of glucose (5 to 125 mM) and cell viability was assessed by MTT assays. The effect of CTCF on Pax6 was evaluated in high glucose-induced and CCCTC-binding Factor (CTCF)/Erk suppressed cells by promoter reporter and Western analyses. Results Increases in glucose and insulin concentrations up-regulated CTCF and consequently down-regulated Pax6 in β-cell survival and proliferation. Knocking-down CTCF directly affected Pax6 transcription through CTCF binding and blocked the response to glucose. Altered Erk activity mediated the effects of CTCF on controlling Pax6 expression, which partially regulates β-cell proliferation. Conclusions CTCF functions as a molecular mediator between insulin-induced upstream Erk signaling and Pax6 expression in pancreatic β-cells. This pathway may contribute to regulation of β-cell survival and proliferation. PMID:24354619
Dávila, David; Jiménez-Mateos, Eva M; Mooney, Claire M; Velasco, Guillermo; Henshall, David C; Prehn, Jochen H M
2014-11-01
Neurons face a changeable microenvironment and therefore need mechanisms that allow rapid switch on/off of their cytoprotective and apoptosis-inducing signaling pathways. Cellular mechanisms that control apoptosis activation include the regulation of pro/antiapoptotic mRNAs through their 3'-untranslated region (UTR). This region holds binding elements for RNA-binding proteins, which can control mRNA translation. Here we demonstrate that heat shock protein 27 (Hsp27) prevents oxidative stress-induced cell death in cerebellar granule neurons by specific regulation of the mRNA for the proapoptotic BH3-only protein, Bim. Hsp27 depletion induced by oxidative stress using hydrogen peroxide (H2O2) correlated with bim gene activation and subsequent neuronal death, whereas enhanced Hsp27 expression prevented these. This effect could not be explained by proteasomal degradation of Bim or bim promoter inhibition; however, it was associated with a specific increase in the levels of bim mRNA and with its binding to Hsp27. Finally, we determined that enhanced Hsp27 expression in neurons exposed to H2O2 or glutamate prevented the translation of a reporter plasmid where bim-3'UTR mRNA sequence was cloned downstream of a luciferase gene. These results suggest that repression of bim mRNA translation through binding to the 3'UTR constitutes a novel cytoprotective mechanism of Hsp27 during stress in neurons. © 2014 Dávila et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Schankin, Christoph J; Maniyar, Farooq H; Seo, Youngho; Kori, Shashidar; Eller, Michael; Chou, Denise E; Blecha, Joseph; Murphy, Stephanie T; Hawkins, Randall A; Sprenger, Till; VanBrocklin, Henry F; Goadsby, Peter J
2016-07-01
SEE DREIER DOI 101093/AWW112 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: For many decades a breakdown of the blood-brain barrier has been postulated to occur in migraine. Hypothetically this would facilitate access of medications, such as dihydroergotamine or triptans, to the brain despite physical properties otherwise restricting their entry. We studied the permeability of the blood-brain barrier in six migraineurs and six control subjects at rest and during acute glyceryl trinitrate-induced migraine attacks using positron emission tomography with the novel radioligand (11)C-dihydroergotamine, which is chemically identical to pharmacologically active dihydroergotamine. The influx rate constant Ki, average dynamic image and time activity curve were assessed using arterial blood sampling and served as measures for receptor binding and thus blood-brain barrier penetration. At rest, there was binding of (11)C-dihydroergotamine in the choroid plexus, pituitary gland, and venous sinuses as expected from the pharmacology of dihydroergotamine. However, there was no binding to the brain parenchyma, including the hippocampus, the area with the highest density of the highest-affinity dihydroergotamine receptors, and the raphe nuclei, a postulated brainstem site of action during migraine, suggesting that dihydroergotamine is not able to cross the blood-brain barrier. This binding pattern was identical in migraineurs during glyceryl trinitrate-induced migraine attacks as well as in matched control subjects. We conclude that (11)C-dihydroergotamine is unable to cross the blood-brain barrier interictally or ictally demonstrating that the blood-brain barrier remains tight for dihydroergotamine during acute glyceryl trinitrate-induced migraine attacks. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.
Chen, Xiao-Qing; Wu, Sheng-Hua; Zhou, Yu; Tang, Yan-Rong
2013-01-01
Objective To investigate whether lipoxin A4 (LXA4) increases expression of heme oxygenase-1(HO-1) in cardiomyocytes, whether LXA4-induced HO-1 protects cardiomyocytes against hypoxia/reoxygenation (H/R) injury, and what are the mechanisms involved in the LXA4-induced HO-1 induction. Methods Rat cardiomyocytes were exposed to H/R injury with or without preincubation with LXA4 or HO-1 inhibitor ZnPP-IX or various signal molecule inhibitors. Expressions of HO-1 protein and mRNA were analyzed by using Western blot and RT-PCR respectively. Activity of nuclear factor E2-related factor 2 (Nrf2) binding to the HO-1 E1 enhancer was assessed by chromatin immunoprecipitation. Nrf2 binding to the HO-1 antioxidant responsive element (ARE) were measured by using electrophoretic mobility shift assay. Results Pretreatment of the cells undergoing H/R lesion with LXA4 significantly reduced the lactate dehydrogenase and creatine kinase productions, increased the cell viability, and increased the expressions of HO-1 protein and mRNA and HO-1 promoter activity. HO-1 inhibition abolished the protective role of LXA4 on the cells undergoing H/R lesion. LXA4 increased p38 mitogen-activated protein kinase (p38 MAPK) activation, nuclear translocation of Nrf2, Nrf2 binding to the HO-1 ARE and E1 enhancer in cardiomyocytes with or without H/R exposure. Conclusion The protection role of LXA4 against H/R injury of cardiomyocytes is related to upregulation of HO-1, via activation of p38 MAPK pathway and nuclear translocation of Nrf2 and Nrf2 binding to the HO-1 ARE and E1 enhancer, but not via activation of phosphatidyinositol-3-kinase or extracellular signal-regulated kinase pathway. PMID:23826208
Danial, Nika N.; Losman, Julie A.; Lu, Tianhong; Yip, Natalie; Krishnan, Kartik; Krolewski, John; Goff, Stephen P.; Wang, Jean Y. J.; Rothman, Paul B.
1998-01-01
In Abelson murine leukemia virus (A-MuLV)-transformed cells, members of the Janus kinase (Jak) family of non-receptor tyrosine kinases and the signal transducers and activators of transcription (STAT) family of signaling proteins are constitutively activated. In these cells, the v-Abl oncoprotein and the Jak proteins physically associate. To define the molecular mechanism of constitutive Jak-STAT signaling in these cells, the functional significance of the v-Abl–Jak association was examined. Mapping the Jak1 interaction domain in v-Abl demonstrates that amino acids 858 to 1080 within the carboxyl-terminal region of v-Abl bind Jak1 through a direct interaction. A mutant of v-Abl lacking this region exhibits a significant defect in Jak1 binding in vivo, fails to activate Jak1 and STAT proteins, and does not support either the proliferation or the survival of BAF/3 cells in the absence of cytokine. Cells expressing this v-Abl mutant show extended latency and decreased frequency in generating tumors in nude mice. In addition, inducible expression of a kinase-inactive mutant of Jak1 protein inhibits the ability of v-Abl to activate STATs and to induce cytokine-independent proliferation, indicating that an active Jak1 is required for these v-Abl-induced signaling pathways in vivo. We propose that Jak1 is a mediator of v-Abl-induced STAT activation and v-Abl induced proliferation in BAF/3 cells, and may be important for efficient transformation of immature B cells by the v-abl oncogene. PMID:9774693
Person, Rachel J.; Whalen, Margaret M.
2010-01-01
Natural Killer (NK) cells are a major immune defense mechanism against cancer development and viral infection. The butyltins (BTs), tributyltin (TBT) and dibutyltin (DBT) have been widely used in industrial and other applications and significantly contaminate the environment. Both TBT and DBT have been detected in human blood. These compounds inhibit the lytic and binding function of human NK cells and thus could increase the incidence of cancer and viral infections. Butyltin (BT)-induced loss of NK function is accompanied by activation of mitogen activated protein kinases (MAPKs) and decreases in expression of cell-surface and cytolytic proteins. MAPKs activate components of the transcription regulator AP-1 and activate the transcription regulator Elk-1. Based on the fact that BTs activate MAPKs and alter protein expression, the current study examined the effect of BT exposures on the levels and phosphorylation states of the components of AP-1 and the phosphorylation state of Elk-1. Exposure to 300 nM TBT for 10 min increased the phosphorylation of c-Jun in NK cells. 1 h exposures to 300 nM and 200 nM TBT increased the phosphorylation and overall level of c-Jun. During a 300 nM treatment with TBT for 1 h the binding activity of AP-1 was significantly decreased. There were no significant alterations of AP-1 components or of Elk-1 with DBT exposures. Thus, it appears that TBT-induced alterations on phosphorylation, total levels and binding activity of c-Jun might contribute to, but are not fully responsible for, TBT-induced alterations of NK protein expression. PMID:20370538
Person, Rachel J; Whalen, Margaret M
2010-06-01
Natural killer (NK) cells are a major immune defense mechanism against cancer development and viral infection. The butyltins (BTs), tributyltin (TBT) and dibutyltin (DBT), have been widely used in industrial and other applications and significantly contaminate the environment. Both TBT and DBT have been detected in human blood. These compounds inhibit the lytic and binding function of human NK cells and thus could increase the incidence of cancer and viral infections. Butyltin (BT)-induced loss of NK function is accompanied by activation of mitogen activated protein kinases (MAPKs) and decreases in expression of cell-surface and cytolytic proteins. MAPKs activate components of the transcription regulator AP-1 and activate the transcription regulator Elk-1. Based on the fact that BTs activate MAPKs and alter protein expression, the current study examined the effect of BT exposures on the levels and phosphorylation states of the components of AP-1 and the phosphorylation state of Elk-1. Exposure to 300 nM TBT for 10 min increased the phosphorylation of c-Jun in NK cells. One hour exposures to 300 nM and 200 nM TBT increased the phosphorylation and overall level of c-Jun. During a 300 nM treatment with TBT for 1 h the binding activity of AP-1 was significantly decreased. There were no significant alterations of AP-1 components or of Elk-1 with DBT exposures. Thus, it appears that TBT-induced alterations on phosphorylation, total levels, and binding activity of c-Jun might contribute to, but are not fully responsible for, TBT-induced alterations of NK protein expression.
Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen; Hsieh, Yi-Hsien; Yang, Shun-Fa
2017-01-01
Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)-induced cell migration and the underlying mechanisms remain unclear. Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription-PCR (RT-PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1-dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases.
Lin, Hung-Yu; Chen, Yong-Syuan; Wang, Kai; Chien, Hsiang-Wen
2017-01-01
Purpose Proliferative vitreoretinopathy (PVR) can result in abnormal migration of RPE cells. Fisetin is a naturally occurring compound that has been reported to have antitumor effects, but its effects on epidermal growth factor (EGF)–induced cell migration and the underlying mechanisms remain unclear. Methods Effects of fisetin on EGF-induced cell viability and migration were examined with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and in vitro migration assays. Reverse transcription–PCR (RT–PCR) and immunoblotting were performed to evaluate matrix metallopeptidase-9 (MMP-9) expression and activation of specificity protein-1 (Sp1) and protein kinase B (AKT) in ARPE-19 cells treated with EGF and with or without fisetin. Luciferase and chromatin immunoprecipitation (ChIP) assays were performed to examine Sp1 transcription activity and MMP-9 binding activity. Results Fisetin did not affect ARPE-19 cell viability and significantly inhibited the EGF-induced migration capacity of ARPE-19 cells. Furthermore, fisetin exerted an antimigratory effect and suppressed MMP-9 mRNA and protein expression. Treatment with EGF induced phosphorylation of AKT and expression of MMP-9 and Sp1. Fisetin combined with LY294002 (an inhibitor of AKT) prevented the EGF-induced migration involved in downregulation of Sp1 and MMP-9 expression. Luciferase and ChIP assays suggested that fisetin remarkably decreased the EGF-induced transcription activity of MMP-9 and Sp1 and inhibited EGF-mediated Sp1 from directly binding to the MMP-9 promoter in ARPE-19 cells. Conclusions Fisetin inhibited EGF-induced cell migration via modulation of AKT/Sp1–dependent MMP-9 transcriptional activity. Therefore, fisetin may be a potential agent in the treatment of migratory PVR diseases. PMID:29296070
Cyclin D1 Repression of Peroxisome Proliferator-Activated Receptor γ Expression and Transactivation
Wang, Chenguang; Pattabiraman, Nagarajan; Zhou, Jian Nian; Fu, Maofu; Sakamaki, Toshiyuki; Albanese, Chris; Li, Zhiping; Wu, Kongming; Hulit, James; Neumeister, Peter; Novikoff, Phyllis M.; Brownlee, Michael; Scherer, Philipp E.; Jones, Joan G.; Whitney, Kathleen D.; Donehower, Lawrence A.; Harris, Emily L.; Rohan, Thomas; Johns, David C.; Pestell, Richard G.
2003-01-01
The cyclin D1 gene is overexpressed in human breast cancers and is required for oncogene-induced tumorigenesis. Peroxisome proliferator-activated receptor γ (PPARγ) is a nuclear receptor selectively activated by ligands of the thiazolidinedione class. PPARγ induces hepatic steatosis, and liganded PPARγ promotes adipocyte differentiation. Herein, cyclin D1 inhibited ligand-induced PPARγ function, transactivation, expression, and promoter activity. PPARγ transactivation induced by the ligand BRL49653 was inhibited by cyclin D1 through a pRB- and cdk-independent mechanism, requiring a region predicted to form an helix-loop-helix (HLH) structure. The cyclin D1 HLH region was also required for repression of the PPARγ ligand-binding domain linked to a heterologous DNA binding domain. Adipocyte differentiation by PPARγ-specific ligands (BRL49653, troglitazone) was enhanced in cyclin D1−/− fibroblasts and reversed by retroviral expression of cyclin D1. Homozygous deletion of the cyclin D1 gene, enhanced expression by PPARγ ligands of PPARγ and PPARγ-responsive genes, and cyclin D1−/− mice exhibit hepatic steatosis. Finally, reduction of cyclin D1 abundance in vivo using ponasterone-inducible cyclin D1 antisense transgenic mice, increased expression of PPARγ in vivo. The inhibition of PPARγ function by cyclin D1 is a new mechanism of signal transduction cross talk between PPARγ ligands and mitogenic signals that induce cyclin D1. PMID:12917338
Stoddard, B L; Koshland, D E
1993-09-14
The structure of the isocitrate dehydrogenase (IDH) complex with bound alpha-ketoglutarate, Ca2+, and NADPH was solved at 2.7-A resolution. The alpha-ketoglutarate binds in the active site at the same position and orientation as isocitrate, with a difference between the two bound molecules of about 0.8 A. The Ca2+ metal is coordinated by alpha-ketoglutarate, three conserved aspartate residues, and a pair of water molecules. The largest motion in the active site relative to the isocitrate enzyme complex is observed for tyrosine 160, which originally forms a hydrogen bond to the labile carboxyl group of isocitrate and moves to form a new hydrogen bond to Asp 307 in the complex with alpha-ketoglutarate. This triggers a number of significant movements among several short loops and adjoining secondary structural elements in the enzyme, most of which participate in dimer stabilization and formation of the active-site cleft. These rearrangements are similar to the ligand-binding-induced movements observed in globins and insulin and serve as a model for an enzymatic mechanism which involves local shifts of secondary structural elements during turnover, rather than large-scale domain closures or loop transitions induced by substrate binding such as those observed in hexokinase or triosephosphate isomerase.
Albers, Michael; Blume, Beatrix; Schlueter, Thomas; Wright, Matthew B; Kober, Ingo; Kremoser, Claus; Deuschle, Ulrich; Koegl, Manfred
2006-02-24
Partial, selective activation of nuclear receptors is a central issue in molecular endocrinology but only partly understood. Using LXRs as an example, we show here that purely agonistic ligands can be clearly and quantitatively differentiated from partial agonists by the cofactor interactions they induce. Although a pure agonist induces a conformation that is incompatible with the binding of repressors, partial agonists such as GW3965 induce a state where the interaction not only with coactivators, but also corepressors is clearly enhanced over the unliganded state. The activities of the natural ligand 22(R)-hydroxycholesterol and of a novel quinazolinone ligand, LN6500 can be further differentiated from GW3965 and T0901317 by their weaker induction of coactivator binding. Using biochemical and cell-based assays, we show that the natural ligand of LXR is a comparably weak partial agonist. As predicted, we find that a change in the coactivator to corepressor ratio in the cell will affect NCoR recruiting compounds more dramatically than NCoR-dissociating compounds. Our data show how competitive binding of coactivators and corepressors can explain the tissue-specific behavior of partial agonists and open up new routes to a rational design of partial agonists for LXRs.
Yan, Wei; Yang, Tao; Yang, Jianhong; Wang, Taijin; Yu, Yamei; Wang, Yuxi; Chen, Qiang; Bai, Peng; Li, Dan; Ye, Haoyu; Qiu, Qiang; Zhou, Yongzhao; Hu, Yiguo; Yang, Shengyong; Wei, Yuquan; Li, Weimin; Chen, Lijuan
2018-05-22
Many tubulin inhibitors are in clinical use as anti-cancer drugs. In our previous study, a novel series of 4-substituted coumarins derivatives were identified as novel tubulin inhibitors. Here, we report the anti-cancer activity and underlying mechanism of one of the 4-substituted coumarins derivatives (SKLB060). The anti-cancer activity of SKLB060 was tested on 13 different cancer cell lines and four xenograft cancer models. Immunofluorescence staining, cell cycle analysis, and tubulin polymerization assay were employed to study the inhibition of tubulin. N, N '-Ethylenebis(iodoacetamide) assay was used to measure binding to the colchicine site. Wound-healing migration and tube formation assays were performed on human umbilical vascular endothelial cells to study anti-vascular activity (the ability to inhibit blood vessel growth). Mitotic block reversibility and structural biology assays were used to investigate the SKLB060-tubulin bound model. SKLB060 inhibited tubulin polymerization and subsequently induced G2/M cell cycle arrest and apoptosis in cancer cells. SKLB060 bound to the colchicine site of β-tubulin and showed antivascular activity in vitro. Moreover, SKLB060 induced reversible cell cycle arrest and reversible inhibition of tubulin polymerization. A mitotic block reversibility assay showed that the effects of SKLB060 have greater reversibility than those of colcemid (a reversible tubulin inhibitor), indicating that SKLB060 binds to tubulin in a totally reversible manner. The crystal structures of SKLB060-tubulin complexes confirmed that SKLB060 binds to the colchicine site, and the natural coumarin ring in SKLB060 enables reversible binding. These results reveal that SKLB060 is a powerful and reversible microtubule inhibitor that binds to the colchicine site and is effective in multidrug-resistant cell lines. © 2018 The Author(s). Published by S. Karger AG, Basel.
Han, Yo-Han; Kee, Ji-Ye; Park, Jinbong; Kim, Hye-Lin; Jeong, Mi-Young; Kim, Dae-Seung; Jeon, Yong-Deok; Jung, Yunu; Youn, Dong-Hyun; Kang, JongWook; So, Hong-Seob; Park, Raekil; Lee, Jong-Hyun; Shin, Soyoung; Kim, Su-Jin; Um, Jae-Young; Hong, Seung-Heon
2016-09-01
Although arctigenin (ARC) has been reported to have some pharmacological effects such as anti-inflammation, anti-cancer, and antioxidant, there have been no reports on the anti-obesity effect of ARC. The aim of this study is to investigate whether ARC has an anti-obesity effect and mediates the AMP-activated protein kinase (AMPK) pathway. We investigated the anti-adipogenic effect of ARC using 3T3-L1 pre-adipocytes and human adipose tissue-derived mesenchymal stem cells (hAMSCs). In high-fat diet (HFD)-induced obese mice, whether ARC can inhibit weight gain was investigated. We found that ARC reduced weight gain, fat pad weight, and triglycerides in HFD-induced obese mice. ARC also inhibited the expression of peroxisome proliferator-activated receptor gamma (PPARγ) and CCAAT/enhancer-binding protein alpha (C/EBPα) in in vitro and in vivo. Furthermore, ARC induced the AMPK activation resulting in down-modulation of adipogenesis-related factors including PPARγ, C/EBPα, fatty acid synthase, adipocyte fatty acid-binding protein, and lipoprotein lipase. This study demonstrates that ARC can reduce key adipogenic factors by activating the AMPK in vitro and in vivo and suggests a therapeutic implication of ARC for obesity treatment. J. Cell. Biochem. 117: 2067-2077, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Kino, T; Rice, K C; Chrousos, G P
2007-05-01
Interleukin-6 and downstream liver effectors acute phase reactants are implicated in the systemic inflammatory reaction. Peroxisome proliferator-activated receptor delta (PPARdelta), which binds to and is activated by a variety of fatty acids, was recently shown to have anti-inflammatory actions. We examined the ability of the synthetic PPARdelta agonist GW501516 to suppress interleukin-6-induced expression of acute phase proteins in human hepatoma HepG2 cells and rat primary hepatocytes. Results GW501516 dose-dependently suppressed interleukin-6-induced mRNA expression of the acute phase protein alpha1-antichymotrypsin in HepG2 cells. The compound also suppressed interleukin-6-induced mRNA expression of alpha2-acid glycoprotein, beta-fibrinogen and alpha2-macroglobulin in and the secretion of C-reactive protein by rat primary hepatocytes. Depletion of the PPARdelta receptor, but not of PPARalpha or gamma, attenuated the suppressive effect of GW501516 on interleukin-6-induced alpha1-antichymotrypsin mRNA expression, indicating that PPARdelta specifically mediated this effect. Since interleukin-6 stimulates the transcriptional activity of the alpha1-antichymotrypsin promoter by activating the signal transducer and activator of transcription (STAT) 3, we examined functional interaction of this transcription factor and PPARdelta on this promoter. Overexpression of PPARdelta enhanced the suppressive effect of GW501516 on STAT3-activated transcriptional activity of the alpha1-antichymotrypsin promoter, while GW501516 suppressed interleukin-6-induced binding of this transcription factor to this promoter. These findings indicate that agonist-activated PPARdelta interferes with interleukin-6-induced acute phase reaction in the liver by inhibiting the transcriptional activity of STAT3. PPARdelta agonists might be useful for the suppression of systemic inflammatory reactions in which IL-6 plays a central role.
Thai, Minh; Graham, Nicholas A; Braas, Daniel; Nehil, Michael; Komisopoulou, Evangelia; Kurdistani, Siavash K.; McCormick, Frank; Graeber, Thomas G.; Christofk, Heather R.
2014-01-01
SUMMARY Virus infections trigger metabolic changes in host cells that support the bioenergetic and biosynthetic demands of viral replication. While recent studies have characterized virus-induced changes in host cell metabolism (Munger et al., 2008; Terry et al., 2012), the molecular mechanisms by which viruses reprogram cellular metabolism have remained elusive. Here we show that the gene product of adenovirus E4ORF1 is necessary for adenovirus-induced upregulation of host cell glucose metabolism and sufficient to promote enhanced glycolysis in cultured epithelial cells by activation of MYC. E4ORF1 localizes to the nucleus, binds to MYC, and enhances MYC binding to glycolytic target genes, resulting in elevated expression of specific glycolytic enzymes. E4ORF1 activation of MYC promotes increased nucleotide biosynthesis from glucose intermediates and enables optimal adenovirus replication in primary lung epithelial cells. Our findings show how a viral protein exploits host cell machinery to reprogram cellular metabolism and promote optimal progeny virion generation. PMID:24703700
Syk-mediated tyrosine phosphorylation of mule promotes TNF-induced JNK activation and cell death.
Lee, C K; Yang, Y; Chen, C; Liu, J
2016-04-14
The transcription factor Miz1 negatively regulates TNF-induced JNK activation and cell death by suppressing TRAF2 K63-polyubiquitination; upon TNF stimulation, the suppression is relieved by Mule/ARF-BP1-mediated Miz1 ubiquitination and subsequent degradation. It is not known how Mule is activated by TNF. Here we report that TNF activates Mule by inducing the dissociation of Mule from its inhibitor ARF. ARF binds to and thereby inhibits the E3 ligase activity of Mule in the steady state. TNF induces tyrosine phosphorylation of Mule, which subsequently dissociates from ARF and becomes activated. Inhibition of Mule phosphorylation by silencing of the Spleen Tyrosine Kinase (Syk) prevents its dissociation from ARF, thereby inhibiting Mule E3 ligase activity and TNF-induced JNK activation and cell death. Our data provides a missing link in TNF signaling pathway that leads to JNK activation and cell death.
HIV-Derived ssRNA Binds to TLR8 to Induce Inflammation-Driven Macrophage Foam Cell Formation
Bernard, Mark A.; Han, Xinbing; Inderbitzin, Sonya; Agbim, Ifunanya; Zhao, Hui; Koziel, Henry; Tachado, Souvenir D.
2014-01-01
Even though combined anti-retroviral therapy (cART) dramatically improves patient survival, they remain at a higher risk of being afflicted with non-infectious complications such as cardiovascular disease (CVD). This increased risk is linked to persistent inflammation and chronic immune activation. In this study, we assessed whether this complication is related to HIV-derived ssRNAs inducing in macrophages increases in TNFα release through TLR8 activation leading to foam cell formation. HIV ssRNAs induced foam cell formation in monocyte-derived macrophages (MDMs) in a dose-dependent manner. This response was reduced when either endocytosis or endosomal acidification was inhibited by dynasore or chloroquine, respectively. Using a flow cytometry FRET assay, we demonstrated that ssRNAs bind to TLR8 in HEK cells. In MDMs, ssRNAs triggered a TLR8-mediated inflammatory response that ultimately lead to foam cell formation. Targeted silencing of the TLR8 and MYD88 genes reduced foam cell formation. Furthermore, foam cell formation induced by these ssRNAs was blocked by an anti-TNFα neutralizing antibody. Taken together in MDMs, HIV ssRNAs are internalized; bind TLR8 in the endosome followed by endosomal acidification. TLR8 signaling then triggers TNFα release and ultimately leads to foam cell formation. As this response was inhibited by a blocking anti-TNFα antibody, drug targeting HIV ssRNA-driven TLR8 activation may serve as a potential therapeutic target to reduce chronic immune activation and inflammation leading to CVD in HIV+ patients. PMID:25090652
He, Mu-Yang; Li, Wei-Kang; Zheng, Qing-Chuan; Zhang, Hong-Xing
2018-04-17
Deregulated kinase activity of anaplastic lymphoma kinase (ALK) has been observed to be implicated in the development of tumor progression. The activation mechanism of ALK is proposed to be similar to other receptor tyrosine kinases (RTKs), but the distinct static X-ray crystal conformation of ALK suggests its unique conformational transition. Herein, we have illustrated the dynamic conformational property of wild-type ALK as well as the kinase activation equilibrium variation induced by two neuroblastoma mutations (R1275Q and Y1278S) and ATP binding by performing enhanced sampling accelerated Molecular Dynamics (aMD) simulations. The results suggest that the wild-type ALK is mostly favored in the inactive state, whereas the mutations and ATP binding promote a clear shift toward the active-like conformation. The R1275Q mutant stabilizes the active conformation by rigidifying the αC-in conformation. The Y1278S mutant promotes activation at the expense of a π-stacking hydrophobic cluster, which plays a critical role in the stabilization of the inactive conformation of native ALK. ATP produces a more compact active site and thereby facilitates the activation of ALK. Taken together, these findings not only elucidate the diverse conformations in different ALKs but can also shed light on new strategies for protein engineering and structural-based drug design for ALK.
Chitovibrin: a chitin-binding lectin from Vibrio parahemolyticus.
Gildemeister, O S; Zhu, B C; Laine, R A
1994-12-01
A novel 134 kDa, calcium-independent chitin-binding lectin, 'chitovibrin', is secreted by the marine bacterium Vibrio parahemolyticus, inducible with chitin or chitin-oligomers. Chitovibrin shows no apparent enzymatic activity but exhibits a strong affinity for chitin and chito-oligomers > dp9. The protein has an isoelectric pH of 3.6, shows thermal tolerance, binds chitin with an optimum at pH 6 and is active in 0-4 M NaCl. Chitovibrin appears to be completely different from other reported Vibrio lectins and may function to bind V. parahemolyticus to chitin substrates, or to capture or sequester chito-oligomers. It may be a member of a large group of recently described proteins in Vibrios related to a complex chitinoclastic (chitinivorous) system.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Jae Ryoung; Huh, Jae Ho; Lee, Yoonna
2011-02-25
Research highlights: {yields} Binding assays demonstrated that secreted- and cellular-IGFBP-5 interacted with TNFR1. {yields} The interaction between IGFBP-5 and TNFR1 was inhibited by TNF-{alpha} and was blocked TNF-{alpha}-activated NF-{kappa}B activity. {yields} IGFBP-5 interacted with TNFR1 through its N- and L-domains but the binding of L-domain to TNFR1 was blocked by TNF-{alpha}. {yields} Competition between the L-domain of IGFBP-5 and TNF-{alpha} blocked TNF-{alpha}-induced NF-{kappa}B activity. {yields} This study suggests that the L-domain of IGFBP-5 is a novel TNFR1 ligand that functions as a competitive TNF-{alpha} inhibitor. -- Abstract: IGFBP-5 is known to be involved in various cell phenomena such as proliferation,more » differentiation, and apoptosis. However, the exact mechanisms by which IGFBP-5 exerts its functions are unclear. In this study, we demonstrate for the first time that IGFBP-5 is a TNFR1-interacting protein. We found that ectopic expression of IGFBP-5 induced TNFR1 gene expression, and that IGFBP-5 interacted with TNFR1 in both an in vivo and an in vitro system. Secreted IGFBP-5 interacted with GST-TNFR1 and this interaction was blocked by TNF-{alpha}, demonstrating that IGFBP-5 might be a TNFR1 ligand. Furthermore, conditioned media containing secreted IGFBP-5 inhibited PMA-induced NF-{kappa}B activity and IL-6 expression in U-937 cells. Coimmunoprecipitation assays of TNFR1 and IGFBP-5 wild-type and truncation mutants revealed that IGFBP-5 interacts with TNFR1 through its N- and L-domains. However, only the interaction between the L-domain of IGFBP-5 and TNFR1 was blocked by TNF-{alpha} in a dose-dependent manner, suggesting that the L-domain of IGFBP-5 can function as a TNFR1 ligand. Competition between the L-domain of IGFBP-5 and TNF-{alpha} resulted in inhibition of TNF-{alpha}-induced NF-{kappa}{Beta} activity. Taken together, our results suggest that the L-domain of IGFBP-5 is a novel TNFR1 ligand that functions as a competitive TNF-{alpha} inhibitor.« less
Du, Junbao; Huang, Yaqian; Yan, Hui; Zhang, Qiaoli; Zhao, Manman; Zhu, Mingzhu; Liu, Jia; Chen, Stella X.; Bu, Dingfang; Tang, Chaoshu; Jin, Hongfang
2014-01-01
This study was designed to examine the role of hydrogen sulfide (H2S) in the generation of oxidized low-density lipoprotein (ox-LDL)-stimulated monocyte chemoattractant protein 1 (MCP-1) from macrophages and possible mechanisms. THP-1 cells and RAW macrophages were pretreated with sodium hydrosulfide (NaHS) and hexyl acrylate and then treated with ox-LDL. The results showed that ox-LDL treatment down-regulated the H2S/cystathionine-β-synthase pathway, with increased MCP-1 protein and mRNA expression in both THP-1 cells and RAW macrophages. Hexyl acrylate promoted ox-LDL-induced inflammation, whereas the H2S donor NaHS inhibited it. NaHS markedly suppressed NF-κB p65 phosphorylation, nuclear translocation, DNA binding activity, and recruitment to the MCP-1 promoter in ox-LDL-treated macrophages. Furthermore, NaHS decreased the ratio of free thiol groups in p65, whereas the thiol reductant DTT reversed the inhibiting effect of H2S on the p65 DNA binding activity. Most importantly, site-specific mutation of cysteine 38 to serine in p65 abolished the effect of H2S on the sulfhydration of NF-κB and ox-LDL-induced NF-κB activation. These results suggested that endogenous H2S inhibited ox-LDL-induced macrophage inflammation by suppressing NF-κB p65 phosphorylation, nuclear translocation, DNA binding activity, and recruitment to the MCP-1 promoter. The sulfhydration of free thiol group on cysteine 38 in p65 served as a molecular mechanism by which H2S inhibited NF-κB pathway activation in ox-LDL-induced macrophage inflammation. PMID:24550391
Rao, Fang; Yang, Ren-Qiang; Chen, Xiao-Shu; Xu, Jin-Song; Fu, Hui-Min; Su, Hai; Wang, Ling
2014-01-01
Hypertension is known to be associated with platelet overactivity, but the direct effects of hydrostatic pressure on platelet function remain unclear. The present study sought to investigate whether elevated hydrostatic pressure is responsible for platelet activation and to address the potential role of peroxisome proliferator-activated receptor-γ (PPARγ). We observed that hypertensive patients had significantly higher platelet volume and rate of ADP-induced platelets aggregation compared to the controls. In vitro, Primary human platelets were cultured under standard (0 mmHg) or increased (120, 180, 240 mmHg) hydrostatic pressure for 18 h. Exposure to elevated pressure was associated with morphological changes in platelets. Platelet aggregation and PAC-1 (the active confirmation of GPIIb/IIIa) binding were increased, CD40L was translocated from cytoplasm to the surface of platelet and soluble CD40L (sCD40L) was released into the medium in response to elevated hydrostatic pressure (180 and 240 mmHg). The PPARγ activity was up-regulated as the pressure was increased from 120 mmHg to 180 mmHg. Pressure-induced platelet aggregation, PAC-1 binding, and translocation and release of CD40L were all attenuated by the PPARγ agonist Thiazolidinediones (TZDs). These results demonstrate that platelet activation and aggregation are increased by exposure to elevated pressure and that PPARγ may modulate platelet activation induced by high hydrostatic pressure.
Chen, Xiao-Shu; Xu, Jin-Song; Fu, Hui-Min; Su, Hai; Wang, Ling
2014-01-01
Hypertension is known to be associated with platelet overactivity, but the direct effects of hydrostatic pressure on platelet function remain unclear. The present study sought to investigate whether elevated hydrostatic pressure is responsible for platelet activation and to address the potential role of peroxisome proliferator-activated receptor-γ (PPARγ). We observed that hypertensive patients had significantly higher platelet volume and rate of ADP-induced platelets aggregation compared to the controls. In vitro, Primary human platelets were cultured under standard (0 mmHg) or increased (120, 180, 240 mmHg) hydrostatic pressure for 18 h. Exposure to elevated pressure was associated with morphological changes in platelets. Platelet aggregation and PAC-1 (the active confirmation of GPIIb/IIIa) binding were increased, CD40L was translocated from cytoplasm to the surface of platelet and soluble CD40L (sCD40L) was released into the medium in response to elevated hydrostatic pressure (180 and 240 mmHg). The PPARγ activity was up-regulated as the pressure was increased from 120 mmHg to 180 mmHg. Pressure-induced platelet aggregation, PAC-1 binding, and translocation and release of CD40L were all attenuated by the PPARγ agonist Thiazolidinediones (TZDs). These results demonstrate that platelet activation and aggregation are increased by exposure to elevated pressure and that PPARγ may modulate platelet activation induced by high hydrostatic pressure. PMID:24586940
BECN1-dependent CASP2 incomplete autophagy induction by binding to rabies virus phosphoprotein.
Liu, Juan; Wang, Hailong; Gu, Jinyan; Deng, Tingjuan; Yuan, Zhuangchuan; Hu, Boli; Xu, Yunbin; Yan, Yan; Zan, Jie; Liao, Min; DiCaprio, Erin; Li, Jianrong; Su, Shuo; Zhou, Jiyong
2017-04-03
Autophagy is an essential component of host immunity and used by viruses for survival. However, the autophagy signaling pathways involved in virus replication are poorly documented. Here, we observed that rabies virus (RABV) infection triggered intracellular autophagosome accumulation and results in incomplete autophagy by inhibiting autophagy flux. Subsequently, we found that RABV infection induced the reduction of CASP2/caspase 2 and the activation of AMP-activated protein kinase (AMPK)-AKT-MTOR (mechanistic target of rapamycin) and AMPK-MAPK (mitogen-activated protein kinase) pathways. Further investigation revealed that BECN1/Beclin 1 binding to viral phosphoprotein (P) induced an incomplete autophagy via activating the pathways CASP2-AMPK-AKT-MTOR and CASP2-AMPK-MAPK by decreasing CASP2. Taken together, our data first reveals a crosstalk of BECN1 and CASP2-dependent autophagy pathways by RABV infection.
Inducible model for β-six-mediated site-specific recombination in mammalian cells
Servert, Pilar; Garcia-Castro, Javier; Díaz, Vicente; Lucas, Daniel; Gonzalez, Manuel A.; Martínez-A, Carlos; Bernad, Antonio
2006-01-01
The prokaryotic β recombinase catalyzes site-specific recombination between two directly oriented minimal six sites in chromatin-integrated substrates. Here, we demonstrate that an enhanced green fluorescent protein (EGFP)-fused version of β recombinase (β-EGFP) is fully active, retaining most specific activity. It is used to develop a recombination-dependent activatable gene expression (RAGE) system based on the androgen receptor (AR) ligand-binding domain (LBD). Two hybrid molecules, a direct fusion of the LBD-AR to the C-terminus of β recombinase (β-AR) and a triple fusion of β-EGFP to the same ligand-binding domain (β-EGFP-AR), were engineered and their subcellular behavior, stability and catalytic activity were evaluated. Both chimeric β recombinase proteins showed in vivo inducible recombinogenic activity dependent on addition of an androgen receptor agonist, although the β-AR fusion protein demonstrated more accurate ligand-dependent translocation from cytoplasm to nucleus. PMID:16394020
Urata, Mariko; Kokabu, Shoichiro; Matsubara, Takuma; Sugiyama, Goro; Nakatomi, Chihiro; Takeuchi, Hiroshi; Hirata-Tsuchiya, Shizu; Aoki, Kazuhiro; Tamura, Yukihiko; Moriyama, Yasuko; Ayukawa, Yasunori; Matsuda, Miho; Zhang, Min; Koyano, Kiyoshi; Kitamura, Chiaki; Jimi, Eijiro
2018-09-01
Bone morphogenetic protein (BMP) potentiates bone formation through the Smad signaling pathway in vitro and in vivo. The transcription factor nuclear factor κB (NF-κB) suppresses BMP-induced osteoblast differentiation. Recently, we identified that the transactivation (TA) 2 domain of p65, a main subunit of NF-κB, interacts with the mad homology (MH) 1 domain of Smad4 to inhibit BMP signaling. Therefore, we further attempted to identify the interacting regions of these two molecules at the amino acid level. We identified a region that we term the Smad4-binding domain (SBD), an amino-terminal region of TA2 that associates with the MH1 domain of Smad4. Cell-permeable SBD peptide blocked the association of p65 with Smad4 and enhanced BMP2-induced osteoblast differentiation and mineralization without affecting the phosphorylation of Smad1/5 or the activation of NF-κB signaling. SBD peptide enhanced the binding of the BMP2-inudced phosphorylated Smad1/5 on the promoter region of inhibitor of DNA binding 1 (Id-1) compared with control peptide. Although SBD peptide did not affect BMP2-induced chondrogenesis during ectopic bone formation, the peptide enhanced BMP2-induced ectopic bone formation in subcortical bone. Thus, the SBD peptide is useful for enabling BMP2-induced bone regeneration without inhibiting NF-κB activity. © 2018 Wiley Periodicals, Inc.
LH-RH binding to purified pituitary plasma membranes: absence of adenylate cyclase activation.
Clayton, R N; Shakespear, R A; Marshall, J C
1978-06-01
Purified bovine pituitary plasma membranes possess two specific LH-RH binding sites. The high affinity site (2.5 X 10(9) l/mol) has low capacity (9 X 10(-15) mol/mg membrane protein) while the low affinity site 6.1 X 10(5) l/mol) has a much higher capacity (1.1 X 10(-10) mol/mg). Specific LH-RH binding to plasma membranes is increased 8.5-fold during purification from homogenate whilst adenylate cyclase activity is enriched 7--8-fold. Distribution of specific LH-RH binding to sucrose density gradient interface fractions parallels that of adenylate cyclase activity. Mg2+ and Ca2+ inhibit specific [125I]LH-RH binding at micromolar concentrations. Synthetic LH-RH, up to 250 microgram/ml, failed to stimulate adenylase cyclase activity of the purified bovine membranes. Using a crude 10,800 g rat pituitary membrane preparation, LH-RH similarly failed to activate adenylate cyclase even in the presence of guanyl nucleotides. These data confirm the presence of LH-RH receptor sites on pituitary plasma membranes and suggest that LH-RH-induced gonadotrophin release may be mediated by mechanisms other than activation of adenylate cyclase.
Purohit, Rahul; Fritz, Bradley G.; The, Juliana; Issaian, Aaron; Weichsel, Andrzej; David, Cynthia L.; Campbell, Eric; Hausrath, Andrew C.; Rassouli-Taylor, Leida; Garcin, Elsa D.; Gage, Matthew J.; Montfort, William R.
2014-01-01
Soluble guanylate cyclase (sGC) is a heterodimeric heme protein and the primary nitric oxide receptor. NO binding stimulates cyclase activity, leading to regulation of cardiovascular physiology and making sGC an attractive target for drug discovery. YC-1 and related compounds stimulate sGC both independently and synergistically with NO and CO binding; however, where the compounds bind and how they work remains unknown. Using linked-equilibria binding measurements, surface plasmon resonance, and domain truncations in Manduca sexta and bovine sGC, we demonstrate that YC-1 binds near or directly to the heme-containing domain of the beta subunit. In the absence of CO, YC-1 binds with Kd = 9–21 μM, depending on construct. In the presence of CO, these values decrease to 0.6–1.1 μM. Pfizer compound 25 bound ~10-fold weaker than YC-1 in the absence of CO whereas compound BAY 41–2272 bound particularly tightly in the presence of CO (Kd = 30–90 nM). Additionally, we found that CO binding is much weaker to heterodimeric sGC proteins (Kd = 50–100 μM) than to the isolated heme domain (Kd = 0.2 μM for Manduca beta H-NOX/PAS). YC-1 greatly enhanced CO binding to heterodimeric sGC, as expected (Kd = ~1 μM). These data indicate the alpha subunit induces a heme pocket conformation with lower affinity for CO and NO. YC-1 family compounds bind near the heme domain, overcoming the alpha subunit effect and inducing a heme pocket conformation with high affinity. We propose this high-affinity conformation is required for the full-length protein to achieve high catalytic activity. PMID:24328155
Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells
Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele
2014-01-01
Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548
Binding mechanism and dynamic conformational change of C subunit of PKA with different pathways
Chu, Wen-Ting; Chu, Xiakun; Wang, Jin
2017-01-01
The catalytic subunit of PKA (PKAc) exhibits three major conformational states (open, intermediate, and closed) during the biocatalysis process. Both ATP and substrate/inhibitor can effectively induce the conformational changes of PKAc from open to closed states. Aiming to explore the mechanism of this allosteric regulation, we developed a coarse-grained model and analyzed the dynamics of conformational changes of PKAc during binding by performing molecular dynamics simulations for apo PKAc, binary PKAc (PKAc with ATP, PKAc with PKI), and ternary PKAc (PKAc with ATP and PKI). Our results suggest a mixed binding mechanism of induced fit and conformational selection, with the induced fit dominant. The ligands can drive the movements of Gly-rich loop as well as some regions distal to the active site in PKAc and stabilize them at complex state. In addition, there are two parallel pathways (pathway with PKAc-ATP as an intermediate and pathway PKAc-PKI as an intermediate) during the transition from open to closed states. By molecular dynamics simulations and rate constant analyses, we find that the pathway through PKAc-ATP intermediate is the main binding route from open to closed state because of the fact that the bound PKI will hamper ATP from successful binding and significantly increase the barrier for the second binding subprocess. These findings will provide fundamental insights of the mechanisms of PKAc conformational change upon binding. PMID:28855336
Binding mechanism and dynamic conformational change of C subunit of PKA with different pathways.
Chu, Wen-Ting; Chu, Xiakun; Wang, Jin
2017-09-19
The catalytic subunit of PKA (PKAc) exhibits three major conformational states (open, intermediate, and closed) during the biocatalysis process. Both ATP and substrate/inhibitor can effectively induce the conformational changes of PKAc from open to closed states. Aiming to explore the mechanism of this allosteric regulation, we developed a coarse-grained model and analyzed the dynamics of conformational changes of PKAc during binding by performing molecular dynamics simulations for apo PKAc, binary PKAc (PKAc with ATP, PKAc with PKI), and ternary PKAc (PKAc with ATP and PKI). Our results suggest a mixed binding mechanism of induced fit and conformational selection, with the induced fit dominant. The ligands can drive the movements of Gly-rich loop as well as some regions distal to the active site in PKAc and stabilize them at complex state. In addition, there are two parallel pathways (pathway with PKAc-ATP as an intermediate and pathway PKAc-PKI as an intermediate) during the transition from open to closed states. By molecular dynamics simulations and rate constant analyses, we find that the pathway through PKAc-ATP intermediate is the main binding route from open to closed state because of the fact that the bound PKI will hamper ATP from successful binding and significantly increase the barrier for the second binding subprocess. These findings will provide fundamental insights of the mechanisms of PKAc conformational change upon binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marley, R.J.; Wehner, J.M.
Various populations of mice exhibit differential sensitivity to seizure-inducing agents. The relationship of seizure susceptibility to alterations in the GABA receptor complex was investigated in six different populations of mice consisting of four inbred strains (C57BL, DBA, C3H, and BALB) and two selected lines (long sleep and short sleep). Seizure activity was induced by intraperitoneal administration of the GAD inhibitor, 3-mercaptopropionic acid, and latencies to seizure onset and tonus were measured. In naive mice of the same populations, GABA enhancement of TH-flunitrazepam binding was measured in extensively washed whole brain membranes at several GABA concentrations. Both differential seizure sensitivity tomore » 3-mercaptopropionic acid and differential enhancement of TH-flunitrazepam binding by GABA were observed in these six populations of mice. Correlational analyses indicated a positive correlation between the degree of GABA enhancement of TH-flunitrazepam binding and resistance to the seizure-inducing properties of 3-mercaptopropionic acid. These data suggest that genetic differences in sensitivity to seizure-inducing agents that disrupt the GABAergic system may be related to differences in coupling between the various receptors associated with the GABA receptor complex.« less
Quitschke, Wolfgang W.
2012-01-01
Curcumin preparations typically contain a mixture of polyphenols, collectively referred to as curcuminoids. In addition to the primary component curcumin, they also contain smaller amounts of the co-extracted derivatives demethoxycurcumin and bisdemethoxycurcumin. Curcuminoids can be differentially solubilized in serum, which allows for the systematic analysis of concentration-dependent cellular binding, biological effects, and metabolism. Technical grade curcumin was solubilized in fetal calf serum by two alternative methods yielding saturated preparations containing either predominantly curcumin (60%) or bisdemethoxycurcumin (55%). Continual exposure of NT2/D1 cells for 4–6 days to either preparation in cell culture media reduced cell division (1–5 µM), induced senescence (6–7 µM) or comprehensive cell death (8–10 µM) in a concentration-dependent manner. Some of these effects could also be elicited in cells transiently exposed to higher concentrations of curcuminoids (47 µM) for 0.5–4 h. Curcuminoids induced apoptosis by generalized activation of caspases but without nucleosomal fragmentation. The equilibrium binding of serum-solubilized curcuminoids to NT2/D1 cells incubated with increasing amounts of curcuminoid-saturated serum occurred with apparent overall dissociation constants in the 6–10 µM range. However, the presence of excess free serum decreased cellular binding in a hyperbolic manner. Cellular binding was overwhelmingly associated with membrane fractions and bound curcuminoids were metabolized in NT2/D1 cells via a previously unidentified reduction pathway. Both the binding affinities for curcuminoids and their reductive metabolic pathways varied in other cell lines. These results suggest that curcuminoids interact with cellular binding sites, thereby activating signal transduction pathways that initiate a variety of biological responses. The dose-dependent effects of these responses further imply that distinct cellular pathways are sequentially activated and that this activation is dependent on the affinity of curcuminoids for the respective binding sites. Defined serum-solubilized curcuminoids used in cell culture media are thus suitable for further investigating the differential activation of signal transduction pathways. PMID:22768090
Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher
2009-01-01
GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890
Kim, S; Ponka, P
2000-03-03
Iron regulatory proteins (IRP-1 and IRP-2) control the synthesis of transferrin receptors (TfR) and ferritin by binding to iron-responsive elements, which are located in the 3'-untranslated region and the 5'-untranslated region of their respective mRNAs. Cellular iron levels affect binding of IRPs to iron-responsive elements and consequently expression of TfR and ferritin. Moreover, NO(*), a redox species of nitric oxide that interacts primarily with iron, can activate IRP-1 RNA binding activity resulting in an increase in TfR mRNA levels. Recently we found that treatment of RAW 264.7 cells (a murine macrophage cell line) with NO(+) (nitrosonium ion, which causes S-nitrosylation of thiol groups) resulted in a rapid decrease in RNA binding of IRP-2 followed by IRP-2 degradation, and these changes were associated with a decrease in TfR mRNA levels (Kim, S., and Ponka, P. (1999) J. Biol. Chem. 274, 33035-33042). In this study, we demonstrated that stimulation of RAW 264.7 cells with lipopolysaccharide (LPS) and interferon-gamma (IFN-gamma) increased IRP-1 binding activity, whereas RNA binding of IRP-2 decreased and was followed by a degradation of this protein. Moreover, the decrease of IRP-2 binding/protein levels was associated with a decrease in TfR mRNA levels in LPS/IFN-gamma-treated cells, and these changes were prevented by inhibitors of inducible nitric oxide synthase. Furthermore, LPS/IFN-gamma-stimulated RAW 264.7 cells showed increased rates of ferritin synthesis. These results suggest that NO(+)-mediated degradation of IRP-2 plays a major role in iron metabolism during inflammation.
Siddiqui-Jain, Adam; Hoj, Jacob P; Hargiss, J Blade; Hoj, Taylor H; Payne, Carter J; Ritchie, Collin A; Herron, Steven R; Quinn, Colette; Schuler, Jeffrey T; Hansen, Marc D H
2017-09-01
Stimulation of cultured epithelial cells with scatter factor/hepatocyte growth factor (HGF) results in individual cells detaching and assuming a migratory and invasive phenotype. Epithelial scattering recapitulates cancer progression and studies have implicated HGF signaling as a driver of cancer metastasis. Inhibitors of HGF signaling have been proposed to act as anti-cancer agents. We previously screened a small molecule library for compounds that block HGF-induced epithelial scattering. Most hits identified in this screen exhibit anti-mitotic properties. Here we assess the biological mechanism of a compound that blocks HGF-induced scattering with limited anti-mitotic activity. Analogs of this compound have one of two distinct activities: inhibiting either cell migration or cell proliferation with cell cycle arrest in G2/M. Each activity bears unique structure-activity relationships. The mechanism of action of anti-mitotic compounds is by inhibition of microtubule polymerization; these compounds entropically and enthalpically bind tubulin in the colchicine binding site, generating a conformational change in the tubulin dimer. Copyright © 2017 Elsevier Ltd. All rights reserved.
The Role of JMY in p53 Regulation.
Adighibe, Omanma; Pezzella, Francesco
2018-05-31
Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.
Yang, Rui-Nan; Li, Dong-Zhen; Yu, Guangqiang; Yi, Shan-Cheng; Zhang, Yinan; Kong, De-Xin; Wang, Man-Qun
2017-12-01
In light of reverse chemical ecology, the fluorescence competitive binding assays of functional odorant binding proteins (OBPs) is a recent advanced approach for screening behaviorally active compounds of insects. Previous research on Dastareus helophoroides identified a minus-C OBP, DhelOBP21, which preferably binds to several ligands. In this study, only (+)-β-pinene proved attractive to unmated adult beetles. To obtain a more in-depth explanation of the lack of behavioral activity of other ligands we selected compounds with high (camphor) and low (β-caryophyllene) binding affinities. The structural transformation of OBPs was investigated using well-established approaches for studying binding processes, such as fluorescent quenching assays, circular dichroism, and molecular dynamics. The dynamic binding process revealed that the flexibility of DhelOBP21 seems conducive to binding specific ligands, as opposed to broad substrate binding. The compound (+)-β-pinene and DhelOBP21 formed a stable complex through a secondary structural transformation of DhelOBP21, in which its amino-terminus transformed from random coil to an α-helix to cover the binding pocket. On the other hand, camphor could not efficiently induce a stable structural transformation, and its high binding affinities were due to strong hydrogen-bonding, compromising the structure of the protein. The other compound, β-caryophyllene, only collided with DhelOBP21 and could not be positioned in the binding pocket. Studying structural transformation of these proteins through examining the dynamic binding process rather than using approaches that just measure binding affinities such as fluorescence competitive binding assays can provide a more efficient and reliable approach for screening behaviorally active compounds.
Brom, J; König, W
1992-01-01
The effect of various cytokines [interleukin-3(IL-3), IL-6, IL-8, tumour necrosis factor-beta (TNF-beta)] on human neutrophils (PMN) was analysed with regard to the generation of leukotrienes and the involvement of guanosine triphosphate (GTP)-binding proteins (G proteins). Incubation of cytochalasin B-pretreated PMN with cytokines alone did not lead to a generation of leukotrienes. However, the cytokines affected the formyl-methionyl-leucyl-phenylalanine-(FMLP)-induced formation of leukotrienes in a time-dependent manner. Preincubation of the cells with the different cytokines for short periods (15 seconds at 37 degrees) enhanced the subsequent FMLP-induced leukotriene generation, whereas preincubation for prolonged times resulted in a reduced formation of leukotrienes. These results correlated with the respective G protein-associated guanosine triphosphatase (GTPase) activities within isolated membrane fractions. The present study indicates a modulation of the FMLP-induced leukotriene formation by diverse cytokines via interaction with the GTP-binding proteins. PMID:1312995
Díaz-Guerra, M; Rivas, C; Esteban, M
1999-02-01
To define protein domains important for activation of the interferon (IFN)-induced enzyme 2-5A-dependent RNaseL, we have generated vaccinia virus (VV) recombinants able to express in cultured cells truncated forms of this protein and compared their biologic activities with those producing the wild-type enzyme, with and without coexpression of 2-5A synthetase. Our results show that full activation of RNaseL requires binding of 2-5A oligonucleotides within amino acid positions 212-339, corresponding to ankyrin repeats 6 to 9. The protein kinase and ribonuclease domains of RNaseL, amino acids 340-741, are sufficient for a constitutively active enzyme that is unresponsive to excess 2-5A. These results demonstrate in vivo the importance of the ankyrin domains in the biologic function of RNaseL. We suggest that ankyrin repeats act as key modulators of RNaseL activity.
A pain-inducing centipede toxin targets the heat activation machinery of nociceptor TRPV1
NASA Astrophysics Data System (ADS)
Yang, Shilong; Yang, Fan; Wei, Ningning; Hong, Jing; Li, Bowen; Luo, Lei; Rong, Mingqiang; Yarov-Yarovoy, Vladimir; Zheng, Jie; Wang, Kewei; Lai, Ren
2015-09-01
The capsaicin receptor TRPV1 ion channel is a polymodal nociceptor that responds to heat with exquisite sensitivity through an unknown mechanism. Here we report the identification of a novel toxin, RhTx, from the venom of the Chinese red-headed centipede that potently activates TRPV1 to produce excruciating pain. RhTx is a 27-amino-acid small peptide that forms a compact polarized molecule with very rapid binding kinetics and high affinity for TRPV1. We show that RhTx targets the channel's heat activation machinery to cause powerful heat activation at body temperature. The RhTx-TRPV1 interaction is mediated by the toxin's highly charged C terminus, which associates tightly to the charge-rich outer pore region of the channel where it can directly interact with the pore helix and turret. These findings demonstrate that RhTx binding to the outer pore can induce TRPV1 heat activation, therefore providing crucial new structural information on the heat activation machinery.
Gumireddy, Kiranmai; Reddy, C Damodar; Swamy, Narasimha
2003-09-01
Vitamin D-binding protein-macrophage-activating factor (DBP-maf) is derived from serum vitamin D binding protein (DBP) by selective deglycosylation during inflammation. In the present study, we investigated the effect of DBP-maf on RAW 264.7 macrophages and the underlying intracellular signal transduction pathways. DBP-maf increased proapoptotic caspase-3, -8, and -9 activities and induced apoptosis in RAW 264.7 cells. However, DBP, the precursor to DBP-maf did not induce apoptosis in these cells. Cell cycle analysis of DBP-maf-treated RAW 264.7 cells revealed growth arrest with accumulation of cells in sub-G(0)/G(1) phase. We also investigated the role of mitogen-activated protein kinase (MAPK) pathways in the DBP-maf-induced apoptosis of RAW264.7 cells. DBP-maf increased the phosphorylation of p38 and JNK1/2, while it decreased the ERK1/2 phosphorylation. Treatment with the p38 MAPK inhibitor, SB202190, attenuated DBP-maf-induced apoptosis. PD98059, a MEK specific inhibitor, did not show a significant inhibition of apoptosis induced by DBP-maf. Taken together, these results suggest that the p38 MAPK pathway plays a crucial role in DBP-maf-mediated apoptosis of macrophages. Our studies indicate that, during inflammation DBP-maf may function positively by causing death of the macrophages when activated macrophages are no longer needed at the site of inflammation. In summary, we report for the first time that DBP-maf induces apoptosis in macrophages via p38 and JNK1/2 pathway. Copyright 2003 Wiley-Liss, Inc.
Pindyurin, Alexey V
2017-01-01
A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.
Integrin binding and mechanical tension induce movement of mRNA and ribosomes to focal adhesions
NASA Technical Reports Server (NTRS)
Chicurel, M. E.; Singer, R. H.; Meyer, C. J.; Ingber, D. E.
1998-01-01
The extracellular matrix (ECM) activates signalling pathways that control cell behaviour by binding to cell-surface integrin receptors and inducing the formation of focal adhesion complexes (FACs). In addition to clustered integrins, FACs contain proteins that mechanically couple the integrins to the cytoskeleton and to immobilized signal-transducing molecules. Cell adhesion to the ECM also induces a rapid increase in the translation of preexisting messenger RNAs. Gene expression can be controlled locally by targeting mRNAs to specialized cytoskeletal domains. Here we investigate whether cell binding to the ECM promotes formation of a cytoskeletal microcompartment specialized for translational control at the site of integrin binding. High-resolution in situ hybridization revealed that mRNA and ribosomes rapidly and specifically localized to FACs that form when cells bind to ECM-coated microbeads. Relocation of these protein synthesis components to the FAC depended on the ability of integrins to mechanically couple the ECM to the contractile cytoskeleton and on associated tension-moulding of the actin lattice. Our results suggest a new type of gene regulation by integrins and by mechanical stress which may involve translation of mRNAs into proteins near the sites of signal reception.
Gao, Bihu; Kikuchi-Utsumi, Kazue; Ohinata, Hiroshi; Hashimoto, Masaaki; Kuroshima, Akihiro
2003-06-01
Repeat immobilization-stressed rats are leaner and have improved cold tolerance due to enhancement of brown adipose tissue (BAT) thermogenesis. This process likely involves stress-induced sympathetic nervous system activation and adrenocortical hormone release, which dynamically enhances and suppresses uncoupling protein 1 (UCP1) function, respectively. To investigate whether repeated immobilization influences UCP1 thermogenic properties, we assessed UCP1 mRNA, protein expression, and activity (GDP binding) in BAT from immobilization-naive or repeatedly immobilized rats (3 h daily for 4 weeks) and sham operated or adrenalectomized (ADX) rats. UCP1 properties were assessed before (basal) and after exposure to 3 h of acute immobilization. Basal levels of GDP binding and UCP1 expression was significantly increased (140 and 140%) in the repeated immobilized group. Acute immobilization increased GDP binding in both naive (180%) and repeated immobilized groups (220%) without changing UCP1 expression. In ADX rats, basal GDP binding and UCP1 gene expression significantly increased (140 and 110%), and acute immobilization induced further increase. These data demonstrate that repeated immobilization resulted in enhanced UCP1 function, suggesting that enhanced BAT thermogenesis contributes to lower body weight gain through excess energy loss and an improved ability to maintain body temperature during cold exposure.
Zhang, Fan; Zhang, Jie; Liu, Moyan; Zhao, Lichao; LingHu, RuiXia; Feng, Fan; Gao, Xudong; Jiao, Shunchang; Zhao, Lei; Hu, Yi; Yang, Junlan
2015-01-01
Although trastuzumab has succeeded in breast cancer treatment, acquired resistance is one of the prime obstacles for breast cancer therapies. There is an urgent need to develop novel HER2 antibodies against trastuzumab resistance. Here, we first rational designed avidity-imporved trastuzumab and pertuzumab variants, and explored the correlation between the binding avidity improvement and their antitumor activities. After characterization of a pertuzumab variant L56TY with potent antitumor activities, a bispecific immunoglobulin G-like CrossMab (Tras-Permut CrossMab) was generated from trastuzumab and binding avidity-improved pertuzumab variant L56TY. Although, the antitumor efficacy of trastuzumab was not enhanced by improving its binding avidity, binding avidity improvement could significantly increase the anti-proliferative and antibody-dependent cellular cytotoxicity (ADCC) activities of pertuzumab. Further studies showed that Tras-Permut CrossMab exhibited exceptional high efficiency to inhibit the progression of trastuzumab-resistant breast cancer. Notably, we found that calreticulin (CRT) exposure induced by Tras-Permut CrossMab was essential for induction of tumor-specific T cell immunity against tumor recurrence. These data indicated that simultaneous blockade of HER2 protein by Tras-Permut CrossMab could trigger CRT exposure and subsequently induce potent tumor-specific T cell immunity, suggesting it could be a promising therapeutic strategy against trastuzumab resistance. PMID:25949918
Brown, Sharron A N; Richards, Christine M; Hanscom, Heather N; Feng, Sheau-Line Y; Winkles, Jeffrey A
2003-01-01
Fn14 is a growth-factor-inducible immediate-early-response gene encoding a 102-amino-acid type I transmembrane protein. The human Fn14 protein was recently identified as a cell-surface receptor for the tumour necrosis factor (TNF) superfamily member named TWEAK (TNF-like weak inducer of apoptosis). In the present paper, we report that the human TWEAK extracellular domain can also bind the murine Fn14 protein. Furthermore, site-specific mutagenesis and directed yeast two-hybrid interaction assays revealed that the TNFR-associated factor (TRAF) 1, 2, 3 and 5 adaptor molecules bind the murine Fn14 cytoplasmic tail at an overlapping, but non-identical, amino acid sequence motif. We also found that TWEAK treatment of quiescent NIH 3T3 cells stimulates inhibitory kappaBalpha phosphorylation and transcriptional activation of a nuclear factor-kappaB (NF-kappaB) enhancer/luciferase reporter construct. Fn14 overexpression in transiently transfected NIH 3T3 cells also promotes NF-kappaB activation, and this cellular response requires an intact TRAF binding site. These results indicate that Fn14 is a functional TWEAK receptor that can associate with four distinct TRAF family members and stimulate the NF-kappaB transcription factor signalling pathway. PMID:12529173
Festuccia, William T.; Blanchard, Pierre-Gilles; Oliveira, Thiago B.; Magdalon, Juliana; Paschoal, Vivian A.; Richard, Denis
2012-01-01
Here, we investigated whether pharmacological PPARγ activation modulates key early events in brown adipose tissue (BAT) recruitment induced by acute cold exposure with the aim of unraveling the interrelationships between sympathetic and PPARγ signaling. Sprague-Dawley rats treated or not with the PPARγ ligand rosiglitazone (15 mg·kg−1·day−1, 7 days) were kept at 23°C or exposed to cold (5°C) for 24 h and evaluated for BAT gene expression, sympathetic activity, thyroid status, and adrenergic signaling. Rosiglitazone did not affect the reduction in body weight gain and the increase in feed efficiency, V̇o2, and BAT sympathetic activity induced by 24-h cold exposure. Rosiglitazone strongly attenuated the increase in serum total and free T4 and T3 levels and BAT iodothyronine deiodinase type 2 (D2) and PGC-1α mRNA levels and potentiated the reduction in BAT thyroid hormone receptor (THR) β mRNA levels induced by cold. Administration of T3 to rosiglitazone-treated rats exacerbated the cold-induced increase in energy expenditure but did not restore a proper activation of D2 and PGC-1α, nor further increased uncoupling protein 1 expression. Regarding adrenergic signaling, rosiglitazone did not affect the changes in BAT cAMP content and PKA activity induced by cold. Rosiglitazone alone or in combination with cold increased CREB binding to DNA, but it markedly reduced the expression of one of its major coactivators, CREB binding protein. In conclusion, pharmacological PPARγ activation impairs short-term cold elicitation of BAT adrenergic and thyroid signaling, which may result in abnormal tissue recruitment and thermogenic activity. PMID:23100029
The Roles of RNase-L in Antimicrobial Immunity and the Cytoskeleton-Associated Innate Response
Ezelle, Heather J.; Malathi, Krishnamurthy; Hassel, Bret A.
2016-01-01
The interferon (IFN)-regulated endoribonuclease RNase-L is involved in multiple aspects of the antimicrobial innate immune response. It is the terminal component of an RNA cleavage pathway in which dsRNA induces the production of RNase-L-activating 2-5A by the 2′-5′-oligoadenylate synthetase. The active nuclease then cleaves ssRNAs, both cellular and viral, leading to downregulation of their expression and the generation of small RNAs capable of activating retinoic acid-inducible gene-I (RIG-I)-like receptors or the nucleotide-binding oligomerization domain-like receptor 3 (NLRP3) inflammasome. This leads to IFNβ expression and IL-1β activation respectively, in addition to broader effects on immune cell function. RNase-L is also one of a growing number of innate immune components that interact with the cell cytoskeleton. It can bind to several cytoskeletal proteins, including filamin A, an actin-binding protein that collaborates with RNase-L to maintain the cellular barrier to viral entry. This antiviral activity is independent of catalytic function, a unique mechanism for RNase-L. We also describe here the interaction of RNase-L with the E3 ubiquitin ligase and scaffolding protein, ligand of nump protein X (LNX), a regulator of tight junction proteins. In order to better understand the significance and context of these novel binding partners in the antimicrobial response, other innate immune protein interactions with the cytoskeleton are also discussed. PMID:26760998
The Roles of RNase-L in Antimicrobial Immunity and the Cytoskeleton-Associated Innate Response.
Ezelle, Heather J; Malathi, Krishnamurthy; Hassel, Bret A
2016-01-08
The interferon (IFN)-regulated endoribonuclease RNase-L is involved in multiple aspects of the antimicrobial innate immune response. It is the terminal component of an RNA cleavage pathway in which dsRNA induces the production of RNase-L-activating 2-5A by the 2'-5'-oligoadenylate synthetase. The active nuclease then cleaves ssRNAs, both cellular and viral, leading to downregulation of their expression and the generation of small RNAs capable of activating retinoic acid-inducible gene-I (RIG-I)-like receptors or the nucleotide-binding oligomerization domain-like receptor 3 (NLRP3) inflammasome. This leads to IFNβ expression and IL-1β activation respectively, in addition to broader effects on immune cell function. RNase-L is also one of a growing number of innate immune components that interact with the cell cytoskeleton. It can bind to several cytoskeletal proteins, including filamin A, an actin-binding protein that collaborates with RNase-L to maintain the cellular barrier to viral entry. This antiviral activity is independent of catalytic function, a unique mechanism for RNase-L. We also describe here the interaction of RNase-L with the E3 ubiquitin ligase and scaffolding protein, ligand of nump protein X (LNX), a regulator of tight junction proteins. In order to better understand the significance and context of these novel binding partners in the antimicrobial response, other innate immune protein interactions with the cytoskeleton are also discussed.
Lakshmi, Sowmya P; Reddy, Aravind T; Reddy, Raju C
2017-04-24
Transforming growth factor β (TGF-β) contributes to wound healing and, when dysregulated, to pathological fibrosis. TGF-β and the anti-fibrotic nuclear hormone receptor peroxisome proliferator-activated receptor γ (PPARγ) repress each other's expression, and such PPARγ down-regulation is prominent in fibrosis and mediated, via previously unknown SMAD-signaling mechanisms. Here, we show that TGF-β induces the association of SMAD3 with both SMAD4, needed for translocation of the complex into the nucleus, and the essential context-sensitive co-repressors E2F4 and p107. The complex mediates TGF-β-induced repression by binding to regulatory elements in the target promoter. In the PPARG promoter, we found that the SMAD3-SMAD4 complex binds both to a previously unknown consensus TGF-β inhibitory element (TIE) and also to canonical SMAD-binding elements (SBEs). Furthermore, the TIE and SBEs independently mediated the partial repression of PPARG transcription, the first demonstration of a TIE and SBEs functioning within the same promoter. Also, TGF-β-treated fibroblasts contained SMAD complexes that activated a SMAD target gene in addition to those repressing PPARG transcription, the first finding of such dual activity within the same cell. These findings describe in detail novel mechanisms by which TGF-β represses PPARG transcription, thereby facilitating its own pro-fibrotic activity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Xiaokaiti, Yilixiati; Wu, Haoming; Chen, Ya; Yang, Haopeng; Duan, Jianhui; Li, Xin; Pan, Yan; Tie, Lu; Zhang, Liangren; Li, Xuejun
2015-01-01
Lung carcinogenesis is a complex process that occurs in unregulated inflammatory environment. EGCG has been extensively investigated as a multi-targeting anti-tumor and anti-inflammatory compound. In this study, we demonstrated a novel mechanism by which EGCG reverses the neutrophil elastase-induced migration of A549 cells. We found that neutrophil elastase directly triggered human adenocarcinoma A549 cell migration and that EGCG suppressed the elevation of tumor cell migration induced by neutrophil elastase. We observed that EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity based on the CDOCKER algorithm, MD stimulation by GROMACS, SPR assay and elastase enzymatic activity assay. As the natural inhibitor of neutrophil elastase, α1-antitrypsin is synthesized in tumor cells. We further demonstrated that the expression of α1-antitrypsin was up-regulated after EGCG treatment in neutrophil elastase-treated A549 cells. We preliminarily discovered that the EGCG-mediated induction of α1-antitrypsin expression might be correlated with the regulatory effect of EGCG on the PI3K/Akt pathway. Overall, our results suggest that EGCG ameliorates the neutrophil elastase-induced migration of A549 cells. The mechanism underlying this effect may include two processes: EGCG directly binds to neutrophil elastase and inhibits its enzymatic activity; EGCG enhances the expression of α1-antitrypsin by regulating the PI3K/AKT pathway. PMID:26177797
Köberle, Martin; Göppel, David; Grandl, Tanja; Gaentzsch, Peer; Manncke, Birgit; Berchtold, Susanne; Müller, Steffen; Lüscher, Bernhard; Asselin-Labat, Marie-Liesse; Pallardy, Marc; Sorg, Isabel; Langer, Simon; Barth, Holger; Zumbihl, Robert; Autenrieth, Ingo B.; Bohn, Erwin
2012-01-01
Glucocorticoid induced-leucine zipper (GILZ) has been shown to be induced in cells by different stimuli such as glucocorticoids, IL-10 or deprivation of IL-2. GILZ has anti-inflammatory properties and may be involved in signalling modulating apoptosis. Herein we demonstrate that wildtype Yersinia enterocolitica which carry the pYV plasmid upregulated GILZ mRNA levels and protein expression in epithelial cells. Infection of HeLa cells with different Yersinia mutant strains revealed that the protease activity of YopT, which cleaves the membrane-bound form of Rho GTPases was sufficient to induce GILZ expression. Similarly, Clostridium difficile toxin B, another bacterial inhibitor of Rho GTPases induced GILZ expression. YopT and toxin B both increased transcriptional activity of the GILZ promoter in HeLa cells. GILZ expression could not be linked to the inactivation of an individual Rho GTPase by these toxins. However, forced expression of RhoA and RhoB decreased basal GILZ promoter activity. Furthermore, MAPK activation proved necessary for profound GILZ induction by toxin B. Promoter studies and gel shift analyses defined binding of upstream stimulatory factor (USF) 1 and 2 to a canonical c-Myc binding site (E-box) in the GILZ promoter as a crucial step of its trans-activation. In addition we could show that USF-1 and USF-2 are essential for basal as well as toxin B induced GILZ expression. These findings define a novel way of GILZ promoter trans-activation mediated by bacterial toxins and differentiate it from those mediated by dexamethasone or deprivation of IL-2. PMID:22792400
Adam, Yoav; Tayer, Naama; Rotem, Dvir; Schreiber, Gideon; Schuldiner, Shimon
2007-01-01
EmrE is an Escherichia coli H+-coupled multidrug transporter that provides a unique experimental paradigm because of its small size and stability, and because its activity can be studied in detergent solution. In this work, we report a study of the transient kinetics of substrate binding and substrate-induced proton release in EmrE. For this purpose, we measured transient changes in the tryptophan fluorescence upon substrate binding and the rates of substrate-induced proton release. The fluorescence of the essential and fully conserved Trp residue at position 63 is sensitive to the occupancy of the binding site with either protons or substrate. The maximal rate of binding to detergent-solubilized EmrE of TPP+, a high-affinity substrate, is 2 × 107 M−1·s−1, a rate typical of diffusion-limited reactions. Rate measurements with medium- and low-affinity substrates imply that the affinity is determined mainly by the koff of the substrate. The rates of substrate binding and substrate-induced release of protons are faster at basic pHs and slower at lower pHs. These findings imply that the substrate-binding rates are determined by the generation of the species capable of binding; this is controlled by the high affinity to protons of the glutamate at position 14, because an Asp replacement with a lower pK is faster at the same pHs. PMID:17984053
An, Bo; Abbonante, Vittorio; Xu, Huifang; Gavriilidou, Despoina; Yoshizumi, Ayumi; Bihan, Dominique; Farndale, Richard W.; Kaplan, David L.; Balduini, Alessandra; Leitinger, Birgit; Brodsky, Barbara
2016-01-01
A bacterial collagen-like protein Scl2 has been developed as a recombinant collagen model system to host human collagen ligand-binding sequences, with the goal of generating biomaterials with selective collagen bioactivities. Defined binding sites in human collagen for integrins, fibronectin, heparin, and MMP-1 have been introduced into the triple-helical domain of the bacterial collagen and led to the expected biological activities. The modular insertion of activities is extended here to the discoidin domain receptors (DDRs), which are collagen-activated receptor tyrosine kinases. Insertion of the DDR-binding sequence from human collagen III into bacterial collagen led to specific receptor binding. However, even at the highest testable concentrations, the construct was unable to stimulate DDR autophosphorylation. The recombinant collagen expressed in Escherichia coli does not contain hydroxyproline (Hyp), and complementary synthetic peptide studies showed that replacement of Hyp by Pro at the critical Gly-Val-Met-Gly-Phe-Hyp position decreased the DDR-binding affinity and consequently required a higher concentration for the induction of receptor activation. The ability of the recombinant bacterial collagen to bind the DDRs without inducing kinase activation suggested it could interfere with the interactions between animal collagen and the DDRs, and such an inhibitory role was confirmed in vitro and with a cell migration assay. This study illustrates that recombinant collagen can complement synthetic peptides in investigating structure-activity relationships, and this system has the potential for the introduction or inhibition of specific biological activities. PMID:26702058
Campbell, Shirley; Otis, Melissa; Côté, Mylène; Gallo-Payet, Nicole; Payet, Marcel Daniel
2003-04-01
Integrins are responsible for adhesion and activation of several intracellular cascades. The present study was aimed at determining whether the interaction between fibronectin and integrins could generate pathways involved in physiological functions of rat adrenal glomerulosa cells. Immunofluorescence studies and adhesion assays showed that fibronectin was the best matrix in promoting the formation of focal adhesion. Binding of glomerulosa cells to fibronectin, but not to collagen I or poly-L-lysine, involved the integrin-binding sequence Arg-Gly-Asp (RGD). Activation of glomerulosa cells with Arg-Gly-Asp-Ser (RGDS) induced an increase in [Ca(2+)](i), whereas fibronectin triggered a release of Ca(2+) from InsP(3)-sensitive Ca(2+) stores. Aldosterone secretion induced by ACTH, angiotensin II, and RGDS and proliferation were improved on fibronectin, compared with poly-L-lysine. The RGDS peptide induced a transient increase in the activity of the p42/p44(mapk), independent of phosphatidylinositol-3 kinase and protein kinase C. Integrins alpha(5) and alpha(V) as well as their fibronectin receptor partners beta(1) and beta(3), were identified. These results suggest that in rat adrenal glomerulosa cells, binding of the alpha(5)beta(1), alpha(v)beta(1), or alpha(v)beta(3) integrins to fibronectin is involved in the generation of two important signaling events, increase in intracellular calcium, and activation of the p42/p44(mapk) cascade, leading to cell proliferation and aldosterone secretion.
Guntas, Gurkan; Hallett, Ryan A.; Zimmerman, Seth P.; ...
2014-12-22
The discovery of light-inducible protein–protein interactions has allowed for the spatial and temporal control of a variety of biological processes. To be effective, a photodimerizer should have several characteristics: it should show a large change in binding affinity upon light stimulation, it should not cross-react with other molecules in the cell, and it should be easily used in a variety of organisms to recruit proteins of interest to each other. In this study, to create a switch that meets these criteria we have embedded the bacterial SsrA peptide in the C-terminal helix of a naturally occurring photoswitch, the light-oxygen-voltage 2more » (LOV2) domain from Avena sativa. In the dark the SsrA peptide is sterically blocked from binding its natural binding partner, SspB. When activated with blue light, the C-terminal helix of the LOV2 domain undocks from the protein, allowing the SsrA peptide to bind SspB. Without optimization, the switch exhibited a twofold change in binding affinity for SspB with light stimulation. Here, we describe the use of computational protein design, phage display, and high-throughput binding assays to create an improved light inducible dimer (iLID) that changes its affinity for SspB by over 50-fold with light stimulation. A crystal structure of iLID shows a critical interaction between the surface of the LOV2 domain and a phenylalanine engineered to more tightly pin the SsrA peptide against the LOV2 domain in the dark. Finally, we demonstrate the functional utility of the switch through light-mediated subcellular localization in mammalian cell culture and reversible control of small GTPase signaling.« less
Kaliakin, Danil S; Zaari, Ryan R; Varganov, Sergey A
2015-02-12
We investigate the effect of H2 binding on the spin-forbidden nonadiabatic transition probability between the lowest energy singlet and triplet electronic states of [NiFe]-hydrogenase active site model, using a velocity averaged Landau-Zener theory. Density functional and multireference perturbation theories were used to provide parameters for the Landau-Zener calculations. It was found that variation of the torsion angle between the terminal thiolate ligands around the Ni center induces an intersystem crossing between the lowest energy singlet and triplet electronic states in the bare active site and in the active site with bound H2. Potential energy curves between the singlet and triplet minima along the torsion angle and H2 binding energies to the two spin states were calculated. Upon H2 binding to the active site, there is a decrease in the torsion angle at the minimum energy crossing point between the singlet and triplet states. The probability of nonadiabatic transitions at temperatures between 270 and 370 K ranges from 35% to 32% for the active site with bound H2 and from 42% to 38% for the bare active site, thus indicating the importance of spin-forbidden nonadiabatic pathways for H2 binding on the [NiFe]-hydrogenase active site.
Deka, G; Bharath, S R; Savithri, H S; Murthy, M R N
2017-09-02
Enteric pathogens such as Salmonella typhimurium colonize the human gut in spite of the lethal acidic pH environment (pH < 2.5) due to the activation of inducible acid tolerance response (ATR) systems. The pyridoxal 5'-phosphate (PLP)-dependent enzyme, biodegradative arginine decarboxylase (ADC, encoded by AdiA), is a component of an ATR system. The enzyme consumes a cytoplasmic proton in the process of arginine degradation to agmatine. Arginine-agmatine antiporter (AdiC) exchanges the product agmatine for arginine. In this manuscript, we describe the structure of Salmonella typhimurium ADC (StADC). The decameric structure assembled from five dimers related by a non crystallographic 5-fold symmetry represents the first apo-form of the enzyme. The structure suggests that PLP-binding is not a prerequisite for oligomerization. Comparison with E. coli ADC reveals that PLP-binding is accompanied by the movement and ordering of two loops (residues 150-159 and 191-197) and a few active site residues such as His256 and Lys257. A number of residues important for substrate binding are disordered in the apo-StADC structure indicating that PLP binding is important for substrate binding. Unlike the interactions between 5-fold related protomers, interactions that stabilize the dimeric structure are not pH dependent. Copyright © 2017 Elsevier Inc. All rights reserved.
Mishra, Dipti Ranjan; Chaudhary, Sanjib; Krishna, B Madhu; Mishra, Sandip K
2015-01-01
Cytosolic inorganic pyrophosphatase plays an important role in the cellular metabolism by hydrolyzing inorganic pyrophosphate (PPi) formed as a by-product of various metabolic reactions. Inorganic pyrophosphatases are known to be associated with important functions related to the growth and development of various organisms. In humans, the expression of inorganic pyrophosphatase (PPA1) is deregulated in different types of cancer and is involved in the migration and invasion of gastric cancer cells and proliferation of ovarian cancer cells. However, the transcriptional regulation of the gene encoding PPA1 is poorly understood. To gain insights into PPA1 gene regulation, a 1217 bp of its 5'-flanking region was cloned and analyzed. The 5'-deletion analysis of the promoter revealed a 266 bp proximal promoter region exhibit most of the transcriptional activity and upon sequence analysis, three putative Sp1 binding sites were found to be present in this region. Binding of Sp1 to the PPA1 promoter was confirmed by Electrophoretic mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay. Importance of these binding sites was verified by site-directed mutagenesis and overexpression of Sp1 transactivates PPA1 promoter activity, upregulates protein expression and increases chromatin accessibility. p300 binds to the PPA1 promoter and stimulates Sp1 induced promoter activity. Trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor induces PPA1 promoter activity and protein expression and HAT activity of p300 was important in regulation of PPA1 expression. These results demonstrated that PPA1 is positively regulated by Sp1 and p300 coactivates Sp1 induced PPA1 promoter activity and histone acetylation/deacetylation may contribute to a local chromatin remodeling across the PPA1 promoter. Further, knockdown of PPA1 decreased colony formation and viability of MCF7 cells.
Kim, Bo-Kyung; Kim, Hwan Mook; Chung, Kyung-Sook; Kim, Dong-Myung; Park, Song-Kyu; Song, Alexander; Won, Kyoung-Jae; Lee, Kiho; Oh, Yu-Kyoung; Lee, Kyeong; Song, Kyung-Bin; Simon, Julian A; Han, Gyoonhee; Won, Misun
2011-03-01
RhoB expression is reduced in most invasive tumors, with loss of RhoB expression correlating significantly with tumor stage. Here, we demonstrate that upregulation of RhoB by the potent anticancer agent NSC126188 induces apoptosis of NUGC-3 human gastric carcinoma cells. The crucial role of RhoB in NSC126188-induced apoptosis is indicated by the rescue of NUGC-3 cells from apoptosis by knockdown of RhoB. In the presence of NSC126188, c-Jun N-terminal kinase (JNK) signaling was activated, and the JNK inhibitor SP600125 reduced RhoB expression and suppressed the apoptosis of NUGC-3 cells. Knockdowns of mitogen-activated protein kinase kinase (MKK) 4/7, JNK1/2 and c-Jun downregulated RhoB expression and rescued cells from apoptotic death in the presence of NSC126188. The JNK inhibitor SP600125 suppressed transcriptional activation of RhoB in the presence of NSC126188, as indicated by a reporter assay that used luciferase under the RhoB promoter. The ability of NSC126188 to increase luciferase activity through both the p300-binding site and the inverted CCAAT sequence (iCCAAT box) suggests that JNK signaling to upregulate RhoB expression is mediated through both the p300-binding site and the iCCAAT box. However, the JNK inhibitor SP600125 did not inhibit the upregulation of RhoB by farnesyltransferase inhibitor (FTI)-277. The p300-binding site did not affect activation of the RhoB promoter by FTI-277 in NUGC-3 cells, suggesting that the transcriptional activation of RhoB by NSC126188 occurs by a different mechanism than that reported for FTIs. Our data indicate that NSC126188 increases RhoB expression via JNK-mediated signaling through a p300-binding site and iCCAAT box resulting in apoptosis of NUGC-3 cells.
Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon
2007-06-01
A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.
Gruber, Patrick; Vieths, Stefan; Wangorsch, Andrea; Nerkamp, Jörg; Hofmann, Thomas
2004-06-16
The influence of thermal processing and nonenymatic as well as polyphenoloxidase-catalyzed browning reaction on the allergenicity of the major cherry allergen Pru av 1 was investigated. After thermal treatment of the recombinant protein rPru av 1 in the absence or presence of carbohydrates, SDS-PAGE, enzyme allergosorbent tests, and inhibition assays revealed that thermal treatment of rPru av 1 alone did not show any influence on the IgE-binding activity of the protein at least for 30 min, thus correlating well with the refolding of the allergen in buffer solution as demonstrated by CD spectroscopic experiments. Incubation of the protein with starch and maltose also showed no effect on IgE-binding activity, whereas reaction with glucose and ribose and, even more pronounced, with the carbohydrate breakdown products glyceraldehyde and glyoxal induced a strong decrease of the IgE-binding capacity of rPru av 1. In the second part of the study, the effect of polyphenoloxidase-catalyzed oxidation of polyphenols on food allergen activity was investigated. Incubation of rPru av 1 with epicatechin in the presence of tyrosinase led to a drastic decrease in IgE-binding activity of the protein. Variations of the phenolic compound revealed caffeic acid and epicatechin as the most active inhibitors of the IgE-binding activity of rPru av 1, followed by catechin and gallic acid, and, finally, by quercetin and rutin, showing significantly lower activity. On the basis of these data, reactive intermediates formed during thermal carbohydrate degradation as well as during enzymatic polyphenol oxidation are suggested as the active chemical species responsible for modifying nucleophilic amino acid side chains of proteins, thus inducing an irreversible change in the tertiary structure of the protein and resulting in a loss of conformational epitopes of the allergen.
Su, Chang; Lu, Yang; Liu, Haoping
2016-10-03
N-acetylglucosamine (GlcNAc) exists ubiquitously as a component of the surface on a wide range of cells, from bacteria to humans. Many fungi are able to utilize environmental GlcNAc to support growth and induce cellular development, a property important for their survival in various host niches. However, how the GlcNAc signal is sensed and subsequently transduced is largely unknown. Here, we identify a gene that is essential for GlcNAc signalling (NGS1) in Candida albicans, a commensal and pathogenic yeast of humans. Ngs1 can bind GlcNAc through the N-terminal β-N-acetylglucosaminidase homology domain. This binding activates N-acetyltransferase activity in the C-terminal GCN5-related N-acetyltransferase domain, which is required for GlcNAc-induced promoter histone acetylation and transcription. Ngs1 is targeted to the promoters of GlcNAc-inducible genes constitutively by the transcription factor Rep1. Ngs1 is conserved in diverse fungi that have GlcNAc catabolic genes. Thus, fungi use Ngs1 as a GlcNAc-sensor and transducer for GlcNAc-induced transcription.
Su, Chang; Lu, Yang; Liu, Haoping
2016-01-01
N-acetylglucosamine (GlcNAc) exists ubiquitously as a component of the surface on a wide range of cells, from bacteria to humans. Many fungi are able to utilize environmental GlcNAc to support growth and induce cellular development, a property important for their survival in various host niches. However, how the GlcNAc signal is sensed and subsequently transduced is largely unknown. Here, we identify a gene that is essential for GlcNAc signalling (NGS1) in Candida albicans, a commensal and pathogenic yeast of humans. Ngs1 can bind GlcNAc through the N-terminal β-N-acetylglucosaminidase homology domain. This binding activates N-acetyltransferase activity in the C-terminal GCN5-related N-acetyltransferase domain, which is required for GlcNAc-induced promoter histone acetylation and transcription. Ngs1 is targeted to the promoters of GlcNAc-inducible genes constitutively by the transcription factor Rep1. Ngs1 is conserved in diverse fungi that have GlcNAc catabolic genes. Thus, fungi use Ngs1 as a GlcNAc-sensor and transducer for GlcNAc-induced transcription. PMID:27694804
Prokop, Susanne; Perry, Nicole A; Vishnivetskiy, Sergey A; Toth, Andras D; Inoue, Asuka; Milligan, Graeme; Iverson, Tina M; Hunyady, Laszlo; Gurevich, Vsevolod V
2017-08-01
Non-visual arrestins interact with hundreds of different G protein-coupled receptors (GPCRs). Here we show that by introducing mutations into elements that directly bind receptors, the specificity of arrestin-3 can be altered. Several mutations in the two parts of the central "crest" of the arrestin molecule, middle-loop and C-loop, enhanced or reduced arrestin-3 interactions with several GPCRs in receptor subtype and functional state-specific manner. For example, the Lys139Ile substitution in the middle-loop dramatically enhanced the binding to inactive M 2 muscarinic receptor, so that agonist activation of the M 2 did not further increase arrestin-3 binding. Thus, the Lys139Ile mutation made arrestin-3 essentially an activation-independent binding partner of M 2 , whereas its interactions with other receptors, including the β 2 -adrenergic receptor and the D 1 and D 2 dopamine receptors, retained normal activation dependence. In contrast, the Ala248Val mutation enhanced agonist-induced arrestin-3 binding to the β 2 -adrenergic and D 2 dopamine receptors, while reducing its interaction with the D 1 dopamine receptor. These mutations represent the first example of altering arrestin specificity via enhancement of the arrestin-receptor interactions rather than selective reduction of the binding to certain subtypes. Copyright © 2017. Published by Elsevier Inc.
Ji, Weidong; Li, Yonghao; Wan, Ting; Wang, Jing; Zhang, Haifeng; Chen, Hong; Min, Wang
2012-09-01
The proinflammtory cytokine tumor necrosis factor (TNF), primarily via TNF receptor 1 (TNFR1), induces nuclear factor-κB (NF-κB)-dependent cell survival, and c-Jun N-terminal kinase (JNK) and caspase-dependent cell death, regulating vascular endothelial cell (EC) activation and apoptosis. However, signaling by the second receptor, TNFR2, is poorly understood. The goal of this study was to dissect how TNFR2 mediates NF-κB and JNK signaling in vascular EC, and its relevance to in vivo EC function. We show that TNFR2 contributes to TNF-induced NF-κB and JNK signaling in EC as TNFR2 deletion or knockdown reduces the TNF responses. To dissect the critical domains of TNFR2 that mediate the TNF responses, we examine the activity of TNFR2 mutant with a specific deletion of the TNFR2 intracellular region, which contains conserved domain I, domain II, domain III, and 2 TNFR-associated factor-2-binding sites. Deletion analyses indicate that different sequences on TNFR2 have distinct roles in NF-κB and JNK activation. Specifically, deletion of the TNFR-associated factor-2-binding sites (TNFR2-59) diminishes the TNFR2-mediated NF-κB, but not JNK activation; whereas, deletion of domain II or domain III blunts TNFR2-mediated JNK but not NF-κB activation. Interestingly, we find that the TNFR-associated factor-2-binding sites ensure TNFR2 on the plasma membrane, but the di-leucine LL motif within the domain II and aa338-355 within the domain III are required for TNFR2 internalization as well as TNFR2-dependent JNK signaling. Moreover, domain III of TNFR2 is responsible for association with ASK1-interacting protein-1, a signaling adaptor critical for TNF-induced JNK signaling. While TNFR2 containing the TNFR-associated factor-2-binding sites prevents EC cell death, a specific activation of JNK without NF-κB activation by TNFR2-59 strongly induces caspase activation and EC apoptosis. Our data reveal that both internalization and ASK1-interacting protein-1 association are required for TNFR2-dependent JNK and apoptotic signaling. Controlling TNFR2-mediated JNK and apoptotic signaling in EC may provide a novel strategy for the treatment of vascular diseases.
Zhao, Dezheng; Zhan, Yanai; Koon, Hon Wai; Zeng, Huiyan; Keates, Sarah; Moyer, Mary P; Pothoulakis, Charalabos
2004-10-15
Expression of the neuropeptide neurotensin (NT) and its high affinity receptor (NTR1) is increased during the course of Clostridium difficile toxin A-induced acute colitis, and NTR1 antagonism attenuates the severity of toxin A-induced inflammation. We recently demonstrated in non-transformed human colonic epithelial NCM460 cells that NT treatment caused activation of a Ras-mediated MAP kinase pathway that significantly contributes to NT-induced interleukin-8 (IL-8) secretion. Here we used NCM460 cells, which normally express low levels of NTR1, and NCM460 cells stably transfected with NTR1 to identify the upstream signaling molecules involved in NT-NTR1-mediated MAP kinase activation. We found that inhibition of the epidermal growth factor receptor (EGFR) by either an EGFR neutralizing antibody or by its specific inhibitor AG1478 (0.2 microm) blocked NT-induced MAP kinase activation. Moreover, NT stimulated tyrosine phosphorylation of the EGFR, and pretreatment with a broad spectrum metalloproteinase inhibitor batimastat reduced NT-induced MAP kinase activation. Using neutralizing antibodies against the EGFR ligands EGF, heparin-binding-EGF, transforming growth factor-alpha (TGFalpha), or amphiregulin we have shown that only the anti-TGFalpha antibody significantly decreases NT-induced phosphorylation of EGFR and MAP kinases. Furthermore, inhibition of the EGF receptor by AG1478 significantly reduced NT-induced IL-8 promoter activity and IL-8 secretion. This is the first report demonstrating that NT binding to NTR1 transactivates the EGFR and that this response is linked to NT-mediated proinflammatory signaling. Our findings indicate that matrix metalloproteinase-mediated release of TGFalpha and subsequent EGFR transactivation triggers a NT-mediated MAP kinase pathway that leads to IL-8 gene expression in human colonic epithelial cells.
Böhnlein, E; Siekevitz, M; Ballard, D W; Lowenthal, J W; Rimsky, L; Bogérd, H; Hoffman, J; Wano, Y; Franza, B R; Greene, W C
1989-04-01
The human immunodeficiency virus type 1 (HIV-1) preferentially infects CD4+ T lymphocytes and may exist as a latent provirus within these cells for extended periods. The transition to a productive retroviral infection results in T-cell death and clinically may lead to the acquired immune deficiency syndrome. Accelerated production of infectious HIV-1 virions appears to be closely linked to a heightened state of T-cell activation. The transactivator (Tax) protein of the type I human T-cell leukemia virus (HTLV-I) can produce such an activated T-cell phenotype and augments activity of the HIV-1 long terminal repeat. One Tax-responsive region within the HIV-1 long terminal repeat has been mapped to a locus composed of two 10-base-pair direct repeats sharing homology with the binding site for the eucaryotic transcription factor NF-kappaB (GGGACTTTCC). Tax-expressing Jurkat T cells contain one or more inducible cellular proteins that specifically associate with the HIV-1 enhancer at these binding sites. Microscale DNA affinity precipitation assays identified a Tax-inducible 86-kilodalton protein, HIVEN86A, as one of these HIV-1 enhancer-binding factors. The interaction of HIVEN86A, and presumably other cellular proteins, with the HIV-1 enhancer appears functionally important as oligonucleotides corresponding to this enhancer were sufficient to impart Tax inducibility to an unresponsive heterologous promoter. These findings suggest that the Tax-inducible cellular protein HIVEN86A plays an important role in the transcriptional activation of the HIV-1 enhancer. These specific protein-DNA interactions may also be important for the transition of HIV-1 from a latent to a productive mode of infection. Furthermore, these findings highlight an intriguing biological interplay between HTLV-1 and HIV-1 through a cellular transcriptional pathway that is normally involved in T-cell activation and growth.
Oliveira, Amanda; Beyer, Georg; Chugh, Rohit; Skube, Steven J; Majumder, Kaustav; Banerjee, Sulagna; Sangwan, Veena; Li, Lihua; Dawra, Rajinder; Subramanian, Subbaya; Saluja, Ashok; Dudeja, Vikas
2015-06-01
Despite significant progress in diagnostics and therapeutics, over 50 thousand patients die from colorectal cancer annually. Hence, there is urgent need for new lines of treatment. Triptolide, a natural compound isolated from the Chinese herb Tripterygium wilfordii, is effective against multiple cancers. We have synthesized a water soluble analog of triptolide, named Minnelide, which is currently in phase I trial against pancreatic cancer. The aims of the current study were to evaluate whether triptolide/Minnelide is effective against colorectal cancer and to elucidate the mechanism by which triptolide induces cell death in colorectal cancer. Efficacy of Minnelide was evaluated in subcutaneous xenograft and liver metastasis model of colorectal cancer. For mechanistic studies, colon cancer cell lines HCT116 and HT29 were treated with triptolide and the effect on viability, caspase activation, annexin positivity, lactate dehydrogenase release, and cell cycle progression was evaluated. Effect of triptolide on E2F transcriptional activity, mRNA levels of E2F-dependent genes, E2F1- retinoblastoma protein (Rb) binding, and proteins levels of regulator of G1-S transition was also measured. DNA binding of E2F1 was evaluated by chromatin immunoprecipitation assay. Triptolide decreased colon cancer cell viability in a dose- and time-dependent fashion. Minnelide markedly inhibited the growth of colon cancer in the xenograft and liver metastasis model of colon cancer and more than doubles the median survival of animals with liver metastases from colon cancer. Mechanistically, we demonstrate that at low concentrations triptolide induces apoptotic cell death but at higher concentrations it induces cell cycle arrest. Our data suggest that triptolide is able to induce G1 cell cycle arrest by inhibiting transcriptional activation of E2F1. Our data also show that triptolide downregulates E2F activity by potentially modulating events downstream of DNA binding. Therefore, we conclude that Triptolide and Minnelide are effective against colon cancer in multiple pre-clinical models.
Protein Translation and Signaling in Human Eosinophils
Esnault, Stephane; Shen, Zhong-Jian; Malter, James S.
2017-01-01
We have recently reported that, unlike IL-5 and GM-CSF, IL-3 induces increased translation of a subset of mRNAs. In addition, we have demonstrated that Pin1 controls the activity of mRNA binding proteins, leading to enhanced mRNA stability, GM-CSF protein production and prolonged eosinophil (EOS) survival. In this review, discussion will include an overview of cap-dependent protein translation and its regulation by intracellular signaling pathways. We will address the more general process of mRNA post-transcriptional regulation, especially regarding mRNA binding proteins, which are critical effectors of protein translation. Furthermore, we will focus on (1) the roles of IL-3-driven sustained signaling on enhanced protein translation in EOS, (2) the mechanisms regulating mRNA binding proteins activity in EOS, and (3) the potential targeting of IL-3 signaling and the signaling leading to mRNA binding activity changes to identify therapeutic targets to treat EOS-associated diseases. PMID:28971096
Integrity of N- and C-termini is important for E. coli Hsp31 chaperone activity
Sastry, M S R; Zhou, Weibin; Baneyx, François
2009-01-01
Hsp31 is a stress-inducible molecular chaperone involved in the management of protein misfolding at high temperatures and in the development of acid resistance in starved E. coli. Each subunit of the Hsp31 homodimer consists of two structural domains connected by a flexible linker that sits atop a continuous tract of nonpolar residues adjacent to a hydrophobic bowl defined by the dimerization interface. Previously, we proposed that while the bowl serves as a binding site for partially folded species at physiological temperatures, chaperone function under heat shock conditions requires that folding intermediates further anneal to high-affinity binding sites that become uncovered upon thermally induced motion of the linker. In support of a mechanism requiring that client proteins first bind to the bowl, we show here that fusion of a 20-residue-long hexahistidine tag to the N-termini of Hsp31 abolishes chaperone activity at all temperatures by inducing reversible structural changes that interfere with substrate binding. We further demonstrate that extending the C-termini of Hsp31 with short His tags selectively suppresses chaperone function at high temperatures by interfering with linker movement. The structural and functional sensitivity of Hsp31 to lengthening is consistent with the high degree of conservation of class I Hsp31 orthologs and will serve as a cautionary tale on the implications of affinity tagging. PMID:19517531
Characterization of the mouse junD promoter--high basal level activity due to an octamer motif.
de Groot, R P; Karperien, M; Pals, C; Kruijer, W
1991-01-01
The product of the junD gene belongs to the Jun/Fos family of nuclear DNA binding transcription factors. This family regulates the expression of TPA responsive genes by binding to the TPA responsive element (TRE). Unlike its counterparts c-jun and junB, junD expression is hardly inducible by growth factors and phorbol esters. In fact, junD is constitutively expressed at high levels in a wide variety of cells. To unravel the molecular mechanisms underlying constitutive junD expression, we have cloned and characterized the mouse junD promoter. We show that the high constitutive expression is caused by multiple cis-acting elements in its promoter, including an SP1 binding site, an octamer motif, a CAAT box, a Zif268 binding site and a TRE-like sequence. The octamer motif is the major determinant of junD promoter activity, while somewhat smaller contributions are made by the TRE and Zif268 binding site. The SP1 and CAAT box are shown to be of minor importance. The junD TRE is in its behavior indistinguishable from previously identified TREs. However, the junD promoter is not TPA inducible due to the presence of the octamer motif. Images PMID:1714380
Structure and Dynamic Properties of a Glucocorticoid Receptor-Induced Chromatin Transition
Fletcher, Terace M.; Ryu, Byung-Woo; Baumann, Christopher T.; Warren, Barbour S.; Fragoso, Gilberto; John, Sam; Hager, Gordon L.
2000-01-01
Activation of the mouse mammary tumor virus (MMTV) promoter by the glucocorticoid receptor (GR) is associated with a chromatin structural transition in the B nucleosome region of the viral long terminal repeat (LTR). Recent evidence indicates that this transition extends upstream of the B nucleosome, encompassing a region larger than a single nucleosome (G. Fragoso, W. D. Pennie, S. John, and G. L. Hager, Mol. Cell. Biol. 18:3633–3644). We have reconstituted MMTV LTR DNA into a polynucleosome array using Drosophila embryo extracts. We show binding of purified GR to specific GR elements within a large, multinucleosome array and describe a GR-induced nucleoprotein transition that is dependent on ATP and a HeLa nuclear extract. Previously uncharacterized GR binding sites in the upstream C nucleosome region are involved in the extended region of chromatin remodeling. We also show that GR-dependent chromatin remodeling is a multistep process; in the absence of ATP, GR binds to multiple sites on the chromatin array and prevents restriction enzyme access to recognition sites. Upon addition of ATP, GR induces remodeling and a large increase in access to enzymes sites within the transition region. These findings suggest a dynamic model in which GR first binds to chromatin after ligand activation, recruits a remodeling activity, and is then lost from the template. This model is consistent with the recent description of a “hit-and-run” mechanism for GR action in living cells (J. G. McNally, W. G. Müller, D. Walker, and G. L. Hager, Science 287:1262–1264, 2000). PMID:10938123
Macdonald-Obermann, Jennifer L.; Pike, Linda J.
2014-01-01
The EGF receptor has seven different cognate ligands. Previous work has shown that these different ligands are capable of inducing different biological effects, even in the same cell. To begin to understand the molecular basis for this variation, we used luciferase fragment complementation to measure ligand-induced dimer formation and radioligand binding to study the effect of the ligands on subunit-subunit interactions in EGF receptor (EGFR) homodimers and EGFR/ErbB2 heterodimers. In luciferase fragment complementation imaging studies, amphiregulin (AREG) functioned as a partial agonist, inducing only about half as much total dimerization as the other three ligands. However, unlike the other ligands, AREG showed biphasic kinetics for dimer formation, suggesting that its path for EGF receptor activation involves binding to both monomers and preformed dimers. EGF, TGFα, and betacellulin (BTC) appear to mainly stimulate receptor activation through binding to and dimerization of receptor monomers. In radioligand binding assays, EGF and TGFα exhibited increased affinity for EGFR/ErbB2 heterodimers compared with EGFR homodimers. By contrast, BTC and AREG showed a similar affinity for both dimers. Thus, EGF and TGFα are biased agonists, whereas BTC and AREG are balanced agonists with respect to selectivity of dimer formation. These data suggest that the differences in biological response to different EGF receptor ligands may result from partial agonism for dimer formation, differences in the kinetic pathway utilized to generate activated receptor dimers, and biases in the formation of heterodimers versus homodimers. PMID:25086039
Son, Dong Ju; Zheng, Jie; Jung, Yu Yeon; Hwang, Chul Ju; Lee, Hee Pom; Woo, Ju Rang; Baek, Song Yi; Ham, Young Wan; Kang, Min Woong; Shong, Minho; Kweon, Gi Ryang; Song, Min Jong; Jung, Jae Kyung; Han, Sang-Bae; Kim, Bo Yeon; Yoon, Do Young; Choi, Bu Young; Hong, Jin Tae
2017-01-01
Rationale: Signal transducer and activator of transcription-3 (STAT3) plays a pivotal role in cancer biology. Many small-molecule inhibitors that target STAT3 have been developed as potential anticancer drugs. While designing small-molecule inhibitors that target the SH2 domain of STAT3 remains the leading focus for drug discovery, there has been a growing interest in targeting the DNA-binding domain (DBD) of the protein. Methods: We demonstrated the potential antitumor activity of a novel, small-molecule (E)-2-methoxy-4-(3-(4-methoxyphenyl)prop-1-en-1-yl)phenol (MMPP) that directly binds to the DBD of STAT3, in patient-derived non-small cell lung cancer (NSCLC) xenograft model as well as in NCI-H460 cell xenograft model in nude mice. Results: MMPP effectively inhibited the phosphorylation of STAT3 and its DNA binding activity in vitro and in vivo . It induced G1-phase cell cycle arrest and apoptosis through the regulation of cell cycle- and apoptosis-regulating genes by directly binding to the hydroxyl residue of threonine 456 in the DBD of STAT3. Furthermore, MMPP showed a similar or better antitumor activity than that of docetaxel or cisplatin. Conclusion: MMPP is suggested to be a potential candidate for further development as an anticancer drug that targets the DBD of STAT3.
Riboswitches: emerging themes in RNA structure and function.
Montange, Rebecca K; Batey, Robert T
2008-01-01
Riboswitches are RNAs capable of binding cellular metabolites using a diverse array of secondary and tertiary structures to modulate gene expression. The recent determination of the three-dimensional structures of parts of six different riboswitches illuminates common features that allow riboswitches to be grouped into one of two types. Type I riboswitches, as exemplified by the purine riboswitch, are characterized by a single, localized binding pocket supported by a largely pre-established global fold. This arrangement limits ligand-induced conformational changes in the RNA to a small region. In contrast, Type II riboswitches, such as the thiamine pyrophosphate riboswitch, contain binding pockets split into at least two spatially distinct sites. As a result, binding induces both local changes to the binding pocket and global architecture. Similar organizational themes are found in other noncoding RNAs, making it possible to begin to build a hierarchical classification of RNA structure based on the spatial organization of their active sites and associated secondary structural elements.
Li, Jinbing; Wang, Xiaoyong
2015-02-01
Novel thermally-induced BSA/ι-carrageenan particles are used as a protective carrier for (-)-epigallocatechin-3-gallate (EGCG). The addition of EGCG to BSA/ι-carrageenan particles can highly quench the intrinsic fluorescence of BSA, which is explained in terms of the binding of EGCG to the hydrophobic pockets of BSA mainly through the hydrophobic force. According to the double logarithm equation, the binding constant is determined as 1.1×10(8)M(-1) for the binding of EGCG with BSA/ι-carrageenan particles. The high binding affinity is ascribed to both the molecular structure of EGCG and the partial unfolding state of BSA in BSA/ι-carrageenan particles. The circular dichroism spectra and calculated α-helix of BSA suggest that the bound EGCG leads to a more random secondary structure of BSA. Furthermore, BSA/ι-carrageenan particles are found to be superior to native BSA and pure BSA particles for improving the stability and radical scavenging activity of EGCG. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kundu, Joydeb Kumar; Liu, Lijia; Shin, Jun-Wan
2013-09-06
Highlights: •Thymoquinone inhibits phorbol ester-induced COX-2 expression in mouse skin. •Thymoquinone attenuates phosphorylation of IκBα and DNA binding of NF-κB in mouse skin. •Thymoquinone inhibits phosphorylation of p38 MAP kinase, JNK and Akt in mouse skin. •Thymoquinone induces the expression of cytoprotective proteins in mouse skin. -- Abstract: Thymoquinone (TQ), the active ingredient of Nigella sativa, has been reported to possess anti-inflammatory and chemopreventive properties. The present study was aimed at elucidating the molecular mechanisms of anti-inflammatory and antioxidative activities of thymoquinone in mouse skin. Pretreatment of female HR-1 hairless mouse skin with TQ attenuated 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced expression of cyclooxygenase-2more » (COX-2). TQ diminished nuclear translocation and the DNA binding of nuclear factor-kappaB (NF-κB) via the blockade of phosphorylation and subsequent degradation of IκBα in TPA-treated mouse skin. Pretreatment with TQ attenuated the phosphorylation of Akt, c-Jun-N-terminal kinase and p38 mitogen-activated protein kinase, but not that of extracellular signal-regulated kinase-1/2. Moreover, topical application of TQ induced the expression of heme oxygenase-1, NAD(P)H-quinoneoxidoreductase-1, glutathione-S-transferase and glutamate cysteine ligase in mouse skin. Taken together, the inhibitory effects of TQ on TPA-induced COX-2 expression and NF-κB activation, and its ability to induce the expression of cytoprotective proteins provide a mechanistic basis of anti-inflammatory and antioxidative effects of TQ in hairless mouse skin.« less
Xie, Guofeng; Cheng, Kunrong; Shant, Jasleen; Raufman, Jean-Pierre
2009-04-01
Previously, we showed that ACh-induced proliferation of human colon cancer cells is mediated by transactivation of epidermal growth factor (EGF) receptors (EGFRs). In the present study, we elucidate the molecular mechanism underlying this action. ACh-induced proliferation of H508 colon cancer cells, which express exclusively M3 muscarinic receptors (M3Rs), was attenuated by anti-EGFR ligand binding domain antibody, a broad-spectrum matrix metalloproteinase (MMP) inhibitor, anti-MMP7 antibody, a diphtheria toxin analog that blocks release of an EGFR ligand [heparin-binding EGF-like growth factor (HBEGF)], and anti-HBEGF antibody. Conditioned media from ACh-treated H508 cells induced proliferation of SNU-C4 colon cancer cells that express EGFR but not M3R. These actions were attenuated by an EGFR inhibitor and by anti-EGFR and anti-HBEGF antibodies. In H508, but not SNU-C4, colon cancer cells, ACh caused a striking dose- and time-dependent increase in levels of MMP7 mRNA and MMP7 protein. Similarly, ACh induced robust MMP1 and MMP10 gene transcription. ACh-induced MMP1, MMP7, and MMP10 gene transcription was attenuated by atropine, anti-EGFR antibody, and chemical inhibitors of EGFR and ERK activation. In contrast, inhibitors of phosphatidylinositol 3-kinase and NF-kappaB activation did not alter MMP gene transcription. Collectively, these findings indicate that MMP7-catalyzed release of HBEGF mediates ACh-induced transactivation of EGFR and consequent proliferation of colon cancer cells. ACh-induced activation of EGFR and downstream ERK signaling also regulates transcriptional activation of MMP7, thereby identifying a novel feed-forward mechanism for neoplastic cell proliferation.
Xie, Guofeng; Cheng, Kunrong; Shant, Jasleen; Raufman, Jean-Pierre
2009-01-01
Previously, we showed that ACh-induced proliferation of human colon cancer cells is mediated by transactivation of epidermal growth factor (EGF) receptors (EGFRs). In the present study, we elucidate the molecular mechanism underlying this action. ACh-induced proliferation of H508 colon cancer cells, which express exclusively M3 muscarinic receptors (M3Rs), was attenuated by anti-EGFR ligand binding domain antibody, a broad-spectrum matrix metalloproteinase (MMP) inhibitor, anti-MMP7 antibody, a diphtheria toxin analog that blocks release of an EGFR ligand [heparin-binding EGF-like growth factor (HBEGF)], and anti-HBEGF antibody. Conditioned media from ACh-treated H508 cells induced proliferation of SNU-C4 colon cancer cells that express EGFR but not M3R. These actions were attenuated by an EGFR inhibitor and by anti-EGFR and anti-HBEGF antibodies. In H508, but not SNU-C4, colon cancer cells, ACh caused a striking dose- and time-dependent increase in levels of MMP7 mRNA and MMP7 protein. Similarly, ACh induced robust MMP1 and MMP10 gene transcription. ACh-induced MMP1, MMP7, and MMP10 gene transcription was attenuated by atropine, anti-EGFR antibody, and chemical inhibitors of EGFR and ERK activation. In contrast, inhibitors of phosphatidylinositol 3-kinase and NF-κB activation did not alter MMP gene transcription. Collectively, these findings indicate that MMP7-catalyzed release of HBEGF mediates ACh-induced transactivation of EGFR and consequent proliferation of colon cancer cells. ACh-induced activation of EGFR and downstream ERK signaling also regulates transcriptional activation of MMP7, thereby identifying a novel feed-forward mechanism for neoplastic cell proliferation. PMID:19221016
Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz
2015-01-01
The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467
Glyburide inhibits the Cryopyrin/Nalp3 inflammasome
Lamkanfi, Mohamed; Mueller, James L.; Vitari, Alberto C.; Misaghi, Shahram; Fedorova, Anna; Deshayes, Kurt; Lee, Wyne P.; Hoffman, Hal M.
2009-01-01
Inflammasomes activate caspase-1 for processing and secretion of the cytokines interleukin-1β (IL-1β) and IL-18. Cryopyrin/NALP3/NLRP3 is an essential component of inflammasomes triggered by microbial ligands, danger-associated molecular patterns (DAMPs), and crystals. Inappropriate Cryopyrin activity has been incriminated in the pathogenesis of gouty arthritis, Alzheimer's, and silicosis. Therefore, inhibitors of the Nalp3 inflammasome offer considerable therapeutic promise. In this study, we show that the type 2 diabetes drug glyburide prevented activation of the Cryopyrin inflammasome. Glyburide's cyclohexylurea group, which binds to adenosine triphosphatase (ATP)–sensitive K+ (KATP) channels for insulin secretion, is dispensable for inflammasome inhibition. Macrophages lacking KATP subunits or ATP-binding cassette transporters also activate the Cryopyrin inflammasome normally. Glyburide analogues inhibit ATP- but not hypothermia-induced IL-1β secretion from human monocytes expressing familial cold-associated autoinflammatory syndrome–associated Cryopyrin mutations, thus suggesting that inhibition occurs upstream of Cryopyrin. Concurrent with the role of Cryopyrin in endotoxemia, glyburide significantly delays lipopolysaccharide-induced lethality in mice. Therefore, glyburide is the first identified compound to prevent Cryopyrin activation and microbial ligand-, DAMP-, and crystal-induced IL-1β secretion. PMID:19805629
Glyburide inhibits the Cryopyrin/Nalp3 inflammasome.
Lamkanfi, Mohamed; Mueller, James L; Vitari, Alberto C; Misaghi, Shahram; Fedorova, Anna; Deshayes, Kurt; Lee, Wyne P; Hoffman, Hal M; Dixit, Vishva M
2009-10-05
Inflammasomes activate caspase-1 for processing and secretion of the cytokines interleukin-1beta (IL-1beta) and IL-18. Cryopyrin/NALP3/NLRP3 is an essential component of inflammasomes triggered by microbial ligands, danger-associated molecular patterns (DAMPs), and crystals. Inappropriate Cryopyrin activity has been incriminated in the pathogenesis of gouty arthritis, Alzheimer's, and silicosis. Therefore, inhibitors of the Nalp3 inflammasome offer considerable therapeutic promise. In this study, we show that the type 2 diabetes drug glyburide prevented activation of the Cryopyrin inflammasome. Glyburide's cyclohexylurea group, which binds to adenosine triphosphatase (ATP)-sensitive K(+) (K(ATP)) channels for insulin secretion, is dispensable for inflammasome inhibition. Macrophages lacking K(ATP) subunits or ATP-binding cassette transporters also activate the Cryopyrin inflammasome normally. Glyburide analogues inhibit ATP- but not hypothermia-induced IL-1beta secretion from human monocytes expressing familial cold-associated autoinflammatory syndrome-associated Cryopyrin mutations, thus suggesting that inhibition occurs upstream of Cryopyrin. Concurrent with the role of Cryopyrin in endotoxemia, glyburide significantly delays lipopolysaccharide-induced lethality in mice. Therefore, glyburide is the first identified compound to prevent Cryopyrin activation and microbial ligand-, DAMP-, and crystal-induced IL-1beta secretion.
Into the linker's DENN: A tyrosine's control of autophagy.
Caplan, Steve
2017-04-28
The small GTP-binding protein Rab12 plays an important role in the initiation of starvation-induced macroautophagy (autophagy) and is activated by the guanine-nucleotide exchange factor DENND3. However, the molecular mechanism by which DENND3 becomes activated has remained elusive. Xu and McPherson now identify a novel mechanism of DENND3 intramolecular binding that is regulated by the phosphorylation of a single tyrosine residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Alvarado, M.; Budinger, T.F.
2001-12-10
Following induction of acute neuroinflammation by intracisternal injection of endotoxin (lipopolysaccharide) in rats, quantitative autoradiography was used to assess the regional level of microglial activation and glutamate (NMDA) receptor binding. The possible protective action of the antioxidant phenyl-tert-butyl nitrone in this model was tested by administering the drug in the drinking water for 6 days starting 24 hours after endotoxin injection. Animals were killed 7 days post-injection and consecutive cryostat brain sections labeled with [3H]PK11195 as a marker of activated microglia and [125I]iodoMK801 as a marker of the open-channel, activated state of NMDA receptors. Lipopolysaccharide increased [3H]PK11195 binding in themore » brain, with the largest increases (2-3 fold) in temporal and entorhinal cortex, hippocampus, and substantia innominata. A significant (>50 percent) decrease in [125I]iodoMK801 binding was found in the same brain regions. Phenyl-tert-butyl nitrone treatment resulted in a partial inhibition ({approx}25 percent decrease) of the lipopolysaccharide-induced increase in [3H]PK11195 binding but completely reversed the lipopolysaccharide-induced decrease in [125I]iodoMK80 binding in the entorhinal cortex, hippocampus, and substantia innominata. Loss of NMDA receptor function in cortical and hippocampal regions may contribute to the cognitive deficits observed in diseases with a neuroinflammatory component, such as meningitis or Alzheimer's disease.« less
Feldman, D; Couropmitree, C
1976-01-01
Because some nonsteroidal anti-inflammatory drugs (NSAID) induce salt and water retention and exhibit other steroid-like actions, studies were performed to ascertain whether these drugs possess intrinsic mineralocorticoid agonist activity. In vitro competitive binding assays utilizing tissue from adrenalectomized rats demonstrated that some NSAID can displace [3H]-aldosterone from renal cytoplasmic mineralocorticoid receptors. Displacement potency for these sites was in the sequence: aldosterone greater than spironolactone greater than phenylbutazone (PBZ) greater than aspirin (ASA) greater than indomethacin (IDM). Concentration ratios required to obtain significant displacement of [3H]aldosterone were high but clearly within the therapeutic range for PBZ and ASA but not IDM. The analogues oxyphenbutazone (OBZ) and sodium salicylate (SS) were similar in binding activity to PBZ and ASA, respectively. Lineweaver-Burk analysis revealed that the inhibition of [3H]aldosterone binding was competitive in nature. In addition, PBZ was shown to prevent the nuclear binding of [3H]aldosterone. In vivo injection of PBZ and ASA resulted in competition for [3H]aldosterone renal binding comparable to the in vitro studies. Administration of PBZ and OBZ to adrenalectomized rats resulted in significant salt retention whereas ASA and SS did not differ significantly from controls. Salt retention elicited by PBZ and OBZ was inhibited by spironolactone, a competitive mineralocorticoid antagonist. These data suggest that, despite nonsteroidal structures, PBZ and OBZ induce salt retention via a receptor-mediated mineralocorticoid pathway analogous to aldosterone action. PMID:173739
Misono, Kunio S; Ogawa, Haruo; Qiu, Yue; Ogata, Craig M
2005-06-01
The atrial natriuretic peptide (ANP) receptor is a single-span transmembrane receptor that is coupled to its intrinsic intracellular guanylate cyclase (GCase) catalytic activity. To investigate the mechanisms of hormone binding and signal transduction, we have expressed the extracellular hormone-binding domain of the ANP receptor (ANPR) and characterized its structure and function. The disulfide-bond structure, state of glycosylation, binding-site residues, chloride-dependence of ANP binding, dimerization, and binding stoichiometry have been determined. More recently, the crystal structures of both the apoANPR dimer and ANP-bound complex have been determined. The structural comparison between the two has shown that, upon ANP binding, two ANPR molecules in the dimer undergo an inter-molecular twist with little intra-molecular conformational change. This motion produces a Ferris wheel-like translocation of two juxtamembrane domains with essentially no change in the inter-domain distance. This movement alters the relative orientation of the two domains equivalent to counter-clockwise rotation of each by 24 degrees . These results suggest that transmembrane signaling by the ANP receptor is mediated by a novel hormone-induced rotation mechanism.
NASA Astrophysics Data System (ADS)
Borgwardt, Derek S.; Martin, Aaron D.; van Hemert, Jonathan R.; Yang, Jianyi; Fischer, Carol L.; Recker, Erica N.; Nair, Prashant R.; Vidva, Robinson; Chandrashekaraiah, Shwetha; Progulske-Fox, Ann; Drake, David; Cavanaugh, Joseph E.; Vali, Shireen; Zhang, Yang; Brogden, Kim A.
2014-01-01
Histatins are human salivary gland peptides with anti-microbial and anti-inflammatory activities. In this study, we hypothesized that histatin 5 binds to Porphyromonas gingivalis hemagglutinin B (HagB) and attenuates HagB-induced chemokine responses in human myeloid dendritic cells. Histatin 5 bound to immobilized HagB in a surface plasmon resonance (SPR) spectroscopy-based biosensor system. SPR spectroscopy kinetic and equilibrium analyses, protein microarray studies, and I-TASSER structural modeling studies all demonstrated two histatin 5 binding sites on HagB. One site had a stronger affinity with a KD1 of 1.9 μM and one site had a weaker affinity with a KD2 of 60.0 μM. Binding has biological implications and predictive modeling studies and exposure of dendritic cells both demonstrated that 20.0 μM histatin 5 attenuated (p < 0.05) 0.02 μM HagB-induced CCL3/MIP-1α, CCL4/MIP-1β, and TNFα responses. Thus histatin 5 is capable of attenuating chemokine responses, which may help control oral inflammation.
Petrova, Yuliya I.; Spano, MarthaJoy M.; Gumbiner, Barry M.
2012-01-01
We investigated changes in cadherin structure at the cell surface that regulate its adhesive activity. Colo 205 cells are nonadhesive cells with a full but inactive complement of E-cadherin–catenin complexes at the cell surface, but they can be triggered to adhere and form monolayers. We were able to distinguish the inactive and active states of E-cadherin at the cell surface by using a special set of monoclonal antibodies (mAbs). Another set of mAbs binds E-cadherin and strongly activates adhesion. In other epithelial cell types these activating mAbs inhibit growth factor–induced down-regulation of adhesion and epithelial morphogenesis, indicating that these phenomena are also controlled by E-cadherin activity at the cell surface. Both types of mAbs recognize conformational epitopes at different interfaces between extracellular cadherin repeat domains (ECs), especially near calcium-binding sites. Activation also induces p120-catenin dephosphorylation, as well as changes in the cadherin cytoplasmic domain. Moreover, phospho-site mutations indicate that dephosphorylation of specific Ser/Thr residues in the N-terminal domain of p120-catenin mediate adhesion activation. Thus physiological regulation of the adhesive state of E-cadherin involves physical and/or conformational changes in the EC interface regions of the ectodomain at the cell surface that are mediated by catenin-associated changes across the membrane. PMID:22513089
Filosto, Simone; Becker, Cathleen R.; Goldkorn, Tzipora
2015-01-01
The EGF Receptor (EGFR) and its downstream signaling are implicated in lung cancer development. Therefore, much effort was spent in developing specific tyrosine kinase inhibitors (TKIs) that bind to the EGFR ATP-pocket, blocking EGFR phosphorylation/signaling. Clinical use of TKIs is effective in a subset of lung cancers with mutations in the EGFR kinase domain, rendering the receptor highly susceptible to TKIs. However, these benefits are limited, and emergence of additional EGFR mutations usually results in TKI resistance and disease progression. Previously, we demonstrated one mechanism linking cigarette smoke (CS) to EGFR-driven lung cancer. Specifically, exposure of lung epithelial cells to CS-induced oxidative stress stimulates aberrant EGFR phosphorylation/activation with impaired receptor ubiquitination/degradation. The abnormal stabilization of the activated receptor leads to uncontrolled cell growth and tumorigenesis. Here we describe for the first time a novel post-translational mechanism of EGFR resistance to TKIs. Exposure of airway epithelial cells to CS causes aberrant phosphorylation/activation of EGFR, resulting in a conformation that is different from that induced by the ligand EGF. Unlike EGF-activated EGFR, CS-activated EGFR binds c-Src and caveolin-1 and does not undergo canonical dimerization. Importantly, the CS-activated EGFR is not inhibited by TKIs (AG1478; Erlotinib; Gefitinib); in fact, the CS exposure induces TKI-resistance even in the TKI-sensitive EGFR mutants. Our findings demonstrate that CS exposure stimulates not only aberrant EGFR phosphorylation impairing receptor degradation, but also induces a different EGFR conformation and signaling that are resistant to TKIs. Together, these findings offer new insights into CS-induced lung cancer development and TKI resistance. PMID:22302097
A defect in inducible beta-galactosidase of B lymphocytes in the osteopetrotic (mi/mi) mouse.
Yamamoto, N; Naraparaju, V R
1996-01-01
Macrophages were activated by administration of an inflammatory lipid metabolite, lysophosphatidylcholine (lyso-Pc), to wild type mice but not murine (microphthalmic) osteopetrotic (mi/mi) mutant mice. In vitro treatment of wild type mouse peritoneal cells with lyso-Pc efficiently activated macrophages whereas lyso-Pc-treatment of mi mutant mouse peritoneal cells resulted in no activation of macrophages. Generation of macrophage activating factor requires a precursor protein, serum vitamin D binding protein (DBP), and participation of lyso-Pc-inducible beta-galactosidase of B lymphocytes. Lyso-Pc-inducible beta-galactosidase of B lymphocytes was found to be defective in mi mutant mice. PMID:8881764
Energetics of Endotoxin Recognition in the Toll-Like Receptor 4 Innate Immune Response.
Paramo, Teresa; Tomasio, Susana M; Irvine, Kate L; Bryant, Clare E; Bond, Peter J
2015-12-09
Bacterial outer membrane lipopolysaccharide (LPS) potently stimulates the mammalian innate immune system, and can lead to sepsis, the primary cause of death from infections. LPS is sensed by Toll-like receptor 4 (TLR4) in complex with its lipid-binding coreceptor MD-2, but subtle structural variations in LPS can profoundly modulate the response. To better understand the mechanism of LPS-induced stimulation and bacterial evasion, we have calculated the binding affinity to MD-2 of agonistic and antagonistic LPS variants including lipid A, lipid IVa, and synthetic antagonist Eritoran, and provide evidence that the coreceptor is a molecular switch that undergoes ligand-induced conformational changes to appropriately activate or inhibit the receptor complex. The plasticity of the coreceptor binding cavity is shown to be essential for distinguishing between ligands, whilst similar calculations for a model bacterial LPS bilayer reveal the "membrane-like" nature of the protein cavity. The ability to predict the activity of LPS variants should facilitate the rational design of TLR4 therapeutics.
Energetics of Endotoxin Recognition in the Toll-Like Receptor 4 Innate Immune Response
Paramo, Teresa; Tomasio, Susana M.; Irvine, Kate L.; Bryant, Clare E.; Bond, Peter J.
2015-01-01
Bacterial outer membrane lipopolysaccharide (LPS) potently stimulates the mammalian innate immune system, and can lead to sepsis, the primary cause of death from infections. LPS is sensed by Toll-like receptor 4 (TLR4) in complex with its lipid-binding coreceptor MD-2, but subtle structural variations in LPS can profoundly modulate the response. To better understand the mechanism of LPS-induced stimulation and bacterial evasion, we have calculated the binding affinity to MD-2 of agonistic and antagonistic LPS variants including lipid A, lipid IVa, and synthetic antagonist Eritoran, and provide evidence that the coreceptor is a molecular switch that undergoes ligand-induced conformational changes to appropriately activate or inhibit the receptor complex. The plasticity of the coreceptor binding cavity is shown to be essential for distinguishing between ligands, whilst similar calculations for a model bacterial LPS bilayer reveal the “membrane-like” nature of the protein cavity. The ability to predict the activity of LPS variants should facilitate the rational design of TLR4 therapeutics. PMID:26647780
A 31-residue peptide induces aggregation of tau's microtubule-binding region in cells
NASA Astrophysics Data System (ADS)
Stöhr, Jan; Wu, Haifan; Nick, Mimi; Wu, Yibing; Bhate, Manasi; Condello, Carlo; Johnson, Noah; Rodgers, Jeffrey; Lemmin, Thomas; Acharya, Srabasti; Becker, Julia; Robinson, Kathleen; Kelly, Mark J. S.; Gai, Feng; Stubbs, Gerald; Prusiner, Stanley B.; Degrado, William F.
2017-09-01
The self-propagation of misfolded conformations of tau underlies neurodegenerative diseases, including Alzheimer's. There is considerable interest in discovering the minimal sequence and active conformational nucleus that defines this self-propagating event. The microtubule-binding region, spanning residues 244-372, reproduces much of the aggregation behaviour of tau in cells and animal models. Further dissection of the amyloid-forming region to a hexapeptide from the third microtubule-binding repeat resulted in a peptide that rapidly forms fibrils in vitro. We show that this peptide lacks the ability to seed aggregation of tau244-372 in cells. However, as the hexapeptide is gradually extended to 31 residues, the peptides aggregate more slowly and gain potent activity to induce aggregation of tau244-372 in cells. X-ray fibre diffraction, hydrogen-deuterium exchange and solid-state NMR studies map the beta-forming region to a 25-residue sequence. Thus, the nucleus for self-propagating aggregation of tau244-372 in cells is packaged in a remarkably small peptide.
Endothelial stress induces the release of vitamin D-binding protein, a novel growth factor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raymond, Marc-Andre; Desormeaux, Anik; Labelle, Andree
2005-12-23
Endothelial cells (EC) under stress release paracrine mediators that facilitate accumulation of vascular smooth muscle cells (VSCM) at sites of vascular injury. We found that medium conditioned by serum-starved EC increase proliferation and migration of VSCM in vitro. Fractionation of the conditioned medium followed by mass spectral analysis identified one bioactive component as vitamin D-binding protein (DBP). DBP induced both proliferation and migration of VSMC in vitro in association with increased phosphorylation of ERK 1/2. PD 98059, a biochemical inhibitor of ERK 1/2, abrogated these proliferative and migratory responses in VSMC. DBP is an important carrier for the vitamin-D sterols,more » 25-hydroxyvitamin-D, and 1{alpha},25-dihydroxyvitamin-D. Both sterols inhibited the activity of DBP on VSMC, suggesting that vitamin D binding sites are important for initiating the activities of DBP on VSMC. Release of DBP at sites of endothelial injury represents a novel pathway favoring accumulation of VSMC at sites of vascular injury.« less
Suzuki, Hiroyuki; Yagi, Ken; Kondo, Miki; Kato, Mitsuyasu; Miyazono, Kohei; Miyazawa, Keiji
2004-06-24
c-Ski inhibits transforming growth factor-beta (TGF-beta) signaling through interaction with Smad proteins. c-Ski represses Smad-mediated transcriptional activation, probably through its action as a transcriptional co-repressor. c-Ski also inhibits TGF-beta-induced downregulation of genes such as c-myc. However, mechanisms for transcriptional regulation of target genes by c-Ski have not been fully determined. In this study, we examined how c-Ski inhibits both TGF-beta-induced transcriptional activation and repression. DNA-affinity precipitation analysis revealed that c-Ski enhances the binding of Smad2 and 4, and to a lesser extent Smad3, to both CAGA and TGF-beta1 inhibitory element probes. A c-Ski mutant, which is unable to interact with Smad4, failed to enhance the binding of Smad complex on these probes and to inhibit the Smad-responsive promoter. These results suggest that stabilization of inactive Smad complexes on DNA is a critical event in c-Ski-mediated inhibition of TGF-beta signaling.
Ushiro, S; Mizoguchi, K; Yoshida, S; Jimi, S; Fujiwara, T; Yoshida, M; Wei, E T; Kitabgi, P; Amagaya, S; Ono, M; Kuwano, M
1997-12-01
To investigate if neurotensin (NT) could induce activation of urokinase-type plasminogen activator (uPA) in vascular endothelial cells, we utilized the acetyl-NT (8-13) analogue, TJN-950, in which the C-terminal leucine is reduced to leucinol. TJN-950 inhibited the binding of 125I-NT to membranes of newborn rat brains and of COS-7 cells transfected with rat NT receptor cDNA, but at 10(4) higher doses than NT (8-13). However, TJN-950 was as effective as NT in inducing the fibrinolytic activity in bovine vascular aortic and human umbilical vein endothelial cells, and enhanced the migration of vascular endothelial cells. Moreover, administration of TJN-950 induced neovascularization in the rat cornea in vivo. TJN-950 had no effect on expression of uPA, plasminogen activator inhibitor-1 or uPA receptor mRNA. The binding of 125I-TJN-950 to cell membranes was blocked by unlabeled uPA and TJN-950, but not the amino-terminal or 12-32 fragment of uPA. TJN-950 may enhance uPA activity in vascular endothelial cells by interacting with the uPA receptor, resulting in induction of angiogenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoddard, Ethan G.; Killinger, Bryan J.; Nair, Reji N.
Glutathione S-transferases (GSTs) comprise a highly diverse family of phase II drug metabolizing enzymes whose shared function is the conjugation of reduced glutathione to various endo- and xenobiotics. Although the conglomerate activity of these enzymes can be measured by colorimetric assays, measurement of the individual contribution from specific isoforms and their contribution to the detoxification of xenobiotics in complex biological samples has not been possible. For this reason, we have developed two activity-based probes that characterize active glutathione transferases in mammalian tissues. The GST active site is comprised of a glutathione binding “G site” and a distinct substrate binding “Hmore » site”. Therefore, we developed (1) a glutathione-based photoaffinity probe (GSH-ABP) to target the “G site”, and (2) a probe designed to mimic a substrate molecule and show “H site” activity (GST-ABP). The GSH-ABP features a photoreactive moiety for UV-induced covalent binding to GSTs and glutathione-binding enzymes. The GST-ABP is a derivative of a known mechanism-based GST inhibitor that binds within the active site and inhibits GST activity. Validation of probe targets and “G” and “H” site specificity was carried out using a series of competitors in liver homogenates. Herein, we present robust tools for the novel characterization of enzyme- and active site-specific GST activity in mammalian model systems.« less
Vera-Estrella, R.; Barkla, B. J.; Higgins, V. J.; Blumwald, E.
1994-01-01
Elicitor preparations containing the avr5 gene products from race 4 of Cladosporium fulvum and tomato (Lycopersicon esculentum L.) cells near isogenic for the resistance gene Cf5 were used to investigate events following the treatment of host plasma membranes with elicitor. A 4-fold increase in H+-ATPase activity, coincident with the acidification of the extracellular medium, was detected immediately after elicitor treatment. The elicitor-induced stimulation of the plasma membrane H+-ATPase was inhibited by okadaic acid but not by staurosporine, suggesting that protein dephosphorylation was required for increased H+-ATPase activity. This observation was confirmed by [gamma]-32P labeling and immunodetection of the plasma membrane H+-ATPase. Effects of guanidine nucleotide analogs and mastoparan on the ATPase activity suggested the role of GTP-binding proteins in mediating the putative elicitor-receptor binding, resulting in activation of a phosphatase(s), which in turn stimulates the plasma membrane H+-ATPase by dephosphorylation. PMID:12232073
Marine Bivalve Cellular Responses to Beta Blocker Exposures
β blockers are prescription drugs used for medical treatment of hypertension and arrhythmias. They prevent binding of agonists such as catecholamines to β adrenoceptors. In the absence of agonist induced activation of the receptor, adenylate cyclase is not activated whi...
Oxidized mitochondrial DNA activates the NLRP3 inflammasome during apoptosis.
Shimada, Kenichi; Crother, Timothy R; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V Krishnan; Wolf, Andrea J; Vergnes, Laurent; Ojcius, David M; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A; Underhill, David M; Town, Terrence; Arditi, Moshe
2012-03-23
We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The antiapoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. Copyright © 2012 Elsevier Inc. All rights reserved.
Oxidized Mitochondrial DNA Activates the NLRP3 Inflammasome During Apoptosis
Shimada, Kenichi; Crother, Timothy R.; Karlin, Justin; Dagvadorj, Jargalsaikhan; Chiba, Norika; Chen, Shuang; Ramanujan, V. Krishnan; Wolf, Andrea J.; Vergnes, Laurent; Ojcius, David M.; Rentsendorj, Altan; Vargas, Mario; Guerrero, Candace; Wang, Yinsheng; Fitzgerald, Katherine A.; Underhill, David M.; Town, Terrence; Arditi, Moshe
2012-01-01
SUMMARY We report that in the presence of signal 1 (NF-κB), the NLRP3 inflammasome was activated by mitochondrial apoptotic signaling that licensed production of interleukin-1β (IL-1β). NLRP3 secondary signal activators such as ATP induced mitochondrial dysfunction and apoptosis, resulting in release of oxidized mitochondrial DNA (mtDNA) into the cytosol, where it bound to and activated the NLRP3 inflammasome. The anti-apoptotic protein Bcl-2 inversely regulated mitochondrial dysfunction and NLRP3 inflammasome activation. Mitochondrial DNA directly induced NLRP3 inflammasome activation, because macrophages lacking mtDNA had severely attenuated IL-1β production, yet still underwent apoptosis. Both binding of oxidized mtDNA to the NLRP3 inflammasome and IL-1β secretion could be competitively inhibited by the oxidized nucleoside, 8-OH-dG. Thus, our data reveal that oxidized mtDNA released during programmed cell death causes activation of the NLRP3 inflammasome. These results provide a missing link between apoptosis and inflammasome activation, via binding of cytosolic oxidized mtDNA to the NLRP3 inflammasome. PMID:22342844
Jasuja, Ravi; Ulloor, Jagadish; Yengo, Christopher M.; Choong, Karen; Istomin, Andrei Y.; Livesay, Dennis R.; Jacobs, Donald J.; Swerdloff, Ronald S.; Mikšovská, Jaroslava; Larsen, Randy W.; Bhasin, Shalender
2009-01-01
Ligand-induced conformational perturbations in androgen receptor (AR) are important in coactivator recruitment and transactivation. However, molecular rearrangements in AR ligand-binding domain (AR-LBD) associated with agonist binding and their kinetic and thermodynamic parameters are poorly understood. We used steady-state second-derivative absorption and emission spectroscopy, pressure and temperature perturbations, and 4,4′-bis-anilinonaphthalene 8-sulfonate (bis-ANS) partitioning to determine the kinetics and thermodynamics of the conformational changes in AR-LBD after dihydrotestosterone (DHT) binding. In presence of DHT, the second-derivative absorption spectrum showed a red shift and a change in peak-to-peak distance. Emission intensity increased upon DHT binding, and center of spectral mass was blue shifted, denoting conformational changes resulting in more hydrophobic environment for tyrosines and tryptophans within a more compact DHT-bound receptor. In pressure perturbation calorimetry, DHT-induced energetic stabilization increased the Gibbs free energy of unfolding to 8.4 ± 1.3 kcal/mol from 3.5 ± 1.6 kcal/mol. Bis-ANS partitioning studies revealed that upon DHT binding, AR-LBD underwent biphasic rearrangement with a high activation energy (13.4 kcal/mol). An initial, molten globule-like burst phase (k ∼30 sec−1) with greater solvent accessibility was followed by rearrangement (k ∼0.01 sec−1), leading to a more compact conformation than apo-AR-LBD. Molecular simulations demonstrated unique sensitivity of tyrosine and tryptophan residues during pressure unfolding with rearrangement of residues in the coactivator recruitment surfaces distant from the ligand-binding pocket. In conclusion, DHT binding leads to energetic stabilization of AR-LBD domain and substantial rearrangement of residues distant from the ligand-binding pocket. DHT binding to AR-LBD involves biphasic receptor rearrangement including population of a molten globule-like intermediate state. PMID:19443608
Kolin, Ana; Balasubramaniam, Vinitha; Skredenske, Jeff; Wickstrum, Jason; Egan, Susan M.
2008-01-01
SUMMARY Proteins in the largest subset of AraC/XylS family transcription activators, including RhaS and RhaR, have C-terminal domains (CTDs) that mediate DNA-binding and transcription activation, and N-terminal domains (NTDs) that mediate dimerization and effector binding. The mechanism of the allosteric effector response in this family has been identified only for AraC. Here, we investigated the mechanism by which RhaS and RhaR respond to their effector, L-rhamnose. Unlike AraC, N-terminal truncations suggested that RhaS and RhaR don’t use an N-terminal arm to inhibit activity in the absence of effector. We used random mutagenesis to isolate RhaS and RhaR variants with enhanced activation in the absence of L-rhamnose. NTD substitutions largely clustered around the predicted L-rhamnose-binding pockets, suggesting that they mimic the structural outcome of effector binding to the wild-type proteins. RhaS-CTD substitutions clustered in the first HTH motif, and suggested that L-rhamnose induces improved DNA binding. In contrast, RhaR-CTD substitutions clustered at a single residue in the second HTH motif, at a position consistent with improved RNAP contacts. We propose separate allosteric mechanisms for the two proteins: Without L-rhamnose, RhaS doesn’t effectively bind DNA while RhaR doesn’t effectively contact RNAP. Upon L-rhamnose binding, both proteins undergo structural changes that enable transcription activation. PMID:18366439
Variola virus E3L Zα domain, but not its Z-DNA binding activity, is required for PKR inhibition.
Thakur, Meghna; Seo, Eun Joo; Dever, Thomas E
2014-02-01
Responding to viral infection, the interferon-induced, double-stranded RNA (dsRNA)-activated protein kinase PKR phosphorylates translation initiation factor eIF2α to inhibit cellular and viral protein synthesis. To overcome this host defense mechanism, many poxviruses express the protein E3L, containing an N-terminal Z-DNA binding (Zα) domain and a C-terminal dsRNA-binding domain (dsRBD). While E3L is thought to inhibit PKR activation by sequestering dsRNA activators and by directly binding the kinase, the role of the Zα domain in PKR inhibition remains unclear. Here, we show that the E3L Zα domain is required to suppress the growth-inhibitory properties associated with expression of human PKR in yeast, to inhibit PKR kinase activity in vitro, and to reverse the inhibitory effects of PKR on reporter gene expression in mammalian cells treated with dsRNA. Whereas previous studies revealed that the Z-DNA binding activity of E3L is critical for viral pathogenesis, we identified point mutations in E3L that functionally uncouple Z-DNA binding and PKR inhibition. Thus, our studies reveal a molecular distinction between the nucleic acid binding and PKR inhibitory functions of the E3L Zα domain, and they support the notion that E3L contributes to viral pathogenesis by targeting PKR and other components of the cellular anti-viral defense pathway.
Sakkal, Leon A; Rajkowski, Kyle Z; Armen, Roger S
2017-06-05
Following insights from recent crystal structures of the muscarinic acetylcholine receptor, binding modes of Positive Allosteric Modulators (PAMs) were predicted under the assumption that PAMs should bind to the extracellular surface of the active state. A series of well-characterized PAMs for adenosine (A 1 R, A 2A R, A 3 R) and muscarinic acetylcholine (M 1 R, M 5 R) receptors were modeled using both rigid and flexible receptor CHARMM-based molecular docking. Studies of adenosine receptors investigated the molecular basis of the probe-dependence of PAM activity by modeling in complex with specific agonist radioligands. Consensus binding modes map common pharmacophore features of several chemical series to specific binding interactions. These models provide a rationalization of how PAM binding slows agonist radioligand dissociation kinetics. M 1 R PAMs were predicted to bind in the analogous M 2 R PAM LY2119620 binding site. The M 5 R NAM (ML-375) was predicted to bind in the PAM (ML-380) binding site with a unique induced-fit receptor conformation. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Yang, Sun; Shi-Sheng, Sun; Ying-Yong, Zhao; Jun, Fan
2012-07-01
In this study, we compared different binding interactions of TBMS2 with proteins both in hepatocarcinoma HepG2 cells and in normal embryo hepatic L02 cells by using fluorescence, absorption, and CD spectroscopy. The fluorescence data revealed that the fluorescence intensity of proteins in the HepG2 and L02 cells decreased in the presence of TBMS2 by 30.79% and 12.01%, respectively. Binding constants and thermodynamic parameters were obtained for systems of TBMS2 with the two kinds of cell proteins. The results indicated that HepG2 cell proteins had a higher TBMS2 binding activity than those in the L02 cells. Analysis of the TBMS2 cytotoxic activities showed that TBMS2 could selectively induce apoptosis of HepG2 cells by binding to them, while its apoptotic effect on L02 cells was relatively weaker.
Kizis, Dimosthenis; Pagès, Montserrat
2002-06-01
The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.
Ahrens, Ingo; Chen, Yung-Chih; Topcic, Danijal; Bode, Michael; Haenel, David; Hagemeyer, Christoph E; Seeba, Hannah; Duerschmied, Daniel; Bassler, Nicole; Jandeleit-Dahm, Karin A; Sweet, Matthew J; Agrotis, Alex; Bobik, Alex; Peter, Karlheinz
2015-11-01
High mobility group box 1 (HMGB1) acts as both a nuclear protein that regulates gene expression, as well as a pro-inflammatory alarmin that is released from necrotic or activated cells. Recently, HMGB1-expression in human atherosclerotic plaques was identified. Therapeutic blockade of HMGB1 reduced the development of diet-induced atherosclerosis in ApoE knockout mice. Thus, we hypothesised an interaction between HMGB1 and activated platelets. Binding of recombinant HMGB1 to platelets was assessed by flow cytometry. HMGB1 bound to thrombin-activated human platelets (MFI 2.49 vs 25.01, p=0.0079). Blood from wild-type, TLR4 and RAGE knockout mice was used to determine potential HMGB1 receptors on platelets. HMGB1 bound to platelets from wild type C57Bl6 (MFI 2.64 vs 20.3, p< 0.05), and TLR4-/- mice (MFI 2.11 vs 25.65, p< 0.05) but failed to show binding to platelets from RAGE-/- mice (p > 0.05). RAGE expression on human platelets was detected by RT-PCR with mRNA extracted from highly purified platelets and confirmed by Western blot and immunofluorescence microscopy. Platelet activation increased RAGE surface expression (MFI 4.85 vs 6.74, p< 0.05). Expression of HMGB1 in human coronary artery thrombi was demonstrated by immunohistochemistry and revealed high expression levels. Platelets bind HMGB1 upon thrombin-induced activation. Platelet specific expression of RAGE could be detected at the mRNA and protein level and is involved in the binding of HMGB1. Furthermore, platelet activation up-regulates platelet surface expression of RAGE. HMGB1 is highly expressed in platelet-rich human coronary artery thrombi pointing towards a central role for HMGB1 in atherothrombosis, thereby suggesting the possibility of platelet targeted anti-inflammatory therapies for atherothrombosis.
Cellular Uptake of Clostridium botulinum C2 Toxin Requires Acid Sphingomyelinase Activity.
Nagahama, Masahiro; Takehara, Masaya; Takagishi, Teruhisa; Seike, Soshi; Miyamoto, Kazuaki; Kobayashi, Keiko
2017-04-01
Clostridium botulinum C2 toxin consists of an enzyme component (C2I) and a binding component (C2II). Activated C2II (C2IIa) binds to a cell receptor, giving rise to lipid raft-dependent oligomerization, and it then assembles with C2I. The whole toxin complex is then endocytosed into the cytosol, resulting in the destruction of the actin cytoskeleton and cell rounding. Here, we showed that C2 toxin requires acid sphingomyelinase (ASMase) activity during internalization. In this study, inhibitors of ASMase and lysosomal exocytosis blocked C2 toxin-induced cell rounding. C2IIa induced Ca 2+ influx from the extracellular medium to cells. C2 toxin-induced cell rounding was enhanced in the presence of Ca 2+ ASMase was released extracellularly when cells were incubated with C2IIa in the presence of Ca 2+ Small interfering RNA (siRNA) knockdown of ASMase reduced C2 toxin-induced cell rounding. ASMase hydrolyzes sphingomyelin to ceramide on the outer leaflet of the membrane at acidic pH. Ceramide was detected in cytoplasmic vesicles containing C2IIa. These results indicated that ASMase activity is necessary for the efficient internalization of C2 toxin into cells. Inhibitors of ASMase may confer protection against infection. Copyright © 2017 American Society for Microbiology.
Yu, Xiaochun; Sharma, Kailash D.; Takahashi, Tsuyoshi; Iwamoto, Ryo; Mekada, Eisuke
2002-01-01
Dimerization and phosphorylation of the epidermal growth factor (EGF) receptor (EGFR) are the initial and essential events of EGF-induced signal transduction. However, the mechanism by which EGFR ligands induce dimerization and phosphorylation is not fully understood. Here, we demonstrate that EGFRs can form dimers on the cell surface independent of ligand binding. However, a chimeric receptor, comprising the extracellular and transmembrane domains of EGFR and the cytoplasmic domain of the erythropoietin receptor (EpoR), did not form a dimer in the absence of ligands, suggesting that the cytoplasmic domain of EGFR is important for predimer formation. Analysis of deletion mutants of EGFR showed that the region between 835Ala and 918Asp of the EGFR cytoplasmic domain is required for EGFR predimer formation. In contrast to wild-type EGFR ligands, a mutant form of heparin-binding EGF-like growth factor (HB2) did not induce dimerization of the EGFR-EpoR chimeric receptor and therefore failed to activate the chimeric receptor. However, when the dimerization was induced by a monoclonal antibody to EGFR, HB2 could activate the chimeric receptor. These results indicate that EGFR can form a ligand-independent inactive dimer and that receptor dimerization and activation are mechanistically distinct and separable events. PMID:12134089
Hung, Chi-Nan; Huang, Hui-Pei; Wang, Chau-Jong; Liu, Kai-Li; Lii, Chong-Kuei
2014-10-01
Endothelial dysfunction is an early indicator of cardiovascular diseases. Increased stimulation of tumor necrosis factor-α (TNF-α) triggers the inflammatory mediator secretion of endothelial cells, leading to atherosclerotic risk. In this study, we investigated whether sulforaphane (SFN) affected the expression of intracellular adhesion molecule-1 (ICAM-1) in TNF-α-induced ECV 304 endothelial cells. Our data showed that SFN attenuated TNF-α-induced expression of ICAM-1 in ECV 304 cells. Pretreatment of ECV 304 cells with SFN inhibited dose-dependently the secretion of proinflammatory cytokines, such as interleukin (IL)-1β, IL-6, and IL-8. SFN inhibited TNF-α-induced nuclear factor-κB (NF-κB) DNA binding activity. Furthermore, SFN decreased TNF-α-mediated phosphorylation of IκB kinase (IKK) and IκBα, Rho A, ROCK, ERK1/2, and plasminogen activator inhibitor-1 (PAI-1) levels. Collectively, SFN inhibited the NF-κB DNA binding activity and downregulated the TNF-α-mediated induction of ICAM-1 in endothelial cells by inhibiting the Rho A/ROCK/NF-κB signaling pathway, suggesting the beneficial effects of SFN on suppression of inflammation within the atherosclerotic lesion.
S-nitrosation on zinc finger motif of PARP-1 as a mechanism of DNA repair inhibition by arsenite
Zhou, Xixi; Cooper, Karen L.; Huestis, Juliana; Xu, Huan; Burchiel, Scott W.; Hudson, Laurie G.; Liu, Ke Jian
2016-01-01
Arsenic, a widely distributed carcinogen, is known to significantly amplify the impact of other carcinogens through inhibition of DNA repair. Our recent work suggests that reactive oxygen/nitrogen species (ROS/RNS) induced by arsenite (AsIII) play an important role in the inhibition of the DNA repair protein Poly(ADP-ribose) polymerase 1 (PARP-1). AsIII-induced ROS lead to oxidation of cysteine residues within the PARP-1 zinc finger DNA binding domain. However, the mechanism underlying RNS-mediated PARP inhibition by arsenic remains unknown. In this work, we demonstrate that AsIII treatment of normal human keratinocyte (HEKn) cells induced S-nitrosation on cysteine residues of PARP-1 protein, in a similar manner to a nitric oxide donor. S-nitrosation of PARP-1 could be reduced by 1400W (inducible nitric oxide synthase inhibitor) or c-PTIO (a nitric oxide scavenger). Furthermore, AsIII treatment of HEKn cells leads to zinc loss and inhibition of PARP-1 enzymatic activity. AsIII and 1400W/c-PTIO co-treatment demonstrate that these effects occur in an iNOS- and NO-dependent manner. Importantly, we confirmed S-nitrosation on the zinc finger DNA binding domain of PARP-1 protein. Taken together, AsIII induces S-nitrosation on PARP-1 zinc finger DNA binding domain by generating NO through iNOS activation, leading to zinc loss and inhibition of PARP-1 activity, thereby increasing retention of damaged DNA. These findings identify S-nitrosation as an important component of the molecular mechanism underlying AsIII inhibition of DNA repair, which may benefit the development of preventive and intervention strategies against AsIII co-carcinogenesis. PMID:27741521
S-nitrosation on zinc finger motif of PARP-1 as a mechanism of DNA repair inhibition by arsenite.
Zhou, Xixi; Cooper, Karen L; Huestis, Juliana; Xu, Huan; Burchiel, Scott W; Hudson, Laurie G; Liu, Ke Jian
2016-12-06
Arsenic, a widely distributed carcinogen, is known to significantly amplify the impact of other carcinogens through inhibition of DNA repair. Our recent work suggests that reactive oxygen/nitrogen species (ROS/RNS) induced by arsenite (AsIII) play an important role in the inhibition of the DNA repair protein Poly(ADP-ribose) polymerase 1 (PARP-1). AsIII-induced ROS lead to oxidation of cysteine residues within the PARP-1 zinc finger DNA binding domain. However, the mechanism underlying RNS-mediated PARP inhibition by arsenic remains unknown. In this work, we demonstrate that AsIII treatment of normal human keratinocyte (HEKn) cells induced S-nitrosation on cysteine residues of PARP-1 protein, in a similar manner to a nitric oxide donor. S-nitrosation of PARP-1 could be reduced by 1400W (inducible nitric oxide synthase inhibitor) or c-PTIO (a nitric oxide scavenger). Furthermore, AsIII treatment of HEKn cells leads to zinc loss and inhibition of PARP-1 enzymatic activity. AsIII and 1400W/c-PTIO co-treatment demonstrate that these effects occur in an iNOS- and NO-dependent manner. Importantly, we confirmed S-nitrosation on the zinc finger DNA binding domain of PARP-1 protein. Taken together, AsIII induces S-nitrosation on PARP-1 zinc finger DNA binding domain by generating NO through iNOS activation, leading to zinc loss and inhibition of PARP-1 activity, thereby increasing retention of damaged DNA. These findings identify S-nitrosation as an important component of the molecular mechanism underlying AsIII inhibition of DNA repair, which may benefit the development of preventive and intervention strategies against AsIII co-carcinogenesis.
Marsh, Tanya G; Straub, Rachel K; Villalobos, Fatima; Hong, Mee Young
2011-12-01
Animal and human studies have indicated that the presence of soy in the diet improves cardiovascular health. Inflammation plays a pivotal role in the progression of cardiovascular disease (CVD). However, little is known about how dextran sodium sulfate (DSS)-induced systemic inflammation impacts overall heart health and, correspondingly, how soy protein modulates risk of CVD development in DSS-induced systemic inflammation. We hypothesized that soy protein-fed rats would have a lower risk of CVD by beneficial alteration of gene expression involving lipid metabolism and antioxidant capacity in DSS-induced systemic inflammation. Forty Sprague-Dawley rats were divided into 4 groups: casein, casein + DSS, soy protein, and soy protein + DSS. After 26 days, inflammation was induced in one group from each diet by incorporating 3% DSS in drinking water for 48 hours. Soy protein-fed rats had lower final body weights (P = .010), epididymal fat weights (P = .049), total cholesterol (P < .001), and low-density lipoprotein cholesterol (P < .001). In regard to gene expression, soy protein-fed rats had lower sterol regulatory element-binding protein-2 (P = .032) and hydroxymethylglutaryl-coenzyme A reductase (P = .028) levels and higher low-density lipoprotein receptor levels (P = .036). Antioxidant enzyme activity of superoxide dismutase and catalase was higher among the soy protein groups (P = .037 and P = .002, respectively). These results suggest that soy protein positively influences cardiovascular health by regulating serum lipids through modified expression of sterol regulatory element-binding protein-2 and its downstream genes (ie, hydroxymethylglutaryl-coenzyme A reductase and low-density lipoprotein receptor) and by promoting the antioxidant enzyme activity of superoxide dismutase and catalase. Copyright © 2011 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahn, Jiwon; Department of Microbiology, Chungnam National University, Daejeon 305-764; Choi, Jeong-Hae
2011-06-03
Highlights: {yields} Regulation of transcriptional activation of RhoB is still unclear. {yields} We examine the effect of p38 MAPK inhibition, and c-Jun and RhoB depletion on UV-induced RhoB expression and apoptosis. {yields} We identify the regions of RhoB promoter necessary to confer UV responsiveness using pRhoB-luciferase reporter assays. {yields} c-Jun, ATF2 and p300 are dominantly associated with NF-Y on the distal CCAAT box. {yields} The activation of p38 MAPK primarily contribute to UV-induced RhoB expression by recruiting the c-Jun and p300 proteins on distal CCAAT box of RhoB promoter. -- Abstract: The Ras-related small GTP-binding protein RhoB is rapidly inducedmore » in response to genotoxic stresses caused by ionizing radiation. It is known that UV-induced RhoB expression results from the binding of activating transcription factor 2 (ATF2) via NF-Y to the inverted CCAAT box (-23) of the RhoB promoter. Here, we show that the association of c-Jun with the distal CCAAT box (-72) is primarily involved in UV-induced RhoB expression and p38 MAPK regulated RhoB induction through the distal CCAAT box. UV-induced RhoB expression and apoptosis were markedly attenuated by pretreatment with the p38 MAPK inhibitor. siRNA knockdown of RhoB, ATF2 and c-Jun resulted in decreased RhoB expression and eventually restored the growth of UV-irradiated Jurkat cells. In the reporter assay using luciferase under the RhoB promoter, inhibition of RhoB promoter activity by the p38 inhibitor and knockdown of c-Jun using siRNA occurred through the distal CCAAT box. Immunoprecipitation and DNA affinity protein binding assays revealed the association of c-Jun and p300 via NF-YA and the dissociation of histone deacetylase 1 (HDAC1) via c-Jun recruitment to the CCAAT boxes of the RhoB promoter. These results suggest that the activation of p38 MAPK primarily contributes to UV-induced RhoB expression by recruiting the c-Jun and p300 proteins to the distal CCAAT box of the RhoB promoter in Jurkat cells.« less
Rajgor, Dipen; Fiuza, Maria; Parkinson, Gabrielle T; Hanley, Jonathan G
2017-06-09
MicroRNAs (miRNAs) are important regulators of localized mRNA translation in neuronal dendrites. The presence of RNA-induced silencing complex proteins in these compartments and the dynamic miRNA expression changes that occur in response to neuronal stimulation highlight their importance in synaptic plasticity. Previously, we demonstrated a novel interaction between the major RNA-induced silencing complex component Argounaute-2 (Ago2) and the BAR (bin/amphiphysin/rvs) domain protein PICK1. PICK1 recruits Ago2 to recycling endosomes in dendrites, where it inhibits miRNA-mediated translational repression. Chemical induction of long-term depression via NMDA receptor activation causes the dissociation of Ago2 from PICK1 and a consequent increase in dendritic miRNA-mediated gene silencing. The mechanism that underlies the regulation of PICK1-Ago2 binding is unknown. In this study, we demonstrate that the PICK1-Ago2 interaction is directly sensitive to Ca 2+ ions so that high [Ca 2+ ] free reduces PICK1 binding to Ago2. Mutating a stretch of C-terminal Ca 2+ -binding residues in PICK1 results in a complete block of NMDA-induced PICK1-Ago2 disassociation in cortical neurons. Furthermore, the same mutant also blocks NMDA-stimulated miRNA-mediated gene silencing. This study defines a novel mechanism whereby elevated [Ca 2+ ] induced by NMDA receptor activation modulates Ago2 and miRNA activity via PICK1. Our work suggests a Ca 2+ -dependent process to regulate miRNA activity in neurons in response to the induction of long-term depression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Sun, Shishuo; Tan, Pengcheng; Huang, Xiaoheng; Zhang, Wei; Kong, Chen; Ren, Fangfang; Su, Xiong
2018-02-16
Both the magnitude and duration of insulin signaling are important in executing its cellular functions. Insulin-induced degradation of insulin receptor substrate 1 (IRS1) represents a key negative feedback loop that restricts insulin signaling. Moreover, high concentrations of fatty acids (FAs) and glucose involved in the etiology of obesity-associated insulin resistance also contribute to the regulation of IRS1 degradation. The scavenger receptor CD36 binds many lipid ligands, and its contribution to insulin resistance has been extensively studied, but the exact regulation of insulin sensitivity by CD36 is highly controversial. Herein, we found that CD36 knockdown in C2C12 myotubes accelerated insulin-stimulated Akt activation, but the activated signaling was sustained for a much shorter period of time as compared with WT cells, leading to exacerbated insulin-induced insulin resistance. This was likely due to enhanced insulin-induced IRS1 degradation after CD36 knockdown. Overexpression of WT CD36, but not a ubiquitination-defective CD36 mutant, delayed IRS1 degradation. We also found that CD36 functioned through ubiquitination-dependent binding to IRS1 and inhibiting its interaction with cullin 7, a key component of the multisubunit cullin-RING E3 ubiquitin ligase complex. Moreover, dissociation of the Src family kinase Fyn from CD36 by free FAs or Fyn knockdown/inhibition accelerated insulin-induced IRS1 degradation, likely due to disrupted IRS1 interaction with CD36 and thus enhanced binding to cullin 7. In summary, we identified a CD36-dependent FA-sensing pathway that plays an important role in negative feedback regulation of insulin activation and may open up strategies for preventing or managing type 2 diabetes mellitus. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Sun, Hui Bin; Zhu, Yuan Xiao; Yin, Tinggui; Sledge, George; Yang, Yu-Chung
1998-01-01
Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors. PMID:9811838
SH2 Ligand-Like Effects of Second Cytosolic Domain of Na/K-ATPase α1 Subunit on Src Kinase.
Banerjee, Moumita; Duan, Qiming; Xie, Zijian
2015-01-01
Our previous studies have suggested that the α1 Na/K-ATPase interacts with Src to form a receptor complex. In vitro binding assays indicate an interaction between second cytosolic domain (CD2) of Na/K-ATPase α1 subunit and Src SH2 domain. Since SH2 domain targets Src to specific signaling complexes, we expressed CD2 as a cytosolic protein and studied whether it could act as a Src SH2 ligand in LLC-PK1 cells. Co-immunoprecipitation analyses indicated a direct binding of CD2 to Src, consistent with the in vitro binding data. Functionally, CD2 expression increased basal Src activity, suggesting a Src SH2 ligand-like property of CD2. Consistently, we found that CD2 expression attenuated several signaling pathways where Src plays an important role. For instance, although it increased surface expression of Na/K-ATPase, it decreased ouabain-induced activation of Src and ERK by blocking the formation of Na/K-ATPase/Src complex. Moreover, it also attenuated cell attachment-induced activation of Src/FAK. Consequently, CD2 delayed cell spreading, and inhibited cell proliferation. Furthermore, these effects appear to be Src-specific because CD2 expression had no effect on EGF-induced activation of EGF receptor and ERK. Hence, the new findings indicate the importance of Na/K-ATPase/Src interaction in ouabain-induced signal transduction, and support the proposition that the CD2 peptide may be utilized as a Src SH2 ligand capable of blocking Src-dependent signaling pathways via a different mechanism from a general Src kinase inhibitor.
Spindler, Matthew J.; Burmeister, Brian T.; Huang, Yu; Hsiao, Edward C.; Salomonis, Nathan; Scott, Mark J.; Srivastava, Deepak; Carnegie, Graeme K.; Conklin, Bruce R.
2013-01-01
Background A-kinase anchoring proteins (AKAPs) are scaffolding molecules that coordinate and integrate G-protein signaling events to regulate development, physiology, and disease. One family member, AKAP13, encodes for multiple protein isoforms that contain binding sites for protein kinase A (PKA) and D (PKD) and an active Rho-guanine nucleotide exchange factor (Rho-GEF) domain. In mice, AKAP13 is required for development as null embryos die by embryonic day 10.5 with cardiovascular phenotypes. Additionally, the AKAP13 Rho-GEF and PKD-binding domains mediate cardiomyocyte hypertrophy in cell culture. However, the requirements for the Rho-GEF and PKD-binding domains during development and cardiac hypertrophy are unknown. Methodology/Principal Findings To determine if these AKAP13 protein domains are required for development, we used gene-trap events to create mutant mice that lacked the Rho-GEF and/or the protein kinase D-binding domains. Surprisingly, heterozygous matings produced mutant mice at Mendelian ratios that had normal viability and fertility. The adult mutant mice also had normal cardiac structure and electrocardiograms. To determine the role of these domains during β-adrenergic-induced cardiac hypertrophy, we stressed the mice with isoproterenol. We found that heart size was increased similarly in mice lacking the Rho-GEF and PKD-binding domains and wild-type controls. However, the mutant hearts had abnormal cardiac contractility as measured by fractional shortening and ejection fraction. Conclusions These results indicate that the Rho-GEF and PKD-binding domains of AKAP13 are not required for mouse development, normal cardiac architecture, or β-adrenergic-induced cardiac hypertrophic remodeling. However, these domains regulate aspects of β-adrenergic-induced cardiac hypertrophy. PMID:23658642
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Yang, Shu-fa; Zhuang, Tai-feng; Si, Yan-mei; Qi, Ke-yan; Zhao, Juan
2015-03-01
This study aimed to characterize the immunopotentiating effects and immune receptors for Coriolus versicolor mushroom polysaccharides (CVP), a Chinese medicinal fungus that exerts anti-tumor activities by enhancing host immunity. Proliferation assays were used to determine whether CVP could activate splenocytes. Flow cytometry analysis and IgM and IgG detection were used to characterize CVP-binding cells. Immune receptors were analyzed in immunoprecipitation and western blot assays. The downstream signaling pathways were identified by western blotting or immunostaining. CVP significantly stimulated the proliferation of mouse splenocytes. Fluorescence-labeled CVP (fl-CVP) selectively stained mouse B cells, but not T cells. CVP induced the production of IgM and IgG1 with or without exogenous IL-4. Membrane Ig (B cell antigen-receptor, BCR) was identified as a CVP-binding protein in immunoprecipitation and western blot experiments. CVP-induced B cell proliferation could be significantly inhibited by anti-mouse immunoglobulin (Ig) blocking antibody (Fab) or in cells from TLR4-mutant mice (C3H/HeJ). Phosphorylation of ERK-1/2 and p38 MAPK were clearly increased in a time-dependent manner, as was the nuclear translocation of the cytosolic NF-κB p65 subunit after CVP stimulation. Together, we demonstrate that CVP can bind and induce B cell activation using membrane Ig and TLR-4 as potential immune receptors. CVP activates mouse B cells through the MAPK and NF-κB signaling pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
CCAAT/enhancer binding protein ' (C/EBP') is a member of the C/EBP family of transcription factors, which is most highly expressed in immature B cells. C/EBP' lacks known activation domains and thus was originally described as an inhibitor of C/EBP transactivation potential. We have previously demon...
Serine 133 Phosphorylation Is Not Required for Hippocampal CREB-Mediated Transcription and Behavior
ERIC Educational Resources Information Center
Brian, Lisa A.; Lee, Bridgin G.; Lelay, John; Kaestner, Klaus H.; Blendy, Julie A.
2015-01-01
The cAMP response element (CRE)-binding protein, CREB, is a transcription factor whose activity in the brain is critical for long-term memory formation. Phosphorylation of Ser133 in the kinase-inducible domain (KID), that in turn leads to the recruitment of the transcriptional coactivator CREB-binding protein (CBP), is thought to mediate the…
Light-induced exposure of the cytoplasmic end of transmembrane helix seven in rhodopsin
Abdulaev, Najmoutin G.; Ridge, Kevin D.
1998-01-01
A key step in signal transduction in the visual cell is the light-induced conformational change of rhodopsin that triggers the binding and activation of the guanine nucleotide-binding protein. Site-directed mAbs against bovine rhodopsin were produced and used to detect and characterize these conformational changes upon light activation. Among several antibodies that bound exclusively to the light-activated state, an antibody (IgG subclass) with the highest affinity (Ka ≈ 6 × 10−9 M) was further purified and characterized. The epitope of this antibody was mapped to the amino acid sequence 304–311. This epitope extends from the central region to the cytoplasmic end of the seventh transmembrane helix and incorporates a part of a highly conserved NPXXY motif, a critical region for signaling and agonist-induced internalization of several biogenic amine and peptide receptors. In the dark state, no binding of the antibody to rhodopsin was detected. Accessibility of the epitope to the antibody correlated with formation of the metarhodopsin II photointermediate and was reduced significantly at the metarhodopsin III intermediate. Further, incubation of the antigen–antibody complex with 11-cis-retinal failed to regenerate the native rhodopsin chromophore. These results suggest significant and reversible conformational changes in close proximity to the cytoplasmic end of the seventh transmembrane helix of rhodopsin that might be important for folding and signaling. PMID:9789004
Chiu, Shao-Chih; Chen, Jo-Mei Maureen; Wei, Tong-You Wade; Cheng, Tai-Shan; Wang, Ya-Hui Candice; Ku, Chia-Feng; Lian, Chiao-Hsuan; Liu, Chun-Chih Jared; Kuo, Yi-Chun; Yu, Chang-Tze Ricky
2014-09-01
Cells display dramatic morphological changes in mitosis, where numerous factors form regulatory networks to orchestrate the complicated process, resulting in extreme fidelity of the segregation of duplicated chromosomes into two daughter cells. Astrin regulates several aspects of mitosis, such as maintaining the cohesion of sister chromatids by inactivating Separase and stabilizing spindle, aligning and segregating chromosomes, and silencing spindle assembly checkpoint by interacting with Src kinase-associated phosphoprotein (SKAP) and cytoplasmic linker-associated protein-1α (CLASP-1α). To understand how Astrin is regulated in mitosis, we report here that Astrin acts as a mitotic phosphoprotein, and Aurora-A phosphorylates Astrin at Ser(115). The phosphorylation-deficient mutant Astrin S115A abnormally activates spindle assembly checkpoint and delays mitosis progression, decreases spindle stability, and induces chromosome misalignment. Mechanistic analyses reveal that Astrin phosphorylation mimicking mutant S115D, instead of S115A, binds and induces ubiquitination and degradation of securin, which sequentially activates Separase, an enzyme required for the separation of sister chromatids. Moreover, S115A fails to bind mitosis regulators, including SKAP and CLASP-1α, which results in the mitotic defects observed in Astrin S115A-transfected cells. In conclusion, Aurora-A phosphorylates Astrin and guides the binding of Astrin to its cellular partners, which ensures proper progression of mitosis. Copyright © 2014 the American Physiological Society.
Huang, Jiqing; Kast, Juergen
2015-08-07
Physiological stimuli, such as thrombin, or pathological stimuli, such as lysophosphatidic acid (LPA), activate platelets circulating in blood. Once activated, platelets bind to monocytes via P-selectin-PSGL-1 interactions but also release the stored contents of their granules. These platelet releasates, in addition to direct platelet binding, activate monocytes and facilitate their recruitment to atherosclerotic sites. Consequently, understanding the changes platelet releasates induce in monocyte membrane proteins is critical. We studied the glyco-proteome changes of THP-1 monocytic cells affected by LPA- or thrombin-induced platelet releasates. We employed lectin affinity chromatography combined with filter aided sample preparation to achieve high glyco- and membrane protein and protein sequence coverage. Using stable isotope labeling by amino acids in cell culture, we quantified 1715 proteins, including 852 membrane and 500 glycoproteins, identifying the up-regulation of multiple proteins involved in monocyte extracellular matrix binding and transendothelial migration. Flow cytometry indicated expression changes of integrin α5, integrin β1, PECAM-1, and PSGL-1. The observed increase in monocyte adhesion to fibronectin was determined to be mediated by the up-regulation of very late antigen 5 via a P-selectin-PSGL-1 independent mechanism. This novel aspect could be validated on CD14+ human primary monocytes, highlighting the benefits of the improved enrichment method regarding high membrane protein coverage and reliable quantification.
Singh, Appu Kumar; Ekka, Mary Krishna; Kaushik, Abhishek; Pandya, Vaibhav; Singh, Ravi P; Banerjee, Shrijita; Mittal, Monica; Singh, Vijay; Kumaran, S
2017-09-19
By classical competitive antagonism, a substrate and competitive inhibitor must bind mutually exclusively to the active site. The competitive inhibition of O-acetyl serine sulfhydrylase (OASS) by the C-terminus of serine acetyltransferase (SAT) presents a paradox, because the C-terminus of SAT binds to the active site of OASS with an affinity that is 4-6 log-fold (10 4 -10 6 ) greater than that of the substrate. Therefore, we employed multiple approaches to understand how the substrate gains access to the OASS active site under physiological conditions. Single-molecule and ensemble approaches showed that the active site-bound high-affinity competitive inhibitor is actively dissociated by the substrate, which is not consistent with classical views of competitive antagonism. We employed fast-flow kinetic approaches to demonstrate that substrate-mediated dissociation of full length SAT-OASS (cysteine regulatory complex) follows a noncanonical "facilitated dissociation" mechanism. To understand the mechanism by which the substrate induces inhibitor dissociation, we resolved the crystal structures of enzyme·inhibitor·substrate ternary complexes. Crystal structures reveal a competitive allosteric binding mechanism in which the substrate intrudes into the inhibitor-bound active site and disengages the inhibitor before occupying the site vacated by the inhibitor. In summary, here we reveal a new type of competitive allosteric binding mechanism by which one of the competitive antagonists facilitates the dissociation of the other. Together, our results indicate that "competitive allostery" is the general feature of noncanonical "facilitated/accelerated dissociation" mechanisms. Further understanding of the mechanistic framework of "competitive allosteric" mechanism may allow us to design a new family of "competitive allosteric drugs/small molecules" that will have improved selectivity and specificity as compared to their competitive and allosteric counterparts.
Nomura, Koji; Vilalta, Anna; Allendorf, David H.; Hornik, Tamara C.
2017-01-01
Activated microglia can phagocytose dying, stressed, or excess neurons and synapses via the phagocytic receptor Mer tyrosine kinase (MerTK). Galectin-3 (Gal-3) can cross-link surface glycoproteins by binding galactose residues that are normally hidden below terminal sialic acid residues. Gal-3 was recently reported to opsonize cells via activating MerTK. We found that LPS-activated BV-2 microglia rapidly released Gal-3, which was blocked by calcineurin inhibitors. Gal-3 bound to MerTK on microglia and to stressed PC12 (neuron-like) cells, and it increased microglial phagocytosis of PC12 cells or primary neurons, which was blocked by inhibition of MerTK. LPS-activated microglia exhibited a sialidase activity that desialylated PC12 cells and could be inhibited by Tamiflu, a neuraminidase (sialidase) inhibitor. Sialidase treatment of PC12 cells enabled Gal-3 to bind and opsonize the live cells for phagocytosis by microglia. LPS-induced microglial phagocytosis of PC12 was prevented by small interfering RNA knockdown of Gal-3 in microglia, lactose inhibition of Gal-3 binding, inhibition of neuraminidase with Tamiflu, or inhibition of MerTK by UNC569. LPS-induced phagocytosis of primary neurons by primary microglia was also blocked by inhibition of MerTK. We conclude that activated microglia release Gal-3 and a neuraminidase that desialylates microglial and PC12 surfaces, enabling Gal-3 binding to PC12 cells and their phagocytosis via MerTK. Thus, Gal-3 acts as an opsonin of desialylated surfaces, and inflammatory loss of neurons or synapses may potentially be blocked by inhibiting neuraminidases, Gal-3, or MerTK. PMID:28500071
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yan-Jie; Department of Medical Research, Taipei Veterans General Hospital, Taipei, Taiwan; Juan, Chi-Chang
Endothelin-1 (ET-1) is known as potent vasoconstrictor, by virtue of its mitogenic effects, and may deteriorate the process of hypertension and atherosclerosis by aggravating hyperplasia and migration in VSMCs. Our previous study demonstrated that insulin infusion caused sequential induction of hyperinsulinemia, hyperendothelinemia, insulin resistance, and then hypertension in rats. However, the underlying mechanism of ET-1 interfere insulin signaling in VSMCs remains unclear. To characterize insulin signaling during modest insulin resistant syndrome, we established and monitored rats by feeding high fructose-diet (HFD) until high blood pressure and modest insulin resistance occurred. To explore the role of ET-1/ET{sub A}R during insulin resistance,more » ET{sub A}R expression, ET-1 binding, and insulin signaling were investigated in the HFD-fed rats and cultured A-10 VSMCs. Results showed that high blood pressure, tunica medial wall thickening, plasma ET-1 and insulin, and accompanied with modest insulin resistance without overweight and hyperglycemia occurred in early-stage HFD-fed rats. In the endothelium-denuded aorta from HFD-fed rats, ET{sub A}R expression, but not ET{sub B}R, and ET-1 binding in aorta were increased. Moreover, decreasing of insulin-induced Akt phosphorylation and increasing of insulin-induced ERK phosphorylation were observed in aorta during modest insulin resistance. Interestingly, in ET-1 pretreated VSMCs, the increment of insulin-induced Akt phosphorylation was decreased whereas the increment of insulin-induced ERK phosphorylation was increased. In addition, insulin potentiated ET-1-induced VSMCs migration and proliferation due to increasing ET-1 binding. ETAR antagonist reversed effects of ET-1 on insulin-induced signaling and VSMCs migration and proliferation. In summary, modest insulin resistance syndrome accompanied with hyperinsulinemia leading to the potentiation on ET-1-induced actions in aortic VSMCs. ET-1 via ET{sub A}R pathway suppressed insulin-induced AKT activation, whereas remained insulin-induced ERK activation. ET-1 and insulin synergistically potentiated migration and proliferation mainly through ET{sub A}R/ERK dependent pathway, which is dominant in VSMCs during modest insulin resistance syndrome. Therefore, ET-1 and ET{sub A}R are potential targets responsible for the observed synergism effect in the hypertensive atherosclerotic process through enhancement of ET-1 binding, ET-1 binding, ET{sub A}R expression, and ET-1-induced mitogenic actions in aortic VSMCs. - Highlights: • ET-1/ET{sub A}R signaling and insulin-induced pERK were high in modest insulin resistance. • ET-1 via ET{sub A}R suppressed insulin-induced pAKT but remained intact pERK in VSMCs. • Insulin potentiated ET-1-induced VSMC mitogenic action was ET{sub A}R/ERK dependent.« less
Protective Mechanisms of Nitrone Antioxidants in Kanic Acid Induced Neurodegeneration
2004-01-01
Hong, Dextromethorphan modulates the AP-1 DNA bind- Med. 14 (1993) 633-642. ing activity induced by kainic acid, Brain Res. 824 (1999) 125-132. [71 S.C...Hong, The effect of dextromethorphan on kainic acid-induced after kainic acid-induced seizures, Free Radical Biol. Med. 18 seizures in the rat...Bing, G., Bronstein, D., McMillian, M., Hong, J.-S. (1996) the effects of dextromethorphan on kainic acid-induced seizures in the rat. J. Neurotoxic
Signaling Properties of Chemerin Receptors CMKLR1, GPR1 and CCRL2
De Henau, Olivier; Degroot, Gaetan-Nagim; Imbault, Virginie; Robert, Virginie; De Poorter, Cédric; Mcheik, Saria; Galés, Céline; Parmentier, Marc; Springael, Jean-Yves
2016-01-01
Chemerin is a small chemotactic protein originally identified as the natural ligand of CMKLR1. More recently, two other receptors, GPR1 and CCRL2, have been reported to bind chemerin but their functional relevance remains poorly understood. In this study, we compared the binding and signaling properties of the three human chemerin receptors and showed differences in mode of chemerin binding and receptor signaling. Chemerin binds to all three receptors with low nanomolar affinities. However, the contribution of the chemerin C-terminus to binding efficiency varies greatly amongst receptors. By using BRET-based biosensors monitoring the activation of various G proteins, we showed that binding of chemerin and the chemerin 9 nonapeptide (149YFPGQFAFS157) to CMKLR1 activates the three Gαi subtypes (Gαi1, Gαi2 and Gαi3) and the two Gαo isoforms (Gαoa and Gαob) with potencies correlated to binding affinities. In contrast, no significant activation of G proteins was detected upon binding of chemerin to GPR1 or CCRL2. Binding of chemerin and the chemerin 9 peptide also induced the recruitment of β-arrestin1 and 2 to CMKLR1 and GPR1, though to various degree, but not to CCRL2. However, the propensity of chemerin 9 to activate β-arrestins relative to chemerin is higher when bound to GPR1. Finally, we showed that binding of chemerin to CMKLR1 and GPR1 promotes also the internalization of the two receptors and the phosphorylation of ERK1/2 MAP kinases, although with a different efficiency, and that phosphorylation of ERK1/2 requires both Gαi/o and β-arrestin2 activation but not β-arrestin1. Collectively, these data support a model in which each chemerin receptor displays selective signaling properties. PMID:27716822
Signaling Properties of Chemerin Receptors CMKLR1, GPR1 and CCRL2.
De Henau, Olivier; Degroot, Gaetan-Nagim; Imbault, Virginie; Robert, Virginie; De Poorter, Cédric; Mcheik, Saria; Galés, Céline; Parmentier, Marc; Springael, Jean-Yves
2016-01-01
Chemerin is a small chemotactic protein originally identified as the natural ligand of CMKLR1. More recently, two other receptors, GPR1 and CCRL2, have been reported to bind chemerin but their functional relevance remains poorly understood. In this study, we compared the binding and signaling properties of the three human chemerin receptors and showed differences in mode of chemerin binding and receptor signaling. Chemerin binds to all three receptors with low nanomolar affinities. However, the contribution of the chemerin C-terminus to binding efficiency varies greatly amongst receptors. By using BRET-based biosensors monitoring the activation of various G proteins, we showed that binding of chemerin and the chemerin 9 nonapeptide (149YFPGQFAFS157) to CMKLR1 activates the three Gαi subtypes (Gαi1, Gαi2 and Gαi3) and the two Gαo isoforms (Gαoa and Gαob) with potencies correlated to binding affinities. In contrast, no significant activation of G proteins was detected upon binding of chemerin to GPR1 or CCRL2. Binding of chemerin and the chemerin 9 peptide also induced the recruitment of β-arrestin1 and 2 to CMKLR1 and GPR1, though to various degree, but not to CCRL2. However, the propensity of chemerin 9 to activate β-arrestins relative to chemerin is higher when bound to GPR1. Finally, we showed that binding of chemerin to CMKLR1 and GPR1 promotes also the internalization of the two receptors and the phosphorylation of ERK1/2 MAP kinases, although with a different efficiency, and that phosphorylation of ERK1/2 requires both Gαi/o and β-arrestin2 activation but not β-arrestin1. Collectively, these data support a model in which each chemerin receptor displays selective signaling properties.
Granata, R; Trovato, L; Lupia, E; Sala, G; Settanni, F; Camussi, G; Ghidoni, R; Ghigo, E
2007-04-01
Angiogenesis is critical for development and repair, and is a prominent feature of many pathological conditions. Based on evidence that insulin-like growth factor binding protein (IGFBP)-3 enhances cell motility and activates sphingosine kinase (SphK) in human endothelial cells, we have investigated whether IGFBP-3 plays a role in promoting angiogenesis. IGFBP-3 potently induced network formation by human endothelial cells on Matrigel. Moreover, it up-regulated proangiogenic genes, such as vascular endothelial growth factor (VEGF) and matrix metalloproteinases (MMP)-2 and -9. IGFBP-3 even induced membrane-type 1 MMP (MT1-MMP), which regulates MMP-2 activation. Decreasing SphK1 expression by small interfering RNA (siRNA), blocked IGFBP-3-induced network formation and inhibited VEGF, MT1-MMP but not IGF-I up-regulation. IGF-I activated SphK, leading to sphingosine-1-phosphate (S1P) formation. The IGF-I effect on SphK activity was blocked by specific inhibitors of IGF-IR, PI3K/Akt and ERK1/2 phosphorylation. The disruption of IGF-I signaling prevented the IGFBP-3 effect on tube formation, SphK activity and VEGF release. Blocking ERK1/2 signaling caused the loss of SphK activation and VEGF and IGF-I up-regulation. Finally, IGFBP-3 dose-dependently stimulated neovessel formation into subcutaneous implants of Matrigel in vivo. Thus, IGFBP-3 positively regulates angiogenesis through involvement of IGF-IR signaling and subsequent SphK/S1P activation.
Wang, Bin; Zhou, Xiaoying; Loros, Jennifer J.
2015-01-01
In the Neurospora circadian system, the White Collar complex (WCC) of WC-1 and WC-2 drives transcription of the circadian pacemaker gene frequency (frq), whose gene product, FRQ, as a part of the FRQ-FRH complex (FFC), inhibits its own expression. The WCC is also the principal Neurospora photoreceptor; WCC-mediated light induction of frq resets the clock, and all acute light induction is triggered by WCC binding to promoters of light-induced genes. However, not all acutely light-induced genes are also clock regulated, and conversely, not all clock-regulated direct targets of WCC are light induced; the structural determinants governing the shift from WCC's dark circadian role to its light activation role are poorly described. We report that the DBD region (named for being defective in binding DNA), a basic region in WC-1 proximal to the DNA-binding zinc finger (ZnF) whose function was previously ascribed to nuclear localization, instead plays multiple essential roles assisting in DNA binding and mediating interactions with the FFC. DNA binding for light induction by the WCC requires only WC-2, whereas DNA binding for circadian functions requires WC-2 as well as the ZnF and DBD motif of WC-1. The data suggest a means by which alterations in the tertiary and quaternary structures of the WCC can lead to its distinct functions in the dark and in the light. PMID:26711258
Taniguchi, Rei; Fukushima, Hidefumi; Osawa, Kenji; Maruyama, Toshimasa; Yasuda, Hisataka; Weih, Falk; Doi, Takahiro; Maki, Kenshi; Jimi, Eijiro
2014-03-14
The alternative nuclear factor-κB (NF-κB) pathway, mainly the RelB-p52 heterodimer, plays important roles in bone metabolism through an unknown mechanism. We have previously reported that alymphoplasia (aly/aly) mice, which lack active NF-κB-inducing kinase (NIK), show mild osteopetrosis due to the inhibition of osteoclastogenesis. p100 retains RelB in the cytoplasm and inhibits RANKL-induced osteoclastogenesis in aly/aly cells. Furthermore, the overexpression of RelB in aly/aly cells rescues RANKL-induced osteoclastogenesis by inducing p100 processing. In contrast, the overexpression of p65 in aly/aly cells has no effect. However, the overexpression of RelB fails to rescue RANKL-induced osteoclastogenesis in the presence of p100ΔGRR, which cannot be processed to p52, suggesting that p100 processing is a key step in RelB-rescued, RANKL-induced osteoclastogenesis in aly/aly cells. In this study, Cot (cancer Osaka thyroid), an MAP3K, was up-regulated by RelB overexpression. Analysis of the Cot promoter demonstrated that p65 and RelB bound to the distal NF-κB-binding site and that RelB but not p65 bound to the proximal NF-κB-binding site in the Cot promoter. The knocking down of Cot expression significantly reduced the RANKL-induced osteoclastogenesis induced by RelB overexpression. The phosphorylation of IKKα at threonine 23 and its kinase activity were indispensable for the processing of p100 and osteoclastogenesis by RelB-induced Cot. Finally, constitutively activated Akt enhanced osteoclastogenesis by RelB-induced Cot, and a dominant-negative form of Akt significantly inhibited it. Taken together, these results indicate that the overexpression of RelB restores RANKL-induced osteoclastogenesis by activation of Akt/Cot/IKKα-induced p100 processing.
Taniguchi, Rei; Fukushima, Hidefumi; Osawa, Kenji; Maruyama, Toshimasa; Yasuda, Hisataka; Weih, Falk; Doi, Takahiro; Maki, Kenshi; Jimi, Eijiro
2014-01-01
The alternative nuclear factor-κB (NF-κB) pathway, mainly the RelB-p52 heterodimer, plays important roles in bone metabolism through an unknown mechanism. We have previously reported that alymphoplasia (aly/aly) mice, which lack active NF-κB-inducing kinase (NIK), show mild osteopetrosis due to the inhibition of osteoclastogenesis. p100 retains RelB in the cytoplasm and inhibits RANKL-induced osteoclastogenesis in aly/aly cells. Furthermore, the overexpression of RelB in aly/aly cells rescues RANKL-induced osteoclastogenesis by inducing p100 processing. In contrast, the overexpression of p65 in aly/aly cells has no effect. However, the overexpression of RelB fails to rescue RANKL-induced osteoclastogenesis in the presence of p100ΔGRR, which cannot be processed to p52, suggesting that p100 processing is a key step in RelB-rescued, RANKL-induced osteoclastogenesis in aly/aly cells. In this study, Cot (cancer Osaka thyroid), an MAP3K, was up-regulated by RelB overexpression. Analysis of the Cot promoter demonstrated that p65 and RelB bound to the distal NF-κB-binding site and that RelB but not p65 bound to the proximal NF-κB-binding site in the Cot promoter. The knocking down of Cot expression significantly reduced the RANKL-induced osteoclastogenesis induced by RelB overexpression. The phosphorylation of IKKα at threonine 23 and its kinase activity were indispensable for the processing of p100 and osteoclastogenesis by RelB-induced Cot. Finally, constitutively activated Akt enhanced osteoclastogenesis by RelB-induced Cot, and a dominant-negative form of Akt significantly inhibited it. Taken together, these results indicate that the overexpression of RelB restores RANKL-induced osteoclastogenesis by activation of Akt/Cot/IKKα-induced p100 processing. PMID:24488495
Cheng, Chih-Fu; Pan, Tzu-Ming
2018-03-01
Alcoholic hepatitis is a necroinflammatory process that is associated with fibrosis and leads to cirrhosis in 40% of cases. The hepatoprotective effects of red mold dioscorea (RMD) from Monascus purpureus NTU 568 were evaluated in vivo using a mouse model of chronic alcohol-induced liver disease (ALD). ALD mice were orally administered vehicle (ALD group) or vehicle plus 307.5, 615.0 or 1537.5 mg kg -1 (1 ×, 2 × and 5 ×) RMD for 5 weeks. RMD lowered serum leptin, hepatic total cholesterol, free fatty acid and hepatic triglyceride levels and increased serum adiponectin, hepatic alcohol dehydrogenase and antioxidant enzyme levels. Furthermore, ankaflavin (AK) and monascin (MS), metabolites of RMD fermented with M. purpureus 568, induced peroxisome proliferator-activated receptor-γ expression and the concomitant suppression of ethanol-induced elevation of sterol regulatory element-binding transcription factor-1 and TG in HepG2 cells. These results indicate the hepatoprotective effect of Monascus-fermented RMD. Moreover, AK and MS were identified as the active constituents of RMD for the first time and were shown to protect against ethanol-induced liver damage. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Hoo, Ruby L. C.; Shu, Lingling; Cheng, Kenneth K. Y.; Wu, Xiaoping; Liao, Boya; Wu, Donghai; Zhou, Zhiguang; Xu, Aimin
2017-01-01
Lipotoxicity is implicated in the pathogenesis of obesity-related inflammatory complications by promoting macrophage infiltration and activation. Endoplasmic reticulum (ER) stress and adipocyte fatty acid binding protein (A-FABP) play key roles in obesity and mediate inflammatory activity through similar signaling pathways. However, little is known about their interplay in lipid-induced inflammatory responses. Here, we showed that prolonged treatment of palmitic acid (PA) increased ER stress and expression of A-FABP, which was accompanied by reduced autophagic flux in macrophages. Over-expression of A-FABP impaired PA-induced autophagy associating with enhanced ER stress and pro-inflammatory cytokine production, while genetic ablation or pharmacological inhibition of A-FABP reversed the conditions. PA-induced expression of autophagy-related protein (Atg)7 was attenuated in A-FABP over-expressed macrophages, but was elevated in A-FABP-deficient macrophages. Mechanistically, A-FABP potentiated the effects of PA by inhibition of Janus Kinase (JAK)2 activity, thus diminished PA-induced Atg7 expression contributing to impaired autophagy and further augmentation of ER stress. These findings suggest that A-FABP acts as autophagy inhibitor to instigate toxic lipids-induced ER stress through inhibition of JAK2-dependent autophagy, which in turn triggers inflammatory responses in macrophages. A-FABP-JAK2 axis may represent an important pathological pathway contributing to obesity-related inflammatory diseases. PMID:28094778
Design of Conditionally Active STATs: Insights into STAT Activation and Gene Regulatory Function
Milocco, Lawrence H.; Haslam, Jennifer A.; Rosen, Jonathan; Seidel, H. Martin
1999-01-01
The STAT (signal transducer and activator of transcription) signaling pathway is activated by a large number of cytokines and growth factors. We sought to design a conditionally active STAT that could not only provide insight into basic questions about STAT function but also serve as a powerful tool to determine the precise biological role of STATs. To this end, we have developed a conditionally active STAT by fusing STATs with the ligand-binding domain of the estrogen receptor (ER). We have demonstrated that the resulting STAT-ER chimeras are estrogen-inducible transcription factors that retain the functional and biochemical characteristics of the cognate wild-type STATs. In addition, these tools have allowed us to evaluate separately the contribution of tyrosine phosphorylation and dimerization to STAT function. We have for the first time provided experimental data supporting the model that the only apparent role of STAT tyrosine phosphorylation is to drive dimerization, as dimerization alone is sufficient to unmask a latent STAT nuclear localization sequence and induce nuclear translocation, sequence-specific DNA binding, and transcriptional activity. PMID:10082558
Neuronal activity-induced regulation of Lingo-1.
Trifunovski, Alexandra; Josephson, Anna; Ringman, Andreas; Brené, Stefan; Spenger, Christian; Olson, Lars
2004-10-25
Axonal regeneration after injury can be limited in the adult CNS by the presence of inhibitory proteins such as Nogo. Nogo binds to a receptor complex that consists of Nogo receptor (NgR), p75NTR, and Lingo-1. Nogo binding activates RhoA, which inhibits axonal outgrowth. Here we assessed Lingo-1 and NgR mRNA levels after delivery of BDNF into the rat hippocampal formation, Lingo-1 mRNA levels in rats subjected to kainic acid (KA) and running in running wheels. Lingo-1 mRNA was not changed by running. However, we found that Lingo-1 mRNA was strongly up-regulated while NgR mRNA was down-regulated in the dentate gyrus in both the BDNF and the KA experiments. Our data demonstrate inverse regulation of NgR and Lingo-1 in these situations, suggesting that Lingo-1 up-regulation is one characteristic of activity-induced neural plasticity responses.
Zurawski, S M; Imler, J L; Zurawski, G
1990-01-01
Some mouse interleukin-2 (mIL-2) proteins with substitutions at residue Gln141 are unable to trigger a maximal biological response. The Asp141 protein induces the lowest maximal response. The Asp141 protein can weakly antagonize the biological activity of mIL-2 and strongly antagonizes the biological activity of active mIL-2 mutant proteins that have defects in interactions with the high affinity receptor. Residue 141 mutant proteins bind with reduced affinity to T cells expressing the high affinity IL-2 receptor, yet bind normally to transfected fibroblasts expressing only the alpha and beta chains of the receptor. These results suggest that a third receptor component is important for both binding and signal transduction. PMID:2249656
Park, Min; Youn, ByungSoo; Zheng, Xi-long; Wu, Donghai; Xu, Aimin; Sweeney, Gary
2011-01-01
Cardiomyocyte apoptosis is an important remodeling event contributing to heart failure and adiponectin may mediate cardioprotective effects at least in part via attenuating apoptosis. Here we used hypoxia-reoxygenation (H/R) induced apoptosis in H9c2 cells to examine the effect of adiponectin and cellular mechanisms of action. We first used TUNEL labeling in combination with laser scanning cytometry to demonstrate that adiponectin prevented H/R-induced DNA fragmentation. The anti-apoptotic effect of adiponectin was also verified via attenuation of H/R-induced phosphatidylserine exposure using annexin V binding. H/R-induced apoptosis via the mitochondrial-mediated intrinsic pathway of apoptosis as assessed by cytochrome c release into cytosol and caspase-3 activation, both of which were attenuated by adiponectin. Mechanistically, we demonstrated that adiponectin enhanced anti-oxidative potential in these cells which led to attenuation of the increase in intracellular reactive oxygen species (ROS) caused by H/R. To further address the mechanism of adiponctins anti-apoptotic effects we used siRNA to efficiently knockdown adiponectin receptor (AdipoR1) expression and found that this attenuated the protective effects of adiponectin on ROS production and caspase 3 activity. Knockdown of APPL1, an important intracellular binding partner for AdipoR, also significantly reduced the ability of adiponectin to prevent H/R-induced ROS generation and caspase 3 activity. In summary, H/R-induced ROS generation and activation of the intrinsic apoptotic pathway was prevented by adiponectin via AdipoR1/APPL1 signaling and increased anti-oxidant potential. PMID:21552570
Lungu, Gina; Covaleda, Lina; Mendes, Odete; Martini-Stoica, Heidi; Stoica, George
2008-06-01
Matrix metalloproteinase-9 (MMP-9) plays a critical role in tumor invasion and metastasis. Here, we investigate the effect of fibroblast growth factor-1 (FGF-1) on the expression of MMP-9 in ENU1564, an ethyl-N-nitrosourea-induced rat mammary adenocarcinoma cell line. We observed that FGF-1 induces a dose-dependent increase in MMP-9 mRNA, protein, and activity in ENU1564 cells. To gain insight into the molecular mechanism of MMP-9 regulation by FGF-1, we investigated the role of components of PI3K-Akt and MEK1/2-ERK signaling pathways in our system since NF-kappaB and AP-1 transcription factor binding sites have been characterized in the upstream region of the MMP-9 gene. We demonstrated that FGF-1 increases Akt phosphorylation, triggers nuclear translocation of NF-kappaBp65, and enhances degradation of cytoplasmic IkappaBalpha. Pretreatment of cells with LY294002, a PI3K inhibitor, significantly inhibited MMP-9 protein expression in FGF-1-treated cells. Conversely, our data show that FGF-1 increases ERK phosphorylation in ENU1564 cells, increases c-jun and c-fos mRNA expression in a time-dependent manner, and triggers nuclear translocation of c-jun. Pretreatment of cells with PD98059, a MEK1/2 inhibitor significantly inhibited MMP-9 protein expression in FGF-1 treated cells. Finally, we observed increased DNA binding of NF-kappaB and AP-1 in FGF-1-treated cells and that mutation of either NF-kappaB or AP-1 response elements prevented MMP-9 promoter activation by FGF-1. Taken together, these results demonstrated that FGF-1-induced MMP-9 expression in ENU1564 cells is associated with increasing DNA binding activities of NF-kappaB and AP-1 and involve activation of a dual signaling pathway, PI3K-Akt and MEK1/2-ERK. (c) 2007 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Fangxing, E-mail: fxyang@zju.edu.cn; Zhuang, Shulin; Zhang, Chao
2013-06-15
Increasing environmental pollution by carcinogens such as some of persistent organic pollutants (POPs) has prompted growing interest in searching for chemopreventive compounds which are readily obtainable. Sulforaphane (SFN) is isolated from cruciferous vegetables and has the potentials to reduce carcinogenesis through various pathways. In this study, we studied the effects of SFN on CYP1A1 activity and genotoxicity induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The results showed that SFN inhibited TCDD-induced CYP1A1 activity in H4IIE cells by directly inhibiting CYP1A1 activity, probably through binding to aryl hydrocarbon receptor and/or CYP1A1 revealed by molecular docking. However, SFN promoted TCDD-induced DNA damage in yeast cellsmore » and reduced the viability of initiated yeast cells. Besides, it is surprising that SFN also failed to reduce genotoxicity induced by other genotoxic reagents which possess different mechanisms to lead to DNA damage. Currently, it is difficult to predict whether SFN has the potentials to reduce the risk of TCDD based on the conflicting observations in the study. Therefore, further studies should be urgent to reveal the function and mechanism of SFN in the stress of such POPs on human health. - Highlights: • Sulforaphane inhibited TCDD-induced CYP1A1 activity in H4IIE cells. • Sulforaphane may bind to aryl hydrocarbon receptor and/or CYP1A1. • Sulforaphane promoted TCDD-induced DNA damage in yeast cells. • Sulforaphane may promote DNA damage by DNA strand breaks or DNA alkylation.« less
Chemical Endoplasmic Reticulum Chaperone Alleviates Doxorubicin-Induced Cardiac Dysfunction.
Fu, Hai Ying; Sanada, Shoji; Matsuzaki, Takashi; Liao, Yulin; Okuda, Keiji; Yamato, Masaki; Tsuchida, Shota; Araki, Ryo; Asano, Yoshihiro; Asanuma, Hiroshi; Asakura, Masanori; French, Brent A; Sakata, Yasushi; Kitakaze, Masafumi; Minamino, Tetsuo
2016-03-04
Doxorubicin is an effective chemotherapeutic agent for cancer, but its use is often limited by cardiotoxicity. Doxorubicin causes endoplasmic reticulum (ER) dilation in cardiomyocytes, and we have demonstrated that ER stress plays important roles in the pathophysiology of heart failure. We evaluated the role of ER stress in doxorubicin-induced cardiotoxicity and examined whether the chemical ER chaperone could prevent doxorubicin-induced cardiac dysfunction. We confirmed that doxorubicin caused ER dilation in mouse hearts, indicating that doxorubicin may affect ER function. Doxorubicin activated an ER transmembrane stress sensor, activating transcription factor 6, in cultured cardiomyocytes and mouse hearts. However, doxorubicin suppressed the expression of genes downstream of activating transcription factor 6, including X-box binding protein 1. The decreased levels of X-box binding protein 1 resulted in a failure to induce the expression of the ER chaperone glucose-regulated protein 78 which plays a major role in adaptive responses to ER stress. In addition, doxorubicin activated caspase-12, an ER membrane-resident apoptotic molecule, which can lead to cardiomyocyte apoptosis and cardiac dysfunction. Cardiac-specific overexpression of glucose-regulated protein 78 by adeno-associated virus 9 or the administration of the chemical ER chaperone 4-phenylbutyrate attenuated caspase-12 cleavage, and alleviated cardiac apoptosis and dysfunction induced by doxorubicin. Doxorubicin activated the ER stress-initiated apoptotic response without inducing the ER chaperone glucose-regulated protein 78, further augmenting ER stress in mouse hearts. Cardiac-specific overexpression of glucose-regulated protein 78 or the administration of the chemical ER chaperone alleviated the cardiac dysfunction induced by doxorubicin and may facilitate the safe use of doxorubicin for cancer treatment. © 2016 American Heart Association, Inc.
Jung, Eunsun; Cho, Jae Youl; Park, Deokhoon; Kim, Min Hee; Park, Beomseok; Lee, Sang Yeol; Lee, Jongsung
2015-02-01
Skin aging appears to be principally attributed to a decrease in type I collagen level and the regeneration ability of dermal fibroblasts. We hypothesized that vegetable peptones promote cell proliferation and production of type I collagen in human dermal fibroblasts. Therefore, we investigated the effects of vegetable peptones on cell proliferation and type I collagen production and their possible mechanisms in human dermal fibroblasts. Vegetable peptones significantly promoted cell proliferation in a concentration-dependent manner. In addition, the human luciferase type I collagen α2 promoter and type I procollagen synthesis assays showed that the vegetable peptones induced type I procollagen production by activating the type I collagen α2 promoter. Moreover, the vegetable peptones activated p90 ribosomal s6 kinase, which was mediated by activating the Raf-p44/42 mitogen-activated protein kinase signaling pathway. Furthermore, the vegetable peptone-induced increase in cell proliferation and type I collagen production decreased upon treatment with the ERK inhibitor PD98059. Taken together, these findings suggest that increased proliferation of human dermal fibroblasts and enhanced production of type I collagen by vegetable peptones occur primarily by inducing the p90 ribosomal s6 kinase-CCAAT/enhancer binding protein β phosphorylation pathway, which is mediated by activating Raf-ERK signaling. Copyright © 2015 Elsevier Inc. All rights reserved.
Jocks, T; Freudenberg, J; Zahner, G; Stahl, R A
1998-01-01
These studies were designed to determine the possible role of platelet-activating factor (PAF) in the production of monocyte chemoattractant protein-1 (MCP-1) in glomerular immune injury. The glomerular lesion was induced in isolated perfused rat kidneys by a rabbit anti-rat-thymocyte serum (ATS) and rat serum (RS) as a complement source. Perfusion of kidneys with ATS and RS results in the selective binding of the antiserum to the glomerular mesangium with consecutive intraglomerular activation of complement. Antibody binding and complement activation induced a significant increase in glomerular MCP-1 mRNA levels when assessed by Northern blotting or RT-PCR. Decomplemented RS or non antibody rabbit IgG had only moderate effects on glomerular MCP-1 mRNA levels. The PAF receptor antagonist WEB 2170 almost completely blocked the ATS and RS induced MCP-1 mRNA levels. Perfusion of control kidneys with PAF increased MCP-1 mRNA expression, an effect which was blocked by WEB 2170. Glomerular MCP-1 protein formation, assessed by Western blotting, was stimulated following ATS and RS and PAF, respectively, was blocked by WEB 2170. These data show that PAF, derived from glomerular resident cells following antibody and complement induced injury, stimulates MCP-1 expression. In addition to the direct effects on leukocyte adhesion and activation PAF may mediate inflammatory cell influx in glomerular injuries due to the release of MCP-1.
Relationship between natural and heme-mediated antibody polyreactivity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadzhieva, Maya; Vassilev, Tchavdar; Bayry, Jagadeesh
Polyreactive antibodies represent a considerable fraction of the immune repertoires. Some antibodies acquire polyreactivity post-translationally after interaction with various redox-active substances, including heme. Recently we have demonstrated that heme binding to a naturally polyreactive antibody (SPE7) results in a considerable broadening of the repertoire of recognized antigens. A question remains whether the presence of certain level of natural polyreactivity of antibodies is a prerequisite for heme-induced further extension of antigen binding potential. Here we used a second monoclonal antibody (Hg32) with unknown specificity and absence of intrinsic polyreactivity as a model to study the potential of heme to induce polyreactivitymore » of antibodies. We demonstrated that exposure to heme greatly extends the antigen binding potential of Hg32, suggesting that the intrinsic binding promiscuity is not a prerequisite for the induction of polyreactivity by heme. In addition we compared the kinetics and thermodynamics of the interaction of heme-exposed antibodies with a panel of unrelated antigens. These analyses revealed that the two heme-sensitive antibodies adopt different mechanisms of binding to the same set of antigens. This study contributes to understanding the phenomenon of induced antibody polyreactivity. The data may also be of importance for understanding of physiological and pathological roles of polyreactive antibodies. - Highlights: • Exposure of certain monoclonal IgE antibodies to heme results in gain of antigen binding polyreactivity. • Natural polyreactivity of antibodies is dispensable for acquisition of polyreactivity through interaction with heme. • Heme-induced monoclonal IgE antibodies differ in their thermodynamic mechanisms of antigen recognition.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava
Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less
Thyer, Lynda; Ward, Emma; Smith, Rodney; Fiore, Maria Giulia; Magherini, Stefano; Branca, Jacopo J V; Morucci, Gabriele; Gulisano, Massimo; Ruggiero, Marco; Pacini, Stefania
2013-07-08
The role of vitamin D in maintaining health appears greater than originally thought, and the concept of the vitamin D axis underlines the complexity of the biological events controlled by biologically active vitamin D (1,25(OH)(2)D3), its two binding proteins that are the vitamin D receptor (VDR) and the vitamin D-binding protein-derived macrophage activating factor (GcMAF). In this study we demonstrate that GcMAF stimulates macrophages, which in turn attack human breast cancer cells, induce their apoptosis and eventually phagocytize them. These results are consistent with the observation that macrophages infiltrated implanted tumors in mice after GcMAF injections. In addition, we hypothesize that the last 23 hydrophobic amino acids of VDR, located at the inner part of the plasma membrane, interact with the first 23 hydrophobic amino acids of the GcMAF located at the external part of the plasma membrane. This allows 1,25(OH)(2)D3 and oleic acid to become sandwiched between the two vitamin D-binding proteins, thus postulating a novel molecular mode of interaction between GcMAF and VDR. Taken together, these results support and reinforce the hypothesis that GcMAF has multiple biological activities that could be responsible for its anti-cancer effects, possibly through molecular interaction with the VDR that in turn is responsible for a multitude of non-genomic as well as genomic effects.
Two novel GPER agonists induce gene expression changes and growth effects in cancer cells.
Lappano, R; Rosano, C; Santolla, M F; Pupo, M; De Francesco, E M; De Marco, P; Ponassi, M; Spallarossa, A; Ranise, A; Maggiolini, M
2012-06-01
Although the action of estrogens has been traditionally explained by the binding to and transactivation of the nuclear estrogen receptor (ER)α and ERβ, recently the G protein-coupled receptor GPR30/GPER has been involved in the rapid estrogen signaling. We investigated the ability of two original molecules, which were named GPER-L1 and GPERL2, to bind to and activate the GPER transduction pathway in cancer cells. Competition assays, docking simulations, transfection experiments, real-time PCR, immunoblotting, gene silencing technology and growth assays were performed to ascertain the selective action of GPER-L1 and GPER-L2 in activating the GPER-mediated signaling. Both compounds, which did not show any ability to bind to and activate the classical ERs, were able to bind to GPER and to trigger the rapid activation of the GPER/EGFR/ERK transduction pathway which led to the up-regulation of GPER-target genes. Notably, GPER-L1 and GPER-L2 induced the proliferation of SkBr3 breast and Ishikawa endometrial cancer cells at nM concentrations through GPER, hence providing further evidence on their capability to elicit relevant biological responses mediated by GPER. The identification and characterization of these novel compounds as selective GPER agonists represent a valuable tool to further dissect the pharmacology of this novel estrogen receptor and to better differentiate the specific functions elicited by each estrogen receptor subtype in cancer cells.
Schiro, Michelle M.; Stauber, Sara E.; Peterson, Tami L.; Krueger, Chateen; Darnell, Steven J.; Satyshur, Kenneth A.; Drinkwater, Norman R.; Newton, Michael A.; Hoffmann, F. Michael
2011-01-01
Background Hub proteins are connected through binding interactions to many other proteins. Smad3, a mediator of signal transduction induced by transforming growth factor beta (TGF-β), serves as a hub protein for over 50 protein-protein interactions. Different cellular responses mediated by Smad3 are the product of cell-type and context dependent Smad3-nucleated protein complexes acting in concert. Our hypothesis is that perturbation of this spectrum of protein complexes by mutation of single protein-binding hot-spots on Smad3 will have distinct consequences on Smad3-mediated responses. Methodology/Principal Findings We mutated 28 amino acids on the surface of the Smad3 MH2 domain and identified 22 Smad3 variants with reduced binding to subsets of 17 Smad3-binding proteins including Smad4, SARA, Ski, Smurf2 and SIP1. Mutations defective in binding to Smad4, e.g., D408H, or defective in nucleocytoplasmic shuttling, e.g., W406A, were compromised in modulating the expression levels of a Smad3-dependent reporter gene or six endogenous Smad3-responsive genes: Mmp9, IL11, Tnfaip6, Fermt1, Olfm2 and Wnt11. However, the Smad3 mutants Y226A, Y297A, W326A, K341A, and E267A had distinct differences on TGF-β signaling. For example, K341A and Y226A both reduced the Smad3-mediated activation of the reporter gene by ∼50% but K341A only reduced the TGF-β inducibilty of Olfm2 in contrast to Y226A which reduced the TGF-β inducibility of all six endogenous genes as severely as the W406A mutation. E267A had increased protein binding but reduced TGF-β inducibility because it caused higher basal levels of expression. Y297A had increased TGF-β inducibility because it caused lower Smad3-induced basal levels of gene expression. Conclusions/Significance Mutations in protein binding hot-spots on Smad3 reduced the binding to different subsets of interacting proteins and caused a range of quantitative changes in the expression of genes induced by Smad3. This approach should be useful for unraveling which Smad3 protein complexes are critical for specific biological responses. PMID:21949838
Schiro, Michelle M; Stauber, Sara E; Peterson, Tami L; Krueger, Chateen; Darnell, Steven J; Satyshur, Kenneth A; Drinkwater, Norman R; Newton, Michael A; Hoffmann, F Michael
2011-01-01
Hub proteins are connected through binding interactions to many other proteins. Smad3, a mediator of signal transduction induced by transforming growth factor beta (TGF-β), serves as a hub protein for over 50 protein-protein interactions. Different cellular responses mediated by Smad3 are the product of cell-type and context dependent Smad3-nucleated protein complexes acting in concert. Our hypothesis is that perturbation of this spectrum of protein complexes by mutation of single protein-binding hot-spots on Smad3 will have distinct consequences on Smad3-mediated responses. We mutated 28 amino acids on the surface of the Smad3 MH2 domain and identified 22 Smad3 variants with reduced binding to subsets of 17 Smad3-binding proteins including Smad4, SARA, Ski, Smurf2 and SIP1. Mutations defective in binding to Smad4, e.g., D408H, or defective in nucleocytoplasmic shuttling, e.g., W406A, were compromised in modulating the expression levels of a Smad3-dependent reporter gene or six endogenous Smad3-responsive genes: Mmp9, IL11, Tnfaip6, Fermt1, Olfm2 and Wnt11. However, the Smad3 mutants Y226A, Y297A, W326A, K341A, and E267A had distinct differences on TGF-β signaling. For example, K341A and Y226A both reduced the Smad3-mediated activation of the reporter gene by ∼50% but K341A only reduced the TGF-β inducibilty of Olfm2 in contrast to Y226A which reduced the TGF-β inducibility of all six endogenous genes as severely as the W406A mutation. E267A had increased protein binding but reduced TGF-β inducibility because it caused higher basal levels of expression. Y297A had increased TGF-β inducibility because it caused lower Smad3-induced basal levels of gene expression. Mutations in protein binding hot-spots on Smad3 reduced the binding to different subsets of interacting proteins and caused a range of quantitative changes in the expression of genes induced by Smad3. This approach should be useful for unraveling which Smad3 protein complexes are critical for specific biological responses.
Lan, Hongxiang; Teeter, Martha M; Gurevich, Vsevolod V; Neve, Kim A
2009-01-01
Dopamine D(2) and D(3) receptors are similar subtypes with distinct interactions with arrestins; the D(3) receptor mediates less agonist-induced translocation of arrestins than the D(2) receptor. The goals of this study were to compare nonphosphorylated arrestin-binding determinants in the second intracellular domain (IC2) of the D(2) and D(3) receptors to identify residues that contribute to the differential binding of arrestin to the subtypes. Arrestin 3 bound to glutathione transferase (GST) fusion proteins of the D(2) receptor IC2 more avidly than to the D(3) receptor IC2. Mutagenesis of the fusion proteins identified a residue at the C terminus of IC2, Lys149, that was important for the preferential binding of arrestin 3 to D(2)-IC2; arrestin binding to D(2)-IC2-K149C was greatly decreased compared with wild-type D(2)-IC2, whereas binding to the reciprocal mutant D(3)-IC2-C147K was enhanced compared with wild-type D(3)-IC2. Mutating this lysine in the full-length D(2) receptor to cysteine decreased the ability of the D(2) receptor to mediate agonist-induced arrestin 3 translocation to the membrane and decreased agonist-induced receptor internalization in human embryonic kidney 293 cells. The reciprocal mutation in the D(3) receptor increased receptor-mediated translocation of arrestin 3 without affecting agonist-induced receptor internalization. G protein-coupled receptor crystal structures suggest that Lys149, at the junction of IC2 and the fourth membrane-spanning helix, has intramolecular interactions that contribute to maintaining an inactive receptor state. It is suggested that the preferential agonist-induced binding of arrestin3 to the D(2) receptor over the D(3) receptor is due in part to Lys149, which could be exposed as a result of receptor activation.
Saeki, Ayumi; Suzuki, Toshihiko; Hasebe, Akira; Kamezaki, Ryousuke; Fujita, Mari; Nakazawa, Futoshi; Shibata, Ken-Ichiro
2017-03-01
Streptococcus sanguinis is frequently isolated from the blood of patients with infective endocarditis and contributes to the pathology of this disease through induction of interleukin (IL)-1β responsible for the development of the disease. However, the mechanism of IL-1β induction remains unknown. In this study, S. sanguinis activated a murine dendritic cell (DC) to induce IL-1β and this activity was attenuated by silencing the mRNAs of nucleotide-binding domain-like receptor containing protein 3 (NLRP3) and caspase-1. S. sanguinis induced IL-1β production in murine bone marrow-derived macrophage, but this activity was significantly reduced in bone marrow-derived macrophages from NLRP3-, apoptosis-associated speck-like protein containing a caspase-recruitment domain-, and caspase-1-deficient mice. DC phagocytosed S. sanguinis cells, followed by the release of adenosine triphosphate (ATP). The ATP-degradating enzyme attenuated the release of ATP and IL-1β. The inhibitors for ATP receptor reduced IL-1β release in DC. These results strongly suggest that S. sanguinis has the activity to induce IL-1β through the NLRP3 inflammasome in macrophage and DC and interaction of purinergic receptors with ATP released is involved in expression of the activity. © 2016 John Wiley & Sons Ltd.
Liu, J; Burdette, J E; Sun, Y; Deng, S; Schlecht, S M; Zheng, W; Nikolic, D; Mahady, G; van Breemen, R B; Fong, H H S; Pezzuto, J M; Bolton, J L; Farnsworth, N R
2004-01-01
A methanol extract of chaste-tree berry (Vitex agnus-castus L.) was tested for its ability to displace radiolabeled estradiol from the binding site of estrogen receptors alpha (ERalpha) and beta (ERbeta). The extract at 46 +/- 3 microg/ml displaced 50% of estradiol from ERalpha and 64 +/- 4 microg/ml from ERbeta. Treatment of the ER+ hormone-dependent T47D:A18 breast cancer cell line with the extract induced up-regulation of ERbeta mRNA. Progesterone receptor (PR) mRNA was upregulated in the Ishikawa endometrial cancer cell line. However, chaste-tree berry extract did not induce estrogen-dependent alkaline phosphatase (AP) activity in Ishikawa cells. Bioassay-guided isolation, utilizing ER binding as a monitor, resulted in the isolation of linoleic acid as one possible estrogenic component of the extract. The use of pulsed ultrafiltration liquid chromatography-mass spectrometry, which is an affinity-based screening technique, also identified linoleic acid as an ER ligand based on its selective affinity, molecular weight, and retention time. Linoleic acid also stimulated mRNA ERbeta expression in T47D:A18 cells, PR expression in Ishikawa cells, but not AP activity in Ishikawa cells. These data suggest that linoleic acid from the fruits of Vitex agnus-castus can bind to estrogen receptors and induce certain estrogen inducible genes.
Permatasari, Galuh W; Utomo, Didik H; Widodo
2016-10-01
A designing peptide as agent for inducing diabetes mellitus type 2 (T2DM) in an animal model is challenging. The computational approach provides a sophisticated tool to design a functional peptide that may block the insulin receptor activity. The peptide that able to inhibit the binding between insulin and insulin receptor is a warrant for inducing T2DM. Therefore, we designed a potential peptide inhibitor of insulin receptor as an agent to generate T2DM animal model by bioinformatics approach. The peptide has been developed based on the structure of insulin receptor binding site of insulin and then modified it to obtain the best properties of half life, hydrophobicity, antigenicity, and stability binding into insulin receptor. The results showed that the modified peptide has characteristics 100h half-life, high-affinity -95.1±20, and high stability 28.17 in complex with the insulin receptor. Moreover, the modified peptide has molecular weight 4420.8g/Mol and has no antigenic regions. Based on the molecular dynamic simulation, the complex of modified peptide-insulin receptor is more stable than the commercial insulin receptor blocker. This study suggested that the modified peptide has the promising performance to block the insulin receptor activity that potentially induce diabetes mellitus type 2 in mice. Copyright © 2016 Elsevier Ltd. All rights reserved.
Tell, G; Perrone, L; Fabbro, D; Pellizzari, L; Pucillo, C; De Felice, M; Acquaviva, R; Formisano, S; Damante, G
1998-01-01
The thyroid transcription factor 1 (TTF-1) is a tissue-specific transcription factor involved in the development of thyroid and lung. TTF-1 contains two transcriptional activation domains (N and C domain). The primary amino acid sequence of the N domain does not show any typical characteristic of known transcriptional activation domains. In aqueous solution the N domain exists in a random-coil conformation. The increase of the milieu hydrophobicity, by the addition of trifluoroethanol, induces a considerable gain of alpha-helical structure. Acidic transcriptional activation domains are largely unstructured in solution, but, under hydrophobic conditions, folding into alpha-helices or beta-strands can be induced. Therefore our data indicate that the inducibility of alpha-helix by hydrophobic conditions is a property not restricted to acidic domains. Co-transfections experiments indicate that the acidic domain of herpes simplex virus protein VP16 (VP16) and the TTF-1 N domain are interchangeable and that a chimaeric protein, which combines VP16 linked to the DNA-binding domain of TTF-1, undergoes the same regulatory constraints that operate for the wild-type TTF-1. In addition, we demonstrate that the TTF-1 N domain possesses two typical properties of acidic activation domains: TBP (TATA-binding protein) binding and ability to activate transcription in yeast. Accordingly, the TTF-1 N domain is able to squelch the activity of the p65 acidic domain. Altogether, these structural and functional data suggest that a non-acidic transcriptional activation domain (TTF-1 N domain) activates transcription by using molecular mechanisms similar to those used by acidic domains. TTF-1 N domain and acidic domains define a family of proteins whose common property is to activate transcription through the use of mechanisms largely conserved during evolutionary development. PMID:9425125
Wu, Ying-Ying; Hsu, Ching-Mei; Chen, Pei-Hsuan; Fung, Chang-Phone
2014-01-01
Prior antibiotic exposure is associated with increased mortality in Gram-negative bacteria-induced sepsis. However, how antibiotic-mediated changes of commensal bacteria promote the spread of enteric pathogenic bacteria in patients remains unclear. In this study, the effects of systemic antibiotic treatment with or without Toll-like receptor (TLR) stimulation on bacterium-killing activity, antibacterial protein expression in the intestinal mucosa, and bacterial translocation were examined in mice receiving antibiotics with or without oral supplementation of dead Escherichia coli or Staphylococcus aureus. We developed a systemic ampicillin, vancomycin, and metronidazole treatment protocol to simulate the clinical use of antibiotics. Antibiotic treatment decreased the total number of bacteria, including aerobic bacteria belonging to the family Enterobacteriaceae and the genus Enterococcus as well as organisms of the anaerobic genera Lactococcus and Bifidobacterium in the intestinal mucosa and lumen. Antibiotic treatment significantly decreased the bacterium-killing activity of the intestinal mucosa and the expression of non-defensin-family proteins, such as RegIIIβ, RegIIIγ, C-reactive protein-ductin, and RELMβ, but not the defensin-family proteins, and increased Klebsiella pneumoniae translocation. TLR stimulation after antibiotic treatment increased NF-κB DNA binding activity, nondefensin protein expression, and bacterium-killing activity in the intestinal mucosa and decreased K. pneumoniae translocation. Moreover, germfree mice showed a significant decrease in nondefensin proteins as well as intestinal defense against pathogen translocation. Since TLR stimulation induced NF-κB DNA binding activity, TLR4 expression, and mucosal bacterium-killing activity in germfree mice, we conclude that the commensal microflora is critical in maintaining intestinal nondefensin protein expression and the intestinal barrier. In turn, we suggest that TLR stimulation induces nondefensin protein expression and reverses antibiotic-induced gut defense impairment. PMID:24595141
Wu, Ying-Ying; Hsu, Ching-Mei; Chen, Pei-Hsuan; Fung, Chang-Phone; Chen, Lee-Wei
2014-05-01
Prior antibiotic exposure is associated with increased mortality in Gram-negative bacteria-induced sepsis. However, how antibiotic-mediated changes of commensal bacteria promote the spread of enteric pathogenic bacteria in patients remains unclear. In this study, the effects of systemic antibiotic treatment with or without Toll-like receptor (TLR) stimulation on bacterium-killing activity, antibacterial protein expression in the intestinal mucosa, and bacterial translocation were examined in mice receiving antibiotics with or without oral supplementation of dead Escherichia coli or Staphylococcus aureus. We developed a systemic ampicillin, vancomycin, and metronidazole treatment protocol to simulate the clinical use of antibiotics. Antibiotic treatment decreased the total number of bacteria, including aerobic bacteria belonging to the family Enterobacteriaceae and the genus Enterococcus as well as organisms of the anaerobic genera Lactococcus and Bifidobacterium in the intestinal mucosa and lumen. Antibiotic treatment significantly decreased the bacterium-killing activity of the intestinal mucosa and the expression of non-defensin-family proteins, such as RegIIIβ, RegIIIγ, C-reactive protein-ductin, and RELMβ, but not the defensin-family proteins, and increased Klebsiella pneumoniae translocation. TLR stimulation after antibiotic treatment increased NF-κB DNA binding activity, nondefensin protein expression, and bacterium-killing activity in the intestinal mucosa and decreased K. pneumoniae translocation. Moreover, germfree mice showed a significant decrease in nondefensin proteins as well as intestinal defense against pathogen translocation. Since TLR stimulation induced NF-κB DNA binding activity, TLR4 expression, and mucosal bacterium-killing activity in germfree mice, we conclude that the commensal microflora is critical in maintaining intestinal nondefensin protein expression and the intestinal barrier. In turn, we suggest that TLR stimulation induces nondefensin protein expression and reverses antibiotic-induced gut defense impairment.
Mitić, Natasa; Schwartz, Jennifer K; Brazeau, Brian J; Lipscomb, John D; Solomon, Edward I
2008-08-12
The multicomponent soluble form of methane monooxygenase (sMMO) catalyzes the oxidation of methane through the activation of O 2 at a nonheme biferrous center in the hydroxylase component, MMOH. Reactivity is limited without binding of the sMMO effector protein, MMOB. Past studies show that mutations of specific MMOB surface residues cause large changes in the rates of individual steps in the MMOH reaction cycle. To define the structural and mechanistic bases for these observations, CD, MCD, and VTVH MCD spectroscopies coupled with ligand-field (LF) calculations are used to elucidate changes occurring near and at the MMOH biferrous cluster upon binding of MMOB and the MMOB variants. Perturbations to both the CD and MCD are observed upon binding wild-type MMOB and the MMOB variant that similarly increases O 2 reactivity. MMOB variants that do not greatly increase O 2 reactivity fail to cause one or both of these changes. LF calculations indicate that reorientation of the terminal glutamate on Fe2 reproduces the spectral perturbations in MCD. Although this structural change allows O 2 to bridge the diiron site and shifts the redox active orbitals for good overlap, it is not sufficient for enhanced O 2 reactivity of the enzyme. Binding of the T111Y-MMOB variant to MMOH induces the MCD, but not CD changes, and causes only a small increase in reactivity. Thus, both the geometric rearrangement at Fe2 (observed in MCD) coupled with a more global conformational change that may control O 2 access (probed by CD), induced by MMOB binding, are critical factors in the reactivity of sMMO.
Asai, Saori; Kusada, Mio; Watanabe, Suzuyo; Kawashima, Takuji; Nakamura, Tadashi; Shimada, Masaya; Goto, Tsuyoshi; Nagaoka, Satoshi
2014-01-01
Royal jelly (RJ) intake lowers serum cholesterol levels in animals and humans, but the active component in RJ that lowers serum cholesterol level and its molecular mechanism are unclear. In this study, we set out to identify the bile acid-binding protein contained in RJ, because dietary bile acid-binding proteins including soybean protein and its peptide are effective in ameliorating hypercholesterolemia. Using a cholic acid-conjugated column, we separated some bile acid-binding proteins from RJ and identified the major RJ protein 1 (MRJP1), MRJP2, and MRJP3 as novel bile acid-binding proteins from RJ, based on matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Purified MRJP1, which is the most abundant protein of the bile acid-binding proteins in RJ, exhibited taurocholate-binding activity in vitro. The micellar solubility of cholesterol was significantly decreased in the presence of MRJP1 compared with casein in vitro. Liver bile acids levels were significantly increased, and cholesterol 7α-hydroxylase (CYP7A1) mRNA and protein tended to increase by MRJP1 feeding compared with the control. CYP7A1 mRNA and protein levels were significantly increased by MRJP1 tryptic hydrolysate treatment compared with that of casein tryptic hydrolysate in hepatocytes. MRJP1 hypocholesterolemic effect has been investigated in rats. The cholesterol-lowering action induced by MRJP1 occurs because MRJP1 interacts with bile acids induces a significant increase in fecal bile acids excretion and a tendency to increase in fecal cholesterol excretion and also enhances the hepatic cholesterol catabolism. We have identified, for the first time, a novel hypocholesterolemic protein, MRJP1, in RJ. Interestingly, MRJP1 exhibits greater hypocholesterolemic activity than the medicine β-sitosterol in rats. PMID:25144734
Influence of E. coli endotoxin on ACTH induced adrenal cell steroidogenesis.
Garcia, R; Viloria, M D; Municio, A M
1985-03-01
The effect of endotoxin (lipopolysaccharide from E. coli) on isolated adrenocortical cells was examined. Lipopolysaccharide decreased the ACTH-induced steroidogenesis. This effect was shown by all corticotropin concentrations studied, and the longer the incubation time, the higher the effect produced. The rate of decrease of ACTH-induced steroidogenesis was dependent on the concentration of lipopolysaccharide in the medium. Binding of [125I]ACTH to adrenocortical cells was modified by lipopolysaccharide; this modification was related to a decrease of the ACTH-induced steroidogenesis. This effect supports the hypothesis of a direct interaction between lipopolysaccharide and the cell membrane with a concomitant distortion of the cell surface affecting the ACTH receptor sites of their environment. [14C]Lipopolysaccharide binds to isolated adrenocortical cells. Binding specificity was investigated by competitive experiments in the presence of various types of endotoxins, polypeptide hormones and proteins. Unlabelled lipopolysaccharide from the same bacterial strain and isolated under identical conditions than the labelled lipopolysaccharide exerted the strongest inhibitory activity. Unlabelled lipopolysaccharide of various strains different from that originating the labelled lipopolysaccharide exerted the less displacement. It would imply a certain kind of specificity but the decrease in the binding of lipopolysaccharide produced by ACTH and glucagon suggests the existence of non-specific interactions between lipopolysaccharide and cell membrane.
EWS-FLI1 inhibits TNF{alpha}-induced NF{kappa}B-dependent transcription in Ewing sarcoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lagirand-Cantaloube, Julie, E-mail: julie.cantaloube@crbm.cnrs.fr; Laud, Karine, E-mail: karine.laud@curie.fr; Institut Curie, Genetique et biologie des cancers, Paris
2010-09-03
Research highlights: {yields} EWS-FLI1 interferes with TNF-induced activation of NF{kappa}B in Ewing sarcoma cells. {yields} EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NF{kappa}B binding to DNA. {yields} EWS-FLI1 reduces TNF-stimulated NF{kappa}B-dependent transcriptional activation. {yields} Constitutive NF{kappa}B activity is not affected by EWS-FLI1. {yields} EWS-FLI1 physically interacts with NF{kappa}B p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NF{kappa}B) is a tightly regulated transcription factor controllingmore » cell survival, proliferation and differentiation, as well as tumorigenesis. NF{kappa}B activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NF{kappa}B activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NF{kappa}B basal activity, but impairs TNF-induced NF{kappa}B-driven transcription, at least in part through inhibition of NF{kappa}B binding to DNA. We detected an in vivo physical interaction between the fusion protein and NF{kappa}B p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NF{kappa}B.« less
Activating PXR by Imperatorin Attenuates Dextran Sulphate Sodium-Induced Colitis in Mice.
Liu, Meijing; Zhang, Guohui; Zheng, Chunge; Song, Meng; Liu, Fangle; Huang, Xiaotao; Bai, Shasha; Huang, Xinan; Lin, Chaozhan; Zhu, Chenchen; Hu, Yingjie; Mi, Suiqing; Liu, Changhui
2018-06-26
The activation of human pregnane X receptor (PXR) has potential therapeutic uses for inflammatory bowel disease (IBD). Imperatorin (IMP), a naturally-occurring coumarin, is the main bioactive ingredient of Angelica dahurica Radix, which is regularly used to treat the common cold and intestinal disorders. However, there are no data on the protective effects of IMP against IBD. The effects of IMP on PXR-modulated cytochrome P450 3A4 (CYP3A4) expression were assessed using a PXR transactivation assay, a mammalian two-hybrid assay, a competitive ligand-binding assay, analysis of CYP3A4 mRNA and protein expression levels, and measurement of CYP3A4 activity using a cell-based reporter gene assay and in vitro model. The inhibitory effects of IMP on NF-κB activity was evaluated by a reporter assay and NF-κB p65 nuclear translocation. The anti-IBD effects of IMP were investigated in a dextran sulphate sodium (DSS)-induced colitis mouse model. Colon inflammatory cytokines were assessed by ELISA. IMP activated CYP3A4 promoter activity, recruited steroid receptor coactivator 1 (SRC-1) to the ligand-binding domain of PXR, and increased the expression and activity of CYP3A4. However, PXR knockdown substantially reduced PXR-mediated CYP3A4 expression. Furthermore, IMP-mediated PXR activation suppressed NF-κB nuclear translocation and downregulated lipopolysaccharide-induced proinflammatory gene expression. Nevertheless, PXR knockdown partially reduced the IMP-mediated inhibition of NF-κB. IMP ameliorated DSS-induced colitis by PXR/NF-κB signalling. IMP serves as a PXR agonist to attenuate DSS-induced colitis by the suppression of the NF-κB-mediated proinflammatory response in a PXR/NF-κB- dependent manner. This article is protected by copyright. All rights reserved.
NASA Astrophysics Data System (ADS)
Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai
1985-05-01
The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Chao-Feng
Purpose: Vascular smooth muscle cell (VSMC) proliferation plays a critical role in the pathogenesis of atherosclerosis and restenosis. This study investigated piperazinedione derived compound TW-01-mediated inhibitory effects on VSMC proliferation and intimal hyperplasia. Methods: Cell proliferation was determined using [{sup 3}H]-thymidine incorporation and MTT assay; cell cycle distribution was measured using flow cytometry; proteins and mRNA expression were determined using western blotting and RT-PCR analyses; DNA binding activity of nuclear factor-κB (NF-κB), as measured using enzyme-linked immunosorbent assays (ELISA); in vivo effects of TW-01 were determined using balloon angioplasty in the rat. Results: TW-01 significantly inhibited cell proliferation. At themore » concentrations used, no cytotoxic effects were observed. Three predominant signaling pathways were inhibited by TW-01: (a) extracellular signal-regulated kinase (ERK)1/2 mitogen-activated protein kinase (MAPK) activation and its downstream effectors of c-fos, c-jun, and c-myc; (b) DNA binding activity of nuclear factor-κB (NF-κB); and, (c) Akt/protein kinase B (PKB) and cell cycle progression. Furthermore, TW-01 also inhibited Ras activation, a shared upstream event of each of these signaling cascades. In vascular injury studies, oral administration of TW-01 significantly suppressed intimal hyperplasia induced by balloon angioplasty. Conclusion: The present study suggests that TW-01 might be a potential candidate for atherosclerosis treatment. - Highlights: • TW-01significantly inhibits vascular smooth muscle cell proliferation. • TW-01 inhibits ERK, Akt and Ras pathway and DNA binding activity of NF-κB. • TW-01 significantly suppresses intimal hyperplasia induced by balloon angioplasty. • TW-01 might be a potential candidate for atherosclerosis treatment.« less
Huang, Guiqiong; Huang, Xiaofang; Liu, Min; Hua, Yue; Deng, Bo; Jin, Wen; Yan, Wen; Tan, Zhangbin; Wu, Yifen; Liu, Bin; Zhou, Yingchun
2018-06-01
Myocardial cell apoptosis mediated by oxidative stress has previously been identified as a key process in ischemic heart disease. Secoisolariciresinol diglucoside (SDG), a polyphenolic plant lignan primarily found in flaxseed, has been demonstrated to effectively protect myocardial cells from apoptosis. In the present study, the role of the Janus kinase 2 (JAK2)/signal transducer and activator of transcription 3 (STAT3) was investigated in mediating the protective effect of SDG. Findings of the present study revealed that treatment with H2O2 reduced cell viability and induced apoptosis in H9C2 rat cardiomyocytes. However, SDG was able to reduce the effect of H2O2 in a dose‑dependent manner. H2O2 reduced the expression level of phosphorylated STAT3 and inhibited the levels of B‑cell lymphoma‑extra‑large and induced myeloid leukemia cell differentiation protein, which are the STAT3 target genes. Conversely, SDG rescued phosphorylation of STAT3 and increased the levels of STAT3 target genes. Treatment with SDG alone led to a dose‑dependent increased phosphorylation of JAK2 and STAT3, without activating Src. Furthermore, the anti‑apoptotic effects of SDG were partially abolished by a JAK2/STAT3 inhibitor. In addition, molecular docking revealed that SDG may bind to the protein kinase domain of JAK2, at a binding energy of ‑8.258 kcal/mol. Molecular dynamics simulations revealed that JAK2‑SDG binding was stable. In conclusion, activation of the JAK2/STAT3 signaling pathway contributed to the anti‑apoptotic activity of SDG, which may be a potential JAK2 activator.