Crystal structure of importin-α3 bound to the nuclear localization signal of Ran-binding protein 3.
Koyama, Masako; Matsuura, Yoshiyuki
2017-09-23
Ran-binding protein 3 (RanBP3) is a primarily nuclear Ran-binding protein that functions as an accessory factor in the Ran GTPase system. RanBP3 associates with Ran-specific nucleotide exchange factor RCC1 and enhances its catalytic activity towards Ran. RanBP3 also promotes CRM1-mediated nuclear export as well as CRM1-independent nuclear export of β-catenin, Smad2, and Smad3. Nuclear import of RanBP3 is dependent on the nuclear import adaptor protein importin-α and, RanBP3 is imported more efficiently by importin-α3 than by other members of the importin-α family. Protein kinase signaling pathways control nucleocytoplasmic transport through phosphorylation of RanBP3 at Ser58, immediately C-terminal to the nuclear localization signal (NLS) in the N-terminal region of RanBP3. Here we report the crystal structure of human importin-α3 bound to an N-terminal fragment of human RanBP3 containing the NLS sequence that is necessary and sufficient for nuclear import. The structure reveals that RanBP3 binds to importin-α3 residues that are strictly conserved in all seven isoforms of human importin-α at the major NLS-binding site, indicating that the region of importin-α outside the NLS-binding site, possibly the autoinhibotory importin-β1-binding domain, may be the key determinant for the preferential binding of RanBP3 to importin-α3. Computational docking simulation indicates that phosphorylation of RanBP3 at Ser58 could potentially stabilize the association of RanBP3 with importin-α through interactions between the phosphate moiety of phospho-Ser58 of RanBP3 and a cluster of basic residues (Arg96 and Lys97 in importin-α3) on armadillo repeat 1 of importin-α. Copyright © 2017 Elsevier Inc. All rights reserved.
Mahato, Sourav; De, Debojyoti; Dutta, Debajyoti; Kundu, Moloy; Bhattacharya, Sumana; Schiavone, Marc T; Bhattacharya, Sanjoy K
2004-01-01
Sugar binding proteins and binders of intermediate sugar metabolites derived from microbes are increasingly being used as reagents in new and expanding areas of biotechnology. The fixation of carbon dioxide at emission source has recently emerged as a technology with potentially significant implications for environmental biotechnology. Carbon dioxide is fixed onto a five carbon sugar D-ribulose-1,5-bisphosphate. We present a review of enzymatic and non-enzymatic binding proteins, for 3-phosphoglycerate (3PGA), 3-phosphoglyceraldehyde (3PGAL), dihydroxyacetone phosphate (DHAP), xylulose-5-phosphate (X5P) and ribulose-1,5-bisphosphate (RuBP) which could be potentially used in reactors regenerating RuBP from 3PGA. A series of reactors combined in a linear fashion has been previously shown to convert 3-PGA, (the product of fixed CO2 on RuBP as starting material) into RuBP (Bhattacharya et al., 2004; Bhattacharya, 2001). This was the basis for designing reactors harboring enzyme complexes/mixtures instead of linear combination of single-enzyme reactors for conversion of 3PGA into RuBP. Specific sugars in such enzyme-complex harboring reactors requires removal at key steps and fed to different reactors necessitating reversible sugar binders. In this review we present an account of existing microbial sugar binding proteins and their potential utility in these operations. PMID:15175111
The potential role of CacyBP/SIP in tumorigenesis.
Ning, Xiaoxuan; Chen, Yang; Wang, Xiaosu; Li, Qiaoneng; Sun, Shiren
2016-08-01
Calcyclin-binding protein/Siah-1-interacting protein (CacyBP/SIP) was initially described as a binding partner of S100A6 in the Ehrlich ascites tumor cells and later as a Siah-1-interacting protein. This 30 kDa protein includes three domains and is involved in cell proliferation, differentiation, cytoskeletal rearrangement, and transcriptional regulation via binding to various proteins. Studies have also shown that the CacyBP/SIP is a critical protein in tumorigenesis. But, its promotion or suppression of cancer progression may depend on the cell type. In this review, the biological characteristics and target proteins of CacyBP/SIP have been described. Moreover, the exact role of CacyBP/SIP in various cancers is discussed.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
How Cations Can Assist DNase I in DNA Binding and Hydrolysis
Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc
2010-01-01
DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947
Studies of the viral binding proteins of shrimp BP53, a receptor of white spot syndrome virus.
Li, Chen; Gao, Xiao-Xiao; Huang, Jie; Liang, Yan
2016-02-01
The specific binding between viral attachment proteins (VAPs) of a virus and its cellular receptors on host cells mediates virus entry into host cells, which triggers subsequent viral infections. Previous studies indicate that F1 ATP synthase β subunit (named BP53), is found on the surface of shrimp cells and involved in white spot syndrome virus (WSSV) infection by functioning as a potential viral receptor. Herein, in a far-western blotting assay, three WSSV proteins with molecular weights of 28 kDa, 37 kDa, and >50 kDa were found to interact with BP53. The 28 kDa and 37 kDa proteins were identified as the envelope protein VP28 and VP37 of WSSV respectively, which could be recognized by the polyclonal antibodies. Enzyme-linked immunosorbent binding assays revealed that VP37 contributed to almost 80% of the binding capability for BP53 compared with the same amount of total WSSV protein. The relationship between BP53 and its complementary interacting protein, VP37, was visualized using a co-localization assay. Bound VP37 on the cell surface co-localized with BP53 and shared a similar subcellular location on the outer surface of shrimp cells. Pearson's correlation coefficients reached to 0.67 ± 0.05 and the Mander's overlap coefficients reached 0.70 ± 0.05, which indicated a strong relationship between the localization of BP53 and bound rVP37. This provides evidence for an interaction between BP53 and VP37 obtained at the molecular and cellular levels, supporting the hypothesis that BP53 serves as a receptor for WSSV by binding to VP37. The identification of the viral binding proteins of shrimp BP53 is helpful for better understanding the pathogenic mechanisms of WSSV to infect shrimp at the cellular level. Copyright © 2016 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohan, S.; Bautista, C.M.; Wergedal, J.
1989-11-01
Inhibitory insulin-like growth factor binding protein (In-IGF-BP) has been purified to homogeneity from medium conditioned by TE89 human osteosarcoma cells by two different methods using Sephadex G-100 gel filtration, FPLC Mono Q ion-exchange, HPLC C{sub 4} reverse-phase, HPLC CN reverse-phase and affinity chromatographies. In-IGF-BP thus purified appeared to be homogeneous and unique by the following criteria. (i) N-terminal sequence analysis yielded a unique sequence (Asp-Glu-Ala-Ile-His-Cys-Pro-Pro-Glu-Ser-Glu-Ala-Lys-Leu-Ala). (ii) Amino acid composition of In-IGF-BP revealed marked differences with the amino acid compositions of other known PBs. (iii) In-IGF-BP exhibited a single band with molecular mass of 25 kDa under reducing conditions on sodiummore » dodecyl sulfate/polyacrylamide gels. IGF-I and IGF-II but not insulin displaced the binding of {sup 125}I-labeled IGF-I or {sup 125}I-labeled IGF-II binding to In-IGF-BP. In-IGF-BP inhibited basal, IGF-stimulated bone cell proliferation and serum-stimulated bone cell proliferation. Forskolin increases synthesis of In-IGF-BP in TE85 human osteosarcoma cells in a dose-dependent manner. Based on these findings, the authors conclude that In-IGF-BP is a protein that has a unique sequence and significant biological actions on bone cells.« less
A six-year longitudinal PET study of (+)-[11C]DTBZ binding to the VMAT2 in monkey brain.
Kilbourn, Michael R; Koeppe, Robert A
2017-12-01
The longitudinal reproducibility of in vivo binding potential measures for [ 11 C]dihydrotetrabenazine ([ 11 C]DTBZ) binding to the vesicular monoamine transporter 2 (VMAT2) site in primate brain was examined using a unique dataset of repeated control PET imaging studies. Forty-one dynamic [ 11 C]DTBZ PET studies were completed in a single rhesus monkey. Imaging equipment (microPET P4), personnel, radiotracer characteristics (injected mass amounts, molar activity) and image data analysis (BP ND-Logan ) were consistent throughout the entire sequence of PET studies. Same day reproducibility of BP ND-Logan estimates of specific binding was very good (-3% and -7% changes) for two control-control sessions. Over the full 74 months, the average BP ND-Logan value for [ 11 C]DTBZ-PET studies was 4.19±0.52, for a variance of 12%. No age-dependent change in binding potentials was observed over the six-year period. If the technical variables associated with PET scanner are consistently maintained, including PET scanner, imaging procedures and radiotracer preparation, in vivo biochemistry can be reproducibly measured in the primate brain over a multi-year period of time. Copyright © 2017 Elsevier Inc. All rights reserved.
Matsubara, Teruhiko; Otani, Ryohei; Yamashita, Miki; Maeno, Haruka; Nodono, Hanae; Sato, Toshinori
2017-02-13
Glycosphingolipids are major components of the membrane raft, and several kinds of viruses and bacterial toxins are known to bind to glycosphingolipids in the membrane raft. Since the viral genes and pathogenic proteins that are taken into cells are directly delivered to their target organelles, caveolae/raft-mediated endocytosis represents a promising pathway for specific delivery. In the present study, we demonstrated the ability of an artificial pentadecapeptide, which binds to ganglioside GM3, to deliver protein into cells by caveolae/raft-mediated endocytosis. The cellular uptake of a biotinylated GM3-binding peptide (GM3BP)-avidin complex into HeLa cells was observed, and the cellular uptake of this complex was inhibited by an incubation with sialic acid or endocytic inhibitors such as methyl-ß-cyclodextrin, and also by an incubation at 4 °C. These results indicate that the GM3BP-avidin complex bind to GM3 in membrane raft, and are taken into cell through caveolae/raft-mediated endocytosis. The GM3BP-avidin complex was transported into cells and localized around the nucleus more slowly than a human immunodeficiency virus type 1 TAT peptide. Furthermore, the uptake of a green fluorescent protein (GFP) linked with GM3BP into HeLa cells was similar to that of the GM3BP-avidin complex, and the localization of the GM3BP-GFP fusion protein was markedly different with that of the TAT-GFP fusion protein. The uptake and trafficking of GM3BP were distinguished from conventional cell-penetrating peptides. GM3BP has potential as a novel peptide for the selective delivery of therapeutic proteins and materials into cells in addition to being a cell-penetrating peptide.
Ketchesin, Kyle D.; Huang, Nicholas S.; Seasholtz, Audrey F.
2017-01-01
Corticotropin-releasing hormone-binding protein (CRH-BP) is a secreted glycoprotein that binds CRH with very high affinity to modulate CRH receptor activity. CRH-BP is widely expressed throughout the brain, with particularly high expression in regions such as the amygdala, hippocampus, ventral tegmental area and prefrontal cortex (PFC). Recent studies suggest a role for CRH-BP in stress-related psychiatric disorders and addiction, with the PFC being a potential site of interest. However, the molecular phenotype of CRH-BP-expressing cells in this region has not been well-characterized. In the current study, we sought to determine the cell type-specific expression of CRH-BP in the PFC to begin to define the neural circuits in which this key regulator is acting. To characterize the expression of CRH-BP in excitatory and/or inhibitory neurons, we utilized dual in situ hybridization to examine the cellular colocalization of CRH-BP mRNA with vesicular glutamate transporter (VGLUT) or glutamic acid decarboxylase (GAD) mRNA in different subregions of the PFC. We show that CRH-BP is expressed predominantly in GABAergic interneurons of the PFC, as revealed by the high degree of colocalization (>85%) between CRH-BP and GAD. To further characterize the expression of CRH-BP in this heterogenous group of inhibitory neurons, we examined the colocalization of CRH-BP with various molecular markers of GABAergic interneurons, including parvalbumin (PV), somatostatin (SST), vasoactive intestinal peptide (VIP) and cholecystokinin (CCK). We demonstrate that CRH-BP is colocalized predominantly with SST in the PFC, with lower levels of colocalization in PV- and CCK-expressing neurons. Our results provide a more comprehensive characterization of the cell type-specific expression of CRH-BP and begin to define its potential role within circuits of the PFC. These results will serve as the basis for future in vivo studies to manipulate CRH-BP in a cell type-specific manner to better understand its role in stress-related psychiatric disorders, including anxiety, depression and addiction. PMID:29066956
RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.
Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C
2015-09-23
Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.
TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability
Germann, Susanne M.; Schramke, Vera; Pedersen, Rune Troelsgaard; Gallina, Irene; Eckert-Boulet, Nadine; Oestergaard, Vibe H.
2014-01-01
DNA anaphase bridges are a potential source of genome instability that may lead to chromosome breakage or nondisjunction during mitosis. Two classes of anaphase bridges can be distinguished: DAPI-positive chromatin bridges and DAPI-negative ultrafine DNA bridges (UFBs). Here, we establish budding yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion of TopBP1/Dpb11 led to an accumulation of chromatin bridges. Importantly, the NoCut checkpoint that delays progression from anaphase to abscission in yeast was activated by both UFBs and chromatin bridges independently of Dpb11, and disruption of the NoCut checkpoint in Dpb11-depleted cells led to genome instability. In conclusion, we propose that TopBP1/Dpb11 prevents accumulation of anaphase bridges via stimulation of the Mec1/ATR kinase and suppression of homologous recombination. PMID:24379413
TopBP1/Dpb11 binds DNA anaphase bridges to prevent genome instability.
Germann, Susanne M; Schramke, Vera; Pedersen, Rune Troelsgaard; Gallina, Irene; Eckert-Boulet, Nadine; Oestergaard, Vibe H; Lisby, Michael
2014-01-06
DNA anaphase bridges are a potential source of genome instability that may lead to chromosome breakage or nondisjunction during mitosis. Two classes of anaphase bridges can be distinguished: DAPI-positive chromatin bridges and DAPI-negative ultrafine DNA bridges (UFBs). Here, we establish budding yeast Saccharomyces cerevisiae and the avian DT40 cell line as model systems for studying DNA anaphase bridges and show that TopBP1/Dpb11 plays an evolutionarily conserved role in their metabolism. Together with the single-stranded DNA binding protein RPA, TopBP1/Dpb11 binds to UFBs, and depletion of TopBP1/Dpb11 led to an accumulation of chromatin bridges. Importantly, the NoCut checkpoint that delays progression from anaphase to abscission in yeast was activated by both UFBs and chromatin bridges independently of Dpb11, and disruption of the NoCut checkpoint in Dpb11-depleted cells led to genome instability. In conclusion, we propose that TopBP1/Dpb11 prevents accumulation of anaphase bridges via stimulation of the Mec1/ATR kinase and suppression of homologous recombination.
Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun
2016-01-01
The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000
Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas
2011-01-01
Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716
NASA Astrophysics Data System (ADS)
Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka
2012-09-01
CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e
Villoutreix, B O; Härdig, Y; Wallqvist, A; Covell, D G; García de Frutos, P; Dahlbäck, B
1998-06-01
C4b-binding protein (C4BP) contributes to the regulation of the classical pathway of the complement system and plays an important role in blood coagulation. The main human C4BP isoform is composed of one beta-chain and seven alpha-chains essentially built from three and eight complement control protein (CCP) modules, respectively, followed by a nonrepeat carboxy-terminal region involved in polymerization of the chains. C4BP is known to interact with heparin, C4b, complement factor I, serum amyloid P component, streptococcal Arp and Sir proteins, and factor VIII/VIIIa via its alpha-chains and with protein S through its beta-chain. The principal aim of the present study was to localize regions of C4BP involved in the interaction with C4b, Arp, and heparin. For this purpose, a computer model of the 8 CCP modules of C4BP alpha-chain was constructed, taking into account data from previous electron microscopy (EM) studies. This structure was investigated in the context of known and/or new experimental data. Analysis of the alpha-chain model, together with monoclonal antibody studies and heparin binding experiments, suggests that a patch of positively charged residues, at the interface between the first and second CCP modules, plays an important role in the interaction between C4BP and C4b/Arp/Sir/heparin. Putative binding sites, secondary-structure prediction for the central core, and an overall reevaluation of the size of the C4BP molecule are also presented. An understanding of these intermolecular interactions should contribute to the rational design of potential therapeutic agents aiming at interfering specifically some of these protein-protein interactions.
Ito, Hiroshi; Yokoi, Takashi; Ikoma, Yoko; Shidahara, Miho; Seki, Chie; Naganawa, Mika; Takahashi, Hidehiko; Takano, Harumasa; Kimura, Yuichi; Ichise, Masanori; Suhara, Tetsuya
2010-01-01
In positron emission tomography (PET) studies with radioligands for neuroreceptors, tracer kinetics have been described by the standard two-tissue compartment model that includes the compartments of nondisplaceable binding and specific binding to receptors. In the present study, we have developed a new graphic plot analysis to determine the total distribution volume (V(T)) and nondisplaceable distribution volume (V(ND)) independently, and therefore the binding potential (BP(ND)). In this plot, Y(t) is the ratio of brain tissue activity to time-integrated arterial input function, and X(t) is the ratio of time-integrated brain tissue activity to time-integrated arterial input function. The x-intercept of linear regression of the plots for early phase represents V(ND), and the x-intercept of linear regression of the plots for delayed phase after the equilibrium time represents V(T). BP(ND) can be calculated by BP(ND)=V(T)/V(ND)-1. Dynamic PET scanning with measurement of arterial input function was performed on six healthy men after intravenous rapid bolus injection of [(11)C]FLB457. The plot yielded a curve in regions with specific binding while it yielded a straight line through all plot data in regions with no specific binding. V(ND), V(T), and BP(ND) values calculated by the present method were in good agreement with those by conventional non-linear least-squares fitting procedure. This method can be used to distinguish graphically whether the radioligand binding includes specific binding or not.
Thomsen, Dana; Lee, Chow H.
2014-01-01
Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3′UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862–3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862–3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions. PMID:24622399
King, Dustin T; Barnes, Mark; Thomsen, Dana; Lee, Chow H
2014-01-01
Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3'UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862-3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862-3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions.
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Wang, Yuchan; Liu, Fang; Mao, Feng; Hang, Qinlei; Huang, Xiaodong; He, Song; Wang, Yingying; Cheng, Chun; Wang, Huijie; Xu, Guangfei; Zhang, Tianyi; Shen, Aiguo
2013-01-01
CtBP2 has been demonstrated to possess tumor-promoting capacities by virtue of up-regulating epithelial-mesenchymal transition (EMT) and down-regulating apoptosis in cancer cells. As a result, cellular CtBP2 levels are considered a key factor determining the outcome of oncogenic transformation. How pro-tumorigenic and anti-tumorigenic factors compete for fine-tuning CtBP2 levels is incompletely understood. Here we report that the cyclin H/cyclin-dependent kinase 7 (CCNH/CDK7) complex interacted with CtBP2 in vivo and in vitro. Depletion of either CCNH or CDK7 decreased CtBP2 protein levels by accelerating proteasome-dependent CtBP2 clearance. Further analysis revealed that CCNH/CDK7 competed with the tumor repressor HIPK2 for CtBP2 binding and consequently inhibited phosphorylation and dimerization of CtBP2. Phosphorylation-defective CtBP2 interacted more strongly with CCNH/CDK7 and was more resistant to degradation. Finally, overexpression of CtBP2 increased whereas depletion of CtBP2 dampened the invasive and migratory potential of breast cancer cells. CtBP2 promoted the invasion and migration of breast cancer cells in a CCNH-dependent manner. Taken together, our data have delineated a novel pathway that regulates CtBP2 stability, suggesting that targeting the CCNH/CDK7-CtBP2 axis may yield a viable anti-tumor strategy. PMID:23393140
Stanczyk, Paulina J; Seidel, Monika; White, Judith; Viero, Cedric; George, Christopher H; Zissimopoulos, Spyros; Lai, F Anthony
2018-06-21
The cardiac muscle ryanodine receptor-Ca 2+ release channel (RyR2) constitutes the sarcoplasmic reticulum (SR) Ca 2+ efflux mechanism that initiates myocyte contraction, while cardiac myosin binding protein-C (cMyBP-C) mediates regulation of acto-myosin cross-bridge cycling. In this report, we provide the first evidence for the presence of direct interaction between these two proteins, forming a RyR2:cMyBP-C complex. The C-terminus of cMyBP-C binds with the RyR2 N-terminus in mammalian cells and is not mediated by a fibronectin-like domain. Notably, we detected complex formation between both recombinant cMyBP-C and RyR2, as well as with the native proteins in cardiac tissue. Cellular Ca 2+ dynamics in HEK293 cells is altered upon co-expression of cMyBP-C and RyR2, with lowered frequency of RyR2-mediated spontaneous Ca 2+ oscillations, suggesting cMyBP-C exerts a potential inhibitory effect on RyR2-dependent Ca 2+ release. Discovery of a functional RyR2 association with cMyBP-C provides direct evidence for a putative mechanistic link between cytosolic soluble cMyBP-C and SR-mediated Ca 2+ release, via RyR2. Importantly, this interaction may have clinical relevance to the observed cMyBP-C and RyR2 dysfunction in cardiac pathologies, such as hypertrophic cardiomyopathy. © 2018. Published by The Company of Biologists Ltd.
van Dijk, Sabine J; Kooiker, Kristina B; Napierski, Nathaniel C; Touma, Katia D; Mazzalupo, Stacy; Harris, Samantha P
2018-06-01
Cardiac myosin binding protein-C (cMyBP-C) is an essential regulatory protein required for proper systolic contraction and diastolic relaxation. We previously showed that N'-terminal domains of cMyBP-C stimulate contraction by binding to actin and activating the thin filament in vitro. In principle, thin filament activating effects of cMyBP-C could influence contraction and relaxation rates, or augment force amplitude in vivo. cMyBP-C binding to actin could also contribute to an internal load that slows muscle shortening velocity as previously hypothesized. However, the functional significance of cMyBP-C binding to actin has not yet been established in vivo. We previously identified an actin binding site in the regulatory M-domain of cMyBP-C and described two missense mutations that either increased (L348P) or decreased (E330K) binding affinity of recombinant cMyBP-C N'-terminal domains for actin in vitro. Here we created transgenic mice with either the L348P or E330K mutations to determine the functional significance of cMyBP-C binding to actin in vivo. Results showed that enhanced binding of cMyBP-C to actin in L348P-Tg mice prolonged the time to end-systole and slowed relaxation rates. Reduced interactions between cMyBP-C and actin in E330K-Tg mice had the opposite effect and significantly shortened the duration of ejection. Neither mouse model displayed overt systolic dysfunction, but L348P-Tg mice showed diastolic dysfunction presumably resulting from delayed relaxation. We conclude that cMyBP-C binding to actin contributes to sustained thin filament activation at the end of systole and during isovolumetric relaxation. These results provide the first functional evidence that cMyBP-C interactions with actin influence cardiac function in vivo. Copyright © 2018 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Avendaño-Estrada, A.; Lara-Camacho, V. M.; Ávila-García, M. C.; Ávila-Rodríguez, M. A.
2014-11-01
There is great interest in the study of dopamine (DA) pathways due to the increasing number of patients with illnesses related to the dopaminergic system and molecular imaging based in Positron Emission Tomography (PET) has been proven helpful for this task. Among the different radiopharmaceuticals available to study DA interaction, [11C ]Dihydrotetrabenazine (DTBZ) has a high affinity for the vesicular monoamine transporter type 2 (VMAT2) and its binding potential (BP) is a marker of DA terminal integrity. This paper reports on the intersubject reproducibility of BP measurements in rat striatum with [11C]DTBZ using the Logańs method.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Avendaño-Estrada, A., E-mail: avilarod@uwalumni.com; Lara-Camacho, V. M., E-mail: avilarod@uwalumni.com; Ávila-García, M. C., E-mail: avilarod@uwalumni.com
2014-11-07
There is great interest in the study of dopamine (DA) pathways due to the increasing number of patients with illnesses related to the dopaminergic system and molecular imaging based in Positron Emission Tomography (PET) has been proven helpful for this task. Among the different radiopharmaceuticals available to study DA interaction, [{sup 11}C]Dihydrotetrabenazine (DTBZ) has a high affinity for the vesicular monoamine transporter type 2 (VMAT2) and its binding potential (BP) is a marker of DA terminal integrity. This paper reports on the intersubject reproducibility of BP measurements in rat striatum with [11C]DTBZ using the Logańs method.
Mattsson, Patrik; Forsberg, Anton; Persson, Jonas; Nyberg, Lars; Nilsson, Lars-Göran; Halldin, Christer; Farde, Lars
2015-09-01
Cognitive decline has been suggested as an early marker for later onset of Alzheimer's disease. We therefore explored the relationship between decline in episodic memory and β-amyloid using positron emission tomography (PET) and [(11)C]AZD2184, a radioligand with potential to detect low levels of amyloid deposits. Healthy elderly subjects with declining (n = 10) or stable (n = 10) episodic memory over 15 years were recruited from the population-based Betula study and examined with PET. Brain radioactivity was measured after intravenous administration of [(11)C]AZD2184. The binding potential BP ND was calculated using linear graphical analysis with the cerebellum as reference region. The binding of [(11)C]AZD2184 in total grey matter was generally low in the declining group, whereas some binding could be observed in the stable group. Mean BP ND was significantly higher in the stable group compared to the declining group (p = 0.019). An observation was that the three subjects with the highest BP ND were ApoE ε4 allele carriers. We conclude that cognitive decline in the general population does not seem to stand by itself as an early predictor for amyloid deposits.
Nonaka, Motohiro; Ma, Bruce Yong; Imaeda, Hirotsugu; Kawabe, Keiko; Kawasaki, Nobuko; Hodohara, Keiko; Kawasaki, Nana; Andoh, Akira; Fujiyama, Yoshihide; Kawasaki, Toshisuke
2011-01-01
Dendritic cell (DC)-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) is a type II transmembrane C-type lectin expressed on DCs such as myeloid DCs and monocyte-derived DCs (MoDCs). Recently, we have reported that DC-SIGN interacts with carcinoembryonic antigen (CEA) expressed on colorectal carcinoma cells. CEA is one of the most widely used tumor markers for gastrointestinal cancers such as colorectal cancer. On the other hand, other groups have reported that the level of Mac-2-binding protein (Mac-2BP) increases in patients with pancreatic, breast, and lung cancers, virus infections such as human immunodeficiency virus and hepatitis C virus, and autoimmune diseases. Here, we first identified Mac-2BP expressed on several colorectal carcinoma cell lines as a novel DC-SIGN ligand through affinity chromatography and mass spectrometry. Interestingly, we found that DC-SIGN selectively recognizes Mac-2BP derived from some colorectal carcinomas but not from the other ones. Furthermore, we found that the α1-3,4-fucose moieties of Le glycans expressed on DC-SIGN-binding Mac-2BP were important for recognition. DC-SIGN-dependent cellular interactions between immature MoDCs and colorectal carcinoma cells significantly inhibited MoDC functional maturation, suggesting that Mac-2BP may provide a tolerogenic microenvironment for colorectal carcinoma cells through DC-SIGN-dependent recognition. Importantly, Mac-2BP was detected as a predominant DC-SIGN ligand expressed on some primary colorectal cancer tissues from certain parts of patients in comparison with CEA from other parts, suggesting that DC-SIGN-binding Mac-2BP bearing tumor-associated Le glycans may become a novel potential colorectal cancer biomarker for some patients instead of CEA. PMID:21515679
Deane, R; Schäfer, W; Zimmermann, H P; Mueller, L; Görlich, D; Prehn, S; Ponstingl, H; Bischoff, F R
1997-01-01
We report the identification and characterization of a novel 124-kDa Ran binding protein, RanBP5. This protein is related to importin-beta, the key mediator of nuclear localization signal (NLS)-dependent nuclear transport. RanBP5 was identified by two independent methods: it was isolated from HeLa cells by using its interaction with RanGTP in an overlay assay to monitor enrichment, and it was also found by the yeast two-hybrid selection method with RanBP1 as bait. RanBP5 binds to RanBP1 as part of a trimeric RanBP1-Ran-RanBP5 complex. Like importin-beta, RanBP5 strongly binds the GTP-bound form of Ran, stabilizing it against both intrinsic and RanGAP1-induced GTP hydrolysis and also against nucleotide exchange. The GAP resistance of the RanBP5-RanGTP complex can be relieved by RanBP1, which might reflect an in vivo role for RanBP1. RanBP5 is a predominantly cytoplasmic protein that can bind to nuclear pore complexes. We propose that RanBP5 is a mediator of a nucleocytoplasmic transport pathway that is distinct from the importin-alpha-dependent import of proteins with a classical NLS. PMID:9271386
Milak, Matthew S; Pantazatos, Spiro; Rashid, Rain; Zanderigo, Francesca; DeLorenzo, Christine; Hesselgrave, Natalie; Ogden, R Todd; Oquendo, Maria A; Mulhern, Stephanie T; Miller, Jeffrey M; Burke, Ainsley K; Parsey, Ramin V; Mann, J John
2018-04-13
Higher serotonin-1A (5-HT 1A ) receptor binding potential (BP F ) has been found in major depressive disorder (MDD) during and between major depressive episodes. We investigated whether higher 5-HT 1A binding is a biologic trait transmitted to healthy high risk (HR) offspring of MDD probands. Data were collected contemporaneously from: nine HR, 30 depressed not-recently medicated (NRM) MDD, 18 remitted NRM MDD, 51 healthy volunteer (HV) subjects. Subjects underwent positron emission tomography (PET) using [ 11 C]WAY100635 to quantify 5-HT 1A BP F , estimated using metabolite, free fraction-corrected arterial input function and cerebellar white matter as reference region. Multivoxel pattern analyses (MVPA) of PET data evaluated group status classification of individuals. When tested across 13 regions of interest, an effect of diagnosis is found on BP F which remains significant after correction for sex, age, injected mass and dose: HR have higher BP F than HV (84.3% higher in midbrain raphe, 40.8% higher in hippocampus, mean BP F across all 13 brain regions is 49.9% ± 11.8% higher). Voxel-level BP F maps distinguish HR vs. HV. Elevated 5-HT 1A BP F appears to be a familially transmitted trait abnormality. Future studies are needed to replicate this finding in a larger cohort and demonstrate the link to the familial transmission of mood disorders. Copyright © 2018 Elsevier B.V. All rights reserved.
Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Le Masurier, Clare; Gautel, Mathias; Pfuhl, Mark
2008-12-19
Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1-S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (K(d) of approximately 10-20 microM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1-S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1-C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation.
Ababou, Abdessamad; Rostkova, Elena; Mistry, Shreena; Masurier, Clare Le; Gautel, Mathias; Pfuhl, Mark
2008-01-01
Myosin binding protein C (MyBP-C) is a thick filament protein involved in the regulation of muscle contraction. Mutations in the gene for MyBP-C are the second most frequent cause of hypertrophic cardiomyopathy. MyBP-C binds to myosin with two binding sites, one at its C-terminus and another at its N-terminus. The N-terminal binding site, consisting of immunoglobulin domains C1 and C2 connected by a flexible linker, interacts with the S2 segment of myosin in a phosphorylation-regulated manner. It is assumed that the function of MyBP-C is to act as a tether that fixes the S1 heads in a resting position and that phosphorylation releases the S1 heads into an active state. Here, we report the structure and binding properties of domain C1. Using a combination of site-directed mutagenesis and NMR interaction experiments, we identified the binding site of domain C1 in the immediate vicinity of the S1–S2 hinge, very close to the light chains. In addition, we identified a zinc binding site on domain C1 in close proximity to the S2 binding site. Its zinc binding affinity (Kd of approximately 10–20 μM) might not be sufficient for a physiological effect. However, the familial hypertrophic cardiomyopathy-related mutation of one of the zinc ligands, glutamine 210 to histidine, will significantly increase the binding affinity, suggesting that this mutation may affect S2 binding. The close proximity of the C1 binding site to the hinge, the light chains and the S1 heads also provides an explanation for recent observations that (a) shorter fragments of MyBP-C unable to act as a tether still have an effect on the actomyosin ATPase and (b) as to why the myosin head positions in phosphorylated wild-type mice and MyBP-C knockout mice are so different: Domain C1 bound to the S1–S2 hinge is able to manipulate S1 head positions, thus influencing force generation without tether. The potentially extensive extra interactions of C1 are expected to keep it in place, while phosphorylation dislodges the C1–C2 linker and domain C2. As a result, the myosin heads would always be attached to a tether that has phosphorylation-dependent length regulation. PMID:18926831
Sumner, E T; Chawla, A T; Cororaton, A D; Koblinski, J E; Kovi, R C; Love, I M; Szomju, B B; Korwar, S; Ellis, K C; Grossman, S R
2017-08-17
Overexpression of the transcriptional coregulators C-terminal binding proteins 1 and 2 (CtBP1 and 2) occurs in many human solid tumors and is associated with poor prognosis. CtBP modulates oncogenic gene expression programs and is an emerging drug target, but its oncogenic role is unclear. Consistent with this oncogenic potential, exogenous CtBP2 transformed primary mouse and human cells to anchorage independence similarly to mutant H-Ras. To investigate CtBP's contribution to in vivo tumorigenesis, Apc min/+ mice, which succumb to massive intestinal polyposis, were bred to Ctbp2 +/- mice. CtBP interacts with adenomatous polyposis coli (APC) protein, and is stabilized in both APC-mutated human colon cancers and Apc min/+ intestinal polyps. Ctbp2 heterozygosity increased the median survival of Apc min/+ mice from 21 to 48 weeks, and reduced polyp formation by 90%, with Ctbp2 +/- polyps exhibiting reduced levels of β-catenin and its oncogenic transcriptional target, cyclin D1. CtBP's potential as a therapeutic target was studied by treating Apc min/+ mice with the CtBP small-molecule inhibitors 4-methylthio-2-oxobutyric acid and 2-hydroxy-imino phenylpyruvic acid, both of which reduced polyposis by more than half compared with vehicle treatment. Phenocopying Ctbp2 deletion, both Ctbp inhibitors caused substantial decreases in the protein level of Ctbp2, as well its oncogenic partner β-catenin, and the effects of the inhibitors on CtBP and β-catenin levels could be modeled in an APC-mutated human colon cancer cell line. CtBP2 is thus a druggable transforming oncoprotein critical for the evolution of neoplasia driven by Apc mutation.
Tao, Yiming; Hu, Kuan; Tan, Fengbo; Zhang, Sai; Zhou, Ming; Luo, Jia; Wang, Zhiming
2016-01-01
SH3-domain binding protein-1 (SH3BP1) specifically inactivating Rac1 and its target WAVE2 is required for cell motility. The present study shows SH3BP1 expression patterns in human HCC tissues and cell lines were examined. The regulation of SH3BP1 on HCC cell migration and invasion related to Rac1-WAVE2 signaling was characterized using in vitro and in vivo models. SH3BP1 overexpressed in HCC tissues and highly metastatic HCC cells was significantly associated vascular invasion (VI). SH3BP1 promoted VEGF secretion via Rac1-WAVE2 signaling, so as to exert an augmentation on cell invasion and microvessel formation. In three study cohorts with a total of 516 HCC patients, high SH3BP1 expression combined with high microvessel density (MVD) was confirmed as a powerful independent predictor of HCC prognosis in both training cohorts and validation cohort. Being an important angiogenic factor of HCC through Rac1-WAVE2 signaling, SH3BP1 promotes tumor invasion and microvessel formation contributing to HCC metastasis and recurrence. SH3BP1 is a novel WAVE2 regulator, a prognostic marker and a potential therapeutic target of HCC. PMID:26933917
Tao, Yiming; Hu, Kuan; Tan, Fengbo; Zhang, Sai; Zhou, Ming; Luo, Jia; Wang, Zhiming
2016-04-05
SH3-domain binding protein-1 (SH3BP1) specifically inactivating Rac1 and its target WAVE2 is required for cell motility. The present study shows SH3BP1 expression patterns in human HCC tissues and cell lines were examined. The regulation of SH3BP1 on HCC cell migration and invasion related to Rac1-WAVE2 signaling was characterized using in vitro and in vivo models. SH3BP1 overexpressed in HCC tissues and highly metastatic HCC cells was significantly associated vascular invasion (VI). SH3BP1 promoted VEGF secretion via Rac1-WAVE2 signaling, so as to exert an augmentation on cell invasion and microvessel formation. In three study cohorts with a total of 516 HCC patients, high SH3BP1 expression combined with high microvessel density (MVD) was confirmed as a powerful independent predictor of HCC prognosis in both training cohorts and validation cohort. Being an important angiogenic factor of HCC through Rac1-WAVE2 signaling, SH3BP1 promotes tumor invasion and microvessel formation contributing to HCC metastasis and recurrence. SH3BP1 is a novel WAVE2 regulator, a prognostic marker and a potential therapeutic target of HCC.
Determination of layer-dependent exciton binding energies in few-layer black phosphorus
Zhang, Guowei; Chaves, Andrey; Huang, Shenyang; Wang, Fanjie; Xing, Qiaoxia; Low, Tony; Yan, Hugen
2018-01-01
The attraction between electrons and holes in semiconductors forms excitons, which largely determine the optical properties of the hosting material, and hence the device performance, especially for low-dimensional systems. Mono- and few-layer black phosphorus (BP) are emerging two-dimensional (2D) semiconductors. Despite its fundamental importance and technological interest, experimental investigation of exciton physics has been rather limited. We report the first systematic measurement of exciton binding energies in ultrahigh-quality few-layer BP by infrared absorption spectroscopy, with layer (L) thickness ranging from 2 to 6 layers. Our experiments allow us to determine the exciton binding energy, decreasing from 213 meV (2L) to 106 meV (6L). The scaling behavior with layer numbers can be well described by an analytical model, which takes into account the nonlocal screening effect. Extrapolation to free-standing monolayer yields a large binding energy of ~800 meV. Our study provides insights into 2D excitons and their crossover from 2D to 3D, and demonstrates that few-layer BP is a promising high-quality optoelectronic material for potential infrared applications. PMID:29556530
Assembly of human C-terminal binding protein (CtBP) into tetramers.
Bellesis, Andrew G; Jecrois, Anne M; Hayes, Janelle A; Schiffer, Celia A; Royer, William E
2018-06-08
C-terminal binding protein 1 (CtBP1) and CtBP2 are transcriptional coregulators that repress numerous cellular processes, such as apoptosis, by binding transcription factors and recruiting chromatin-remodeling enzymes to gene promoters. The NAD(H)-linked oligomerization of human CtBP is coupled to its co-transcriptional activity, which is implicated in cancer progression. However, the biologically relevant level of CtBP assembly has not been firmly established; nor has the stereochemical arrangement of the subunits above that of a dimer. Here, multi-angle light scattering (MALS) data established the NAD + - and NADH-dependent assembly of CtBP1 and CtBP2 into tetramers. An examination of subunit interactions within CtBP1 and CtBP2 crystal lattices revealed that both share a very similar tetrameric arrangement resulting from assembly of two dimeric pairs, with specific interactions probably being sensitive to NAD(H) binding. Creating a series of mutants of both CtBP1 and CtBP2, we tested the hypothesis that the crystallographically observed interdimer pairing stabilizes the solution tetramer. MALS data confirmed that these mutants disrupt both CtBP1 and CtBP2 tetramers, with the dimer generally remaining intact, providing the first stereochemical models for tetrameric assemblies of CtBP1 and CtBP2. The crystal structure of a subtle destabilizing mutant suggested that small structural perturbations of the hinge region linking the substrate- and NAD-binding domains are sufficient to weaken the CtBP1 tetramer. These results strongly suggest that the tetramer is important in CtBP function, and the series of CtBP mutants reported here can be used to investigate the physiological role of the tetramer. © 2018 Bellesis et al.
NASA Astrophysics Data System (ADS)
Zhou, Zhigang; Li, Yumin
2009-10-01
As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.
Meng, Xiangzhi; Leman, Michael; Xiang, Yan
2007-01-01
Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683
Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas
2008-01-01
Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548
Peptide-functionalized iron oxide magnetic nanoparticle for gold mining
NASA Astrophysics Data System (ADS)
Shen, Wei-Zheng; Cetinel, Sibel; Sharma, Kumakshi; Borujeny, Elham Rafie; Montemagno, Carlo
2017-02-01
Here, we present our work on preparing a novel nanomaterial composed of inorganic binding peptides and magnetic nanoparticles for inorganic mining. Two previously selected and well-characterized gold-binding peptides from cell surface display, AuBP1 and AuBP2, were exploited. This nanomaterial (AuBP-MNP) was designed to fulfill the following two significant functions: the surface conjugated gold-binding peptide will recognize and selectively bind to gold, while the magnetic nano-sized core will respond and migrate according to the applied external magnetic field. This will allow the smart nanomaterial to mine an individual material (gold) from a pool of mixture, without excessive solvent extraction, filtration, and concentration steps. The working efficiency of AuBP-MNP was determined by showing a dramatic reduction of gold nanoparticle colloid concentration, monitored by spectroscopy. The binding kinetics of AuBP-MNP onto the gold surface was determined using surface plasmon resonance (SPR) spectroscopy, which exhibits around 100 times higher binding kinetics than peptides alone. The binding capacity of AuBP-MNP was demonstrated by a bench-top mining test with gold microparticles.
Arad, Shiri; Le, Phuong T.; Bustin, Michael; Rosen, Clifford J.; Gabet, Yankel
2015-01-01
Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3−/− mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography analysis showed that Hp1bp3−/− mice present a dramatic impairment of their bone development and structure. By 3 weeks of age, mice of both sexes have severely impaired cortical and trabecular bone, and these defects persist into adulthood and beyond. Primary cultures of both osteoblasts and osteoclasts from Hp1bp3−/− bone marrow and splenocytes, respectively, showed normal differentiation and function, strongly suggesting that the impaired bone accrual is due to noncell autonomous systemic cues in vivo. One major endocrine pathway regulating both body growth and bone acquisition is the IGF regulatory system, composed of IGF-1, the IGF receptors, and the IGF-binding proteins (IGFBPs). At 3 weeks of age, Hp1bp3−/− mice exhibited a 60% reduction in circulating IGF-1 and a 4-fold increase in the levels of IGFBP-1 and IGFBP-2. These alterations were reflected in similar changes in the hepatic transcripts of the Igf1, Igfbp1, and Igfbp2 genes. Collectively, these results suggest that HP1BP3 plays a key role in normal growth and bone development by regulating transcription of endocrine IGF-1 components. PMID:26402843
Garfinkel, Benjamin P; Arad, Shiri; Le, Phuong T; Bustin, Michael; Rosen, Clifford J; Gabet, Yankel; Orly, Joseph
2015-12-01
Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3(-/-) mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography analysis showed that Hp1bp3(-/-) mice present a dramatic impairment of their bone development and structure. By 3 weeks of age, mice of both sexes have severely impaired cortical and trabecular bone, and these defects persist into adulthood and beyond. Primary cultures of both osteoblasts and osteoclasts from Hp1bp3(-/-) bone marrow and splenocytes, respectively, showed normal differentiation and function, strongly suggesting that the impaired bone accrual is due to noncell autonomous systemic cues in vivo. One major endocrine pathway regulating both body growth and bone acquisition is the IGF regulatory system, composed of IGF-1, the IGF receptors, and the IGF-binding proteins (IGFBPs). At 3 weeks of age, Hp1bp3(-/-) mice exhibited a 60% reduction in circulating IGF-1 and a 4-fold increase in the levels of IGFBP-1 and IGFBP-2. These alterations were reflected in similar changes in the hepatic transcripts of the Igf1, Igfbp1, and Igfbp2 genes. Collectively, these results suggest that HP1BP3 plays a key role in normal growth and bone development by regulating transcription of endocrine IGF-1 components.
Manzini, Mariana C; Perez, Katia R; Riske, Karin A; Bozelli, José C; Santos, Talita L; da Silva, Marcia A; Saraiva, Greice K V; Politi, Mario J; Valente, Ana P; Almeida, Fábio C L; Chaimovich, Hernan; Rodrigues, Magali A; Bemquerer, Marcelo P; Schreier, Shirley; Cuccovia, Iolanda M
2014-07-01
The cecropin-melittin hybrid antimicrobial peptide BP100 (H-KKLFKKILKYL-NH2) is selective for Gram-negative bacteria, negatively charged membranes, and weakly hemolytic. We studied BP100 conformational and functional properties upon interaction with large unilamellar vesicles, LUVs, and giant unilamellar vesicles, GUVs, containing variable proportions of phosphatidylcholine (PC) and negatively charged phosphatidylglycerol (PG). CD and NMR spectra showed that upon binding to PG-containing LUVs BP100 acquires α-helical conformation, the helix spanning residues 3-11. Theoretical analyses indicated that the helix is amphipathic and surface-seeking. CD and dynamic light scattering data evinced peptide and/or vesicle aggregation, modulated by peptide:lipid ratio and PG content. BP100 decreased the absolute value of the zeta potential (ζ) of LUVs with low PG contents; for higher PG, binding was analyzed as an ion-exchange process. At high salt, BP100-induced LUVS leakage requires higher peptide concentration, indicating that both electrostatic and hydrophobic interactions contribute to peptide binding. While a gradual release took place at low peptide:lipid ratios, instantaneous loss occurred at high ratios, suggesting vesicle disruption. Optical microscopy of GUVs confirmed BP100-promoted disruption of negatively charged membranes. The mechanism of action of BP100 is determined by both peptide:lipid ratio and negatively charged lipid content. While gradual release results from membrane perturbation by a small number of peptide molecules giving rise to changes in acyl chain packing, lipid clustering (leading to membrane defects), and/or membrane thinning, membrane disruption results from a sequence of events - large-scale peptide and lipid clustering, giving rise to peptide-lipid patches that eventually would leave the membrane in a carpet-like mechanism. Copyright © 2014 Elsevier B.V. All rights reserved.
ALS mutant SOD1 interacts with G3BP1 and affects stress granule dynamics.
Gal, Jozsef; Kuang, Lisha; Barnett, Kelly R; Zhu, Brian Z; Shissler, Susannah C; Korotkov, Konstantin V; Hayward, Lawrence J; Kasarskis, Edward J; Zhu, Haining
2016-10-01
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. Mutations in Cu/Zn superoxide dismutase (SOD1) are responsible for approximately 20 % of the familial ALS cases. ALS-causing SOD1 mutants display a gain-of-toxicity phenotype, but the nature of this toxicity is still not fully understood. The Ras GTPase-activating protein-binding protein G3BP1 plays a critical role in stress granule dynamics. Alterations in the dynamics of stress granules have been reported in several other forms of ALS unrelated to SOD1. To our surprise, the mutant G93A SOD1 transgenic mice exhibited pathological cytoplasmic inclusions that co-localized with G3BP1-positive granules in spinal cord motor neurons. The co-localization was also observed in fibroblast cells derived from familial ALS patient carrying SOD1 mutation L144F. Mutant SOD1, unlike wild-type SOD1, interacted with G3BP1 in an RNA-independent manner. Moreover, the interaction is specific for G3BP1 since mutant SOD1 showed little interaction with four other RNA-binding proteins implicated in ALS. The RNA-binding RRM domain of G3BP1 and two particular phenylalanine residues (F380 and F382) are critical for this interaction. Mutant SOD1 delayed the formation of G3BP1- and TIA1-positive stress granules in response to hyperosmolar shock and arsenite treatment in N2A cells. In summary, the aberrant mutant SOD1-G3BP1 interaction affects stress granule dynamics, suggesting a potential link between pathogenic SOD1 mutations and RNA metabolism alterations in ALS.
Vanicek, Thomas; Kutzelnigg, Alexandra; Philippe, Cecile; Sigurdardottir, Helen L; James, Gregory M; Hahn, Andreas; Kranz, Georg S; Höflich, Anna; Kautzky, Alexander; Traub-Weidinger, Tatjana; Hacker, Marcus; Wadsak, Wolfgang; Mitterhauser, Markus; Kasper, Siegfried; Lanzenberger, Rupert
2017-02-01
Altered serotonergic neurotransmission has been found to cause impulsive and aggressive behavior, as well as increased motor activity, all exemplifying key symptoms of ADHD. The main objectives of this positron emission tomography (PET) study were to investigate the serotonin transporter binding potential (SERT BP ND ) in patients with ADHD and to assess associations of SERT BP ND between the brain regions. 25 medication-free patients with ADHD (age ± SD; 32.39 ± 10.15; 10 females) without any psychiatric comorbidity and 25 age and sex matched healthy control subjects (33.74 ± 10.20) were measured once with PET and the highly selective and specific radioligand [ 11 C]DASB. SERT BP ND maps in nine a priori defined ROIs exhibiting high SERT binding were compared between groups by means of a linear mixed model. Finally, adopted from structural and functional connectivity analyses, we performed correlational analyses using regional SERT binding potentials to examine molecular interregional associations between all selected ROIs. We observed significant differences in the interregional correlations between the precuneus and the hippocampus in patients with ADHD compared to healthy controls, using SERT BP ND of the investigated ROIs (P < 0.05; Bonferroni corrected). When correlating SERT BP ND and age in the ADHD and the healthy control group, we confirmed an age-related decline in brain SERT binding in the thalamus and insula (R 2 = 0.284, R 2 = 0.167, Ps < 0.05; Bonferroni corrected). The results show significantly different interregional molecular associations of the SERT expression for the precuneus with hippocampus in patients with ADHD, indicating presumably altered functional coupling. Altered interregional coupling between brain regions might be a sensitive approach to demonstrate functional and molecular alterations in psychiatric conditions. Hum Brain Mapp 38:792-802, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone
Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna
2016-01-01
The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023
The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch.
Oberst, Andrew; Malatesta, Martina; Aqeilan, Rami I; Rossi, Mario; Salomoni, Paolo; Murillas, Rodolfo; Sharma, Prashant; Kuehn, Michael R; Oren, Moshe; Croce, Carlo M; Bernassola, Francesca; Melino, Gerry
2007-07-03
Nedd4-binding partner-1 (N4BP1) has been identified as a protein interactor and a substrate of the homologous to E6AP C terminus (HECT) domain-containing E3 ubiquitin-protein ligase (E3), Nedd4. Here, we describe a previously unrecognized functional interaction between N4BP1 and Itch, a Nedd4 structurally related E3, which contains four WW domains, conferring substrate-binding activity. We show that N4BP1 association with the second WW domain (WW2) of Itch interferes with E3 binding to its substrates. In particular, we found that N4BP1 and p73 alpha, a target of Itch-mediated ubiquitin/proteasome proteolysis, share the same binding site. By competing with p73 alpha for binding to the WW2 domain, N4BP1 reduces the ability of Itch to recruit and ubiquitylate p73 alpha and inhibits Itch autoubiquitylation activity both in in vitro and in vivo ubiquitylation assays. Similarly, both c-Jun and p63 polyubiquitylation by Itch are inhibited by N4BP1. As a consequence, genetic and RNAi knockdown of N4BP1 diminish the steady-state protein levels and significantly impair the transcriptional activity of Itch substrates. Notably, stress-induced induction of c-Jun was impaired in N4BP1(-/-) cells. These results demonstrate that N4BP1 functions as a negative regulator of Itch. In addition, because inhibition of Itch by N4BP1 results in the stabilization of crucial cell death regulators such as p73 alpha and c-Jun, it is conceivable that N4BP1 may have a role in regulating tumor progression and the response of cancer cells to chemotherapy.
Shen, Rong; Liu, Hongliang; Wen, Juyi; Liu, Zhensheng; Wang, Li-E; Wang, Qiming; Tan, Dongfeng; Ajani, Jaffer A; Wei, Qingyi
2015-09-01
Thymidylate synthase (TYMS) plays a crucial role in folate metabolism as well as DNA synthesis and repair. We hypothesized that functional polymorphisms in the 3' UTR of TYMS are associated with gastric cancer risk and survival. In the present study, we tested our hypothesis by genotyping three potentially functional (at miRNA binding sites) TYMS SNPs (rs16430 6bp del/ins, rs2790 A>G and rs1059394 C>T) in 379 gastric cancer patients and 431 cancer-free controls. Compared with the rs16430 6bp/6bp + 6bp/0bp genotypes, the 0bp/0bp genotype was associated with significantly increased gastric cancer risk (adjusted OR = 1.72, 95% CI = 1.15-2.58). Similarly, rs2790 GG and rs1059394 TT genotypes were also associated with significantly increased risk (adjusted OR = 2.52, 95% CI = 1.25-5.10 and adjusted OR = 1.57, 95% CI = 1.04-2.35, respectively), compared with AA + AG and CC + CT genotypes, respectively. In the haplotype analysis, the T-G-0bp haplotype was associated with significantly increased gastric cancer risk, compared with the C-A-6bp haplotype (adjusted OR = 1.34, 95% CI = 1.05-1.72). Survival analysis revealed that rs16430 0bp/0bp and rs1059394 TT genotypes were also associated with poor survival in gastric cancer patients who received chemotherapy treatment (adjusted HR = 1.61, 95% CI = 1.05-2.48 and adjusted HR = 1.59, 95% CI = 1.02-2.48, respectively). These results suggest that these three variants in the miRNA binding sites of TYMS may be associated with cancer risk and survival of gastric cancer patients. Larger population studies are warranted to verify these findings. © 2014 Wiley Periodicals, Inc.
Kramer, B; Ferrari, D M; Klappa, P; Pöhlmann, N; Söling, H D
2001-01-01
The rat luminal endoplasmic-recticulum calcium-binding proteins 1 and 2 (CaBP1 and CaBP2 respectively) are members of the protein disulphide-isomerase (PDI) family. They contain two and three thioredoxin boxes (Cys-Gly-His-Cys) respectively and, like PDI, may be involved in the folding of nascent proteins. We demonstrate here that CaBP1, similar to PDI and CaBP2, can complement the lethal phenotype of the disrupted Saccharomyces cerevisiae PDI gene, provided that the natural C-terminal Lys-Asp-Glu-Leu sequence is replaced by His-Asp-Glu-Leu. Both the in vitro RNase AIII-re-activation assays and in vivo pro-(carboxypeptidase Y) processing assays using CaBP1 and CaBP2 thioredoxin (trx)-box mutants revealed that, whereas the three trx boxes in CaBP2 seem to be functionally equivalent, the first trx box of CaBP1 is significantly more active than the second trx box. Furthermore, only about 65% re-activation of denatured reduced RNase AIII could be obtained with CaBP1 or CaBP2 compared with PDI, and the yield of PDI-catalysed reactions was significantly reduced in the presence of either CaBP1 or CaBP2. In contrast with PDI, neither CaBP1 nor CaBP2 could catalyse the renaturation of denatured glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which is a redox-independent process, and neither protein had any effect on the PDI-catalysed refolding of GAPDH. Furthermore, although PDI can bind peptides via its b' domain, a property it shares with PDIp, the pancreas-specific PDI homologue, and although PDI can bind malfolded proteins such as 'scrambled' ribonuclease, no such interactions could be detected for CaBP2. We conclude that: (1) both CaBP2 and CaBP1 lack peptide-binding activity for GAPDH attributed to the C-terminal region of the a' domain of PDI; (2) CaBP2 lacks the general peptide-binding activity attributed to the b' domain of PDI; (3) interaction of CaBP2 with substrate (RNase AIII) is different from that of PDI and substrate; and (4) both CaBP2 and CaBP1 may promote oxidative folding by different kinetic pathways. PMID:11415439
Liu, Chunyun; Jia, Xiwei; Zou, Zhihua; Wang, Xiaowei; Wang, Yilei; Zhang, Ziping
2018-01-01
Vitellogenesis-inhibiting hormone (VIH) is known to regulate ovarian maturation by suppressing the synthesis of vitellogenin (Vtg) in crustaceans, which belongs to a member of crustacean hyperglycemic hormone (CHH) family synthesized and secreted from the X-organ/sinus gland complex of eyestalks. In this study, the cDNA, genomic DNA (gDNA) and the 5'-upstream regulatory (promoter region) sequences of VIH gene were obtained by conventional PCR, genome walker and tail-PCR techniques according to our transcriptomic database of Scylla paramamosain. The full-length cDNA of SpVIH is 634bp including 105bp 5'UTR, 151bp 3'UTR and 378bp ORF that encodes a peptide of 125 amino acids. The full length gDNA of SpVIH is 790bp containing two exons and one intron. The 5'-flanking promoter regions of SpVIH we isolated are 3070bp from the translation initiation (ATG) and 2398bp from the predicted transcription initiation (A), which consists of putative core promoter region and multiple potential transcription factor binding sites. SpVIH was only expressed in eyestalk. The expression level of SpVIH in eyestalk of female crab decreased gradually along with the development of ovary. As there is not cell line of crabs available, we chose the mature transfection system HEK293FT cell lines to explore the mechanism of transcription regulation of SpVIH in crabs. Sequential deletion assays using luciferase reporter gene in HEK293FT cells revealed that the possible promoter activity regions (including positive and negative transcription factors binding sites simultaneously) presented between pSpVIH-4 and pSpVIH-6. In order to further identify the crucial transcription factors binding site in this region, the site-directed mutagenesis of Sox9/Oct4/Oct1 binding site of pSpVIH-4 was created. The results demonstrated that the transcriptional activity of pSpVIH-4△ decreased significantly (p<0.05). Thus, it is reasonable to deduce that the Sox9/Oct4/Oct1 may be the essential positive transcription factors which regulate the expression of SpVIH. Copyright © 2017 Elsevier Inc. All rights reserved.
TIRR regulates 53BP1 by masking its histone methyl-lysine binding function.
Drané, Pascal; Brault, Marie-Eve; Cui, Gaofeng; Meghani, Khyati; Chaubey, Shweta; Detappe, Alexandre; Parnandi, Nishita; He, Yizhou; Zheng, Xiao-Feng; Botuyan, Maria Victoria; Kalousi, Alkmini; Yewdell, William T; Münch, Christian; Harper, J Wade; Chaudhuri, Jayanta; Soutoglou, Evi; Mer, Georges; Chowdhury, Dipanjan
2017-03-09
P53-binding protein 1 (53BP1) is a multi-functional double-strand break repair protein that is essential for class switch recombination in B lymphocytes and for sensitizing BRCA1-deficient tumours to poly-ADP-ribose polymerase-1 (PARP) inhibitors. Central to all 53BP1 activities is its recruitment to double-strand breaks via the interaction of the tandem Tudor domain with dimethylated lysine 20 of histone H4 (H4K20me2). Here we identify an uncharacterized protein, Tudor interacting repair regulator (TIRR), that directly binds the tandem Tudor domain and masks its H4K20me2 binding motif. Upon DNA damage, the protein kinase ataxia-telangiectasia mutated (ATM) phosphorylates 53BP1 and recruits RAP1-interacting factor 1 (RIF1) to dissociate the 53BP1-TIRR complex. However, overexpression of TIRR impedes 53BP1 function by blocking its localization to double-strand breaks. Depletion of TIRR destabilizes 53BP1 in the nuclear-soluble fraction and alters the double-strand break-induced protein complex centring 53BP1. These findings identify TIRR as a new factor that influences double-strand break repair using a unique mechanism of masking the histone methyl-lysine binding function of 53BP1.
Insight into the Role of Ca2+-Binding Protein 5 in Vesicle Exocytosis
Sokal, Izabela
2011-01-01
Purpose. CaBP5 is a neuronal calmodulin-like Ca2+-binding protein that is expressed in the retina and in the cochlea. Although CaBP5 knockout mice displayed reduced sensitivity of retinal ganglion cell light responses, the function of CaBP5 in vivo is still unknown. To gain further insight into CaBP5 function, the authors screened for CaBP5-interacting partners. Methods. Potential retinal interacting partners for CaBP5 were identified using affinity chromatography followed by mass spectrometry and by yeast two-hybrid screening of a bovine retina cDNA library. Interacting partners were further analyzed using coimmunoprecipitation. Immunohistochemistry and subcellular fractionation were performed to determine their colocalization in the retina. The effect of CaBP5 on dopamine release and neurite outgrowth of PC12 cells was analyzed using ELISA and fluorescent labeling. Results. Using affinity chromatography, the authors identified Munc18–1 and myosin VI as interacting partners for CaBP5. Munc18–1 was also identified using the yeast two-hybrid system. Colocalization and coimmunoprecipitation of CaBP5 with these two proteins in retinal tissue further established their physiological interactions. Furthermore, CaBP5 expression in NGF-stimulated PC12 cells stimulates neurite outgrowth and dopamine exocytosis. Conclusions. This study shows that CaBP5 interacts with Munc18–1 and myosin VI, two proteins involved in the synaptic vesicle cycle. Together with the effect of CaBP5 in stimulating neurite outgrowth and vesicle exocytosis in PC12 cells, these results suggest that CaBP5 plays a role in neurotransmitter release. PMID:22039235
Larsen, Svend Arild; Mogensen, Line; Dietz, Rune; Baagøe, Hans Jørgen; Andersen, Mogens; Werge, Thomas; Rasmussen, Henrik Berg
2005-12-01
In this study we have identified and characterized dopamine receptor D4 (DRD4) exon III tandem repeats in 33 public available nucleotide sequences from different mammalian species. We found that the tandem repeat in canids could be described in a novel and simple way, namely, as a structure composed of 15- and 12- bp modules. Tandem repeats composed of 18-bp modules were found in sequences from the horse, zebra, onager, and donkey, Asiatic bear, polar bear, common raccoon, dolphin, harbor porpoise, and domestic cat. Several of these sequences have been analyzed previously without a tandem repeat being found. In the domestic cow and gray seal we identified tandem repeats composed of 36-bp modules, each consisting of two closely related 18-bp basic units. A tandem repeat consisting of 9-bp modules was identified in sequences from mink and ferret. In the European otter we detected an 18-bp tandem repeat, while a tandem repeat consisting of 27-bp modules was identified in a sequence from European badger. Both these tandem repeats were composed of 9-bp basic units, which were closely related with the 9-bp repeat modules identified in the mink and ferret. Tandem repeats could not be identified in sequences from rodents. All tandem repeats possessed a high GC content with a strong bias for C. On phylogenetic analysis of the tandem repeats evolutionary related species were clustered into the same groups. The degree of conservation of the tandem repeats varied significantly between species. The deduced amino acid sequences of most of the tandem repeats exhibited a high propensity for disorder. This was also the case with an amino acid sequence of the human DRD4 exon III tandem repeat, which was included in the study for comparative purposes. We identified proline-containing motifs for SH3 and WW domain binding proteins, potential phosphorylation sites, PDZ domain binding motifs, and FHA domain binding motifs in the amino acid sequences of the tandem repeats. The numbers of potential functional sites varied pronouncedly between species. Our observations provide a platform for future studies of the architecture and evolution of the DRD4 exon III tandem repeat, and they suggest that differences in the structure of this tandem repeat contribute to specialization and generation of diversity in receptor function.
Slater, Paula G.; Gutierrez-Maldonado, Sebastian E.; Gysling, Katia; Lagos, Carlos F.
2018-01-01
The corticotropin-releasing factor (CRF) system is a key mediator of the stress response and addictive behavior. The CRF system includes four peptides: The CRF system includes four peptides: CRF, urocortins I–III, CRF binding protein (CRF-BP) that binds CRF with high affinity, and two class B G-protein coupled receptors CRF1R and CRF2R. CRF-BP is a secreted protein without significant sequence homology to CRF receptors or to any other known class of protein. Recently, it has been described a potentiation role of CRF-BP over CRF signaling through CRF2R in addictive-related neuronal plasticity and behavior. In addition, it has been described that CRF-BP is capable to physically interact specifically with the α isoform of CRF2R and acts like an escort protein increasing the amount of the receptor in the plasma membrane. At present, there are no available structures for CRF-BP or for full-length CRFR. Knowing and studying the structure of these proteins could be beneficial in order to characterize the CRF-BP/CRF2αR interaction. In this work, we report the modeling of CRF-BP and of full-length CRF2αR and CRF2βR based on the recently solved crystal structures of the transmembrane domains of the human glucagon receptor and human CRF1R, in addition with the resolved N-terminal extracellular domain of CRFRs. These models were further studied using molecular dynamics simulations and protein–protein docking. The results predicted a higher possibility of interaction of CRF-BP with CRF2αR than CRF2βR and yielded the possible residues conforming the interacting interface. Thus, the present study provides a framework for further investigation of the CRF-BP/CRF2αR interaction. PMID:29515519
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCormack, T.; Petrovich,; Mercier, K
2010-01-01
We identified a homologue of the molluscan acetylcholine-binding protein (AChBP) in the marine polychaete Capitella teleta, from the annelid phylum. The amino acid sequence of C. teleta AChBP (ct-AChBP) is 21-30% identical with those of known molluscan AChBPs. Sequence alignments indicate that ct-AChBP has a shortened Cys loop compared to other Cys loop receptors, and a variation on a conserved Cys loop triad, which is associated with ligand binding in other AChBPs and nicotinic ACh receptor (nAChR) {alpha} subunits. Within the D loop of ct-AChBP, a conserved aromatic residue (Tyr or Trp) in nAChRs and molluscan AChBPs, which has beenmore » implicated directly in ligand binding, is substituted with an isoleucine. Mass spectrometry results indicate that Asn122 and Asn216 of ct-AChBP are glycosylated when expressed using HEK293 cells. Small-angle X-ray scattering data suggest that the overall shape of ct-AChBP in the apo or unliganded state is similar to that of homologues with known pentameric crystal structures. NMR experiments show that acetylcholine, nicotine, and {alpha}-bungarotoxin bind to ct-AChBP with high affinity, with KD values of 28.7 {micro}M, 209 nM, and 110 nM, respectively. Choline bound with a lower affinity (K{sub D} = 163 {micro}M). Our finding of a functional AChBP in a marine annelid demonstrates that AChBPs may exhibit variations in hallmark motifs such as ligand-binding residues and Cys loop length and shows conclusively that this neurotransmitter binding protein is not limited to the phylum Mollusca.« less
Montanuy, Imma; Alejo, Ali; Alcami, Antonio
2011-01-01
Eradication of smallpox was accomplished 30 yr ago, but poxviral infections still represent a public health concern due to the potential release of variola virus or the emergence of zoonotic poxviruses, such as monkeypox virus. A critical determinant of poxvirus virulence is the inhibition of interferons (IFNs) by the virus-encoded type I IFN-binding protein (IFNα/βBP). This immunomodulatory protein is secreted and has the unique property of interacting with the cell surface in order to prevent IFN-mediated antiviral responses. However, the mechanism of its attachment to the cell surface remains unknown. Using surface plasmon resonance and cell-binding assays, we report that the IFNα/βBP from vaccinia virus, the smallpox vaccine, interacts with cell surface glycosaminoglycans (GAGs). Analysis of the contribution of different regions of the protein to cell surface binding demonstrated that clusters of basic residues in the first immunoglobulin domain mediate GAG interactions. Furthermore, mutation of the GAG-interaction motifs does not affect its IFN-binding and -blocking capacity. Functional conservation of GAG-binding sites is demonstrated for the IFNα/βBP from variola and monkeypox viruses, extending our understanding of immune modulation by the most virulent human poxviruses. These results are relevant for the design of improved vaccines and intervention strategies.—Montanuy, I., Alejo, A., Alcami, A. Glycosaminoglycans mediate retention of the poxvirus type I interferon binding protein at the cell surface to locally block interferon antiviral responses. PMID:21372110
Woodward, Neil D; Zald, David H; Ding, Zhaohua; Riccardi, Patrizia; Ansari, M Sib; Baldwin, Ronald M; Cowan, Ronald L; Li, Rui; Kessler, Robert M
2009-05-15
The relationship between cerebral morphology and the expression of dopamine receptors has not been extensively studied in humans. Elucidation of such relationships may have important methodological implications for clinical studies of dopamine receptor ligand binding differences between control and patient groups. The association between cerebral morphology and dopamine receptor distribution was examined in 45 healthy subjects who completed T1-weighted structural MRI and PET scanning with the D(2)/D(3) ligand [(18)F]fallypride. Optimized voxel-based morphometry was used to create grey matter volume and density images. Grey matter volume and density images were correlated with binding potential (BP(ND)) images on a voxel-by-voxel basis using the Biological Parametric Mapping toolbox. Associations between cerebral morphology and BP(ND) were also examined for selected regions-of-interest (ROIs) after spatial normalization. Voxel-wise analyses indicated that grey matter volume and density positively correlated with BP(ND) throughout the midbrain, including the substantia nigra. Positive correlations were observed in medial cortical areas, including anterior cingulate and medial prefrontal cortex, and circumscribed regions of the temporal, frontal, and parietal lobes. ROI analyses revealed significant positive correlations between BP(ND) and cerebral morphology in the caudate, thalamus, and amygdala. Few negative correlations between morphology and BP(ND) were observed. Overall, grey matter density appeared more strongly correlated with BP(ND) than grey matter volume. Cerebral morphology, particularly grey matter density, correlates with [(18)F]fallypride BP(ND) in a regionally specific manner. Clinical studies comparing dopamine receptor availability between clinical and control groups may benefit by accounting for potential differences in cerebral morphology that exist even after spatial normalization.
The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking
Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M.; Baehr, Wolfgang
2012-01-01
Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d−/− mouse. PMID:22960045
The Nedd4-binding partner 1 (N4BP1) protein is an inhibitor of the E3 ligase Itch
Oberst, Andrew; Malatesta, Martina; Aqeilan, Rami I.; Rossi, Mario; Salomoni, Paolo; Murillas, Rodolfo; Sharma, Prashant; Kuehn, Michael R.; Oren, Moshe; Croce, Carlo M.; Bernassola, Francesca; Melino, Gerry
2007-01-01
Nedd4-binding partner-1 (N4BP1) has been identified as a protein interactor and a substrate of the homologous to E6AP C terminus (HECT) domain-containing E3 ubiquitin–protein ligase (E3), Nedd4. Here, we describe a previously unrecognized functional interaction between N4BP1 and Itch, a Nedd4 structurally related E3, which contains four WW domains, conferring substrate-binding activity. We show that N4BP1 association with the second WW domain (WW2) of Itch interferes with E3 binding to its substrates. In particular, we found that N4BP1 and p73α, a target of Itch-mediated ubiquitin/proteasome proteolysis, share the same binding site. By competing with p73α for binding to the WW2 domain, N4BP1 reduces the ability of Itch to recruit and ubiquitylate p73α and inhibits Itch autoubiquitylation activity both in in vitro and in vivo ubiquitylation assays. Similarly, both c-Jun and p63 polyubiquitylation by Itch are inhibited by N4BP1. As a consequence, genetic and RNAi knockdown of N4BP1 diminish the steady-state protein levels and significantly impair the transcriptional activity of Itch substrates. Notably, stress-induced induction of c-Jun was impaired in N4BP1−/− cells. These results demonstrate that N4BP1 functions as a negative regulator of Itch. In addition, because inhibition of Itch by N4BP1 results in the stabilization of crucial cell death regulators such as p73α and c-Jun, it is conceivable that N4BP1 may have a role in regulating tumor progression and the response of cancer cells to chemotherapy. PMID:17592138
Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos; ...
2015-07-13
The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less
Ca2+-Binding Protein 1 Regulates Hippocampal-dependent Memory and Synaptic Plasticity.
Yang, Tian; Britt, Jeremiah K; Cintrón-Pérez, Coral J; Vázquez-Rosa, Edwin; Tobin, Kevin V; Stalker, Grant; Hardie, Jason; Taugher, Rebecca J; Wemmie, John; Pieper, Andrew A; Lee, Amy
2018-06-01
Ca 2+ -binding protein 1 (CaBP1) is a Ca 2+ -sensing protein similar to calmodulin that potently regulates voltage-gated Ca 2+ channels. Unlike calmodulin, however, CaBP1 is mainly expressed in neuronal cell-types and enriched in the hippocampus, where its function is unknown. Here, we investigated the role of CaBP1 in hippocampal-dependent behaviors using mice lacking expression of CaBP1 (C-KO). By western blot, the largest CaBP1 splice variant, caldendrin, was detected in hippocampal lysates from wild-type (WT) but not C-KO mice. Compared to WT mice, C-KO mice exhibited mild deficits in spatial learning and memory in both the Barnes maze and in Morris water maze reversal learning. In contextual but not cued fear-conditioning assays, C-KO mice showed greater freezing responses than WT mice. In addition, the number of adult-born neurons in the hippocampus of C-KO mice was ∼40% of that in WT mice, as measured by bromodeoxyuridine labeling. Moreover, hippocampal long-term potentiation was significantly reduced in C-KO mice. We conclude that CaBP1 is required for cellular mechanisms underlying optimal encoding of hippocampal-dependent spatial and fear-related memories. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R
1994-05-01
Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.
Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site
Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.
2011-01-01
Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053
Mulye, Minal; Bechill, Michael P.; Grose, William; Ferreira, Viviana P.; Lafontaine, Eric R.; Wooten, R. Mark
2014-01-01
Infection of susceptible hosts by the encapsulated Gram-negative bacterium Burkholderia pseudomallei (Bp) causes melioidosis, with septic patients attaining mortality rates ≥40%. Due to its high infectivity through inhalation and limited effective therapies, Bp is considered a potential bioweapon. Thus, there is great interest in identifying immune effectors that effectively kill Bp. Our goal is to compare the relative abilities of murine macrophages and neutrophils to clear Bp, as well as determine the importance of serum opsonins and bacterial capsule. Our findings indicate that murine macrophages and neutrophils are inherently unable to clear either unopsonized Bp or the relatively-avirulent acapsular bacterium B. thailandensis (Bt). Opsonization of Bp and Bt with complement or pathogen-specific antibodies increases macrophage-uptake, but does not promote clearance, although antibody-binding enhances complement deposition. In contrast, complement opsonization of Bp and Bt causes enhanced uptake and killing by neutrophils, which is linked with rapid ROS induction against bacteria exhibiting a threshold level of complement deposition. Addition of bacteria-specific antibodies enhances complement deposition, but antibody-binding alone cannot elicit neutrophil clearance. Bp capsule provides some resistance to complement deposition, but is not anti-phagocytic or protective against reactive oxygen species (ROS)-killing. Macrophages were observed to efficiently clear Bp only after pre-activation with IFNγ, which is independent of serum- and/or antibody-opsonization. These studies indicate that antibody-enhanced complement activation is sufficient for neutrophil-clearance of Bp, whereas macrophages are ineffective at clearing serum-opsonized Bp unless pre-activated with IFNγ. This suggests that effective immune therapies would need to elicit both antibodies and Th1-adaptive responses for successful prevention/eradication of melioidosis. PMID:25144195
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sekiyama, Naotaka; Arthanari, Haribabu; Papadopoulos, Evangelos
The eIF4E-binding protein (4E-BP) is a phosphorylation-dependent regulator of protein synthesis. The nonphosphorylated or minimally phosphorylated form binds translation initiation factor 4E (eIF4E), preventing binding of eIF4G and the recruitment of the small ribosomal subunit. Signaling events stimulate serial phosphorylation of 4E-BP, primarily by mammalian target of rapamycin complex 1 (mTORC1) at residues T 37/T 46, followed by T 70 and S 65. Hyperphosphorylated 4E-BP dissociates from eIF4E, allowing eIF4E to interact with eIF4G and translation initiation to resume. Because overexpression of eIF4E is linked to cellular transformation, 4E-BP is a tumor suppressor, and up-regulation of its activity is amore » goal of interest for cancer therapy. A recently discovered small molecule, eIF4E/eIF4G interaction inhibitor 1 (4EGI-1), disrupts the eIF4E/eIF4G interaction and promotes binding of 4E-BP1 to eIF4E. Structures of 14- to 16-residue 4E-BP fragments bound to eIF4E contain the eIF4E consensus binding motif, 54YXXXXLΦ 60 (motif 1) but lack known phosphorylation sites. We report in this paper a 2.1-Å crystal structure of mouse eIF4E in complex with m 7GTP and with a fragment of human 4E-BP1, extended C-terminally from the consensus-binding motif (4E-BP1 50–84). The extension, which includes a proline-turn-helix segment (motif 2) followed by a loop of irregular structure, reveals the location of two phosphorylation sites (S 65 and T 70). Our major finding is that the C-terminal extension (motif 3) is critical to 4E-BP1–mediated cell cycle arrest and that it partially overlaps with the binding site of 4EGI-1. Finally, the binding of 4E-BP1 and 4EGI-1 to eIF4E is therefore not mutually exclusive, and both ligands contribute to shift the equilibrium toward the inhibition of translation initiation.« less
Contrasting Pathology of the Stress Granule Proteins TIA-1 and G3BP in Tauopathies
Vanderweyde, Tara; Yu, Haung; Varnum, Megan; Liu-Yesucevitz, Liqun; Citro, Allison; Ikezu, Tsuneya; Duff, Karen; Wolozin, Benjamin
2012-01-01
Stress induces aggregation of RNA-binding proteins to form inclusions, termed stress granules (SGs). Recent evidence suggests that SG proteins also colocalize with neuropathological structures, but whether this occurs in Alzheimer’s disease is unknown. We examined the relationship between SG proteins and neuropathology in brain tissue from P301L Tau transgenic mice, as well as in cases of Alzheimer’s disease and FTDP-17. The pattern of SG pathology differs dramatically based on the RNA-binding protein examined. SGs positive for T-cell intracellular antigen-1 (TIA-1) or tristetraprolin (TTP) initially do not colocalize with tau pathology, but then merge with tau inclusions as disease severity increases. In contrast, G3BP (ras GAP-binding protein) identifies a novel type of molecular pathology that shows increasing accumulation in neurons with increasing disease severity, but often is not associated with classic markers of tau pathology. TIA-1 and TTP both bind phospho-tau, and TIA-1 overexpression induces formation of inclusions containing phospho-tau. These data suggest that SG formation might stimulate tau pathophysiology. Thus, study of RNA-binding proteins and SG biology highlights novel pathways interacting with the pathophysiology of AD, providing potentially new avenues for identifying diseased neurons and potentially novel mechanisms regulating tau biology. PMID:22699908
NASA Technical Reports Server (NTRS)
Kim, Soo-Hwan; Roux, Stanley J.
2003-01-01
Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.
Müller, Simon; Bley, Nadine; Glaß, Markus; Busch, Bianca; Rousseau, Vanessa; Misiak, Danny; Fuchs, Tommy; Lederer, Marcell; Hüttelmaier, Stefan
2018-04-12
The oncofetal IGF2 mRNA binding proteins (IGF2BPs) are upregulated in most cancers but their paralogue-specific roles in tumor cells remain poorly understood. In a panel of five cancer-derived cell lines, IGF2BP1 shows highly conserved oncogenic potential. Consistently, the deletion of IGF2BP1 impairs the growth and metastasis of ovarian cancer-derived cells in nude mice. Gene expression analyses in ovarian cancer-derived cells reveal that the knockdown of IGF2BPs is associated with the downregulation of mRNAs that are prone to miRNA regulation. All three IGF2BPs preferentially associate upstream of miRNA binding sites (MBSs) in the 3'UTR of mRNAs. The downregulation of mRNAs co-regulated by miRNAs and IGF2BP1 is abrogated at low miRNA abundance or when miRNAs are depleted. IGF2BP1 associates with these target mRNAs in RISC-free complexes and its deletion enhances their association with AGO2. The knockdown of most miRNA-regulated target mRNAs of IGF2BP1 impairs tumor cell properties. In four primary cancers, elevated synthesis of these target mRNAs is largely associated with upregulated IGF2BP1 mRNA levels. In ovarian cancer, the enhanced expression of IGF2BP1 and most of its miRNA-controlled target mRNAs is associated with poor prognosis. In conclusion, these findings indicate that IGF2BP1 enhances an aggressive tumor cell phenotype by antagonizing miRNA-impaired gene expression.
Ritterhoff, Tobias; Das, Hrishikesh; Hofhaus, Götz; Schröder, Rasmus R.; Flotho, Annette; Melchior, Frauke
2016-01-01
Continuous cycles of nucleocytoplasmic transport require disassembly of transport receptor/Ran-GTP complexes in the cytoplasm. A basic disassembly mechanism in all eukaryotes depends on soluble RanGAP and RanBP1. In vertebrates, a significant fraction of RanGAP1 stably interacts with the nucleoporin RanBP2 at a binding site that is flanked by FG-repeats and Ran-binding domains, and overlaps with RanBP2's SUMO E3 ligase region. Here, we show that the RanBP2/RanGAP1*SUMO1/Ubc9 complex functions as an autonomous disassembly machine with a preference for the export receptor Crm1. We describe three in vitro reconstituted disassembly intermediates, which show binding of a Crm1 export complex via two FG-repeat patches, cargo-release by RanBP2's Ran-binding domains and retention of free Crm1 at RanBP2 after Ran-GTP hydrolysis. Intriguingly, all intermediates are compatible with SUMO E3 ligase activity, suggesting that the RanBP2/RanGAP1*SUMO1/Ubc9 complex may link Crm1- and SUMO-dependent functions. PMID:27160050
Structural basis for antagonism of human interleukin 18 by poxvirus interleukin 18-binding protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krumm, Brian; Meng, Xiangzhi; Li, Yongchao
2009-07-10
Human interleukin-18 (hIL-18) is a cytokine that plays an important role in inflammation and host defense against microbes. Its activity is regulated in vivo by a naturally occurring antagonist, the human IL-18-binding protein (IL-18BP). Functional homologs of human IL-18BP are encoded by all orthopoxviruses, including variola virus, the causative agent of smallpox. They contribute to virulence by suppressing IL-18-mediated immune responses. Here, we describe the 2.0-{angstrom} resolution crystal structure of an orthopoxvirus IL-18BP, ectromelia virus IL-18BP (ectvIL-18BP), in complex with hIL-18. The hIL-18 structure in the complex shows significant conformational change at the binding interface compared with the structure ofmore » ligand-free hIL-18, indicating that the binding is mediated by an induced-fit mechanism. EctvIL-18BP adopts a canonical Ig fold and interacts via one edge of its {beta}-sandwich with 3 cavities on the hIL-18 surface through extensive hydrophobic and hydrogen bonding interactions. Most of the ectvIL-18BP residues that participate in these interactions are conserved in both human and viral homologs, explaining their functional equivalence despite limited sequence homology. EctvIL-18BP blocks a putative receptor-binding site on IL-18, thus preventing IL-18 from engaging its receptor. Our structure provides insights into how IL-18BPs modulate hIL-18 activity. The revealed binding interface provides the basis for rational design of inhibitors against orthopoxvirus IL-18BP (for treating orthopoxvirus infection) or hIL-18 (for treating certain inflammatory and autoimmune diseases).« less
Grauel, M. Katharina; Reddy-Alla, Suneel; Willmes, Claudia G.; Brockmann, Marisa M.; Trimbuch, Thorsten; Rosenmund, Tanja; Pangalos, Maria; Vardar, Gülçin; Stumpf, Alexander; Walter, Alexander M.; Rost, Benjamin R.; Eickholt, Britta J.; Haucke, Volker; Schmitz, Dietmar; Sigrist, Stephan J.; Rosenmund, Christian
2016-01-01
The tight spatial coupling of synaptic vesicles and voltage-gated Ca2+ channels (CaVs) ensures efficient action potential-triggered neurotransmitter release from presynaptic active zones (AZs). Rab-interacting molecule-binding proteins (RIM-BPs) interact with Ca2+ channels and via RIM with other components of the release machinery. Although human RIM-BPs have been implicated in autism spectrum disorders, little is known about the role of mammalian RIM-BPs in synaptic transmission. We investigated RIM-BP2–deficient murine hippocampal neurons in cultures and slices. Short-term facilitation is significantly enhanced in both model systems. Detailed analysis in culture revealed a reduction in initial release probability, which presumably underlies the increased short-term facilitation. Superresolution microscopy revealed an impairment in CaV2.1 clustering at AZs, which likely alters Ca2+ nanodomains at release sites and thereby affects release probability. Additional deletion of RIM-BP1 does not exacerbate the phenotype, indicating that RIM-BP2 is the dominating RIM-BP isoform at these synapses. PMID:27671655
Cardon, Zoe G.; Mott, Keith A.
1989-01-01
The binding of ribulose 1,5-bisphosphate (RuBP) to inactive (noncarbamylated) sites of the enzyme RuBP carboxylase in vivo was investigated in Spinacia oleracea and Helianthus annuus. The concentrations of RuBP and inactive sites were determined in leaf tissue as a function of time after a change to darkness. RuBP concentrations fell rapidly after the change to darkness and were approximately equal to the concentration of inactive sites after 60 s. Variations in the concentration of inactive sites, which were induced by differences in the light intensity before the light-dark transition, correlated with the concentration of RuBP between 60 and 120 s after the change to darkness. These data are discussed as evidence that RuBP binds to inactive sites of RuBP carboxylase in vivo. After the concentration of RuBP fell below that of inactive sites (at times longer than 60 s of darkness), the decline in RuBP was logarithmic with time. This would be expected if the dissociation of RuBP from inactive sites controlled the decline in RuBP concentration. These data were used to estimate the rate constant for dissociation of RuBP from inactive sites in vivo. PMID:16666692
The prenyl-binding protein PrBP/δ: a chaperone participating in intracellular trafficking.
Zhang, Houbin; Constantine, Ryan; Frederick, Jeanne M; Baehr, Wolfgang
2012-12-15
Expressed ubiquitously, PrBP/δ functions as chaperone/co-factor in the transport of a subset of prenylated proteins. PrBP/δ features an immunoglobulin-like β-sandwich fold for lipid binding, and interacts with diverse partners. PrBP/δ binds both C-terminal C15 and C20 prenyl side chains of phototransduction polypeptides and small GTP-binding (G) proteins of the Ras superfamily. PrBP/δ also interacts with the small GTPases, ARL2 and ARL3, which act as release factors (GDFs) for prenylated cargo. Targeted deletion of the mouse Pde6d gene encoding PrBP/δ resulted in impeded trafficking to the outer segments of GRK1 and cone PDE6 which are predicted to be farnesylated and geranylgeranylated, respectively. Rod and cone transducin trafficking was largely unaffected. These trafficking defects produce progressive cone-rod dystrophy in the Pde6d(-/-) mouse. Copyright © 2012 Elsevier Ltd. All rights reserved.
Sargent, Peter A; Rabiner, Eugenii A; Bhagwagar, Zubin; Clark, Luke; Cowen, Philip; Goodwin, Guy M; Grasby, Paul M
2010-06-01
This study was undertaken to examine whether brain 5-HT(1A) receptor binding is reduced in euthymic bipolar patients. Eight medicated euthymic bipolar patients and 8 healthy volunteers underwent positron emission tomography scanning using the selective 5-HT(1A) receptor radioligand [carbonyl-(11)C]WAY-100635. No significant difference in global postsynaptic parametric binding potential (BP(ND)) was found between euthymic bipolar patients (mean + or - SD, 4.24 + or - 0.76) and healthy volunteers (mean + or - SD, 4.34 + or - 0.86). Ninety five percent Confidence Intervals for the difference in group mean global postsynaptic BP(ND) were -0.77 to 0.97. Analysis of regional BP(ND) did not reveal regional differences between patients and healthy controls. The number of subjects studied was limited and all subjects were on medication. In contrast to previous findings of reduced 5-HT(1A) receptor binding in untreated unipolar and bipolar depressed patients [Sargent, P.A., Kjaer, K.H., Bench, C.J., Rabiner, E.A., Messa, C., Meyer, J., Gunn, R.N., Grasby, P.M., Cowen, P.J., 2000. Brain serotonin1A receptor binding measured by positron emission tomography with [(11)C]WAY-100635: effects of depression and antidepressant treatment. Arch. Gen. Psychiatry 57, 174-180]; [Drevets, W.C., Frank, E., Price, J.C., Kupfer, D.J., Holt, D., Greer, P.J., Huang, Y., Gautier, C., Mathis, C., 1999. PET imaging of serotonin1A receptor binding in depression. Biol. Psychiatry 46, 1375-1387] and in recovered unipolar depressed patients [Bhagwagar, Z., Rabiner, E.A., Sargent, P.A., Grasby, P.M., Cowen, P.J., 2004. Persistent reduction in brain serotonin1A receptor binding in recovered depressed men measured by positron emission tomography with [(11)C]WAY-100635. Mol. Psychiatry 9, 386-92], this study found no difference in 5-HT(1A) receptor BP(ND) between medicated euthymic bipolar patients and healthy controls. Normal 5-HT(1A) receptor BP(ND) in these patients may be a result of drug treatment or could indicate that reduced 5-HT(1A) receptor binding is specific to the depressed state in bipolar patients. Copyright 2009 Elsevier B.V. All rights reserved.
Bailer, Ursula F; Frank, Guido K; Price, Julie C; Meltzer, Carolyn C; Becker, Carl; Mathis, Chester A; Wagner, Angela; Barbarich-Marsteller, Nicole C; Bloss, Cinnamon S; Putnam, Karen; Schork, Nicholas J; Gamst, Anthony; Kaye, Walter H
2013-02-28
Individuals with anorexia nervosa (AN) and bulimia nervosa (BN) have alterations of measures of serotonin (5-HT) and dopamine (DA) function, which persist after long-term recovery and are associated with elevated harm avoidance (HA), a measure of anxiety and behavioral inhibition. Based on theories that 5-HT is an aversive motivational system that may oppose a DA-related appetitive system, we explored interactions of positron emission tomography (PET) radioligand measures that reflect portions of these systems. Twenty-seven individuals recovered (REC) from eating disorders (EDs) (7 AN-BN, 11 AN, 9 BN) and nine control women (CW) were analyzed for correlations between [(11)C]McN5652 and [(11)C]raclopride binding. There was a significant positive correlation between [(11)C]McN5652 binding potential (BP(non displaceable(ND))) and [(11)C]Raclopride BP(ND) for the dorsal caudate, antero-ventral striatum (AVS), middle caudate, and ventral and dorsal putamen. No significant correlations were found in CW. [(11)C]Raclopride BP(ND), but not [(11)C]McN5652 BP(ND), was significantly related to HA in REC EDs. A linear regression analysis showed that the interaction between [(11)C]McN5652 BP(ND) and [(11)C]raclopride BP(ND) in the dorsal putamen significantly predicted HA. This is the first study using PET and the radioligands [(11)C]McN5652 and [(11)C]raclopride to show a direct relationship between 5-HT transporter and striatal DA D2/D3 receptor binding in humans, supporting the possibility that 5-HT and DA interactions contribute to HA behaviors in EDs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Cropley, Vanessa L; Innis, Robert B; Nathan, Pradeep J; Brown, Amira K; Sangare, Janet L; Lerner, Alicja; Ryu, Yong Hoon; Sprague, Kelly E; Pike, Victor W; Fujita, Masahiro
2008-06-01
Molecular imaging has been used to estimate both drug-induced and tonic dopamine release in the striatum and most recently extrastriatal areas of healthy humans. However, to date, studies of drug-induced and tonic dopamine release have not been performed in the same subjects. This study performed positron emission tomography (PET) with [18F]fallypride in healthy subjects to assess (1) the reproducibility of [18F]fallypride and (2) both D-amphetamine-induced and alpha-methyl-p-tyrosine (AMPT)-induced changes in dopamin release on [(18)F]fallypride binding in striatal and extrastriatal areas. Subjects underwent [18F]fallypride PET studies at baseline and following oral D-amphetamine administration (0.5 mg/kg) and oral AMPT administration (3 g/70 kg/day over 44 h). Binding potential (BP) (BP(ND)) of [18F]fallypride was calculated in striatal and extrastriatal areas using a reference region method. Percent change in regional BP(ND) was computed and correlated with change in cognition and mood. Test-retest variability of [18F]fallypride was low in both striatal and extrastriatal regions. D-Amphetamine significantly decreased BP(ND) by 8-14% in striatal subdivisions, caudate, putamen, substantia nigra, medial orbitofrontal cortex, and medial temporal cortex. Correlation between change in BP(ND) and verbal fluency was seen in the thalamus and substantia nigra. In contrast, depletion of endogenous dopamine with AMPT did not effect [18F]fallypride BP(ND) in both striatum and extrastriatal regions. These findings indicate that [18F]fallypride is useful for measuring amphetamine-induced dopamine release, but may be unreliable for estimating tonic dopamine levels, in striatum and extrastriatal regions of healthy humans.
Vas, Adám; Shchukin, Yevgeni; Karrenbauer, Virginija D; Cselényi, Zsolt; Kostulas, Kosta; Hillert, Jan; Savic, Ivanka; Takano, Akihiro; Halldin, Christer; Gulyás, Balázs
2008-01-15
With the purpose of demonstrating the use of positron emission tomography (PET) and radiolabelled glia markers to indicate regional cerebral damage, we measured with PET in four young multiplex sclerosis (MS) patients in two consecutive measurements the global and regional brain uptake as well as regional distribution and binding potential (BP) of [(11)C]vinpocetine and [(11)C]PK11195. Both ligands showed increased uptake and BP in the regions of local brain damage. However, regional BP values for [(11)C]vinpocetine were markedly higher than those for [(11)C]PK11195. This feature of the former radioligand may be related to its high brain uptake and marked affinity to the peripheral benzodiazepine receptor binding sites (PBBS), characteristic for glia cells. As local brain traumas entail reactive glia accumulation in and around the site of the damage, the present findings may indicate that [(11)C]vinpocetine marks the place or boundaries of local brain damage by binding to the PBBS present in glia cells, which, in turn, accumulate in the region of the damage. The present findings (i) confirm earlier observations with [(11)C]PK11195 as a potential glia marker in PET studies and (ii) support the working hypothesis that [(11)C]vinpocetine is a potentially useful PET marker of regional and global brain damage resulting in glia accumulation locally or globally in the human brain. The comparative analysis of the two ligands indicate that [(11)C]vinpocetine shows a number of characteristics favourable in comparison with [(11)C]PK11195.
CacyBP/SIP nuclear translocation regulates p27Kip1 stability in gastric cancer cells
Niu, Ying-Lin; Li, Ya-Jun; Wang, Jing-Bo; Lu, Yuan-Yuan; Liu, Zhen-Xiong; Feng, Shan-Shan; Hu, Jian-Guo; Zhai, Hui-Hong
2016-01-01
AIM: To investigate the mechanism of calcyclin binding protein/Siah-1 interacting protein (CacyBP/SIP) nuclear translocation in promoting the proliferation of gastric cancer (GC) cells. METHODS: The effect of CacyBP/SIP nuclear translocation on cell cycle was investigated by cell cycle analysis. Western blot analysis was used to assess the change in expression of cell cycle regulatory proteins and proteasome-mediated degradation of p27Kip1. Co-immunoprecipitation (co-IP) analysis was performed to examine the binding of CacyBP/SIP with Skp1. A CacyBP/SIP truncation mutant which lacked the Skp1 binding site was constructed and fused to a fluorescent protein. Subsequently, the effect on Skp1 binding with the fusion protein was examined by co-IP, while localization of fluorescent fusion protein observed by confocal laser microscopy, and change in p27Kip1 protein expression assessed by Western blot analysis. RESULTS: CacyBP/SIP nuclear translocation induced by gastrin promoted progression of GC cells from G1 phase. However, while CacyBP/SIP nuclear translocation was inhibited using siRNA to suppress CacyBP/SIP expression, cell cycle was clearly inhibited. CacyBP/SIP nuclear translocation significantly decreased the level of cell cycle inhibitor p27Kip1, increased Cyclin E protein expression whereas the levels of Skp1, Skp2, and CDK2 were not affected. Upon inhibition of CacyBP/SIP nuclear translocation, there were no changes in protein levels of p27Kip1 and Cyclin E, while p27Kip1 decrease could be prevented by the proteasome inhibitor MG132. Moreover, CacyBP/SIP was found to bind to Skp1 by immunoprecipitation, an event that was abolished by mutant CacyBP/SIP, which also failed to stimulate p27Kip1 degradation, even though the mutant could still translocate into the nucleus. CONCLUSION: CacyBP/SIP nuclear translocation contributes to the proliferation of GC cells, and CacyBP/SIP exerts this effect, at least in part, by stimulating ubiquitin-mediated degradation of p27Kip1. PMID:27099442
Corticotropin-releasing hormone-binding protein and stress: from invertebrates to humans.
Ketchesin, Kyle D; Stinnett, Gwen S; Seasholtz, Audrey F
2017-09-01
Corticotropin-releasing hormone (CRH) is a key regulator of the stress response. This peptide controls the hypothalamic-pituitary-adrenal (HPA) axis as well as a variety of behavioral and autonomic stress responses via the two CRH receptors, CRH-R1 and CRH-R2. The CRH system also includes an evolutionarily conserved CRH-binding protein (CRH-BP), a secreted glycoprotein that binds CRH with subnanomolar affinity to modulate CRH receptor activity. In this review, we discuss the current literature on CRH-BP and stress across multiple species, from insects to humans. We describe the regulation of CRH-BP in response to stress, as well as genetic mouse models that have been utilized to elucidate the in vivo role(s) of CRH-BP in modulating the stress response. Finally, the role of CRH-BP in the human stress response is examined, including single nucleotide polymorphisms in the human CRHBP gene that are associated with stress-related affective disorders and addiction. Lay summary The stress response is controlled by corticotropin-releasing hormone (CRH), acting via CRH receptors. However, the CRH system also includes a unique CRH-binding protein (CRH-BP) that binds CRH with an affinity greater than the CRH receptors. In this review, we discuss the role of this highly conserved CRH-BP in regulation of the CRH-mediated stress response from invertebrates to humans.
Dewi, Vitri; Kwok, Alister; Lee, Stella; Lee, Ming Min; Tan, Yee Mun; Nicholas, Hannah R; Isono, Kyo-ichi; Wienert, Beeke; Mak, Ka Sin; Knights, Alexander J; Quinlan, Kate G R; Cordwell, Stuart J; Funnell, Alister P W; Pearson, Richard C M; Crossley, Merlin
2015-03-27
Krüppel-like factor 3 (KLF3/BKLF), a member of the Krüppel-like factor (KLF) family of transcription factors, is a widely expressed transcriptional repressor with diverse biological roles. Although there is considerable understanding of the molecular mechanisms that allow KLF3 to silence the activity of its target genes, less is known about the signal transduction pathways and post-translational modifications that modulate KLF3 activity in response to physiological stimuli. We observed that KLF3 is modified in a range of different tissues and found that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) can both bind and phosphorylate KLF3. Mass spectrometry identified serine 249 as the primary phosphorylation site. Mutation of this site reduces the ability of KLF3 to bind DNA and repress transcription. Furthermore, we also determined that HIPK2 can phosphorylate the KLF3 co-repressor C-terminal binding protein 2 (CtBP2) at serine 428. Finally, we found that phosphorylation of KLF3 and CtBP2 by HIPK2 strengthens the interaction between these two factors and increases transcriptional repression by KLF3. Taken together, our results indicate that HIPK2 potentiates the activity of KLF3. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Engineered Escherichia coli Silver-Binding Periplasmic Protein That Promotes Silver Tolerance
Hall Sedlak, Ruth; Hnilova, Marketa; Grosh, Carolynn; Fong, Hanson; Baneyx, Francois; Schwartz, Dan; Sarikaya, Mehmet; Tamerler, Candan
2012-01-01
Silver toxicity is a problem that microorganisms face in medical and environmental settings. Through exposure to silver compounds, some bacteria have adapted to growth in high concentrations of silver ions. Such adapted microbes may be dangerous as pathogens but, alternatively, could be potentially useful in nanomaterial-manufacturing applications. While naturally adapted isolates typically utilize efflux pumps to achieve metal resistance, we have engineered a silver-tolerant Escherichia coli strain by the use of a simple silver-binding peptide motif. A silver-binding peptide, AgBP2, was identified from a combinatorial display library and fused to the C terminus of the E. coli maltose-binding protein (MBP) to yield a silver-binding protein exhibiting nanomolar affinity for the metal. Growth experiments performed in the presence of silver nitrate showed that cells secreting MBP-AgBP2 into the periplasm exhibited silver tolerance in a batch culture, while those expressing a cytoplasmic version of the fusion protein or MBP alone did not. Transmission electron microscopy analysis of silver-tolerant cells revealed the presence of electron-dense silver nanoparticles. This is the first report of a specifically engineered metal-binding peptide exhibiting a strong in vivo phenotype, pointing toward a novel ability to manipulate bacterial interactions with heavy metals by the use of short and simple peptide motifs. Engineered metal-ion-tolerant microorganisms such as this E. coli strain could potentially be used in applications ranging from remediation to interrogation of biomolecule-metal interactions in vivo. PMID:22286990
Kuster, Diederik W. D.; Govindan, Suresh; Springer, Tzvia I.; Martin, Jody L.; Finley, Natosha L.; Sadayappan, Sakthivel
2015-01-01
Hypertrophic cardiomyopathy (HCM) results from mutations in genes encoding sarcomeric proteins, most often MYBPC3, which encodes cardiac myosin binding protein-C (cMyBP-C). A recently discovered HCM-associated 25-base pair deletion in MYBPC3 is inherited in millions worldwide. Although this mutation causes changes in the C10 domain of cMyBP-C (cMyBP-CC10mut), which binds to the light meromyosin (LMM) region of the myosin heavy chain, the underlying molecular mechanism causing HCM is unknown. In this study, adenoviral expression of cMyBP-CC10mut in cultured adult rat cardiomyocytes was used to investigate protein localization and evaluate contractile function and Ca2+ transients, compared with wild-type cMyBP-C expression (cMyBP-CWT) and controls. Forty-eight hours after infection, 44% of cMyBP-CWT and 36% of cMyBP-CC10mut protein levels were determined in total lysates, confirming equal expression. Immunofluorescence experiments showed little or no localization of cMyBP-CC10mut to the C-zone, whereas cMyBP-CWT mostly showed C-zone staining, suggesting that cMyBP-CC10mut could not properly integrate in the C-zone of the sarcomere. Subcellular fractionation confirmed that most cMyBP-CC10mut resided in the soluble fraction, with reduced presence in the myofilament fraction. Also, cMyBP-CC10mut displayed significantly reduced fractional shortening, sarcomere shortening, and relaxation velocities, apparently caused by defects in sarcomere function, because Ca2+ transients were unaffected. Co-sedimentation and protein cross-linking assays confirmed that C10mut causes the loss of C10 domain interaction with myosin LMM. Protein homology modeling studies showed significant structural perturbation in cMyBP-CC10mut, providing a potential structural basis for the alteration in its mode of interaction with myosin LMM. Therefore, expression of cMyBP-CC10mut protein is sufficient to cause contractile dysfunction in vitro. PMID:25583989
Fang, Hui; Zhang, Yang; Li, Ning; Wang, Gang; Liu, Zhi
2018-01-01
Bullous pemphigoid (BP) is an autoimmune and inflammatory skin disease associated with subepidermal blistering and autoantibodies directed against the hemidesmosomal components BP180 and BP230. Animal models of BP were developed by passively transferring anti-BP180 IgG into mice, which recapitulates the key features of human BP. By using these in vivo model systems, key cellular and molecular events leading to the BP disease phenotype are identified, including binding of pathogenic IgG to its target, complement activation of the classical pathway, mast cell degranulation, and infiltration and activation of neutrophils. Proteinases released by infiltrating neutrophils cleave BP180 and other hemidesmosome-associated proteins, causing DEJ separation. Mast cells and mast cell-derived mediators including inflammatory cytokines and proteases are increased in lesional skin and blister fluids of BP. BP animal model evidence also implicates mast cells in the pathogenesis of BP. However, recent studies questioned the pathogenic role of mast cells in autoimmune diseases such as multiple sclerosis, rheumatoid arthritis, and epidermolysis bullosa acquisita. This review highlights the current knowledge on BP pathophysiology with a focus on a potential role for mast cells in BP and mast cell-related critical issues needing to be addressed in the future. PMID:29545809
NASA Astrophysics Data System (ADS)
Ehlen, N.; Sanna, A.; Senkovskiy, B. V.; Petaccia, L.; Fedorov, A. V.; Profeta, G.; Grüneis, A.
2018-01-01
We report a Cs-doping-induced band inversion and the direct observation of a surface resonance state with an elliptical Fermi surface in black phosphorus (BP) using angle-resolved photoemission spectroscopy. By selectively inducing a higher electron concentration (1.7 ×1014cm-2 ) in the topmost layer, the changes in the Coulomb potential are sufficiently large to cause surface band inversion between the parabolic valence band of BP and a parabolic surface state around the Γ point of the BP Brillouin zone. Tight-binding calculations reveal that band gap openings at the crossing points in the two high-symmetry directions of the Brillouin zone require out-of-plane hopping and breaking of the glide mirror symmetry. Ab initio calculations are in very good agreement with the experiment if a stacking fault on the BP surface is taken into account. The demonstrated level of control over the band structure suggests the potential application of few-layer phosphorene in topological field-effect transistors.
Kensler, Robert W.; Craig, Roger; Moss, Richard L.
2017-01-01
Cardiac myosin binding protein C (cMyBP-C) has a key regulatory role in cardiac contraction, but the mechanism by which changes in phosphorylation of cMyBP-C accelerate cross-bridge kinetics remains unknown. In this study, we isolated thick filaments from the hearts of mice in which the three serine residues (Ser273, Ser282, and Ser302) that are phosphorylated by protein kinase A in the m-domain of cMyBP-C were replaced by either alanine or aspartic acid, mimicking the fully nonphosphorylated and the fully phosphorylated state of cMyBP-C, respectively. We found that thick filaments from the cMyBP-C phospho-deficient hearts had highly ordered cross-bridge arrays, whereas the filaments from the cMyBP-C phospho-mimetic hearts showed a strong tendency toward disorder. Our results support the hypothesis that dephosphorylation of cMyBP-C promotes or stabilizes the relaxed/superrelaxed quasi-helical ordering of the myosin heads on the filament surface, whereas phosphorylation weakens this stabilization and binding of the heads to the backbone. Such structural changes would modulate the probability of myosin binding to actin and could help explain the acceleration of cross-bridge interactions with actin when cMyBP-C is phosphorylated because of, for example, activation of β1-adrenergic receptors in myocardium. PMID:28167762
Kensler, Robert W; Craig, Roger; Moss, Richard L
2017-02-21
Cardiac myosin binding protein C (cMyBP-C) has a key regulatory role in cardiac contraction, but the mechanism by which changes in phosphorylation of cMyBP-C accelerate cross-bridge kinetics remains unknown. In this study, we isolated thick filaments from the hearts of mice in which the three serine residues (Ser273, Ser282, and Ser302) that are phosphorylated by protein kinase A in the m-domain of cMyBP-C were replaced by either alanine or aspartic acid, mimicking the fully nonphosphorylated and the fully phosphorylated state of cMyBP-C, respectively. We found that thick filaments from the cMyBP-C phospho-deficient hearts had highly ordered cross-bridge arrays, whereas the filaments from the cMyBP-C phospho-mimetic hearts showed a strong tendency toward disorder. Our results support the hypothesis that dephosphorylation of cMyBP-C promotes or stabilizes the relaxed/superrelaxed quasi-helical ordering of the myosin heads on the filament surface, whereas phosphorylation weakens this stabilization and binding of the heads to the backbone. Such structural changes would modulate the probability of myosin binding to actin and could help explain the acceleration of cross-bridge interactions with actin when cMyBP-C is phosphorylated because of, for example, activation of β 1 -adrenergic receptors in myocardium.
Liu, Jianyu; Stevens, Payton D; Eshleman, Nichole E; Gao, Tianyan
2013-08-09
Protein translation initiation is a tightly controlled process responding to nutrient availability and mitogen stimulation. Serving as one of the most important negative regulators of protein translation, 4E binding protein 1 (4E-BP1) binds to translation initiation factor 4E and inhibits cap-dependent translation in a phosphorylation-dependent manner. Although it has been demonstrated previously that the phosphorylation of 4E-BP1 is controlled by mammalian target of rapamycin in the mammalian target of rapamycin complex 1, the mechanism underlying the dephosphorylation of 4E-BP1 remains elusive. Here, we report the identification of PPM1G as the phosphatase of 4E-BP1. A coimmunoprecipitation experiment reveals that PPM1G binds to 4E-BP1 in cells and that purified PPM1G dephosphorylates 4E-BP1 in vitro. Knockdown of PPM1G in 293E and colon cancer HCT116 cells results in an increase in the phosphorylation of 4E-BP1 at both the Thr-37/46 and Ser-65 sites. Furthermore, the time course of 4E-BP1 dephosphorylation induced by amino acid starvation or mammalian target of rapamycin inhibition is slowed down significantly in PPM1G knockdown cells. Functionally, the amount of 4E-BP1 bound to the cap-dependent translation initiation complex is decreased when the expression of PPM1G is depleted. As a result, the rate of cap-dependent translation, cell size, and protein content are increased in PPM1G knockdown cells. Taken together, our study has identified protein phosphatase PPM1G as a novel regulator of cap-dependent protein translation by negatively controlling the phosphorylation of 4E-BP1.
Interaction between cardiac myosin-binding protein C and formin Fhod3.
Matsuyama, Sho; Kage, Yohko; Fujimoto, Noriko; Ushijima, Tomoki; Tsuruda, Toshihiro; Kitamura, Kazuo; Shiose, Akira; Asada, Yujiro; Sumimoto, Hideki; Takeya, Ryu
2018-05-08
Mutations in cardiac myosin-binding protein C (cMyBP-C) are a major cause of familial hypertrophic cardiomyopathy. Although cMyBP-C has been considered to regulate the cardiac function via cross-bridge arrangement at the C-zone of the myosin-containing A-band, the mechanism by which cMyBP-C functions remains unclear. We identified formin Fhod3, an actin organizer essential for the formation and maintenance of cardiac sarcomeres, as a cMyBP-C-binding protein. The cardiac-specific N-terminal Ig-like domain of cMyBP-C directly interacts with the cardiac-specific N-terminal region of Fhod3. The interaction seems to direct the localization of Fhod3 to the C-zone, since a noncardiac Fhod3 variant lacking the cMyBP-C-binding region failed to localize to the C-zone. Conversely, the cardiac variant of Fhod3 failed to localize to the C-zone in the cMyBP-C-null mice, which display a phenotype of hypertrophic cardiomyopathy. The cardiomyopathic phenotype of cMyBP-C-null mice was further exacerbated by Fhod3 overexpression with a defect of sarcomere integrity, whereas that was partially ameliorated by a reduction in the Fhod3 protein levels, suggesting that Fhod3 has a deleterious effect on cardiac function under cMyBP-C-null conditions where Fhod3 is aberrantly mislocalized. Together, these findings suggest the possibility that Fhod3 contributes to the pathogenesis of cMyBP-C-related cardiomyopathy and that Fhod3 is critically involved in cMyBP-C-mediated regulation of cardiac function via direct interaction.
Zhao, Mengjing; Zhang, Tianpeng; Yu, Fangjun; Guo, Lianxia; Wu, Baojian
2018-06-01
Carboxylesterases (CES) are a family of phase I enzymes that play an important role in xenobiotic clearance and lipid metabolism. Here, we investigate a potential role of E4 promoter-binding protein 4 (E4bp4) in regulation of Ces and CPT-11 (irinotecan, a first-line drug for treating colorectal cancer) pharmacokinetics in mice. Mouse hepatoma Hepa-1c1c7 cells were transfected with Rev-erbα expression plasmid or siRNA targeting E4bp4. The relative mRNA and protein levels of Ces enzymes in the cells or the livers of wild-type and E4bp4-deficient (E4bp4 -/- ) mice were determined by qPCR and Western blotting, respectively. Transcriptional regulation of Ces by E4bp4/Rev-erbα were investigated using luciferase reporter, mobility shift, and co-immunoprecipitation (Co-IP) assays. Pharmacokinetic studies were performed with wild-type and E4bp4 -/- mice after intraperitoneal injection of CPT-11. E4bp4 ablation down-regulated an array of hepatic Ces genes in mice. E4bp4 -/- mice also showed reduced Ces-mediated metabolism and elevated systemic exposure of CPT-11, a well-known Ces substrate. Consistently, E4bp4 knockdown reduced the expression of Ces genes (Ces2b, Ces2e and Ces2f) in Hepa-1c1c7 cells. Furthermore, Rev-erbα repressed the transcription of Ces2b, whereas E4bp4 antagonized this repressive action. Co-IP experiment confirmed a direct interaction between E4bp4 and Rev-erbα. Through a combination of promoter analysis and mobility shift assays, we demonstrated that Rev-erbα trans-repressed Ces (Ces2b) through its specific binding to the -767 to-754 bp promoter region. In conclusion, E4bp4 regulates Ces enzymes through inhibition of the transrepression activity of Rev-erbα, thereby impacting the metabolism and pharmacokinetics of Ces substrates. Copyright © 2018 Elsevier Inc. All rights reserved.
Martha, P M; Rogol, A D; Blizzard, R M; Shaw, M A; Baumann, G
1991-07-01
To investigate the physiological relationship between serum GH-binding proteins and 24-h GH release, we compared the 24-h GH pulse attributes in serum samples obtained at 20-min intervals to the serum GH-binding protein activity (GH-BP) from 38 normal boys between 7 5/12 and 18 4/12 yr of age. GH-BP was determined in a serum sample from each study (containing less than 1.0 micrograms/L GH) using a standardized GH-BP assay. GH-BP results are expressed as the percentage of [125I]human GH bound to the high affinity GH-BP complex (peak II) per 160 microL serum. There were significant inverse relationships between the high affinity (receptor-related) GH-BP and several characteristics of 24-h GH release. Specifically, GH-BP was significantly (P less than 0.005 for all), but negatively, correlated with mean 24-h GH concentration (r = -0.62), sum of the GH pulse amplitudes (r = -0.57), sum of the GH pulse areas (r = -0.55), interpulse mean GH concentration (r = -0.53), and number of GH pulses per 24 h (r = -0.53). In addition, GH-BP correlated positively with the mean time interval between pulses (r = 0.59). There was also a significant positive correlation (r = 0.75; P less than 0.001) between GH-BP and the subject's age-adjusted body mass index SD score (BMI-SDS). Each characteristic of 24-h GH release correlating inversely with GH-BP also correlated inversely with BMI-SDS (P less than 0.01 for all comparisons). GH-BP did not, however, correlate with plasma insulin-like growth factor-I levels, serum testosterone concentrations, or height SDS. Binding to the low affinity GH-BP (peak I) did not correlate significantly with any of the examined GH pulse attributes, BMI-SDS, or the degree of binding to the high affinity GH-BP (peak II). We conclude that an inverse relationship exists between the high affinity serum GH-BP and 24-h GH release in boys under normal physiological conditions. We speculate that abnormalities in this relationship probably also exist and may underlie some disorders of growth.
[Purification of arsenic-binding proteins in hamster plasma after oral administration of arsenite].
Wang, Wenwen; Zhang, Min; Li, Chunhui; Qin, Yingjie; Hua, Naranmandura
2013-01-01
To purify the arsenic-binding proteins (As-BP) in hamster plasma after a single oral administration of arsenite (iAs(III)). Arsenite was given to hamsters in a single dose. Three types of HPLC columns, size exclusion, gel filtration and anion exchange columns, combined with an inductively coupled argon plasma mass spectrometer (ICP MS) were used to purify the As-BP in hamster plasma. SDS-PAGE was used to confirm the arsenic-binding proteins at each purification step. The three-step purification process successfully separated As-BP from other proteins (ie, arsenic unbound proteins) in hamster plasma. The molecular mass of purified As-BP in plasma was approximately 40-50 kD on SDS-PAGE. The three-step purification method is a simple and fast approach to purify the As-BP in plasma samples.
De, Debojyoti; Dutta, Debajyoti; Kundu, Moloy; Mahato, Sourav; Schiavone, Marc T; Chaudhuri, Surabhi; Giri, Ashok; Gupta, Vidya; Bhattacharya, Sanjoy K
2005-01-01
Background Carbon dioxide fixation bioprocess in reactors necessitates recycling of D-ribulose1,5-bisphosphate (RuBP) for continuous operation. A radically new close loop of RuBP regenerating reactor design has been proposed that will harbor enzyme-complexes instead of purified enzymes. These reactors will need binders enabling selective capture and release of sugar and intermediate metabolites enabling specific conversions during regeneration. In the current manuscript we describe properties of proteins that will act as potential binders in RuBP regeneration reactors. Results We demonstrate specific binding of 3-phosphoglycerate (3PGA) and 3-phosphoglyceraldehyde (3PGAL) from sugar mixtures by inactive mutant of yeast enzymes phosphoglycerate mutase and enolase. The reversibility in binding with respect to pH and EDTA has also been shown. No chemical conversion of incubated sugars or sugar intermediate metabolites were found by the inactive enzymatic proteins. The dissociation constants for sugar metabolites are in the micromolar range, both proteins showed lower dissociation constant (Kd) for 3-phosphoglycerate (655–796 μM) compared to 3-phosphoglyceraldehyde (822–966 μM) indicating higher affinity for 3PGA. The proteins did not show binding to glucose, sucrose or fructose within the sensitivity limits of detection. Phosphoglycerate mutase showed slightly lower stability on repeated use than enolase mutants. Conclusions The sugar and their intermediate metabolite binders may have a useful role in RuBP regeneration reactors. The reversibility of binding with respect to changes in physicochemical factors and stability when subjected to repeated changes in these conditions are expected to make the mutant proteins candidates for in-situ removal of sugar intermediate metabolites for forward driving of specific reactions in enzyme-complex reactors. PMID:15689239
DOE Office of Scientific and Technical Information (OSTI.GOV)
Das, M.; Bik, D.P.; Bickers, D.R.
1986-03-05
Naturally occurring plant phenols such as tannic acid (TA), quercetin (QT), myricetin (MY) and anthraflavic acid (AA) have been shown to inhibit the mutagenicity of several bay-region diolepoxides of PAHs. Since skin is a target for PAH carcinogenesis, they investigated the effect of these plant phenols on epidermal aryl hydrocarbon hydroxylase (AHH) activity and the binding of PAHs to DNA in SENCAR mice. Each of the plant phenols tested was found to be an in vitro and in vivo inhibitor of epidermal AHH activity with I/sub 50/ values ranging from 4.4 x 10/sup -5/ - 12.4 x 10/sup -5/M inmore » control and 3-methylcholanthrene (MCA) pretreated skin. On an equimolar basis TA was the most potent inhibitor with a Ki of 81 ..mu..M. Incubation of TA, QT, MY and AA with epidermal microsomes resulted in varying degrees of inhibition of enzyme mediated covalent binding of benzo(a)pyrene (BP) to calf thymus DNA. TA (25 ..mu..M) showed maximum inhibition (64%). A single topical application (12 ..mu..mol) of TA, QT, MY and AA resulted in significant decrease in the binding of BP, BP-7,8-diol and 7,12-dimethylbenz(a)anthracene to epidermal DNA. The formation of (+)-7..beta..,8..cap alpha..-dihydroxy-9..cap alpha..,10..cap alpha..-epoxy-7,8,9,10-tetrahydro-BP-deoxyguanine adduct in epidermis was significantly reduced (62-86%) following topical application of the plant phenols. Their results suggest that some of these plant phenols have substantial though variable potential to modify the risk of PAHs induced skin carcinogenicity.« less
Soluble Siglec-5 associates to PSGL-1 and displays anti-inflammatory activity
Pepin, Marion; Mezouar, Soraya; Pegon, Julie; Muczynski, Vincent; Adam, Frédéric; Bianchini, Elsa P.; Bazaa, Amine; Proulle, Valerie; Rupin, Alain; Paysant, Jerome; Panicot-Dubois, Laurence; Christophe, Olivier D.; Dubois, Christophe; Lenting, Peter J.; Denis, Cécile V.
2016-01-01
Interactions between endothelial selectins and the leukocyte counter-receptor PSGL1 mediates leukocyte recruitment to inflammation sites. PSGL1 is highly sialylated, making it a potential ligand for Siglec-5, a leukocyte-receptor that recognizes sialic acid structures. Binding assays using soluble Siglec-5 variants (sSiglec-5/C4BP and sSiglec-5/Fc) revealed a dose- and calcium-dependent binding to PSGL1. Pre-treatment of PSGL1 with sialidase reduced Siglec-5 binding by 79 ± 4%. In confocal immune-fluorescence assays, we observed that 50% of Peripheral Blood Mononuclear Cells (PBMCs) simultaneously express PSGL1 and Siglec-5. Duolink-proximity ligation analysis demonstrated that PSGL1 and Siglec-5 are in close proximity (<40 nm) in 31 ± 4% of PBMCs. In vitro perfusion assays revealed that leukocyte-rolling over E- and P-selectin was inhibited by sSiglec-5/Fc or sSiglec-5/C4BP, while adhesion onto VCAM1 was unaffected. When applied to healthy mice (0.8 mg/kg), sSiglec-5/C4BP significantly reduced the number of rolling leukocytes under basal conditions (10.9 ± 3.7 versus 23.5 ± 9.3 leukocytes/field/min for sSiglec-5/C4BP-treated and control mice, respectively; p = 0.0093). Moreover, leukocyte recruitment was inhibited over a 5-h observation period in an in vivo model of TNFalpha-induced inflammation following injection sSiglec-5/C4BP (0.8 mg/kg). Our data identify PSGL1 as a ligand for Siglec-5, and soluble Siglec-5 variants appear efficient in blocking PSGL1-mediated leukocyte rolling and the inflammatory response in general. PMID:27892504
Ren, Xinguo; Rizavi, Hooriyah S.; Khan, Mansoor A.; Bhaumik, Runa; Dwivedi, Yogesh; Pandey, Ghanshyam N.
2013-01-01
Background Abnormalities of cyclic-AMP (cAMP) response element binding protein (CREB) function has been suggested in bipolar (BP) illness and schizophrenia (SZ), based on both indirect and direct evidence. To further elucidate the role of CREB in these disorders, we studied CREB expression and function in two brain areas implicated in these disorders, i.e., dorsolateral prefrontal cortex (DLPFC) and cingulate gyrus (CG). Methods We determined CREB protein expression using Western blot technique, CRE-DNA binding using gel shift assay, and mRNA expression using real-time RT-polymerase chain reaction (qPCR) in DLPFC and CG of the postmortem brain of BP (n = 19), SZ (n = 20), and normal control (NC, n = 20) subjects. Results We observed that CREB protein and mRNA expression and CRE-DNA binding activity were significantly decreased in the nuclear fraction of DLPFC and CG obtained from BP subjects compared with NC subjects. However, the protein and mRNA expression and CRE-DNA binding in SZ subjects was significantly decreased in CG, but not in DLPFC, compared with NC. Conclusion These studies thus indicate region-specific abnormalities of CREB expression and function in both BP and SZ. They suggest that abnormalities of CREB in CG may be associated with both BP and SZ, but its abnormality in DLPFC is specific to BP illness. PMID:24148789
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ritvos, O.; Ranta, T.; Jalkanen, J.
1988-05-01
The placenta expresses genes for insulin-like growth factors (IGFs) and possesses IGF-receptors, suggesting that placental growth is regulated by IGFs in an autocrine manner. We have previously shown that human decidua, but not placenta, synthesizes and secretes a 34 K IGF-binding protein (34 K IGF-BP) called placental protein 12. We now used human choriocarcinoma JEG-3 cell monolayer cultures and recombinant (Thr59)IGF-I as a model to study whether the decidual 34 K IGF-BP is able to modulate the receptor binding and biological activity of IGFs in trophoblasts. JEG-3 cells, which possess type I IGF receptors, were unable to produce IGF-BPs. Purifiedmore » 34 K IGF-BP specifically bound (125I)iodo-(Thr59)IGF-I. Multiplication-stimulating activity had 2.5% the potency of (Thr59)IGF-I, and insulin had no effect on the binding of (125I) iodo-(Thr59)IGF-I. 34 K IGF-BP inhibited the binding of (125I) iodo-(Thr59)IGF-I to JEG-3 monolayers in a concentration-dependent manner by forming with the tracer a soluble complex that could not bind to the cell surface as demonstrated by competitive binding and cross-linking experiments. After incubating the cell monolayers with (125I)iodo-(Thr59)IGF-I in the presence of purified binding protein, followed by cross-linking, no affinity labeled bands were seen on autoradiography. In contrast, an intensely labeled band at 40 K was detected when the incubation medium was analyzed, suggesting that (Thr59)IGF-I and 34 K IGF-BP formed a complex in a 1:1 molar ratio. Also, 34 K IGF-BP inhibited both basal and IGF-I-stimulated uptake of alpha-(3H)aminoisobutyric acid in JEG-3 cells. RNA analysis revealed that IGF-II is expressed in JEG-3 cells.« less
Serum growth hormone (GH)-binding protein/receptor: an important determinant of GH responsiveness.
Martha, P M; Reiter, E O; Dávila, N; Shaw, M A; Holcombe, J H; Baumann, G
1992-12-01
Individual growth rates (or responses to GH therapy) and adult heights vary over a wide range. The reasons for this variation are poorly understood. Based on the reciprocal relationship between GH production and serum GH-binding protein/receptor (GH-BP), we hypothesized that genetic growth potential was achieved by a specific combination of GH-BP/receptor and GH production in each individual. To address the question whether GH production regulates GH-BP, or vice versa, we studied GH-deficient children, where one of the parameters, GH exposure, could be controlled through exogenous administration. Forty-three untreated prepubertal GH-deficient children were studied before and after 6 and 12 months of GH replacement therapy (0.18 mg/kg.week). Growth velocity, height, bone age, weight and their respective Z scores, serum GH-BP, and serum insulin-like growth factor I (IGF-I) were measured at each time point. The patients responded with significant increases in serum IGF-I, age-adjusted growth velocity, and height (P < 10(-6) for all). Before therapy, GH-BP correlated directly with chronologic and bone age (P < 10(-4), but not with either growth velocity or IGF-I. In contrast, GH-BP correlated strongly with the response to therapy whether assessed as the incremental change in IGF-I (P < 10(-6)) or as the increase in growth velocity (P approximately 0.003). GH treatment had no consistent effect on GH-BP/receptor levels. These findings support the concept that the GH-BP/receptor endowment is characteristic for an individual and plays a pivotal role in somatic growth. The GH-BP/receptor system and its ontogeny appears relatively independent of regulation by GH. Differences in individual GH-BP/GH receptor complement account for some of the variability in the response to GH, and GH-BP levels may serve as a predictor for the degree of response. The reciprocal relationship between GH production and GH-BP in normal subjects probably results from adjustment of GH secretion to accommodate the prevailing GH-BP/receptor environment.
Hu, Qi; Botuyan, Maria Victoria; Cui, Gaofeng; Zhao, Debiao
2017-01-01
Summary The protein 53BP1 plays a central regulatory role in DNA double-strand break repair. 53BP1 relocates to chromatin by recognizing RNF168-mediated mono-ubiquitylation of histone H2A Lys15 in the nucleosome core particle dimethylated at histone H4 Lys20 (NCP-ubme). 53BP1 relocation is terminated by ubiquitin ligases RNF169 and RAD18 via unknown mechanisms. Using NMR spectroscopy and biochemistry, we show that RNF169 bridges ubiquitin and histone surfaces, stabilizing a pre-existing ubiquitin orientation in NCP-ubme to form a high-affinity complex. This conformational selection mechanism contrasts with the low-affinity binding mode of 53BP1 and ensures 53BP1 displacement by RNF169 from NCP-ubme. We also show that RAD18 binds tightly to NCP-ubme through a ubiquitin-binding domain that contacts ubiquitin and nucleosome surfaces accessed by 53BP1. Our work uncovers diverse ubiquitin recognition mechanisms in the nucleosome, explaining how RNF168, RNF169 and RAD18 regulate 53BP1 chromatin recruitment and how specificity can be achieved in the recognition of a ubiquitin-modified substrate. PMID:28506460
Tichauer, K M; Samkoe, K S; Klubben, W S; Hasan, T; Pogue, B W
2012-01-01
The quantification of tumor molecular expression in vivo could have a significant impact for informing and monitoring immerging targeted therapies in oncology. Molecular imaging of targeted tracers can be used to quantify receptor expression in the form of a binding potential (BP) if the arterial input curve or a surrogate of it is also measured. However, the assumptions of the most common approaches (reference tissue models) may not be valid for use in tumors. In this study, the validity of reference tissue models is investigated for use in tumors experimentally and in simulations. Three different tumor lines were grown subcutaneously in athymic mice and the mice were injected with a mixture of an epidermal growth factor receptor- (EGFR-) targeted fluorescent tracer and an untargeted fluorescent tracer. A one-compartment plasma input model demonstrated that the transport kinetics of both tracers were significantly different between tumors and all potential reference tissues, and using the reference tissue model resulted in a theoretical underestimation in BP of 50 ± 37%. On the other hand, the targeted and untargeted tracers demonstrated similar transport kinetics, allowing a dual-tracer approach to be employed to accurately estimate binding potential (with a theoretical error of 0.23 ± 9.07%). These findings highlight the potential for using a dual-tracer approach to quantify receptor expression in tumors with abnormal hemodynamics, possibly to inform the choice or progress of molecular cancer therapies. PMID:23022732
Searle, Graham; Beaver, John D; Comley, Robert A; Bani, Massimo; Tziortzi, Andri; Slifstein, Mark; Mugnaini, Manolo; Griffante, Cristiana; Wilson, Alan A; Merlo-Pich, Emilio; Houle, Sylvain; Gunn, Roger; Rabiner, Eugenii A; Laruelle, Marc
2010-08-15
Dopamine D(3) receptors are involved in the pathophysiology of several neuropsychiatric conditions. [(11)C]-(+)-PHNO is a radiolabeled D(2) and D(3) agonist, suitable for imaging the agonist binding sites (denoted D(2HIGH) and D(3)) of these receptors with positron emission tomography (PET). PET studies in nonhuman primates documented that, in vivo, [(11)C]-(+)-PHNO displays a relative selectivity for D(3) compared with D(2HIGH) receptor sites and that the [(11)C]-(+)-PHNO signal is enriched in D(3) contribution compared with conventional ligands such as [(11)C] raclopride. To define the D(3) contribution (f(PHNO)(D3)) to [(11)C]-(+)-PHNO binding potential (BP(ND)) in healthy humans, 52 PET scans were obtained in 19 healthy volunteers at baseline and following oral administration of various doses of the selective D(3) receptor antagonist, GSK598809. The impact of GSK598809 on [(11)C]-(+)-PHNO was regionally selective. In dorsal regions of the striatum, GSK598809 did not significantly affect [(11)C]-(+)-PHNO BP(ND) (f(PHNO)(D3) approximately 0%). Conversely, in the substantia nigra, GSK598809 dose-dependently reduced [(11)C]-(+)-PHNO binding to nonspecific level (f(PHNO)(D3) approximately 100%). In ventral striatum (VST), globus pallidus and thalamus (THA), [(11)C]-(+)-PHNO BP(ND) was attributable to a combination of D(2HIGH) and D(3) receptor sites, with f(PHNO)(D3) of 26%, 67% and 46%, respectively. D(3) receptor binding potential (BP(ND)(D3)) was highest in globus pallidus (1.90) and substantial nigra (1.39), with lower levels in VST (.77) and THA (.18) and negligible levels in dorsal striatum. This study elucidated the pharmacologic nature of the [(11)C]-(+)-PHNO signal in healthy subjects and provided the first quantification of D(3) receptor availability with PET in the living human brain. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Ito, Hiroshi; Ikoma, Yoko; Seki, Chie; Kimura, Yasuyuki; Kawaguchi, Hiroshi; Takuwa, Hiroyuki; Ichise, Masanori; Suhara, Tetsuya; Kanno, Iwao
2017-05-01
Objectives In PET studies for neuroreceptors, tracer kinetics are described by the two-tissue compartment model (2-TCM), and binding parameters, including the total distribution volume (V T ), non-displaceable distribution volume (V ND ), and binding potential (BP ND ), can be determined from model parameters estimated by kinetic analysis. The stability of binding parameter estimates depends on the kinetic characteristics of radioligands. To describe these kinetic characteristics, we previously developed a two-phase graphic plot analysis in which V ND and V T can be estimated from the x-intercept of regression lines for early and delayed phases, respectively. In this study, we applied this graphic plot analysis to visual evaluation of the kinetic characteristics of radioligands for neuroreceptors, and investigated a relationship between the shape of these graphic plots and the stability of binding parameters estimated by the kinetic analysis with 2-TCM in simulated brain tissue time-activity curves (TACs) with various binding parameters. Methods 90-min TACs were generated with the arterial input function and assumed kinetic parameters according to 2-TCM. Graphic plot analysis was applied to these simulated TACs, and the curvature of the plot for each TAC was evaluated visually. TACs with several noise levels were also generated with various kinetic parameters, and the bias and variation of binding parameters estimated by kinetic analysis were calculated in each TAC. These bias and variation were compared with the shape of graphic plots. Results The graphic plots showed larger curvature for TACs with higher specific binding and slower dissociation of specific binding. The quartile deviations of V ND and BP ND determined by kinetic analysis were smaller for radioligands with slow dissociation. Conclusions The larger curvature of graphic plots for radioligands with slow dissociation might indicate a stable determination of V ND and BP ND by kinetic analysis. For investigation of the kinetics of radioligands, such kinetic characteristics should be considered.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
IGF2BP3 modulates the interaction of invasion-associated transcripts with RISC
Ennajdaoui, Hanane; Howard, Jonathan M.; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J.; Uren, Philip J.; Dargyte, Marija; Katzman, Sol; Draper, Jolene M.; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C.; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D.; Toloue, Masoud M.; Blencowe, Benjamin J.; Penalva, Luiz O.F.; Sanford, Jeremy R.
2016-01-01
Summary Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy. But its role(s) in pathogenesis remain enigmatic. Here, we interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches we identify 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual-nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and miRNA binding sites. IGF2BP3 promotes association of the RNA induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. PMID:27210763
Release kinetics of circulating cardiac myosin binding protein-C following cardiac injury
Kuster, Diederik W. D.; Cardenas-Ospina, Adriana; Miller, Lawson; Liebetrau, Christoph; Troidl, Christian; Nef, Holger M.; Möllmann, Helge; Hamm, Christian W.; Pieper, Karen S.; Mahaffey, Kenneth W.; Kleiman, Neal S.; Stuyvers, Bruno D.; Marian, Ali J.
2013-01-01
Diagnosis of myocardial infarction (MI) is based on ST-segment elevation on electrocardiographic evaluation and/or elevated plasma cardiac troponin (cTn) levels. However, troponins lack the sensitivity required to detect the onset of MI at its earliest stages. Therefore, to confirm its viability as an ultra-early biomarker of MI, this study investigates the release kinetics of cardiac myosin binding protein-C (cMyBP-C) in a porcine model of MI and in two human cohorts. Release kinetics of cMyBP-C were determined in a porcine model of MI (n = 6, pigs, either sex) by measuring plasma cMyBP-C level serially from 30 min to 14 days after coronary occlusion, with use of a custom-made immunoassay. cMyBP-C plasma levels were increased from baseline (76 ± 68 ng/l) at 3 h (767 ± 211 ng/l) and peaked at 6 h (2,418 ± 780 ng/l) after coronary ligation. Plasma cTnI, cTnT, and myosin light chain-3 levels were all increased 6 h after ligation. In a cohort of patients (n = 12) with hypertrophic obstructive cardiomyopathy undergoing transcoronary ablation of septal hypertrophy, cMyBP-C was significantly increased from baseline (49 ± 23 ng/l) in a time-dependent manner, peaking at 4 h (560 ± 273 ng/l). In a cohort of patients with non-ST segment elevation MI (n = 176) from the SYNERGY trial, cMyBP-C serum levels were significantly higher (7,615 ± 4,514 ng/l) than those in a control cohort (416 ± 104 ng/l; n = 153). cMyBP-C is released in the blood rapidly after cardiac damage and therefore has the potential to positively mark the onset of MI. PMID:24337456
Phosphorylation and calcium antagonistically tune myosin-binding protein C’s structure and function
Previs, Michael J.; Mun, Ji Young; Michalek, Arthur J.; Previs, Samantha Beck; Gulick, James; Robbins, Jeffrey; Warshaw, David M.; Craig, Roger
2016-01-01
During each heartbeat, cardiac contractility results from calcium-activated sliding of actin thin filaments toward the centers of myosin thick filaments to shorten cellular length. Cardiac myosin-binding protein C (cMyBP-C) is a component of the thick filament that appears to tune these mechanochemical interactions by its N-terminal domains transiently interacting with actin and/or the myosin S2 domain, sensitizing thin filaments to calcium and governing maximal sliding velocity. Both functional mechanisms are potentially further tunable by phosphorylation of an intrinsically disordered, extensible region of cMyBP-C’s N terminus, the M-domain. Using atomic force spectroscopy, electron microscopy, and mutant protein expression, we demonstrate that phosphorylation reduced the M-domain’s extensibility and shifted the conformation of the N-terminal domain from an extended structure to a compact configuration. In combination with motility assay data, these structural effects of M-domain phosphorylation suggest a mechanism for diminishing the functional potency of individual cMyBP-C molecules. Interestingly, we found that calcium levels necessary to maximally activate the thin filament mitigated the structural effects of phosphorylation by increasing M-domain extensibility and shifting the phosphorylated N-terminal fragments back to the extended state, as if unphosphorylated. Functionally, the addition of calcium to the motility assays ablated the impact of phosphorylation on maximal sliding velocities, fully restoring cMyBP-C’s inhibitory capacity. We conclude that M-domain phosphorylation may have its greatest effect on tuning cMyBP-C’s calcium-sensitization of thin filaments at the low calcium levels between contractions. Importantly, calcium levels at the peak of contraction would allow cMyBP-C to remain a potent contractile modulator, regardless of cMyBP-C’s phosphorylation state. PMID:26908872
Wang, Guohao; Xu, Yuquan
2012-01-01
Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyazaki, Masaya; Nishihara, Hiroshi, E-mail: hnishihara@med.hokudai.ac.jp; Hasegawa, Hideki
Highlights: •NS1 induced excessive phosphorylation of ERK and elevated cell viability. •NS1-BP expression and CRKL knockdown abolished survival effect of NS1. •NS1-BP and NS1 formed the complex through the interaction with CRKL-SH3(N). -- Abstract: The influenza A virus non-structural protein 1 (NS1) is a multifunctional virulence factor consisting of an RNA binding domain and several Src-homology (SH) 2 and SH3 binding motifs, which promotes virus replication in the host cell and helps to evade antiviral immunity. NS1 modulates general host cell physiology in association with various cellular molecules including NS1-binding protein (NS1-BP) and signaling adapter protein CRK-like (CRKL), while themore » physiological role of NS1-BP during influenza A virus infection especially in association with NS1 remains unclear. In this study, we analyzed the intracellular association of NS1-BP, NS1 and CRKL to elucidate the physiological roles of these molecules in the host cell. In HEK293T cells, enforced expression of NS1 of A/Beijing (H1N1) and A/Indonesia (H5N1) significantly induced excessive phosphorylation of ERK and elevated cell viability, while the over-expression of NS1-BP and the abrogation of CRKL using siRNA abolished such survival effect of NS1. The pull-down assay using GST-fusion CRKL revealed the formation of intracellular complexes of NS1-BP, NS1 and CRKL. In addition, we identified that the N-terminus SH3 domain of CRKL was essential for binding to NS1-BP using GST-fusion CRKL-truncate mutants. This is the first report to elucidate the novel function of NS1-BP collaborating with viral protein NS1 in modulation of host cell physiology. In addition, an alternative role of adaptor protein CRKL in association with NS1 and NS1-BP during influenza A virus infection is demonstrated.« less
Hu, Qi; Botuyan, Maria Victoria; Cui, Gaofeng; Zhao, Debiao; Mer, Georges
2017-05-18
The protein 53BP1 plays a central regulatory role in DNA double-strand break repair. 53BP1 relocates to chromatin by recognizing RNF168-mediated mono-ubiquitylation of histone H2A Lys15 in the nucleosome core particle dimethylated at histone H4 Lys20 (NCP-ubme). 53BP1 relocation is terminated by ubiquitin ligases RNF169 and RAD18 via unknown mechanisms. Using nuclear magnetic resonance (NMR) spectroscopy and biochemistry, we show that RNF169 bridges ubiquitin and histone surfaces, stabilizing a pre-existing ubiquitin orientation in NCP-ubme to form a high-affinity complex. This conformational selection mechanism contrasts with the low-affinity binding mode of 53BP1, and it ensures 53BP1 displacement by RNF169 from NCP-ubme. We also show that RAD18 binds tightly to NCP-ubme through a ubiquitin-binding domain that contacts ubiquitin and nucleosome surfaces accessed by 53BP1. Our work uncovers diverse ubiquitin recognition mechanisms in the nucleosome, explaining how RNF168, RNF169, and RAD18 regulate 53BP1 chromatin recruitment and how specificity can be achieved in the recognition of a ubiquitin-modified substrate. Copyright © 2017 Elsevier Inc. All rights reserved.
Wooster, David G; Maruvada, Ravi; Blom, Anna M; Prasadarao, Nemani V
2006-01-01
Meningitis caused by Escherichia coli K1 is a serious illness in neonates with neurological sequelae in up to 50% of survivors. A high degree of bacteremia is required for E. coli K1 to cross the blood–brain barrier, which suggests that the bacterium must evade the host defence mechanisms and survive in the bloodstream. We previously showed that outer membrane protein A (OmpA) of E. coli binds C4b-binding protein (C4bp), an inhibitor of complement activation via the classical pathway. Nevertheless, the exact mechanism by which E. coli K1 survives in serum remains elusive. Here, we demonstrate that log phase (LP) OmpA+E. coli K1 avoids serum bactericidal activity more effectively than postexponential phase bacteria. OmpA–E. coli cannot survive in serum grown to either phase. The increased serum resistance of LP OmpA+E. coli is the result of increased binding of C4bp, with a concomitant decrease in the deposition of C3b and the downstream complement proteins responsible for the formation of the membrane attack complex. C4bp bound to E. coli K1 acts as a cofactor to factor I in the cleavage of both C3b and C4b, which shuts down the ensuing complement cascade. Accordingly, a peptide corresponding to the complement control protein domain 3 of C4bp sequence, was able to compete with C4bp binding to OmpA and cause increased deposition of C3b. Thus, binding of C4bp appears to be responsible for survival of E. coli K1 in human serum. PMID:16556262
Ackermann, Maegen A.; Patel, Puja D.; Valenti, Jane; Takagi, Yasuharu; Homsher, Earl; Sellers, James R.; Kontrogianni-Konstantopoulos, Aikaterini
2013-01-01
Myosin binding protein C (MyBP-C) is expressed in striated muscles, where it plays key roles in the modulation of actomyosin cross-bridges. Slow MyBP-C (sMyBP-C) consists of multiple variants sharing common domains but also containing unique segments within the NH2 and COOH termini. Two missense mutations in the NH2 terminus (W236R) and COOH terminus (Y856H) of sMyBP-C have been causally linked to the development of distal arthrogryposis-1 (DA-1), a severe skeletal muscle disorder. Using a combination of in vitro binding and motility assays, we show that the COOH terminus mediates binding of sMyBP-C to thick filaments, while the NH2 terminus modulates the formation of actomyosin cross-bridges in a variant-specific manner. Consistent with this, a recombinant NH2-terminal peptide that excludes residues 34–59 reduces the sliding velocity of actin filaments past myosin heads from 9.0 ± 1.3 to 5.7 ± 1.0 μm/s at 0.1 μM, while a recombinant peptide that excludes residues 21–59 fails to do so. Notably, the actomyosin regulatory properties of sMyBP-C are completely abolished by the presence of the DA-1 mutations. In summary, our studies are the first to show that the NH2 and COOH termini of sMyBP-C have distinct functions, which are regulated by differential splicing, and are compromized by the presence of missense point mutations linked to muscle disease.—Ackermann, M. A., Patel, P. D., Valenti, J., Takagi, Y., Homsher, E., Sellers, J. R., Kontrogiannni-Konstantopoulos, A. Loss of actomyosin regulation in distal arthrogryposis myopathy due to mutant myosin binding protein-C slow. PMID:23657818
SH3BP2 is an activator of NFAT Activity and Osteoclastogenesis
Lietman, Steven A.; Yin, Lihong; Levine, Michael A.
2009-01-01
Heterozygous activating mutations in exon 9 of SH3BP2 have been found in most patients with cherubism, an unusual genetic syndrome characterized by excessive remodeling of the mandible and maxilla due to spontaneous and excessive osteoclastic bone resorption. Osteoclasts differentiate after binding of sRANKL to RANK induces a number of downstream signaling effects, including activation of the calcineurin/NFAT (nuclear factor of activated T cells) pathway. Here we have investigated the functional significance of SH3BP2 protein on osteoclastogenesis in the presence of sRANKL. Our results indicate that SH3BP2 both increases nuclear NFATc1 in sRANKL treated RAW 264.7 preosteoclast cells and enhances expression of tartrate resistant acid phosphatase (TRAP), a specific marker of osteoclast differentiation. Moreover, overexpression of SH3BP2 in RAW 264.7 cells potentiates sRANKL stimulated phosphorylation of PLCγ1 and 2, thus providing a mechanistic pathway for the rapid translocation of NFATc1 into the nucleus and increased osteoclastogenesis in cherubism. PMID:18440306
Nuclear localisation of 53BP1 is regulated by phosphorylation of the nuclear localisation signal.
von Morgen, Patrick; Lidak, Tomas; Horejsi, Zuzana; Macurek, Libor
2018-06-01
Repair of damaged DNA is essential for maintaining genomic stability. TP53-binding protein 1 (53BP1) plays an important role in repair of the DNA double-strand breaks. Nuclear localisation of 53BP1 depends on importin β and nucleoporin 153, but the type and location of 53BP1 nuclear localisation signal (NLS) have yet to be determined. Here, we show that nuclear import of 53BP1 depends on two basic regions, namely 1667-KRK-1669 and 1681-KRGRK-1685, which are both needed for importin binding. Lysine 1667 is essential for interaction with importin and its substitution to arginine reduced nuclear localisation of 53BP1. Furthermore, we have found that CDK1-dependent phosphorylation of 53BP1 at S1678 impairs importin binding during mitosis. Phosphorylation-mimicking mutant S1678D showed reduced nuclear localisation, suggesting that phosphorylation of the NLS interferes with nuclear import of the 53BP1 CONCLUSIONS: We show that 53BP1 contains a classical bipartite NLS 1666-GKRKLITSEEERSPAKRGRKS-1686, which enables the importin-mediated nuclear transport of 53BP1. Additionally, we found that posttranslational modification within the NLS region can regulate 53BP1 nuclear import. Our results indicate that integrity of the NLS is important for 53BP1 nuclear localisation. Precise mapping of the NLS will facilitate further studies on the effect of posttranslational modifications and somatic mutations on the nuclear localisation 53BP1 and DNA repair. © 2018 Société Française des Microscopies and Société de Biologie Cellulaire de France. Published by John Wiley & Sons Ltd.
Kapetanopoulos, Katharina; Braukmann, Sandra; Gebauer, Wolfgang; Tenzer, Stefan; Markl, Jürgen
2012-01-01
Nicotinic acetylcholine receptors (nAChR) play important neurophysiological roles and are of considerable medical relevance. They have been studied extensively, greatly facilitated by the gastropod acetylcholine-binding proteins (AChBP) which represent soluble structural and functional homologues of the ligand-binding domain of nAChR. All these proteins are ring-like pentamers. Here we report that AChBP exists in the hemolymph of the planorbid snail Biomphalaria glabrata (vector of the schistosomiasis parasite) as a regular pentagonal dodecahedron, 22 nm in diameter (12 pentamers, 60 active sites). We sequenced and recombinantly expressed two ∼25 kDa polypeptides (BgAChBP1 and BgAChBP2) with a specific active site, N-glycan site and disulfide bridge variation. We also provide the exon/intron structures. Recombinant BgAChBP1 formed pentamers and dodecahedra, recombinant BgAChBP2 formed pentamers and probably disulfide-bridged di-pentamers, but not dodecahedra. Three-dimensional electron cryo-microscopy (3D-EM) yielded a 3D reconstruction of the dodecahedron with a resolution of 6 Å. Homology models of the pentamers docked to the 6 Å structure revealed opportunities for chemical bonding at the inter-pentamer interfaces. Definition of the ligand-binding pocket and the gating C-loop in the 6 Å structure suggests that 3D-EM might lead to the identification of functional states in the BgAChBP dodecahedron. PMID:22916297
Hashiguchi, Y; Lee, J M; Shiraishi, M; Komatsu, S; Miki, S; Shimasaki, Y; Mochioka, N; Kusakabe, T; Oshima, Y
2015-05-01
Understanding the evolutionary mechanisms of toxin accumulation in pufferfishes has been long-standing problem in toxicology and evolutionary biology. Pufferfish saxitoxin and tetrodotoxin-binding protein (PSTBP) is involved in the transport and accumulation of tetrodotoxin and is one of the most intriguing proteins related to the toxicity of pufferfishes. PSTBPs are fusion proteins consisting of two tandem repeated tributyltin-binding protein type 2 (TBT-bp2) domains. In this study, we examined the evolutionary dynamics of TBT-bp2 and PSTBP genes to understand the evolution of toxin accumulation in pufferfishes. Database searches and/or PCR-based cDNA cloning in nine pufferfish species (6 toxic and 3 nontoxic) revealed that all species possessed one or more TBT-bp2 genes, but PSTBP genes were found only in 5 toxic species belonging to genus Takifugu. These toxic Takifugu species possessed two or three copies of PSTBP genes. Phylogenetic analysis of TBT-bp2 and PSTBP genes suggested that PSTBPs evolved in the common ancestor of Takifugu species by repeated duplications and fusions of TBT-bp2 genes. In addition, a detailed comparison of Takifugu TBT-bp2 and PSTBP gene sequences detected a signature of positive selection under the pressure of gene conversion. The complicated evolutionary dynamics of TBT-bp2 and PSTBP genes may reflect the diversity of toxicity in pufferfishes. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2015 European Society For Evolutionary Biology.
Safari, Roghaiyeh; Salimi, Reza; Tunca, Zeliha; Ozerdem, Aysegul; Ceylan, Deniz; Sakizli, Meral
2016-06-01
Calcium signaling is important for synaptic plasticity, generation of brain rhythms, regulating neuronal excitability, data processing and cognition. Impairment in calcium homeostasis contributed to the development of psychiatric disorders such as bipolar disorder (BP). MCU is the most important calcium transporter in mitochondria inner membrane responsible for influx of Ca[Formula: see text]. MICU1 is linked with MCU and has two canonical EF hands that are vital for its activity and regulates MCU-mediated Ca[Formula: see text] influx. In the current study, we aimed to investigate the role of genetic alteration of EF hand calcium binding motifs of MICU1 on the development of BP. We examined patients with BP, first degree relatives of these patients and healthy volunteers for mutations and polymorphisms in EF hand calcium binding motifs of MICU1. The result showed no SNP/mutation in BP patients, in healthy subjects and in first degree relatives. Additionally, alignment of the EF hand calcium binding regions among species (Gallus-gallus, Canis-lupus-familiaris, Bos-taurus, Mus-musculus, Rattus-norvegicus, Pan-troglodytes, Homosapiens and Danio-rerio) showed exactly the same amino acids (DLNGDGEVDMEE and DCDGNGELSNKE) except in one of the calcium binding domain of Danio-rerio that there was only one difference; leucine instead of Methionine. Our results showed that the SNP on EF-hand Ca[Formula: see text] binding domains of MICU1 gene had no effect in phenotypic characters of BP patients.
Steer, J H; Kroeger, K M; Abraham, L J; Joyce, D A
2000-06-16
Glucocorticoid drugs suppress tumor necrosis factor-alpha (TNF-alpha) synthesis by activated monocyte/macrophages, contributing to an anti-inflammatory action in vivo. In lipopolysaccharide (LPS)-activated human monocytic THP-1 cells, glucocorticoids acted primarily on the TNF-alpha promoter to suppress a burst of transcriptional activity that occurred between 90 min and 3 h after LPS exposure. LPS increased nuclear c-Jun/ATF-2, NF-kappaB(1)/Rel-A, and Rel-A/C-Rel transcription factor complexes, which bound specifically to oligonucleotide sequences from the -106 to -88 base pair (bp) region of the promoter. The glucocorticoid, dexamethasone, suppressed nuclear binding activity of these complexes prior to and during the critical phase of TNF-alpha transcription. Site-directed mutagenesis in TNF-alpha promoter-luciferase reporter constructs showed that the adjacent c-Jun/ATF-2 (-106 to -99 bp) and NF-kappaB (-97 to -88 bp) binding sites each contributed to the LPS-stimulated expression. Mutating both sites largely prevented dexamethasone from suppressing TNF-alpha promoter-luciferase reporters. LPS exposure also increased nuclear Egr-1 and PU.1 abundance. The Egr-1/Sp1 (-172 to -161 bp) binding sites and the PU.1-binding Ets site (-116 to -110 bp) each contributed to the LPS-stimulated expression but not to glucocorticoid response. Dexamethasone suppressed the abundance of the c-Fos/c-Jun complex in THP-1 cell nuclei, but there was no direct evidence for c-Fos/c-Jun transactivation through sites in the -172 to -52 bp region. Small contributions to glucocorticoid response were attributable to promoter sequences outside the -172 to -88 bp region and to sequences in the TNF-alpha 3'-untranslated region. We conclude that glucocorticoids suppress LPS-stimulated secretion of TNF-alpha from human monocytic cells largely through antagonizing transactivation by c-Jun/ATF-2 and NF-kappaB complexes at binding sites in the -106 to -88 bp region of the TNF-alpha promoter.
Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.
1997-01-01
Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans. PMID:9371826
Zhou, Y; Xu, B C; Maheshwari, H G; He, L; Reed, M; Lozykowski, M; Okada, S; Cataldo, L; Coschigamo, K; Wagner, T E; Baumann, G; Kopchick, J J
1997-11-25
Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans.
Clemens, Michael J; Elia, Androulla; Morley, Simon J
2013-01-01
The protein kinase mammalian target of rapamycin (mTOR) regulates the phosphorylation and activity of several proteins that have the potential to control translation, including p70S6 kinase and the eIF4E binding proteins 4E-BP1 and 4E-BP2. In spite of this, in exponentially growing cells overall protein synthesis is often resistant to mTOR inhibitors. We report here that sensitivity of wild-type mouse embryonic fibroblasts (MEFs) to mTOR inhibitors can be greatly increased when the cells are subjected to the physiological stress imposed by hypertonic conditions. In contrast, protein synthesis in MEFs with a double knockout of 4E-BP1 and 4E-BP2 remains resistant to mTOR inhibitors under these conditions. Phosphorylation of p70S6 kinase and protein kinase B (Akt) is blocked by the mTOR inhibitor Ku0063794 equally well in both wild-type and 4E-BP knockout cells, under both normal and hypertonic conditions. The response of protein synthesis to hypertonic stress itself does not require the 4E-BPs. These data suggest that under certain stress conditions: (i) translation has a greater requirement for mTOR activity and (ii) there is an absolute requirement for the 4E-BPs for regulation by mTOR. Importantly, dephosphorylation of p70S6 kinase and Akt is not sufficient to affect protein synthesis acutely.
Wang, Li; Sadayappan, Sakthivel; Kawai, Masakata
2014-01-01
Based on our recent finding that cardiac myosin binding protein C (cMyBP-C) phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302), DAD (Asp273-Ala282-Asp302), SAS (Ser273-Ala282-Ser302), and t/t (cMyBP-C null) genotypes, and the results were compared to transgenic mice expressing wide-type (WT) cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi), and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc), and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases. PMID:25420047
Wang, Li; Sadayappan, Sakthivel; Kawai, Masakata
2014-01-01
Based on our recent finding that cardiac myosin binding protein C (cMyBP-C) phosphorylation affects muscle contractility in a site-specific manner, we further studied the force per cross-bridge and the kinetic constants of the elementary steps in the six-state cross-bridge model in cMyBP-C mutated transgenic mice for better understanding of the influence of cMyBP-C phosphorylation on contractile functions. Papillary muscle fibres were dissected from cMyBP-C mutated mice of ADA (Ala273-Asp282-Ala302), DAD (Asp273-Ala282-Asp302), SAS (Ser273-Ala282-Ser302), and t/t (cMyBP-C null) genotypes, and the results were compared to transgenic mice expressing wide-type (WT) cMyBP-C. Sinusoidal analyses were performed with serial concentrations of ATP, phosphate (Pi), and ADP. Both t/t and DAD mutants significantly reduced active tension, force per cross-bridge, apparent rate constant (2πc), and the rate constant of cross-bridge detachment. In contrast to the weakened ATP binding and enhanced Pi and ADP release steps in t/t mice, DAD mice showed a decreased ADP release without affecting the ATP binding and the Pi release. ADA showed decreased ADP release, and slightly increased ATP binding and cross-bridge detachment steps, whereas SAS diminished the ATP binding step and accelerated the ADP release step. t/t has the broadest effects with changes in most elementary steps of the cross-bridge cycle, DAD mimics t/t to a large extent, and ADA and SAS predominantly affect the nucleotide binding steps. We conclude that the reduced tension production in DAD and t/t is the result of reduced force per cross-bridge, instead of the less number of strongly attached cross-bridges. We further conclude that cMyBP-C is an allosteric activator of myosin to increase cross-bridge force, and its phosphorylation status modulates the force, which is regulated by variety of protein kinases.
Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.
2012-01-01
Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882
Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A
2012-08-21
Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.
Van Laere, Koen; Clerinx, Kristien; D'Hondt, Eduard; de Groot, Tjibbe; Vandenberghe, Wim
2010-04-01
Striatal dopamine D(2) receptor (D2R) PET has been proposed to differentiate between Parkinson disease (PD) and multiple-system atrophy with predominant parkinsonism (MSA-P). However, considerable overlap in striatal D(2) binding may exist between PD and MSA-P. It has been shown that imaging of neuronal activity, as determined by metabolism or perfusion, can also help distinguish PD from MSA-P. We investigated whether the differential diagnostic value of (11)C-raclopride PET could be improved by dynamic scan analysis combining D2R binding and regional tracer influx. (11)C-raclopride PET was performed in 9 MSA-P patients (mean age +/- SD, 56.2 +/- 10.2 y; disease duration, 2.9 +/- 0.8 y; median Hoehn-Yahr score, 3), 10 PD patients (mean age +/- SD, 65.7 +/- 8.1 y; disease duration, 3.3 +/- 1.5 y; median Hoehn-Yahr score, 1.5), and 10 healthy controls (mean age +/- SD, 61.6 +/- 6.5 y). Diagnosis was obtained after prolonged follow-up (MSA-P, 5.5 +/- 2.0 y; PD, 6.0 +/- 2.3 y) using validated clinical criteria. Spatially normalized parametric images of binding potential (BP) and local influx ratio (R(1) = K(1)/K'(1)) of (11)C-raclopride were obtained using a voxelwise reference tissue model with occipital cortex as reference region. Stepwise forward discriminant analysis with cross-validation, with and without the inclusion of regional R(1) values, was performed using a predefined volume-of-interest template. Using conventional BP values, we correctly classified 65.5% (all values given with cross-validation) of 29 cases only. The combination of BP and R(1) information increased discrimination accuracy to 79.3%. When healthy controls were not included and patients only were considered, BP information alone discriminated PD and MSA-P in 84.2% of cases, but the combination with R(1) data increased accuracy to 100%. Discriminant analysis using combined striatal D2R BP and cerebral influx ratio information of a single dynamic (11)C-raclopride PET scan distinguishes MSA-P and PD patients with high accuracy and is superior to conventional methods of striatal D2R binding analysis.
Lynch, Thomas L; Sadayappan, Sakthivel
2014-08-01
Cardiac myosin binding protein-C (cMyBP-C) is a regulatory protein of the contractile apparatus within the cardiac sarcomere. Ischemic injury to the heart during myocardial infarction (MI) results in the cleavage of cMyBP-C in a phosphorylation-dependent manner and release of an N-terminal fragment (C0C1f) into the circulation. C0C1f has been shown to be pathogenic within cardiac tissue, leading to the development of heart failure. Based on its high levels and early release into the circulation post-MI, C0C1f may serve as a novel biomarker for diagnosing MI more effectively than current clinically used biomarkers. Over time, circulating C0C1f could trigger an autoimmune response leading to myocarditis and progressive cardiac dysfunction. Given the importance of cMyBP-C phosphorylation state in the context of proteolytic cleavage and release into the circulation post-MI, understanding the posttranslational modifications (PTMs) of cMyBP-C would help in further elucidating the role of this protein in health and disease. Accordingly, recent studies have implemented the latest proteomics approaches to define the PTMs of cMyBP-C. The use of such proteomics assays may provide accurate quantitation of the levels of cMyBP-C in the circulation following MI, which could, in turn, demonstrate the efficacy of using plasma cMyBP-C as a cardiac-specific early biomarker of MI. In this review, we define the pathogenic and potential immunogenic effects of C0C1f on cardiac function in the post-MI heart. We also discuss the most advanced proteomics approaches now used to determine cMyBP-C PTMs with the aim of validating C0C1f as an early biomarker of MI. © The Authors PROTEOMICS - Clinical Applications Published by Wiley-VCH Verlag GmbH & Co. KGaA.
IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC.
Ennajdaoui, Hanane; Howard, Jonathan M; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J; Uren, Philip J; Dargyte, Marija; Katzman, Sol; Draper, Jolene M; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D; Toloue, Masoud M; Blencowe, Benjamin J; Penalva, Luiz O F; Sanford, Jeremy R
2016-05-31
Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy, but its role(s) in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and microRNA (miRNA) binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Decreased GABA-A binding on FMZ-PET in succinic semialdehyde dehydrogenase deficiency.
Pearl, P L; Gibson, K M; Quezado, Z; Dustin, I; Taylor, J; Trzcinski, S; Schreiber, J; Forester, K; Reeves-Tyer, P; Liew, C; Shamim, S; Herscovitch, P; Carson, R; Butman, J; Jakobs, C; Theodore, W
2009-08-11
Succinic semialdehyde dehydrogenase (SSADH) deficiency is an autosomal recessive disorder of GABA metabolism characterized by elevated levels of GABA and gamma-hydroxybutyric acid. Clinical findings include intellectual impairment, hypotonia, hyporeflexia, hallucinations, autistic behaviors, and seizures. Autoradiographic labeling and slice electrophysiology studies in the murine model demonstrate use-dependent downregulation of GABA(A) receptors. We studied GABA(A) receptor activity in human SSADH deficiency utilizing [(11)C]-flumazenil (FMZ)-PET. FMZ binding was measured in 7 patients, 10 unaffected parents, and 8 healthy controls. Data analysis was performed using a reference region compartmental model, with time-activity curve from pons as the input function. Relative parametric binding potential (BP(ND)) was derived, with MRI-based pixel by pixel partial volume correction, in regions of interest drawn on coregistered MRI. In amygdala, hippocampus, cerebellar vermis, frontal, parietal, and occipital cortex, patients with SSADH deficiency had significant reductions in FMZ BP(ND) compared to parents and controls. Mean cortical values were 6.96 +/- 0.79 (controls), 6.89 +/- 0.71 (parents), and 4.88 +/- 0.77 (patients) (F ratio 16.1; p < 0.001). There were no differences between controls and parents in any cortical region. Succinic semialdehyde dehydrogenase (SSADH) deficient patients show widespread reduction in BZPR binding on [(11)C]-flumazenil-PET. Our results suggest that high endogenous brain GABA levels in SSADH deficiency downregulate GABA(A)-BZPR binding site availability. This finding suggests a potential mechanism for neurologic dysfunction in a serious neurodevelopmental disorder, and suggests that PET may be useful to translate studies in animal models to human disease.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Ackermann, Maegen A; Patel, Puja D; Valenti, Jane; Takagi, Yasuharu; Homsher, Earl; Sellers, James R; Kontrogianni-Konstantopoulos, Aikaterini
2013-08-01
Myosin binding protein C (MyBP-C) is expressed in striated muscles, where it plays key roles in the modulation of actomyosin cross-bridges. Slow MyBP-C (sMyBP-C) consists of multiple variants sharing common domains but also containing unique segments within the NH2 and COOH termini. Two missense mutations in the NH2 terminus (W236R) and COOH terminus (Y856H) of sMyBP-C have been causally linked to the development of distal arthrogryposis-1 (DA-1), a severe skeletal muscle disorder. Using a combination of in vitro binding and motility assays, we show that the COOH terminus mediates binding of sMyBP-C to thick filaments, while the NH2 terminus modulates the formation of actomyosin cross-bridges in a variant-specific manner. Consistent with this, a recombinant NH2-terminal peptide that excludes residues 34-59 reduces the sliding velocity of actin filaments past myosin heads from 9.0 ± 1.3 to 5.7 ± 1.0 μm/s at 0.1 μM, while a recombinant peptide that excludes residues 21-59 fails to do so. Notably, the actomyosin regulatory properties of sMyBP-C are completely abolished by the presence of the DA-1 mutations. In summary, our studies are the first to show that the NH2 and COOH termini of sMyBP-C have distinct functions, which are regulated by differential splicing, and are compromized by the presence of missense point mutations linked to muscle disease.
Di Biase, M A; Zalesky, A; O'keefe, G; Laskaris, L; Baune, B T; Weickert, C S; Olver, J; McGorry, P D; Amminger, G P; Nelson, B; Scott, A M; Hickie, I; Banati, R; Turkheimer, F; Yaqub, M; Everall, I P; Pantelis, C; Cropley, V
2017-08-29
We examined putative microglial activation as a function of illness course in schizophrenia. Microglial activity was quantified using [ 11 C](R)-(1-[2-chrorophynyl]-N-methyl-N-[1-methylpropyl]-3 isoquinoline carboxamide ( 11 C-(R)-PK11195) positron emission tomography (PET) in: (i) 10 individuals at ultra-high risk (UHR) of psychosis; (ii) 18 patients recently diagnosed with schizophrenia; (iii) 15 patients chronically ill with schizophrenia; and, (iv) 27 age-matched healthy controls. Regional-binding potential (BP ND ) was calculated using the simplified reference-tissue model with four alternative reference inputs. The UHR, recent-onset and chronic patient groups were compared to age-matched healthy control groups to examine between-group BP ND differences in 6 regions: dorsal frontal, orbital frontal, anterior cingulate, medial temporal, thalamus and insula. Correlation analysis tested for BP ND associations with gray matter volume, peripheral cytokines and clinical variables. The null hypothesis of equality in BP ND between patients (UHR, recent-onset and chronic) and respective healthy control groups (younger and older) was not rejected for any group comparison or region. Across all subjects, BP ND was positively correlated to age in the thalamus (r=0.43, P=0.008, false discovery rate). No correlations with regional gray matter, peripheral cytokine levels or clinical symptoms were detected. We therefore found no evidence of microglial activation in groups of individuals at high risk, recently diagnosed or chronically ill with schizophrenia. While the possibility of 11 C-(R)-PK11195-binding differences in certain patient subgroups remains, the patient cohorts in our study, who also displayed normal peripheral cytokine profiles, do not substantiate the assumption of microglial activation in schizophrenia as a regular and defining feature, as measured by 11 C-(R)-PK11195 BP ND .
Hansen, Scott B; Sulzenbacher, Gerlind; Huxford, Tom; Marchot, Pascale; Bourne, Yves; Taylor, Palmer
2006-01-01
Nicotinic acetylcholine receptors (nAChRs) are well-characterized allosteric transmembrane proteins involved in the rapid gating of ions elicited by ACh. These receptors belong to the Cys-loop superfamily of ligand-gated ion channels, which also includes GABAA and GABAC, 5-HT3, and glycine receptors. The nAChRs are homo- or heteromeric pentamers of structurally related subunits that encompass an extracellular N-terminal ligand-binding domain, four transmembrane-spanning regions that form the ion channel, and an extended intracellular region between spans 3 and 4. Ligand binding triggers conformational changes that are transmitted to the transmembrane-spanning region, leading to gating and changes in membrane potential. The four transmembrane spans on each of the five subunits create a substantial region of hydrophobicity that precludes facile crystallization of this protein. However the freshwater snail, Lymnaea stagnalis, produces a soluble homopentameric protein, termed the ACh-binding protein (AChBP), which binds ACh (Smit et al., 2001). Its structure was determined recently (Brejc et al., 2001) at high resolution, revealing the structural scaffold for nAChR, and has become a functional and structural surrogate of the nAChR ligand-binding domain. We have characterized an AChBP from Aplysia californica and determined distinct ligand-binding properties when compared to those of L. stagnalis, including ligand specificity for the nAChR alpha7 subtype-specific alpha-conotoxin ImI (Hansen et al., 2004).
Pfeifer, Philippe; Tüscher, Oliver; Buchholz, Hans Georg; Gründer, Gerhard; Vernaleken, Ingo; Paulzen, Michael; Zimmermann, Ulrich S; Maus, Stephan; Lieb, Klaus; Eggermann, Thomas; Fehr, Christoph; Schreckenberger, Mathias
2017-09-01
Investigations on the acute effects of alcohol in the human mesolimbic dopamine D 2 /D 3 receptor system have yielded conflicting results. With respect to the effects of alcohol on extrastriatal D 2 /D 3 dopamine receptors no investigations have been reported yet. Therefore we applied PET imaging using the postsynaptic dopamine D 2 /D 3 receptor ligand [ 18 F]fallypride addressing the question, whether intravenously applied alcohol stimulates the extrastriatal and striatal dopamine system. We measured subjective effects of alcohol and made correlation analyses with the striatal and extrastriatal D 2 /D 3 binding potential. Twenty-four healthy male μ-opioid receptor (OPRM1)118G allele carriers underwent a standardized intravenous and placebo alcohol administration. The subjective effects of alcohol were measured with a visual analogue scale. For the evaluation of the dopamine response we calculated the binding potential (BP ND ) by using the simplified reference tissue model (SRTM). In addition, we calculated distribution volumes (target and reference regions) in 10 subjects for which metabolite corrected arterial samples were available. In the alcohol condition no significant dopamine response in terms of a reduction of BP ND was observed in striatal and extrastriatal brain regions. We found a positive correlation for 'liking' alcohol and the BP ND in extrastriatal brain regions (Inferior frontal cortex (IFC) (r = 0.533, p = 0.007), orbitofrontal cortex (OFC) (r = 0.416, p = 0.043) and prefrontal cortex (PFC) (r = 0.625, p = 0.001)). The acute alcohol effects on the D 2 /D 3 dopamine receptor binding potential of the striatal and extrastriatal system in our experiment were insignificant. A positive correlation of the subjective effect of 'liking' alcohol with cortical D 2 /D 3 receptors may hint at an addiction relevant trait. © 2016 Society for the Study of Addiction.
Takeshita, Yuji; Hashimoto, Yuichi; Nawa, Mikiro; Uchino, Hiroyuki; Matsuoka, Masaaki
2013-01-01
Humanin is a secreted bioactive peptide that suppresses cell toxicity caused by a variety of insults. The neuroprotective effect of Humanin against Alzheimer disease (AD)-related death is mediated by the binding of Humanin to its heterotrimeric Humanin receptor composed of ciliary neurotrophic receptor α, WSX-1, and gp130, as well as the activation of intracellular signaling pathways including a JAK2 and STAT3 signaling axis. Despite the elucidation of the signaling pathways by which Humanin mediates its neuroprotection, the transcriptional targets of Humanin that behaves as effectors of Humanin remains undefined. In the present study, Humanin increased the mRNA and protein expression of SH3 domain-binding protein 5 (SH3BP5), which has been known to be a JNK interactor, in neuronal cells. Similar to Humanin treatment, overexpression of SH3BP5 inhibited AD-related neuronal death, while siRNA-mediated knockdown of endogenous SH3BP5 expression attenuated the neuroprotective effect of Humanin. These results indicate that SH3BP5 is a downstream effector of Humanin. Furthermore, biochemical analysis has revealed that SH3BP5 binds to JNK and directly inhibits JNK through its two putative mitogen-activated protein kinase interaction motifs (KIMs). PMID:23861391
Ettrup, Anders; Hansen, Martin; Santini, Martin A; Paine, James; Gillings, Nic; Palner, Mikael; Lehel, Szabolcs; Herth, Matthias M; Madsen, Jacob; Kristensen, Jesper; Begtrup, Mikael; Knudsen, Gitte M
2011-04-01
Positron emission tomography (PET) imaging of serotonin 2A (5-HT(2A)) receptors with agonist tracers holds promise for the selective labelling of 5-HT(2A) receptors in their high-affinity state. We have previously validated [(11)C]Cimbi-5 and found that it is a 5-HT(2A) receptor agonist PET tracer. In an attempt to further optimize the target-to-background binding ratio, we modified the chemical structure of the phenethylamine backbone and carbon-11 labelling site of [(11)C]Cimbi-5 in different ways. Here, we present the in vivo validation of nine novel 5-HT(2A) receptor agonist PET tracers in the pig brain. Each radiotracer was injected intravenously into anaesthetized Danish Landrace pigs, and the pigs were subsequently scanned for 90 min in a high-resolution research tomography scanner. To evaluate 5-HT(2A) receptor binding, cortical nondisplaceable binding potentials (BP(ND)) were calculated using the simplified reference tissue model with the cerebellum as a reference region. After intravenous injection, all compounds entered the brain and distributed preferentially into the cortical areas, in accordance with the known 5-HT(2A) receptor distribution. The largest target-to-background binding ratio was found for [(11)C]Cimbi-36 which also had a high brain uptake compared to its analogues. The cortical binding of [(11)C]Cimbi-36 was decreased by pretreatment with ketanserin, supporting 5-HT(2A) receptor selectivity in vivo. [(11)C]Cimbi-82 and [(11)C]Cimbi-21 showed lower cortical BP(ND), while [(11)C]Cimbi-27, [(11)C]Cimbi-29, [(11)C]Cimbi-31 and [(11)C]Cimbi-88 gave rise to cortical BP(ND) similar to that of [(11)C]Cimbi-5. [(11)C]Cimbi-36 is currently the most promising candidate for investigation of 5-HT(2A) receptor agonist binding in the living human brain with PET.
The male genital tract is not a pharmacological sanctuary from efavirenz.
Avery, L B; Bakshi, R P; Cao, Y J; Hendrix, C W
2011-07-01
Many antiretroviral (ARV) drugs have large blood plasma-to-seminal plasma (BP/SP) concentration ratios. Concern exists that these drugs do not adequately penetrate the male genital tract (MGT), resulting in the MGT becoming a "pharmacological sanctuary" from these agents, with ineffective MGT concentrations despite effective blood concentrations. Efavirenz (EFV) is the most highly protein-bound ARV drug, with >99% binding in blood plasma and the largest BP/SP total EFV concentration ratio, reportedly ranging from 11 to 33. To evaluate protein binding as an explanation for the differences between the drug concentrations in blood and semen, we developed a novel ultrafiltration method, corrected for the duration of centrifugation, to measure protein binding in the two matrices. In six subjects, protein-free EFV concentrations were the same in blood and semen; the median (interquartile range (IQR)) protein-free EFV SP/BP ratio was 1.21 (0.99-1.35); EFV protein binding was 99.82% (99.79-99.86) in BP and 95.26% (93.24-96.67) in SP. This shows that the MGT is not a sanctuary from EFV.
NASA Astrophysics Data System (ADS)
Constantinescu, C. C.; Yoder, K. K.; Kareken, D. A.; Bouman, C. A.; O'Connor, S. J.; Normandin, M. D.; Morris, E. D.
2008-03-01
We previously developed a model-independent technique (non-parametric ntPET) for extracting the transient changes in neurotransmitter concentration from paired (rest & activation) PET studies with a receptor ligand. To provide support for our method, we introduced three hypotheses of validation based on work by Endres and Carson (1998 J. Cereb. Blood Flow Metab. 18 1196-210) and Yoder et al (2004 J. Nucl. Med. 45 903-11), and tested them on experimental data. All three hypotheses describe relationships between the estimated free (synaptic) dopamine curves (FDA(t)) and the change in binding potential (ΔBP). The veracity of the FDA(t) curves recovered by nonparametric ntPET is supported when the data adhere to the following hypothesized behaviors: (1) ΔBP should decline with increasing DA peak time, (2) ΔBP should increase as the strength of the temporal correlation between FDA(t) and the free raclopride (FRAC(t)) curve increases, (3) ΔBP should decline linearly with the effective weighted availability of the receptor sites. We analyzed regional brain data from 8 healthy subjects who received two [11C]raclopride scans: one at rest, and one during which unanticipated IV alcohol was administered to stimulate dopamine release. For several striatal regions, nonparametric ntPET was applied to recover FDA(t), and binding potential values were determined. Kendall rank-correlation analysis confirmed that the FDA(t) data followed the expected trends for all three validation hypotheses. Our findings lend credence to our model-independent estimates of FDA(t). Application of nonparametric ntPET may yield important insights into how alterations in timing of dopaminergic neurotransmission are involved in the pathologies of addiction and other psychiatric disorders.
Bolia, Ashini; Gerek, Z. Nevin; Ozkan, S. Banu
2016-01-01
Molecular docking serves as an important tool in modeling protein–ligand interactions. However, it is still challenging to incorporate overall receptor flexibility, especially backbone flexibility, in docking due to the large conformational space that needs to be sampled. To overcome this problem, we developed a novel flexible docking approach, BP-Dock (Backbone Perturbation-Dock) that can integrate both backbone and side chain conformational changes induced by ligand binding through a multi-scale approach. In the BP-Dock method, we mimic the nature of binding-induced events as a first-order approximation by perturbing the residues along the protein chain with a small Brownian kick one at a time. The response fluctuation profile of the chain upon these perturbations is computed using the perturbation response scanning method. These response fluctuation profiles are then used to generate binding-induced multiple receptor conformations for ensemble docking. To evaluate the performance of BP-Dock, we applied our approach on a large and diverse data set using unbound structures as receptors. We also compared the BP-Dock results with bound and unbound docking, where overall receptor flexibility was not taken into account. Our results highlight the importance of modeling backbone flexibility in docking for recapitulating the experimental binding affinities, especially when an unbound structure is used. With BP-Dock, we can generate a wide range of binding site conformations realized in nature even in the absence of a ligand that can help us to improve the accuracy of unbound docking. We expect that our fast and efficient flexible docking approach may further aid in our understanding of protein–ligand interactions as well as virtual screening of novel targets for rational drug design. PMID:24380381
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gourinath, S., E-mail: sgourinath@mail.jnu.ac.in; Padhan, Narendra; Alam, Neelima
2005-04-01
Calcium-binding protein-2 (EhCaBP2) crystals were grown using MPD as a precipitant. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. Calcium plays a pivotal role in the pathogenesis of amoebiasis, a major disease caused by Entamoeba histolytica. Two domains with four canonical EF-hand-containing calcium-binding proteins (CaBPs) have been identified from E. histolytica. Even though they have very high sequence similarity, these bind to different target proteins in a Ca{sup 2+}-dependent manner, leading to different functional pathways. Calcium-binding protein-2 (EhCaBP2) crystals were grown usingmore » MPD as a precipitant. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 111.74, b = 68.83, c = 113.25 Å, β = 116.7°. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 69.18, b = 112.03, c = 93.42 Å, β = 92.8°. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. This complex was crystallized with MPD and ethanol as precipitating agents. These crystals belong to space group P2{sub 1}, with unit-cell parameters a = 60.5, b = 69.86, c = 86.5 Å, β = 97.9°.« less
Zhang, Kun; Liang, Jie; Chuai, Yucai; Li, Yuan; Wang, Xiaoming
2012-01-01
Calcyclin-binding protein (CacyBP/SIP), identified on the basis of its ability to interact with S100 proteins in a calcium-dependent manner, was previously found to inhibit the proliferation and tumorigenesis of gastric cancer cells in our laboratory. Importantly, the effects of S100 proteins on the biological behavior of CacyBP/SIP in gastric cancer remain unclear. Herein, we report the construction of eukaryotic expression vectors for wild-type CacyBP/SIP and a truncated mutant lacking the S100 protein binding domain (CacyBP/SIPΔS100). The expressions of the wild-type and truncated recombinant proteins were demonstrated by transfection of MKN45 gastric cancer cells. Co-immunoprecipitation assays demonstrated interaction between S100A6 and wild-type CacyBP/SIP in MKN45 cells. Removal of the S100 protein binding domain dramatically reduced the affinity of CacyBP/SIP for S100 proteins as indicated by reduced co-immunoprecipitation of S100A6 by CacyBP/SIPΔS100. The MTT assay, FACS assay, clonogenic assay and tumor xenograft experiment were performed to assess the effect of CacyBP/SIP on cell growth and tumorigenesis in vitro and in vivo. Overexpression of CacyBP/SIP inhibited the proliferation and tumorigenesis of MKN45 gastric cancer cells; the proliferation and tumorigenesis rates were even further reduced by the expression of CacyBP/SIPΔS100. We also showed that S100 proteins negatively regulate CacyBP/SIP-mediated inhibition of gastric cancer cell proliferation, through an effect on β-catenin protein expression and transcriptional activation of Tcf/LEF. Although the underlying mechanism of action requires further investigation, this study provides new insight into the interaction between S100 proteins and CacyBP/SIP, which might enrich our knowledge of S100 proteins and be helpful for our understanding of the development of gastric cancer. PMID:22295074
CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.
Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J
1995-01-01
Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797
Abe, Koichi; Sunagawa, Naoki; Terada, Tohru; Takahashi, Yuta; Arakawa, Takatoshi; Igarashi, Kiyohiko; Samejima, Masahiro; Nakai, Hiroyuki; Taguchi, Hayao; Nakajima, Masahiro; Fushinobu, Shinya
2018-06-08
β-1,2-Glucans are bacterial carbohydrates that exist in cyclic or linear forms and play an important role in infections and symbioses involving Gram-negative bacteria. Although several β-1,2-glucan-associated enzymes have been characterized, little is known about how β-1,2-glucan and its shorter oligosaccharides (Sop n s) are captured and imported into the bacterial cell. Here, we report the biochemical and structural characteristics of the Sop n -binding protein (SO-BP, Lin1841) associated with the ATP-binding cassette (ABC) transporter from the Gram-positive bacterium Listeria innocua Calorimetric analysis revealed that SO-BP specifically binds to Sop n s with a degree of polymerization of 3 or more, with K d values in the micromolar range. The crystal structures of SO-BP in an unliganded open form and in closed complexes with tri-, tetra-, and pentaoligosaccharides (Sop 3-5 ) were determined to a maximum resolution of 1.6 Å. The binding site displayed shape complementarity to Sop n , which adopted a zigzag conformation. We noted that water-mediated hydrogen bonds and stacking interactions play a pivotal role in the recognition of Sop 3-5 by SO-BP, consistent with its binding thermodynamics. Computational free-energy calculations and a mutational analysis confirmed that interactions with the third glucose moiety of Sop n s are significantly responsible for ligand binding. A reduction in unfavorable changes in binding entropy that were in proportion to the lengths of the Sop n s was explained by conformational entropy changes. Phylogenetic and sequence analyses indicated that SO-BP ABC transporter homologs, glycoside hydrolases, and other related proteins are co-localized in the genomes of several bacteria. This study may improve our understanding of bacterial β-1,2-glucan metabolism and promote the discovery of unidentified β-1,2-glucan-associated proteins. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Hashimoto, Tetsuya; Yokota, Chiaki; Koshino, Kazuhiro; Temma, Takashi; Yamazaki, Makoto; Iguchi, Satoshi; Shimomura, Ryo; Uehara, Toshiyuki; Funatsu, Naoko; Hino, Tenyu; Minematsu, Kazuo; Iida, Hidehiro; Toyoda, Kazunori
2017-04-01
11 C-Pittsburgh compound-B ( 11 C-PIB) positron emission tomography (PET) is used to visualize and quantify amyloid deposition in the brain cortex in pathological conditions such as Alzheimer's disease (AD). Intense 11 C-PIB retention is also observed in the white matter (WM) of both healthy individuals and AD patients. However, the clinical implications of this retention in brain WM have not been clarified. We investigated the relationship between the extent of white matter lesions (WMLs) and the binding potential of 11 C-PIB (BP ND ) in the WM in patients with hypertensive small vessel disease. We further examined the relationship between the extent of WMLs and BP ND in WML and in normal-appearing white matter (NAWM). Twenty-one hypertensive vasculopathy patients, without AD and major cerebral arterial stenosis and/or occlusion, were enrolled (9 women, 68 ± 7 years). Regions of WML and NAWM were extracted using magnetization-prepared rapid gradient-echo and fluid-attenuated inversion recovery of magnetic resonance images. Volumes of interest (VOIs) were set in the cortex-subcortex, basal ganglia, and centrum semiovale (CS). BP ND in the cortex-subcortex, basal ganglia, CS, WML, and NAWM were estimated on 11 C-PIB PET using Logan graphical analysis with cerebellar regions as references. The relationships between WML volume and BP ND in each region were examined by linear regression analysis. BP ND was higher in the CS and basal ganglia than in the cortex-subcortex regions. WML volume had a significant inverse correlation with BP ND in the CS (Slope = -0.0042, R 2 = 0.44, P < 0.01). For intra WM comparison, BP ND in NAWM was significantly higher than that in WML. In addition, although there were no correlations between WML volume and BP ND in WML, WML volume was significantly correlated inversely with BP ND in NAWM (Slope = -0.0017, R 2 = 0.26, P = 0.02). 11 C-PIB could be a marker of not only cortical amyloid-β deposition but also WM injury accompanying the development of WMLs in hypertensive small vessel disease.
Topolska-Woś, Agnieszka M.; Shell, Steven M.; Kilańczyk, Ewa; Szczepanowski, Roman H.; Chazin, Walter J.; Filipek, Anna
2015-01-01
CacyBP/SIP [calcyclin-binding protein/Siah-1 [seven in absentia homolog 1 (Siah E3 ubiquitin protein ligase 1)] interacting protein] is a multifunctional protein whose activity includes acting as an ERK1/2 phosphatase. We analyzed dimerization of mouse CacyBP/SIP in vitro and in mouse neuroblastoma cell line (NB2a) cells, as well as the structure of a full-length protein. Moreover, we searched for the CacyBP/SIP domain important for dimerization and dephosphorylation of ERK2, and we analyzed the role of dimerization in ERK1/2 signaling in NB2a cells. Cell-based assays showed that CacyBP/SIP forms a homodimer in NB2a cell lysate, and biophysical methods demonstrated that CacyBP/SIP forms a stable dimer in vitro. Data obtained using small-angle X-ray scattering supported a model in which CacyBP/SIP occupies an anti-parallel orientation mediated by the N-terminal dimerization domain. Site-directed mutagenesis established that the N-terminal domain is indispensable for full phosphatase activity of CacyBP/SIP. We also demonstrated that the oligomerization state of CacyBP/SIP as well as the level of post-translational modifications and subcellular distribution of CacyBP/SIP change after activation of the ERK1/2 pathway in NB2a cells due to oxidative stress. Together, our results suggest that dimerization is important for controlling phosphatase activity of CacyBP/SIP and for regulating the ERK1/2 signaling pathway.—Topolska-Woś, A. M., Shell, S. M., Kilańczyk, E., Szczepanowski, R. H., Chazin, W. J., Filipek, A. Dimerization and phosphatase activity of calcyclin-binding protein/Siah-1 interacting protein: the influence of oxidative stress. PMID:25609429
NEDD 4 binding protein 2-like 1 promotes cancer cell invasion in oral squamous cell carcinoma.
Sasahira, Tomonori; Kurihara, Miyako; Nishiguchi, Yukiko; Fujiwara, Rina; Kirita, Tadaaki; Kuniyasu, Hiroki
2016-08-01
Head and neck cancer, including oral squamous cell carcinoma, is the sixth most common cancer worldwide. Although cancer cell invasion and metastasis are crucial for tumor progression, detailed molecular mechanisms underlying the invasion and metastasis of oral squamous cell carcinoma are unclear. Comparison of transcriptional profiles using a cDNA microarray demonstrated that N4BP2L1, a novel oncogene expressed by neural precursor cells, is involved in oral squamous cell carcinoma. Expression of N4BP2L1 in oral squamous cell carcinoma is regulated by activation of miR-448 and is higher than in normal oral mucosa. Knockdown of N4BP2L1 and upregulation of miR-448 significantly reduced the invasive potential of oral squamous cell carcinoma cells. We studied N4BP2L1 expression in 187 cases of oral squamous cell carcinoma and found its overexpression to be significantly associated with nodal metastasis (P = 0.0155) and poor prognosis (P = 0.0136). Expression of miR-448 was found to be inversely associated with that of N4BP2L1 (P = 0.0019). Cox proportional hazards analysis identified N4BP2L1 expression as an independent predictor of disease-free survival (P = 0.0349). Our results suggest that N4BP2L1 plays an important role in tumor cell invasion in oral squamous cell carcinoma. Further studies on expression of N4BP2L1 may provide new insight into its function and clarify its potential as biomarker in human oral cancer.
Sugiura, Tomonori; Dohi, Yasuaki; Takase, Hiroyuki; Yamashita, Sumiyo; Murai, Shunsuke; Tsuzuki, Yuji; Ogawa, Shintaro; Tanaka, Yasuhito; Ohte, Nobuyuki
2016-08-01
Mac-2 binding protein (M2BP) was reported to be a useful biomarker for liver fibrosis and malignant tumors. We hypothesized that expression of M2BP might also change in the process of atherosclerosis. This study included subjects who visited our hospital for a physical checkup. The M2BP levels in subjects with hypertension, dyslipidemia, or abnormal glucose metabolism were higher than those in subjects without such risk factors. Moreover, the M2BP levels were associated with severity of cardiovascular risk. Subdivision of M2BP levels into quartiles revealed that M2BP was significantly associated with reactive oxygen metabolites, central systolic blood pressure, and radial augmentation index (AI). Logistic regression analysis with the endpoint of high radial AI (above mean value) showed that high radial AI was independently associated with high M2BP. Although the spectrum was narrow as compared to that in cases of hepatic fibrosis, serum M2BP may reflect silent atherosclerosis in apparently healthy subjects. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Cloning and characterization of giant panda (Ailuropoda melanoleuca) IL-18 binding protein.
Yan, Yue; Deng, Jiabo; Niu, Lili; Wang, Qiang; Yu, Jianqiu; Shao, Huanhuan; Cao, Qinghua; Zhang, Yizheng; Tan, Xuemei
2016-06-01
The giant panda (Ailuropoda melanoleuca) is an endangered species. Interleukin-18 (IL-18) plays an important role in the innate and adaptive immune responses by inducing IFN-γ. IL-18 has been implicated in the pathogenesis of various diseases. IL-18 binding protein (IL-18BP) is an intrinsic inhibitor of IL-18 that possesses higher affinity to IL-18. In this study, we cloned and characterized IL-18BP in giant panda (AmIL-18BP) from the spleen. The amino acid sequence of giant panda IL-18BP ORF shared about 65% identities with other species. To evaluate the effects of AmIL-18BP on the immune responses, we expressed the recombinant AmIL-18BP in Escherichia coli BL21 (DE3).The fusing protein PET-AmIL-18BP was purified by nickel affinity column chromatography. The biological function of purified PET-AmIL-18BP was determined on mice splenocyte by qRT-PCR. The results showed that AmIL-18BP was functional and could significantly reduce IFN-γ production in murine splenocytes. These results will facilitate the study of protecting giant panda on etiology and immunology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Markowitz, Joseph; Chen, Ijen; Gitti, Rossi; Baldisseri, Donna M; Pan, Yongping; Udan, Ryan; Carrier, France; MacKerell, Alexander D; Weber, David J
2004-10-07
The binding of S100B to p53 down-regulates wild-type p53 tumor suppressor activity in cancer cells such as malignant melanoma, so a search for small molecules that bind S100B and prevent S100B-p53 complex formation was undertaken. Chemical databases were computationally searched for potential inhibitors of S100B, and 60 compounds were selected for testing on the basis of energy scoring, commercial availability, and chemical similarity clustering. Seven of these compounds bound to S100B as determined by steady state fluorescence spectroscopy (1.0 microM < or = K(D) < or = 120 microM) and five inhibited the growth of primary malignant melanoma cells (C8146A) at comparable concentrations (1.0 microM < or = IC(50) < or = 50 microM). Additionally, saturation transfer difference (STD) NMR experiments confirmed binding and qualitatively identified protons from the small molecule at the small molecule-S100B interface. Heteronuclear single quantum coherence (HSQC) NMR titrations indicate that these compounds interact with the p53 binding site on S100B. An NMR-docked model of one such inhibitor, pentamidine, bound to Ca(2+)-loaded S100B was calculated using intermolecular NOE data between S100B and the drug, and indicates that pentamidine binds into the p53 binding site on S100B defined by helices 3 and 4 and loop 2 (termed the hinge region).
2015-01-01
Riboflavin receptors are overexpressed in malignant cells from certain human breast and prostate cancers, and they constitute a group of potential surface markers important for cancer targeted delivery of therapeutic agents and imaging molecules. Here we report on the fabrication and atomic force microscopy (AFM) characterization of a core–shell nanocomposite consisting of a gold nanoparticle (AuNP) coated with riboflavin receptor-targeting poly(amido amine) dendrimer. We designed this nanocomposite for potential applications such as a cancer targeted imaging material based on its surface plasmon resonance properties conferred by AuNP. We employed AFM as a technique for probing the binding interaction between the nanocomposite and riboflavin binding protein (RfBP) in solution. AFM enabled precise measurement of the AuNP height distribution before (13.5 nm) and after chemisorption of riboflavin-conjugated dendrimer (AuNP–dendrimer; 20.5 nm). Binding of RfBP to the AuNP–dendrimer caused a height increase to 26.7 nm, which decreased to 22.8 nm when coincubated with riboflavin as a competitive ligand, supporting interaction of AuNP–dendrimer and its target protein. In summary, physical determination of size distribution by AFM imaging can serve as a quantitative approach to monitor and characterize the nanoscale interaction between a dendrimer-covered AuNP and target protein molecules in vitro. PMID:24571134
Findeisen, Felix; Minor, Daniel L
2010-12-08
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (Ca(V)s) with unusual properties. CaBP1 inhibits Ca(V)1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit Ca(V)1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the Ca(V)1.2 IQ domain at a site that overlaps with the Ca²+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates Ca(V)s. Copyright © 2010 Elsevier Ltd. All rights reserved.
Findeisen, Felix; Minor, Daniel L.
2010-01-01
Calcium-binding protein 1 (CaBP1), a calmodulin (CaM) homolog, endows certain voltage-gated calcium channels (CaVs) with unusual properties. CaBP1 inhibits CaV1.2 calcium-dependent inactivation (CDI) and introduces calcium-dependent facilitation (CDF). Here, we show that the ability of CaBP1 to inhibit CaV1.2 CDI and induce CDF arises from interaction between the CaBP1 N-lobe and interlobe linker residue Glu94. Unlike CaM, where functional EF hands are essential for channel modulation, CDI inhibition does not require functional CaBP1 EF-hands. Furthermore, CaBP1-mediated CDF has different molecular requirements than CaM-mediated CDF. Overall, the data show that CaBP1 comprises two structural modules having separate functions: similar to CaM, the CaBP1 C-lobe serves as a high-affinity anchor that binds the CaV1.2 IQ domain at a site that overlaps with the Ca2+/CaM C-lobe site, whereas the N-lobe/linker module houses the elements required for channel modulation. Discovery of this division provides the framework for understanding how CaBP1 regulates CaVs. PMID:21134641
Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M
1991-01-01
Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554
Steiner, Jennifer L.; Pruznak, Anne M.; Deiter, Gina; Navaratnarajah, Maithili; Kutzler, Lydia; Kimball, Scot R.; Lang, Charles H.
2014-01-01
Sepsis decreases skeletal muscle protein synthesis in part by impairing mTOR activity and the subsequent phosphorylation of 4E-BP1 and S6K1 thereby controlling translation initiation; however, the relative importance of changes in these two downstream substrates is unknown. The role of 4E-BP1 (and -BP2) in regulating muscle protein synthesis was assessed in wild-type (WT) and 4E-BP1/BP2 double knockout (DKO) male mice under basal conditions and in response to sepsis. At 12 months of age, body weight, lean body mass and energy expenditure did not differ between WT and DKO mice. Moreover, in vivo rates of protein synthesis in gastrocnemius, heart and liver did not differ between DKO and WT mice. Sepsis decreased skeletal muscle protein synthesis and S6K1 phosphorylation in WT and DKO male mice to a similar extent. Sepsis only decreased 4E-BP1 phosphorylation in WT mice as no 4E-BP1/BP2 protein was detected in muscle from DKO mice. Sepsis decreased the binding of eIF4G to eIF4E in WT mice; however, eIF4E•eIF4G binding was not altered in DKO mice under either basal or septic conditions. A comparable sepsis-induced increase in eIF4B phosphorylation was seen in both WT and DKO mice. eEF2 phosphorylation was similarly increased in muscle from WT septic mice and both control and septic DKO mice, compared to WT control values. The sepsis-induced increase in muscle MuRF1 and atrogin-1 (markers of proteolysis) as well as TNFα and IL-6 (inflammatory cytokines) mRNA was greater in DKO than WT mice. The sepsis-induced decrease in myocardial and hepatic protein synthesis did not differ between WT and DKO mice. These data suggest overall basal protein balance and synthesis is maintained in muscle of mice lacking both 4E-BP1/BP2 and that sepsis-induced changes in mTOR signaling may be mediated by a down-stream mechanism independent of 4E-BP1 phosphorylation and eIF4E•eIF4G binding. PMID:24945486
Steiner, Jennifer L; Pruznak, Anne M; Deiter, Gina; Navaratnarajah, Maithili; Kutzler, Lydia; Kimball, Scot R; Lang, Charles H
2014-01-01
Sepsis decreases skeletal muscle protein synthesis in part by impairing mTOR activity and the subsequent phosphorylation of 4E-BP1 and S6K1 thereby controlling translation initiation; however, the relative importance of changes in these two downstream substrates is unknown. The role of 4E-BP1 (and -BP2) in regulating muscle protein synthesis was assessed in wild-type (WT) and 4E-BP1/BP2 double knockout (DKO) male mice under basal conditions and in response to sepsis. At 12 months of age, body weight, lean body mass and energy expenditure did not differ between WT and DKO mice. Moreover, in vivo rates of protein synthesis in gastrocnemius, heart and liver did not differ between DKO and WT mice. Sepsis decreased skeletal muscle protein synthesis and S6K1 phosphorylation in WT and DKO male mice to a similar extent. Sepsis only decreased 4E-BP1 phosphorylation in WT mice as no 4E-BP1/BP2 protein was detected in muscle from DKO mice. Sepsis decreased the binding of eIF4G to eIF4E in WT mice; however, eIF4E•eIF4G binding was not altered in DKO mice under either basal or septic conditions. A comparable sepsis-induced increase in eIF4B phosphorylation was seen in both WT and DKO mice. eEF2 phosphorylation was similarly increased in muscle from WT septic mice and both control and septic DKO mice, compared to WT control values. The sepsis-induced increase in muscle MuRF1 and atrogin-1 (markers of proteolysis) as well as TNFα and IL-6 (inflammatory cytokines) mRNA was greater in DKO than WT mice. The sepsis-induced decrease in myocardial and hepatic protein synthesis did not differ between WT and DKO mice. These data suggest overall basal protein balance and synthesis is maintained in muscle of mice lacking both 4E-BP1/BP2 and that sepsis-induced changes in mTOR signaling may be mediated by a down-stream mechanism independent of 4E-BP1 phosphorylation and eIF4E•eIF4G binding.
Patil, Hemangi; Cho, Kyoung-in; Lee, James; Yang, Yi; Orry, Andrew; Ferreira, Paulo A
2013-03-27
The pleckstrin homology (PH) domain is a versatile fold that mediates a variety of protein-protein and protein-phosphatidylinositol lipid interactions. The Ran-binding protein 2 (RanBP2) contains four interspersed Ran GTPase-binding domains (RBD(n = 1-4)) with close structural homology to the PH domain of Bruton's tyrosine kinase. The RBD2, kinesin-binding domain (KBD) and RBD3 comprise a tripartite domain (R2KR3) of RanBP2 that causes the unfolding, microtubule binding and biphasic activation of kinesin-1, a crucial anterograde motor of mitochondrial motility. However, the interplay between Ran GTPase and R2KR3 of RanBP2 in kinesin-1 activation and mitochondrial motility is elusive. We use structure-function, biochemical, kinetic and cell-based assays with time-lapse live-cell microscopy of over 260,000 mitochondrial-motility-related events to find mutually exclusive subdomains in RBD2 and RBD3 towards Ran GTPase binding, kinesin-1 activation and mitochondrial motility regulation. The RBD2 and RBD3 exhibit Ran-GTP-independent, subdomain and stereochemical-dependent discrimination on the biphasic kinetics of kinesin-1 activation or regulation of mitochondrial motility. Further, KBD alone and R2KR3 stimulate and suppress, respectively, multiple biophysical parameters of mitochondrial motility. The regulation of the bidirectional transport of mitochondria by either KBD or R2KR3 is highly coordinated, because their kinetic effects are accompanied always by changes in mitochondrial motile events of either transport polarity. These studies uncover novel roles in Ran GTPase-independent subdomains of RBD2 and RBD3, and KBD of RanBP2, that confer antagonizing and multi-modal mechanisms of kinesin-1 activation and regulation of mitochondrial motility. These findings open new venues towards the pharmacological harnessing of cooperative and competitive mechanisms regulating kinesins, RanBP2 or mitochondrial motility in disparate human disorders.
Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.
Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N
2014-06-01
The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.
Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.
2013-01-01
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053
A novel computational approach "BP-STOCH" to study ligand binding to finite lattice.
Beshnova, Daria A; Bereznyak, Ekaterina G; Shestopalova, Anna V; Evstigneev, Maxim P
2011-03-01
We report a novel computational algorithm "BP-STOCH" to be used for studying single-type ligand binding with biopolymers of finite lengths, such as DNA oligonucleotides or oligopeptides. It is based on an idea to represent any type of ligand-biopolymer complex in a form of binary number, where "0" and "1" bits stand for vacant and engaged monomers of the biopolymer, respectively. Cycling over all binary numbers from the lowest 0 up to the highest 2(N) - 1 means a sequential generating of all possible configurations of vacant/engaged monomers, which, after proper filtering, results in a full set of possible types of complexes in solution between the ligand and the N-site lattice. The principal advantage of BP-STOCH algorithm is the possibility to incorporate into this cycle any conditions on computation of the concentrations and observed experimental parameters of the complexes in solution, and programmatic access to each monomer of the biopolymer within each binding site of every binding configuration. The latter is equivalent to unlimited extension of the basic reaction scheme and allows to use BP-STOCH algorithm as an alternative to conventional computational approaches.
Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook
2008-11-28
FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp -308 to -188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp -65 to -56) and GC-box 2 (bp -18 to -9), the latter of which is also bound by FBI-1. We found that FRE3 (bp -244 to -236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression.
The effects of PEP-1-FK506BP on dry eye disease in a rat model.
Kim, Dae Won; Lee, Sung Ho; Ku, Sae Kwang; Lee, Ji Eun; Cha, Hyun Ju; Youn, Jong Kyu; Kwon, Hyeok Yil; Park, Jong Hoon; Park, Eun Young; Cho, Sung-Woo; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young
2015-03-01
As FK506 binding proteins (FK506BPs) are known to play an important role in the regulation of a variety of biological processes related to cell survival, this study was designed to examined the protective effects of FK506 binding protein 12 (FK506BP) on low humidity air flow induced dry eye in a rat model using transduced PEP-1-FK506BP. After the topical application of PEP-1-FK506BP, tear volumes were markedly increased and significant prevention of cornea damage was observed compared with dry eye rats. Further, immunohistochemical analysis demonstrated that PEP-1-FK506BP markedly prevented damage to the cornea, the bulbar conjunctiva, and the palpebral conjunctiva epithelial lining compared with dry eye rats. In addition, caspase-3 and PARP expression levels were found to be decreased. These results demonstrated that topical application of PEP-1-FK506BP significantly ameliorates dry eye injury in an animal model. Thus, we suggest that PEP-1-FK506BP can be developed as a new ophthalmic drop to treat dry eye diseases.
The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis.
Kiem, Lena-Maria; Dietmann, Petra; Linnemann, Alexander; Schmeisser, Michael J; Kühl, Susanne J
2017-03-01
The Fezzin family member Nedd4-binding protein 3 (N4BP3) is known to regulate axonal and dendritic branching. Here, we show that n4bp3 is expressed in the neural tissue of the early Xenopus laevis embryo including the eye, the brain and neural crest cells. Knockdown of N4bp3 in the Xenopus anterior neural tissue results in severe developmental impairment of the eye, the brain and neural crest derived cranial cartilage structures. Moreover, we demonstrate that N4bp3 depletion leads to a significant reduction of both eye and brain specific marker genes and reduced neural crest cell migration. Finally, we demonstrate an impact of N4bp3 deficiency on cell apoptosis and proliferation. Our studies indicate that N4bp3 is required for early anterior neural development of vertebrates. This is in line with a study implicating that genetic disruption of N4BP3 in humans might be related to neurodevelopmental disease. Copyright © 2017 Elsevier Inc. All rights reserved.
Kim, Sujin; Choi, Kyungho
2014-09-01
Benzophenone-3 (BP-3) has been widely used in sunscreens and many other consumer products, including cosmetics. The widespread use of BP-3 has resulted in its release into the water environment, and hence its potential impact on aquatic ecosystem is of concern. To better understand the risk associated with BP-3 in aquatic ecosystems, we conducted a thorough review of available articles regarding the physicochemical properties, toxicokinetics, environmental occurrence, and toxic effects of BP-3 and its suspected metabolites. BP-3 is lipophilic, photostable, and bioaccumulative, and can be rapidly absorbed via oral and dermal routes. BP-3 is reported to be transformed into three major metabolites in vivo, i.e., benzophenone-1 (BP-1), benzophenone-8 (BP-8), and 2,3,4-trihydroxybenzophenone (THB). BP-1 has a longer biological half-life than its parent compound and exhibits greater estrogenic potency in vitro. BP-3 has been detected in water, soil, sediments, sludge, and biota. The maximum detected level in ambient freshwater and seawater is 125ng/L and 577.5ng/L, respectively, and in wastewater influent is 10,400ng/L. The major sources of BP-3 are reported to be human recreational activities and wastewater treatment plant (WWTP) effluents. BP-3 and its derivatives have been also detected in fish lipid. In humans, BP-3 has been detected in urine, serum, and breast milk samples worldwide. BP-1 has also been detected in placental tissues of delivering women. While sunscreens and cosmetics are known to be major sources of exposure, the fact that BP-3 has been detected frequently among young children and men suggests other sources. An increasing number of in vitro studies have indicated the endocrine disrupting capacity of BP-3. Based on a receptor binding assay, BP-3 has shown strong anti-androgenic and weak estrogenic activities but at the same time BP-3 displays anti-estrogenic activity as well. Predicted no effect concentration (PNEC) for BP-3 was derived at 1.32μg/L. The levels observed in ambient water are generally an order of magnitude lower than the PNEC, but in wastewater influents, hazard quotients (HQs) greater than 1 were noted. Considering limited ecotoxicological information and significant seasonal and spatial variations of BP-3 in water, further studies on environmental monitoring and potential consequences of long-term exposure in aquatic ecosystem are warranted. Copyright © 2014 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
E. coli DksA is in a class of transcription factors that modify RNA polymerase (RNAP) in all three kingdoms of life. DksA potentiates the effects of the global regulator ppGpp and the initiating NTP, controlling transcription initiation without binding to DNA. Incorporating benzoyl-phenylalanine (Bp...
NASA Astrophysics Data System (ADS)
Alamiddine, Zakaria; Selvam, Balaji; Cerón-Carrasco, José P.; Mathé-Allainmat, Monique; Lebreton, Jacques; Thany, Steeve H.; Laurent, Adèle D.; Graton, Jérôme; Le Questel, Jean-Yves
2015-12-01
The binding of thiaclopride (THI), a neonicotinoid insecticide, with Aplysia californica acetylcholine binding protein ( Ac-AChBP), the surrogate of the extracellular domain of insects nicotinic acetylcholine receptors, has been studied with a QM/QM' hybrid methodology using the ONIOM approach (M06-2X/6-311G(d):PM6). The contributions of Ac-AChBP key residues for THI binding are accurately quantified from a structural and energetic point of view. The importance of water mediated hydrogen-bond (H-bond) interactions involving two water molecules and Tyr55 and Ser189 residues in the vicinity of the THI nitrile group, is specially highlighted. A larger stabilization energy is obtained with the THI- Ac-AChBP complex compared to imidacloprid (IMI), the forerunner of neonicotinoid insecticides. Pairwise interaction energy calculations rationalize this result with, in particular, a significantly more important contribution of the pivotal aromatic residues Trp147 and Tyr188 with THI through CH···π/CH···O and π-π stacking interactions, respectively. These trends are confirmed through a complementary non-covalent interaction (NCI) analysis of selected THI- Ac-AChBP amino acid pairs.
Fabrication of hierarchical hybrid structures using bio-enabled layer-by-layer self-assembly.
Hnilova, Marketa; Karaca, Banu Taktak; Park, James; Jia, Carol; Wilson, Brandon R; Sarikaya, Mehmet; Tamerler, Candan
2012-05-01
Development of versatile and flexible assembly systems for fabrication of functional hybrid nanomaterials with well-defined hierarchical and spatial organization is of a significant importance in practical nanobiotechnology applications. Here we demonstrate a bio-enabled self-assembly technique for fabrication of multi-layered protein and nanometallic assemblies utilizing a modular gold-binding (AuBP1) fusion tag. To accomplish the bottom-up assembly we first genetically fused the AuBP1 peptide sequence to the C'-terminus of maltose-binding protein (MBP) using two different linkers to produce MBP-AuBP1 hetero-functional constructs. Using various spectroscopic techniques, surface plasmon resonance (SPR) and localized surface plasmon resonance (LSPR), we verified the exceptional binding and self-assembly characteristics of AuBP1 peptide. The AuBP1 peptide tag can direct the organization of recombinant MBP protein on various gold surfaces through an efficient control of the organic-inorganic interface at the molecular level. Furthermore using a combination of soft-lithography, self-assembly techniques and advanced AuBP1 peptide tag technology, we produced spatially and hierarchically controlled protein multi-layered assemblies on gold nanoparticle arrays with high molecular packing density and pattering efficiency in simple, reproducible steps. This model system offers layer-by-layer assembly capability based on specific AuBP1 peptide tag and constitutes novel biological routes for biofabrication of various protein arrays, plasmon-active nanometallic assemblies and devices with controlled organization, packing density and architecture. Copyright © 2011 Wiley Periodicals, Inc.
Gryglewski, G; Rischka, L; Philippe, C; Hahn, A; James, G M; Klebermass, E; Hienert, M; Silberbauer, L; Vanicek, T; Kautzky, A; Berroterán-Infante, N; Nics, L; Traub-Weidinger, T; Mitterhauser, M; Wadsak, W; Hacker, M; Kasper, S; Lanzenberger, R
2017-04-01
In-vivo quantification of serotonin transporters (SERT) in human brain has been a mainstay of molecular imaging in the field of neuropsychiatric disorders and helped to explore the underpinnings of several medical conditions, therapeutic and environmental influences. The emergence of PET/MR hybrid systems and the heterogeneity of SERT binding call for the development of efficient methods making the investigation of larger or vulnerable populations with limited scanner time and simultaneous changes in molecular and functional measures possible. We propose [ 11 C]DASB bolus plus constant infusion for these applications and validate it against standard analyses of dynamic PET data. [ 11 C]DASB bolus/infusion optimization was performed on data acquired after [ 11 C]DASB bolus in 8 healthy subjects. Subsequently, 16 subjects underwent one scan using [ 11 C]DASB bolus plus constant infusion with K bol 160-179min and one scan after [ 11 C]DASB bolus for inter-method reliability analysis. Arterial blood sampling and metabolite analysis were performed for all scans. Distribution volumes (V T ) were obtained using Logan plots for bolus scans and ratios between tissue and plasma parent activity for bolus plus infusion scans for different time spans of the scan (V T-70 for 60-70min after start of tracer infusion, V T-90 for 75-90min, V T-120 for 100-120min) in 9 subjects. Omitting blood data, binding potentials (BP ND ) obtained using multilinear reference tissue modeling (MRTM2) and cerebellar gray matter as reference region were compared in 11 subjects. A K bol of 160min was observed to be optimal for rapid equilibration in thalamus and striatum. V T-70 showed good intraclass correlation coefficients (ICCs) of 0.61-0.70 for thalamus, striatal regions and olfactory cortex with bias ≤5.1% compared to bolus scans. ICCs increased to 0.72-0.78 for V T-90 and 0.77-0.93 for V T-120 in these regions. BP ND-90 had negligible bias ≤2.5%, low variability ≤7.9% and ICCs of 0.74-0.87; BP ND-120 had ICCs of 0.73-0.90. Low-binding cortical regions and cerebellar gray matter showed a positive bias of ~8% and ICCs 0.57-0.68 at V T-90 . Cortical BP ND suffered from high variability and bias, best results were obtained for olfactory cortex and anterior cingulate cortex with ICC=0.74-0.75 for BP ND-90 . High-density regions amygdala and midbrain had a negative bias of -5.5% and -22.5% at V T-90 with ICC 0.70 and 0.63, respectively. We have optimized the equilibrium method with [ 11 C]DASB bolus plus constant infusion and demonstrated good inter-method reliability with accepted standard methods and for SERT quantification using both V T and BP ND in a range of different brain regions. With as little as 10-15min of scanning valid estimates of SERT V T and BP ND in thalamus, amygdala, striatal and high-binding cortical regions could be obtained. Blood sampling seems vital for valid quantification of SERT in low-binding cortical regions. These methods allow the investigation of up to three subjects with a single radiosynthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
An HMGA2-IGF2BP2 Axis Regulates Myoblast Proliferation and Myogenesis
Li, Zhizhong; Gilbert, Jason A.; Zhang, Yunyu; Zhang, Minsi; Qiu, Qiong; Ramanujan, Krishnan; Shavlakadze, Tea; Eash, John K.; Scaramozza, Annarita; Goddeeris, Matthew M.; Kirsch, David G.; Campbell, Kevin P.; Brack, Andrew S.; Glass, David J.
2013-01-01
Summary A group of genes that are highly and specifically expressed in proliferating skeletal myoblasts during myogenesis was identified. Expression of one of these genes, Hmga2, increases coincident with satellite cell activation, and later its expression significantly declines correlating with fusion of myoblasts into myotubes. Hmga2 knockout mice exhibit impaired muscle development and reduced myoblast proliferation, while overexpression of HMGA2 promotes myoblast growth. This perturbation in proliferation can be explained by the finding that HMGA2 directly regulates the RNA-binding protein IGF2BP2. Add-back of IGF2BP2 rescues the phenotype. IGF2BP2 in turn binds to and controls the translation of a set of mRNAs, including c-myc, Sp1, and Igf1r. These data demonstrate that the HMGA2-IGF2BP2 axis functions as a key regulator of satellite cell activation and therefore skeletal muscle development. PMID:23177649
Stoichiometry of the Cre recombinase bound to the lox recombining site.
Mack, A; Sauer, B; Abremski, K; Hoess, R
1992-01-01
The site-specific recombinase Cre from bacteriophage P1 binds and carries out recombination at a 34 bp lox site. The lox site consists of two 13 bp inverted repeats, separated by an 8 bp spacer region. Both the palindromic nature of the site and the results of footprinting and band shift experiments suggest that a minimum of two Cre molecules bind to a lox site. We report here experiments that demonstrate the absolute stoichiometry of the Cre-lox complex to be one molecule of Cre bound per inverted repeat, or two molecules per lox site. Images PMID:1408747
Striatal dopamine (D2) receptor availability predicts socially desirable responding.
Reeves, Suzanne J; Mehta, Mitul A; Montgomery, Andrew J; Amiras, Dimitri; Egerton, Alice; Howard, Robert J; Grasby, Paul M
2007-02-15
Research in non-human primates has implicated striatal dopamine (D2) receptor function in the expression of social dominance--a fundamental component of social extraversion. We predicted that trait extraversion - indexed by the revised Eysenck Personality Questionnaire (EPQ-R) - would correlate with striatal DA (D2) receptor measures - indexed by [(11)C]-Raclopride binding potential (BP) - in 28 healthy post-menopausal females (mean age=75 years; range=58-91 years). Region of interest (ROI) and voxel-based statistical parametric mapping (SPM) analyses were performed, using a reference tissue model for [(11)C]-Raclopride. ROI analysis showed moderately significant negative correlations between extraversion and BP measures in the left caudate and between psychoticism scores and BP in the right putamen. Unexpectedly, scores on the Lie scale, a measure of socially desirable responding, were significantly and negatively correlated with BP measures in the putamen and survived Bonferroni correction on the right side. After controlling for the potential confounding of self-report bias in high Lie scorers, only the correlation between Lie scores and BP measures in the right putamen remained significant. Voxel-based analysis showed only Lie scores to be significantly and negatively correlated with BP measures in the right putamen. We explored this association further by applying an ROI-based approach to data on a previously scanned sample of young adults (n=13) and found a similar pattern of association, which achieved trend level significance in the right putamen. Although unanticipated, the relationship observed between BP measures in the right putamen and Lie scores is consistent with dopaminergic involvement in socially rewarding behaviour. How this relates to dopaminergic tone will need to be further explored.
Let-7b Regulates Myoblast Proliferation by Inhibiting IGF2BP3 Expression in Dwarf and Normal Chicken
Lin, Shumao; Luo, Wen; Ye, Yaqiong; Bekele, Endashaw J.; Nie, Qinghua; Li, Yugu; Zhang, Xiquan
2017-01-01
The sex-linked dwarf chicken is caused by the mutation of growth hormone receptor (GHR) gene and characterized by shorter shanks, lower body weight, smaller muscle fiber diameter and fewer muscle fiber number. However, the precise regulatory pathways that lead to the inhibition of skeletal muscle growth in dwarf chickens still remain unclear. Here we found a let-7b mediated pathway might play important role in the regulation of dwarf chicken skeletal muscle growth. Let-7b has higher expression in the skeletal muscle of dwarf chicken than in normal chicken, and the expression of insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3), which is a translational activator of IGF2, showed opposite expression trend to let-7b. In vitro cellular assays validated that let-7b directly inhibits IGF2BP3 expression through binding to its 3′UTR region, and the protein level but not mRNA level of IGF2 would be reduced in let-7b overexpressed chicken myoblast. Let-7b can inhibit cell proliferation and induce cell cycle arrest in chicken myoblast through let-7b-IGF2BP3-IGF2 signaling pathway. Additionally, let-7b can also regulate skeletal muscle growth through let-7b-GHR-GHR downstream genes pathway, but this pathway is non-existent in dwarf chicken because of the deletion mutation of GHR 3′UTR. Notably, as the loss binding site of GHR for let-7b, let-7b has enhanced its binding and inhibition on IGF2BP3 in dwarf myoblast, suggesting that the miRNA can balance its inhibiting effect through dynamic regulate its binding to target genes. Collectively, these results not only indicate that let-7b can inhibit skeletal muscle growth through let-7b-IGF2BP3-IGF2 signaling pathway, but also show that let-7b regulates myoblast proliferation by inhibiting IGF2BP3 expression in dwarf and normal chickens. PMID:28736533
Wang, Jingjing; Feng, Yeqian; Chen, Xishan; Du, Zheng; Jiang, Shaijun; Ma, Shuyun; Zou, Wen
2018-02-01
Cervical cancer still remains the fourth most common cancer, affecting women worldwide with large geographic variations in cervical cancer incidence and mortality rates. SH3-domain binding protein-1 (SH3BP1) specifically inactivating Rac1 and its target Wave2 is required for cell motility, thus regarded as an essential regulator of cancer cell metastasis. However, the exact effects and molecular mechanisms of SH3BP1 in cervical cancer progression are still unknown. The present study is aimed to investigate the mechanism of SH3BP1 in regulation of cervical cancer cell metastasis and chemoresistance. In the present study, we demonstrated a high SH3BP1 expression in cervical cancer tissues; a higher SH3BP1 expression is also correlated with a shorter overall survival of patients with cervical cancer. Further, we revealed that SH3BP1 overexpression promoted the invasion, migration, and chemoresistance of cervical cancer cell through increasing Rac1 activity and Wave2 protein level. The promotive effect of SH3BP1 could be partially reversed by a Rac1 inhibitor, NSC 23766. In cisplatin-resistant cervical cancer tissues, SH3BP1, Rac1, and Wave2 mRNA expression was significantly up-regulated compared to that of the cisplatin-sensitive cervical cancer tissues. Taken together, SH3BP1/Rac1/Wave2 pathway may potentially act as an effective therapeutic target combined with traditional cisplatin-based chemotherapy for cervical cancer. © 2017 Wiley Periodicals, Inc.
Nielsen, C T; Østergaard, O; Rekvig, O P; Sturfelt, G; Jacobsen, S; Heegaard, N H H
2015-10-01
A high level of galectin-3-binding protein (G3BP) appears to distinguish circulating cell-derived microparticles in systemic lupus erythematosus (SLE). The aim of this study is to characterize the population of G3BP-positive microparticles from SLE patients compared to healthy controls, explore putative clinical correlates, and examine if G3BP is present in immune complex deposits in kidney biopsies from patients with lupus nephritis. Numbers of annexin V-binding and G3BP-exposing plasma microparticles from 56 SLE patients and 36 healthy controls were determined by flow cytometry. Quantitation of microparticle-associated G3BP, C1q and immunoglobulins was obtained by liquid chromatography tandem mass spectrometry (LC-MS/MS). Correlations between microparticle-G3BP data and clinical parameters were analyzed. Co-localization of G3BP with in vivo-bound IgG was examined in kidney biopsies from one non-SLE control and from patients with class IV (n = 2) and class V (n = 1) lupus nephritis using co-localization immune electron microscopy. Microparticle-G3BP, microparticle-C1q and microparticle-immunoglobulins were significantly (P < 0.01) increased in SLE patients by LC-MS/MS. Three G3BP-exposing microparticle populations could be discerned by flow cytometry, including two subpopulations that were significantly increased in SLE samples (P = 0.01 and P = 0.0002, respectively). No associations of G3BP-positive microparticles with clinical manifestations or disease activity were found. Immune electron microscopy showed co-localization of G3BP with in vivo-bound IgG in glomerular electron dense immune complex deposits in all lupus nephritis biopsies. Both circulating microparticle-G3BP numbers as well as G3BP expression are increased in SLE patients corroborating G3BP being a feature of SLE microparticles. By demonstrating G3BP co-localized with deposited immune complexes in lupus nephritis, the study supports cell-derived microparticles as a major autoantigen source and provides a new understanding of the origin of immune complexes occurring in lupus nephritis. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.
Smaldone, Giovanni; Vigorita, Marilisa; Ruggiero, Alessia; Balasco, Nicole; Dattelbaum, Jonathan D; D'Auria, Sabato; Del Vecchio, Pompea; Graziano, Giuseppe; Vitagliano, Luigi
2016-07-01
The Arginine Binding Protein isolated from Thermotoga maritima (TmArgBP) is a protein endowed with several peculiar properties. We have previously shown that TmArgBP dimerization is a consequence of the swapping of the C-terminal helix. Here we explored the structural determinants of TmArgBP domain swapping and oligomerization. In particular, we report a mutational analysis of the residue Pro235, which is located in the hinge region of the swapping dimer. This residue was either replaced with a Gly-Lys dipeptide (TmArgBP(P235GK)) or a Gly residue (TmArgBP(P235G)). Different forms of these mutants were generated and extensively characterized using biophysical techniques. For both TmArgBP(P235GK) and TmArgBP(P235G) mutants, the occurrence of multiple oligomerization states (monomers, dimers and trimers) was detected. The formation of well-folded monomeric forms for these mutants indicates that the dimerization through C-terminal domain swapping observed in wild-type TmArgBP is driven by conformational restraints imposed by the presence of Pro235 in the hinge region. Molecular dynamics studies corroborate this observation by showing that Gly235 assumes conformational states forbidden for Pro residues in the TmArgBP(P235G) monomer. Unexpectedly, the trimeric forms present: (a) peculiar circular dichroism spectra, (b) a great susceptibility to heating, and (c) the ability to bind the Thioflavin T dye. The present findings clearly demonstrate that single-point mutations have an important impact on the TmArgBP oligomerization process. In a wider context, they also indicate that proteins endowed with an intrinsic propensity to swap have an easy access to states with altered structural and, possibly, functional properties. Copyright © 2016. Published by Elsevier B.V.
Ca2+-binding Motif of βγ-Crystallins*
Srivastava, Shanti Swaroop; Mishra, Amita; Krishnan, Bal; Sharma, Yogendra
2014-01-01
βγ-Crystallin-type double clamp (N/D)(N/D)XX(S/T)S motif is an established but sparsely investigated motif for Ca2+ binding. A βγ-crystallin domain is formed of two Greek key motifs, accommodating two Ca2+-binding sites. βγ-Crystallins make a separate class of Ca2+-binding proteins (CaBP), apparently a major group of CaBP in bacteria. Paralleling the diversity in βγ-crystallin domains, these motifs also show great diversity, both in structure and in function. Although the expression of some of them has been associated with stress, virulence, and adhesion, the functional implications of Ca2+ binding to βγ-crystallins in mediating biological processes are yet to be elucidated. PMID:24567326
Barbosa, Angela S.; Monaris, Denize; Silva, Ludmila B.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Cianciarullo, Aurora M.; Isaac, Lourdes; Abreu, Patricia A. E.
2010-01-01
We have previously shown that pathogenic leptospiral strains are able to bind C4b binding protein (C4BP). Surface-bound C4BP retains its cofactor activity, indicating that acquisition of this complement regulator may contribute to leptospiral serum resistance. In the present study, the abilities of seven recombinant putative leptospiral outer membrane proteins to interact with C4BP were evaluated. The protein encoded by LIC11947 interacted with this human complement regulator in a dose-dependent manner. The cofactor activity of C4BP bound to immobilized recombinant LIC11947 (rLIC11947) was confirmed by detecting factor I-mediated cleavage of C4b. rLIC11947 was therefore named LcpA (for leptospiral complement regulator-acquiring protein A). LcpA was shown to be an outer membrane protein by using immunoelectron microscopy, cell surface proteolysis, and Triton X-114 fractionation. The gene coding for LcpA is conserved among pathogenic leptospiral strains. This is the first characterization of a Leptospira surface protein that binds to the human complement regulator C4BP in a manner that allows this important regulator to control complement system activation mediated either by the classical pathway or by the lectin pathway. This newly identified protein may play a role in immune evasion by Leptospira spp. and may therefore represent a target for the development of a human vaccine against leptospirosis. PMID:20404075
Fredslund, Folmer; Vujičić Žagar, Andreja; Andersen, Thomas Lars; Svensson, Birte; Slotboom, Dirk Jan
2016-01-01
The molecular details and impact of oligosaccharide uptake by distinct human gut microbiota (HGM) are currently not well understood. Non-digestible dietary galacto- and gluco-α-(1,6)-oligosaccharides from legumes and starch, respectively, are preferentially fermented by mainly bifidobacteria and lactobacilli in the human gut. Here we show that the solute binding protein (BlG16BP) associated with an ATP binding cassette (ABC) transporter from the probiotic Bifidobacterium animalis subsp. lactis Bl-04 binds α-(1,6)-linked glucosides and galactosides of varying size, linkage, and monosaccharide composition with preference for the trisaccharides raffinose and panose. This preference is also reflected in the α-(1,6)-galactoside uptake profile of the bacterium. Structures of BlG16BP in complex with raffinose and panose revealed the basis for the remarkable ligand binding plasticity of BlG16BP, which recognizes the non-reducing α-(1,6)-diglycoside in its ligands. BlG16BP homologues occur predominantly in bifidobacteria and a few Firmicutes but lack in other HGMs. Among seven bifidobacterial taxa, only those possessing this transporter displayed growth on α-(1,6)-glycosides. Competition assays revealed that the dominant HGM commensal Bacteroides ovatus was out-competed by B. animalis subsp. lactis Bl-04 in mixed cultures growing on raffinose, the preferred ligand for the BlG16BP. By comparison, B. ovatus mono-cultures grew very efficiently on this trisaccharide. These findings suggest that the ABC-mediated uptake of raffinose provides an important competitive advantage, particularly against dominant Bacteroides that lack glycan-specific ABC-transporters. This novel insight highlights the role of glycan transport in defining the metabolic specialization of gut bacteria. PMID:27502277
Duplication of an upstream silencer of FZP increases grain yield in rice.
Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong
2017-11-01
Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
Uchida, Noriyuki; Okuro, Kou; Niitani, Yamato; Ling, Xiao; Ariga, Takayuki; Tomishige, Michio; Aida, Takuzo
2013-03-27
A water-soluble dendron with a fluorescein isothiocyanate (FITC) fluorescent label and bearing nine pendant guanidinium ion (Gu(+))/benzophenone (BP) pairs at its periphery (Glue(BP)-FITC) serves as a "photoclickable molecular glue". By multivalent salt-bridge formation between Gu(+) ions and oxyanions, Glue(BP)-FITC temporarily adheres to a kinesin/microtubule hybrid. Upon subsequent exposure to UV light, this noncovalent binding is made permanent via a cross-linking reaction mediated by carbon radicals derived from the photoexcited BP units. This temporal-to-permanent transformation by light occurs quickly and efficiently in this preorganized state, allowing the movements of microtubules on a kinesin-coated glass plate to be photochemically controlled. A fundamental difference between such temporal and permanent bindings was visualized by the use of "optical tweezers".
Ren, Tingting; Zhu, Juanjuan; Zhu, Lili; Cheng, Mingliang
2017-01-01
Nonalcoholic steatohepatitis (NASH) is liver inflammation and a major threat to public health. Several pharmaceutical agents have been used for NASH therapy but their high-rate side effects limit the use. Blueberry juice and probiotics (BP) have anti-inflammation and antibacterial properties, and may be potential candidates for NASH therapy. To understand the molecular mechanism, Sprague Dawley rats were used to create NASH models and received different treatments. Liver tissues were examined using HE (hematoxylin and eosin) and ORO (Oil Red O) stain, and serum biochemical indices were measured. The levels of peroxisome proliferators-activated receptor (PPAR)-α, sterol regulatory element binding protein-1c (SREBP-1c), Patatin-like phospholipase domain-containing protein 3 (PNPLA-3), inflammatory cytokines and apoptosis biomarkers in liver tissues were measured by qRT-PCR and Western blot. HE and ORO analysis indicated that the hepatocytes were seriously damaged with more and larger lipid droplets in NASH models while BP reduced the number and size of lipid droplets (p < 0.05). Meanwhile, BP increased the levels of SOD (superoxide dismutase), GSH (reduced glutathione) and HDL-C (high-density lipoprotein cholesterol), and reduced the levels of AST (aspartate aminotransferase), ALT (alanine aminotransferase), TG (triglycerides), LDL-C (low-density lipoprotein cholesterol) and MDA (malondialdehyde) in NASH models (p < 0.05). BP increased the level of PPAR-α (Peroxisome proliferator-activated receptor α), and reduced the levels of SREBP-1c (sterol regulatory element binding protein-1c) and PNPLA-3 (Patatin-like phospholipase domain-containing protein 3) (p < 0.05). BP reduced hepatic inflammation and apoptosis by affecting IL-6 (interleukin 6), TNF-α (Tumor necrosis factor α), caspase-3 and Bcl-2 in NASH models. Furthermore, PPAR-α inhibitor increased the level of SREBP-1c and PNPLA-3. Therefore, BP prevents NASH progression by affecting SREBP-1c/PNPLA-3 pathway via PPAR-α. PMID:28264426
Ren, Tingting; Zhu, Juanjuan; Zhu, Lili; Cheng, Mingliang
2017-02-27
Nonalcoholic steatohepatitis (NASH) is liver inflammation and a major threat to public health. Several pharmaceutical agents have been used for NASH therapy but their high-rate side effects limit the use. Blueberry juice and probiotics (BP) have anti-inflammation and antibacterial properties, and may be potential candidates for NASH therapy. To understand the molecular mechanism, Sprague Dawley rats were used to create NASH models and received different treatments. Liver tissues were examined using HE (hematoxylin and eosin) and ORO (Oil Red O) stain, and serum biochemical indices were measured. The levels of peroxisome proliferators-activated receptor (PPAR)-α, sterol regulatory element binding protein-1c (SREBP-1c), Patatin-like phospholipase domain-containing protein 3 (PNPLA-3), inflammatory cytokines and apoptosis biomarkers in liver tissues were measured by qRT-PCR and Western blot. HE and ORO analysis indicated that the hepatocytes were seriously damaged with more and larger lipid droplets in NASH models while BP reduced the number and size of lipid droplets ( p < 0.05). Meanwhile, BP increased the levels of SOD (superoxide dismutase), GSH (reduced glutathione) and HDL-C (high-density lipoprotein cholesterol), and reduced the levels of AST (aspartate aminotransferase), ALT (alanine aminotransferase), TG (triglycerides), LDL-C (low-density lipoprotein cholesterol) and MDA (malondialdehyde) in NASH models ( p < 0.05). BP increased the level of PPAR-α (Peroxisome proliferator-activated receptor α), and reduced the levels of SREBP-1c (sterol regulatory element binding protein-1c) and PNPLA-3 (Patatin-like phospholipase domain-containing protein 3) ( p < 0.05). BP reduced hepatic inflammation and apoptosis by affecting IL-6 (interleukin 6), TNF-α (Tumor necrosis factor α), caspase-3 and Bcl-2 in NASH models. Furthermore, PPAR-α inhibitor increased the level of SREBP-1c and PNPLA-3. Therefore, BP prevents NASH progression by affecting SREBP-1c/PNPLA-3 pathway via PPAR-α.
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents. PMID:28463978
Yadav, Saveg; Pandey, Shrish Kumar; Singh, Vinay Kumar; Goel, Yugal; Kumar, Ajay; Singh, Sukh Mahendra
2017-01-01
Altered metabolism is an emerging hallmark of cancer, as malignant cells display a mammoth up-regulation of enzymes responsible for steering their bioenergetic and biosynthetic machinery. Thus, the recent anticancer therapeutic strategies focus on the targeting of metabolic enzymes, which has led to the identification of specific metabolic inhibitors. One of such inhibitors is 3-bromopyruvate (3-BP), with broad spectrum of anticancer activity due to its ability to inhibit multiple metabolic enzymes. However, the molecular characterization of its binding to the wide spectrum of target enzymes remains largely elusive. Therefore, in the present study we undertook in silico investigations to decipher the molecular nature of the docking of 3-BP with key target enzymes of glycolysis and TCA cycle by PatchDock and YASARA docking tools. Additionally, derivatives of 3-BP, dibromopyruvate (DBPA) and propionic acid (PA), with reported biological activity, were also investigated for docking to important target metabolic enzymes of 3-BP, in order to predict their therapeutic efficacy versus that of 3-BP. A comparison of the docking scores with respect to 3-BP indicated that both of these derivatives display a better binding strength to metabolic enzymes. Further, analysis of the drug likeness of 3-BP, DBPA and PA by Lipinski filter, admetSAR and FAF Drug3 indicated that all of these agents showed desirable drug-like criteria. The outcome of this investigation sheds light on the molecular characteristics of the binding of 3-BP and its derivatives with metabolic enzymes and thus may significantly contribute in designing and optimizing therapeutic strategies against cancer by using these agents.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang
Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of themore » bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.« less
A New Regulator of Osteoclastogenesis: Estrogen Response Element–Binding Protein in Bone
Chen, Hong; Gilbert, Linda C; Lu, X; Liu, Zhaofan; You, Shaojin; Weitzmann, M Neale; Nanes, Mark S; Adams, John
2012-01-01
The heterogeneous nuclear ribonucleoprotein (hnRNP)–like estrogen response element–binding protein (ERE-BP) competes with estrogen receptor α (ERα) for occupancy of estrogen response elements (EREs). Here we report that ERE-BP potently stimulates osteoclastogenesis. ERE-BP mRNA and protein were found to be expressed ubiquitously in bone. Overexpression of ERE-BP in cultured osteoblasts stimulated expression of the receptor activator of NF-κB ligand (RANKL) and decreased osteoprotegerin (OPG). The effect of ERE-BP on RANKL was shown to be transcriptional in transient transfection assay and competed with via the ER. Constitutive expression of ERE-BP increased the sensitivity of cells toward 1,25-dihydroxyvitamin D3 stimulation of RANKL expression. In contrast, knockdown of ERE-BP in stromal ST-2 cells decreased basal RANKL promoter activity. Cocultures of ERE-BP lentivirus–transduced ST-2 cells with spleen monocytes induced formation of multinucleated osteoclasts (OCs) characterized by tartrate-resistant acid phosphatase, calcitonin receptors, and functional calcium resorption from bone slices. Although ERα competed with ERE-BP for an ERE in a dose-dependent manner, ERE-BP was an independent and potent regulator of RANKL and osteoclastogenesis. In preosteoclastic RAW cells, overexpression of ERE-BP increased RANK, upregulated NF-κB signaling, and enhanced differentiation toward a mature OC phenotype independent of RANKL. These results identify ERE-BP as a potent modulator of osteoclastogenesis. We hypothesize that ERE-BP may play a critical role in the regulation of bone homeostasis as a modulator of estrogen sensitivity as well as by direct action on the transcription of critical osteoclastogenic genes. PMID:21773989
Tanimura, Akira; Dan, Shingo; Yoshida, Mitsuaki
1998-01-01
The expression of human T-cell leukemia virus type 1 (HTLV-1) is activated by interaction of a viral transactivator protein, Tax, and cellular transcription factor, CREB (cyclic AMP response element binding protein), which bind to a 21-bp enhancer in the long terminal repeats (LTR). THP (Tax-helping protein) was previously determined to enhance the transactivation by Tax protein. Here we report novel forms of the human homolog of a member of the Gli oncogene family, Gli2 (also termed Gli2/THP), an extended form of a zinc finger protein, THP, which was described previously. Four possible isoforms (hGli2 α, β, γ, and δ) are formed by combinations of two independent alternative splicings, and all the isoforms could bind to a DNA motif, TRE2S, in the LTR. The longer isoforms, α and β, were abundantly expressed in various cell lines including HTLV-1-infected T-cell lines. Fusion proteins of the hGli2 isoforms with the DNA-binding domain of Gal4 activated transcription when the reporter contained a Gal4-binding site and one copy of the 21-bp sequence, to which CREB binds. This activation was observed only in the presence of Tax. The 21-bp sequence in the reporter was also essential for the activation. These results suggest that simultaneous binding of hGli2 and CREB to the respective sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the LTR contains the 21-bp and TRE2S sequences in the vicinity. PMID:9557682
Bremner, J D; Horti, A; Staib, L H; Zea-Ponce, Y; Soufer, R; Charney, D S; Baldwin, R
2000-01-01
Quantitation of the PET benzodiazepine receptor antagonist, [(11)C]Iomazenil, using low specific activity radioligand was recently described. The purpose of this study was to quantitate benzodiazepine receptor binding in human subjects using PET and high specific activity [(11)C]Iomazenil. Six healthy human subjects underwent PET imaging following a bolus injection of high specific activity (>100 Ci/mmol) [(11)C]iomazenil. Arterial samples were collected at multiple time points after injection for measurement of unmetabolized total and nonprotein-bound parent compound in plasma. Time activity curves of radioligand concentration in brain and plasma were analyzed using two and three compartment model. Kinetic rate constants of transfer of radioligand between plasma, nonspecifically bound brain tissue, and specifically bound brain tissue compartments were fitted to the model. Values for fitted kinetic rate constants were used in the calculation of measures of benzodiazepine receptor binding, including binding potential (the ratio of receptor density to affinity), and product of BP and the fraction of free nonprotein-bound parent compound (V(3)'). Use of the three compartment model improved the goodness of fit in comparison to the two compartment model. Values for kinetic rate constants and measures of benzodiazepine receptor binding, including BP and V(3)', were similar to results obtained with the SPECT radioligand [(123)I]iomazenil, and a prior report with low specific activity [(11)C]Iomazenil. Kinetic modeling using the three compartment model with PET and high specific activity [(11)C]Iomazenil provides a reliable measure of benzodiazepine receptor binding. Synapse 35:68-77, 2000. Published 2000 Wiley-Liss, Inc.
Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak
2015-02-18
HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakabayashi, Hiroko; Ohta, Yasuharu, E-mail: yohta@yamaguchi-u.ac.jp; Yamamoto, Masayoshi
2013-05-03
Highlights: •Arnt mRNA expressed in a circadian manner in mouse pancreatic islets. •Expressions of Dbp and Arnt damped in the islets of a diabetic model mouse. •DBP and E4BP4 regulate Arnt promoter activity by direct binding. •Arnt may have a role in connecting circadian rhythm and metabolism. -- Abstract: Aryl hydrocarbon receptor nuclear translocator (ARNT)/hypoxia inducible factor-1β (HIF-1β) has emerged as a potential determinant of pancreatic β-cell dysfunction and type 2 diabetes in humans. An 82% reduction in Arnt expression was observed in islets from type 2 diabetic donors as compared to non-diabetic donors. However, few regulators of Arnt expressionmore » have been identified. Meanwhile, disruption of the clock components CLOCK and BMAL1 is known to result in hypoinsulinemia and diabetes, but the molecular details remain unclear. In this study, we identified a novel molecular connection between Arnt and two clock-controlled output genes, albumin D-element binding protein (Dbp) and E4 binding protein 4 (E4bp4). By conducting gene expression studies using the islets of Wfs1{sup −/−} A{sup y}/a mice that develop severe diabetes due to β-cell apoptosis, we demonstrated clock-related gene expressions to be altered in the diabetic mice. Dbp mRNA decreased by 50%, E4bp4 mRNA increased by 50%, and Arnt mRNA decreased by 30% at Zeitgever Time (ZT) 12. Mouse pancreatic islets exhibited oscillations of clock gene expressions. E4BP4, a D-box negative regulator, oscillated anti-phase to DBP, a D-box positive regulator. We also found low-amplitude circadian expression of Arnt mRNA, which peaked at ZT4. Over-expression of DBP raised both mRNA and protein levels of ARNT in HEK293 and MIN6 cell lines. Arnt promoter-driven luciferase reporter assay in MIN6 cells revealed that DBP increased Arnt promoter activity by 2.5-fold and that E4BP4 competitively inhibited its activation. In addition, on ChIP assay, DBP and E4BP4 directly bound to D-box elements within the Arnt promoter in MIN6 cells. These results suggest that in mouse pancreatic islets mRNA expression of Arnt fluctuates significantly in a circadian manner and that the down-regulation of Dbp and up-regulation E4bp4 contribute to direct suppression of Arnt expression in diabetes.« less
Kaczanowska, Katarzyna; Camacho Hernandez, Gisela Andrea; Bendiks, Larissa; Kohs, Larissa; Cornejo-Bravo, Jose Manuel; Harel, Michal; Finn, M G; Taylor, Palmer
2017-03-15
Through studies with ligand binding to the acetylcholine binding protein (AChBP), we previously identified a series of 4,6-substituted 2-aminopyrimidines that associate with this soluble surrogate of the nicotinic acetylcholine receptor (nAChR) in a cooperative fashion, not seen for classical nicotinic agonists and antagonists. To examine receptor interactions of this structural family on ligand-gated ion channels, we employed HEK cells transfected with cDNAs encoding three requisite receptor subtypes: α7-nAChR, α4β2-nAChR, and a serotonin receptor (5-HT 3A R), along with a fluorescent reporter. Initial screening of a series of over 50 newly characterized 2-aminopyrimidines with affinity for AChBP showed only two to be agonists on the α7-nAChR below 10 μM concentration. Their unique structural features were incorporated into design of a second subset of 2-aminopyrimidines yielding several congeners that elicited α7 activation with EC 50 values of 70 nM and K d values for AChBP in a similar range. Several compounds within this series exhibit specificity for the α7-nAChR, showing no activation or antagonism of α4β2-nAChR or 5-HT3AR at concentrations up to 10 μM, while others were weaker antagonists (or partial agonists) on these receptors. Analysis following cocrystallization of four ligand complexes with AChBP show binding at the subunit interface, but with an orientation or binding pose that differs from classical nicotinic agonists and antagonists and from the previously analyzed set of 2-aminopyrimidines that displayed distinct cooperative interactions with AChBP. Orientations of aromatic side chains of these complexes are distinctive, suggesting new modes of binding at the agonist-antagonist site and perhaps an allosteric action for heteromeric nAChRs.
Jeon, Bu-Nam; Yoo, Jung-Yoon; Choi, Won-Il; Lee, Choong-Eun; Yoon, Ho-Geun; Hur, Man-Wook
2008-01-01
FBI-1 (also called Pokemon/ZBTB7A) is a BTB/POZ-domain Krüppel-like zinc-finger transcription factor. Recently, FBI-1 was characterized as a proto-oncogenic protein, which represses tumor suppressor ARF gene transcription. The expression of FBI-1 is increased in many cancer tissues. We found that FBI-1 potently represses transcription of the Rb gene, a tumor suppressor gene important in cell cycle arrest. FBI-1 binds to four GC-rich promoter elements (FREs) located at bp –308 to –188 of the Rb promoter region. The Rb promoter also contains two Sp1 binding sites: GC-box 1 (bp –65 to –56) and GC-box 2 (bp –18 to –9), the latter of which is also bound by FBI-1. We found that FRE3 (bp –244 to –236) is also a Sp1 binding element. FBI-1 represses transcription of the Rb gene not only by binding to the FREs, but also by competing with Sp1 at the GC-box 2 and the FRE3. By binding to the FREs and/or the GC-box, FBI-1 represses transcription of the Rb gene through its POZ-domain, which recruits a co-repressor-histone deacetylase complex and deacetylates histones H3 and H4 at the Rb gene promoter. FBI-1 inhibits C2C12 myoblast cell differentiation by repressing Rb gene expression. PMID:18801742
7H-Dibenzo[c,g]carbazole (DBC) induces skin and liver tumors in mice following topical application, whereas benzo[a]pyrene (BP) induces only skin tumors. DBC also binds to liver DNA to a much greater extent than does BP. The present study examined factors that might account for t...
Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L
2013-09-09
In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
Schuitemaker, Alie; van Berckel, Bart N M; Kropholler, Marc A; Veltman, Dick J; Scheltens, Philip; Jonker, Cees; Lammertsma, Adriaan A; Boellaard, Ronald
2007-05-01
(R)-[11C]PK11195 has been used for quantifying cerebral microglial activation in vivo. In previous studies, both plasma input and reference tissue methods have been used, usually in combination with a region of interest (ROI) approach. Definition of ROIs, however, can be labourious and prone to interobserver variation. In addition, results are only obtained for predefined areas and (unexpected) signals in undefined areas may be missed. On the other hand, standard pharmacokinetic models are too sensitive to noise to calculate (R)-[11C]PK11195 binding on a voxel-by-voxel basis. Linearised versions of both plasma input and reference tissue models have been described, and these are more suitable for parametric imaging. The purpose of this study was to compare the performance of these plasma input and reference tissue parametric methods on the outcome of statistical parametric mapping (SPM) analysis of (R)-[11C]PK11195 binding. Dynamic (R)-[11C]PK11195 PET scans with arterial blood sampling were performed in 7 younger and 11 elderly healthy subjects. Parametric images of volume of distribution (Vd) and binding potential (BP) were generated using linearised versions of plasma input (Logan) and reference tissue (Reference Parametric Mapping) models. Images were compared at the group level using SPM with a two-sample t-test per voxel, both with and without proportional scaling. Parametric BP images without scaling provided the most sensitive framework for determining differences in (R)-[11C]PK11195 binding between younger and elderly subjects. Vd images could only demonstrate differences in (R)-[11C]PK11195 binding when analysed with proportional scaling due to intersubject variation in K1/k2 (blood-brain barrier transport and non-specific binding).
Spudich, James A.
2015-01-01
No matter how many times one explores the structure of the myosin molecule, there is always something new to discover. Here, I describe the myosin mesa, a structural feature of the motor domain that has the characteristics of a binding domain for another protein, possibly myosin-binding protein C (MyBP-C). Interestingly, many well-known hypertrophic cardiomyopathy (HCM) mutations lie along this surface and may affect the putative interactions proposed here. A potential unifying hypothesis for the molecular basis of human hypertrophic cardiomyopathy is discussed here. It involves increased power output of the cardiac muscle as a result of HCM mutations causing the release of inhibition by myosin binding protein C. PMID:25619247
Structural and Biochemical Insights into MLL1 Core Complex Assembly
DOE Office of Scientific and Technical Information (OSTI.GOV)
Avdic, Vanja; Zhang, Pamela; Lanouette, Sylvain
2012-05-02
Histone H3 Lys-4 methylation is predominantly catalyzed by a family of methyltransferases whose enzymatic activity depends on their interaction with a three-subunit complex composed of WDR5, RbBP5, and Ash2L. Here, we report that a segment of 50 residues of RbBP5 bridges the Ash2L C-terminal domain to WDR5. The crystal structure of WDR5 in ternary complex with RbBP5 and MLL1 reveals that both proteins binds peptide-binding clefts located on opposite sides of WDR5s {beta}-propeller domain. RbBP5 engages in several hydrogen bonds and van der Waals contacts within a V-shaped cleft formed by the junction of two blades on WDR5. Mutational analysesmore » of both the WDR5 V-shaped cleft and RbBP5 residues reveal that the interactions between RbBP5 and WDR5 are important for the stimulation of MLL1 methyltransferase activity. Overall, this study provides the structural basis underlying the formation of the WDR5-RbBP5 subcomplex and further highlight the crucial role of WDR5 in scaffolding the MLL1 core complex.« less
Sóvágó, Judit; Farde, Lars; Halldin, Christer; Langer, Oliver; Laszlovszky, István; Kiss, Béla; Gulyás, Balázs
2004-10-01
The dopamine-D3 receptor is of special interest due to its postulated role in the pathophysiology and treatment of schizophrenia and Parkinson's Disease. Increasing evidences support the assumption that the D3 receptors are occupied to a high degree by dopamine at physiological conditions. Research on the functional role of the D3 receptors in brain has however been hampered by the lack of D3 selective ligands. In the present Positron Emission Tomography (PET) study the binding of the novel, putative dopamine-D3 receptor ligand, [11C]RGH-1756 was characterized in the cynomolgus monkey brain. [11C]RGH-1756 was rather homogenously distributed in brain and the regional binding potential (BP) values ranged between 0.17 and 0.48. Pretreatment with unlabelled RGH-1756 decreased radioligand binding to the level of the cerebellum in most brain areas. The regional BP values were lower after intravenous injection of a higher mass of RGH-1756, indicating saturable binding of [11C]RGH-1756. The D2/D3 antagonist raclopride partly inhibited the binding of [11C]RGH-1756 in several brain areas, including the striatum, mesencephalon and neocortex, whereas the 5HT(1A) antagonist WAY-100635 had no evident effect on [11C]RGH-1756 binding. Despite the promising binding characteristics of RGH-1756 in vitro the present PET-study indicates that [11C]RGH-1756 provides a low signal for specific binding to the D3 receptor in vivo. One explanation is that the favorable binding characteristics of RGH-1756 in vitro are not manifested in vivo. Alternatively, the results may support the hypothesis that the dopamine-D3 receptors are indeed occupied to a high extent by dopamine in vivo and thus not available for radioligand binding.
Impurity-induced anisotropic semiconductor-semimetal transition in monolayer biased black phosphorus
NASA Astrophysics Data System (ADS)
Bui, D. H.; Yarmohammadi, Mohsen
2018-07-01
Taking into account the electron-impurity interaction within the continuum approximation of tight-binding model, the Born approximation, and the Green's function method, the main features of anisotropic electronic phase transition are investigated in monolayer biased black phosphorus (BP). To this end, we concentrated on the disordered electronic density of states (DOS), which gives useful information for electro-optical devices. Increasing the impurity concentration in both unbiased and biased impurity-infected single-layer BP, in addition to the decrease of the band gap, independent of the direction, leads to the midgap states and an extra Van Hove singularity inside and outside of the band gap, respectively. Furthermore, strong impurity scattering potentials lead to a semiconductor-semimetal transition and one more Van Hove singularity in x-direction of unbiased BP and surprisingly, this transition does not occur in biased BP. We found that there is no phase transition in y-direction. Since real applications require structures with modulated band gaps, we have studied the influence of different bias voltages on the disordered DOS in both directions, resulting in the increase of the band gap.
Grove, A; Galeone, A; Mayol, L; Geiduschek, E P
1996-07-12
TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.
Nonaka, Mayumi I; Zsigmond, Eva; Kudo, Akihiko; Kawakami, Hayato; Yoshida, Kaoru; Yoshida, Manabu; Kawano, Natsuko; Miyado, Kenji; Nonaka, Masaru; Wetsel, Rick A
2015-04-01
C4b-binding protein (C4BP) is known as one of the circulating complement regulators that prevents excessive activation of the host-defense complement system. We have reported previously that C4BP is expressed abundantly in the rodent epididymis, one of the male reproductive organs connecting the testis and vas deferens, where immature spermatozoa acquire their motility and fertilizing ability during their transit through the duct. Epididymal C4BP (EpC4BP) is synthesized androgen-dependently by the epithelial cells, secreted into the lumen, and bound to the outer membrane of the passing spermatozoa. In this study, we found that EpC4BP is secreted as a large oligomer, similar to the serum C4BP, but is digested during the epididymal transit and is almost lost from both the luminal fluid and the sperm surface in the vas deferens. Such a processing pattern is not known in serum C4BP, suggesting that EpC4BP and serum C4BP might have different functional mechanisms, and that there is a novel function of EpC4BP in reproduction. In addition, the disappearance of EpC4BP from the sperm surface prior to ejaculation suggests that EpC4BP works only in the epididymis and would not work in the female reproductive tract to protect spermatozoa from complement attack. Next, we generated C4BP-deficient (C4BP-/-) mice to examine the possible role of EpC4BP in reproduction. However, the C4BP-/- mice were fertile and no significant differences were observed between the C4BP-/- and wild-type mouse spermatozoa in terms of morphology, motility, and rate of the spontaneous acrosome reaction. These results suggest that EpC4BP is involved in male reproduction, but not essential for sperm maturation. Copyright © 2014 Elsevier GmbH. All rights reserved.
53BP1 is a reader of the DNA damage-induced H2A Lys15 ubiquitin mark
Fradet-Turcotte, Amélie; Canny, Marella D.; Escribano-Díaz, Cristina; Orthwein, Alexandre; Leung, Charles C.Y.; Huang, Hao; Landry, Marie-Claude; Kitevski-LeBlanc, Julianne; Noordermeer, Sylvie M.; Sicheri, Frank; Durocher, Daniel
2014-01-01
53BP1 (TP53BP1) is a chromatin-associated factor that promotes immunoglobulin class switching and DNA double-strand break (DSB) repair by non-homologous end joining. To accomplish its function in DNA repair, 53BP1 accumulates at DSB sites downstream of the RNF168 ubiquitin ligase. How ubiquitin recruits 53BP1 to break sites remains enigmatic since its relocalization involves recognition of H4 Lys20 (H4K20) methylation by its Tudor domain. Here we elucidate how 53BP1 is recruited to the chromatin that flanks DSB sites. We show that 53BP1 recognizes mono-nucleosomes containing dimethylated H4K20 (H4K20me2) and H2A ubiquitylated on Lys15 (H2AK15ub), the latter being a product of RNF168 action on chromatin. 53BP1 binds to nucleosomes minimally as a dimer using its previously characterized methyl-lysine-binding Tudor domain and a C-terminal extension, termed the ubiquitylation-dependent recruitment (UDR) motif, which interacts with the epitope formed by H2AK15ub and its surrounding residues on the H2A tail. 53BP1 is therefore a bivalent histone modification reader that recognizes a histone “code” produced by DSB signaling. PMID:23760478
2011-01-01
Background Insecticide resistance jeopardizes the control of mosquito populations and mosquito-borne disease control, which creates a major public health concern. Two-dimensional electrophoresis identified one protein segment with high sequence homology to part of Aedes aegypti iron-responsive element binding protein (IRE-BP). Method RT-PCR and RACE (rapid amplification of cDNA end) were used to clone a cDNA encoding full length IRE-BP 1. Real-time quantitative RT-PCR was used to evaluate the transcriptional level changes in the Cr-IRE strain Aedes aegypti compared to the susceptible strain of Cx. pipiens pallens. The expression profile of the gene was established in the mosquito life cycle. Methyl tritiated thymidine (3H-TdR) was used to observe the cypermethrin resistance changes in C6/36 cells containing the stably transfected IRE-BP 1 gene of Cx. pipiens pallens. Results The complete sequence of iron responsive element binding protein 1 (IRE-BP 1) has been cloned from the cypermethrin-resistant strain of Culex pipiens pallens (Cr-IRE strain). Quantitative RT-PCR analysis indicated that the IRE-BP 1 transcription level was 6.7 times higher in the Cr-IRE strain than in the susceptible strain of 4th instar larvae. The IRE-BP 1 expression was also found to be consistently higher throughout the life cycle of the Cr-IRE strain. A protein of predicted size 109.4 kDa has been detected by Western blotting in IRE-BP 1-transfected mosquito C6/36 cells. These IRE-BP 1-transfected cells also showed enhanced cypermethrin resistance compared to null-transfected or plasmid vector-transfected cells as determined by 3H-TdR incorporation. Conclusion IRE-BP 1 is expressed at higher levels in the Cr-IRE strain, and may confer some insecticide resistance in Cx. pipiens pallens. PMID:22075242
DOE Office of Scientific and Technical Information (OSTI.GOV)
J Wingard; J Ladner; M Vanarotti
2011-12-31
The flagellar calcium-binding protein (FCaBP) of the protozoan Trypanosoma cruzi is targeted to the flagellar membrane where it regulates flagellar function and assembly. As a first step toward understanding the Ca{sup 2+}-induced conformational changes important for membrane-targeting, we report here the x-ray crystal structure of FCaBP in the Ca{sup 2+}-free state determined at 2.2{angstrom} resolution. The first 17 residues from the N terminus appear unstructured and solvent-exposed. Residues implicated in membrane targeting (Lys-19, Lys-22, and Lys-25) are flanked by an exposed N-terminal helix (residues 26-37), forming a patch of positive charge on the protein surface that may interact electrostatically withmore » flagellar membrane targets. The four EF-hands in FCaBP each adopt a 'closed conformation' similar to that seen in Ca{sup 2+}-free calmodulin. The overall fold of FCaBP is closest to that of grancalcin and other members of the penta EF-hand superfamily. Unlike the dimeric penta EF-hand proteins, FCaBP lacks a fifth EF-hand and is monomeric. The unstructured N-terminal region of FCaBP suggests that its covalently attached myristoyl group at the N terminus may be solvent-exposed, in contrast to the highly sequestered myristoyl group seen in recoverin and GCAP1. NMR analysis demonstrates that the myristoyl group attached to FCaBP is indeed solvent-exposed in both the Ca{sup 2+}-free and Ca{sup 2+}-bound states, and myristoylation has no effect on protein structure and folding stability. We propose that exposed acyl groups at the N terminus may anchor FCaBP to the flagellar membrane and that Ca{sup 2+}-induced conformational changes may control its binding to membrane-bound protein targets..« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Terawaki, Shin-ichi, E-mail: terawaki@gunma-u.ac.jp; SPring-8 Center, RIKEN, 1-1-1 Koto, Sayo-cho, Sayo-gun, Hyogo 679-5148; Yoshikane, Asuka
Bicaudal-D1 (BICD1) is an α-helical coiled-coil protein mediating the attachment of specific cargo to cytoplasmic dynein. It plays an essential role in minus end-directed intracellular transport along microtubules. The third C-terminal coiled-coil region of BICD1 (BICD1 CC3) has an important role in cargo sorting, including intracellular vesicles associating with the small GTPase Rab6 and the nuclear pore complex Ran binding protein 2 (RanBP2), and inhibiting the association with cytoplasmic dynein by binding to the first N-terminal coiled-coil region (CC1). The crystal structure of BICD1 CC3 revealed a parallel homodimeric coiled-coil with asymmetry and complementary knobs-into-holes interactions, differing from Drosophila BicDmore » CC3. Furthermore, our binding study indicated that BICD1 CC3 possesses a binding surface for two distinct cargos, Rab6 and RanBP2, and that the CC1-binding site overlaps with the Rab6-binding site. These findings suggest a molecular basis for cargo recognition and autoinhibition of BICD proteins during dynein-dependent intracellular retrograde transport. - Highlights: • BICD1 CC3 is a parallel homodimeric coiled-coil with axial asymmetry. • The coiled-coil packing of BICD1 CC3 is adapted to the equivalent heptad position. • BICD1 CC3 has distinct binding sites for two classes of cargo, Rab6 and RanBP2. • The CC1-binding site of BICD1 CC3 overlaps with the Rab6-binding site.« less
An HMGA2-IGF2BP2 axis regulates myoblast proliferation and myogenesis.
Li, Zhizhong; Gilbert, Jason A; Zhang, Yunyu; Zhang, Minsi; Qiu, Qiong; Ramanujan, Krishnan; Shavlakadze, Tea; Eash, John K; Scaramozza, Annarita; Goddeeris, Matthew M; Kirsch, David G; Campbell, Kevin P; Brack, Andrew S; Glass, David J
2012-12-11
A group of genes that are highly and specifically expressed in proliferating skeletal myoblasts during myogenesis was identified. Expression of one of these genes, Hmga2, increases coincident with satellite cell activation, and later its expression significantly declines correlating with fusion of myoblasts into myotubes. Hmga2 knockout mice exhibit impaired muscle development and reduced myoblast proliferation, while overexpression of HMGA2 promotes myoblast growth. This perturbation in proliferation can be explained by the finding that HMGA2 directly regulates the RNA-binding protein IGF2BP2. Add-back of IGF2BP2 rescues the phenotype. IGF2BP2 in turn binds to and controls the translation of a set of mRNAs, including c-myc, Sp1, and Igf1r. These data demonstrate that the HMGA2-IGF2BP2 axis functions as a key regulator of satellite cell activation and therefore skeletal muscle development. Copyright © 2012 Elsevier Inc. All rights reserved.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
Carretero, Gustavo P B; Saraiva, Greice K V; Cauz, Ana C G; Rodrigues, Magali A; Kiyota, Sumika; Riske, Karin A; Dos Santos, Alcindo A; Pinatto-Botelho, Marcos F; Bemquerer, Marcelo P; Gueiros-Filho, Frederico J; Chaimovich, Hernan; Schreier, Shirley; Cuccovia, Iolanda M
2018-05-09
Antimicrobial peptides (AMPs) work as a primary defense against pathogenic microorganisms. BP100, (KKLFKKILKYL-NH 2 ), a rationally designed short, highly cationic AMP, acts against many bacteria, displaying low toxicity to eukaryotic cells. Previously we found that its mechanism of action depends on membrane surface charge and on peptide-to-lipid ratio. Here we present the synthesis of two BP100 analogs: BP100‑alanyl‑hexadecyl‑1‑amine (BP100-Ala-NH-C 16 H 33 ) and cyclo(1‑4)‑d‑Cys 1 , Ile 2 , Leu 3 , Cys 4 -BP100 (Cyclo(1‑4)‑cILC-BP100). We examined their binding to large unilamellar vesicles (LUV), conformational and functional properties, and compared with those of BP100. The analogs bound to membranes with higher affinity and a lesser dependence on electrostatic forces than BP100. In the presence of LUV, BP100 and BP100-Ala-NH-C 16 H 33 acquired α-helical conformation, while Cyclo(1‑4)‑cILC-BP100) was partly α-helical and partly β-turn. Taking in conjunction: 1. particle sizes and zeta potential, 2. effects on lipid flip-flop, 3. leakage of LUVs internal contents, and 4. optical microscopy of giant unilamellar vesicles, we concluded that at high concentrations, all three peptides acted by a carpet mechanism, while at low concentrations the peptides acted by disorganizing the lipid bilayer, probably causing membrane thinning. The higher activity and lesser membrane surface charge dependence of the analogs was probably due to their greater hydrophobicity. The MIC values of both analogs towards Gram-positive and Gram-negative bacteria were similar to those of BP100 but both analogues were more hemolytic. Confocal microscopy showed Gram-positive B. subtilis killing with concomitant extensive membrane damage suggestive of lipid clustering, or peptide-lipid aggregation. These results were in agreement with those found in model membranes. Copyright © 2018. Published by Elsevier B.V.
Mechanisms Down-Regulating Sprouty1, a Growth Inhibitor in Prostate Cancer
2008-10-01
cancer cells all express FGF-BP. Using ribozymes to FGF-BP, Aigner et al. (2002) were able to demonstrate that decreased FGF-BP is associated with...International Journal of Cancer 92 510–517. Aigner A, Renneberg H, Bojunga J, Apel J, Nelson PS & Czubayko F 2002 Ribozyme -targeting of a secreted FGF- binding
Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto
2016-11-01
The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
2012-01-01
Background In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS) after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR), which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Methods Recombinant HmC1q (rHmC1q) was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. Results rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. Conclusions A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal leech. PMID:22356764
Tahtouh, Muriel; Garçon-Bocquet, Annelise; Croq, Françoise; Vizioli, Jacopo; Sautière, Pierre-Eric; Van Camp, Christelle; Salzet, Michel; Nagnan-le Meillour, Patricia; Pestel, Joël; Lefebvre, Christophe
2012-02-22
In invertebrates, the medicinal leech is considered to be an interesting and appropriate model to study neuroimmune mechanisms. Indeed, this non-vertebrate animal can restore normal function of its central nervous system (CNS) after injury. Microglia accumulation at the damage site has been shown to be required for axon sprouting and for efficient regeneration. We characterized HmC1q as a novel chemotactic factor for leech microglial cell recruitment. In mammals, a C1q-binding protein (C1qBP alias gC1qR), which interacts with the globular head of C1q, has been reported to participate in C1q-mediated chemotaxis of blood immune cells. In this study, we evaluated the chemotactic activities of a recombinant form of HmC1q and its interaction with a newly characterized leech C1qBP that acts as its potential ligand. Recombinant HmC1q (rHmC1q) was produced in the yeast Pichia pastoris. Chemotaxis assays were performed to investigate rHmC1q-dependent microglia migration. The involvement of a C1qBP-related molecule in this chemotaxis mechanism was assessed by flow cytometry and with affinity purification experiments. The cellular localization of C1qBP mRNA and protein in leech was investigated using immunohistochemistry and in situ hybridization techniques. rHmC1q-stimulated microglia migrate in a dose-dependent manner. This rHmC1q-induced chemotaxis was reduced when cells were preincubated with either anti-HmC1q or anti-human C1qBP antibodies. A C1qBP-related molecule was characterized in leech microglia. A previous study showed that recruitment of microglia is observed after HmC1q release at the cut end of axons. Here, we demonstrate that rHmC1q-dependent chemotaxis might be driven via a HmC1q-binding protein located on the microglial cell surface. Taken together, these results highlight the importance of the interaction between C1q and C1qBP in microglial activation leading to nerve repair in the medicinal leech.
The effect of S100A6 on nuclear translocation of CacyBP/SIP in colon cancer cells
Yang, Bo; Li, Qianqian; Liu, Aiqin; Zhao, Yingying; Qiu, Changqing; Ge, Jun
2018-01-01
Background Calcyclin Binding Protein/(Siah-1 interacting protein) (CacyBP/SIP) acts as an oncogene in colorectal cancer. The nuclear accumulation of CacyBP/SIP has been linked to the proliferation of cancer cells. It has been reported that intracellular Ca2+ induces the nuclear translocation of CacyBP/SIP. However, the molecular mechanism of CacyBP/SIP nuclear translocation has yet to be elucidated. The purpose of this study was to test whether the Ca2+-dependent binding partner S100 protein is involved in CacyBP/SIP nuclear translocation in colon cancer SW480 cells. Methods The subcellular localization of endogenous CacyBP/SIP was observed following the stimulation of ionomycin or BAPTA/AM by immunofluorescence staining in SW480 cells. S100A6 small interfering RNAs (siRNA) were transfected into SW480 cells. Immunoprecipitation assays detected whether S100 protein is relevant to the nuclear translocation of CacyBP/SIP in response to changes in [Ca2+]i. Results We observed that endogenous CacyBP/SIP is translocated from the cytosol to the nucleus following the elevation of [Ca2+]i by ionomycin in SW480 cells. Co-immunoprecipitation experiments showed that the interaction between S100A6 and CacyBP/SIP was increased simultaneously with elevated Ca2+. Knockdown of S100A6 abolished the Ca2+ effect on the subcellular translocation of CacyBP/SIP. Conclusion Thus, we demonstrated that S100A6 is required for the Ca2+-dependent nuclear translocation of CacyBP/SIP in colon cancer SW480 cells. PMID:29534068
Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050
Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C
2015-01-01
Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
Narusaka, Yoshihiro; Nakashima, Kazuo; Shinwari, Zabta K; Sakuma, Yoh; Furihata, Takashi; Abe, Hiroshi; Narusaka, Mari; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2003-04-01
Many abiotic stress-inducible genes contain two cis-acting elements, namely a dehydration-responsive element (DRE; TACCGACAT) and an ABA-responsive element (ABRE; ACGTGG/TC), in their promoter regions. We precisely analyzed the 120 bp promoter region (-174 to -55) of the Arabidopsis rd29A gene whose expression is induced by dehydration, high-salinity, low-temperature, and abscisic acid (ABA) treatments and whose 120 bp promoter region contains the DRE, DRE/CRT-core motif (A/GCCGAC), and ABRE sequences. Deletion and base substitution analyses of this region showed that the DRE-core motif functions as DRE and that the DRE/DRE-core motif could be a coupling element of ABRE. Gel mobility shift assays revealed that DRE-binding proteins (DREB1s/CBFs and DREB2s) bind to both DRE and the DRE-core motif and that ABRE-binding proteins (AREBs/ABFs) bind to ABRE in the 120 bp promoter region. In addition, transactivation experiments using Arabidopsis leaf protoplasts showed that DREBs and AREBs cumulatively transactivate the expression of a GUS reporter gene fused to the 120 bp promoter region of rd29A. These results indicate that DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A gene in response to ABA in Arabidopsis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sawada, Y.; Kawai, R.; McManaway, M.
(3H)Cyclofoxy (CF: 17-cyclopropylmethyl-3,14-dihydroxy-4,5-alpha-epoxy-6-beta-fluoromorp hinan) is an opioid antagonist with affinity to both mu and kappa subtypes that was synthesized for quantitative evaluation of opioid receptor binding in vivo. Two sets of experiments in rats were analyzed. The first involved determining the metabolite-corrected blood concentration and tissue distribution of CF in brain 1 to 60 min after i.v. bolus injection. The second involved measuring brain washout for 15 to 120 s following intracarotid artery injection of CF. A physiologically based model and a classical compartmental pharmacokinetic model were compared. The models included different assumptions for transport across the blood-brain barrier (BBB);more » estimates of nonspecific tissue binding and specific binding to a single opiate receptor site were found to be essentially the same with both models. The nonspecific binding equilibrium constant varied modestly in different brain structures (Keq = 3-9), whereas the binding potential (BP) varied over a much broader range (BP = 0.6-32). In vivo estimates of the opioid receptor dissociation constant were similar for different brain structures (KD = 2.1-5.2 nM), whereas the apparent receptor density (Bmax) varied between 1 (cerebellum) and 78 (thalamus) pmol/g of brain. The receptor dissociation rate constants in cerebrum (k4 = 0.08-0.16 min-1; koff = 0.16-0.23 min-1) and brain vascular permeability (PS = 1.3-3.4 ml/min/g) are sufficiently high to achieve equilibrium conditions within a reasonable period of time. Graphical analysis of the data is inappropriate due to the high tissue-loss rate constant for CF in brain. From these findings, CF should be a very useful opioid receptor ligand for the estimation of the receptor binding parameters in human subjects using (18F)CF and positron emission tomography.« less
Bremner, J D; Baldwin, R; Horti, A; Staib, L H; Ng, C K; Tan, P Z; Zea-Ponce, Y; Zoghbi, S; Seibyl, J P; Soufer, R; Charney, D S; Innis, R B
1999-08-31
Although positron emission tomography (PET) and single photon emission computed tomography (SPECT) are increasingly used for quantitation of neuroreceptor binding, almost no studies to date have involved a direct comparison of the two. One study found a high level of agreement between the two techniques, although there was a systematic 30% increase in measures of benzodiazepine receptor binding in SPECT compared with PET. The purpose of the current study was to directly compare quantitation of benzodiazepine receptor binding in the same human subjects using PET and SPECT with high specific activity [11C]iomazenil and [123I]iomazenil, respectively. All subjects were administered a single bolus of high specific activity iomazenil labeled with 11C or 123I followed by dynamic PET or SPECT imaging of the brain. Arterial blood samples were obtained for measurement of metabolite-corrected radioligand in plasma. Compartmental modeling was used to fit values for kinetic rate constants of transfer of radioligand between plasma and brain compartments. These values were used for calculation of binding potential (BP = Bmax/Kd) and product of BP and the fraction of free non-protein-bound parent compound (V3'). Mean values for V3' in PET and SPECT were as follows: temporal cortex 23+/-5 and 22+/-3 ml/g, frontal cortex23+/-6 and 22+/-3 ml/g, occipital cortex 28+/-3 and 31+/-5 ml/g, and striatum 4+/-4 and 7+/-4 ml/g. These preliminary findings indicate that PET and SPECT provide comparable results in quantitation of neuroreceptor binding in the human brain.
Schönermark, S; Filsinger, S; Berger, B; Hänsch, G M
1988-01-01
C8-binding protein is an intrinsic membrane protein of the human erythrocyte. It inhibits the complement (C5b-9)-mediated lysis in a species-restricting manner. In the present study we incorporated C8bp, isolated from human erythrocytes, into sheep erythrocytes (SRBC). SRBC, normally sensitive to lysis by human C5b-9, became insensitive to lysis. Furthermore, we found that C8bp is incorporated into the membrane-attack complex C5b-9, most probably by interacting with C8, since C8bp has an affinity for C8, particularly for the C8 alpha-gamma-subunit. Antibodies to C8bp react with the C8 alpha-subunits and with C9, pointing to the possibility of a partial homology between these proteins. Images Figure 4 Figure 6 Figure 7 PMID:3366469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Subramanian, T.; Zhao, Ling-jun; Chinnadurai, G., E-mail: chinnag@slu.edu
Adenovirus E1A induces cell proliferation, oncogenic transformation and promotes viral replication through interaction with p300/CBP, TRRAP/p400 multi-protein complex and the retinoblastoma (pRb) family proteins through distinct domains in the E1A N-terminal region. The C-terminal region of E1A suppresses E1A/Ras co-transformation and interacts with FOXK1/K2, DYRK1A/1B/HAN11 and CtBP1/2 (CtBP) protein complexes. To specifically dissect the role of CtBP interaction with E1A, we engineered a mutation (DL→AS) within the CtBP-binding motif, PLDLS, and investigated the effect of the mutation on immortalization and Ras cooperative transformation of primary cells and viral replication. Our results suggest that CtBP–E1A interaction suppresses immortalization and Ras co-operativemore » transformation of primary rodent epithelial cells without significantly influencing the tumorigenic activities of transformed cells in immunodeficient and immunocompetent animals. During productive infection, CtBP–E1A interaction enhances viral replication in human cells. Between the two CtBP family proteins, CtBP2 appears to restrict viral replication more than CtBP1 in human cells. - Highlights: • Adenovirus E1A C-terminal region suppresses E1A/Ras co-transformation. • This E1A region binds with FOXK, DYRK1/HAN11 and CtBP cellular protein complexes. • We found that E1A–CtBP interaction suppresses immortalization and transformation. • The interaction enhances viral replication in human cells.« less
Biryukova, Inna; Heitzler, Pascal
2008-11-01
The peripheral nervous system is required for animals to detect and to relay environmental stimuli to central nervous system for the information processing. In Drosophila, the precise spatial and temporal expression of two proneural genes achaete (ac) and scute (sc), is necessary for development of the sensory organs. Here we present an evidence that the transcription co-repressor, dCtBP acts as a negative regulator of sensory organ prepattern. Loss of dCtBP function mutant exhibits ectopic sensory organs, while overexpression of dCtBP results in a dramatic loss of sensory organs. These phenotypes are correlated with mis-emerging of sensory organ precursors and perturbated expression of proneural transcription activator Ac. Mammalian CtBP-1 was identified via interaction with the consensus motif PXDLSX(K/R) of adenovirus E1A oncoprotein. We demonstrated that dCtBP binds directly to PLDLS motif of Drosophila Friend of GATA-1 protein, U-shaped and sharpens the adult sensory organ development. Moreover, we found that dCtBP mediates multivalent interaction with the GATA transcriptional activator Pannier and acts as a direct co-repressor of the Pannier-mediated activation of proneural genes. We demonstrated that Pannier genetically interacts with dCtBP-interacting protein HDAC1, suggesting that the dCtBP-dependent regulation of Pannier activity could utilize a repressive mechanism involving alteration of local chromatine structure.
NASA Astrophysics Data System (ADS)
Tolosa, Leah; Ge, Xudong; Kostov, Yordan; Lakowicz, Joseph R.; Rao, Govind
2003-07-01
Glucose is the major source of carbon, and glutamine is the major source of nitrogen in cell culture media. Thus, glucose and glutamine monitoring are important in maintaining optimal conditions in industrial bioprocesses. Here we report reagentless glucose and glutamine sensors using the E. coli glucose binding protein (GBP) and the glutamine binding protein (GlnBP). Both of these proteins are derived from the permease system of the gram-negative bacteria. The Q26C variant of GBP was labeled at the 26-position with anilino-naphthalene sulfonate (ANS), while the S179C variant of GlnBP was labeled at the 179-position with acrylodan. The ANS and acrylodan emissions are quenched in the presence of glucose and glutamine, respectively. The acrylodan-labeled GlnBP was labeled at the N-terminal with ruthenium bis-(2,2"-bipyridyl)-1,10-phenanthroline-9-isothiocyanate. The ruthenium acts as a non-responsive long-lived reference. The apparent binding constant, Kd", of 8.0 μM glucose was obtained from the decrease in intensity of ANS in GBP. The reliability of the method in monitoring glucose during yeast fermentation was determined by comparison with the YSI Biochemistry Analyzer. The apparent binding constant, Kd", of 0.72 μM glutamine was calculated from the ratio of emission intensities of acrylodan and ruthenium (I515/I610) in GlnBP. The presence of the long-lived ruthenium allowed for modulation sensing at lower frequencies (1-10 MHz) approaching an accuracy of +/- 0.02 μM. The conversion of the GBP into a similar ratiometric sensor was described.
He, Xiaoyuan; Wang, Liqin; Wang, Shuishu
2016-04-15
The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.
NASA Technical Reports Server (NTRS)
Kim, S. H.; Arnold, D.; Lloyd, A.; Roux, S. J.
2001-01-01
We cloned a cDNA encoding an Arabidopsis Ran binding protein, AtRanBP1c, and generated transgenic Arabidopsis expressing the antisense strand of the AtRanBP1c gene to understand the in vivo functions of the Ran/RanBP signal pathway. The transgenic plants showed enhanced primary root growth but suppressed growth of lateral roots. Auxin significantly increased lateral root initiation and inhibited primary root growth in the transformants at 10 pM, several orders of magnitude lower than required to induce these responses in wild-type roots. This induction was followed by a blockage of mitosis in both newly emerged lateral roots and in the primary root, ultimately resulting in the selective death of cells in the tips of both lateral and primary roots. Given the established role of Ran binding proteins in the transport of proteins into the nucleus, these findings are consistent with a model in which AtRanBP1c plays a key role in the nuclear delivery of proteins that suppress auxin action and that regulate mitotic progress in root tips.
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Placenta-specific drug delivery by trophoblast-targeted nanoparticles in mice
Zhang, Baozhen; Tan, Lunbo; Yu, Yan; Wang, Baobei; Chen, Zhilong; Han, Jinyu; Li, Mengxia; Chen, Jie; Xiao, Tianxia; Ambati, Balamurali K; Cai, Lintao; Yang, Qing; Nayak, Nihar R; Zhang, Jian; Fan, Xiujun
2018-01-01
Rationale: The availability of therapeutics to treat pregnancy complications is severely lacking, mainly due to the risk of harm to the fetus. In placental malaria, Plasmodium falciparum-infected erythrocytes (IEs) accumulate in the placenta by adhering to chondroitin sulfate A (CSA) on the surfaces of trophoblasts. Based on this principle, we have developed a method for targeted delivery of payloads to the placenta using a synthetic placental CSA-binding peptide (plCSA-BP) derived from VAR2CSA, a CSA-binding protein expressed on IEs. Methods: A biotinylated plCSA-BP was used to examine the specificity of plCSA-BP binding to mouse and human placental tissue in tissue sections in vitro. Different nanoparticles, including plCSA-BP-conjugated nanoparticles loaded with indocyanine green (plCSA-INPs) or methotrexate (plCSA-MNPs), were administered intravenously to pregnant mice to test their efficiency at drug delivery to the placenta in vivo. The tissue distribution and localization of the plCSA-INPs were monitored in live animals using an IVIS imaging system. The effect of plCSA-MNPs on fetal and placental development and pregnancy outcome were examined using a small-animal high-frequency ultrasound (HFUS) imaging system, and the concentrations of methotrexate in fetal and placental tissues were measured using high-performance liquid chromatography (HPLC). Results: plCSA-BP binds specifically to trophoblasts and not to other cell types in the placenta or to CSA-expressing cells in other tissues. Moreover, we found that intravenously administered plCSA-INPs accumulate in the mouse placenta, and ex vivo analysis of the fetuses and placentas confirmed placenta-specific delivery of these nanoparticles. We also demonstrate successful delivery of methotrexate specifically to placental cells by plCSA-BP-conjugated nanoparticles, resulting in dramatic impairment of placental and fetal development. Importantly, plCSA-MNPs treatment had no apparent adverse effects on maternal tissues. Conclusion: These results demonstrate that plCSA-BP-guided nanoparticles could be used for the targeted delivery of payloads to the placenta and serve as a novel placenta-specific drug delivery option. PMID:29774074
van Dijk, Sabine J; Bezold Kooiker, Kristina; Mazzalupo, Stacy; Yang, Yuanzhang; Kostyukova, Alla S; Mustacich, Debbie J; Hoye, Elaine R; Stern, Joshua A; Kittleson, Mark D; Harris, Samantha P
2016-07-01
Mutations in MYBPC3, the gene encoding cardiac myosin binding protein C (cMyBP-C), are a major cause of hypertrophic cardiomyopathy (HCM). While most mutations encode premature stop codons, missense mutations causing single amino acid substitutions are also common. Here we investigated effects of a single proline for alanine substitution at amino acid 31 (A31P) in the C0 domain of cMyBP-C, which was identified as a natural cause of HCM in cats. Results using recombinant proteins showed that the mutation disrupted C0 structure, altered sensitivity to trypsin digestion, and reduced recognition by an antibody that preferentially recognizes N-terminal domains of cMyBP-C. Western blots detecting A31P cMyBP-C in myocardium of cats heterozygous for the mutation showed a reduced amount of A31P mutant protein relative to wild-type cMyBP-C, but the total amount of cMyBP-C was not different in myocardium from cats with or without the A31P mutation indicating altered rates of synthesis/degradation of A31P cMyBP-C. Also, the mutant A31P cMyBP-C was properly localized in cardiac sarcomeres. These results indicate that reduced protein expression (haploinsufficiency) cannot account for effects of the A31P cMyBP-C mutation and instead suggest that the A31P mutation causes HCM through a poison polypeptide mechanism that disrupts cMyBP-C or myocyte function. Copyright © 2016 Elsevier Inc. All rights reserved.
2012-01-01
Background Leptospirosis is considered a re-emerging infectious disease caused by pathogenic spirochaetes of the genus Leptospira. Pathogenic leptospires have the ability to survive and disseminate to multiple organs after penetrating the host. Leptospires were shown to express surface proteins that interact with the extracellular matrix (ECM) and to plasminogen (PLG). This study examined the interaction of two putative leptospiral proteins with laminin, collagen Type I, collagen Type IV, cellular fibronectin, plasma fibronectin, PLG, factor H and C4bp. Results We show that two leptospiral proteins encoded by LIC11834 and LIC12253 genes interact with laminin in a dose - dependent and saturable mode, with dissociation equilibrium constants (KD) of 367.5 and 415.4 nM, respectively. These proteins were named Lsa33 and Lsa25 (Leptospiral surface adhesin) for LIC11834 and LIC12253, respectively. Metaperiodate - treated laminin reduced Lsa25 - laminin interaction, suggesting that sugar moieties of this ligand participate in this interaction. The Lsa33 is also PLG - binding receptor, with a KD of 23.53 nM, capable of generating plasmin in the presence of an activator. Although in a weak manner, both proteins interact with C4bp, a regulator of complement classical route. In silico analysis together with proteinase K and immunoflorescence data suggest that these proteins might be surface exposed. Moreover, the recombinant proteins partially inhibited leptospiral adherence to immobilized laminin and PLG. Conclusions We believe that these multifunctional proteins have the potential to participate in the interaction of leptospires to hosts by mediating adhesion and by helping the bacteria to escape the immune system and to overcome tissue barriers. To our knowledge, Lsa33 is the first leptospiral protein described to date with the capability of binding laminin, PLG and C4bp in vitro. PMID:22463075
Mrinal, Nirotpal; Nagaraju, Javaregowda
2010-01-01
Autoregulation is one of the mechanisms of imparting feedback control on gene expression. Positive autoregulatory feedback results in induction of a gene, and negative feedback leads to its suppression. Here, we report an interesting mechanism of autoregulation operating on Drosophila Rel gene dorsal that can activate as well as repress its expression. Using biochemical and genetic approaches, we show that upon immune challenge Dorsal regulates its activation as well as repression by dynamically binding to two different κB motifs, κBI (intronic κB) and κBP (promoter κB), present in the dorsal gene. Although the κBI motif functions as an enhancer, the κBP motif acts as a transcriptional repressor. Interestingly, Dorsal binding to these two motifs is dynamic; immediately upon immune challenge, Dorsal binds to the κBI leading to auto-activation, whereas at the terminal phase of the immune response, it is removed from the κBI and repositioned at the κBP, resulting in its repression. Furthermore, we show that repression of Dorsal as well as its binding to the κBP depends on the transcription factor AP1. Depletion of AP1 by RNA interference resulted in constitutive expression of Dorsal. In conclusion, this study suggests that during acute phase response dorsal is regulated by following two subcircuits: (i) Dl-κBI for activation and (ii) Dl-AP1-κBP for repression. These two subcircuits are temporally delineated and bring about overall regulation of dorsal during immune response. These results suggest the presence of a previously unknown mechanism of Dorsal autoregulation in immune-challenged Drosophila. PMID:20504768
Gene encoding herbicide safener binding protein
Walton, Jonathan D.; Scott-Craig, John S.
1999-01-01
The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
Nieva, Claudia; Busk, Peter K; Domínguez-Puigjaner, Eva; Lumbreras, Victoria; Testillano, Pilar S; Risueño, Maria-Carmen; Pagès, Montserrat
2005-08-01
The plant hormone abscisic acid regulates gene expression in response to growth stimuli and abiotic stress. Previous studies have implicated members of the bZIP family of transcription factors as mediators of abscisic acid dependent gene expression through the ABRE cis-element. Here, we identify two new maize bZIP transcription factors, EmBP-2 and ZmBZ-1 related to EmBP-1 and OsBZ-8 families. They are differentially expressed during embryo development; EmBP-2 is constitutive, whereas ZmBZ-1 is abscisic acid-inducible and accumulates during late embryogenesis. Both factors are nuclear proteins that bind to ABREs and activate transcription of the abscisic acid-inducible gene rab28 from maize. EmBP-2 and ZmBZ-1 are phosphorylated by protein kinase CK2 and phosphorylation alters their DNA binding properties. Our data suggest that EmBP-2 and ZmBZ-1 are involved in the expression of abscisic acid inducible genes such as rab28 and their activity is modulated by ABA and by phosphorylation.
Acevedo, Julyana; Yan, Shan; Michael, W. Matthew
2016-01-01
A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245
Dopamine release in chronic cannabis users: a [11c]raclopride positron emission tomography study.
Urban, Nina B L; Slifstein, Mark; Thompson, Judy L; Xu, Xiaoyan; Girgis, Ragy R; Raheja, Sonia; Haney, Margaret; Abi-Dargham, Anissa
2012-04-15
Low striatal dopamine 2/3 receptor (D(2/3)) availability and low ventrostriatal dopamine (DA) release have been observed in alcoholism and cocaine and heroin dependence. Less is known about the dopaminergic system in cannabis dependence. We assessed D(2/3) availability and DA release in abstinent cannabis users compared with control subjects and explored relationships to cannabis use history using [(11)C]raclopride positron emission tomography and an amphetamine challenge paradigm. Sixteen recently abstinent, psychiatrically healthy cannabis-using participants (27.3 ± 6.1 years, 1 woman, 15 men) and 16 matched control subjects (28.1 ± 6.7 years, 2 women, 14 men) completed two positron emission tomography scans, before and after injection of intravenous d-amphetamine (.3 mg/kg). Percent change in [(11)C]raclopride binding after amphetamine (change in nondisplaceable binding potential, ΔBP(ND)) in subregions of the striatum was compared between groups. Correlations with clinical parameters were examined. Cannabis users had an average consumption of 517 ± 465 estimated puffs per month, indicating mild to moderate cannabis dependence. Neither baseline BP(ND) nor ΔBP(ND) differed from control subjects in any region of interest, including ventral striatum. In cannabis-dependent subjects, earlier age of onset of use correlated with lower [ΔBP(ND)] in the associative striatum when controlling for current age. Unlike other addictions, cannabis dependence of mild to moderate severity is not associated with striatal DA alterations. However, earlier or longer duration of use is related to lower DA release in the associative striatum. These observations suggest a more harmful effect of use during adolescence; more research is needed to distinguish effects of chronicity versus onset. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Majuri, Joonas; Joutsa, Juho; Johansson, Jarkko; Voon, Valerie; Alakurtti, Kati; Parkkola, Riitta; Lahti, Tuuli; Alho, Hannu; Hirvonen, Jussi; Arponen, Eveliina; Forsback, Sarita; Kaasinen, Valtteri
2017-04-01
Although behavioral addictions share many clinical features with drug addictions, they show strikingly large variation in their behavioral phenotypes (such as in uncontrollable gambling or eating). Neurotransmitter function in behavioral addictions is poorly understood, but has important implications in understanding its relationship with substance use disorders and underlying mechanisms of therapeutic efficacy. Here, we compare opioid and dopamine function between two behavioral addiction phenotypes: pathological gambling (PG) and binge eating disorder (BED). Thirty-nine participants (15 PG, 7 BED, and 17 controls) were scanned with [ 11 C]carfentanil and [ 18 F]fluorodopa positron emission tomography using a high-resolution scanner. Binding potentials relative to non-displaceable binding (BP ND ) for [ 11 C]carfentanil and influx rate constant (K i ) values for [ 18 F]fluorodopa were analyzed with region-of-interest and whole-brain voxel-by-voxel analyses. BED subjects showed widespread reductions in [ 11 C]carfentanil BP ND in multiple subcortical and cortical brain regions and in striatal [ 18 F]fluorodopa K i compared with controls. In PG patients, [ 11 C]carfentanil BP ND was reduced in the anterior cingulate with no differences in [ 18 F]fluorodopa K i compared with controls. In the nucleus accumbens, a key region involved in reward processing, [ 11 C]Carfentanil BP ND was 30-34% lower and [ 18 F]fluorodopa K i was 20% lower in BED compared with PG and controls (p<0.002). BED and PG are thus dissociable as a function of dopaminergic and opioidergic neurotransmission. Compared with PG, BED patients show widespread losses of mu-opioid receptor availability together with presynaptic dopaminergic defects. These findings highlight the heterogeneity underlying the subtypes of addiction and indicate differential mechanisms in the expression of pathological behaviors and responses to treatment.
Peter, Daniel; Weber, Ramona; Köne, Carolin; Chung, Min-Yi; Ebertsch, Linda; Truffault, Vincent; Weichenrieder, Oliver; Igreja, Cátia; Izaurralde, Elisa
2015-01-01
The eIF4E-binding proteins (4E-BPs) are a diverse class of translation regulators that share a canonical eIF4E-binding motif (4E-BM) with eIF4G. Consequently, they compete with eIF4G for binding to eIF4E, thereby inhibiting translation initiation. Mextli (Mxt) is an unusual 4E-BP that promotes translation by also interacting with eIF3. Here we present the crystal structures of the eIF4E-binding regions of the Drosophila melanogaster (Dm) and Caenorhabditis elegans (Ce) Mxt proteins in complex with eIF4E in the cap-bound and cap-free states. The structures reveal unexpected evolutionary plasticity in the eIF4E-binding mode, with a classical bipartite interface for Ce Mxt and a novel tripartite interface for Dm Mxt. Both interfaces comprise a canonical helix and a noncanonical helix that engage the dorsal and lateral surfaces of eIF4E, respectively. Remarkably, Dm Mxt contains a C-terminal auxiliary helix that lies anti-parallel to the canonical helix on the eIF4E dorsal surface. In contrast to the eIF4G and Ce Mxt complexes, the Dm eIF4E–Mxt complexes are resistant to competition by bipartite 4E-BPs, suggesting that Dm Mxt can bind eIF4E when eIF4G binding is inhibited. Our results uncovered unexpected diversity in the binding modes of 4E-BPs, resulting in eIF4E complexes that display differential sensitivity to 4E-BP regulation. PMID:26294658
Sander, Christin Y; Mandeville, Joseph B; Wey, Hsiao-Ying; Catana, Ciprian; Hooker, Jacob M; Rosen, Bruce R
2017-01-01
The potential effects of changes in blood flow on the delivery and washout of radiotracers has been an ongoing question in PET bolus injection studies. This study provides practical insight into this topic by experimentally measuring cerebral blood flow (CBF) and neuroreceptor binding using simultaneous PET/MRI. Hypercapnic challenges (7% CO 2 ) were administered to non-human primates in order to induce controlled increases in CBF, measured with pseudo-continuous arterial spin labeling. Simultaneously, dopamine D 2 /D 3 receptor binding of [ 11 C]raclopride or [ 18 F]fallypride was monitored with dynamic PET. Experiments showed that neither time activity curves nor quantification of binding through binding potentials ( BP ND ) were measurably affected by CBF increases, which were larger than two-fold. Simulations of experimental procedures showed that even large changes in CBF should have little effect on the time activity curves of radiotracers, given a set of realistic assumptions. The proposed method can be applied to experimentally assess the flow sensitivity of other radiotracers. Results demonstrate that CBF changes, which often occur due to behavioral tasks or pharmacological challenges, do not affect PET [ 11 C]raclopride or [ 18 F]fallypride binding studies and their quantification. The results from this study suggest flow effects may have limited impact on many PET neuroreceptor tracers with similar properties.
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Tanabe, Kazuhiro; Matsuo, Koji; Miyazawa, Masaki; Hayashi, Masaru; Ikeda, Masae; Shida, Masako; Hirasawa, Takeshi; Sho, Ryuichiro; Mikami, Mikio
2018-05-01
Serum levels of fully sialylated C4-binding protein (FS-C4BP) are remarkably elevated in patients with epithelial ovarian cancer (EOC) and can be used as a marker to distinguish ovarian clear cell carcinoma from endometrioma. This study aimed to develop a stable, robust and reliable liquid chromatography-hybrid mass spectrometry (UPLC-MS/MS) based diagnostic method that would generalize FS-C4BP as a clinical EOC biomarker. Glycopeptides derived from 20 μL of trypsin-digested serum glycoprotein were analyzed via UPLC equipped with an electrospray ionization time-of-flight mass spectrometer. This UPLC-MS/MS-based diagnostic method was optimized for FS-C4BP and validated using sera from 119 patients with EOC and 127 women without cancer. A1958 (C4BP peptide with two fully sialylated biantennary glycans) was selected as a marker of FS-C4BP because its level in serum was highest among FS-C4BP family members. Preparation and UPLC-MS/MS were optimized for A1958, and performance and robustness were significantly improved relative to our previous method. An area under the curve analysis of the FS-C4BP index receiver operating characteristic curve revealed that the ratio between A1958 and A1813 (C4BP peptide with two partially sialylated biantennary glycans) reached 85%. A combination of the FS-C4BP index and carbohydrate antigen-125 levels further enhanced the sensitivity and specificity. © 2017 The Authors. Biomedical Chromatography published by John Wiley & Sons Ltd.
Detecting cooperative sequences in the binding of RNA Polymerase-II
NASA Astrophysics Data System (ADS)
Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles
2008-03-01
Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.
A Role for USP7 in DNA Replication
Jagannathan, Madhav; Nguyen, Tin; Gallo, David; Luthra, Niharika; Brown, Grant W.; Saridakis, Vivian
2014-01-01
The minichromosome maintenance (MCM) complex, which plays multiple important roles in DNA replication, is loaded onto chromatin following mitosis, remains on chromatin until the completion of DNA synthesis, and then is unloaded by a poorly defined mechanism that involves the MCM binding protein (MCM-BP). Here we show that MCM-BP directly interacts with the ubiquitin-specific protease USP7, that this interaction occurs predominantly on chromatin, and that MCM-BP can tether USP7 to MCM proteins. Detailed biochemical and structure analyses of the USP7–MCM-BP interaction showed that the 155PSTS158 MCM-BP sequence mediates critical interactions with the TRAF domain binding pocket of USP7. Analysis of the effects of USP7 knockout on DNA replication revealed that lack of USP7 results in slowed progression through late S phase without globally affecting the fork rate or origin usage. Lack of USP7 also resulted in increased levels of MCM proteins on chromatin, and investigation of the cause of this increase revealed a defect in the dissociation of MCM proteins from chromatin in mid- to late S phase. This role of USP7 mirrors the previously described role for MCM-BP in MCM complex unloading and suggests that USP7 works with MCM-BP to unload MCM complexes from chromatin at the end of S phase. PMID:24190967
Inhibition of Herpes Simplex Virus gD and Lymphotoxin-α Binding to HveA by Peptide Antagonists
Sarrias, Maria Rosa; Whitbeck, J. Charles; Rooney, Isabelle; Spruce, Lynn; Kay, Brian K.; Montgomery, Rebecca I.; Spear, Patricia G.; Ware, Carl F.; Eisenberg, Roselyn J.; Cohen, Gary H.; Lambris, John D.
1999-01-01
The herpesvirus entry mediator A (HveA) is a recently characterized member of the tumor necrosis factor receptor family that mediates the entry of most herpes simplex virus type 1 (HSV-1) strains into mammalian cells. Studies on the interaction of HSV-1 with HveA have shown that of all the viral proteins involved in uptake, only gD has been shown to bind directly to HveA, and this binding mediates viral entry into cells. In addition to gD binding to HveA, the latter has been shown to interact with proteins of tumor necrosis factor receptor-associated factor family, lymphotoxin-α (LT-α), and a membrane-associated protein referred to as LIGHT. To study the relationship between HveA, its natural ligands, and the viral proteins involved in HSV entry into cells, we have screened two phage-displayed combinatorial peptide libraries for peptide ligands of a recombinant form of HveA. Affinity selection experiments yielded two peptide ligands, BP-1 and BP-2, which could block the interaction between gD and HveA. Of the two peptides, only BP-2 inhibited HSV entry into CHO cells transfected with an HveA-expressing plasmid. When we analyzed these peptides for the ability to interfere with HveA binding to its natural ligand LT-α, we found that BP-1 inhibited the interaction of cellular LT-α with HveA. Thus, we have dissected the sites of interaction between the cell receptor, its natural ligand LT-α and gD, the virus-specific protein involved in HSV entry into cells. PMID:10364318
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
2006-05-01
between 53BP1 and the platelet derived growth factor (PDGF) was recently identified in a patient with a myeloproliferative disorder.32 The 53BP1-PDGF...receptor beta in a patient with a t(5;15)(q33;q22) and an imatinib-responsive eosinophilic myeloproliferative disorder. Cancer Res 2004; 64:7216-9
Enhanced Cellular Adhesion on Titanium by Silk Functionalized with titanium binding and RGD peptides
Vidal, Guillaume; Blanchi, Thomas; Mieszawska, Aneta J.; Calabrese, Rossella; Rossi, Claire; Vigneron, Pascale; Duval, Jean-Luc; Kaplan, David L.; Egles, Christophe
2012-01-01
Soft tissue adhesion on titanium represents a challenge for implantable materials. In order to improve adhesion at the cell/material interface we used a new approach based on the molecular recognition of titanium by specific peptides. Silk fibroin protein was chemically grafted with titanium binding peptide (TiBP) to increase adsorption of these chimeric proteins to the metal surface. Quartz Crystal Microbalance was used to quantify the specific adsorption of TiBP-functionalized silk and an increase in protein deposition by more than 35% was demonstrated due to the presence of the binding peptide. A silk protein grafted with TiBP and fibronectin-derived RGD peptide was then prepared. The adherence of fibroblasts on the titanium surface modified with the multifunctional silk coating demonstrated an increase in the number of adhering cells by 60%. The improved adhesion was demonstrated by Scanning Electron Microscopy and immunocytochemical staining of focal contact points. Chick embryo organotypic culture also revealed strong adhesion of endothelial cells expanding on the multifunctional silk-peptide coating. These results demonstrated that silk functionalized with TiBP and RGD represents a promising approach to modify cell-biomaterial interfaces, opening new perspectives for implantable medical devices, especially when reendothelialization is required. PMID:22975628
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chihara, Kazuyasu; Organization for Life Science Advancement Programs, University of Fukui, Fukui 910-1193; Kimura, Yukihiro
Adaptor protein c-Abl SH3 domain-binding protein-2 (3BP2) is known to play regulatory roles in immunoreceptor-mediated signal transduction. We have previously demonstrated that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 446} in mouse 3BP2 are predominantly phosphorylated by Syk, and the phosphorylation of Tyr{sup 183} and the Src homology 2 (SH2) domain of mouse 3BP2 are critical for B cell receptor (BCR)-induced activation of nuclear factor of activated T cells (NFAT) in human B cells. In this report, we have shown that Syk, but not Abl family protein-tyrosine kinases, is critical for BCR-mediated tyrosine phosphorylation of 3BP2 in chicken DT40 cells. Mutationalmore » analysis showed that Tyr{sup 174}, Tyr{sup 183} and Tyr{sup 426} of chicken 3BP2 are the major phosphorylation sites by Syk and the SH2 domain of 3BP2 is critical for tyrosine phosphorylation. In addition, phosphorylation of Tyr{sup 426} is required for the inducible interaction with the SH2 domain of Vav3. Moreover, the expression of the mutant form of 3BP2 in which Tyr{sup 426} was substituted to Phe resulted in the reduction in BCR-mediated Rac1 activation, when compared with the case of wild-type. Altogether, these data suggest that 3BP2 is involved in the activation of Rac1 through the regulation of Vav3 by Syk-dependent phosphorylation of Tyr{sup 426} following BCR stimulation. - Highlights: • 3BP2 is phosphorylated by Syk, but not Abl family kinases in BCR signaling. • Tyr183 and Tyr426 in chicken 3BP2 are the major phosphorylation sites by Syk. • The SH2 domain of 3BP2 is critical for tyrosine phosphorylation of 3BP2. • Phosphorylation of Tyr426 in 3BP2 is required for the inducible binding with Vav3. • 3BP2 is involved in the regulation of BCR-mediated Rac1 activation.« less
Lyabin, D N; Ovchinnikov, L P
2016-03-02
The Y-box binding protein 1 (YB-1) is a key regulator of gene expression at the level of both translation and transcription. The mode of its action on cellular events depends on its subcellular distribution and the amount in the cell. So far, the regulatory mechanisms of YB-1 synthesis have not been adequately studied. Our previous finding was that selective inhibition of YB-1 mRNA translation was caused by suppression of activity of the mTOR signaling pathway. It was suggested that this event may be mediated by phosphorylation of the 4E-binding protein (4E-BP). Here, we report that 4E-BP alone can only slightly inhibit YB-1 synthesis both in the cell and in vitro, although it essentially decreases binding of the 4F-group translation initiation factors to mRNA. With inhibited mTOR kinase, the level of mRNA binding to the eIF4F-group factors was decreased, while that to 4E-BP1 was increased, as was observed for both mTOR kinase-sensitive mRNAs and those showing low sensitivity. This suggests that selective inhibition of translation of YB-1 mRNA, and probably some other mRNAs as well, by mTOR kinase inhibitors is not mediated by the action of the 4E-binding protein upon functions of the 4F-group translation initiation factors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buffalo, Cosmo Z.; Bahn-Suh, Adrian J.; Hirakis, Sophia P.
No vaccine exists against group A Streptococcus (GAS), a leading cause of worldwide morbidity and mortality. A severe hurdle is the hypervariability of its major antigen, the M protein, with >200 different M types known. Neutralizing antibodies typically recognize M protein hypervariable regions (HVRs) and confer narrow protection. In stark contrast, human C4b-binding protein (C4BP), which is recruited to the GAS surface to block phagocytic killing, interacts with a remarkably large number of M protein HVRs (apparently ~90%). Such broad recognition is rare, and we discovered a unique mechanism for this through the structure determination of four sequence-diverse M proteinsmore » in complexes with C4BP. The structures revealed a uniform and tolerant ‘reading head’ in C4BP, which detected conserved sequence patterns hidden within hypervariability. Our results open up possibilities for rational therapies that target the M–C4BP interaction, and also inform a path towards vaccine design.« less
Rattanaporn, Onnicha; Utarabhand, Prapaporn
2011-02-01
A diverse class of pattern-recognition proteins called lectins play important roles in shrimp innate immunity. A novel C-type lectin gene (FmLC) was cloned from the hepatopancreas of banana shrimp Fenneropenaeus merguiensis by means of PCR and 5' and 3' rapid amplification of cDNA ends (RACE). The full-length cDNA consists of 1118 bp with one 1002 bp open reading frame, encoding 333 amino acids. Its deduced amino acid sequence contains a putative signal peptide of 20 amino acids. FmLC contains two carbohydrate recognition domains, CRD1 and CRD2, that share only 30% identity with each other. The first CRD comprises a QPD motif with specificity for binding galactose and a single Ca(2+) binding site, while the second CRD consists of an EPN motif for a mannose-specific binding site. FmLC had a close evolutionary relationship to other dual-CRD lectins of penaeid shrimp. Expression results showed that transcripts of FmLC were detected only in the hepatopancreas, none was found in other tissues. After challenging either whole shrimp or hepatopancreas tissue fragments with Vibrioharveyi, the expression of FmLC was up-regulated. This indicates that FmLC is inducible and may be involved in a shrimp immune response to recognize potential bacterial pathogens. Copyright © 2010 Elsevier Inc. All rights reserved.
Ceriello, A; Giugliano, D; Quatraro, A; Marchi, E; Barbanti, M; Lefebvre, P
1990-04-01
In this study, total protein S (PS) immunological levels, free-PS and C4b-binding-protein (C4bBP) concentrations, and PS functional activity were investigated in insulin-dependent (type I) diabetic patients and compared with nondiabetic subjects. Mean total PS antigen concentration was not different between diabetic patients and nondiabetic subjects, whereas free-PS levels and PS functional activity were significantly reduced in diabetic patients. C4bBP was increased in diabetic patients and correlated with HbA1 levels. This study shows that type I diabetic patients have depressed free PS and PS activity despite the presence of normal total PS concentration and suggests that this phenomenon is probably linked to the increase of circulating C4bBP.
Cellular RNA binding proteins NS1-BP and hnRNP K regulate influenza A virus RNA splicing.
Tsai, Pei-Ling; Chiou, Ni-Ting; Kuss, Sharon; García-Sastre, Adolfo; Lynch, Kristen W; Fontoura, Beatriz M A
2013-01-01
Influenza A virus is a major human pathogen with a genome comprised of eight single-strand, negative-sense, RNA segments. Two viral RNA segments, NS1 and M, undergo alternative splicing and yield several proteins including NS1, NS2, M1 and M2 proteins. However, the mechanisms or players involved in splicing of these viral RNA segments have not been fully studied. Here, by investigating the interacting partners and function of the cellular protein NS1-binding protein (NS1-BP), we revealed novel players in the splicing of the M1 segment. Using a proteomics approach, we identified a complex of RNA binding proteins containing NS1-BP and heterogeneous nuclear ribonucleoproteins (hnRNPs), among which are hnRNPs involved in host pre-mRNA splicing. We found that low levels of NS1-BP specifically impaired proper alternative splicing of the viral M1 mRNA segment to yield the M2 mRNA without affecting splicing of mRNA3, M4, or the NS mRNA segments. Further biochemical analysis by formaldehyde and UV cross-linking demonstrated that NS1-BP did not interact directly with viral M1 mRNA but its interacting partners, hnRNPs A1, K, L, and M, directly bound M1 mRNA. Among these hnRNPs, we identified hnRNP K as a major mediator of M1 mRNA splicing. The M1 mRNA segment generates the matrix protein M1 and the M2 ion channel, which are essential proteins involved in viral trafficking, release into the cytoplasm, and budding. Thus, reduction of NS1-BP and/or hnRNP K levels altered M2/M1 mRNA and protein ratios, decreasing M2 levels and inhibiting virus replication. Thus, NS1-BP-hnRNPK complex is a key mediator of influenza A virus gene expression.
Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy
2018-05-09
Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.
Multi level optimization of burnable poison utilization for advanced PWR fuel management
NASA Astrophysics Data System (ADS)
Yilmaz, Serkan
The objective of this study was to develop an unique methodology and a practical tool for designing burnable poison (BP) pattern for a given PWR core. Two techniques were studied in developing this tool. First, the deterministic technique called Modified Power Shape Forced Diffusion (MPSFD) method followed by a fine tuning algorithm, based on some heuristic rules, was developed to achieve this goal. Second, an efficient and a practical genetic algorithm (GA) tool was developed and applied successfully to Burnable Poisons (BPs) placement optimization problem for a reference Three Mile Island-1 (TMI-1) core. This thesis presents the step by step progress in developing such a tool. The developed deterministic method appeared to perform as expected. The GA technique produced excellent BP designs. It was discovered that the Beginning of Cycle (BOC) Kinf of a BP fuel assembly (FA) design is a good filter to eliminate invalid BP designs created during the optimization process. By eliminating all BP designs having BOC Kinf above a set limit, the computational time was greatly reduced since the evaluation process with reactor physics calculations for an invalid solution is canceled. Moreover, the GA was applied to develop the BP loading pattern to minimize the total Gadolinium (Gd) amount in the core together with the residual binding at End-of-Cycle (EOC) and to keep the maximum peak pin power during core depletion and Soluble boron concentration at BOC both less than their limit values. The number of UO2/Gd2O3 pins and Gd 2O3 concentrations for each fresh fuel location in the core are the decision variables and the total amount of the Gd in the core and maximum peak pin power during core depletion are in the fitness functions. The use of different fitness function definition and forcing the solution movement towards to desired region in the solution space accelerated the GA runs. Special emphasize is given to minimizing the residual binding to increase core lifetime as well as minimizing the total Gd amount in the core. The GA code developed many good solutions that satisfy all of the design constraints. For these solutions, the EOC soluble boron concentration changes from 68.9 to 97.2 ppm. It is important to note that the difference of 28.3 ppm between the best and the worst solution in the good solutions region represent the potential of 12.5 Effective-Full-Power-Day (EPFD) savings in cycle length. As a comparison, the best BP loading design has 97.2 ppm soluble boron concentration at EOC while the BP loading with available vendors' U/Gd FA designs has 94.4 ppm SOB at EOC. It was estimated that the difference of 2.8 ppm reflected the potential savings of 1.25 EFPD in cycle length. Moreover, the total Gd amount was reduced by 6.89% in mass that provided extra savings in fuel cost compared to the BP loading pattern with available vendor's U/Gd FA designs. (Abstract shortened by UMI.)
NASA Astrophysics Data System (ADS)
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Grutter, Thomas; Prado de Carvalho, Lia; Virginie, Dufresne; Taly, Antoine; Fischer, Markus; Changeux, Jean-Pierre
2005-03-01
To understand the mechanism of allosteric coupling between the ligand-binding domain and the ion channel of the Cys-loop ligand-gated ion channels (LGICs), we fused the soluble acetylcholine-binding protein (AChBP), which lacks an ion channel, to either the cationic serotonin type-3A ion channel (5HT(3A)) or the anionic glycine ion channel. Both linear chimeras expressed in HEK-293 cells display high affinity for the nicotinic agonist epibatidine (K(D) = 0.2-0.5 nM), but are not targeted to the cell surface. Only after substituting a ring of three loops located at the putative membrane side of the AChBP three-dimensional structure by the homologous residues of 5HT(3A), the resulting chimera AChBP(ring)/5HT(3A) (i) still displayed on intact cells an apparent high affinity for epibatidine, yet with a fourfold decrease (K(D) = 2.1 nM), (ii) displayed a high proportion of low affinity sites (11 +/- 7 microM) for the resting state stabilizing competitive antagonist alpha-bungarotoxin and (iii) was successfully targeted to the cell surface, as seen by immunofluorescence labelling. The AChBP(ring)/5HT(3A) chimera forms a pentameric structure, as revealed by sucrose gradient sedimentation. However, no whole-cell patch-clamp currents were detectable. Interestingly, binding assays with membrane fragments prepared from cells expressing AChBP(ring)/5HT(3A) showed a decrease in the apparent affinity for the agonists nicotine and epibatidine (5-fold), concomitant with an increase in the proportion of high-affinity sites (48 +/- 1 nM) for alpha-bungarotoxin. These results indicate that fusion of AChBP to an ion channel forms a pentameric receptor exposed to the cell surface and able to convert between discrete allosteric states, but stabilized in a high affinity state for epibatidine that likely corresponds to a desensitized form of LGICs. These artificial chimeras might offer a useful system to investigate signal transduction in LGICs.
Lee, Kyounghwan; Harris, Samantha P.; Sadayappan, Sakthivel; Craig, Roger
2014-01-01
Myosin binding protein-C is a thick filament protein of vertebrate striated muscle. The cardiac isoform (cMyBP-C) is essential for normal cardiac function, and mutations in cMyBP-C cause cardiac muscle disease. The rod-shaped molecule is composed primarily of 11 immunoglobulin- or fibronectin-like domains, and is located at 9 sites, 43 nm apart, in each half of the A-band. To understand how cMyBP-C functions, it is important to know its structural organization in the sarcomere, as this will affect its ability to interact with other sarcomeric proteins. Several models have been proposed, in which cMyBP-C wraps around, extends radially from, or runs axially along the thick filament. Our goal was to define cMyBP-C orientation by determining the relative axial positions of different cMyBP-C domains. Immuno-electron microscopy was performed using mouse cardiac myofibrils labeled with antibodies specific to the N- and C-terminal domains and to the middle of cMyBP-C. Antibodies to all regions of the molecule, except the C-terminus, labeled at the same nine axial positions in each half A-band, consistent with a circumferential and/or radial rather than an axial orientation of the bulk of the molecule. The C-terminal antibody stripes were slightly displaced axially, demonstrating an axial orientation of the C-terminal 3 domains, with the C-terminus closer to the M-line. These results, combined with previous studies, suggest that the C-terminal domains of cMyBP-C run along the thick filament surface, while the N-terminus extends towards neighboring thin filaments. This organization provides a structural framework for understanding cMyBP-C’s modulation of cardiac muscle contraction. PMID:25451032
Richardson, D R; Neumannova, V; Nagy, E; Ponka, P
1995-10-15
The iron-responsive element-binding protein (IRE-BP) modulates both ferritin mRNA translation and transferrin receptor (TfR) mRNA stability by binding to specific mRNA sequences called iron-responsive elements (IREs). The regulation of IRE-BP in situ could possibly occur either through its Fe-S cluster and/or via free cysteine sulphydryl groups such as cysteine 437 (Philpott et al, J Biol Chem 268:17655, 1993; and Hirling et al, EMBO J 13:453, 1994). Recently, nitrogen monoxide (NO) has been shown to have markedly different biologic effects depending on its redox state (Lipton et al, Nature 364:626, 1993). Considering this fact, it is conceivable that the NO group, as either the nitrosonium ion (NO+) or nitric oxide (NO+), may regulate IRE-BP activity by S-nitrosylation of key sulphydryl groups or via ligation of NO. to the Fe-S cluster, respectively. This hypothesis has been examined using the NO+ generator, sodium nitroprusside (SNP); the NO. generator, S-nitroso-N-acetylpenicillamine (SNAP); and the NO./peroxynitrite (ONOO-) generator, 3-morpholinosydnonimine hydrochloride (SIN-1). Treatment of K562 cells for 18 hours with SNP (1 mmol/L) resulted in a pronounced decrease in both the RNA-binding activity of IRE-BP and the level of TfR mRNA. In addition, Scatchard analysis showed a marked decrease in the number of specific Tf-binding sites, from 590,000/cell (control) to 170,000/cell (test), and there was also a distinct decrease in Fe uptake. Furthermore, SNP did not decrease cellular viability or proliferation. In contrast, the NO. generator, SNAP (1 mmol/L), increased RNA-binding activity of IRE-BP, the level of TfR mRNA, and the number of TfRs in K562 cells. Moreover, both SNAP (1 mmol/L) and SIN-1 (0.5 mmol/L) reduced cellular proliferation. The results are discussed in context of the possible physiologic role of redox-related species of NO in regulating iron metabolism.
Davidson, Alice E.; Schwarz, Nele; Zelinger, Lina; Stern-Schneider, Gabriele; Shoemark, Amelia; Spitzbarth, Benjamin; Gross, Menachem; Laxer, Uri; Sosna, Jacob; Sergouniotis, Panagiotis I.; Waseem, Naushin H.; Wilson, Robert; Kahn, Richard A.; Plagnol, Vincent; Wolfrum, Uwe; Banin, Eyal; Hardcastle, Alison J.; Cheetham, Michael E.; Sharon, Dror; Webster, Andrew R.
2013-01-01
Retinitis pigmentosa (RP) is a genetically heterogeneous retinal degeneration characterized by photoreceptor death, which results in visual failure. Here, we used a combination of homozygosity mapping and exome sequencing to identify mutations in ARL2BP, which encodes an effector protein of the small GTPases ARL2 and ARL3, as causative for autosomal-recessive RP (RP66). In a family affected by RP and situs inversus, a homozygous, splice-acceptor mutation, c.101−1G>C, which alters pre-mRNA splicing of ARLBP2 in blood RNA, was identified. In another family, a homozygous c.134T>G (p.Met45Arg) mutation was identified. In the mouse retina, ARL2BP localized to the basal body and cilium-associated centriole of photoreceptors and the periciliary extension of the inner segment. Depletion of ARL2BP caused cilia shortening. Moreover, depletion of ARL2, but not ARL3, caused displacement of ARL2BP from the basal body, suggesting that ARL2 is vital for recruiting or anchoring ARL2BP at the base of the cilium. This hypothesis is supported by the finding that the p.Met45Arg amino acid substitution reduced binding to ARL2 and caused the loss of ARL2BP localization at the basal body in ciliated nasal epithelial cells. These data demonstrate a role for ARL2BP and ARL2 in primary cilia function and that this role is essential for normal photoreceptor maintenance and function. PMID:23849777
Di, Li-Jun; Byun, Jung S; Wong, Madeline M; Wakano, Clay; Taylor, Tara; Bilke, Sven; Baek, Songjoon; Hunter, Kent; Yang, Howard; Lee, Maxwell; Zvosec, Cecilia; Khramtsova, Galina; Cheng, Fan; Perou, Charles M; Miller, C Ryan; Raab, Rachel; Olopade, Olufunmilayo I; Gardner, Kevin
2013-01-01
The C-terminal binding protein (CtBP) is a NADH-dependent transcriptional repressor that links carbohydrate metabolism to epigenetic regulation by recruiting diverse histone-modifying complexes to chromatin. Here global profiling of CtBP in breast cancer cells reveals that it drives epithelial-to-mesenchymal transition, stem cell pathways and genome instability. CtBP expression induces mesenchymal and stem cell-like features, whereas CtBP depletion or caloric restriction reverses gene repression and increases DNA repair. Multiple members of the CtBP-targeted gene network are selectively downregulated in aggressive breast cancer subtypes. Differential expression of CtBP-targeted genes predicts poor clinical outcome in breast cancer patients, and elevated levels of CtBP in patient tumours predict shorter median survival. Finally, both CtBP promoter targeting and gene repression can be reversed by small molecule inhibition. These findings define broad roles for CtBP in breast cancer biology and suggest novel chromatin-based strategies for pharmacologic and metabolic intervention in cancer.
Use of Mac‐2 binding protein as a biomarker for nonalcoholic fatty liver disease diagnosis
Kamada, Yoshihiro; Ono, Masafumi; Hyogo, Hideyuki; Fujii, Hideki; Sumida, Yoshio; Yamada, Makoto; Mori, Kojiroh; Tanaka, Saiyu; Maekawa, Tomohiro; Ebisutani, Yusuke; Yamamoto, Akiko; Takamatsu, Shinji; Yoneda, Masashi; Kawada, Norifumi; Chayama, Kazuaki; Saibara, Toshiji; Takehara, Tetsuo
2017-01-01
In contrast to patients with viral hepatitis, patients with nonalcoholic fatty liver disease (NAFLD) can progress to hepatocellular carcinoma during the initial stages of liver fibrosis. Development and implementation of noninvasive methods for diagnosis and progression prediction are important for effective NAFLD surveillance. Mac‐2 binding protein (Mac‐2bp) is a useful nonalcoholic steatohepatitis (NASH) diagnosis biomarker and a powerful prediction biomarker for NAFLD fibrosis stage. Wisteria floribunda agglutinin (WFA)‐positive Mac‐2bp (WFA+‐M2BP) is a novel serum fibrosis biomarker for chronic hepatitis C that has clinical validity. Mac‐2bp and WFA+‐M2BP are also clinical NAFLD biomarker candidates. We examined the efficacy of Mac‐2bp and WFA+‐M2BP for NAFLD assessment using patients with biopsy‐proven NAFLD (n = 510; NAFLD cohort) and subjects who received a health check‐up (n = 2,122; check‐up cohort). In the NAFLD cohort, we set the fibrosis predicting cutoff values as 1.80 (F1), 2.21 (F2), and 2.24 μg/mL (F3). In the subjects with fatty liver from the check‐up cohort (n = 1,291), the serum Mac‐2bp levels were >1.80 μg/mL in 38.6% of the subjects (n = 498), and >2.24 μg/mL in 24.6% of the subjects (n = 318). The NAFLD cohort results indicated that Mac‐2bp and WFA+‐M2BP were equally useful for NASH diagnosis. During the early stages of fibrosis (F1, F2), the increase in Mac‐2bp was statistically significant but WFA+‐M2BP did not increase. Logistic regression analysis revealed that Mac‐2bp was an independent determinant for the prediction of advanced fibrosis stage (≥F2), even when adjusted for WFA+‐M2BP. Immunohistochemical staining of Mac‐2bp revealed that hepatocytes strongly expressed Mac‐2bp in patients with NAFLD. Conclusion: Our results indicated that hepatocyte‐derived Mac‐2bp would be a useful single biomarker for NASH diagnosis and fibrosis stage prediction in patients with NAFLD. (Hepatology Communications 2017;1:780–791) PMID:29404494
Free-Energy Landscape of Protein-Ligand Interactions Coupled with Protein Structural Changes.
Moritsugu, Kei; Terada, Tohru; Kidera, Akinori
2017-02-02
Protein-ligand interactions are frequently coupled with protein structural changes. Focusing on the coupling, we present the free-energy surface (FES) of the ligand-binding process for glutamine-binding protein (GlnBP) and its ligand, glutamine, in which glutamine binding accompanies large-scale domain closure. All-atom simulations were performed in explicit solvents by multiscale enhanced sampling (MSES), which adopts a multicopy and multiscale scheme to achieve enhanced sampling of systems with a large number of degrees of freedom. The structural ensemble derived from the MSES simulation yielded the FES of the coupling, described in terms of both the ligand's and protein's degrees of freedom at atomic resolution, and revealed the tight coupling between the two degrees of freedom. The derived FES led to the determination of definite structural states, which suggested the dominant pathways of glutamine binding to GlnBP: first, glutamine migrates via diffusion to form a dominant encounter complex with Arg75 on the large domain of GlnBP, through strong polar interactions. Subsequently, the closing motion of GlnBP occurs to form ligand interactions with the small domain, finally completing the native-specific complex structure. The formation of hydrogen bonds between glutamine and the small domain is considered to be a rate-limiting step, inducing desolvation of the protein-ligand interface to form the specific native complex. The key interactions to attain high specificity for glutamine, the "door keeper" existing between the two domains (Asp10-Lys115) and the "hydrophobic sandwich" formed between the ligand glutamine and Phe13/Phe50, have been successfully mapped on the pathway derived from the FES.
Wang, Hongjie; Dey, Debleena; Carrera, Ivan; Minond, Dmitriy; Bianchi, Elisabetta; Xu, Shaohua; Lakshmana, Madepalli K
2013-09-13
Increased processing of amyloid precursor protein (APP) and accumulation of neurotoxic amyloid β peptide (Aβ) in the brain is central to the pathogenesis of Alzheimer's disease (AD). Therefore, the identification of molecules that regulate Aβ generation is crucial for future therapeutic approaches for AD. We demonstrated previously that RanBP9 regulates Aβ generation in a number of cell lines and primary neuronal cultures by forming tripartite protein complexes with APP, low-density lipoprotein-related protein, and BACE1, consequently leading to increased amyloid plaque burden in the brain. RanBP9 is a scaffold protein that exists and functions in multiprotein complexes. To identify other proteins that may bind RanBP9 and regulate Aβ levels, we used a two-hybrid analysis against a human brain cDNA library and identified COPS5 as a novel RanBP9-interacting protein. This interaction was confirmed by coimmunoprecipitation experiments in both neuronal and non-neuronal cells and mouse brain. Colocalization of COPS5 and RanBP9 in the same subcellular compartments further supported the interaction of both proteins. Furthermore, like RanBP9, COPS5 robustly increased Aβ generation, followed by increased soluble APP-β (sAPP-β) and decreased soluble-APP-α (sAPP-α) levels. Most importantly, down-regulation of COPS5 by siRNAs reduced Aβ generation, implying that endogenous COPS5 regulates Aβ generation. Finally, COPS5 levels were increased significantly in AD brains and APΔE9 transgenic mice, and overexpression of COPS5 strongly increased RanBP9 protein levels by increasing its half-life. Taken together, these results suggest that COPS5 increases Aβ generation by increasing RanBP9 levels. Thus, COPS5 is a novel RanBP9-binding protein that increases APP processing and Aβ generation by stabilizing RanBP9 protein levels.
Crystal structure of the Rasputin NTF2-like domain from Drosophila melanogaster
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vognsen, Tina, E-mail: tv@farma.ku.dk; Kristensen, Ole, E-mail: ok@farma.ku.dk
2012-03-30
Highlights: Black-Right-Pointing-Pointer The crystal structure of the NTF2-like domain of Rasputin protein is presented. Black-Right-Pointing-Pointer Differences to known ligand binding sites of nuclear transport factor 2 are discussed. Black-Right-Pointing-Pointer A new ligand binding site for the Rasputin and G3BP proteins is proposed. -- Abstract: The crystal structure of the NTF2-like domain of the Drosophila homolog of Ras GTPase SH3 Binding Protein (G3BP), Rasputin, was determined at 2.7 A resolution. The overall structure is highly similar to nuclear transport factor 2: It is a homodimer comprised of a {beta}-sheet and three {alpha}-helices forming a cone-like shape. However, known binding sites formore » RanGDP and FxFG containing peptides show electrostatic and steric differences compared to nuclear transport factor 2. A HEPES molecule bound in the structure suggests a new, and possibly physiologically relevant, ligand binding site.« less
Topography of the ISW2–nucleosome complex: insights into nucleosome spacing and chromatin remodeling
Kagalwala, Mohamedi N; Glaus, Benjamin J; Dang, Weiwei; Zofall, Martin; Bartholomew, Blaine
2004-01-01
Linker DNA was found to be critical for the specific docking of ISW2 with nucleosomes as shown by mapping the physical contacts of ISW2 with nucleosomes at base-pair resolution. Hydroxyl radical footprinting revealed that ISW2 not only extensively interacts with the linker DNA, but also approaches the nucleosome from the side perpendicular to the axis of the DNA superhelix and contacts two disparate sites on the nucleosomal DNA from opposite sides of the superhelix. The topography of the ISW2–nucleosome was further delineated by finding which of the ISW2 subunits are proximal to specific sites within the linker and nucleosomal DNA regions by site-directed DNA photoaffinity labeling. Although ISW2 was shown to contact ∼63 bp of linker DNA, a minimum of 20 bp of linker DNA was required for stable binding of ISW2 to nucleosomes. The remaining ∼43 bp of flanking linker DNA promoted more efficient binding under competitive binding conditions and was functionally important for enhanced sliding of nucleosomes when ISW2 was significantly limiting. PMID:15131696
The Glucuronic Acid Utilization Gene Cluster from Bacillus stearothermophilus T-6
Shulami, Smadar; Gat, Orit; Sonenshein, Abraham L.; Shoham, Yuval
1999-01-01
A λ-EMBL3 genomic library of Bacillus stearothermophilus T-6 was screened for hemicellulolytic activities, and five independent clones exhibiting β-xylosidase activity were isolated. The clones overlap each other and together represent a 23.5-kb chromosomal segment. The segment contains a cluster of xylan utilization genes, which are organized in at least three transcriptional units. These include the gene for the extracellular xylanase, xylanase T-6; part of an operon coding for an intracellular xylanase and a β-xylosidase; and a putative 15.5-kb-long transcriptional unit, consisting of 12 genes involved in the utilization of α-d-glucuronic acid (GlcUA). The first four genes in the potential GlcUA operon (orf1, -2, -3, and -4) code for a putative sugar transport system with characteristic components of the binding-protein-dependent transport systems. The most likely natural substrate for this transport system is aldotetraouronic acid [2-O-α-(4-O-methyl-α-d-glucuronosyl)-xylotriose] (MeGlcUAXyl3). The following two genes code for an intracellular α-glucuronidase (aguA) and a β-xylosidase (xynB). Five more genes (kdgK, kdgA, uxaC, uxuA, and uxuB) encode proteins that are homologous to enzymes involved in galacturonate and glucuronate catabolism. The gene cluster also includes a potential regulatory gene, uxuR, the product of which resembles repressors of the GntR family. The apparent transcriptional start point of the cluster was determined by primer extension analysis and is located 349 bp from the initial ATG codon. The potential operator site is a perfect 12-bp inverted repeat located downstream from the promoter between nucleotides +170 and +181. Gel retardation assays indicated that UxuR binds specifically to this sequence and that this binding is efficiently prevented in vitro by MeGlcUAXyl3, the most likely molecular inducer. PMID:10368143
Cis-acting elements in the promoter region of the human aldolase C gene.
Buono, P; de Conciliis, L; Olivetta, E; Izzo, P; Salvatore, F
1993-08-16
We investigated the cis-acting sequences involved in the expression of the human aldolase C gene by transient transfections into human neuroblastoma cells (SKNBE). We demonstrate that 420 bp of the 5'-flanking DNA direct at high efficiency the transcription of the CAT reporter gene. A deletion between -420 bp and -164 bp causes a 60% decrease of CAT activity. Gel shift and DNase I footprinting analyses revealed four protected elements: A, B, C and D. Competition analyses indicate that Sp1 or factors sharing a similar sequence specificity bind to elements A and B, but not to elements C and D. Sequence analysis shows a half palindromic ERE motif (GGTCA), in elements B and D. Region D binds a transactivating factor which appears also essential to stabilize the initiation complex.
GalaxyDock BP2 score: a hybrid scoring function for accurate protein-ligand docking
NASA Astrophysics Data System (ADS)
Baek, Minkyung; Shin, Woong-Hee; Chung, Hwan Won; Seok, Chaok
2017-07-01
Protein-ligand docking is a useful tool for providing atomic-level understanding of protein functions in nature and design principles for artificial ligands or proteins with desired properties. The ability to identify the true binding pose of a ligand to a target protein among numerous possible candidate poses is an essential requirement for successful protein-ligand docking. Many previously developed docking scoring functions were trained to reproduce experimental binding affinities and were also used for scoring binding poses. However, in this study, we developed a new docking scoring function, called GalaxyDock BP2 Score, by directly training the scoring power of binding poses. This function is a hybrid of physics-based, empirical, and knowledge-based score terms that are balanced to strengthen the advantages of each component. The performance of the new scoring function exhibits significant improvement over existing scoring functions in decoy pose discrimination tests. In addition, when the score is used with the GalaxyDock2 protein-ligand docking program, it outperformed other state-of-the-art docking programs in docking tests on the Astex diverse set, the Cross2009 benchmark set, and the Astex non-native set. GalaxyDock BP2 Score and GalaxyDock2 with this score are freely available at http://galaxy.seoklab.org/softwares/galaxydock.html.
Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.
Bischoff, F R; Krebber, H; Smirnova, E; Dong, W; Ponstingl, H
1995-01-01
RCC1 (the regulator of chromosome condensation) stimulates guanine nucleotide dissociation on the Ras-related nuclear protein Ran. Both polypeptides are components of a regulatory pathway that has been implicated in regulating DNA replication, onset of and exit from mitosis, mRNA processing and transport, and import of proteins into the nucleus. In a search for further members of the RCC1-Ran signal pathway, we have identified proteins of 23, 45 and 300 kDa which tightly bind to Ran-GTP but not Ran-GDP. The purified soluble 23 kDa Ran binding protein RanBP1 does not activate RanGTPase, but increases GTP hydrolysis induced by the RanGTPase-activating protein RanGAP1 by an order of magnitude. In the absence of RanGAP, it strongly inhibits RCC1-induced exchange of Ran-bound GTP. In addition, it forms a stable complex with nucleotide-free RCC1-Ran. With these properties, it differs markedly from guanine diphosphate dissociation inhibitors which preferentially prevent the exchange of protein-bound GDP and in some cases were shown to inhibit GAP-induced GTP hydrolysis. RanBP1 is the first member of a new class of proteins regulating the binding and hydrolysis of GTP by Ras-related proteins. Images PMID:7882974
Riccardi, Patrizia; Baldwin, Ron; Salomon, Ronald; Anderson, Sharlet; Ansari, Mohammad S; Li, Rui; Dawant, Benoit; Bauernfeind, Amy; Schmidt, Dennis; Kessler, Robert
2008-01-15
This study examined whether positron emission tomography (PET) studies with [18F] fallypride performed before and after alpha-methyl-para-tyrosine (AMPT) administration can be used to estimate baseline dopamine (DA) D2 receptor occupancy in striatal and extrastriatal regions. Six normal subjects underwent PET with [18 F] fallypride before and after administration of AMPT. The DA D2 receptor binding potentials (bp) were calculated with the reference region method. Percent changes in bp in striatal and extrastriatal regions were calculated with both region-of-interest analysis and on a voxel by voxel basis with parametric images of DA D2 receptor levels. The results of the current study indicate that AMPT treatment significantly increased the bp in the caudate, putamen, ventral striatum, and substantia nigra. A trend level increase was seen in the medial thalamus. This study demonstrates that PET with [18F] fallypride can be used to estimate baseline DA D2 receptor occupancy in striatal and extrastriatal regions.
Amount of cadmium associated with Cd-binding protein in roots of young plants. [Agrostis gigantea
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rauser, W.E.
1986-04-01
The partitioning of Cd between roots and shoots was determined for young plants exposed to Cd in nutrient solution. The intentionally high concentration of 3 ..mu..m Cd was used to assess the role of root Cd-binding protein (Cd-BP) in Cd detoxification. The roots of tomatoes exposed to Cd retained 60-84% of the plant Cd from day 2 through day 9 without toxicity symptoms evident. Cd-BP did not contribute to Cd retention over the initial 4 days, only 1-4% of the root Cd was in this protein fraction. Maize roots retained 59-66% of the plant Cd from day 1 through daymore » 7. The Cd-BP fraction bound 8-19% of the root Cd on day 1 and 31-55% by day 7. Cd toxicity symptoms occurred in leaves by 4 days. In the grass Agrostis gigantea the roots retained 73-85% of the seedling Cd after 1 day and for another 6 days. A high proportion of the root Cd(34-68%) was in the Cd-BP fraction after one day and continued to be so to day 7 (46-64%). No Cd toxicity symptoms were evident. Only the specific pattern of rapid, early and sustained production of Cd-BP observed in Agrostis was consistent with the putative detoxification role for Cd-BP.« less
Yamaguchi, Airi; Kaneko, Takane; Inai, Tetsuichiro; Iida, Hiroshi
2014-04-01
Tektins (TEKTs) are composed of a family of filament-forming proteins localized in cilia and flagella. Five types of mammalian TEKTs have been reported, all of which have been verified to be present in sperm flagella. TEKT2, which is indispensable for sperm structure, mobility, and fertilization, was present at the periphery of the outer dense fiber (ODF) in the sperm flagella. By yeast two-hybrid screening, we intended to isolate flagellar proteins that could interact with TEKT2, which resulted in the isolation of novel two genes from the mouse testis library, referred as a TEKT2-binding protein 1 (TEKT2BP1) and -protein 2 (TEKT2BP2). In this study, we characterized TEKT2BP1, which is registered as a coiled-coil domain-containing protein 172 (Ccdc172) in the latest database. RT-PCR analysis indicated that TEKT2BP1 was predominantly expressed in rat testis and that its expression was increased after 3 weeks of postnatal development. Immunocytochemical studies discovered that TEKT2BP1 localized in the middle piece of rat spermatozoa, predominantly concentrated at the mitochondria sheath of the flagella. We hypothesize that the TEKT2-TEKT2BP1 complex might be involved in the structural linkage between the ODF and mitochondria in the middle piece of the sperm flagella.
Torres, L M F C; Braga, N A; Gomes, I P; Almeida, M T; Santos, T L; de Mesquita, J P; da Silva, L M; Martins, H R; Kato, K C; Dos Santos, W T P; Resende, J M; Pereira, M C; Bemquerer, M P; Rodrigues, M A; Verly, R M
2018-03-01
The functionalization of alumina nanoparticles of specific morphology with antimicrobial peptides (AMP) can be a promising strategy for modeling medical devices and packaging materials for cosmetics, medicines or food, since the contamination by pathogens could be reduced. In this paper, we show the synthesis of a fibrous-like alumina nanobiostructure, as well as its functionalization with the peptide EAAA-BP100, an analog of the antimicrobial peptide BP100. The antibacterial activity of the obtained material against some bacterial strains is also investigated. The covalent binding of the peptide to the nanoparticles was promoted by a reaction between the carboxyl group of the glutamate side chain (E1) of the peptide and the amino groups of the alumina nanoparticles, previously modified by reaction with 3-aminopropyltrietoxysilane (APTES). The functionalized nanoparticles were characterized by zeta potential measurements, Fourier transform infrared spectroscopy, and other physicochemical techniques. Although the obtained alumina nanobiostructure shows a relatively low degree of substitution with EAAA-BP100, antibacterial activities against Escherichia coli and Salmonella typhimurium strains are appreciably higher than the activities of the free peptide. The obtained results can affect the design of new hybrid nanobiomaterials based on nanoparticles functionalized with AMP. Copyright © 2018. Published by Elsevier B.V.
Talley, Todd T.; Harel, Michal; Hibbs, Ryan E.; Radić, Zoran; Tomizawa, Motohiro; Casida, John E.; Taylor, Palmer
2008-01-01
Acetylcholine-binding proteins (AChBPs) from mollusks are suitable structural and functional surrogates of the nicotinic acetylcholine receptors when combined with transmembrane spans of the nicotinic receptor. These proteins assemble as a pentamer with identical ACh binding sites at the subunit interfaces and show ligand specificities resembling those of the nicotinic receptor for agonists and antagonists. A subset of ligands, termed the neonicotinoids, exhibit specificity for insect nicotinic receptors and selective toxicity as insecticides. AChBPs are of neither mammalian nor insect origin and exhibit a distinctive pattern of selectivity for the neonicotinoid ligands. We define here the binding orientation and determinants of differential molecular recognition for the neonicotinoids and classical nicotinoids by estimates of kinetic and equilibrium binding parameters and crystallographic analysis. Neonicotinoid complex formation is rapid and accompanied by quenching of the AChBP tryptophan fluorescence. Comparisons of the neonicotinoids imidacloprid and thiacloprid in the binding site from Aplysia californica AChBP at 2.48 and 1.94 Å in resolution reveal a single conformation of the bound ligands with four of the five sites occupied in the pentameric crystal structure. The neonicotinoid electronegative pharmacophore is nestled in an inverted direction compared with the nicotinoid cationic functionality at the subunit interfacial binding pocket. Characteristic of several agonists, loop C largely envelops the ligand, positioning aromatic side chains to interact optimally with conjugated and hydrophobic regions of the neonicotinoid. This template defines the association of interacting amino acids and their energetic contributions to the distinctive interactions of neonicotinoids. PMID:18477694
Noe, Megan H.; Messingham, Kelly A.N.; Brandt, Debra S.; Andrews, Janet I.; Fairley, Janet A.
2016-01-01
BP180 (type XVII collagen) is a transmembrane protein expressed in a variety of cell types. It is also the target of autoantibodies in cutaneous autoimmune disease including bullous pemphigoid and pemphigoid gestationis, a disease unique to pregnancy. The purpose of this study was to determine the prevalence and specificity of cutaneous autoantibodies in a cohort of pregnant women. De-identified sera were collected from pregnant women (n = 299) and from non-pregnant controls (n = 134). Sera were analyzed by ELISA for the presence of IgG and IgE autoantibodies directed against several cutaneous autoantigens. IgE antibodies against the NC16A domain of BP180 were detected in 7.7% of pregnant women, compared to 2.2% of healthy controls (p = 0.01). No increase in total or cutaneous autoantigen specific IgG was seen. Total serum IgE was within the normal range. Full-length BP180 was detected by western immunoblot in epidermal, keratinocyte, placental and cytotrophoblast (CTB) cell lysates. Furthermore, flow cytometry and indirect immunofluorescence confirmed the expression of BP180 on the surface of cultured CTBs. Finally, it was demonstrated that IgE antibodies in the pregnancy sera labeled not only cultured CTBs, but also the placental amnion and cutaneous basement membrane zone using indirect immunofluorescence. We conclude that some pregnant women develop antibodies specific for BP180, and that these autoantibodies are capable of binding both CTB and the placental amnion, potentially affecting placental function. PMID:20471095
Bernard, D J; Woodruff, T K
2001-04-01
Inhibin binding protein (InhBP) and the transforming growth factor-beta (TGF beta) type III receptor, beta glycan, have been identified as putative inhibin coreceptors. Here we cloned the InhBP cDNA in rats and predict that it encodes a large membrane-spanning protein that is part of the Ig superfamily, as has been described for humans. Two abundant InhBP transcripts (4.4 and 1.8 kb) were detected in the adult rat pituitary. The larger transcript encodes the full-length protein while the 1.8-kb transcript (InhBP-short or InhBP-S) corresponds to a splice variant of the receptor. This truncated isoform contains only the N-terminal signal peptide and first two (of 12) Ig-like domains observed in the full-length InhBP (InhBP-long or InhBP-L). InhBP-S does not contain a transmembrane domain and is predicted to be a soluble protein. Beta glycan was also detected in the pituitary; however, it was most abundant within the intermediate lobe. Although we also observed beta glycan immunopositive cells in the anterior pituitary, they rarely colocalized with FSH beta-producing cells. We next examined physiological regulation of the coreceptors across the rat estrous cycle. Like circulating inhibin A and inhibin B levels, pituitary InhBP-L and InhBP-S mRNA levels were dynamically regulated across the cycle and were negatively correlated with serum FSH levels. Expression of both forms of InhBP was also positively correlated with serum inhibin B, but not inhibin A, levels. These data are particularly interesting in light of our in vitro observations that InhBP may function as an inhibin B-specific coreceptor. Pituitary beta glycan mRNA levels did not fluctuate across the cycle nor did they correlate with serum FSH. These observations, coupled with its pattern of expression within the pituitary, indicate that beta glycan likely functions as more than merely an inhibin coreceptor within the pituitary. A direct role for InhBP or beta glycan in regulation of pituitary FSH by inhibin in vivo has yet to be determined, but the demonstration of dynamic regulation of pituitary InhBP and its negative relation to serum FSH across the estrous cycle is an important step in this direction.
Association of 3BP2 with SHP-1 regulates SHP-1-mediated production of TNF-α in RBL-2H3 cells.
Chihara, Kazuyasu; Nakashima, Kenji; Takeuchi, Kenji; Sada, Kiyonao
2011-12-01
Adaptor protein 3BP2, a c-Abl Src homology 3 (SH3) domain-binding protein, is tyrosine phosphorylated and positively regulates mast cell signal transduction after the aggregation of the high affinity IgE receptor (FcεRI). Overexpression of the Src homology 2 (SH2) domain of 3BP2 results in the dramatic suppression of antigen-induced degranulation in rat basophilic leukemia RBL-2H3 cells. Previously, a linker for activation of T cells (LAT) was identified as one of the 3BP2 SH2 domain-binding protein. In this report, to further understand the functions of 3BP2 in FcεRI-mediated activation of mast cell, we explored the protein that associates with the SH2 domain of 3BP2 and found that SH2 domain-containing phosphatase-1 (SHP-1) inducibly interacts with the SH2 domain of 3BP2 after the aggregation of FcεRI. The phosphorylation of Tyr(564) in the carboxy (C)-terminal tail region of SHP-1 is required for the direct interaction of SHP-1 to the SH2 domain of 3BP2. The expression of the mutant form of SHP-1 which was unable to interact with 3BP2 resulted in the significant reduction in SHP-1-mediated tumor necrosis factor-α (TNF-α) production without any effects on the degranulation in antigen-stimulated RBL-2H3 cells. These findings suggest that 3BP2 directly interacts with Tyr(564) -phosphorylated form of SHP-1 and positively regulates the function of SHP-1 in FcεRI-mediated signaling in mast cells. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.
Xu, Wen Ping; Wang, Ze Rui; Zou, Xia; Zhao, Chen; Wang, Rui; Shi, Pei Mei; Yuan, Zong Li; Yang, Fang; Zeng, Xin; Wang, Pei Qin; Sultan, Sakhawat; Zhang, Yan; Xie, Wei Fen
2018-04-01
Wisteria floribunda agglutinin-positive Mac-2-binding protein (WFA + -M2BP) is a novel glycobiomarker for evaluating liver fibrosis, but less is known about its role in liver cirrhosis (LC). This study aimed to investigate the utility of WFA + -M2BP in evaluating liver function and predicting prognosis of cirrhotic patients. We retrospectively included 197 patients with LC between 2013 and 2016. Serum WFA + -M2BP and various biochemical parameters were measured in all patients. With a median follow-up of 23 months, liver-related complications and deaths of 160 patients were recorded. The accuracy of WFA + -M2BP in evaluating liver function, predicting decompensation and mortality were measured by the receiver operating characteristic (ROC) curve, logistic and Cox's regression analyses, respectively. WFA + -M2BP levels increased with elevated Child-Pugh classification, especially in patients with hepatitis B virus (HBV) infection. ROC analysis confirmed the high reliability of WFA + -M2BP for the assessment of liver function using Child-Pugh classification. WFA + -M2BP was also significantly positively correlated with the model for end-stage liver disease (MELD) score. Multivariate logistic regression analysis indicated WFA + -M2BP as an independent predictor of clinical decompensation for compensated patients (odds ratio 11.958, 95% confidence interval [CI] 1.876-76.226, P = 0.009), and multivariate Cox's regression analysis verified WFA + -M2BP as an independent risk factor for liver-related death in patients with HBV infection (hazards ratio 10.596, 95% CI 1.356-82.820, P = 0.024). Serum WFA + -M2BP is a reliable predictor of liver function and prognosis in LC and could be incorporated into clinical surveillance strategies for LC patients, especially those with HBV infection. © 2018 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.
Wang, Jun; Lee, Seungsoo; Teh, Charis En-Yi; Bunting, Karen; Ma, Lina; Shannon, M Frances
2009-03-01
Activation of T cells leads to the induction of many cytokine genes that are required for appropriate immune responses, including IL-2, a key cytokine for T cell proliferation and homeostasis. The activating transcription factors such as nuclear factor of activated T cells, nuclear factor kappaB/Rel and activated protein-1 family members that regulate inducible IL-2 gene expression have been well documented. However, negative regulation of the IL-2 gene is less studied. Here we examine the role of zinc finger E-box-binding protein (ZEB) 1, a homeodomain/Zn finger transcription factor, as a repressor of IL-2 gene transcription. We show here that ZEB1 is expressed in non-stimulated and stimulated T cells and using chromatin immunoprecipitation assays we show that ZEB1 binds to the IL-2 promoter. Over-expression of ZEB1 can repress IL-2 promoter activity, as well as endogenous IL-2 mRNA production in EL-4 T cells, and this repression is dependent on the ZEB-binding site at -100. ZEB1 cooperates with the co-repressor C-terminal-binding protein (CtBP) 2 and with histone deacetylase 1 to repress the IL-2 promoter and this cooperation depends on the ZEB-binding site in the promoter as well as the Pro-X-Asp-Leu-Ser protein-protein interaction domain in CtBP2. Thus, ZEB1 may function to recruit a repressor complex to the IL-2 promoter.
Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.
Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H
2001-12-21
We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.
Maunder, E M; Pillay, A V; Care, A D
1987-10-01
An i.v. injection of calcitriol (1,25-(OH)2D3) had no effect within 2.5 h on plasma concentrations of calbindin-D9K (vitamin D-induced calcium-binding protein; CaBP) in hypocalcaemic pigs with inherited vitamin D-dependent rickets type I or in their normocalcaemic siblings or half-siblings. Three days later the plasma concentration of CaBP had doubled in the hypocalcaemic pigs, but was unaltered in the normocalcaemic siblings and half-siblings. Following daily i.v. injections of 1,25-(OH)2D3 for a further 5 days (days 4-8) plasma concentrations of CaBP increased in both the hypocalcaemic (days 4-8) and normocalcaemic (day 8) pigs, the effect being more rapid and greater in the hypocalcaemic 1,25-(OH)2D3-deficient animals. An i.v. injection of 1,25-(OH)2D3 to pure Yucatan pigs also had no effect on plasma concentrations of CaBP within 1.5 h, but in the following 1 h there was some indication of an increase in plasma CaBP levels. In contrast to the normal pigs, insulin-induced hypoglycaemia did not lead to a peak in plasma CaBP concentrations in the hypocalcaemic pigs. There was also no change in the plasma concentrations of 1,25-(OH)2D3 associated with the peak in plasma CaBP following insulin-induced hypoglycaemia in normocalcaemic pigs. These results suggest that changes in plasma concentrations of 1,25-(OH)2D3 are not directly involved in mediating the increase in plasma CaBP which follows hypoglycaemia induced by insulin in normal pigs, although 1,25-(OH)2D3 probably plays a permissive role.
Hasegawa, Kunihiro; Takata, Ryo; Nishikawa, Hiroki; Enomoto, Hirayuki; Ishii, Akio; Iwata, Yoshinori; Miyamoto, Yuho; Ishii, Noriko; Yuri, Yukihisa; Nakano, Chikage; Nishimura, Takashi; Yoh, Kazunori; Aizawa, Nobuhiro; Sakai, Yoshiyuki; Ikeda, Naoto; Takashima, Tomoyuki; Iijima, Hiroko; Nishiguchi, Shuhei
2016-09-12
We aimed to examine the effect of Wisteria floribunda agglutinin-positive Mac-2-binding protein (WFA⁺-M2BP) level on survival comparing with other laboratory liver fibrosis markers in hepatitis C virus (HCV)-related compensated liver cirrhosis (LC) (n = 165). For assessing prognostic performance of continuous fibrosis markers, we adapted time-dependent receiver operating characteristics (ROC) curves for clinical outcome. In time-dependent ROC analysis, annual area under the ROCs (AUROCs) were plotted. We also calculated the total sum of AUROCs in all time-points (TAAT score) in each fibrosis marker. WFA⁺-M2BP value ranged from 0.66 cutoff index (COI) to 19.95 COI (median value, 5.29 COI). Using ROC analysis for survival, the optimal cutoff point for WFA⁺-M2BP was 6.15 COI (AUROC = 0.79348, sensitivity = 80.0%, specificity = 74.78%). The cumulative five-year survival rate in patients with WFA⁺-M2BP ≥ 6.15 COI (n = 69) was 43.99%, while that in patients with WFA⁺-M2BP < 6.15 COI (n = 96) was 88.40% (p < 0.0001). In the multivariate analysis, absence of hepatocellular carcinoma (p = 0.0008), WFA⁺-M2BP < 6.15 COI (p = 0.0132), achievement of sustained virological response (p < 0.0001) and des-γ-carboxy prothrombin < 41 mAU/mL (p = 0.0018) were significant favorable predictors linked to survival. In time-dependent ROC analysis in all cases, WFA⁺-M2BP had the highest TAAT score among liver fibrosis markers. In conclusion, WFA⁺-M2BP can be a useful predictor in HCV-related compensated LC.
Wang, Zhiyun; Liu, Zhining; Wang, Ling; Wang, Junling; Chen, Liping; Xie, Hua; Zhang, Huiyun; He, Shaoheng
2018-05-01
IL-18 is likely to contribute to asthma. However, little is known regarding the role of IL-18 binding protein (BP) and IL-18 receptor (R) in asthma. Because the action of IL-18 in the body is regulated by IL-18BP and mast cells and basophils are key cell types involved in asthma, we investigated the expression of IL-18, IL-18BP and IL-18R in basophils and mast cells using flow cytometry and a mouse asthma model. We found that among basophils, approximately 53% and 51% were IL-18 + , 85% and 81% were IL-18BP + basophils, and 19.8% and 8.6% were IL-18R + in healthy control (HC) and asthmatic blood, respectively. The allergens tested had little effect on the expression of IL-18 and related factors. Only 3.5%, 14.3% and 2.4% of dispersed mast cells expressed IL-18, IL-18BP and IL-18R, respectively, in asthmatic sputum. In a mouse asthma model, OVA-sensitized mice exhibited decreased IL-18BP + but increased IL-18R + basophils in their blood. IL-18 increased the number of basophils but eliminated IL-18BP + basophils in mouse blood. IL-18 increased the number of mast cells and IL-18R + mast cells in the lung as well as increased the mast cell numbers and IL-18BP + mast cells in the bronchoalveolar lavage fluid (BALF) of OVA-sensitized mice. Thus, basophils and mast cells may be involved in asthma pathogenesis via an IL-18-associated mechanism. © 2018 The Foundation for the Scandinavian Journal of Immunology.
Ren, Xiang-Liang; Chen, Rui-Rui; Zhang, Ying; Ma, Yan; Cui, Jin-Jie; Han, Zhao-Jun; Mu, Li-Li
2013-01-01
Crystal toxin Cry1Ca from Bacillus thuringiensis has an insecticidal spectrum encompassing lepidopteran insects that are tolerant to current commercially used B. thuringiensis crops (Bt crops) expressing Cry1A toxins and may be useful as a potential bioinsecticide. The mode of action of Cry1A is fairly well understood. However, whether Cry1Ca interacts with the same receptor proteins as Cry1A remains unproven. In the present paper, we first cloned a cadherin-like gene, SeCad1b, from Spodoptera exigua (relatively susceptible to Cry1Ca). SeCad1b was highly expressed in the larval gut but scarcely detected in fat body, Malpighian tubules, and remaining carcass. Second, we bacterially expressed truncated cadherin rSeCad1bp and its interspecific homologue rHaBtRp from Helicoverpa armigera (more sensitive to Cry1Ac) containing the putative toxin-binding regions. Competitive binding assays showed that both Cry1Ca and Cry1Ac could bind to rSeCad1bp and rHaBtRp, and they did not compete with each other. Third, Cry1Ca ingestion killed larvae and decreased the weight of surviving larvae. Dietary introduction of SeCad1b double-stranded RNA (dsRNA) reduced approximately 80% of the target mRNA and partially alleviated the negative effect of Cry1Ca on larval survival and growth. Lastly, rSeCad1bp and rHaBtRp differentially enhanced the negative effects of Cry1Ca and Cry1Ac on the larval mortalities and growth of S. exigua and H. armigera. Thus, we provide the first lines of evidence to suggest that SeCad1b from S. exigua is a functional receptor of Cry1Ca. PMID:23835184
Stark, Adam J; Smith, Christopher T; Petersen, Kalen J; Trujillo, Paula; van Wouwe, Nelleke C; Donahue, Manus J; Kessler, Robert M; Deutch, Ariel Y; Zald, David H; Claassen, Daniel O
2018-01-01
Parkinson's disease (PD) is characterized by widespread degeneration of monoaminergic (especially dopaminergic) networks, manifesting with a number of both motor and non-motor symptoms. Regional alterations to dopamine D 2/3 receptors in PD patients are documented in striatal and some extrastriatal areas, and medications that target D 2/3 receptors can improve motor and non-motor symptoms. However, data regarding the combined pattern of D 2/3 receptor binding in both striatal and extrastriatal regions in PD are limited. We studied 35 PD patients off-medication and 31 age- and sex-matched healthy controls (HCs) using PET imaging with [ 18 F]fallypride, a high affinity D 2/3 receptor ligand, to measure striatal and extrastriatal D 2/3 nondisplaceable binding potential (BP ND ). PD patients completed PET imaging in the off medication state, and motor severity was concurrently assessed. Voxel-wise evaluation between groups revealed significant BP ND reductions in PD patients in striatal and several extrastriatal regions, including the locus coeruleus and mesotemporal cortex. A region-of-interest (ROI) based approach quantified differences in dopamine D 2/3 receptors, where reduced BP ND was noted in the globus pallidus, caudate, amygdala, hippocampus, ventral midbrain, and thalamus of PD patients relative to HC subjects. Motor severity positively correlated with D 2/3 receptor density in the putamen and globus pallidus. These findings support the hypothesis that abnormal D 2/3 expression occurs in regions related to both the motor and non-motor symptoms of PD, including areas richly invested with noradrenergic neurons.
Schiffer, Wynne K.; Alexoff, David L.; Shea, Colleen; Logan, Jean; Dewey, Stephen L.
2005-01-01
In the field of small animal positron emission tomography (PET), the assumptions underlying human and primate kinetic models may not be sustained in rodents. That is, the threshold dose at which a pharmacologic response occurs may be lower in small animals. In order to define this relationship, we combined microPET imaging using 11C-raclopride with microdialysis measures of extracellular fluid (ECF) dopamine (DA). In addition, we performed a series of studies in which a known mass of raclopride was microinfused into one striatum prior to a high specific activity (SA) systemic injection of 11C-raclopride. This single-injection approach provided a high and low SA region of radiotracer binding in the same animal during the same scanning session. Our data demonstrate that the binding potential (BP) declines above 3.5 pmol/ml (0.35 μg), with an ED50 of 8.55 ± 5.62 pmol/ml. These data also provide evidence that BP may be compromised by masses of raclopride below 2.0 pmol/ml (0.326 μg). Increases in ECF DA were produced by mass doses of raclopride over 3.9 pmol/ml (0.329 μg) with an ED50 of 8.53 ± 2.48 pmol/ml. Taken together, it appears that an optimal range of raclopride mass exists between 2.0 and 3.5 pmol/ml, around which the measured BP can be compromised by system sensitivity, endogenous DA, or excessive competition with unlabeled compound. PMID:15848236
Bisphosphonate-decorated lipid nanoparticles designed as drug carriers for bone diseases.
Wang, Guilin; Mostafa, Nesrine Z; Incani, Vanessa; Kucharski, Cezary; Uludağ, Hasan
2012-03-01
A conjugate of distearoylphosphoethanolamine-polyethylene glycol with 2-(3-mercaptopropylsulfanyl)-ethyl-1,1-bisphosphonic acid (thiolBP) was synthesized and incorporated into micelles and liposomes to create mineral-binding nanocarriers for therapeutic agents. The micelles and liposomes were used to encapsulate the anticancer drug doxorubicin (DOX) and a model protein lysozyme (LYZ) by using lipid film hydration (LFH) and reverse-phase evaporation vesicle (REV) methods. The results indicated that the micelles and LFH-derived liposomes were better at DOX loading than the REV-derived liposomes, while the REV method was preferable for encapsulating LYZ. The affinity of the micellar and liposomal formulations to hydroxyapatite (HA) was assessed in vitro, and the results indicated that all the thiolBP-incorporated nanocarriers had stronger HA affinity than their counterparts without thiolBP. The thiolBP-decorated liposomes also displayed a strong binding to a collagen/HA composite scaffold in vitro. More importantly, thiolBP-decorated liposomes gave increased retention in the collagen/HA scaffolds after subcutaneously implantation in rats. The designed liposomes were able to entrap the bone morphogenetic protein-2 in a bioactive form, indicating that the proposed nanocarriers could deliver bioactive factors locally in mineralized scaffolds for bone tissue engineering. Copyright © 2011 Wiley Periodicals, Inc.
Jaffrey, S R; Haile, D J; Klausner, R D; Harford, J B
1993-09-25
To assess the influence of RNA sequence/structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and/or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP forms multiple contacts with its cognate RNA, and that these contacts, acting in concert, provide the basis for the high affinity of this interaction.
Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry
NASA Astrophysics Data System (ADS)
Song, Hong Yan; Su, Xiaodi
In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.
Sidorova, Yulia A; Perepechaeva, Maria L; Pivovarova, Elena N; Markel, Arkady L; Lyakhovich, Vyacheslav V; Grishanova, Alevtina Y
2016-01-01
Oxidative reactions that are catalyzed by cytochromes P450 1A (CYP1A) lead to formation of carcinogenic derivatives of arylamines and polycyclic aromatic hydrocarbons (PAHs), such as the widespread environmental pollutant benzo(α)pyrene (BP). These compounds upregulate CYP1A at the transcriptional level via an arylhydrocarbon receptor (AhR)-dependent signaling pathway. Because of the involvement of AhR-dependent genes in chemically induced carcinogenesis, suppression of this signaling pathway could prevent tumor formation and/or progression. Here we show that menadione (a water-soluble analog of vitamin K3) inhibits BP-induced expression and enzymatic activity of both CYP1A1 and CYP1A2 in vivo (in the rat liver) and BP-induced activity of CYP1A1 in vitro. Coadministration of BP and menadione reduced DNA-binding activity of AhR and increased DNA-binding activity of transcription factors Oct-1 and CCAAT/enhancer binding protein (C/EBP), which are known to be involved in negative regulation of AhR-dependent genes, in vivo. Expression of another factor involved in downregulation of CYP1A-pAhR repressor (AhRR)-was lower in the liver of the rats treated with BP and menadione, indicating that the inhibitory effect of menadione on CYP1A is not mediated by this protein. Furthermore, menadione was well tolerated by the animals: no signs of acute toxicity were detected by visual examination or by assessment of weight gain dynamics or liver function. Taken together, our results suggest that menadione can be used in further studies on animal models of chemically induced carcinogenesis because menadione may suppress tumor formation and possibly progression.
Pivovarova, Elena N.; Markel, Arkady L.; Lyakhovich, Vyacheslav V.; Grishanova, Alevtina Y.
2016-01-01
Oxidative reactions that are catalyzed by cytochromes P450 1A (CYP1A) lead to formation of carcinogenic derivatives of arylamines and polycyclic aromatic hydrocarbons (PAHs), such as the widespread environmental pollutant benzo(α)pyrene (BP). These compounds upregulate CYP1A at the transcriptional level via an arylhydrocarbon receptor (AhR)-dependent signaling pathway. Because of the involvement of AhR-dependent genes in chemically induced carcinogenesis, suppression of this signaling pathway could prevent tumor formation and/or progression. Here we show that menadione (a water-soluble analog of vitamin K3) inhibits BP-induced expression and enzymatic activity of both CYP1A1 and CYP1A2 in vivo (in the rat liver) and BP-induced activity of CYP1A1 in vitro. Coadministration of BP and menadione reduced DNA-binding activity of AhR and increased DNA-binding activity of transcription factors Oct-1 and CCAAT/enhancer binding protein (C/EBP), which are known to be involved in negative regulation of AhR-dependent genes, in vivo. Expression of another factor involved in downregulation of CYP1A—pAhR repressor (AhRR)—was lower in the liver of the rats treated with BP and menadione, indicating that the inhibitory effect of menadione on CYP1A is not mediated by this protein. Furthermore, menadione was well tolerated by the animals: no signs of acute toxicity were detected by visual examination or by assessment of weight gain dynamics or liver function. Taken together, our results suggest that menadione can be used in further studies on animal models of chemically induced carcinogenesis because menadione may suppress tumor formation and possibly progression. PMID:27167070
Salvetti, A; Lilienbaum, A; Li, Z; Paulin, D; Gazzolo, L
1993-01-01
The vimentin gene is a member of the intermediate filament multigene family and encodes a protein expressed, in vivo, in all mesenchymal derivatives and, in vitro, in cell types of various origin. We have previously demonstrated that the expression of this growth-regulated gene could be trans activated by the 40-kDa Tax protein of HTLV-I (human T-cell leukemia virus type I) and that responsiveness to this viral protein was mediated by the presence of an NF-kappa B binding site located between -241 and -210 bp upstream of the mRNA cap site (A. Lilienbaum, M. Duc Dodon, C. Alexandre, L. Gazzolo, and D. Paulin, J. Virol. 64:256-263, 1990). These previous assays, performed with deletion mutants of the vimentin promoter linked to the chloramphenicol acetyltransferase gene, also revealed the presence of an upstream negative region between -529 and -241 bp. Interestingly, the inhibitory activity exerted by this negative region was overcome after cotransfection of a Tax-expressing plasmid. In this study, we further characterize the vimentin negative element and define the effect of the Tax protein on the inhibitory activity of this element. We first demonstrate that a 187-bp domain (-424 to -237 bp) behaves as a negative region when placed upstream either of the NF-kappa B binding site of vimentin or of a heterologous enhancer such as that present in the desmin gene promoter. The negative effect can be further assigned to a 32-bp element which is indeed shown to repress the basal or induced activity of the NF-kappa B binding site.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:8417364
Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong
2015-01-01
Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.
NASA Astrophysics Data System (ADS)
Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping
2015-07-01
Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.
The HCM-linked W792R mutation in cardiac myosin-binding protein C reduces C6 FnIII domain stability.
Smelter, Dan F; de Lange, Willem J; Cai, Wenxuan; Ge, Ying; Ralphe, J Carter
2018-06-01
Cardiac myosin-binding protein C (cMyBP-C) is a functional sarcomeric protein that regulates contractility in response to contractile demand, and many mutations in cMyBP-C lead to hypertrophic cardiomyopathy (HCM). To gain insight into the effects of disease-causing cMyBP-C missense mutations on contractile function, we expressed the pathogenic W792R mutation (substitution of a highly conserved tryptophan residue by an arginine residue at position 792) in mouse cardiomyocytes lacking endogenous cMyBP-C and studied the functional effects using three-dimensional engineered cardiac tissue constructs (mECTs). Based on complete conservation of tryptophan at this location in fibronectin type II (FnIII) domains, we hypothesized that the W792R mutation affects folding of the C6 FnIII domain, destabilizing the mutant protein. Adenoviral transduction of wild-type (WT) and W792R cDNA achieved equivalent mRNA transcript abundance, but not equivalent protein levels, with W792R compared with WT controls. mECTs expressing W792R demonstrated abnormal contractile kinetics compared with WT mECTs that were nearly identical to cMyBP-C-deficient mECTs. We studied whether common pathways of protein degradation were responsible for the rapid degradation of W792R cMyBP-C. Inhibition of both ubiquitin-proteasome and lysosomal degradation pathways failed to increase full-length mutant protein abundance to WT equivalence, suggesting rapid cytosolic degradation. Bacterial expression of WT and W792R protein fragments demonstrated decreased mutant stability with altered thermal denaturation and increased susceptibility to trypsin digestion. These data suggest that the W792R mutation destabilizes the C6 FnIII domain of cMyBP-C, resulting in decreased full-length protein expression. This study highlights the vulnerability of FnIII-like domains to mutations that alter domain stability and further indicates that missense mutations in cMyBP-C can cause disease through a mechanism of haploinsufficiency. NEW & NOTEWORTHY This study is one of the first to describe a disease mechanism for a missense mutation in cardiac myosin-binding protein C linked to hypertrophic cardiomyopathy. The mutation decreases stability of the fibronectin type III domain and results in substantially reduced mutant protein expression dissonant to transcript abundance.
Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao
2008-07-02
Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.
Production of insulin-like growth factor binding proteins by small-cell lung cancer cell lines
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jaques, G.; Kiefer, P.; Rotsch, M.
1989-10-01
Conditioned serum-free media (CM) from small-cell lung cancer (SCLC) cell lines were examined for the presence of insulin-like growth-factor-binding proteins (IGF-BP). 6/9 SCLC cell lines secreted binding proteins with high affinity for IGFs. When ({sup 125}I)IGF-1 or ({sup 125}I)IGF-II was incubated with the CMs, complexes of tracer with proteins could be demonstrated by gel filtration, by precipitation with polyethylenglycol, and after adsorption of unbound tracer with activated charcoal. Analysis of binding data according to the method of Scatchard resulted in linear plots for IGF-I and IGF-II. Cross-linking of ({sup 125}I)IGF-I or ({sup 125}I)IGF-II to the CMs followed by sodium dodecylmore » sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) under nonreducing conditions revealed the presence of IGF-BPs with molecular masses in the range of 24-32 kDa. Northern blot hybridization with an IGF-BP cDNA probe encoding a low-molecular-weight IGF-BP from a human placenta cDNA library and Western blot analysis with a corresponding polyclonal antibody showed no expression of this gene. These data demonstrate that SCLC cell lines release IGF-BPs in culture supernatants, which differ from IGF-BPs detected in liver and placenta. These IGF-BPs might be important mediators in the autocrine/paracrine growth regulation of IGFs in SCLC.« less
Targeted Disruption of the Basic Krüppel-Like Factor Gene (Klf3) Reveals a Role in Adipogenesis ▿ †
Sue, Nancy; Jack, Briony H. A.; Eaton, Sally A.; Pearson, Richard C. M.; Funnell, Alister P. W.; Turner, Jeremy; Czolij, Robert; Denyer, Gareth; Bao, Shisan; Molero-Navajas, Juan Carlos; Perkins, Andrew; Fujiwara, Yuko; Orkin, Stuart H.; Bell-Anderson, Kim; Crossley, Merlin
2008-01-01
Krüppel-like factors (KLFs) recognize CACCC and GC-rich sequences in gene regulatory elements. Here, we describe the disruption of the murine basic Krüppel-like factor gene (Bklf or Klf3). Klf3 knockout mice have less white adipose tissue, and their fat pads contain smaller and fewer cells. Adipocyte differentiation is altered in murine embryonic fibroblasts from Klf3 knockouts. Klf3 expression was studied in the 3T3-L1 cellular system. Adipocyte differentiation is accompanied by a decline in Klf3 expression, and forced overexpression of Klf3 blocks 3T3-L1 differentiation. Klf3 represses transcription by recruiting C-terminal binding protein (CtBP) corepressors. CtBPs bind NADH and may function as metabolic sensors. A Klf3 mutant that does not bind CtBP cannot block adipogenesis. Other KLFs, Klf2, Klf5, and Klf15, also regulate adipogenesis, and functional CACCC elements occur in key adipogenic genes, including in the C/ebpα promoter. We find that C/ebpα is derepressed in Klf3 and Ctbp knockout fibroblasts and adipocytes from Klf3 knockout mice. Chromatin immunoprecipitations confirm that Klf3 binds the C/ebpα promoter in vivo. These results implicate Klf3 and CtBP in controlling adipogenesis. PMID:18391014
Control of eIF4E cellular localization by eIF4E-binding proteins, 4E-BPs.
Rong, Liwei; Livingstone, Mark; Sukarieh, Rami; Petroulakis, Emmanuel; Gingras, Anne-Claude; Crosby, Katherine; Smith, Bradley; Polakiewicz, Roberto D; Pelletier, Jerry; Ferraiuolo, Maria A; Sonenberg, Nahum
2008-07-01
Eukaryotic initiation factor (eIF) 4E, the mRNA 5'-cap-binding protein, mediates the association of eIF4F with the mRNA 5'-cap structure to stimulate cap-dependent translation initiation in the cytoplasm. The assembly of eIF4E into the eIF4F complex is negatively regulated through a family of repressor proteins, called the eIF4E-binding proteins (4E-BPs). eIF4E is also present in the nucleus, where it is thought to stimulate nuclear-cytoplasmic transport of certain mRNAs. eIF4E is transported to the nucleus via its interaction with 4E-T (4E-transporter), but it is unclear how it is retained in the nucleus. Here we show that a sizable fraction (approximately 30%) of 4E-BP1 is localized to the nucleus, where it binds eIF4E. In mouse embryo fibroblasts (MEFs) subjected to serum starvation and/or rapamycin treatment, nuclear 4E-BPs sequester eIF4E in the nucleus. A dramatic loss of nuclear 4E-BP1 occurs in c-Ha-Ras-expressing MEFs, which fail to show starvation-induced nuclear accumulation of eIF4E. Therefore, 4E-BP1 is a regulator of eIF4E cellular localization.
Control of eIF4E cellular localization by eIF4E-binding proteins, 4E-BPs
Rong, Liwei; Livingstone, Mark; Sukarieh, Rami; Petroulakis, Emmanuel; Gingras, Anne-Claude; Crosby, Katherine; Smith, Bradley; Polakiewicz, Roberto D.; Pelletier, Jerry; Ferraiuolo, Maria A.; Sonenberg, Nahum
2008-01-01
Eukaryotic initiation factor (eIF) 4E, the mRNA 5′-cap-binding protein, mediates the association of eIF4F with the mRNA 5′-cap structure to stimulate cap-dependent translation initiation in the cytoplasm. The assembly of eIF4E into the eIF4F complex is negatively regulated through a family of repressor proteins, called the eIF4E-binding proteins (4E-BPs). eIF4E is also present in the nucleus, where it is thought to stimulate nuclear-cytoplasmic transport of certain mRNAs. eIF4E is transported to the nucleus via its interaction with 4E-T (4E-transporter), but it is unclear how it is retained in the nucleus. Here we show that a sizable fraction (∼30%) of 4E-BP1 is localized to the nucleus, where it binds eIF4E. In mouse embryo fibroblasts (MEFs) subjected to serum starvation and/or rapamycin treatment, nuclear 4E-BPs sequester eIF4E in the nucleus. A dramatic loss of nuclear 4E-BP1 occurs in c-Ha-Ras–expressing MEFs, which fail to show starvation-induced nuclear accumulation of eIF4E. Therefore, 4E-BP1 is a regulator of eIF4E cellular localization. PMID:18515545
FORMATION AND PERSISTANCE OF DNA ADDUCTS IN THE LIVER OF BROWN BULLHEADS EXPOSED TO BENZO(A)PYRENE
The formation and persistence of benzo[a]pyrene (BP)-DNA adducts in the liver of brown bullheads (Ictalurus nebulosus) treated with the hydrocarbon (20 mg/kg body wt, i.p.) was investigated using the 32P-postlabeling assay. he highest level of covalent binding of BP to liver DNA ...
Structural basis for genome wide recognition of 5-bp GC motifs by SMAD transcription factors.
Martin-Malpartida, Pau; Batet, Marta; Kaczmarska, Zuzanna; Freier, Regina; Gomes, Tiago; Aragón, Eric; Zou, Yilong; Wang, Qiong; Xi, Qiaoran; Ruiz, Lidia; Vea, Angela; Márquez, José A; Massagué, Joan; Macias, Maria J
2017-12-12
Smad transcription factors activated by TGF-β or by BMP receptors form trimeric complexes with Smad4 to target specific genes for cell fate regulation. The CAGAC motif has been considered as the main binding element for Smad2/3/4, whereas Smad1/5/8 have been thought to preferentially bind GC-rich elements. However, chromatin immunoprecipitation analysis in embryonic stem cells showed extensive binding of Smad2/3/4 to GC-rich cis-regulatory elements. Here, we present the structural basis for specific binding of Smad3 and Smad4 to GC-rich motifs in the goosecoid promoter, a nodal-regulated differentiation gene. The structures revealed a 5-bp consensus sequence GGC(GC)|(CG) as the binding site for both TGF-β and BMP-activated Smads and for Smad4. These 5GC motifs are highly represented as clusters in Smad-bound regions genome-wide. Our results provide a basis for understanding the functional adaptability of Smads in different cellular contexts, and their dependence on lineage-determining transcription factors to target specific genes in TGF-β and BMP pathways.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.
2013-01-01
Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800
Kuster, Diederik W D; Sequeira, Vasco; Najafi, Aref; Boontje, Nicky M; Wijnker, Paul J M; Witjas-Paalberends, E Rosalie; Marston, Steven B; Dos Remedios, Cristobal G; Carrier, Lucie; Demmers, Jeroen A A; Redwood, Charles; Sadayappan, Sakthivel; van der Velden, Jolanda
2013-02-15
Cardiac myosin-binding protein C (cMyBP-C) regulates cross-bridge cycling kinetics and, thereby, fine-tunes the rate of cardiac muscle contraction and relaxation. Its effects on cardiac kinetics are modified by phosphorylation. Three phosphorylation sites (Ser275, Ser284, and Ser304) have been identified in vivo, all located in the cardiac-specific M-domain of cMyBP-C. However, recent work has shown that up to 4 phosphate groups are present in human cMyBP-C. To identify and characterize additional phosphorylation sites in human cMyBP-C. Cardiac MyBP-C was semipurified from human heart tissue. Tandem mass spectrometry analysis identified a novel phosphorylation site on serine 133 in the proline-alanine-rich linker sequence between the C0 and C1 domains of cMyBP-C. Unlike the known sites, Ser133 was not a target of protein kinase A. In silico kinase prediction revealed glycogen synthase kinase 3β (GSK3β) as the most likely kinase to phosphorylate Ser133. In vitro incubation of the C0C2 fragment of cMyBP-C with GSK3β showed phosphorylation on Ser133. In addition, GSK3β phosphorylated Ser304, although the degree of phosphorylation was less compared with protein kinase A-induced phosphorylation at Ser304. GSK3β treatment of single membrane-permeabilized human cardiomyocytes significantly enhanced the maximal rate of tension redevelopment. GSK3β phosphorylates cMyBP-C on a novel site, which is positioned in the proline-alanine-rich region and increases kinetics of force development, suggesting a noncanonical role for GSK3β at the sarcomere level. Phosphorylation of Ser133 in the linker domain of cMyBP-C may be a novel mechanism to regulate sarcomere kinetics.
Ohashi, Jun; Naka, Izumi; Patarapotikul, Jintana; Hananantachai, Hathairad; Brittenham, Gary; Looareesuwan, Sornchai; Clark, Andrew G; Tokunaga, Katsushi
2005-01-01
A binding site for the repressor protein BP1, which contains a tandem (AT)x(T)y repeat, is located approximately 530 bp 5' to the human beta-globin gene (HBB). There is accumulating evidence that BP1 binds to the (AT)9(T)5 allele more strongly than to other alleles, thereby reducing the expression of HBB. In this study, we investigated polymorphisms in the (AT)x(T)y repeat in 57 individuals living in Thailand, including three homozygotes for the hemoglobin E variant (HbE; beta26Glu-->Lys), 22 heterozygotes, and 32 normal homozygotes. We found that (AT)9(T)5 and (AT)7(T)7 alleles were predominant in the studied population and that the HbE variant is in strong linkage disequilibrium with the (AT)9(T)5 allele, which can explain why the betaE chain is inefficiently synthesized compared to the normal betaA chain. Moreover, the mildness of the HbE disease compared to other hemoglobinopathies in Thai may be due, in part, to the presence of the (AT)9(T)5 repeat on the HbE chromosome. In addition, a novel (AC)n polymorphism adjacent to the (AT)x(T)y repeat (i.e., (AC)3(AT)7(T)5) was found through the variation screening in this study.
CacyBP/SIP as a regulator of transcriptional responses in brain cells
Kilanczyk, Ewa; Filipek, Anna; Hetman, Michal
2014-01-01
Summary The Calcyclin-Binding Protein/Siah-1-Interacting Protein (CacyBP/SIP) is highly expressed in the brain and was shown to regulate the β-catenin-driven transcription in thymocytes. Therefore, it was investigated whether in brain cells CacyBP/SIP might play a role as a transcriptional regulator. In BDNF- or forskolin-stimulated rat primary cortical neurons, overexpression of CacyBP/SIP enhanced transcriptional activity of the cAMP-response element (CRE). In addition, overexpressed CacyBP/SIP enhanced BDNF-mediated activation of the Nuclear Factor of Activated T-cells (NFAT) but not the Serum Response Element (SRE). These stimulatory effects required an intact C-terminal domain of CacyBP/SIP. Moreover, in C6 rat glioma cells, the overexpressed CacyBP/SIP enhanced activation of CRE- or NFAT- following forskolin- or serum stimulation, respectively. Conversely, knockdown of endogenous CacyBP/SIP reduced activation of CRE- and NFAT but not SRE. Taken together, these results indicate that CacyBP/SIP is a novel regulator of CRE- and NFAT-driven transcription. PMID:25163685
Dai, Faxiang; Xuan, Yi; Jin, Jie-Jie; Yu, Shengjia; Long, Zi-Wen; Cai, Hong; Liu, Xiao-Wen; Zhou, Ye; Wang, Ya-Nong; Chen, Zhong; Huang, Hua
2017-04-25
C-terminal binding protein-2 (CtBP2), a transcriptional corepressor, has been reported to correlate with tumorigenesis and progression and predict a poor prognosis in several human cancers. However, few studies on CtBP2 in gastric cancer (GC) have been performed. In this research, we evaluated the correlations between CtBP2 expression and the clinicopathological characteristics, as well as prognosis of GC patients. The effects of silencing CtBP2 expression on GC cells biology activity were also assessed. The results showed that CtBP2 was overexpressed in GC tissues and closely correlated with poor differentiation, advanced tumor stage and poor prognosis in GC patients. CtBP2 induced epithelial-to-mesenchymal transition (EMT) and repressed PTEN to increase proliferation rate, migration, and invasion in GC cells. Silencing CtBP2 inhibited GC growth in nude mice model. In conclusion, CtBP2 is overexpressed in GC and may accelerate GC tumorigenesis and metastasis, which could represent an independent prognostic marker and promising therapeutic target for GC.
Muntean, Brian S; Martemyanov, Kirill A
2016-03-25
Regulators of G protein Signaling (RGS) promote deactivation of heterotrimeric G proteins thus controlling the magnitude and kinetics of responses mediated by G protein-coupled receptors (GPCR). In the nervous system, RGS7 and RGS9-2 play essential role in vision, reward processing, and movement control. Both RGS7 and RGS9-2 belong to the R7 subfamily of RGS proteins that form macromolecular complexes with R7-binding protein (R7BP). R7BP targets RGS proteins to the plasma membrane and augments their GTPase-accelerating protein (GAP) activity, ultimately accelerating deactivation of G protein signaling. However, it remains unclear if R7BP serves exclusively as a membrane anchoring subunit or further modulates RGS proteins to increase their GAP activity. To directly answer this question, we utilized a rapidly reversible chemically induced protein dimerization system that enabled us to control RGS localization independent from R7BP in living cells. To monitor kinetics of Gα deactivation, we coupled this strategy with measuring changes in the GAP activity by bioluminescence resonance energy transfer-based assay in a cellular system containing μ-opioid receptor. This approach was used to correlate changes in RGS localization and activity in the presence or absence of R7BP. Strikingly, we observed that RGS activity is augmented by membrane recruitment, in an orientation independent manner with no additional contributions provided by R7BP. These findings argue that the association of R7 RGS proteins with the membrane environment provides a major direct contribution to modulation of their GAP activity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Wong, Dean F; Brasić, James R; Singer, Harvey S; Schretlen, David J; Kuwabara, Hiroto; Zhou, Yun; Nandi, Ayon; Maris, Marika A; Alexander, Mohab; Ye, Weiguo; Rousset, Olivier; Kumar, Anil; Szabo, Zsolt; Gjedde, Albert; Grace, Anthony A
2008-05-01
Tourette syndrome (TS) is a neuropsychiatric disorder with childhood onset characterized by motor and phonic tics. Obsessive-compulsive disorder (OCD) is often concomitant with TS. Dysfunctional tonic and phasic dopamine (DA) and serotonin (5-HT) metabolism may play a role in the pathophysiology of TS. We simultaneously measured the density, affinity, and brain distribution of dopamine D2 receptors (D2-R's), dopamine transporter binding potential (BP), and amphetamine-induced dopamine release (DA(rel)) in 14 adults with TS and 10 normal adult controls. We also measured the brain distribution and BP of serotonin 5-HT2A receptors (5-HT2AR), and serotonin transporter (SERT) BP, in 11 subjects with TS and 10 normal control subjects. As compared with controls, DA rel was significantly increased in the ventral striatum among subjects with TS. Adults with TS+OCD exhibited a significant D(2)-R increase in left ventral striatum. SERT BP in midbrain and caudate/putamen was significantly increased in adults with TS (TS+OCD and TS-OCD). In three subjects with TS+OCD, in whom D2-R, 5-HT2AR, and SERT were measured within a 12-month period, there was a weakly significant elevation of DA rel and 5-HT2A BP, when compared with TS-OCD subjects and normal controls. The current study confirms, with a larger sample size and higher resolution PET scanning, our earlier report that elevated DA rel is a primary defect in TS. The finding of decreased SERT BP, and the possible elevation in 5-HT2AR in individuals with TS who had increased DA rel, suggest a condition of increased phasic DA rel modulated by low 5-HT in concomitant OCD.
Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J
2016-01-04
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.
Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.
2015-01-01
The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315
ERIC Educational Resources Information Center
Sui, Li; Wang, Jing; Li, Bao-Ming
2008-01-01
Phosphatidylinositol 3-kinase (PI3K) and its downstream targets, including Akt (also known as protein kinase B, PKB), mammalian target of rapamycin (mTOR), the 70-kDa ribosomal S6 kinase (p70S6k), and the eukaryotic initiation factor 4E (eIF4E)-binding protein 1 (4E-BP1), may play important roles in long-term synaptic plasticity and memory in many…
Hymes, Jeffrey P; Johnson, Brant R; Barrangou, Rodolphe; Klaenhammer, Todd R
2016-05-01
Bacterial surface layers (S-layers) are crystalline arrays of self-assembling proteinaceous subunits called S-layer proteins (Slps) that comprise the outermost layer of the cell envelope. Many additional proteins that are associated with or embedded within the S-layer have been identified in Lactobacillus acidophilus NCFM, an S-layer-forming bacterium that is widely used in fermented dairy products and probiotic supplements. One putative S-layer-associated protein (SLAP), LBA0191, was predicted to mediate adhesion to fibronectin based on the in silico detection of a fibronectin-binding domain. Fibronectin is a major component of the extracellular matrix (ECM) of intestinal epithelial cells. Adhesion to intestinal epithelial cells is considered an important trait for probiotic microorganisms during transit and potential association with the intestinal mucosa. To investigate the functional role of LBA0191 (designated FbpB) in L. acidophilus NCFM, an fbpB-deficient strain was constructed. The L. acidophilus mutant with a deletion off bpB lost the ability to adhere to mucin and fibronectin in vitro Homologues off bpB were identified in five additional putative S-layer-forming species, but no homologues were detected in species outside theL. acidophilus homology group. Copyright © 2016 Hymes et al.
Engineering synthetic TAL effectors with orthogonal target sites
Garg, Abhishek; Lohmueller, Jason J.; Silver, Pamela A.; Armel, Thomas Z.
2012-01-01
The ability to engineer biological circuits that process and respond to complex cellular signals has the potential to impact many areas of biology and medicine. Transcriptional activator-like effectors (TALEs) have emerged as an attractive component for engineering these circuits, as TALEs can be designed de novo to target a given DNA sequence. Currently, however, the use of TALEs is limited by degeneracy in the site-specific manner by which they recognize DNA. Here, we propose an algorithm to computationally address this problem. We apply our algorithm to design 180 TALEs targeting 20 bp cognate binding sites that are at least 3 nt mismatches away from all 20 bp sequences in putative 2 kb human promoter regions. We generated eight of these synthetic TALE activators and showed that each is able to activate transcription from a targeted reporter. Importantly, we show that these proteins do not activate synthetic reporters containing mismatches similar to those present in the genome nor a set of endogenous genes predicted to be the most likely targets in vivo. Finally, we generated and characterized TALE repressors comprised of our orthogonal DNA binding domains and further combined them with shRNAs to accomplish near complete repression of target gene expression. PMID:22581776
Pathogenic Leptospira Species Acquire Factor H and Vitronectin via the Surface Protein LcpA
da Silva, Ludmila Bezerra; Miragaia, Lidia dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima
2014-01-01
Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn2+-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. PMID:25534939
Pathogenic Leptospira species acquire factor H and vitronectin via the surface protein LcpA.
da Silva, Ludmila Bezerra; Miragaia, Lidia Dos Santos; Breda, Leandro Carvalho Dantas; Abe, Cecilia Mari; Schmidt, Mariana Costa Braga; Moro, Ana Maria; Monaris, Denize; Conde, Jonas Nascimento; Józsi, Mihály; Isaac, Lourdes; Abreu, Patrícia Antônia Estima; Barbosa, Angela Silva
2015-03-01
Upon infection, pathogenic Leptospira species bind several complement regulators in order to overcome host innate immunity. We previously characterized a 20-kDa leptospiral surface protein which interacts with C4b binding protein (C4BP): leptospiral complement regulator-acquiring protein A (LcpA). Here we show that LcpA also interacts with human factor H (FH), which remains functionally active once bound to the protein. Antibodies directed against short consensus repeat 20 (SCR20) inhibited binding of FH to LcpA by approximately 90%, thus confirming that this particular domain is involved in the interaction. We have also shown for the first time that leptospires bind human vitronectin and that the interaction is mediated by LcpA. Coincubation with heparin blocked LcpA-vitronectin interaction in a dose-dependent manner, strongly suggesting that binding may occur through the heparin binding domains of vitronectin. LcpA also bound to the terminal pathway component C9 and inhibited Zn(2+)-induced polymerization and membrane attack complex (MAC) formation. Competitive binding assays indicated that LcpA interacts with C4BP, FH, and vitronectin through distinct sites. Taken together, our findings indicate that LcpA may play a role in leptospiral immune evasion. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Morris, Joanna S; Nixon, Colin; Bruck, Alicia; Nasir, Lubna; Morgan, Iain M; Philbey, Adrian W
2008-02-01
The immunohistochemical expression of topoisomerase IIbeta binding protein 1 (TopBP1) was examined in 123 feline mammary lesions (18 non-neoplastic lesions including six fibroadenomatous hyperplasia and 12 duct ectasia, 17 adenomas and 88 carcinomas) in relation to histological grade, oestrogen receptor alpha (ERalpha) status, proliferation index (Ki67) and p53 expression. There was positive staining for TopBP1 in 122 of 123 feline mammary lesions, although nine samples had fewer than 20% positive cells. The percentage of cells positive for TopBP1 increased with histological grade. Most staining was nuclear but both nuclear and cytoplasmic staining was observed as the degree of malignancy increased. TopBP1 is expressed in feline mammary tumours and its expression is correlated with histological grade. Many neoplasms which over-express p53 or are ERalpha negative show TopBP1 immunoreactivity.
Around and beyond 53BP1 Nuclear Bodies.
Fernandez-Vidal, Anne; Vignard, Julien; Mirey, Gladys
2017-12-05
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction.
Varrone, Andrea; Gulyás, Balázs; Takano, Akihiro; Stabin, Michael G; Jonsson, Cathrine; Halldin, Christer
2012-02-01
[(18)F]FE-PE2I is a promising dopamine transporter (DAT) radioligand. In nonhuman primates, we examined the accuracy of simplified quantification methods and the estimates of radiation dose of [(18)F]FE-PE2I. In the quantification study, binding potential (BP(ND)) values previously reported in three rhesus monkeys using kinetic and graphical analyses of [(18)F]FE-PE2I were used for comparison. BP(ND) using the cerebellum as reference region was obtained with four reference tissue methods applied to the [(18)F]FE-PE2I data that were compared with the kinetic and graphical analyses. In the whole-body study, estimates of adsorbed radiation were obtained in two cynomolgus monkeys. All reference tissue methods provided BP(ND) values within 5% of the values obtained with the kinetic and graphical analyses. The shortest imaging time for stable BP(ND) estimation was 54 min. The average effective dose of [(18)F]FE-PE2I was 0.021 mSv/MBq, similar to 2-deoxy-2-[(18)F]fluoro-d-glucose. The results in nonhuman primates suggest that [(18)F]FE-PE2I is suitable for accurate and stable DAT quantification, and its radiation dose estimates would allow for a maximal administered radioactivity of 476 MBq in human subjects. Copyright © 2012 Elsevier Inc. All rights reserved.
Investigation of the influence of sampling schemes on quantitative dynamic fluorescence imaging
Dai, Yunpeng; Chen, Xueli; Yin, Jipeng; Wang, Guodong; Wang, Bo; Zhan, Yonghua; Nie, Yongzhan; Wu, Kaichun; Liang, Jimin
2018-01-01
Dynamic optical data from a series of sampling intervals can be used for quantitative analysis to obtain meaningful kinetic parameters of probe in vivo. The sampling schemes may affect the quantification results of dynamic fluorescence imaging. Here, we investigate the influence of different sampling schemes on the quantification of binding potential (BP) with theoretically simulated and experimentally measured data. Three groups of sampling schemes are investigated including the sampling starting point, sampling sparsity, and sampling uniformity. In the investigation of the influence of the sampling starting point, we further summarize two cases by considering the missing timing sequence between the probe injection and sampling starting time. Results show that the mean value of BP exhibits an obvious growth trend with an increase in the delay of the sampling starting point, and has a strong correlation with the sampling sparsity. The growth trend is much more obvious if throwing the missing timing sequence. The standard deviation of BP is inversely related to the sampling sparsity, and independent of the sampling uniformity and the delay of sampling starting time. Moreover, the mean value of BP obtained by uniform sampling is significantly higher than that by using the non-uniform sampling. Our results collectively suggest that a suitable sampling scheme can help compartmental modeling of dynamic fluorescence imaging provide more accurate results and simpler operations. PMID:29675325
Reconstitution of RPA-covered single-stranded DNA-activated ATR-Chk1 signaling.
Choi, Jun-Hyuk; Lindsey-Boltz, Laura A; Kemp, Michael; Mason, Aaron C; Wold, Marc S; Sancar, Aziz
2010-08-03
ATR kinase is a critical upstream regulator of the checkpoint response to various forms of DNA damage. Previous studies have shown that ATR is recruited via its binding partner ATR-interacting protein (ATRIP) to replication protein A (RPA)-covered single-stranded DNA (RPA-ssDNA) generated at sites of DNA damage where ATR is then activated by TopBP1 to phosphorylate downstream targets including the Chk1 signal transducing kinase. However, this critical feature of the human ATR-initiated DNA damage checkpoint signaling has not been demonstrated in a defined system. Here we describe an in vitro checkpoint system in which RPA-ssDNA and TopBP1 are essential for phosphorylation of Chk1 by the purified ATR-ATRIP complex. Checkpoint defective RPA mutants fail to activate ATR kinase in this system, supporting the conclusion that this system is a faithful representation of the in vivo reaction. Interestingly, we find that an alternative form of RPA (aRPA), which does not support DNA replication, can substitute for the checkpoint function of RPA in vitro, thus revealing a potential role for aRPA in the activation of ATR kinase. We also find that TopBP1 is recruited to RPA-ssDNA in a manner dependent on ATRIP and that the N terminus of TopBP1 is required for efficient recruitment and activation of ATR kinase.
Krapp, Susanna; Greiner, Eva; Amin, Bushra; Sonnewald, Uwe; Krenz, Björn
2017-01-02
Stress granules (SGs) are structures within cells that regulate gene expression during stress response, e.g. viral infection. In mammalian cells assembly of SGs is dependent on the Ras-GAP SH3-domain-binding protein (G3BP). The C-terminal domain of the viral nonstructural protein 3 (nsP3) of Semliki Forest virus (SFV) forms a complex with mammalian G3BP and sequesters it into viral RNA replication complexes in a manner that inhibits the formation of SGs. The binding domain of nsP3 to HsG3BP was mapped to two tandem 'FGDF' repeat motifs close to the C-terminus of the viral proteins. It was speculated that plant viruses employ a similar strategy to inhibit SG function. This study identifies an Arabidopsis thaliana NTF2-RRM domain-containing protein as a G3BP-like protein (AtG3BP), which localizes to plant SGs. Moreover, the nuclear shuttle protein (NSP) of the begomovirus abutilon mosaic virus (AbMV), which harbors a 'FVSF'-motif at its C-terminal end, interacts with the AtG3BP-like protein, as does the 'FNGSF'-motif containing NSP of pea necrotic yellow dwarf virus (PNYDV), a member of the Nanoviridae family. We therefore propose that SG formation upon stress is conserved between mammalian and plant cells and that plant viruses may follow a similar strategy to inhibit plant SG function as it has been shown for their mammalian counterparts. Copyright © 2016 Elsevier B.V. All rights reserved.
Smaldone, Giovanni; Berisio, Rita; Balasco, Nicole; D'Auria, Sabato; Vitagliano, Luigi; Ruggiero, Alessia
2018-05-31
Thermotoga maritima Arginine Binding Protein (TmArgBP) is a valuable candidate for arginine biosensing in diagnostics. This protein is endowed with unusual structural properties that include an extraordinary thermal/chemical stability, a domain swapped structure that undergoes large tertiary and quaternary structural transition, and the ability to form non-canonical oligomeric species. As the intrinsic stability of TmArgBP allows for extensive protein manipulations, we here dissected its structure in two parts: its main body deprived of the swapping fragment (TmArgBP 20-233 ) and the C-terminal peptide corresponding to the helical swapping element. Both elements have been characterized independently or in combination using a repertoire of biophysical/structural techniques. Present investigations clearly indicate that TmArgBP 20-233 represents a better scaffold for arginine sensing compared to the wild-type protein. Moreover, our data demonstrate that the ligand-free and the ligand-bound forms respond very differently to this helix deletion. This drastic perturbation has an important impact on the ligand-bound form of TmArgBP 20-233 stability whereas it barely affects its ligand-free state. The crystallographic structures of these forms provide a rationale to this puzzling observation. Indeed, the arginine-bound state is very rigid and virtually unchanged upon protein truncation. On the other hand, the flexible ligand-free TmArgBP 20-233 is able to adopt a novel state as a consequence of the helix deletion. Therefore, the flexibility of the ligand-free form endows this state with a remarkable robustness upon severe perturbations. In this scenario, TmArgBP dissection highlights an intriguing connection between destabilizing/stabilizing effects and the overall flexibility that could operate also in other proteins. Copyright © 2018 Elsevier B.V. All rights reserved.
Harms, Robert Z.; Creer, Austin J.; Lorenzo-Arteaga, Kristina M.; Ostlund, Katie R.; Sarvetnick, Nora E.
2017-01-01
The cytokine interleukin (IL)-18 is a crucial amplifier of natural killer (NK) cell function. IL-18 signaling is regulated by the inhibitory effects of IL-18 binding protein (IL-18BP). Using mice deficient in IL-18BP (IL-18BPKO), we investigated the impact of mismanaged IL-18 signaling on NK cells. We found an overall reduced abundance of splenic NK cells in the absence of IL-18BP. Closer examination of NK cell subsets in spleen and bone marrow using CD27 and CD11b expression revealed that immature NK cells were increased in abundance, while the mature population of NK cells was reduced. Also, NK cells were polarized to greater production of TNF-α, while dedicated IFN-γ producers were reduced. A novel subset of IL-18 receptor α− NK cells contributed to the expansion of immature NK cells in IL-18BPKO mice. Splenocytes cultured with IL-18 resulted in alterations similar to those observed in IL-18BP deficiency. NK cell changes were associated with significantly reduced levels of circulating plasma IL-18. However, IL-18BPKO mice exhibited normal weight gain and responded to LPS challenge with a >10-fold increase in IFN-γ compared to wild type. Finally, we identified that the source of splenic IL-18BP was among dendritic cells/macrophage localized to the T cell-rich regions of the spleen. Our results demonstrate that IL-18BP is required for normal NK cell abundance and function and also contributes to maintaining steady-state levels of circulating IL-18. Thus, IL-18BP appears to have functions suggestive of a carrier protein, not just an inhibitor. PMID:28900426
Myosin binding protein-C activates thin filaments and inhibits thick filaments in heart muscle cells
Kampourakis, Thomas; Yan, Ziqian; Gautel, Mathias; Sun, Yin-Biao; Irving, Malcolm
2014-01-01
Myosin binding protein-C (MyBP-C) is a key regulatory protein in heart muscle, and mutations in the MYBPC3 gene are frequently associated with cardiomyopathy. However, the mechanism of action of MyBP-C remains poorly understood, and both activating and inhibitory effects of MyBP-C on contractility have been reported. To clarify the function of the regulatory N-terminal domains of MyBP-C, we determined their effects on the structure of thick (myosin-containing) and thin (actin-containing) filaments in intact sarcomeres of heart muscle. We used fluorescent probes on troponin C in the thin filaments and on myosin regulatory light chain in the thick filaments to monitor structural changes associated with activation of demembranated trabeculae from rat ventricle by the C1mC2 region of rat MyBP-C. C1mC2 induced larger structural changes in thin filaments than calcium activation, and these were still present when active force was blocked with blebbistatin, showing that C1mC2 directly activates the thin filaments. In contrast, structural changes in thick filaments induced by C1mC2 were smaller than those associated with calcium activation and were abolished or reversed by blebbistatin. Low concentrations of C1mC2 did not affect resting force but increased calcium sensitivity and reduced cooperativity of force and structural changes in both thin and thick filaments. These results show that the N-terminal region of MyBP-C stabilizes the ON state of thin filaments and the OFF state of thick filaments and lead to a novel hypothesis for the physiological role of MyBP-C in the regulation of cardiac contractility. PMID:25512492
Kampourakis, Thomas; Yan, Ziqian; Gautel, Mathias; Sun, Yin-Biao; Irving, Malcolm
2014-12-30
Myosin binding protein-C (MyBP-C) is a key regulatory protein in heart muscle, and mutations in the MYBPC3 gene are frequently associated with cardiomyopathy. However, the mechanism of action of MyBP-C remains poorly understood, and both activating and inhibitory effects of MyBP-C on contractility have been reported. To clarify the function of the regulatory N-terminal domains of MyBP-C, we determined their effects on the structure of thick (myosin-containing) and thin (actin-containing) filaments in intact sarcomeres of heart muscle. We used fluorescent probes on troponin C in the thin filaments and on myosin regulatory light chain in the thick filaments to monitor structural changes associated with activation of demembranated trabeculae from rat ventricle by the C1mC2 region of rat MyBP-C. C1mC2 induced larger structural changes in thin filaments than calcium activation, and these were still present when active force was blocked with blebbistatin, showing that C1mC2 directly activates the thin filaments. In contrast, structural changes in thick filaments induced by C1mC2 were smaller than those associated with calcium activation and were abolished or reversed by blebbistatin. Low concentrations of C1mC2 did not affect resting force but increased calcium sensitivity and reduced cooperativity of force and structural changes in both thin and thick filaments. These results show that the N-terminal region of MyBP-C stabilizes the ON state of thin filaments and the OFF state of thick filaments and lead to a novel hypothesis for the physiological role of MyBP-C in the regulation of cardiac contractility.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less
Persistent cognitive and dopamine transporter deficits in abstinent methamphetamine users.
McCann, Una D; Kuwabara, Hiroto; Kumar, Anil; Palermo, Michael; Abbey, Rubyna; Brasic, James; Ye, Weiguo; Alexander, Mohab; Dannals, Robert F; Wong, Dean F; Ricaurte, George A
2008-02-01
Studies in abstinent methamphetamine (METH) users have demonstrated reductions in brain dopamine transporter (DAT) binding potential (BP), as well as cognitive and motor deficits, but it is not yet clear whether cognitive deficits and brain DAT reductions fully reverse with sustained abstinence, or whether behavioral deficits in METH users are related to dopamine (DA) deficits. This study was conducted to further investigate potential persistent psychomotor deficits secondary to METH abuse, and their relationship to brain DAT availability, as measured using quantitative PET methods with [(11)C]WIN 35428. Twenty-two abstinent METH users and 17 healthy non-METH using controls underwent psychometric testing to test the hypothesis that METH users would demonstrate selective deficits in neuropsychiatric domains known to involve DA neurons (e.g., working memory, executive function, motor function). A subset of subjects also underwent PET scanning with [(11)C]WIN 35428. METH users were found to have modest deficits in short-term memory, executive function, and manual dexterity. Exploratory correlational analyses revealed that deficits in memory, but not those in executive or motor function, were associated with decreases in striatal DAT BP. These results suggest a possible relationship between DAT BP and memory deficits in abstinent METH users, and lend support to the notion that METH produces lasting effects on central DA neurons in humans. As METH can also produce toxic effects on serotonin (5-HT) neurons, further study is needed to address the potential role of brain 5-HT depletion in cognitive deficits in abstinent METH users. (c) 2007 Wiley-Liss, Inc.
Characterisation of single domain ATP-binding cassette protien homologues of Theileria parva.
Kibe, M K; Macklin, M; Gobright, E; Bishop, R; Urakawa, T; ole-MoiYoi, O K
2001-09-01
Two distinct genes encoding single domain, ATP-binding cassette transport protein homologues of Theileria parva were cloned and sequenced. Neither of the genes is tandemly duplicated. One gene, TpABC1, encodes a predicted protein of 593 amino acids with an N-terminal hydrophobic domain containing six potential membrane-spanning segments. A single discontinuous ATP-binding element was located in the C-terminal region of TpABC1. The second gene, TpABC2, also contains a single C-terminal ATP-binding motif. Copies of TpABC2 were present at four loci in the T. parva genome on three different chromosomes. TpABC1 exhibited allelic polymorphism between stocks of the parasite. Comparison of cDNA and genomic sequences revealed that TpABC1 contained seven short introns, between 29 and 84 bp in length. The full-length TpABC1 protein was expressed in insect cells using the baculovirus system. Application of antibodies raised against the recombinant antigen to western blots of T. parva piroplasm lysates detected an 85 kDa protein in this life-cycle stage.
Prasath, Thiruketheeswaran; Greven, Hartmut; D'Haese, Jochen
2012-06-01
Many tardigrade species resist harsh environmental conditions by entering anhydrobiosis or cryobiosis. Desiccation as well as freeze resistance probably leads to changes of the ionic balance that includes the intracellular calcium concentration. In order to search for protein modifications affecting the calcium homoeostasis, we studied the regulatory system controlling actin-myosin interaction of the eutardigrade Hypsibius klebelsbergi and identified full-length cDNA clones for troponin C (TnC, 824 bp), calmodulin (CaM, 1,407 bp), essential myosin light chain (eMLC, 1,015 bp), and regulatory myosin light chain (rMLC, 984 bp) from a cDNA library. All four proteins belong to the EF-hand superfamily typified by a calcium coordinating helix-loop-helix motif. Further, we cloned and obtained recombinant TnC and both MLCs. CaM and TnC revealed four and two potential calcium-binding domains, respectively. Gel mobility shift assays demonstrated calcium-induced conformational transition of TnC. From both MLCs, only the rMLC showed one potential N-terminal EF-hand domain. Additionally, sequence properties suggest phosphorylation of this myosin light chain. Based on our results, we suggest a dual-regulated system at least in somatic muscles for tardigrades with a calcium-dependent tropomyosin-troponin complex bound to the actin filaments and a phosphorylation of the rMLC turning on and off both actin and myosin. Our results indicate no special modifications of the molecular structure and function of the EF-hand proteins in tardigrades. Phylogenetic trees of 131 TnCs, 96 rMLCs, and 62 eMLCs indicate affinities to Ecdysozoa, but also to some other taxa suggesting that our results reflect the complex evolution of these proteins rather than phylogenetic relationships. © 2012 WILEY PERIODICALS, INC.
IL-27 Regulates IL-18 binding protein in skin resident cells.
Wittmann, Miriam; Doble, Rosella; Bachmann, Malte; Pfeilschifter, Josef; Werfel, Thomas; Mühl, Heiko
2012-01-01
IL-18 is an important mediator involved in chronic inflammatory conditions such as cutaneous lupus erythematosus, psoriasis and chronic eczema. An imbalance between IL-18 and its endogenous antagonist IL-18 binding protein (BP) may account for increased IL-18 activity. IL-27 is a cytokine with dual function displaying pro- and anti-inflammatory properties. Here we provide evidence for a yet not described anti-inflammatory mode of action on skin resident cells. Human keratinocytes and surprisingly also fibroblasts (which do not produce any IL-18) show a robust, dose-dependent and highly inducible mRNA expression and secretion of IL-18BP upon IL-27 stimulation. Other IL-12 family members failed to induce IL-18BP. The production of IL-18BP peaked between 48-72 h after stimulation and was sustained for up to 96 h. Investigation of the signalling pathway showed that IL-27 activates STAT1 in human keratinocytes and that a proximal GAS site at the IL-18BP promoter is of importance for the functional activity of IL-27. The data are in support of a significant anti-inflammatory effect of IL-27 on skin resident cells. An important novel property of IL-27 in skin pathobiology may be to counter-regulate IL-18 activities by acting on keratinocytes and importantly also on dermal fibroblasts.
NASA Astrophysics Data System (ADS)
Soret, Marine; Alaoui, Jawad; Koulibaly, Pierre M.; Darcourt, Jacques; Buvat, Irène
2007-02-01
ObjectivesPartial volume effect (PVE) is a major source of bias in brain SPECT imaging of dopamine transporter. Various PVE corrections (PVC) making use of anatomical data have been developed and yield encouraging results. However, their accuracy in clinical data is difficult to demonstrate because the gold standard (GS) is usually unknown. The objective of this study was to assess the accuracy of PVC. MethodTwenty-three patients underwent MRI and 123I-FP-CIT SPECT. The binding potential (BP) values were measured in the striata segmented on the MR images after coregistration to SPECT images. These values were calculated without and with an original PVC. In addition, for each patient, a Monte Carlo simulation of the SPECT scan was performed. For these simulations where true simulated BP values were known, percent biases in BP estimates were calculated. For the real data, an evaluation method that simultaneously estimates the GS and a quadratic relationship between the observed and the GS values was used. It yields a surrogate mean square error (sMSE) between the estimated values and the estimated GS values. ResultsThe averaged percent difference between BP measured for real and for simulated patients was 0.7±9.7% without PVC and was -8.5±14.5% with PVC, suggesting that the simulated data reproduced the real data well enough. For the simulated patients, BP was underestimated by 66.6±9.3% on average without PVC and overestimated by 11.3±9.5% with PVC, demonstrating the greatest accuracy of BP estimates with PVC. For the simulated data, sMSE were 27.3 without PVC and 0.90 with PVC, confirming that our sMSE index properly captured the greatest accuracy of BP estimates with PVC. For the real patient data, sMSE was 50.8 without PVC and 3.5 with PVC. These results were consistent with those obtained on the simulated data, suggesting that for clinical data, and despite probable segmentation and registration errors, BP were more accurately estimated with PVC than without. ConclusionPVC was very efficient to greatly reduce the error in BP estimates in clinical imaging of dopamine transporter.
Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S
1997-01-01
The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477
Liu, Yi-Chen; Li, Fu-Hua; Dong, Bo; Wang, Bing; Luan, Wei; Zhang, Xiao-Jun; Zhang, Liu-Suo; Xiang, Jian-Hai
2007-01-01
Lectin is regarded as a potential molecule involved in immune recognition and phagocytosis through opsonization in crustacean. Knowledge on lectin at molecular level would help us to understand its regulation mechanism in crustacean immune system. A novel C-type lectin gene (Fclectin) was cloned from hemocytes of Chinese shrimp Fenneropenaeus chinensis by 3' and 5' rapid amplification of cDNA ends (RACE) PCR. The full-length cDNA consists of 1482 bp with an 861 bp open reading frame, encoding 287 amino acids. The deduced amino acid sequence contains a putative signal peptide of 19 amino acids. It also contains two carbohydrate recognition domains/C-type lectin-like domains (CRD1 and CRD2), which share 78% identity with each other. CRD1 and CRD2 showed 34% and 30% identity with that of mannose-binding lectin from Japanese lamprey (Lethenteron japonicum), respectively. Both CRD1 and CRD2 of Fclectin have 11 amino acids residues, which are relatively invariant in animals' C-type lectin CRDs. Five residues at Ca2+ binding site 1 are conserved in Fclectin. The potential Ca2+/carbohydrate-binding (site 2) motif QPD, E, NP (Gln-Pro-Asp, Glu, Asn-Pro) presented in the two CRDs of Fclectin may support its ability to bind galactose-type sugars. It could be deduced that Fclectin is a member of C-type lectin superfamily. Transcripts of Fclectin were found only in hemocytes by Northern blotting and RNA in situ hybridization. The variation of mRNA transcription level in hemocytes during artificial infection with bacteria and white spot syndrome virus (WSSV) was quantitated by capillary electrophoresis after RT-PCR. An exploration of mRNA expression variation after LPS stimulation was carried out in primarily cultured hemocytes in vitro. Expression profiles of Fclectin gene were greatly modified after bacteria, LPS or WSSV challenge. The above-stated data can provide us clues to understand the probable role of C-type lectin in innate immunity of shrimp and would be helpful to shrimp disease control.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Velásquez, Celestino; Cheng, Erdong; Shuda, Masahiro
mTOR-directed 4E-BP1 phosphorylation promotes cap-dependent translation and tumorigen-esis. During mitosis, CDK1 substitutes for mTOR and fully phosphorylates 4E-BP1 at canoni-cal as well a non-canonical S83 site resulting in a mitosis-specific hyperphosphorylated δ isoform. Colocalization studies with a phospho-S83 specific antibody indicate that 4E-BP1 S83 phosphorylation accumulates at centrosomes during prophase, peaks at metaphase, and decreases through telophase. While S83 phosphorylation of 4E-BP1 does not affect in vitro cap-dependent translation, nor eIF4G/4E-BP1 cap-binding, expression of an alanine substitution mutant 4E-BP1.S83A partially reverses rodent cell transformation induced by Merkel cell polyomavirus (MCV) small T (sT) antigen viral oncoprotein. In contrast to inhibitorymore » mTOR 4E-BP1 phosphorylation, these findings suggest that mitotic CDK1-directed phosphorylation of δ-4E-BP1 may yield a gain-of-function, distinct from translation regulation, that may be important in tumorigenesis and mitotic centrosome function.« less
2013-01-01
Background Rubinstein-Taybi syndrome (RTS) is a rare autosomal dominant disorder (prevalence 1:125,000) characterised by broad thumbs and halluces, facial dysmorphism, psychomotor development delay, skeletal defects, abnormalities in the posterior fossa and short stature. The known genetic causes are point mutations or deletions of the cAMP-response element binding protein-BP (CREBBP) (50-60% of the cases) and of the homologous gene E1A-binding protein (EP300) (5%). Case presentation We describe, for the first time in literature, a RTS Caucasian girl, 14-year-old, with growth hormone (GH) deficiency, pituitary hypoplasia, Arnold Chiari malformation type 1, double syringomyelic cavity and a novel CREBBP mutation (c.3546insCC). Conclusion We hypothesize that CREBBP mutation we have identified in this patient could be responsible also for RTS atypical features as GH deficiency and pituitary hypoplasia. PMID:23432975
McCready, Jessica; Wong, Daniel S; Burlison, Joseph A; Ying, Weiwen; Jay, Daniel G
2014-04-30
Extracellular Hsp90 (eHsp90) activates a number of client proteins outside of cancer cells required for migration and invasion. Therefore, eHsp90 may serve as a novel target for anti-metastatic drugs as its inhibition using impermeant Hsp90 inhibitors would not affect the numerous vital intracellular Hsp90 functions in normal cells. While some eHsp90 clients are known, it is important to establish other proteins that act outside the cell to validate eHsp90 as a drug target to limit cancer spread. Using mass spectrometry we identified two precursor proteins Galectin 3 binding protein (G3BP) and Lysyl oxidase 2-like protein (LOXL2) that associate with eHsp90 in MDA-MB231 breast cancer cell conditioned media and confirmed that LOXL2 binds to eHsp90 in immunoprecipitates. We introduce a novel impermeant Hsp90 inhibitor STA-12-7191 derived from ganetespib and show that it is markedly less toxic to cells and can inhibit cancer cell migration in a dose dependent manner. We used STA-12-7191 to test if LOXL2 and G3BP are potential eHsp90 clients. We showed that while LOXL2 can increase wound healing and compensate for STA-12-7191-mediated inhibition of wound closure, addition of G3BP had no affect on this assay. These findings support of role for LOXL2 in eHsp90 stimulated cancer cell migration and provide preliminary evidence for the use of STA-12-7191 to inhibit eHsp90 to limit cancer invasion.
McCready, Jessica; Wong, Daniel S.; Burlison, Joseph A.; Ying, Weiwen; Jay, Daniel G.
2014-01-01
Extracellular Hsp90 (eHsp90) activates a number of client proteins outside of cancer cells required for migration and invasion. Therefore, eHsp90 may serve as a novel target for anti-metastatic drugs as its inhibition using impermeant Hsp90 inhibitors would not affect the numerous vital intracellular Hsp90 functions in normal cells. While some eHsp90 clients are known, it is important to establish other proteins that act outside the cell to validate eHsp90 as a drug target to limit cancer spread. Using mass spectrometry we identified two precursor proteins Galectin 3 binding protein (G3BP) and Lysyl oxidase 2-like protein (LOXL2) that associate with eHsp90 in MDA-MB231 breast cancer cell conditioned media and confirmed that LOXL2 binds to eHsp90 in immunoprecipitates. We introduce a novel impermeant Hsp90 inhibitor STA-12-7191 derived from ganetespib and show that it is markedly less toxic to cells and can inhibit cancer cell migration in a dose dependent manner. We used STA-12-7191 to test if LOXL2 and G3BP are potential eHsp90 clients. We showed that while LOXL2 can increase wound healing and compensate for STA-12-7191-mediated inhibition of wound closure, addition of G3BP had no affect on this assay. These findings support of role for LOXL2 in eHsp90 stimulated cancer cell migration and provide preliminary evidence for the use of STA-12-7191 to inhibit eHsp90 to limit cancer invasion. PMID:24785146
Murrough, James W; Czermak, Christoph; Henry, Shannan; Nabulsi, Nabeel; Gallezot, Jean-Dominique; Gueorguieva, Ralitza; Planeta-Wilson, Beata; Krystal, John H; Neumaier, John F; Huang, Yiyun; Ding, Yu-Shin; Carson, Richard E; Neumeister, Alexander
2011-09-01
Serotonergic dysfunction is implicated in the pathogenesis of posttraumatic stress disorder (PTSD), and recent animal models suggest that disturbances in serotonin type 1B receptor function, in particular, may contribute to chronic anxiety. However, the specific role of the serotonin type 1B receptor has not been studied in patients with PTSD. To investigate in vivo serotonin type 1B receptor expression in individuals with PTSD, trauma-exposed control participants without PTSD (TC), and healthy (non-trauma-exposed) control participants (HC) using positron emission tomography and the recently developed serotonin type 1B receptor selective radiotracer [(11)C]P943. Cross-sectional positron emission tomography study under resting conditions. Academic and Veterans Affairs medical centers. Ninety-six individuals in 3 study groups: PTSD (n = 49), TC (n = 20), and HC (n = 27). Main Outcome Measure Regional [(11)C]P943 binding potential (BP(ND)) values in an a priori-defined limbic corticostriatal circuit investigated using multivariate analysis of variance and multiple regression analysis. A history of severe trauma exposure in the PTSD and TC groups was associated with marked reductions in [(11)C]P943 BP(ND) in the caudate, the amygdala, and the anterior cingulate cortex. Participant age at first trauma exposure was strongly associated with low [(11)C]P943 BP(ND). Developmentally earlier trauma exposure also was associated with greater PTSD symptom severity and major depression comorbidity. These data suggest an enduring effect of trauma history on brain function and the phenotype of PTSD. The association of early age at first trauma and more pronounced neurobiological and behavioral alterations in PTSD suggests a developmental component in the cause of PTSD.
Syal, Poonam; Verma, Ved Vrat; Gupta, Rani
2017-11-01
Biodiesel, an environment friendly alternative for fuels, contains methyl esters of long-chain fatty acids. Our group has reported a methanol-stable YLIP9 from Yarrowia lipolytica MSR80 that shows poor catalysis of long-chain fatty acids. To shift its substrate specificity, residues within lid and binding pocket were identified for sequential mutations using YLIP2 as the template. Of the two point mutations (Glu116Leu and Ser119Val) introduced in the lid, the former mutation (YLIP9L1) increased the catalytic rate by ∼2-fold without any change in substrate specificity. In this mutant, six binding pocket residues (Bp2-Bp7) were further mutated to obtain six double mutants. YLIP9L1Bp3 showed significant shift in substrate specificity towards long-chain pNPesters with 11-fold increase in catalytic efficiency than YLIP9. Double mutations also led to increased thermostability and lowered activation energy of YLIP9L1Bp3 thereby shifting its optimum temperature from 60°C to 50°C. In silico molecular dynamics simulations revealed improved lid flexibility and increased catalytic triad volume in YLIP9L1Bp3. The enzyme YLIP9L1Bp3 was methanol-stable having selectivity for long-chain fatty acids with improved catalytic efficiency. Its application as a biodiesel enzyme was validated by transesterification of palm oil in presence of methanol, where it showed 8-fold increase in conversion of oil to methyl esters. Copyright © 2017 Elsevier B.V. All rights reserved.
Lee, M H; Hazard, S; Carpten, J D; Yi, S; Cohen, J; Gerhardt, G T; Salen, G; Patel, S B
2001-02-01
Cerebrotendinous xanthomatosis (CTX) is a rare autosomal recessive disorder of bile acid biosynthesis. Clinically, CTX patients present with tendon xanthomas, juvenile cataracts, and progressive neurological dysfunction and can be diagnosed by the detection of elevated plasma cholestanol levels. CTX is caused by mutations affecting the sterol 27-hydroxylase gene (CYP27 ). CTX has been identified in a number of populations, but seems to have a higher prevalence in the Japanese, Sephardic Jewish, and Italian populations. We have assembled 12 previously unreported pedigrees from the United States. The CYP27 locus had been previously mapped to chromosome 2q33-qter. We performed linkage analyses and found no evidence of genetic heterogeneity. All CTX patients showed segregation with the CYP27 locus, and haplotype analysis and recombinant events allowed us to precisely map CYP27 to chromosome 2q35, between markers D2S1371 and D2S424. Twenty-three mutations were identified from 13 probands analyzed thus far; 11 were compound heterozygotes and 2 had homozygous mutations. Of these, five are novel mutations [Trp100Stop, Pro408Ser, Gln428Stop, a 10-base pair (bp) deletion in exon 1, and a 2-bp deletion in exon 6 of the CYP27 gene]. Three-dimensional structural modeling of sterol 27-hydroxylase showed that, while the majority of the missense mutations disrupt the heme-binding and adrenodoxin-binding domains critical for enzyme activity, two missense mutations (Arg94Trp/Gln and Lys226Arg) are clearly located outside these sites and may identify a potential substrate-binding or other protein contact site.
Umemura, Takeji; Joshita, Satoru; Sekiguchi, Tomohiro; Usami, Yoko; Shibata, Soichiro; Kimura, Takefumi; Komatsu, Michiharu; Matsumoto, Akihiro; Ota, Masao; Tanaka, Eiji
2015-06-01
Noninvasive markers of liver fibrosis in patients with primary biliary cirrhosis (PBC) are needed for predicting disease progression. As the Wisteria floribunda agglutinin-positive Mac-2-binding protein (WFA(+)-M2BP) was recently established as a liver fibrosis glycobiomarker in chronic hepatitis C, we assessed its efficacy in evaluating liver fibrosis stage and disease progression in PBC. A total of 137 patients with PBC who underwent liver biopsy and serological tests for WFA(+)-M2BP were enrolled. All patients were treated with ursodeoxycholic acid. Clinical data were compared with those for other noninvasive markers (aspartate aminotransferase-to-platelet ratio, FIB-4 index, aspartate aminotransferase/alanine aminotransferase ratio, Forn's index, and Mayo score) for estimating liver fibrosis using receiver operating characteristic analysis. The association between WFA(+)-M2BP and clinical outcome (liver decompensation, liver transplantation, or death) was evaluated using the Cox proportional hazards model with stepwise method. WFA(+)-M2BP was independently associated with liver fibrosis stage as determined by liver biopsy. The cutoff values of WFA(+)-M2BP for fibrosis stages ≥F1, ≥F2, ≥F3, and F4 were 0.7, 1.0, 1.4, and 2.0, respectively. The area under the receiver operating characteristic curve values for significant fibrosis, severe fibrosis, and cirrhosis were 0.979, 0.933, and 0.965, respectively. WFA(+)-M2BP was significantly superior to the other indices for the determination of significant and severe fibrosis stages. Furthermore, the WFA(+)-M2BP level at enrollment was strongly and independently associated with clinical outcome (hazard ratio 18.59, P=0.021). Baseline measurements of WFA(+)-M2BP represent a simple and reliable noninvasive surrogate marker of liver fibrosis and prognosis in patients with PBC.
The corepressor CtBP interacts with Evi-1 to repress transforming growth factor beta signaling.
Izutsu, K; Kurokawa, M; Imai, Y; Maki, K; Mitani, K; Hirai, H
2001-05-01
Evi-1 is a zinc finger nuclear protein whose inappropriate expression leads to leukemic transformation of hematopoietic cells in mice and humans. This was previously shown to block the antiproliferative effect of transforming growth factor beta (TGF-beta). Evi-1 represses TGF-beta signaling by direct interaction with Smad3 through its first zinc finger motif. Here, it is demonstrated that Evi-1 represses Smad-induced transcription by recruiting C-terminal binding protein (CtBP) as a corepressor. Evi-1 associates with CtBP1 through one of the consensus binding motifs, and this association is required for efficient inhibition of TGF-beta signaling. A specific inhibitor for histone deacetylase (HDAc) alleviates Evi-1-mediated repression of TGF-beta signaling, suggesting that HDAc is involved in the transcriptional repression by Evi-1. This identifies a novel function of Evi-1 as a member of corepressor complexes and suggests that aberrant recruitment of corepressors is one of the mechanisms for Evi-1-induced leukemogenesis.
NASA Technical Reports Server (NTRS)
Yang, Tianbao; Poovaiah, B. W.
2002-01-01
We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.
TopBP1 deficiency impairs V(D)J recombination during lymphocyte development
Kim, Jieun; Kyu Lee, Sung; Jeon, Yoon; Kim, Yehyun; Lee, Changjin; Ho Jeon, Sung; Shim, Jaegal; Kim, In-Hoo; Hong, Seokmann; Kim, Nayoung; Lee, Ho; Seong, Rho Hyun
2014-01-01
TopBP1 was initially identified as a topoisomerase II-β-binding protein and it plays roles in DNA replication and repair. We found that TopBP1 is expressed at high levels in lymphoid tissues and is essential for early lymphocyte development. Specific abrogation of TopBP1 expression resulted in transitional blocks during early lymphocyte development. These defects were, in major part, due to aberrant V(D)J rearrangements in pro-B cells, double-negative and double-positive thymocytes. We also show that TopBP1 was located at sites of V(D)J rearrangement. In TopBP1-deficient cells, γ-H2AX foci were found to be increased. In addition, greater amount of γ-H2AX product was precipitated from the regions where TopBP1 was localized than from controls, indicating that TopBP1 deficiency results in inefficient DNA double-strand break repair. The developmental defects were rescued by introducing functional TCR αβ transgenes. Our data demonstrate a novel role for TopBP1 as a crucial factor in V(D)J rearrangement during the development of B, T and iNKT cells. PMID:24442639
Velasquez, Celestino; Cheng, Erdong; Shuda, Masahiro; ...
2016-07-11
mTOR-directed 4E-BP1 phosphorylation promotes cap-dependent translation and tumorigen-esis. During mitosis, CDK1 substitutes for mTOR and fully phosphorylates 4E-BP1 at canoni-cal as well a non-canonical S83 site resulting in a mitosis-specific hyperphosphorylated δ isoform. Colocalization studies with a phospho-S83 specific antibody indicate that 4E-BP1 S83 phosphorylation accumulates at centrosomes during prophase, peaks at metaphase, and decreases through telophase. While S83 phosphorylation of 4E-BP1 does not affect in vitro cap-dependent translation, nor eIF4G/4E-BP1 cap-binding, expression of an alanine substitution mutant 4E-BP1.S83A partially reverses rodent cell transformation induced by Merkel cell polyomavirus (MCV) small T (sT) antigen viral oncoprotein. In contrast to inhibitorymore » mTOR 4E-BP1 phosphorylation, these findings suggest that mitotic CDK1-directed phosphorylation of δ-4E-BP1 may yield a gain-of-function, distinct from translation regulation, that may be important in tumorigenesis and mitotic centrosome function.« less
The MCM-associated protein MCM-BP is important for human nuclear morphology.
Jagannathan, Madhav; Sakwe, Amos M; Nguyen, Tin; Frappier, Lori
2012-01-01
Mini-chromosome maintenance complex-binding protein (MCM-BP) was discovered as a protein that is strongly associated with human MCM proteins, known to be crucial for DNA replication in providing DNA helicase activity. The Xenopus MCM-BP homologue appears to play a role in unloading MCM complexes from chromatin after DNA synthesis; however, the importance of MCM-BP and its functional contribution to human cells has been unclear. Here we show that depletion of MCM-BP by sustained expression of short hairpin RNA (shRNA) results in highly abnormal nuclear morphology and centrosome amplification. The abnormal nuclear morphology was not seen with depletion of other MCM proteins and was rescued with shRNA-resistant MCM-BP. MCM-BP depletion was also found to result in transient activation of the G2 checkpoint, slowed progression through G2 and increased replication protein A foci, indicative of replication stress. In addition, MCM-BP depletion led to increased cellular levels of MCM proteins throughout the cell cycle including soluble MCM pools. The results suggest that MCM-BP makes multiple contributions to human cells that are not limited to unloading of the MCM complex.
Kazi, Abid A; Pruznak, Anne M; Frost, Robert A; Lang, Charles H
2011-02-01
Sepsis-induced muscle atrophy is produced in part by decreased protein synthesis mediated by inhibition of mTOR (mammalian target of rapamycin). The present study tests the hypothesis that alteration of specific protein-protein interactions within the mTORC1 (mTOR complex 1) contributes to the decreased mTOR activity observed after cecal ligation and puncture in rats. Sepsis decreased in vivo translational efficiency in gastrocnemius and reduced the phosphorylation of eukaryotic initiation factor (eIF) 4E-binding protein (BP) 1, S6 kinase (S6K) 1, and mTOR, compared with time-matched pair-fed controls. Sepsis decreased T246-phosphorylated PRAS40 (proline-rich Akt substrate 40) and reciprocally increased S792-phosphorylated raptor (regulatory associated protein of mTOR). Despite these phosphorylation changes, sepsis did not alter PRAS40 binding to raptor. The amount of the mTOR-raptor complex did not differ between groups. In contrast, the binding and retention of both 4E-BP1 and S6K1 to raptor were increased, and, conversely, the binding of raptor with eIF3 was decreased in sepsis. These changes in mTORC1 in the basal state were associated with enhanced 5'-AMP activated kinase activity. Acute in vivo leucine stimulation increased muscle protein synthesis in control, but not septic rats. This muscle leucine resistance was associated with coordinated changes in raptor-eIF3 binding and 4E-BP1 phosphorylation. Overall, our data suggest the sepsis-induced decrease in muscle protein synthesis may be mediated by the inability of 4E-BP1 and S6K1 to be phosphorylated and released from mTORC1 as well as the decreased recruitment of eIF3 necessary for a functional 48S complex. These data provide additional mechanistic insight into the molecular mechanisms by which sepsis impairs both basal protein synthesis and the anabolic response to the nutrient signal leucine in skeletal muscle.
Interleukin-18: Biological properties and role in disease pathogenesis.
Kaplanski, Gilles
2018-01-01
Initially described as an interferon (IFN)γ-inducing factor, interleukin (IL)-18 is indeed involved in Th1 and NK cell activation, but also in Th2, IL-17-producing γδ T cells and macrophage activation. IL-18, a member of the IL-1 family, is similar to IL-1β for being processed by caspase 1 to an 18 kDa-biologically active mature form. IL-18 binds to its specific receptor (IL-18Rα, also known as IL-1R7) forming a low affinity ligand chain. This is followed by recruitment of the IL-18Rβ chain. IL-18 then uses the same signaling pathway as IL-1 to activate NF-kB and induce inflammatory mediators such as adhesion molecules, chemokines and Fas ligand. IL-18 also binds to the circulating high affinity IL-18 binding protein (BP), such as only unbound free IL-18 is active. IL-18Rα may also bind IL-37, another member of the IL-1 family, but in association with the negative signaling chain termed IL-1R8, which transduces an anti-inflammatory signal. IL-18BP also binds IL-37 and this acts as a sink for the anti-inflammatory properties of IL-37. There is now ample evidence for a role of IL-18 in various infectious, metabolic or inflammatory diseases such as influenza virus infection, atheroma, myocardial infarction, chronic obstructive pulmonary disease, or Crohn's disease. However, IL-18 plays a very specific role in the pathogenesis of hemophagocytic syndromes (HS) also termed Macrophage Activation Syndrome. In children affected by NLRC4 gain-of-function mutations, IL-18 circulates in the range of tens of nanograms/mL. HS is treated with the IL-1 Receptor antagonist (anakinra) but also specifically with IL-18BP. Systemic juvenile idiopathic arthritis or adult-onset Still's disease are also characterized by high serum IL-18 concentrations and are treated by IL-18BP. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Al-Mudarris, Ban A.; Chen, Shih-Hsun; Liang, Po-Huang; Osman, Hasnah; Jamal Din, Shah Kamal Khan; Abdul Majid, Amin M. S.
2013-01-01
Benzyl-o-vanillin and benzimidazole nucleus serve as important pharmacophore in drug discovery. The benzyl vanillin (2-(benzyloxy)-3-methoxybenzaldehyde) compound shows anti-proliferative activity in HL60 leukemia cancer cells and can effect cell cycle progression at G2/M phase. Its apoptosis activity was due to disruption of mitochondrial functioning. In this study, we have studied a series of compounds consisting of benzyl vanillin and benzimidazole structures. We hypothesize that by fusing these two structures we can produce compounds that have better anticancer activity with improved specificity particularly towards the leukemia cell line. Here we explored the anticancer activity of three compounds namely 2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2MP, N-1-(2-benzyloxy-3-methoxybenzyl)-2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2XP, and (R) and (S)-1-(2-benzyloxy-3-methoxyphenyl)-2, 2, 2-trichloroethyl benzenesulfonate, 3BS and compared their activity to 2-benzyloxy-3-methoxybenzaldehyde, (Bn1), the parent compound. 2XP and 3BS induces cell death of U937 leukemic cell line through DNA fragmentation that lead to the intrinsic caspase 9 activation. DNA binding study primarily by the equilibrium binding titration assay followed by the Viscosity study reveal the DNA binding through groove region with intrinsic binding constant 7.39 µM/bp and 6.86 µM/bp for 3BS and 2XP respectively. 2XP and 3BS showed strong DNA binding activity by the UV titration method with the computational drug modeling showed that both 2XP and 3BS failed to form any electrostatic linkages except via hydrophobic interaction through the minor groove region of the nucleic acid. The benzylvanillin alone (Bn1) has weak anticancer activity even after it was combined with the benzimidazole (2MP), but after addition of another benzylvanillin structure (2XP), stronger activity was observed. Also, the combination of benzylvanillin with benzenesulfonate (3BS) significantly improved the anticancer activity of Bn1. The present study provides a new insight of benzyl vanillin derivatives as potential anti-leukemic agent. PMID:24260527
In the Thick of It: HCM-Causing Mutations in Myosin Binding Proteins of the Thick Filament
Harris, Samantha P.; Lyons, Ross G.; Bezold, Kristina L.
2010-01-01
In the 20 yrs since the discovery of the first mutation linked to familial hypertrophic cardiomyopathy (HCM) an astonishing number of mutations affecting numerous sarcomeric proteins have been described. Among the most prevalent of these are mutations that affect thick filament binding proteins including the myosin essential and regulatory light chains and cardiac myosin binding protein-C (cMyBP-C). However, despite the frequency with which myosin binding proteins, especially cMyBP-C, have been linked to inherited cardiomyopathies, the functional consequences of mutations in these proteins and the mechanisms by which they cause disease are still only partly understood. The purpose of this review is to summarize the known disease-causing mutations that affect the major thick filament binding proteins and to relate these mutations to protein function. Conclusions emphasize the impact that discovery of HCM causing mutations has had on fueling insights into the basic biology of thick filament proteins and reinforce the idea that myosin binding proteins are dynamic regulators of the activation state of the thick filament that contribute to the speed and force of myosin driven muscle contraction. Additional work is still needed to determine the mechanisms by which individual mutations induce hypertrophic phenotypes. PMID:21415409
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.
2015-02-01
The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less
Passamaneck, Yale J; Katikala, Lavanya; Perrone, Lorena; Dunn, Matthew P; Oda-Ishii, Izumi; Di Gregorio, Anna
2009-11-01
The notochord is a defining feature of the chordate body plan. Experiments in ascidian, frog and mouse embryos have shown that co-expression of Brachyury and FoxA class transcription factors is required for notochord development. However, studies on the cis-regulatory sequences mediating the synergistic effects of these transcription factors are complicated by the limited knowledge of notochord genes and cis-regulatory modules (CRMs) that are directly targeted by both. We have identified an easily testable model for such investigations in a 155-bp notochord-specific CRM from the ascidian Ciona intestinalis. This CRM contains functional binding sites for both Ciona Brachyury (Ci-Bra) and FoxA (Ci-FoxA-a). By combining point mutation analysis and misexpression experiments, we demonstrate that binding of both transcription factors to this CRM is necessary and sufficient to activate transcription. To gain insights into the cis-regulatory criteria controlling its activity, we investigated the organization of the transcription factor binding sites within the 155-bp CRM. The 155-bp sequence contains two Ci-Bra binding sites with identical core sequences but opposite orientations, only one of which is required for enhancer activity. Changes in both orientation and spacing of these sites substantially affect the activity of the CRM, as clusters of identical sites found in the Ciona genome with different arrangements are unable to activate transcription in notochord cells. This work presents the first evidence of a synergistic interaction between Brachyury and FoxA in the activation of an individual notochord CRM, and highlights the importance of transcription factor binding site arrangement for its function.
Yang, Zhirong; Patra, Barunava; Li, Runzhi; Pattanaik, Sitakanta; Yuan, Ling
2013-12-01
WRKY transcription factors (TFs) are emerging as an important group of regulators of plant secondary metabolism. However, the cis-regulatory elements associated with their regulation have not been well characterized. We have previously demonstrated that CrWRKY1, a member of subgroup III of the WRKY TF family, regulates biosynthesis of terpenoid indole alkaloids in the ornamental and medicinal plant, Catharanthus roseus. Here, we report the isolation and functional characterization of the CrWRKY1 promoter. In silico analysis of the promoter sequence reveals the presence of several potential TF binding motifs, indicating the involvement of additional TFs in the regulation of the TIA pathway. The CrWRKY1 promoter can drive the expression of a β-glucuronidase (GUS) reporter gene in native (C. roseus protoplasts and transgenic hairy roots) and heterologous (transgenic tobacco seedlings) systems. Analysis of 5'- or 3'-end deletions indicates that the sequence located between positions -140 to -93 bp and -3 to +113 bp, relative to the transcription start site, is critical for promoter activity. Mutation analysis shows that two overlapping as-1 elements and a CT-rich motif contribute significantly to promoter activity. The CrWRKY1 promoter is induced in response to methyl jasmonate (MJ) treatment and the promoter region between -230 and -93 bp contains a putative MJ-responsive element. The CrWRKY1 promoter can potentially be used as a tool to isolate novel TFs involved in the regulation of the TIA pathway.
Luo, Dahu; Lou, Weihua
2017-07-01
Objective To study the expressions of RNA-binding Ras-GAP SH3 binding protein (G3BP) and tumor stem cell marker CD44v6 in laryngeal squamous cell carcinoma and their correlations with angiogenesis. Methods We collected the cancer tissues and corresponding paracancerous tissues from 56 patients with laryngeal squamous cell carcinoma. The expressions of G3BP and CD44v6 proteins were detected by Western blotting in cancer tissues and corresponding paracancerous tissues; the expressions of G3BP, CD44v6 and vascular endothelial growth factor A (VEGF-A) were tested by immunohistochemistry. Thereafter, we compared the positive expression rates of G3BP and CD44v6 between in cancer tissues and in normal tissues, analyzed the correlations between the expressions of G3BP, CD44v6 and the laryngeal squamous cell carcinoma features as well as their correlations with microvessel density (MVD) that was determined by FVIIIAg immunohistochemistry. Results Western blotting showed that the expressions of G3BP and CD44v6 proteins in the laryngeal squamous cell carcinoma were higher than those in the paracancerous tissues. Immunohistochemistry showed that compared with the paracancerous tissues, G3BP, CD44v6 and VEGF-A expressions (the positive rates are 58.9%, 53.6%, 46.4%, respectively) were higher in cancer tissues. The positive rates of G3BP and CD44v6 in cancer tissues were related with the clinical stage, recurrence or metastasis, and lymph node metastasis of laryngeal squamous cell carcinoma, but had nothing to do with patients' age and tumor size. Pearson correlation analysis showed the expressions of both G3BP and CD44v6 were positively correlated with VEGF-A (r=0.741, r=0.756). MVD values were significantly higher in the G3BP and CD44v6 positive cases than in paracancerous tissues, but there was no difference in MVD between those without G3BP and CD44v6 positive expressions and the paracancerous tissues. Conclusion The positive expression rates of G3BP and CD44v6 in laryngeal squamous cell carcinoma tissues are very high, and they have a close relationship with the clinical prognosis. They may raise the VEGF-A expression so as to promote angiogenesis, and then accelerate the development of the laryngeal squamous cell carcinoma.
Subramanian, T; Zhao, Ling-Jun; Chinnadurai, G
2013-09-01
Adenovirus E1A induces cell proliferation, oncogenic transformation and promotes viral replication through interaction with p300/CBP, TRRAP/p400 multi-protein complex and the retinoblastoma (pRb) family proteins through distinct domains in the E1A N-terminal region. The C-terminal region of E1A suppresses E1A/Ras co-transformation and interacts with FOXK1/K2, DYRK1A/1B/HAN11 and CtBP1/2 (CtBP) protein complexes. To specifically dissect the role of CtBP interaction with E1A, we engineered a mutation (DL→AS) within the CtBP-binding motif, PLDLS, and investigated the effect of the mutation on immortalization and Ras cooperative transformation of primary cells and viral replication. Our results suggest that CtBP-E1A interaction suppresses immortalization and Ras co-operative transformation of primary rodent epithelial cells without significantly influencing the tumorigenic activities of transformed cells in immunodeficient and immunocompetent animals. During productive infection, CtBP-E1A interaction enhances viral replication in human cells. Between the two CtBP family proteins, CtBP2 appears to restrict viral replication more than CtBP1 in human cells. Copyright © 2013 Elsevier Inc. All rights reserved.
Subramanian, T.; Zhao, Ling-jun; Chinnadurai, G.
2013-01-01
Adenovirus E1A induces cell proliferation, oncogenic transformation and promotes viral replication through interaction with p300/CBP, TRRAP/p400 multi-protein complex and the retinoblastoma (pRb) family proteins through distinct domains in the E1A N-terminal region. The C-terminal region of E1A suppresses E1A/Ras co-transformation and interacts with FOXK1/K2, DYRK1A/1B/HAN11 and CtBP1/2 (CtBP) protein complexes. To specifically dissect the role of CtBP interaction with E1A, we engineered a mutation (DL→AS) within the CtBP-binding motif, PLDLS, and investigated the effect of the mutation on immortalization and Ras cooperative transformation of primary cells and viral replication. Our results suggest that CtBP-E1A interaction suppresses immortalization and Ras co-operative transformation of primary rodent epithelial cells without significantly influencing the tumorigenic activities of transformed cells in immunodeficient and immunocompetent animals. During productive infection, CtBP-E1A interaction enhances viral replication in human cells. Between the two CtBP family proteins, CtBP2 appears to restrict viral replication more than CtBP1 in human cells. PMID:23747199
Neurotoxicity fingerprinting of venoms using on-line microfluidic AChBP profiling.
Slagboom, Julien; Otvos, Reka A; Cardoso, Fernanda C; Iyer, Janaki; Visser, Jeroen C; van Doodewaerd, Bjorn R; McCleary, Ryan J R; Niessen, Wilfried M A; Somsen, Govert W; Lewis, Richard J; Kini, R Manjunatha; Smit, August B; Casewell, Nicholas R; Kool, Jeroen
2018-06-15
Venoms from snakes are rich sources of highly active proteins with potent affinity towards a variety of enzymes and receptors. Of the many distinct toxicities caused by envenomation, neurotoxicity plays an important role in the paralysis of prey by snakes as well as by venomous sea snails and insects. In order to improve the analytical discovery component of venom toxicity profiling, this paper describes the implementation of microfluidic high-resolution screening (HRS) to obtain neurotoxicity fingerprints from venoms that facilitates identification of the neurotoxic components of envenomation. To demonstrate this workflow, 47 snake venoms were profiled using the acetylcholine binding protein (AChBP) to mimic the target of neurotoxic proteins, in particular nicotinic acetylcholine receptors (nAChRs). In the microfluidic HRS system, nanoliquid chromatographic (nanoLC) separations were on-line connected to both AChBP profiling and parallel mass spectrometry (MS). For virtually all neurotoxic elapid snake venoms tested, we obtained bioactivity fingerprints showing major and minor bioactive zones containing masses consistent with three-finger toxins (3FTxs), whereas, viperid and colubrid venoms showed little or no detectable bioactivity. Our findings demonstrate that venom interactions with AChBP correlate with the severity of neurotoxicity observed following human envenoming by different snake species. We further, as proof of principle, characterized bioactive venom peptides from a viperid (Daboia russelli) and an elapid (Aspidelaps scutatus scutatus) snake by nanoLC-MS/MS, revealing that different toxin classes interact with the AChBP, and that this binding correlates with the inhibition of α7-nAChR in calcium-flux cell-based assays. The on-line post-column binding assay and subsequent toxin characterization methodologies described here provide a new in vitro analytic platform for rapidly investigating neurotoxic snake venom proteins. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R
1999-12-01
The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.
Around and beyond 53BP1 Nuclear Bodies
Fernandez-Vidal, Anne; Vignard, Julien
2017-01-01
Within the nucleus, sub-nuclear domains define territories where specific functions occur. Nuclear bodies (NBs) are dynamic structures that concentrate nuclear factors and that can be observed microscopically. Recently, NBs containing the p53 binding protein 1 (53BP1), a key component of the DNA damage response, were defined. Interestingly, 53BP1 NBs are visualized during G1 phase, in daughter cells, while DNA damage was generated in mother cells and not properly processed. Unlike most NBs involved in transcriptional processes, replication has proven to be key for 53BP1 NBs, with replication stress leading to the formation of these large chromatin domains in daughter cells. In this review, we expose the composition and organization of 53BP1 NBs and focus on recent findings regarding their regulation and dynamics. We then concentrate on the importance of the replication stress, examine the relation of 53BP1 NBs with DNA damage and discuss their dysfunction. PMID:29206178
Ackermann, Maegen A; Ward, Christopher W; Gurnett, Christina; Kontrogianni-Konstantopoulos, Aikaterini
2015-08-19
Myosin Binding Protein-C slow (sMyBP-C), encoded by MYBPC1, comprises a family of regulatory proteins of skeletal muscles that are phosphorylated by PKA and PKC. MYBPC1 missense mutations are linked to the development of Distal Arthrogryposis-1 (DA-1). Although structure-function details for this myopathy are evolving, function is undoubtedly driven by sequence variations and post-translational modifications in sMyBP-C. Herein, we examined the phosphorylation profile of sMyBP-C in mouse and human fast-twitch skeletal muscles. We used Flexor Digitorum Brevis (FDB) isolated from young (~2-months old) and old (~14-months old) wild type and mdx mice, and human Abductor Hallucis (AH) and gastrocnemious muscles carrying the DA-1 mutations. Our results indicate both constitutive and differential phosphorylation of sMyBP-C in aged and diseased muscles. We report a 7-35% reduction in the phosphorylation levels of select sites in old wild type and young or old mdx FDB mouse muscles, compared to young wild type tissue. Similarly, we observe a 30-70% decrease in the phosphorylation levels of all PKA and PKC phospho-sites in the DA-1 AH, but not gastrocnemius, muscle. Overall, our studies show that the phosphorylation pattern of sMyBP-C is differentially regulated in response to age and disease, suggesting that phosphorylation plays important roles in these processes.
Levels of the E2 interacting protein TopBP1 modulate papillomavirus maintenance stage replication
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanginakudru, Sriramana, E-mail: skangina@iu.edu; DeSmet, Marsha, E-mail: mdesmet@iupui.edu; Thomas, Yanique, E-mail: ysthomas@umail.iu.edu
2015-04-15
The evolutionarily conserved DNA topoisomerase II beta-binding protein 1 (TopBP1) functions in DNA replication, DNA damage response, and cell survival. We analyzed the role of TopBP1 in human and bovine papillomavirus genome replication. Consistent with prior reports, TopBP1 co-localized in discrete nuclear foci and was in complex with papillomavirus E2 protein. Similar to E2, TopBP1 is recruited to the region of the viral origin of replication during G1/S and early S phase. TopBP1 knockdown increased, while over-expression decreased transient virus replication, without affecting cell cycle. Similarly, using cell lines harboring HPV-16 or HPV-31 genome, TopBP1 knockdown increased while over-expression reducedmore » viral copy number relative to genomic DNA. We propose a model in which TopBP1 serves dual roles in viral replication: it is essential for initiation of replication yet it restricts viral copy number. - Highlights: • Protein interaction study confirmed In-situ interaction between TopBP1 and E2. • TopBP1 present at papillomavirus ori in G1/S and early S phase of cell cycle. • TopBP1 knockdown increased, over-expression reduced virus replication. • TopBP1 protein level change did not influence cell survival or cell cycle. • TopBP1 displaced from papillomavirus ori after initiation of replication.« less
Mass spectroscopic phosphoprotein mapping of Ral Binding protein 1 (RalBP1/Rip1/RLIP76)
Herlevsen, Mikael C; Theodorescu, Dan
2009-01-01
RalBP1, a multifunctional protein implicated in cancer cell proliferation, radiation and chemoresistance and ligand dependent receptor internalization, is upregulated in bladder cancer and is a downstream effector of RalB, a GTPase associated with metastasis. RalBP1 can be regulated by phosphorylation by protein kinase C (PKC). No studies have comprehensively mapped RalBP1 phosphorylation sites or whether RalB affects these. We identified fourteen phosphorylation sites of RalBP1 in human bladder carcinoma UMUC-3 and embryonic kidney derived 293T cells. The phosphorylated residues are concentrated at the N-terminus. Ten of the first 100 amino acids of the primary structure were phosphorylated. Nine were serine residues, and one a threonine. We evaluated the effect of RalB overexpression on RalBP1 phosphorylation and found the largest change in phosphorylation status at S463 and S645. Further characterization of these sites will provide novel insights on RalBP1 biology, its functional relationship to RalB and possible avenues for therapeutic intervention. PMID:17706599
Structural analysis of the interaction of IGF I with the IGF types 1 and 2 and insulin receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cascieri, M.A.; Chicchi, G.G.; Hayes, N.S.
1987-05-01
A synthetic gene for human IGF I has been synthesized which directs the synthesis and secretion of fully active human IGF I (rIGF I) from yeast. rIGF I inhibits binding of /sup 125/I-IGF I to type 1 IGF receptors from human placenta (IGF-R1, IC50 = 4 nM), binding of /sup 125/I-insulin to insulin receptors (IR, IC50 = 881 nM), binding of /sup 125/I-MSA to type 2 IGF receptors from rat liver (IGF-R2, IC50 = 80 nM), and binding of /sup 125/I-IGF I to crude human serum binding protein (hBP, IC50 = 0.42 nM). rIGF I is equipotent to human IGFmore » I in stimulating glucose transport in murine BC3H1 cells and in stimulating DNA synthesis in rat A10 cells. Site directed mutagenesis of the synthetic gene is being used to characterize the structural requirements for binding to these receptors. IGF I (FFY) B(23-25) is equipotent to rIGF I at the IGF-R1 (6.9 nM), the IGF-R2 (36 nM), and the IR (841 nM) and is less potent at the hBP (1.7 nM). In contrast, IGF I(SFY) B(23-25) is 20-fold less potent than rIGF I at the IGF-R1 and is 10-fold less potent than rIGF I at hBP. This peptide is greater than 10-fold less active at the IGF-R2 and the IR. This peptide is a full agonist in the cell assays but 20-50 fold less potent than rIGF I. These data are consistent with the hypothesis that the F to S change destabilizes the tertiary structure of IGF I.« less
Yoder-Himes, Deborah R.; Kroos, Lee
2006-01-01
The bacterium Myxococcus xanthus employs extracellular signals to coordinate aggregation and sporulation during multicellular development. Extracellular, contact-dependent signaling that involves the CsgA protein (called C-signaling) activates FruA, a putative response regulator that governs a branched signaling pathway inside cells. One branch regulates cell movement, leading to aggregation. The other branch regulates gene expression, leading to sporulation. C-signaling is required for full expression of most genes induced after 6 h into development, including the gene identified by Tn5 lac insertion Ω4400. To determine if FruA is a direct regulator of Ω4400 transcription, a combination of in vivo and in vitro experiments was performed. Ω4400 expression was abolished in a fruA mutant. The DNA-binding domain of FruA bound specifically to DNA upstream of the promoter −35 region in vitro. Mutations between bp −86 and −77 greatly reduced binding. One of these mutations had been shown previously to reduce Ω4400 expression in vivo and make it independent of C-signaling. For the first time, chromatin immunoprecipitation (ChIP) experiments were performed on M. xanthus. The ChIP experiments demonstrated that FruA is associated with the Ω4400 promoter region late in development, even in the absence of C-signaling. Based on these results, we propose that FruA directly activates Ω4400 transcription to a moderate level prior to C-signaling and, in response to C-signaling, binds near bp −80 and activates transcription to a higher level. Also, the highly localized effects of mutations between bp −86 and −77 on DNA binding in vitro, together with recently published footprints, allow us to predict a consensus binding site of GTCG/CGA/G for the FruA DNA-binding domain. PMID:16816188
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
Colocalization of insulin-like growth factor-binding protein with insulin-like growth factor I.
Kobayashi, S; Clemmons, D R; Venkatachalam, M A
1991-07-01
We report the localization of insulin-like growth factor I (IGF-I) and a 25-kDa form of insulin-like growth factor-binding protein (IGF-BP-1) in adult rat kidney. The antigens were localized using a rabbit anti-human IGF-I antibody, and a rabbit anti-human IGF-BP-1 antibody raised against human 25-kDa IGF-BP-1 purified from amniotic fluid. Immunohistochemistry by the avidin-biotin peroxidase conjugate technique showed that both peptides are located in the same nephron segments, in the same cell types. The most intense staining was in papillary collecting ducts. There was moderate staining also in cortical collecting ducts and medullary thick ascending limbs of Henle's loop. In collecting ducts the antigens were shown to be present in principal cells but not in intercalated cells. In distal convoluted tubules, cortical thick ascending limbs, and in structures presumptively identified as thin limbs of Henle's loops there was only modest staining. The macula densa, however, lacked immunoreactivity. Colocalization of IGF-I and IGF-BP-1 in the same cells supports the notion, derived from studies on cultured cells, that the actions of IGF-I may be modified by IGF-BPs that are present in the same location.
Lednicky, J; Folk, W R
1992-01-01
The 21-bp repeat region of simian virus 40 (SV40) activates viral transcription and DNA replication and contains binding sites for many cellular proteins, including Sp1, LSF, ETF, Ap2, Ap4, GT-1B, H16, and p53, and for the SV40 large tumor antigen. We have attempted to reduce the complexity of this region while maintaining its growth-promoting capacity. Deletion of the 21-bp repeat region from the SV40 genome delays the expression of viral early proteins and DNA replication and reduces virus production in CV-1 cells. Replacement of the 21-bp repeat region with two copies of DNA sequence motifs bound with high affinities by Sp1 promotes SV40 growth in CV-1 cells to nearly wild-type levels, but substitution by motifs bound less avidly by Sp1 or bound by other activator proteins does not restore growth. This indicates that Sp1 or a protein with similar sequence specificity is primarily responsible for the function of the 21-bp repeat region. We speculate about how Sp1 activates both SV40 transcription and DNA replication. Images PMID:1328672
Kurtz, Andreas; Aigner, Achim; Cabal-Manzano, Rafael H; Butler, Robert E; Hood, Dozier R; Sessions, Roy B; Czubayko, Frank; Wellstein, Anton
2004-01-01
The initiation of premalignant lesions is associated with subtle cellular and gene expression changes. Here we describe a severe combined immunodeficiency mouse xenograft model with human adult skin and compare chemical carcinogenesis and wound healing. We focus on a secreted binding protein for fibroblast growth factors (FGF-BP) that enhances the activity of locally stored FGFs and is expressed at high levels in human epithelial cancers. Carcinogen treatment of murine skin induced papilloma within 6 weeks, whereas the human skin grafts displayed no obvious macroscopic alterations. Microscopic studies of the human skin, however, showed p53-positive keratinocytes in the epidermis, increased angiogenesis in the dermis of the treated skin, enhanced proliferation of keratinocytes in the basal layer, and an increase of FGF-BP protein and mRNA expression. In contrast, after surgical wounding of human skin grafts or of mouse skin, FGF-BP expression was upregulated within a few hours and returned to control levels after 2 days with wound closure. Enhanced motility of cultured keratinocytes and dermal fibroblasts by FGF-BP supports a role in wound healing. We conclude that adult human skin xenografts can be used to identify early molecular events during malignant transformation as well as transient changes during wound healing.
NASA Astrophysics Data System (ADS)
Menezes, Marcos; Capaz, Rodrigo
Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.
Conti, Antonio; Riva, Nilo; Pesca, Mariasabina; Iannaccone, Sandro; Cannistraci, Carlo V; Corbo, Massimo; Previtali, Stefano C; Quattrini, Angelo; Alessio, Massimo
2014-01-01
Amyotrophic lateral sclerosis (ALS) is a severe and fatal neurodegenerative disease of still unknown pathogenesis. Recent findings suggest that the skeletal muscle may play an active pathogenetic role. To investigate ALS's pathogenesis and to seek diagnostic markers, we analyzed skeletal muscle biopsies with the differential expression proteomic approach. We studied skeletal muscle biopsies from healthy controls (CN), sporadic ALS (sALS), motor neuropathies (MN) and myopathies (M). Pre-eminently among several differentially expressed proteins, Myosin binding protein H (MyBP-H) expression in ALS samples was anomalously high. MyBP-H is a component of the thick filaments of the skeletal muscle and has strong affinity for myosin, but its function is still unclear. High MyBP-H expression level was associated with abnormal expression of Rho kinase 2 (ROCK2), LIM domain kinase 1 (LIMK1) and cofilin2, that might affect the actin-myosin interaction. We propose that MyBP-H expression level serves, as a putative biomarker in the skeletal muscle, to discriminate ALS from motor neuropathies, and that it signals the onset of dysregulation in actin-myosin interaction; this in turn might contribute to the pathogenesis of ALS. © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
McLeod, Kate; Kumar, Sunil; Smart, Roger St. C.; Dutta, Naba; Voelcker, Nicolas H.; Anderson, Gail I.; Sekel, Ron
2006-12-01
This paper reports the use of X-ray photoelectron spectroscopy (XPS) to investigate bisphosphonate (BP) adsorption onto plasma sprayed hydroxyapatite (HA) coatings commonly used for orthopaedic implants. BPs exhibit high binding affinity for the calcium present in HA and hence can be adsorbed onto HA-coated implants to exploit their beneficial properties for improved bone growth at the implant interface. A rigorous XPS analysis of pamidronate, a commonly used nitrogenous BP, adsorbed onto plasma sprayed HA-coated cobalt-chromium substrates has been carried out, aimed at: (a) confirming the adsorption of this BP onto HA; (b) studying the BP diffusion profile in the HA coating by employing the technique of XPS depth profiling; (c) confirming the bioactivity of the adsorbed BP. XPS spectra of plasma sprayed HA-coated discs exposed to a 10 mM aqueous BP solution (pamidronate) for periods of 1, 2 and 24 h showed nitrogen and phosphorous photoelectron signals corresponding to the BP, confirming its adsorption onto the HA substrate. XPS depth profiling of the 2 h BP-exposed HA discs showed penetration of the BP into the HA matrix to depths of at least 260 nm. The bioactivity of the adsorbed BP was confirmed by the observed inhibition of osteoclast (bone resorbing) cell activity. In comparison to the HA sample, the HA sample with adsorbed BP exhibited a 25-fold decrease in primary osteoclast cells.
4E-BP1 regulates the differentiation of white adipose tissue.
Tsukiyama-Kohara, Kyoko; Katsume, Asao; Kimura, Kazuhiro; Saito, Masayuki; Kohara, Michinori
2013-07-01
4E Binding protein 1 (4E-BP1) suppresses translation initiation. The absence of 4E-BP1 drastically reduces the amount of adipose tissue in mice. To address the role of 4E-BP1 in adipocyte differentiation, we characterized 4E-BP1(-/-) mice in this study. The lack of 4E-BP1 decreased the amount of white adipose tissue and increased the amount of brown adipose tissue. In 4E-BP1(-/-) MEF cells, PPARγ coactivator 1 alpha (PGC-1α) expression increased and exogenous 4E-BP1 expression suppressed PGC-1α expression. The level of 4E-BP1 expression was higher in white adipocytes than in brown adipocytes and showed significantly greater up-regulation in white adipocytes than in brown adipocytes during preadipocyte differentiation into mature adipocytes. The amount of PGC-1α was consistently higher in HB cells (a brown preadipocyte cell line) than in HW cells (a white preadipocyte cell line) during differentiation. Moreover, the ectopic over-expression of 4E-BP1 suppressed PGC-1α expression in white adipocytes, but not in brown adipocytes. Thus, the results of our study indicate that 4E-BP1 may suppress brown adipocyte differentiation and PGC-1α expression in white adipose tissues. © 2013 The Authors Genes to Cells © 2013 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
The CCDC55 couples cannabinoid receptor CNR1 to a putative DISC1 schizophrenia pathway.
Xie, J; Gizatullin, R; Vukojevic, V; Leopardi, R
2015-12-03
Our previous study suggested that the coiled coil domain-containing 55 gene (CCDC55), also named as NSRP1 (nuclear speckle splicing regulatory protein 1 (NSRP1)), was encompassed in a haplotype block spanning over the serotonin transporter (5-HTT) gene in patients with schizophrenia (SCZ). However, the neurobiological function of CCDC55 gene remains unknown. This study aims to uncover the potential role of CCDC55 in SCZ-associated molecular pathways. Using molecular cloning, sequencing and immune blotting to identify basic properties, yeast two-hybrid screening and glutathione S-transferase (GST) pull-down assay to test protein-protein interaction, and confocal laser scanning microscopy (CSLM) to show intracellular interaction of proteins. (i) CCDC55 is expressed as a nuclear protein in human neuronal cells; (ii) Protein-protein interaction analyses showed CCDC55 physically interacted with Ran binding protein 9 (RanBP9) and disrupted in schizophrenia 1 (DISC1); (iii) CCDC55 and RanBP9 co-localized in the nucleus of human neuronal cells; (iv) CCDC55 also interacted with the cannabinoid receptor 1 (CNR1), and with the brain cannabinoid receptor-interacting protein 1a (CNRIP1a); (v) CNR1 activation in differentiated human neuronal cells resulted in an altered RanBP9 localization. CCDC55 may be involved in a functional bridging between the CNR1 activation and the DISC1/RanBP9-associated pathways. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.
Induction of the Estrogenic Marker Calbindn-D9k by Octamethylcyclotetrasiloxane
Lee, Dongoh; Ahn, Changhwan; An, Beum-Soo; Jeung, Eui-Bae
2015-01-01
Interrupting the hormonal balance of an organism by interfering with hormones and their target receptors gives rise to various problems such as developmental disorders. Collectively, these reagents are known as endocrine disruptors (EDs). Cyclic volatile methyl siloxanes (cVMSs) are a group of silicone polymers that including octamethylcyclotetrasiloxane (D4). In the present study, we examined the estrogenicity of D4 through in vitro and in vivo assays that employed calcium-binding protein 9K (calbindin-D9k; CaBP-9K) as a biomarker. For in vitro investigation, GH3 rat pituitary cells were exposed to vehicle, 17β-estradiol (E2), or D4 with/without ICI 182 780 (ICI). CaBP-9K and progesterone receptor (PR) both were up-regulated by E2 and D4 which were completely blocked by ICI. Transcription of estrogen receptor α (ER α) was decreased by E2 and D4 but increased by ICI. D4 was also administered to immature female rats for an uterotrophic (UT) assay and detection of CaBP-9K. Ethinyl estradiol (EE) or D4 was administered subcutaneously with or without ICI. Although uterine weight was not significant altered by D4, an effect thought to be due to cytochrome P450 (CYP), it induced CaBP-9K and PR gene expression. Based on these results we reveal that D4 has estrogenic potential proven under in vitro and in vivo experimental conditions. PMID:26593928
Hirosawa, Tetsu; Kikuchi, Mitsuru; Ouchi, Yasuomi; Takahashi, Tetsuya; Yoshimura, Yuko; Kosaka, Hirotaka; Furutani, Naoki; Hiraishi, Hirotoshi; Fukai, Mina; Yokokura, Masamichi; Yoshikawa, Etsuji; Bunai, Tomoyasu; Minabe, Yoshio
2017-05-01
Oxytocin (OT) and the serotonergic system putatively play important roles in autism spectrum disorder (ASD) etiology and symptoms, but no direct neurobiological evidence exists for long-term OT administration effects on the brain's serotonergic system. This pilot study examined 10 male participants with ASD who were administered OT intranasally for 8-10 weeks in an open-label, single-arm, nonrandomized, and uncontrolled manner. Positron emission tomography (PET) with a radiotracer ( 11 C)-3-amino-4-(2-[(dimethylamino)methyl]phenylthio)benzonitrile ( 11 C-DASB) was used before and after OT treatment. The binding potential of serotonin transporter ( 11 C-DASB BP ND ) was then estimated. The main outcome measures were changes in 11 C-DASB BP ND and their correlation with changes in symptoms. ASD participants showed significantly elevated 11 C-DASB BP ND in the left inferior frontal gyrus extending to the left middle frontal gyrus. No significant correlation was found between the change in any clinical symptom and the change in 11 C-DASB BP ND . This report of a pilot study is the first describing long-term effects of OT on the brain's serotonin system in ASD. Additional randomized controlled studies must be conducted to confirm whether activation of the serotonergic system contributes to the prosocial effect of OT in people with ASD. Autism Res 2017, 10: 821-828. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.
Schmidt, E; Reimer, S; Kruse, N; Jainta, S; Bröcker, E B; Marinkovich, M P; Giudice, G J; Zillikens, D
2000-11-01
Bullous pemphigoid is an inflammatory subepidermal blistering disease that is associated with auto- antibodies to the keratinocyte surface protein, BP180. In addition to the binding of autoantibodies, the infiltration of inflammatory cells is necessary for blister formation. Cytokines, including interleukin-6 and interleukin-8, have been implicated in the disease process of both human and experimental murine bullous pemphigoid. This study was aimed at testing the hypothesis that the binding of anti-BP180 antibodies to their target antigen triggers a signal transduction event that results in the secretion of these pro-inflammatory cytokines. Consistent with this hypothesis, treatment of cultured normal human epidermal keratinocytes with bullous pemphigoid IgG, but not control IgG, led to increased levels of interleukin-6 and interleukin-8, but not interleukin-1alpha, interleukin-1beta, tumor necrosis factor-alpha, interleukin-10, or monocyte chemoattractant protein-1, in the culture medium. This effect was concentration- and time-dependent and was abolished by depleting the bullous pemphigoid IgG of reactivity to two distinct epitopes on the BP180 NC16A domain. Upregulation of interleukin-6 and interleukin-8 was found at both protein and mRNA levels. In addition, bullous pemphigoid IgG did not induce the release of interleukin-6 and interleukin-8 from BP180-deficient keratinocytes obtained from a patient with generalized atrophic benign epidermolysis bullosa. These data indicate that bullous pemphigoid-associated autoantibodies to the human BP180 ectodomain trigger a signal transducing event that leads to expression and secretion of interleukin-6 and interleukin-8 from human keratinocytes.
Generation of a miniature pig disease model for human Laron syndrome.
Cui, Dan; Li, Fang; Li, Qiuyan; Li, Jia; Zhao, Yaofeng; Hu, Xiaoxiang; Zhang, Ran; Li, Ning
2015-10-29
Laron syndrome is a rare disease caused by mutations of the growth hormone receptor (GHR), inheriting in an autosomal manner. To better understand the pathogenesis and to develop therapeutics, we generated a miniature pig model for this disease by employing ZFNs to knock out GHR gene. Three types of F0 heterozygous pigs (GHR(+/4bp), GHR(+/2bp), GHR(+/3bp)) were obtained and in which no significant phenotypes of Laron syndrome were observed. Prior to breed heterozygous pigs to homozygosity (GHR(4bp/4bp)), pig GHR transcript with the 4 bp insert was evaluated in vitro and was found to localize to the cytoplasm rather than the membrane. Moreover, this mutated transcript lost most of its signal transduction capability, although it could bind bGH. GHR(4bp/4bp) pigs showed a small body size and reduced body weight. Biochemically, these pigs exhibited significantly elevated levels of GH and decreased levels of IGF-I. These results resemble the phenotype observed in Laron patients, suggesting that these pigs could serve as an ideal model for Laron syndrome to bridge the gaps between mouse model and human.
Generation of a miniature pig disease model for human Laron syndrome
Cui, Dan; Li, Fang; Li, Qiuyan; Li, Jia; Zhao, Yaofeng; Hu, Xiaoxiang; Zhang, Ran; Li, Ning
2015-01-01
Laron syndrome is a rare disease caused by mutations of the growth hormone receptor (GHR), inheriting in an autosomal manner. To better understand the pathogenesis and to develop therapeutics, we generated a miniature pig model for this disease by employing ZFNs to knock out GHR gene. Three types of F0 heterozygous pigs (GHR+/4bp, GHR+/2bp, GHR+/3bp) were obtained and in which no significant phenotypes of Laron syndrome were observed. Prior to breed heterozygous pigs to homozygosity (GHR4bp/4bp), pig GHR transcript with the 4 bp insert was evaluated in vitro and was found to localize to the cytoplasm rather than the membrane. Moreover, this mutated transcript lost most of its signal transduction capability, although it could bind bGH. GHR4bp/4bp pigs showed a small body size and reduced body weight. Biochemically, these pigs exhibited significantly elevated levels of GH and decreased levels of IGF-I. These results resemble the phenotype observed in Laron patients, suggesting that these pigs could serve as an ideal model for Laron syndrome to bridge the gaps between mouse model and human. PMID:26511035
Kautzky, A; James, G M; Philippe, C; Baldinger-Melich, P; Kraus, C; Kranz, G S; Vanicek, T; Gryglewski, G; Wadsak, W; Mitterhauser, M; Rujescu, D; Kasper, S; Lanzenberger, R
2017-06-13
Major depressive disorder (MDD) is the most common neuropsychiatric disease and despite extensive research, its genetic substrate is still not sufficiently understood. The common polymorphism rs6295 of the serotonin-1A receptor gene (HTR1A) is affecting the transcriptional regulation of the 5-HT 1A receptor and has been closely linked to MDD. Here, we used positron emission tomography (PET) exploiting advances in data mining and statistics by using machine learning in 62 healthy subjects and 19 patients with MDD, which were scanned with PET using the radioligand [carbonyl- 11 C]WAY-100635. All the subjects were genotyped for rs6295 and genotype was grouped in GG vs C allele carriers. Mixed model was applied in a ROI-based (region of interest) approach. ROI binding potential (BP ND ) was divided by dorsal raphe BP ND as a specific measure to highlight rs6295 effects (BP Div ). Mixed model produced an interaction effect of ROI and genotype in the patients' group but no effects in healthy controls. Differences of BP Div was demonstrated in seven ROIs; parahippocampus, hippocampus, fusiform gyrus, gyrus rectus, supplementary motor area, inferior frontal occipital gyrus and lingual gyrus. For classification of genotype, 'RandomForest' and Support Vector Machines were used, however, no model with sufficient predictive capability could be computed. Our results are in line with preclinical data, mouse model knockout studies as well as previous clinical analyses, demonstrating the two-pronged effect of the G allele on 5-HT 1A BP ND for, we believe, the first time. Future endeavors should address epigenetic effects and allosteric heteroreceptor complexes. Replication in larger samples of MDD patients is necessary to substantiate our findings.
Gluskin, B S; Mickey, B J
2016-03-01
The D2 dopamine receptor mediates neuropsychiatric symptoms and is a target of pharmacotherapy. Inter-individual variation of D2 receptor density is thought to influence disease risk and pharmacological response. Numerous molecular imaging studies have tested whether common genetic variants influence D2 receptor binding potential (BP) in humans, but demonstration of robust effects has been limited by small sample sizes. We performed a systematic search of published human in vivo molecular imaging studies to estimate effect sizes of common genetic variants on striatal D2 receptor BP. We identified 21 studies examining 19 variants in 11 genes. The most commonly studied variant was a single-nucleotide polymorphism in ANKK1 (rs1800497, Glu713Lys, also called 'Taq1A'). Fixed- and random-effects meta-analyses of this variant (5 studies, 194 subjects total) revealed that striatal BP was significantly and robustly lower among carriers of the minor allele (Lys713) relative to major allele homozygotes. The weighted standardized mean difference was -0.57 under the fixed-effect model (95% confidence interval=(-0.87, -0.27), P=0.0002). The normal relationship between rs1800497 and BP was not apparent among subjects with neuropsychiatric diseases. Significant associations with baseline striatal D2 receptor BP have been reported for four DRD2 variants (rs1079597, rs1076560, rs6277 and rs1799732) and a PER2 repeat polymorphism, but none have yet been tested in more than two independent samples. Our findings resolve apparent discrepancies in the literature and establish that rs1800497 robustly influences striatal D2 receptor availability. This genetic variant is likely to contribute to important individual differences in human striatal function, neuropsychiatric disease risk and pharmacological response.
Early Phthalates Exposure in Pregnant Women Is Associated with Alteration of Thyroid Hormones
Tsai, Chih-Hsin; Liang, Wei-Yen; Li, Sih-Syuan; Huang, Han-Bin
2016-01-01
Introduction Previous studies revealed that phthalate exposure could alter thyroid hormones during the last trimester of pregnancy. However, thyroid hormones are crucial for fetal development during the first trimester. We aimed to clarify the effect of phthalate exposure on thyroid hormones during early pregnancy. Method We recruited 97 pregnant women who were offered an amniocentesis during the early trimester from an obstetrics clinic in southern Taiwan from 2013 to 2014. After signing an informed consent form, we collected amniotic fluid and urine samples from pregnant women to analyze 11 metabolites, including mono-ethyl phthalate (MEP), mono-(2-ethyl-5-carboxypentyl) phthalate (MECPP), mono-(2-ethylhexyl) phthalate (MEHP), mono-butyl phthalate (MnBP), of 9 phthalates using liquid chromatography/ tandem mass spectrometry. We collected blood samples from each subject to analyze serum thyroid hormones including thyroxine (T4), free T4, and thyroid-binding globulin (TBG). Results Three phthalate metabolites were discovered to be >80% in the urine samples of the pregnant women: MEP (88%), MnBP (81%) and MECPP (86%). Median MnBP and MECPP levels in pregnant Taiwanese women were 21.5 and 17.6 μg/g-creatinine, respectively, that decreased after the 2011 Taiwan DEHP scandal. Results of principal component analysis suggested two major sources (DEHP and other phthalates) of phthalates exposure in pregnant women. After adjusting for age, gestational age, TBG, urinary creatinine, and other phthalate metabolites, we found a significantly negative association between urinary MnBP levels and serum T4 (β = –5.41; p-value = 0.012; n = 97) in pregnant women using Bonferroni correction. Conclusion We observed a potential change in the thyroid hormones of pregnant women during early pregnancy after DnBP exposure. Additional study is necessitated to clarify these associations. PMID:27455052
Simonyan, Kristina; Berman, Brian D; Herscovitch, Peter; Hallett, Mark
2013-09-11
Spasmodic dysphonia is a primary focal dystonia characterized by involuntary spasms in the laryngeal muscles during speech production. The pathophysiology of spasmodic dysphonia is thought to involve structural and functional abnormalities in the basal ganglia-thalamo-cortical circuitry; however, neurochemical correlates underpinning these abnormalities as well as their relations to spasmodic dysphonia symptoms remain unknown. We used positron emission tomography with the radioligand [(11)C]raclopride (RAC) to study striatal dopaminergic neurotransmission at the resting state and during production of symptomatic sentences and asymptomatic finger tapping in spasmodic dysphonia patients. We found that patients, compared to healthy controls, had bilaterally decreased RAC binding potential (BP) to striatal dopamine D2/D3 receptors on average by 29.2%, which was associated with decreased RAC displacement (RAC ΔBP) in the left striatum during symptomatic speaking (group average difference 10.2%), but increased RAC ΔBP in the bilateral striatum during asymptomatic tapping (group average difference 10.1%). Patients with more severe voice symptoms and subclinically longer reaction time to initiate the tapping sequence had greater RAC ΔBP measures, while longer duration of spasmodic dysphonia was associated with a decrease in task-induced RAC ΔBP. Decreased dopaminergic transmission during symptomatic speech production may represent a disorder-specific pathophysiological trait involved in symptom generation, whereas increased dopaminergic function during unaffected task performance may be explained by a compensatory adaptation of the nigrostriatal dopaminergic system possibly due to decreased striatal D2/D3 receptor availability. These changes can be linked to the clinical and subclinical features of spasmodic dysphonia and may represent the neurochemical basis of basal ganglia alterations in this disorder.
Berman, Brian D.; Herscovitch, Peter; Hallett, Mark
2013-01-01
Spasmodic dysphonia is a primary focal dystonia characterized by involuntary spasms in the laryngeal muscles during speech production. The pathophysiology of spasmodic dysphonia is thought to involve structural and functional abnormalities in the basal ganglia–thalamo-cortical circuitry; however, neurochemical correlates underpinning these abnormalities as well as their relations to spasmodic dysphonia symptoms remain unknown. We used positron emission tomography with the radioligand [11C]raclopride (RAC) to study striatal dopaminergic neurotransmission at the resting state and during production of symptomatic sentences and asymptomatic finger tapping in spasmodic dysphonia patients. We found that patients, compared to healthy controls, had bilaterally decreased RAC binding potential (BP) to striatal dopamine D2/D3 receptors on average by 29.2%, which was associated with decreased RAC displacement (RAC ΔBP) in the left striatum during symptomatic speaking (group average difference 10.2%), but increased RAC ΔBP in the bilateral striatum during asymptomatic tapping (group average difference 10.1%). Patients with more severe voice symptoms and subclinically longer reaction time to initiate the tapping sequence had greater RAC ΔBP measures, while longer duration of spasmodic dysphonia was associated with a decrease in task-induced RAC ΔBP. Decreased dopaminergic transmission during symptomatic speech production may represent a disorder-specific pathophysiological trait involved in symptom generation, whereas increased dopaminergic function during unaffected task performance may be explained by a compensatory adaptation of the nigrostriatal dopaminergic system possibly due to decreased striatal D2/D3 receptor availability. These changes can be linked to the clinical and subclinical features of spasmodic dysphonia and may represent the neurochemical basis of basal ganglia alterations in this disorder. PMID:24027271
Differential pharmacology and benefit/risk of azilsartan compared to other sartans.
Kurtz, Theodore W; Kajiya, Takashi
2012-01-01
Azilsartan, an angiotensin II type 1 (AT(1)) receptor blocker (ARB), was recently approved by regulatory authorities for treatment of hypertension and is the 8th ARB to join the clinical market. This article discusses the medical reasons for introducing a new AT(1) receptor blocker and reviews the experimental and clinical studies that have compared the functional properties of azilsartan to those of other ARBs. The main question addressed is: Does azilsartan have distinguishing features that should motivate choosing it over any of the other sartans for use in clinical practice? Based on studies conducted to date in hypertensive patients without serious comorbidities, azilsartan appears to be characterized by a superior ability to control 24-hour systolic blood pressure (BP) relative to other widely used ARBs including valsartan, olmesartan, and candesartan, and presumably others as well (eg, losartan). Compared to these other ARBs, azilsartan may increase the BP target control and response rate by an absolute value of 8%-10%. Greater antihypertensive effects of azilsartan might be due in part to its unusually potent and persistent ability to inhibit binding of angiotensin II to AT(1) receptors. Preclinical studies have indicated that azilsartan may also have potentially beneficial effects on cellular mechanisms of cardiometabolic disease and insulin sensitizing activity that could involve more than just blockade of AT(1) receptors and/or reduction in BP. However, the clinical relevance of these additional actions is unknown. Given that the general ability of antihypertensive drugs to protect against target organ damage is largely mediated by their ability to decrease BP, the enhanced antihypertensive effects of azilsartan should serve to justify clinical interest in this ARB relative to other molecules in the class that have a lower capacity to reduce BP.
Differential pharmacology and benefit/risk of azilsartan compared to other sartans
Kurtz, Theodore W; Kajiya, Takashi
2012-01-01
Azilsartan, an angiotensin II type 1 (AT1) receptor blocker (ARB), was recently approved by regulatory authorities for treatment of hypertension and is the 8th ARB to join the clinical market. This article discusses the medical reasons for introducing a new AT1 receptor blocker and reviews the experimental and clinical studies that have compared the functional properties of azilsartan to those of other ARBs. The main question addressed is: Does azilsartan have distinguishing features that should motivate choosing it over any of the other sartans for use in clinical practice? Based on studies conducted to date in hypertensive patients without serious comorbidities, azilsartan appears to be characterized by a superior ability to control 24-hour systolic blood pressure (BP) relative to other widely used ARBs including valsartan, olmesartan, and candesartan, and presumably others as well (eg, losartan). Compared to these other ARBs, azilsartan may increase the BP target control and response rate by an absolute value of 8%–10%. Greater antihypertensive effects of azilsartan might be due in part to its unusually potent and persistent ability to inhibit binding of angiotensin II to AT1 receptors. Preclinical studies have indicated that azilsartan may also have potentially beneficial effects on cellular mechanisms of cardiometabolic disease and insulin sensitizing activity that could involve more than just blockade of AT1 receptors and/or reduction in BP. However, the clinical relevance of these additional actions is unknown. Given that the general ability of antihypertensive drugs to protect against target organ damage is largely mediated by their ability to decrease BP, the enhanced antihypertensive effects of azilsartan should serve to justify clinical interest in this ARB relative to other molecules in the class that have a lower capacity to reduce BP. PMID:22399858
Tracer Kinetic Analysis of (S)-¹⁸F-THK5117 as a PET Tracer for Assessing Tau Pathology.
Jonasson, My; Wall, Anders; Chiotis, Konstantinos; Saint-Aubert, Laure; Wilking, Helena; Sprycha, Margareta; Borg, Beatrice; Thibblin, Alf; Eriksson, Jonas; Sörensen, Jens; Antoni, Gunnar; Nordberg, Agneta; Lubberink, Mark
2016-04-01
Because a correlation between tau pathology and the clinical symptoms of Alzheimer disease (AD) has been hypothesized, there is increasing interest in developing PET tracers that bind specifically to tau protein. The aim of this study was to evaluate tracer kinetic models for quantitative analysis and generation of parametric images for the novel tau ligand (S)-(18)F-THK5117. Nine subjects (5 with AD, 4 with mild cognitive impairment) received a 90-min dynamic (S)-(18)F-THK5117 PET scan. Arterial blood was sampled for measurement of blood radioactivity and metabolite analysis. Volume-of-interest (VOI)-based analysis was performed using plasma-input models; single-tissue and 2-tissue (2TCM) compartment models and plasma-input Logan and reference tissue models; and simplified reference tissue model (SRTM), reference Logan, and SUV ratio (SUVr). Cerebellum gray matter was used as the reference region. Voxel-level analysis was performed using basis function implementations of SRTM, reference Logan, and SUVr. Regionally averaged voxel values were compared with VOI-based values from the optimal reference tissue model, and simulations were made to assess accuracy and precision. In addition to 90 min, initial 40- and 60-min data were analyzed. Plasma-input Logan distribution volume ratio (DVR)-1 values agreed well with 2TCM DVR-1 values (R(2)= 0.99, slope = 0.96). SRTM binding potential (BP(ND)) and reference Logan DVR-1 values were highly correlated with plasma-input Logan DVR-1 (R(2)= 1.00, slope ≈ 1.00) whereas SUVr(70-90)-1 values correlated less well and overestimated binding. Agreement between parametric methods and SRTM was best for reference Logan (R(2)= 0.99, slope = 1.03). SUVr(70-90)-1 values were almost 3 times higher than BP(ND) values in white matter and 1.5 times higher in gray matter. Simulations showed poorer accuracy and precision for SUVr(70-90)-1 values than for the other reference methods. SRTM BP(ND) and reference Logan DVR-1 values were not affected by a shorter scan duration of 60 min. SRTM BP(ND) and reference Logan DVR-1 values were highly correlated with plasma-input Logan DVR-1 values. VOI-based data analyses indicated robust results for scan durations of 60 min. Reference Logan generated quantitative (S)-(18)F-THK5117 DVR-1 parametric images with the greatest accuracy and precision and with a much lower white-matter signal than seen with SUVr(70-90)-1 images. © 2016 by the Society of Nuclear Medicine and Molecular Imaging, Inc.
Naturally occurring deletions of hunchback binding sites in the even-skipped stripe 3+7 enhancer.
Palsson, Arnar; Wesolowska, Natalia; Reynisdóttir, Sigrún; Ludwig, Michael Z; Kreitman, Martin
2014-01-01
Changes in regulatory DNA contribute to phenotypic differences within and between taxa. Comparative studies show that many transcription factor binding sites (TFBS) are conserved between species whereas functional studies reveal that some mutations segregating within species alter TFBS function. Consistently, in this analysis of 13 regulatory elements in Drosophila melanogaster populations, single base and insertion/deletion polymorphism are rare in characterized regulatory elements. Experimentally defined TFBS are nearly devoid of segregating mutations and, as has been shown before, are quite conserved. For instance 8 of 11 Hunchback binding sites in the stripe 3+7 enhancer of even-skipped are conserved between D. melanogaster and Drosophila virilis. Oddly, we found a 72 bp deletion that removes one of these binding sites (Hb8), segregating within D. melanogaster. Furthermore, a 45 bp deletion polymorphism in the spacer between the stripe 3+7 and stripe 2 enhancers, removes another predicted Hunchback site. These two deletions are separated by ∼250 bp, sit on distinct haplotypes, and segregate at appreciable frequency. The Hb8Δ is at 5 to 35% frequency in the new world, but also shows cosmopolitan distribution. There is depletion of sequence variation on the Hb8Δ-carrying haplotype. Quantitative genetic tests indicate that Hb8Δ affects developmental time, but not viability of offspring. The Eve expression pattern differs between inbred lines, but the stripe 3 and 7 boundaries seem unaffected by Hb8Δ. The data reveal segregating variation in regulatory elements, which may reflect evolutionary turnover of characterized TFBS due to drift or co-evolution.
Barret, Olivier; Alagille, David; Sanabria, Sandra; Comley, Robert A; Weimer, Robby M; Borroni, Edilio; Mintun, Mark; Seneca, Nicholas; Papin, Caroline; Morley, Thomas; Marek, Ken; Seibyl, John P; Tamagnan, Gilles D; Jennings, Danna
2017-07-01
18 F-AV-1451 is currently the most widely used of several experimental tau PET tracers. The objective of this study was to evaluate 18 F-AV-1451 binding with full kinetic analysis using a metabolite-corrected arterial input function and to compare parameters derived from kinetic analysis with SUV ratio (SUVR) calculated over different imaging time intervals. Methods: 18 F-AV-1451 PET brain imaging was completed in 16 subjects: 4 young healthy volunteers (YHV), 4 aged healthy volunteers (AHV), and 8 Alzheimer disease (AD) subjects. Subjects were imaged for 3.5 h, with arterial blood samples obtained throughout. PET data were analyzed using plasma and reference tissue-based methods to estimate the distribution volume, binding potential (BP ND ), and SUVR. BP ND and SUVR were calculated using the cerebellar cortex as a reference region and were compared across the different methods and across the 3 groups (YHV, AHV, and AD). Results: AD demonstrated increased 18 F-AV-1451 retention compared with YHV and AHV based on both invasive and noninvasive analyses in cortical regions in which paired helical filament tau accumulation is expected in AD. A correlation of R 2 > 0.93 was found between BP ND (130 min) and SUVR-1 at all time intervals. Cortical SUVR curves reached a relative plateau around 1.0-1.2 for YHV and AHV by approximately 50 min, but increased in AD by up to approximately 20% at 110-130 min and approximately 30% at 160-180 min relative to 80-100 min. Distribution volume (130 min) was lower by 30%-35% in the YHV than AHV. Conclusion: Our data suggest that although 18 F-AV-1451 SUVR curves do not reach a plateau and are still increasing in AD, an SUVR calculated over an imaging window of 80-100 min (as currently used in clinical studies) provides estimates of paired helical filament tau burden in good correlation with BP ND , whereas SUVR sensitivity to regional cerebral blood changes needs further investigation. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.
CacyBP/SIP promotes the proliferation of colon cancer cells
Chen, Xiong; Wang, Jun; Lu, Yuanyuan; Zhang, Faming; Liu, Zhengxiong; Lei, Ting; Fan, Daiming
2017-01-01
CacyBP/SIP is a component of the ubiquitin pathway and is overexpressed in several transformed tumor tissues, including colon cancer, which is one of the most common cancers worldwide. It is unknown whether CacyBP/SIP promotes the proliferation of colon cancer cells. This study examined the expression level, subcellular localization, and binding activity of CacyBP/SIP in human colon cancer cells in the presence and absence of the hormone gastrin. We found that CacyBP/SIP was expressed in a high percentage of colon cancer cells, but not in normal colonic surface epithelium. CacyBP/SIP promoted the cell proliferation of colon cancer cells under both basal and gastrin stimulated conditions as shown by knockdown studies. Gastrin stimulation triggered the translocation of CacyBP/SIP to the nucleus, and enhanced interaction between CacyBP/SIP and SKP1, a key component of ubiquitination pathway which further mediated the proteasome-dependent degradation of p27kip1 protein. The gastrin induced reduction in p27kip1 was prevented when cells were treated with the proteasome inhibitor MG132. These results suggest that CacyBP/SIP may be promoting growth of colon cancer cells by enhancing ubiquitin-mediated degradation of p27kip1. PMID:28196083
Saldarriaga, Omar A.; Travi, Bruno L.; Choudhury, Goutam Ghosh; Melby, Peter C.
2012-01-01
IFN-γ/LPS-activated hamster (Mesocricetus auratus) macrophages express significantly less iNOS (NOS2) than activated mouse macrophages, which contributes to the hamster's susceptibility to intracellular pathogens. We determined a mechanism responsible for differences in iNOS promoter activity in hamsters and mice. The HtPP (1.2 kb) showed low basal and inducible promoter activity when compared with the mouse, and sequences within a 100-bp region (−233 to −133) of the mouse and hamster promoters influenced this activity. Moreover, within this 100 bp, we identified a smaller region (44 bp) in the mouse promoter, which recovered basal promoter activity when swapped into the hamster promoter. The mouse homolog (100-bp region) contained a cis-element for NF-IL-6 (−153/−142), which was absent in the hamster counterpart. EMSA and supershift assays revealed that the hamster sequence did not support the binding of NF-IL-6. Introduction of a functional NF-IL-6 binding sequence into the hamster promoter or its alteration in the mouse promoter revealed the critical importance of this transcription factor for full iNOS promoter activity. Furthermore, the binding of NF-IL-6 to the iNOS promoter (−153/−142) in vivo was increased in mouse cells but was reduced in hamster cells after IFN-γ/LPS stimulation. Differences in the activity of the iNOS promoters were evident in mouse and hamster cells, so they were not merely a result of species-specific differences in transcription factors. Thus, we have identified unique DNA sequences and a critical transcription factor, NF-IL-6, which contribute to the overall basal and inducible expression of hamster iNOS. PMID:22517919
Hernández-Tamayo, Rogelio; Sohlenkamp, Christian; Puente, José Luis; Brom, Susana
2013-01-01
Site-specific recombination occurs at short specific sequences, mediated by the cognate recombinases. IntA is a recombinase from Rhizobium etli CFN42 and belongs to the tyrosine recombinase family. It allows cointegration of plasmid p42a and the symbiotic plasmid via site-specific recombination between attachment regions (attA and attD) located in each replicon. Cointegration is needed for conjugative transfer of the symbiotic plasmid. To characterize this system, two plasmids harboring the corresponding attachment sites and intA were constructed. Introduction of these plasmids into R. etli revealed IntA-dependent recombination events occurring at high frequency. Interestingly, IntA promotes not only integration, but also excision events, albeit at a lower frequency. Thus, R. etli IntA appears to be a bidirectional recombinase. IntA was purified and used to set up electrophoretic mobility shift assays with linear fragments containing attA and attD. IntA-dependent retarded complexes were observed only with fragments containing either attA or attD. Specific retarded complexes, as well as normal in vivo recombination abilities, were seen even in derivatives harboring only a minimal attachment region (comprising the 5-bp central region flanked by 9- to 11-bp inverted repeats). DNase I-footprinting assays with IntA revealed specific protection of these zones. Mutations that disrupt the integrity of the 9- to 11-bp inverted repeats abolish both specific binding and recombination ability, while mutations in the 5-bp central region severely reduce both binding and recombination. These results show that IntA is a bidirectional recombinase that binds to att regions without requiring neighboring sequences as enhancers of recombination. PMID:23935046
1988-01-01
We report the organization of the human genes encoding the complement components C4-binding protein (C4BP), C3b/C4b receptor (CR1), decay accelerating factor (DAF), and C3dg receptor (CR2) within the regulator of complement activation (RCA) gene cluster. Using pulsed field gel electrophoresis analysis these genes have been physically linked and aligned as CR1-CR2-DAF-C4BP in an 800-kb DNA segment. The very tight linkage between the CR1 and the C4BP loci, contrasted with the relative long DNA distance between these genes, suggests the existence of mechanisms interfering with recombination within the RCA gene cluster. PMID:2450163
García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M
2005-06-01
A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ray, R.; Logan, J.; Ray, R.
Evidence points to the endogenous opioid system, and the mu-opioid receptor (MOR) in particular, in mediating the rewarding effects of drugs of abuse, including nicotine. A single nucleotide polymorphism (SNP) in the human MOR gene (OPRM1 A118G) has been shown to alter receptor protein level in preclinical models and smoking behavior in humans. To clarify the underlying mechanisms for these associations, we conducted an in vivo investigation of the effects of OPRM1 A118G genotype on MOR binding potential (BP{sub ND} or receptor availability). Twenty-two smokers prescreened for genotype (12 A/A, 10 */G) completed two [{sup 11}C] carfentanil positron emission tomographymore » (PET) imaging sessions following overnight abstinence and exposure to a nicotine-containing cigarette and a denicotinized cigarette. Independent of session, smokers homozygous for the wild-type OPRM1 A allele exhibited significantly higher levels of MOR BP{sub ND} than smokers carrying the G allele in bilateral amygdala, left thalamus, and left anterior cingulate cortex. Among G allele carriers, the extent of subjective reward difference (denicotinized versus nicotine cigarette) was associated significantly with MOR BP{sub ND} difference in right amygdala, caudate, anterior cingulate cortex, and thalamus. Future translational investigations can elucidate the role of MORs in nicotine addiction, which may lead to development of novel therapeutics.« less
Yamauchi, John G.; Gomez, Kimberly; Grimster, Neil; Dufouil, Mikael; Nemecz, Ákos; Fotsing, Joseph R.; Ho, Kwok-Yiu; Talley, Todd T.; Sharpless, K. Barry; Fokin, Valery V.
2012-01-01
The acetylcholine-binding proteins (AChBPs), which serve as structural surrogates for the extracellular domain of nicotinic acetylcholine receptors (nAChRs), were used as reaction templates for in situ click-chemistry reactions to generate a congeneric series of triazoles from azide and alkyne building blocks. The catalysis of in situ azide-alkyne cycloaddition reactions at a dynamic subunit interface facilitated the synthesis of potentially selective compounds for nAChRs. We investigated compound sets generated in situ with soluble AChBP templates through pharmacological characterization with α7 and α4β2 nAChRs and 5-hydroxytryptamine type 3A receptors. Analysis of activity differences between the triazole 1,5-syn- and 1,4-anti-isomers showed a preference for the 1,4-anti-triazole regioisomers among nAChRs. To improve nAChR subtype selectivity, the highest-potency building block for α7 nAChRs, i.e., 3α-azido-N-methylammonium tropane, was used for additional in situ reactions with a mutated Aplysia californica AChBP that was made to resemble the ligand-binding domain of the α7 nAChR. Fourteen of 50 possible triazole products were identified, and their corresponding tertiary analogs were synthesized. Pharmacological assays revealed that the mutated binding protein template provided enhanced selectivity of ligands through in situ reactions. Discrete trends in pharmacological profiles were evident, with most compounds emerging as α7 nAChR agonists and α4β2 nAChR antagonists. Triazoles bearing quaternary tropanes and aromatic groups were most potent for α7 nAChRs. Pharmacological characterization of the in situ reaction products established that click-chemistry synthesis with surrogate receptor templates offered novel extensions of fragment-based drug design that were applicable to multisubunit ion channels. PMID:22784805
Krajicek, Bryan J.; Kottom, Theodore J.; Villegas, Leah
2010-01-01
Pneumocystis carinii (Pc) causes severe pneumonia in immunocompromised hosts. The binding of Pc trophic forms to alveolar epithelial cells is a central feature of infection, inducing the expression and activation of PcSte20, a gene participating in mating, proliferation, and pseudohyphal growth. In related fungi, Ste20 proteins are generally activated by immediate upstream small G proteins of the Cdc42-like family. PcCdc42 has not been previously described in Pneumocystis. To address the potential role of such a G protein in Pneumocystis, PcCdc42 was cloned from a Pc cDNA library. Using the full-length 576-bp PcCdc42 cDNA sequence, a CHEF blot of genomic DNA yielded a single band, providing evidence that this gene is present as a single copy within the genome. The total length of PcCdc42 cDNA was 576 bp with an estimated molecular mass of ∼38 kDa. BLASTP analysis demonstrated greater than 80% homology with other fungal Cdc42p proteins. Northern analysis indicated equal mRNA expression in both cystic and trophic life forms. Heterologous expression of PcCdc42 in Saccharomyces cerevisiae (Sc) demonstrated that PcCdc42p was able to restore growth in an ScCdc42Δ yeast strain. Additional assays with purified PcCdc42 protein demonstrated GTP binding and intrinsic GTPase activity, which was partially but significantly suppressed by Clostridium difficile toxin B, characteristic of Cdc42 GTPases. Furthermore, PcCdc42 protein was also shown to bind to the downstream PCSte20 kinase partner in the presence (but not the absence) of GTP. These data indicate that Pc possesses a Cdc42 gene expressing an active G protein, which binds the downstream regulatory kinase PcSte20, important in Pc life cycle regulation. PMID:19915161
Künzler, Markus; Gerstberger, Thomas; Stutz, Françoise; Bischoff, F. Ralf; Hurt, Ed
2000-01-01
The RanGTP-binding protein RanBP1, which is located in the cytoplasm, has been implicated in release of nuclear export complexes from the cytoplasmic side of the nuclear pore complex. Here we show that Yrb1 (the yeast homolog of RanBP1) shuttles between the nucleus and the cytoplasm. Nuclear import of Yrb1 is a facilitated process that requires a short basic sequence within the Ran-binding domain (RBD). By contrast, nuclear export of Yrb1 requires an intact RBD, which forms a ternary complex with the Xpo1 (Crm1) NES receptor in the presence of RanGTP. Nuclear export of Yrb1, however, is insensitive towards leptomycin B, suggesting a novel type of substrate recognition between Yrb1 and Xpo1. Taken together, these data suggest that ongoing nuclear import and export is an important feature of Yrb1 function in vivo. PMID:10825193
Zhao, A; Guo, A; Liu, Z; Pape, L
1997-01-01
The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645
Ray, Nicola J.; Miyasaki, Janis M.; Zurowski, Mateusz; Ko, Ji Hyun; Cho, Sang Soo; Pellecchia, Giovanna; Antonelli, Francesca; Houle, Sylvain; Lang, Anthony E.; Strafella, Antonio P.
2012-01-01
Impulse control disorders such as pathological gambling (PG) are a serious and common adverse effect of dopamine (DA) replacement medication in Parkinson’s disease (PD). Patients with PG have increased impulsivity and abnormalities in striatal DA, in common with behavioural and substance addictions in the non-PD population. To date, no studies have investigated the role of extrastriatal dopaminergic abnormalities in PD patients with PG. We used the PET radiotracer, [11C] FLB-457, with high-affinity for extrastriatal DA D2/3 receptors. 14 PD patients on DA agonists were imaged while they performed a gambling task involving real monetary reward and a control task. Trait impulsivity was measured with the Barratt Impulsivity Scale (BIS). Seven of the patients had a history of PG that developed subsequent to DA agonist medication. Change in [11C] FLB-457 binding potential (BP) during gambling was reduced in PD with PG patients in the midbrain, where D2/D3 receptors are dominated by autoreceptors. The degree of change in [11C] FLB-457 binding in this region correlated with impulsivity. In the cortex, [11C] FLB-457 BP was significantly greater in the anterior cingulate cortex (ACC) in PD patients with PG during the control task, and binding in this region was also correlated with impulsivity. Our findings provide the first evidence that PD patients with PG have dysfunctional activation of DA autoreceptors in the midbrain and low DA tone in the ACC. Thus, altered striatal and cortical DA homeostasis may incur vulnerability for the development of PG in PD, linked with the impulsive personality trait. PMID:22766031
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Effects of ghrelin gene genotypes on the growth traits in Chinese cattle.
Zhang, Ai-ling; Zhang, Li; Zhang, Liang-zhi; Zhang, Cun-fang; Lan, Xian-yong; Zhang, Chun-lei; Chen, Hong
2012-06-01
Ghrelin is an important peptide that stimulates food intake and regulates energy balance of animals. Single nucleotide polymorphisms of ghrelin gene in three Chinese cattle populations were investigated through PCR-SSCP and DNA sequencing. Five over-lapped DNA fragments were analyzed and a total of three ones exhibited different genotypes. Three genotypes and four SNPs (-415 A > G, -414 T > C, -321 C > A, and -172 A > G) were found on the -544 to +35 bp region (G-1) of ghrelin gene. On the locus of -1037 to -509 bp (G-2), two genotypes and one SNP (-726 A > T) were discovered. And in the exon1, exon2, and intron1 (G-4 locus, (+4 to +427)), two genotypes and one SNP were detected (+205 C > T, located in intron1). Positions of the five SNPs in the 5′ regulatory region might be the transcription factor binding sites. The SNPs at -415 and -414 in the core binding sequence were found to cause the change of the site. Though the SNP at -172 did not change the binding site, it generated one new site at the same time. The frequencies of the genotypes varied differently in the three breeds. Results of ANOVA showed that G-1 was correlative to the ischium width (IW) of Nanyang cattle aged 18 months (p = 0.043). The least square analysis between genotypes at G-1 locus and growth traits in Nanyang cattle showed that the individuals (aged 18 months) with C genotype had greater IW than that of the other two genotypes. The C genotype might serve as one potential candidate genetic marker for cattle growth and development.
Chan, Chien-Yi; Huang, Shih-Yi; Sheu, Jim Jinn-Chyuan; Roth, Mendel M; Chou, I-Tai; Lien, Chia-Hsien; Lee, Ming-Fen; Huang, Chun-Yin
2017-02-28
Either FOXO1 or HBP1 transcription factor is a downstream effector of the PI3K/Akt pathway and associated with tumorigenesis. However, the relationship between FOXO1 and HBP1 in oral cancer remains unclear. Analysis of 30 oral tumor specimens revealed that mean mRNA levels of both FOXO1 and HBP1 in non-invasive and invasive oral tumors were found to be significantly lower than that of the control tissues, and the status of low FOXO1 and HBP1 (< 0.3 fold of the control) was associated with invasiveness of oral tumors. To investigate if HBP1 is a direct transcription target of FOXO1, we searched potential FOXO1 binding sites in the HBP1 promoter using the MAPPER Search Engine, and two putative FOXO1 binding sites located in the HBP1 promoter -132 to -125 bp and -343 to -336 bp were predicted. These binding sites were then confirmed by both reporter gene assays and the in cellulo ChIP assay. In addition, Akt activity manipulated by PI3K inhibitor LY294002 or Akt mutants was shown to negatively affect FOXO1-mediated HBP1 promoter activation and gene expression. Last, the biological significance of the FOXO1-HBP1 axis in oral cancer malignancy was evaluated in cell growth, colony formation, and invasiveness. The results indicated that HBP1 knockdown potently promoted malignant phenotypes of oral cancer and the suppressive effect of FOXO1 on cell growth, colony formation, and invasion was alleviated upon HBP1 knockdown in invasive oral cancer cells. Taken together, our data provide evidence for HBP1 as a direct downstream target of FOXO1 in oral cancer malignancy.
Šerý, Omar; Paclt, Ivo; Drtílková, Ivana; Theiner, Pavel; Kopečková, Marta; Zvolský, Petr; Balcar, Vladimir J
2015-06-11
ADHD and alcoholism are psychiatric diseases with pathophysiology related to dopamine system. DAT1 belongs to the SLC6 family of transporters and is involved in the regulation of extracellular dopamine levels. A 40 bp variable number tandem repeat (VNTR) polymorphism in the 3'-untranslated region of DAT1/SLC6A3 gene was previously reported to be associated with various phenotypes involving disturbed regulation of dopaminergic neurotransmission. A total of 1312 subjects were included and genotyped for 40 bp VNTR polymorphism of DAT1/SLC6A3 gene in this study (441 alcoholics, 400 non-alcoholic controls, 218 ADHD children and 253 non ADHD children). Using miRBase software, we have performed a computer analysis of VNTR part of DAT1 gene for presence of miRNA binding sites. We have found significant relationships between ADHD and the 40 bp VNTR polymorphisms of DAT1/SLC6A3 gene (P < 0.01). The 9/9 genotype appeared to reduce the risk of ADHD about 0.4-fold (p < 0.04). We also noted an occurrence of rare genotypes in ADHD (frequency different from controls at p < 0.01). No association between alcoholism and genotype frequencies of 40 bp VNTR polymorphism of DAT1/SLC6A3 gene has been detected. We have found an association between 40 bp VNTR polymorphism of DAT1/SLC6A3 gene and ADHD in the Czech population; in a broad agreement with studies in other population samples. Furthermore, we detected rare genotypes 8/10, 7/10 and 10/11 present in ADHD boys only and identified miRNAs that should be looked at as potential novel targets in the research on ADHD.
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069
Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford
2006-01-01
The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.
Maucuer, Alexandre; Desforges, Bénédicte; Joshi, Vandana; Boca, Mirela; Kretov, Dmitry; Hamon, Loic; Bouhss, Ahmed; Curmi, Patrick A; Pastré, David
2018-05-04
Liquid-liquid phase separation enables compartmentalization of biomolecules in cells, notably RNA and associated proteins in the nucleus. Besides critical functions in RNA processing, there is a major interest in deciphering the molecular mechanisms of compartmentalization orchestrated by RNA-binding proteins such as TDP-43 and FUS due to their link to neuron diseases. However, tools for probing compartmentalization in cells are lacking. Here we developed a method to analyze the mixing:demixing of two different phases in a cellular context. The principle is the following: mRNA-binding proteins are confined on microtubules and quantitative parameters defining their spatial segregation are measured along the microtubule network. Through this approach, we found that four mRNA binding proteins, HuR, G3BP1, TDP-43 and FUS form mRNA-rich liquid-like compartments on microtubules. TDP-43 is partly miscible with FUS but immiscible with either HuR or G3BP1. We also demonstrate that mRNA is essential to capture the mixing:demixing behavior of RNA-binding proteins in cells. Altogether we show that microtubules can be used as platforms to understand the mechanisms underlying liquid-liquid phase separation and their deregulation in human diseases. © 2018. Published by The Company of Biologists Ltd.
Malm, Sven; Jusko, Monika; Eick, Sigrun; Potempa, Jan; Riesbeck, Kristian; Blom, Anna M.
2012-01-01
Infection with the Gram-negative pathogen Prevotella intermedia gives rise to periodontitis and a growing number of studies implies an association of P. intermedia with rheumatoid arthritis. The serine protease Factor I (FI) is the central inhibitor of complement degrading complement components C3b and C4b in the presence of cofactors such as C4b-binding protein (C4BP) and Factor H (FH). Yet, the significance of complement inhibitor acquisition in P. intermedia infection and FI binding by Gram-negative pathogens has not been addressed. Here we show that P. intermedia isolates bound purified FI as well as FI directly from heat-inactivated human serum. FI bound to bacteria retained its serine protease activity as shown in degradation experiments with 125I-labeled C4b. Since FI requires cofactors for its activity we also investigated the binding of purified cofactors C4BP and FH and found acquisition of both proteins, which retained their activity in FI mediated degradation of C3b and C4b. We propose that FI binding by P. intermedia represents a new mechanism contributing to complement evasion by a Gram-negative bacterial pathogen associated with chronic diseases. PMID:22514678
Malm, Sven; Jusko, Monika; Eick, Sigrun; Potempa, Jan; Riesbeck, Kristian; Blom, Anna M
2012-01-01
Infection with the Gram-negative pathogen Prevotella intermedia gives rise to periodontitis and a growing number of studies implies an association of P. intermedia with rheumatoid arthritis. The serine protease Factor I (FI) is the central inhibitor of complement degrading complement components C3b and C4b in the presence of cofactors such as C4b-binding protein (C4BP) and Factor H (FH). Yet, the significance of complement inhibitor acquisition in P. intermedia infection and FI binding by Gram-negative pathogens has not been addressed. Here we show that P. intermedia isolates bound purified FI as well as FI directly from heat-inactivated human serum. FI bound to bacteria retained its serine protease activity as shown in degradation experiments with (125)I-labeled C4b. Since FI requires cofactors for its activity we also investigated the binding of purified cofactors C4BP and FH and found acquisition of both proteins, which retained their activity in FI mediated degradation of C3b and C4b. We propose that FI binding by P. intermedia represents a new mechanism contributing to complement evasion by a Gram-negative bacterial pathogen associated with chronic diseases.
Ihara, Makoto; Okajima, Toshihide; Yamashita, Atsuko; Oda, Takuma; Hirata, Koichi; Nishiwaki, Hisashi; Morimoto, Takako; Akamatsu, Miki; Ashikawa, Yuji; Kuroda, Shun’ichi; Mega, Ryosuke; Kuramitsu, Seiki; Sattelle, David B.
2008-01-01
Neonicotinoid insecticides, which act on nicotinic acetylcholine receptors (nAChRs) in a variety of ways, have extremely low mammalian toxicity, yet the molecular basis of such actions is poorly understood. To elucidate the molecular basis for nAChR–neonicotinoid interactions, a surrogate protein, acetylcholine binding protein from Lymnaea stagnalis (Ls-AChBP) was crystallized in complex with neonicotinoid insecticides imidacloprid (IMI) or clothianidin (CTD). The crystal structures suggested that the guanidine moiety of IMI and CTD stacks with Tyr185, while the nitro group of IMI but not of CTD makes a hydrogen bond with Gln55. IMI showed higher binding affinity for Ls-AChBP than that of CTD, consistent with weaker CH–π interactions in the Ls-AChBP–CTD complex than in the Ls-AChBP–IMI complex and the lack of the nitro group-Gln55 hydrogen bond in CTD. Yet, the NH at position 1 of CTD makes a hydrogen bond with the backbone carbonyl of Trp143, offering an explanation for the diverse actions of neonicotinoids on nAChRs. PMID:18338186
Li, Zhizhong; Zhang, Yunyu; Ramanujan, Krishnan; Ma, Yan; Kirsch, David G.; Glass, David J.
2013-01-01
Embryonic rhabdomyosarcoma (ERMS) is the most common soft-tissue tumor in children. Here, we report the identification of the minor groove DNA-binding factor high mobility group AT-hook 2 (HMGA2) as a driver of ERMS development. HMGA2 was highly expressed in normal myoblasts and ERMS cells, where its expression was essential to maintain cell proliferation, survival in vitro, and tumor outgrowth in vivo. Mechanistic investigations revealed that upregulation of the insulin–like growth factor (IGF) mRNA-binding protein IGF2BP2 was critical for HMGA2 action. In particular, IGF2BP2 was essential for mRNA and protein stability of NRAS, a frequently mutated gene in ERMS. shRNA-mediated attenuation of NRAS or pharmacologic inhibition of the MAP-ERK kinase (MEK)/extracellular signal-regulated kinase (ERK) effector pathway showed that NRAS and NRAS-mediated signaling was required for tumor maintenance. Taken together, these findings implicate the HMGA2–IGFBP2–NRAS signaling pathway as a critical oncogenic driver in ERMS. PMID:23536553
Tavares, Adriana Alexandre S; Lewsey, James; Dewar, Deborah; Pimlott, Sally L
2012-01-01
Previously, development of novel brain radiotracers has largely relied on simple screening tools. Improved selection methods at the early stages of radiotracer discovery and an increased understanding of the relationships between in vitro physicochemical and in vivo radiotracer properties are needed. We investigated if high performance liquid chromatography (HPLC) methodologies could provide criteria for lead candidate selection by comparing HPLC measurements with radiotracer properties in humans. Ten molecules, previously used as radiotracers in humans, were analysed to obtain the following measures: partition coefficient (Log P); permeability (P(m)); percentage of plasma protein binding (%PPB); and membrane partition coefficient (K(m)). Relationships between brain entry measurements (Log P, P(m) and %PPB) and in vivo brain percentage injected dose (%ID); and K(m) and specific binding in vivo (BP(ND)) were investigated. Log P values obtained using in silico packages and flask methods were compared with Log P values obtained using HPLC. The modelled associations with %ID were stronger for %PPB (r(2)=0.65) and P(m) (r(2)=0.77) than for Log P (r(2)=0.47) while 86% of BP(ND) variance was explained by K(m). Log P values were variable dependant on the methodology used. Log P should not be relied upon as a predictor of blood-brain barrier penetration during brain radiotracer discovery. HPLC measurements of permeability, %PPB and membrane interactions may be potentially useful in predicting in vivo performance and hence allow evaluation and ranking of compound libraries for the selection of lead radiotracer candidates at early stages of radiotracer discovery. Copyright © 2012 Elsevier Inc. All rights reserved.
Hung, Victoria; Lam, Stephanie S; Udeshi, Namrata D; Svinkina, Tanya; Guzman, Gaelen; Mootha, Vamsi K; Carr, Steven A; Ting, Alice Y
2017-01-01
The cytosol-facing membranes of cellular organelles contain proteins that enable signal transduction, regulation of morphology and trafficking, protein import and export, and other specialized processes. Discovery of these proteins by traditional biochemical fractionation can be plagued with contaminants and loss of key components. Using peroxidase-mediated proximity biotinylation, we captured and identified endogenous proteins on the outer mitochondrial membrane (OMM) and endoplasmic reticulum membrane (ERM) of living human fibroblasts. The proteomes of 137 and 634 proteins, respectively, are highly specific and highlight 94 potentially novel mitochondrial or ER proteins. Dataset intersection identified protein candidates potentially localized to mitochondria-ER contact sites. We found that one candidate, the tail-anchored, PDZ-domain-containing OMM protein SYNJ2BP, dramatically increases mitochondrial contacts with rough ER when overexpressed. Immunoprecipitation-mass spectrometry identified ribosome-binding protein 1 (RRBP1) as SYNJ2BP’s ERM binding partner. Our results highlight the power of proximity biotinylation to yield insights into the molecular composition and function of intracellular membranes. DOI: http://dx.doi.org/10.7554/eLife.24463.001 PMID:28441135
Narendran, Rajesh; Tumuluru, Divya; May, Maureen A.; Chowdari, Kodavali V.; Himes, Michael L.; Fasenmyer, Kelli; Frankle, W. Gordon; Nimgaonkar, Vishwajit L.
2016-01-01
Basic investigations link a Val158Met polymorphism (rs4680) in the catechol-O-methyltransferase (COMT) gene to not only its enzymatic activity, but also to its dopaminergic tone in the prefrontal cortex. Previous PET studies have documented the relationship between COMT Val158Met polymorphism and D1 and D2/3 receptor binding potential (BP), and interpreted them in terms of dopaminergic tone. The use of baseline dopamine D1 and D2/3 receptor binding potential (BPND) as a proxy for dopaminergic tone is problematic because they reflect both endogenous dopamine levels (a change in radiotracer's apparent affinity) and receptor density. In this analysis of 31 healthy controls genotyped for the Val158Met polymorphism (Val/Val, Val/Met, and Met/Met), we used amphetamine-induced displacement of [11C]FLB 457 as a direct measure of dopamine release. Our analysis failed to show a relationship between COMT genotype status and prefrontal cortical dopamine release. COMT genotype was also not predictive of baseline dopamine D2/3 receptor BPND. PMID:27322568
Antal, M; Polgár, E; Chalmers, J; Minson, J B; Llewellyn-Smith, I; Heizmann, C W; Somogyi, P
1991-12-01
The colocalization of parvalbumin (PV), calbindin-D28k (CaBP), GABA immunoreactivities, and the ability to accumulate 3H-D-aspartate selectively were investigated in neurons of laminae I-IV of the dorsal horn of the rat spinal cord. Following injection of 3H-D-aspartate into the basal dorsal horn (laminae IV-VI), perikarya selectively accumulating 3H-D-aspartate were detected in araldite embedded semithin sections by autoradiography, and consecutive semithin sections were treated to reveal PV, CaBP and GABA by postembedding immunocytochemistry. Perikarya accumulating 3H-D-aspartate were found exclusively in laminae I-III, and no labelled somata were found in deeper layers or in the intermediolateral column although the labelled amino acid clearly spread to these regions. More than half of the labelled cells were localized in lamina II. In this layer, 16.4% of 3H-D-aspartate-labelled perikarya were also stained for CaBP. In contrast to CaBP, PV or GABA was never detected in neurons accumulating 3H-D-aspartate. A high proportion of PV-immunoreactive perikarya were also stained for GABA in laminae II and III (70.0% and 61.2% respectively). However, the majority of CaBP-immunoreactive perikarya were GABA-negative. GABA-immunoreactivity was found in less than 2% of the total population of cells stained for CaBP in laminae I-IV. A significant proportion of the GABA-negative but PV-immunoreactive neurons also showed CaBP-immunoreactivity in laminae II and IV. These results show that out of the two calcium-binding proteins, CaBP is a characteristic protein of a small subpopulation of neurons using excitatory amino acids and PV is a characteristic protein of a subpopulation of neurons utilizing GABA as a transmitter. However, both proteins are present in additional subgroups of neurons, and neuronal populations using inhibitory or excitatory amino acid transmitters are heterogeneous with regard to their content of calcium-binding proteins in the dorsal horn of the rat spinal cord.
Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes
Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine
1999-01-01
The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570
Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.
2015-01-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633
Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G
2015-04-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American Society of Plant Biologists. All Rights Reserved.
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Chakraborty, Sudipta; Goswami, Dibakar; Chakravarty, Rubel; Mohammed, Sahiralam Khan; Sarma, Haladhar Deb; Dash, Ashutosh
2018-05-05
This article reports the syntheses and evaluation of 68 Ga- and 153 Sm-complexes of a new DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid)-conjugated geminal bisphosphonate, DOTA-Bn-SCN-BP, for their potential uses in the early detection of skeletal metastases by imaging and palliation of pain arising from skeletal metastases, respectively. The conjugate was synthesized in high purity following an easily adaptable three-step reaction scheme. Gallium-68- and 153 Sm-complexes were prepared in high yield (>98%) and showed excellent in vitro stability in phosphate-buffered saline (PBS) and human serum. Both the complexes showed high affinity for hydroxyapatite particles in in vitro binding study. In biodistribution studies carried out in normal Wistar rats, both the complexes exhibited rapid skeletal accumulation with almost no retention in any other major organ. The newly synthesized molecule DOTA-Bn-SCN-BP would therefore be a promising targeting ligand for the development of radiopharmaceuticals for both imaging skeletal metastases and palliation of pain arising out of it in patients with cancer when radiolabeled with 68 Ga and 153 Sm, respectively. A systematic comparative evaluation, however, showed that there was no significant improvement of skeletal accumulation of the 153 Sm-DOTA-Bn-SCN-BP complex over 153 Sm-DOTMP (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetramethylenephosphonic acid) as the later itself demonstrated optimal properties required for an agent for bone pain palliation. © 2018 John Wiley & Sons A/S.
Sato, Takanobu; Kitahara, Kousuke; Susa, Takao; Kato, Takako; Kato, Yukio
2006-10-01
Recently, we have reported that a Prophet of Pit-1 homeodomain factor, Prop-1, is a novel transcription factor for the porcine follicle-stimulating hormone beta subunit (FSHbeta) gene. This study subsequently aimed to examine the role of Prop-1 in the gene expression of two other porcine gonadotropin subunits, pituitary glycoprotein hormone alpha subunit (alphaGSU), and luteinizing hormone beta subunit (LHbeta). A series of deletion mutants of the porcine alphaGSU (up to -1059 bp) and LHbeta (up to -1277 bp) promoters were constructed in the reporter vector, fused with the secreted alkaline phosphatase gene (pSEAP2-Basic). Transient transfection studies using GH3 cells were carried out to estimate the activation of the porcine alphaGSU and LHbeta promoters by Prop-1, which was found to activate the alphaGSU promoter of -1059/+12 bp up to 11.7-fold but not the LHbeta promoter. Electrophoretic mobility shift assay and DNase I footprinting analysis revealed that Prop-1 binds to six positions, -1038/-1026, -942/-928, -495/-479, -338/-326, -153/-146, and -131/-124 bp, that comprise the A/T cluster. Oligonucleotides of six Prop-1 binding sites were directly connected to the minimum promoter of alphaGSU, fused in the pSEAP2-Basic vector, followed by transfecting GH3 cells to determine the cis-acting activity. Finally, we concluded that at least five Prop-1 binding sites are the cis-acting elements for alphaGSU gene expression. The present results revealed a notable feature of the proximal region, where three Prop-1-binding sites are close to and/or overlap the pituitary glycoprotein hormone basal element, GATA-binding element, and junctional regulatory element. To our knowledge, this is the first demonstration of the role of Prop-1 in the regulation of alphaGSU gene expression. These results, taken together with our previous finding that Prop-1 is a transcription factor for FSHbeta gene, confirm that Prop-1 modulates the synthesis of FSH at the transcriptional level. On the other hand, the defects of Prop-1 are known to cause dwarfism and combined pituitary hormone deficiency accompanying hypogonadism. Accordingly, the present observations provide a novel view to understand the hypogonadism caused by Prop-1 defects at the molecular level through the regulatory mechanism of alphaGSU and FSHbeta gene expressions.
Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G
2000-06-01
The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borrelli, A.; Blosser, J.; Barrantes, M.
Although numerous studies have described the anorectic, cardiovascular, and behavioral effects of phenthylamines, a comparison of the pharmacological concordance of these properties in a single species is needed. The objectives of this study were to compare the anorectic potency of 13 phenethylamines following po administration with their effects on spontaneous locomotor activity (SLA) and blood pressure (BP) in vivo and with amphetamine receptor affinity in vitro. The anorectic potencies (ED 50) ranged from 12 umol/kg (fenfluramine) to over 400 umol/kg (d-norephedrine and 1-pseudoephedrine). d-Amphetamine, phentermine, and d-norpseudoephedrine were among the most active and 1-pseudoephedrine and 1-nor-ephedrine the least active inmore » increasing SLA. 1-Norephedrine, and d-norpseudoephedrine were the most active increasing BP while d-norephedrine produced a weak vasodepressor effect. A significant correlation (r = .80) was observed between anorectic potency and affinity (IC 50) for /sup 3/H-amphetamine binding sites in the hypothalamus. However, the stereoselectivity between pairs of enantiomers to inhibit food consumption was not paralleled in binding affinity. The rank order of concordance of phenethylamines in anorectic activity was most apparent in behavior and binding affinity.« less
Kitevski-LeBlanc, Julianne; Fradet-Turcotte, Amélie; Portella, Guillem; Yuwen, Tairan; Panier, Stephanie; Duan, Shili; Canny, Marella D; van Ingen, Hugo; Arrowsmith, Cheryl H; Rubinstein, John L; Vendruscolo, Michele; Durocher, Daniel; Kay, Lewis E
2017-01-01
Site-specific histone ubiquitylation plays a central role in orchestrating the response to DNA double-strand breaks (DSBs). DSBs elicit a cascade of events controlled by the ubiquitin ligase RNF168, which promotes the accumulation of repair factors such as 53BP1 and BRCA1 on the chromatin flanking the break site. RNF168 also promotes its own accumulation, and that of its paralog RNF169, but how they recognize ubiquitylated chromatin is unknown. Using methyl-TROSY solution NMR spectroscopy and molecular dynamics simulations, we present an atomic resolution model of human RNF169 binding to a ubiquitylated nucleosome, and validate it by electron cryomicroscopy. We establish that RNF169 binds to ubiquitylated H2A-Lys13/Lys15 in a manner that involves its canonical ubiquitin-binding helix and a pair of arginine-rich motifs that interact with the nucleosome acidic patch. This three-pronged interaction mechanism is distinct from that by which 53BP1 binds to ubiquitylated H2A-Lys15 highlighting the diversity in site-specific recognition of ubiquitylated nucleosomes. DOI: http://dx.doi.org/10.7554/eLife.23872.001 PMID:28406400
DOE Office of Scientific and Technical Information (OSTI.GOV)
Molina-Molina, Jose-Manuel; INSERM, U896, Montpellier, F-34298; Universite Montpellier1, Montpellier, F-34298
Benzophenone (BP) derivatives, BP1 (2,4-dihydroxybenzophenone), BP2 (2,2',4,4'-tetrahydroxybenzophenone), BP3 (2-hydroxy-4-methoxybenzophenone), and THB (2,4,4'-trihydroxybenzophenone) are UV-absorbing chemicals widely used in pharmaceutical, cosmetics, and industrial applications, such as topical sunscreens in lotions and hair sprays to protect skin and hair from UV irradiation. Studies on their endocrine disrupting properties have mostly focused on their interaction with human estrogen receptor alpha (hER{alpha}), and there has been no comprehensive analysis of their potency in a system allowing comparison between hER{alpha} and hER{beta} activities. The objective of this study was to provide a comprehensive ER activation profile of BP derivatives using ER from human and fishmore » origin in a battery of in vitro tests, i.e., competitive binding, reporter gene based assays, vitellogenin (Vtg) induction in isolated rainbow trout hepatocytes, and proliferation based assays. The ability to induce human androgen receptor (hAR)-mediated reporter gene expression was also examined. All BP derivatives tested except BP3 were full hER{alpha} and hER{beta} agonists (BP2 > THB > BP1) and displayed a stronger activation of hER{beta} compared with hER{alpha}, the opposite effect to that of estradiol (E{sub 2}). Unlike E{sub 2}, BPs were more active in rainbow trout ER{alpha} (rtER{alpha}) than in hER{alpha} assay. All four BP derivatives showed anti-androgenic activity (THB > BP2 > BP1 > BP3). Overall, the observed anti-androgenic potencies of BP derivatives, together with their proposed greater effect on ER{beta} versus ER{alpha} activation, support further investigation of their role as endocrine disrupters in humans and wildlife.« less
Boulanger, Alice; Francez-Charlot, Anne; Conter, Annie; Castanié-Cornet, Marie-Pierre; Cam, Kaymeuang; Gutierrez, Claude
2005-01-01
Transcription of the Escherichia coli osmB gene is induced by several stress conditions. osmB is expressed from two promoters, osmBp1 and osmBp2. The downstream promoter, osmBp2, is induced after osmotic shock or upon entry into stationary phase in a σS-dependent manner. The upstream promoter, osmBp1, is independent of σS and is activated by RcsB, the response regulator of the His-Asp phosphorelay signal transduction system RcsCDB. RcsB is responsible for the induction of osmBp1 following treatment with chlorpromazine. Activation of osmBp1 by RcsB requires a sequence upstream of its −35 element similar to the RcsB binding site consensus, suggesting a direct regulatory role. osmB appears as another example of a multistress-responsive gene whose transcription involves both a σS-dependent promoter and a second one independent of σS but controlled by stress-specific transcription factors. PMID:15838058
Aslanukov, Azamat; Bhowmick, Reshma; Guruju, Mallikarjuna; Oswald, John; Raz, Dorit; Bush, Ronald A; Sieving, Paul A; Lu, Xinrong; Bock, Cheryl B; Ferreira, Paulo A
2006-10-01
The Ran-binding protein 2 (RanBP2) is a large multimodular and pleiotropic protein. Several molecular partners with distinct functions interacting specifically with selective modules of RanBP2 have been identified. Yet, the significance of these interactions with RanBP2 and the genetic and physiological role(s) of RanBP2 in a whole-animal model remain elusive. Here, we report the identification of two novel partners of RanBP2 and a novel physiological role of RanBP2 in a mouse model. RanBP2 associates in vitro and in vivo and colocalizes with the mitochondrial metallochaperone, Cox11, and the pacemaker of glycolysis, hexokinase type I (HKI) via its leucine-rich domain. The leucine-rich domain of RanBP2 also exhibits strong chaperone activity toward intermediate and mature folding species of Cox11 supporting a chaperone role of RanBP2 in the cytosol during Cox11 biogenesis. Cox11 partially colocalizes with HKI, thus supporting additional and distinct roles in cell function. Cox11 is a strong inhibitor of HKI, and RanBP2 suppresses the inhibitory activity of Cox11 over HKI. To probe the physiological role of RanBP2 and its role in HKI function, a mouse model harboring a genetically disrupted RanBP2 locus was generated. RanBP2(-/-) are embryonically lethal, and haploinsufficiency of RanBP2 in an inbred strain causes a pronounced decrease of HKI and ATP levels selectively in the central nervous system. Inbred RanBP2(+/-) mice also exhibit deficits in growth rates and glucose catabolism without impairment of glucose uptake and gluconeogenesis. These phenotypes are accompanied by a decrease in the electrophysiological responses of photosensory and postreceptoral neurons. Hence, RanBP2 and its partners emerge as critical modulators of neuronal HKI, glucose catabolism, energy homeostasis, and targets for metabolic, aging disorders and allied neuropathies.
Transgenic plants with increased calcium stores
NASA Technical Reports Server (NTRS)
Robertson, Dominique (Inventor); Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Boss, Wendy (Inventor)
2004-01-01
The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.
Nehls, P; Rajewsky, M F; Spiess, E; Werner, D
1984-01-01
Brain chromosomal DNA isolated from fetal BDIX-rats 1 h after i.v. administration of the ethylating N-nitroso carcinogen N-ethyl-N-nitrosourea (75 micrograms/g body weight), statistically contained one molecule of O6-ethyl-2'-deoxyguanosine (O6-EtdGuo) per 81 micron of DNA, as determined in enzymatic DNA hydrolysates by competitive radio-immunoassay using a high-affinity anti-(O6-EtdGuo) monoclonal antibody (ER-6). After fragmentation of the DNA by the restriction enzyme AluI (average fragment length, Lav = 0.28 micron = 970 bp; length range, Lr = 1.87-0.02 micron = 6540 - 60 bp), a small (approximately 2%) fraction of DNA enriched in specific polypeptides tightly associated with DNA was separated from the bulk DNA by a glass fiber binding technique. As analyzed by immune electron microscopy, approximately 1% of the DNA molecules in this fraction contained clusters of 2-10 (O6-EtdGuo)-antibody binding sites (ABS). On the cluster-bearing fragments (Lav, 0.85 micron +/- 0.50 micron S.D.; corresponding to 2970 +/- 1760 bp) the average ABS-ABS interspace distance was 110 nm (= 390 bp; range approximately 9-600 nm), indicating a highly non-random distribution of O6-EtdGuo in target cell DNA. Images Fig. 2. PMID:6370677
Ramanathan, K; Jönsson, B R; Danielsson, B
2000-08-01
The stability of horseradish peroxidase (HRP) in aqueous and organic solvents is applied to develop a simple thermometric procedure to detect the binding of retinoic acid-HRP conjugate to retinol binding protein (RBP). Butanone peroxide (BP) in organic phase and hydrogen peroxide in aqueous phase is detected thermometrically on a HRP column, immobilized by cross-linking with glutaraldehyde on controlled pore glass (CPG). Acetone, acetonitrile, methanol, and 2-butanol are used for detection of BP, in the flow injection analysis (FIA) mode. A linear range between 1 and 50 mM BP is obtained in all the organic solvents with a precision of 5-7% (CV%). The magnitude and nature of the thermometric response is significantly different in each organic solvent. The stability of HRP in the organic phase is used to study the stability of a retinoic acid-HRP conjugate bound to immobilized RBP. The response of HRP (to 20 mM BP) in the retinoic acid-HRP conjugate is used as an indicator of the stability of the RBP-retinoic acid-HRP complex, after challenges with various organic/aqueous solvents. Both immobilized HRP and RBP are stable at least for 6 months. The effect of o-phenylene diamine on the thermometric response of HRP is also investigated. A scheme for the design of a thermometric retinol (vitamin A) biosensor is proposed.
Meyer, Thomas; Pankuweit, Sabine; Richter, Anette; Maisch, Bernhard; Ruppert, Volker
2013-09-15
Hypertrophic cardiomyopathy (HCM) is a cardiovascular disease with autosomal dominant inheritance caused by mutations in genes coding for sarcomeric and/or regulatory proteins expressed in cardiomyocytes. In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). The c.702ins26bp insertion resulted from the duplication of a 26-bp fragment in a 54-year-old female HCM patient presenting with clinical signs of heart failure due to diastolic dysfunction. Although such large duplications (>10 bp) in the MYBPC3 gene are very rare and have been identified only in 4 families reported so far, the identical duplication mutation was found earlier in a Dutch patient, demonstrating that it may constitute a hitherto unknown founder mutation in central European populations. This observation underscores the significance of insertions into the coding sequence of the MYBPC3 gene for the development and pathogenesis of HCM. © 2013 Elsevier B.V. All rights reserved.
Schnabel, Guido; Dait, Qun; Paradkar, Manjiri R
2003-10-01
Brown rot, caused by Moniliniafructicola (G Wint) Honey, is a serious disease of peach in all commercial peach production areas in the USA, including South Carolina where it has been primarily controlled by pre-harvest application of 14-alpha demethylation (DMI) fungicides for more than 15 years. Recently, the Qo fungicide azoxystrobin was registered for brown rot control and is currently being investigated for its potential as a DMI fungicide rotation partner because of its different mode of action. In an effort to investigate molecular mechanisms of DMI and Qo fungicide resistance in M fructicola, the ABC transporter gene MfABC1 and the alternative oxidase gene MfAOX1 were cloned to study their potential role in conferring fungicide resistance. The MfABC1 gene was 4380 bp in length and contained one intron of 71 bp. The gene revealed high amino acid homologies with atrB from Aspergillus nidulans (Eidam) Winter, an ABC transporter conferring resistance to many fungicides, including DMI fungicides. MfABC1 gene expression was induced after myclobutanil and propiconazole treatment in isolates with low sensitivity to the same fungicides, and in an isolate with high sensitivity to propiconazole. The results suggest that the MfABC1 gene may be a DMI fungicide resistance determinant in M fructicola. The alternative oxidase gene MfAOX1 from M fructicola was cloned and gene expression was analyzed. The MfAOX1 gene was 1077 bp in length and contained two introns of 54 and 67 bp. The amino acid sequence was 63.8, 63.8 and 57.7% identical to alternative oxidases from Venturia inaequalis (Cooke) Winter, Aspergillus niger van Teighem and A nidulans, respectively. MfAOX1 expression in some but not all M fructicola isolates was induced in mycelia treated with azoxystrobin. Azoxystrobin at 2 microg ml(-1) significantly induced MfAOX1 expression in isolates with low MfAOX1 constitutive expression levels.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neboori, Hanmanth J.R.; Haffty, Bruce G., E-mail: hafftybg@umdnj.edu; Wu Hao
2012-08-01
Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survivalmore » (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their clinical significance.« less
Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons
NASA Astrophysics Data System (ADS)
Baghaee Ravari, Soodeh
G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).
MCM-BP regulates unloading of the MCM2–7 helicase in late S phase
Nishiyama, Atsuya; Frappier, Lori; Méchali, Marcel
2011-01-01
Origins of DNA replication are licensed by recruiting MCM2–7 to assemble the prereplicative complex (pre-RC). How MCM2–7 is inactivated or removed from chromatin at the end of S phase is still unclear. Here, we show that MCM-BP can disassemble the MCM2–7 complex and might function as an unloader of MCM2–7 from chromatin. In Xenopus egg extracts, MCM-BP exists in a stable complex with MCM7, but is not associated with the MCM2–7 hexameric complex. MCM-BP accumulates in nuclei in late S phase, well after the loading of MCM2–7 onto chromatin. MCM-BP immunodepletion in Xenopus egg extracts inhibits replication-dependent MCM dissociation without affecting pre-RC formation and DNA replication. When excess MCM-BP is incubated with Xenopus egg extracts or immunopurified MCM2–7, it binds to MCM proteins and promotes disassembly of the MCM2–7 complex. Recombinant MCM-BP also releases MCM2–7 from isolated late-S-phase chromatin, but this activity is abolished when DNA replication is blocked. MCM-BP silencing in human cells also delays MCM dissociation in late S phase. We propose that MCM-BP plays a key role in the mechanism by which pre-RC is cleared from replicated DNA in vertebrate cells. PMID:21196493
Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji
2015-11-10
Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.
2015-01-01
Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071
Xu, Chun-Ping; Boks, Niels P.; de Vries, Joop; Kaper, Hans J.; Norde, Willem; Busscher, Henk J.; van der Mei, Henny C.
2008-01-01
Adhesion and residence-time-dependent desorption of two Staphylococcus aureus strains with and without fibronectin (Fn) binding proteins (FnBPs) on Fn-coated glass were compared under flow conditions. To obtain a better understanding of the role of Fn-FnBP binding, the adsorption enthalpies of Fn with staphylococcal cell surfaces were determined using isothermal titration calorimetry (ITC). Interaction forces between staphylococci and Fn coatings were measured using atomic force microscopy (AFM). The strain with FnBPs adhered faster and initially stronger to an Fn coating than the strain without FnBPs, and its Fn adsorption enthalpies were higher. The initial desorption was high for both strains but decreased substantially within 2 s. These time scales of staphylococcal bond ageing were confirmed by AFM adhesion force measurement. After exposure of either Fn coating or staphylococcal cell surfaces to bovine serum albumin (BSA), the adhesion of both strains to Fn coatings was reduced, suggesting that BSA suppresses not only nonspecific but also specific Fn-FnBP interactions. Adhesion forces and adsorption enthalpies were only slightly affected by BSA adsorption. This implies that under the mild contact conditions of convective diffusion in a flow chamber, adsorbed BSA prevents specific interactions but does allow forced Fn-FnBP binding during AFM or stirring in ITC. The bond strength energies calculated from retraction force-distance curves from AFM were orders of magnitude higher than those calculated from desorption data, confirming that a penetrating Fn-coated AFM tip probes multiple adhesins in the outermost cell surface that remain hidden during mild landing of an organism on an Fn-coated substratum, like that during convective diffusional flow. PMID:18952882
Song, B; Hou, Y L; Ding, X; Wang, T; Wang, F; Zhong, J C; Xu, T; Zhong, J; Hou, W R; Shuai, S R
2014-02-20
Fatty acid binding proteins (FABPs) are a family of small, highly conserved cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. In this study, cDNA and genomic sequences of FABP4 and FABP5 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-PCR. The cDNAs of FABP4 and FABP5 cloned from the giant panda were 400 and 413 bp in length, containing an open reading frame of 399 and 408 bp, encoding 132 and 135 amino acids, respectively. The genomic sequences of FABP4 and FABP5 were 3976 and 3962 bp, respectively, which each contained four exons and three introns. Sequence alignment indicated a high degree of homology with reported FABP sequences of other mammals at both the amino acid and DNA levels. Topology prediction revealed seven protein kinase C phosphorylation sites, two casein kinase II phosphorylation sites, two N-myristoylation sites, and one cytosolic fatty acid-binding protein signature in the FABP4 protein, and three N-glycosylation sites, three protein kinase C phosphorylation sites, one casein kinase II phosphorylation site, one N-myristoylation site, one amidation site, and one cytosolic fatty acid-binding protein signature in the FABP5 protein. The FABP4 and FABP5 genes were overexpressed in Escherichia coli BL21 and they produced the expected 16.8- and 17.0-kDa polypeptides. The results obtained in this study provide information for further in-depth research of this system, which has great value of both theoretical and practical significance.
Yamasu, K; Wilt, F H
1999-02-01
The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.
Miura, Shin-ichiro; Okabe, Atsutoshi; Matsuo, Yoshino; Karnik, Sadashiva S; Saku, Keijiro
2014-01-01
The angiotensin II type 1 (AT1) receptor blocker (ARB) candesartan strongly reduces blood pressure (BP) in patients with hypertension and has been shown to have cardioprotective effects. A new ARB, azilsartan, was recently approved and has been shown to provide a more potent 24-h sustained antihypertensive effect than candesartan. However, the molecular interactions of azilsartan with the AT1 receptor that could explain its strong BP-lowering activity are not yet clear. To address this issue, we examined the binding affinities of ARBs for the AT1 receptor and their inverse agonist activity toward the production of inositol phosphate (IP), and we constructed docking models for the interactions between ARBs and the receptor. Azilsartan, unlike candesartan, has a unique moiety, a 5-oxo-1,2,4-oxadiazole, in place of a tetrazole ring. Although the results regarding the binding affinities of azilsartan and candesartan demonstrated that these ARBs interact with the same sites in the AT1 receptor (Tyr113, Lys199 and Gln257), the hydrogen bonding between the oxadiazole of azilsartan-Gln257 is stronger than that between the tetrazole of candesartan-Gln257, according to molecular docking models. An examination of the inhibition of IP production by ARBs using constitutively active mutant receptors indicated that inverse agonist activity required azilsartan–Gln257 interaction and that azilsartan had a stronger interaction with Gln257 than candesartan. Thus, we speculate that azilsartan has a unique binding behavior to the AT1 receptor due to its 5-oxo-1,2,4-oxadiazole moiety and induces stronger inverse agonism. This property of azilsartan may underlie its previously demonstrated superior BP-lowering efficacy compared with candesartan and other ARBs. PMID:23034464
Miura, Shin-ichiro; Okabe, Atsutoshi; Matsuo, Yoshino; Karnik, Sadashiva S; Saku, Keijiro
2013-02-01
The angiotensin II type 1 (AT(1)) receptor blocker (ARB) candesartan strongly reduces blood pressure (BP) in patients with hypertension and has been shown to have cardioprotective effects. A new ARB, azilsartan, was recently approved and has been shown to provide a more potent 24-h sustained antihypertensive effect than candesartan. However, the molecular interactions of azilsartan with the AT(1) receptor that could explain its strong BP-lowering activity are not yet clear. To address this issue, we examined the binding affinities of ARBs for the AT(1) receptor and their inverse agonist activity toward the production of inositol phosphate (IP), and we constructed docking models for the interactions between ARBs and the receptor. Azilsartan, unlike candesartan, has a unique moiety, a 5-oxo-1,2,4-oxadiazole, in place of a tetrazole ring. Although the results regarding the binding affinities of azilsartan and candesartan demonstrated that these ARBs interact with the same sites in the AT(1) receptor (Tyr(113), Lys(199) and Gln(257)), the hydrogen bonding between the oxadiazole of azilsartan-Gln(257) is stronger than that between the tetrazole of candesartan-Gln(257), according to molecular docking models. An examination of the inhibition of IP production by ARBs using constitutively active mutant receptors indicated that inverse agonist activity required azilsartan-Gln(257) interaction and that azilsartan had a stronger interaction with Gln(257) than candesartan. Thus, we speculate that azilsartan has a unique binding behavior to the AT(1) receptor due to its 5-oxo-1,2,4-oxadiazole moiety and induces stronger inverse agonism. This property of azilsartan may underlie its previously demonstrated superior BP-lowering efficacy compared with candesartan and other ARBs.
Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong
2012-01-01
Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID:22363633
Thamotharan, Shanthie; Raychaudhuri, Nupur; Tomi, Masatoshi; Shin, Bo-Chul
2013-01-01
We have shown in vitro a hypoxia-induced time-dependent increase in facilitative glucose transporter isoform 3 (GLUT3) expression in N2A murine neuroblasts. This increase in GLUT3 expression is partially reliant on a transcriptional increase noted in actinomycin D and cycloheximide pretreatment experiments. Transient transfection assays in N2A neuroblasts using murine glut3-luciferase reporter constructs mapped the hypoxia-induced enhancer activities to −857- to −573-bp and −203- to −177-bp regions. Hypoxia-exposed N2A nuclear extracts demonstrated an increase in HIF-1α and p-Creb binding to HRE (−828 to −824 bp) and AP-1 (−187 to −180 bp) cis-elements, respectively, in electromobility shift and supershift assays, which was confirmed by chromatin immunoprecipitation assays. In addition, the interaction of CBP with Creb and HIF-1α and CREST with CBP in hypoxia was detected by coimmunoprecipitation. Furthermore, small interference (si)RNA targeting Creb in these cells decreased endogenous Creb concentrations that reduced by twofold hypoxia-induced glut3 gene transcription. Thus, in N2A neuroblasts, phosphorylated HIF-1α and Creb mediated the hypoxia-induced increase in glut3 transcription. Coactivation by the Ca++-dependent CREST and CBP proteins may enhance cross-talk between p-Creb-AP-1 and HIF-1α/HRE of the glut3 gene. Collectively, these processes can facilitate an adaptive response to hypoxic energy depletion targeted at enhancing glucose transport and minimizing injury while fueling the proliferative potential of neuroblasts. PMID:23321477
Chihara, Kazuyasu; Kato, Yuji; Yoshiki, Hatsumi; Takeuchi, Kenji; Fujieda, Shigeharu; Sada, Kiyonao
2017-09-13
The adaptor protein c-Abl SH3 domain binding protein-2 (3BP2) is tyrosine phosphorylated by Syk in response to cross-linking of antigen receptors, which in turn activates various immune responses. Recently, a study using the mouse model of cherubism, a dominant inherited disorder caused by mutations in the gene encoding 3BP2, showed that 3BP2 is involved in the regulation of phagocytosis mediated by Fc receptor for IgG (FcγR) in macrophages. However, the molecular mechanisms underlying 3BP2-mediated regulation of phagocytosis and the physiological relevance of 3BP2 tyrosine phosphorylation remains elusive. In this study, we established various gene knockout U937 cell lines using the CRISPR/Cas9 system and found that 3BP2 is rapidly tyrosine phosphorylated by Syk in response to cross-linking of FcγRI. Depletion of 3BP2 caused significant reduction in the Fc receptor γ chain (FcRγ)-mediated phagocytosis in addition to the FcγRI-mediated induction of chemokine mRNA for IL-8, CCL3L3 and CCL4L2. Syk-dependent tyrosine phosphorylation of 3BP2 was required for overcoming these defects. Finally, we found that the PH and SH2 domains play important roles on FcγRI-mediated tyrosine phosphorylation of 3BP2 in HL-60 cells. Taken together, these results indicate that Syk-dependent tyrosine phosphorylation of 3BP2 is required for optimal FcRγ-mediated phagocytosis and chemokine expression.
Hu, Yalin; Wang, Junling; Zhang, Huiyun; Xie, Hua; Song, Weiwei; Jiang, Qijun; Zhao, Nan; He, Shaoheng
2017-01-01
IL-18 has been found to be associated with eczema. However, little is known of the role of IL-18 binding protein (BP) and IL-18 receptor (R) in eczema. We therefore investigated the expression of IL-18, IL-18BP, and IL-18R on mast cells by using flow cytometry analysis and mouse eczema model. The results showed that plasma free IL-18 and free IL-18BP levels in eczema patients were higher than those in healthy controls. IL-18 provoked up to 3.1-fold increase in skin mast cells. IL-18 induced also an increase in IL-18BP+ mast cells, but a reduction of IL-18R+ mast cells in mouse eczema skin. It was found that house dust mite allergen Der p1 and egg allergen OVA induced upregulation of the expression of IL-18, IL-18BP, and IL-18R mRNAs in HMC-1 cells following 2 and 16 h incubation. In conclusion, correlation of IL-18 and IL-18BP in eczema plasma suggests an important balance between IL-18 and IL-18BP in eczema. The decrease in molar concentration ratio of plasma IL-18BP/IL-18 and allergen-induced upregulated expression of IL-18 and IL-18R in skin mast cells of the patients with eczema suggests that anti-IL-18 including IL-18BP therapy may be useful for the treatment of eczema.
2017-01-01
IL-18 has been found to be associated with eczema. However, little is known of the role of IL-18 binding protein (BP) and IL-18 receptor (R) in eczema. We therefore investigated the expression of IL-18, IL-18BP, and IL-18R on mast cells by using flow cytometry analysis and mouse eczema model. The results showed that plasma free IL-18 and free IL-18BP levels in eczema patients were higher than those in healthy controls. IL-18 provoked up to 3.1-fold increase in skin mast cells. IL-18 induced also an increase in IL-18BP+ mast cells, but a reduction of IL-18R+ mast cells in mouse eczema skin. It was found that house dust mite allergen Der p1 and egg allergen OVA induced upregulation of the expression of IL-18, IL-18BP, and IL-18R mRNAs in HMC-1 cells following 2 and 16 h incubation. In conclusion, correlation of IL-18 and IL-18BP in eczema plasma suggests an important balance between IL-18 and IL-18BP in eczema. The decrease in molar concentration ratio of plasma IL-18BP/IL-18 and allergen-induced upregulated expression of IL-18 and IL-18R in skin mast cells of the patients with eczema suggests that anti-IL-18 including IL-18BP therapy may be useful for the treatment of eczema. PMID:28839348
Spreckelmeyer, Katja N; Paulzen, Michael; Raptis, Mardjan; Baltus, Thomas; Schaffrath, Sabrina; Van Waesberghe, Julia; Zalewski, Magdalena M; Rösch, Frank; Vernaleken, Ingo; Schäfer, Wolfgang M; Gründer, Gerhard
2011-10-15
Preclinical data implicate the reinforcing effects of alcohol to be mediated by interaction between the opioid and dopamine systems of the brain. Specifically, alcohol-induced release of β-endorphins stimulates μ-opioid receptors (MORs), which is believed to cause dopamine release in the brain reward system. Individual differences in opioid or dopamine neurotransmission have been suggested to be responsible for enhanced liability to abuse alcohol. In the present study, a single dose of the MOR agonist remifentanil was administered in detoxified alcohol-dependent patients and healthy control subjects to mimic the β-endorphin-releasing properties of ethanol and to assess the effects of direct MOR stimulation on dopamine release in the mesolimbic reward system. Availability of D(2/3) receptors was assessed before and after single-dose administration of the MOR agonist remifentanil in 11 detoxified alcohol-dependent patients and 11 healthy control subjects with positron emission tomography with the radiotracer [(18)F]fallypride. Severity of dependence as assessed with the Alcohol Use Disorders Identification Test was compared with remifentanil-induced percentage change in [(18)F]fallypride binding (Δ%BP(ND)). The [(18)F]fallypride binding potentials (BP(ND)s) were significantly reduced in the ventral striatum, dorsal putamen, and amygdala after remifentanil application in both patients and control subjects. In the patient group, ventral striatum Δ%BP(ND) was correlated with the Alcohol Use Disorders Identification Test score. The data provide evidence for a MOR-mediated interaction between the opioid and the dopamine system, supporting the assumption that one way by which alcohol unfolds its rewarding effects is via a MOR-(γ-aminobutyric acid)-dopamine pathway. No difference in dopamine release was found between patients and control subjects, but evidence for a patient-specific association between sensitivity to MOR stimulation and severity of alcohol dependence was found. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
Yang, Yuanzheng; Huang, Gangxiong; Zhou, Zhichao; Fewell, Jason G; Kleinerman, Eugenie S
2018-01-01
The metastatic potential of osteosarcoma cells is inversely correlated to cell surface FAS expression. Downregulation of FAS allows osteosarcoma cells to escape FAS ligand-mediated apoptosis when they enter a FAS ligand-positive microenvironment such as the lung. We have previously demonstrated that miR-20a, encoded by the miR-17-92 cluster, downregulates FAS expression in osteosarcoma. We further demonstrated an inverse correlation between FAS expression and miR-20a expression. However, the mechanism of FAS regulation by miR-20a was still unclear. The purpose of the current study was to evaluate the mechanism of FAS regulation by miR-20a in vitro and test the effect of targeting miR-20a in vivo We investigated whether miR-20a's downregulation of FAS was mediated by binding to the 3'-untranslated region (3'-UTR) of FAS mRNA with the consequent induction of mRNA degradation or translational suppression. We identified and mutated two miR-20a binding sites on the FAS mRNA 3'-UTR. Using luciferase reporter assays, we demonstrated that miR-20a did not bind to either the wild-type or mutated FAS 3'-UTR. In contrast, overexpression of miR-20a resulted in downregulation of FAS promoter activity. Similarly, the inhibition of miR-20a increased FAS promoter activity. The critical region identified on the FAS promoter was between -240 bp and -150 bp. Delivery of anti-miR-20a in vivo using nanoparticles in mice with established osteosarcoma lung metastases resulted in upregulation of FAS and tumor growth inhibition. Taken together, our data suggest that miR-20a regulates FAS expression through the modulation of the FAS promoter and that targeting miR-20a using anti-miR-20a has therapeutic potential. Mol Cancer Ther; 17(1); 130-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Transcriptional regulation of the human mitochondrial peptide deformylase (PDF).
Pereira-Castro, Isabel; Costa, Luís Teixeira da; Amorim, António; Azevedo, Luisa
2012-05-18
The last years of research have been particularly dynamic in establishing the importance of peptide deformylase (PDF), a protein of the N-terminal methionine excision (NME) pathway that removes formyl-methionine from mitochondrial-encoded proteins. The genomic sequence of the human PDF gene is shared with the COG8 gene, which encodes a component of the oligomeric golgi complex, a very unusual case in Eukaryotic genomes. Since PDF is crucial in maintaining mitochondrial function and given the atypical short distance between the end of COG8 coding sequence and the PDF initiation codon, we investigated whether the regulation of the human PDF is affected by the COG8 overlapping partner. Our data reveals that PDF has several transcription start sites, the most important of which only 18 bp from the initiation codon. Furthermore, luciferase-activation assays using differently-sized fragments defined a 97 bp minimal promoter region for human PDF, which is capable of very strong transcriptional activity. This fragment contains a potential Sp1 binding site highly conserved in mammalian species. We show that this binding site, whose mutation significantly reduces transcription activation, is a target for the Sp1 transcription factor, and possibly of other members of the Sp family. Importantly, the entire minimal promoter region is located after the end of COG8's coding region, strongly suggesting that the human PDF preserves an independent regulation from its overlapping partner. Copyright © 2012 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Biaoyang; Nasir, J.; Kalchman, M.A.
1995-02-10
We have previously cloned and characterized the murine homologue of the Huntington disease (HD) gene and shown that it maps to mouse chromosome 5 within a region of conserved synteny with human chromosome 4p16.3. Here we present a detailed comparison of the sequence of the putative promoter and the organization of the 5{prime} genomic region of the murine (Hdh) and human HD genes encompassing the first five exons. We show that in this region these two genes share identical exon boundaries, but have different-size introns. Two dinucleotide (CT) and one trinucleotide intronic polymorphism in Hdh and an intronic CA polymorphismmore » in the HD gene were identified. Comparison of 940-bp sequence 5{prime} to the putative translation start site reveals a highly conserved region (78.8% nucleotide identity) between Hdh and the HD gene from nucleotide -56 to -206 (of Hdh). Neither Hdh nor the HD gene have typical TATA or CCAAT elements, but both show one putative AP2 binding site and numerous potential Sp1 binding sites. The high sequence identity between Hdh and the HD gene for approximately 200 bp 5{prime} to the putative translation start site indicates that these sequences may play a role in regulating expression of the Huntington disease gene. 30 refs., 4 figs., 2 tabs.« less
Xie, P; Yuan, C; Wang, C; Zou, X-T; Po, Z; Tong, H-B; Zou, J-M
2014-01-01
1. Peroxisome proliferator-activated receptors (PPAR) are involved in lipid metabolism through transcriptional regulation of target gene expression. The objective of the current study was to clone and characterise the PPARα and PPARγ genes in pigeon. 2. The full-length of 1941-bp PPARα and 1653-bp PPARγ were cloned from pigeons. The two genes were predicted to encode 468 and 475 amino acids, respectively. Both proteins contained two C4-type zinc fingers, a nuclear hormone receptor DNA-binding region signature and a HOLI domain (ligand binding domain of hormone receptors), and had high identities with other corresponding avian genes. 3. Using quantitative real-time PCR, pigeon PPARα gene expression was shown to be high in kidney, liver, gizzard and duodenum whereas PPARγ was predominantly expressed in adipose tissue.
Regulatory elements involved in tax-mediated transactivation of the HTLV-I LTR.
Seeler, J S; Muchardt, C; Podar, M; Gaynor, R B
1993-10-01
HTLV-I is the etiologic agent of adult T-cell leukemia. In this study, we investigated the regulatory elements and cellular transcription factors which function in modulating HTLV-I gene expression in response to the viral transactivator protein, tax. Transfection experiments into Jurkat cells of a variety of site-directed mutants in the HTLV-1 LTR indicated that each of the three motifs A, B, and C within the 21-bp repeats, the binding sites for the Ets family of proteins, and the TATA box all influenced the degree of tax-mediated activation. Tax is also able to activate gene expression of other viral and cellular promoters. Tax activation of the IL-2 receptor and the HIV-1 LTR is mediated through NF-kappa B motifs. Interestingly, sequences in the 21-bp repeat B and C motifs contain significant homology with NF-kappa B regulatory elements. We demonstrated that an NF-kappa B binding protein, PRDII-BF1, but not the rel protein, bound to the B and C motifs in the 21-bp repeat. PRDII-BF1 was also able to stimulate activation of HTLV-I gene expression by tax. The role of the Ets proteins on modulating tax activation was also studied. Ets 1 but not Ets 2 was capable of increasing the degree of tax activation of the HTLV-I LTR. These results suggest that tax activates gene expression by either direct or indirect interaction with several cellular transcription factors that bind to the HTLV-I LTR.
Singh, Digvijay; Mallon, John; Poddar, Anustup; Wang, Yanbo; Tippana, Ramreddy; Yang, Olivia; Bailey, Scott; Ha, Taekjip
2018-05-22
CRISPR-Cas9, which imparts adaptive immunity against foreign genomic invaders in certain prokaryotes, has been repurposed for genome-engineering applications. More recently, another RNA-guided CRISPR endonuclease called Cpf1 (also known as Cas12a) was identified and is also being repurposed. Little is known about the kinetics and mechanism of Cpf1 DNA interaction and how sequence mismatches between the DNA target and guide-RNA influence this interaction. We used single-molecule fluorescence analysis and biochemical assays to characterize DNA interrogation, cleavage, and product release by three Cpf1 orthologs. Our Cpf1 data are consistent with the DNA interrogation mechanism proposed for Cas9. They both bind any DNA in search of protospacer-adjacent motif (PAM) sequences, verify the target sequence directionally from the PAM-proximal end, and rapidly reject any targets that lack a PAM or that are poorly matched with the guide-RNA. Unlike Cas9, which requires 9 bp for stable binding and ∼16 bp for cleavage, Cpf1 requires an ∼17-bp sequence match for both stable binding and cleavage. Unlike Cas9, which does not release the DNA cleavage products, Cpf1 rapidly releases the PAM-distal cleavage product, but not the PAM-proximal product. Solution pH, reducing conditions, and 5' guanine in guide-RNA differentially affected different Cpf1 orthologs. Our findings have important implications on Cpf1-based genome engineering and manipulation applications.
De Lange, Willem J; Grimes, Adrian C; Hegge, Laura F; Spring, Alexander M; Brost, Taylor M; Ralphe, J Carter
2013-09-01
Mutations in cardiac myosin binding protein C (cMyBP-C) are prevalent causes of hypertrophic cardiomyopathy (HCM). Although HCM-causing truncation mutations in cMyBP-C are well studied, the growing number of disease-related cMyBP-C missense mutations remain poorly understood. Our objective was to define the primary contractile effect and molecular disease mechanisms of the prevalent cMyBP-C E258K HCM-causing mutation in nonremodeled murine engineered cardiac tissue (mECT). Wild-type and human E258K cMyBP-C were expressed in mECT lacking endogenous mouse cMyBP-C through adenoviral-mediated gene transfer. Expression of E258K cMyBP-C did not affect cardiac cell survival and was appropriately incorporated into the cardiac sarcomere. Functionally, expression of E258K cMyBP-C caused accelerated contractile kinetics and severely compromised twitch force amplitude in mECT. Yeast two-hybrid analysis revealed that E258K cMyBP-C abolished interaction between the N terminal of cMyBP-C and myosin heavy chain sub-fragment 2 (S2). Furthermore, this mutation increased the affinity between the N terminal of cMyBP-C and actin. Assessment of phosphorylation of three serine residues in cMyBP-C showed that aberrant phosphorylation of cMyBP-C is unlikely to be responsible for altering these interactions. We show that the E258K mutation in cMyBP-C abolishes interaction between N-terminal cMyBP-C and myosin S2 by directly disrupting the cMyBP-C-S2 interface, independent of cMyBP-C phosphorylation. Similar to cMyBP-C ablation or phosphorylation, abolition of this inhibitory interaction accelerates contractile kinetics. Additionally, the E258K mutation impaired force production of mECT, which suggests that in addition to the loss of physiological function, this mutation disrupts contractility possibly by tethering the thick and thin filament or acting as an internal load.
Barrett, Christian L.; Cho, Byung-Kwan
2011-01-01
Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353
Structural features of diverse Pin-II proteinase inhibitor genes from Capsicum annuum.
Mahajan, Neha S; Dewangan, Veena; Lomate, Purushottam R; Joshi, Rakesh S; Mishra, Manasi; Gupta, Vidya S; Giri, Ashok P
2015-02-01
The proteinase inhibitor (PI) genes from Capsicum annuum were characterized with respect to their UTR, introns and promoter elements. The occurrence of PIs with circularly permuted domain organization was evident. Several potato inhibitor II (Pin-II) type proteinase inhibitor (PI) genes have been analyzed from Capsicum annuum (L.) with respect to their differential expression during plant defense response. However, complete gene characterization of any of these C. annuum PIs (CanPIs) has not been carried out so far. Complete gene architectures of a previously identified CanPI-7 (Beads-on-string, Type A) and a member of newly isolated Bracelet type B, CanPI-69 are reported in this study. The 5' UTR (untranslated region), 3'UTR, and intronic sequences of both the CanPI genes were obtained. The genomic sequence of CanPI-7 exhibited, exon 1 (49 base pair, bp) and exon 2 (740 bp) interrupted by a 294-bp long type I intron. We noted the occurrence of three multi-domain PIs (CanPI-69, 70, 71) with circularly permuted domain organization. CanPI-69 was found to possess exon 1 (49 bp), exon 2 (551 bp) and a 584-bp long type I intron. The upstream sequence analysis of CanPI-7 and CanPI-69 predicted various transcription factor-binding sites including TATA and CAAT boxes, hormone-responsive elements (ABRELATERD1, DOFCOREZM, ERELEE4), and a defense-responsive element (WRKY71OS). Binding of transcription factors such as zinc finger motif MADS-box and MYB to the promoter regions was confirmed using electrophoretic mobility shift assay followed by mass spectrometric identification. The 3' UTR analysis for 25 CanPI genes revealed unique/distinct 3' UTR sequence for each gene. Structures of three domain CanPIs of type A and B were predicted and further analyzed for their attributes. This investigation of CanPI gene architecture will enable the better understanding of the genetic elements present in CanPIs.
Bai, Hua; Post, Stephanie; Kang, Ping; Tatar, Marc
2015-01-01
Mutations of the insulin/IGF signaling (IIS) pathway extend Drosophila lifespan. Based on genetic epistasis analyses, this longevity assurance is attributed to downstream effects of the FOXO transcription factor. However, as reported FOXO accounts for only a portion of the observed longevity benefit, suggesting there are additional outputs of IIS to mediate aging. One candidate is target of rapamycin complex 1 (TORC1). Reduced TORC1 activity is reported to slow aging, whereas reduced IIS is reported to repress TORC1 activity. The eukaryotic translation initiation factor 4E binding protein (4E-BP) is repressed by TORC1, and activated 4E-BP is reported to increase Drosophila lifespan. Here we use genetic epistasis analyses to test whether longevity assurance mutants of chico, the Drosophila insulin receptor substrate homolog, require Drosophila d4eBP to slow aging. In chico heterozygotes, which are robustly long-lived, d4eBP is required but not sufficient to slow aging. Remarkably, d4eBP is not required or sufficient for chico homozygotes to extend longevity. Likewise, chico heterozygote females partially require d4eBP to preserve age-dependent locomotion, and both chico genotypes require d4eBP to improve stress-resistance. Reproduction and most measures of growth affected by either chico genotype are always independent of d4eBP. In females, chico heterozygotes paradoxically produce more rather than less phosphorylated 4E-BP (p4E-BP). Altered IRS function within the IIS pathway of Drosophila appears to have partial, conditional capacity to regulate aging through an unconventional interaction with 4E-BP.
Schuhmann, D; Godoy, P; Weiß, C; Gerloff, A; Singer, M V; Dooley, S; Böcker, U
2011-01-01
The intestinal epithelial barrier represents an important component in the pathogenesis of inflammatory bowel diseases. Interferon (IFN)-γ, a T helper type 1 (Th1) cytokine, regulated by the interleukin (IL)-18/IL-18 binding protein (bp) system, modulates the integrity of this barrier. The aim of this work was to study functionally the consequences of IFN-γ on intestinal epithelial cells (IEC) and to interfere selectively with identified adverse IFN-γ effects. IEC lines were stimulated with IFN-γ. IL-18 and IL-18bp were assessed by enzyme-linked immunosorbent assay. Staining of phosphatidylserine, DNA laddering, lactate dehydrogenase (LDH) release, cleavage of poly-adenosine diphosphate-ribose-polymerase (PARP) and activation of caspase-3 were analysed to determine cell death. Inhibitors of tyrosine kinase, caspase-3 or p38 mitogen-activated kinase ((MAP) activity were used. Cytokines were measured in supernatants of colonic biopsies of healthy controls and inflammatory bowel disease (IBD) patients. In IEC lines, IFN-γ up-regulated IL-18bp selectively. Ex vivo, IFN-γ was present in supernatants from cultured biopsies and up-regulated with inflammation. Contrary to previous reports, IFN-γ alone induced apoptosis in IEC lines, as demonstrated by phosphatidylserin staining, DNA cleavage and LDH release. Further, activation of caspase-3, PARP cleavage and expression of pro-apoptotic Bad were induced. Partial inhibition of caspase-3 and of p38 but not JAK tyrosine kinase, preserved up-regulation of IL-18bp expression. Selective inhibition of IFN-γ mediated apoptosis, while preserving its beneficial consequences on the ratio of IL-18/IL-18bp, could contribute to the integrity of the mucosal barrier in intestinal inflammation. PMID:21078084
Characterization of Plasmids in a Human Clinical Strain of Lactococcus garvieae
Blanco, M. Mar; López-Campos, Guillermo H.; Cutuli, M. Teresa; Fernández-Garayzábal, José F.
2012-01-01
The present work describes the molecular characterization of five circular plasmids found in the human clinical strain Lactococcus garvieae 21881. The plasmids were designated pGL1-pGL5, with molecular sizes of 4,536 bp, 4,572 bp, 12,948 bp, 14,006 bp and 68,798 bp, respectively. Based on detailed sequence analysis, some of these plasmids appear to be mosaics composed of DNA obtained by modular exchange between different species of lactic acid bacteria. Based on sequence data and the derived presence of certain genes and proteins, the plasmid pGL2 appears to replicate via a rolling-circle mechanism, while the other four plasmids appear to belong to the group of lactococcal theta-type replicons. The plasmids pGL1, pGL2 and pGL5 encode putative proteins related with bacteriocin synthesis and bacteriocin secretion and immunity. The plasmid pGL5 harbors genes (txn, orf5 and orf25) encoding proteins that could be considered putative virulence factors. The gene txn encodes a protein with an enzymatic domain corresponding to the family actin-ADP-ribosyltransferases toxins, which are known to play a key role in pathogenesis of a variety of bacterial pathogens. The genes orf5 and orf25 encode two putative surface proteins containing the cell wall-sorting motif LPXTG, with mucin-binding and collagen-binding protein domains, respectively. These proteins could be involved in the adherence of L. garvieae to mucus from the intestine, facilitating further interaction with intestinal epithelial cells and to collagenous tissues such as the collagen-rich heart valves. To our knowledge, this is the first report on the characterization of plasmids in a human clinical strain of this pathogen. PMID:22768237
Calmodulin and calmodulin-binding proteins in cystic fibrosis and normal human fibroblasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tallant, E.A.; Wallace, R.W.
1986-05-01
The authors have investigated the possibility that a lesion in a calmodulin (CaM)-dependent regulatory mechanism may be involved in cystic fibrosis (CF). The level of CaM, CaM-binding proteins (CaM-BP) and a CaM-dependent phosphatase (CaM-Ptase) have been compared in cultured fibroblasts from CF patients versus age- and sex-matched control subjects. The CaM concentration, measured by radioimmunoassay, ranged from 0.20 to 0.76 ..mu..g/mg protein (n=8); there was no significant difference in the average CaM concentration from CF patients vs controls. Using Western blotting techniques with /sup 125/I-CaM, they detected at least ten distinct CaM-BPs in fibroblasts with molecular weights ranging from 230Kmore » to 37K; the only consistent difference between control and CF cell lines was in a 46.5K CaM-BP, which was depressed in all three CF samples. The 46.5 K CaM-BP was found only in the particulate fraction. A 59K CaM-BP was identified as a CaM-Ptase by its crossreactivity with an antibody against a brain CaM-Ptase. There was no significant difference in CaM-Ptase activity or in the amount of the phosphatase as determined by radioimmunoassay in CF vs. normal samples (n=8). Thus, the level of CaM as well as its various enzymes and proteins do not appear to be altered in CF fibroblasts except for a CaM-BP of 46.5K, the identity of which is currently being investigated.« less
Harwood, V J; Gordon, A S
1994-01-01
Extracellular proteins of wild-type Vibrio alginolyticus were compared with those of copper-resistant and copper-sensitive mutants. One copper-resistant mutant (Cu40B3) constitutively produced an extracellular protein with the same apparent molecular mass (21 kDa) and chromatographic behavior as copper-binding protein (CuBP), a copper-induced supernatant protein which has been implicated in copper detoxification in wild-type V. alginolyticus. Copper-sensitive V. alginolyticus mutants displayed a range of alterations in supernatant protein profiles. CuBP was not detected in supernatants of one copper-sensitive mutant after cultures had been stressed with 50 microM copper. Increased resistance to copper was not induced by preincubation with subinhibitory levels of copper in the wild type or in the copper-resistant mutant Cu40B3. Copper-resistant mutants maintained the ability to grow on copper-amended agar after 10 or more subcultures on nonselective agar, demonstrating the stability of the phenotype. A derivative of Cu40B3 with wild-type sensitivity to copper which no longer constitutively expressed CuBP was isolated. The simultaneous loss of both constitutive CuBP production and copper resistance in Cu40B3 indicates that constitutive CuBP production is necessary for copper resistance in this mutant. These data support the hypothesis that the extracellular, ca. 20-kDa protein(s) of V. alginolyticus is an important factor in survival and growth of the organism at elevated copper concentrations. The range of phenotypes observed in copper-resistant and copper-sensitive V. alginolyticus indicate that altered sensitivity to copper was mediated by a variety of physiological changes. Images PMID:8031076
Vergara-Irigaray, Marta; Valle, Jaione; Merino, Nekane; Latasa, Cristina; García, Begoña; Ruiz de los Mozos, Igor; Solano, Cristina; Toledo-Arana, Alejandro; Penadés, José R.; Lasa, Iñigo
2009-01-01
Staphylococcus aureus can establish chronic infections on implanted medical devices due to its capacity to form biofilms. Analysis of the factors that assemble cells into a biofilm has revealed the occurrence of strains that produce either a polysaccharide intercellular adhesin/poly-N-acetylglucosamine (PIA/PNAG) exopolysaccharide- or a protein-dependent biofilm. Examination of the influence of matrix nature on the biofilm capacities of embedded bacteria has remained elusive, because a natural strain that readily converts between a polysaccharide- and a protein-based biofilm has not been studied. Here, we have investigated the clinical methicillin (meticillin)-resistant Staphylococcus aureus strain 132, which is able to alternate between a proteinaceous and an exopolysaccharidic biofilm matrix, depending on environmental conditions. Systematic disruption of each member of the LPXTG surface protein family identified fibronectin-binding proteins (FnBPs) as components of a proteinaceous biofilm formed in Trypticase soy broth-glucose, whereas a PIA/PNAG-dependent biofilm was produced under osmotic stress conditions. The induction of FnBP levels due to a spontaneous agr deficiency present in strain 132 and the activation of a LexA-dependent SOS response or FnBP overexpression from a multicopy plasmid enhanced biofilm development, suggesting a direct relationship between the FnBP levels and the strength of the multicellular phenotype. Scanning electron microscopy revealed that cells growing in the FnBP-mediated biofilm formed highly dense aggregates without any detectable extracellular matrix, whereas cells in a PIA/PNAG-dependent biofilm were embedded in an abundant extracellular material. Finally, studies of the contribution of each type of biofilm matrix to subcutaneous catheter colonization revealed that an FnBP mutant displayed a significantly lower capacity to develop biofilm on implanted catheters than the isogenic PIA/PNAG-deficient mutant. PMID:19581398
Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori
2013-01-01
The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1+, two temperature-sensitive mcb1 gene mutants (mcb1ts) were isolated. Extensive genetic analysis showed that the mcb1ts mutants were suppressed by a mcm5+ multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1ts mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1ts mutants. Furthermore, the mcb1ts mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex. PMID:23322785
Santosa, Venny; Martha, Sabrina; Hirose, Noriaki; Tanaka, Katsunori
2013-03-08
The minichromosome maintenance (MCM) complex is a replicative helicase, which is essential for chromosome DNA replication. In recent years, the identification of a novel MCM-binding protein (MCM-BP) in most eukaryotes has led to numerous studies investigating its function and its relationship to the MCM complex. However, the mechanisms by which MCM-BP functions and associates with MCM complexes are not well understood; in addition, the functional role of MCM-BP remains controversial and may vary between model organisms. The present study aims to elucidate the nature and biological function of the MCM-BP ortholog, Mcb1, in fission yeast. The Mcb1 protein continuously interacts with MCM proteins during the cell cycle in vivo and can interact with any individual MCM subunit in vitro. To understand the detailed characteristics of mcb1(+), two temperature-sensitive mcb1 gene mutants (mcb1(ts)) were isolated. Extensive genetic analysis showed that the mcb1(ts) mutants were suppressed by a mcm5(+) multicopy plasmid and displayed synthetic defects with many S-phase-related gene mutants. Moreover, cyclin-dependent kinase modulation by Cig2 repression or Rum1 overproduction suppressed the mcb1(ts) mutants, suggesting the involvement of Mcb1 in pre-RC formation during DNA replication. These data are consistent with the observation that Mcm7 loading onto replication origins is reduced and S-phase progression is delayed in mcb1(ts) mutants. Furthermore, the mcb1(ts) mutation led to the redistribution of MCM subunits to the cytoplasm, and this redistribution was dependent on an active nuclear export system. These results strongly suggest that Mcb1 promotes efficient pre-RC formation during DNA replication by regulating the MCM complex.
Selection of homeotic proteins for binding to a human DNA replication origin.
de Stanchina, E; Gabellini, D; Norio, P; Giacca, M; Peverali, F A; Riva, S; Falaschi, A; Biamonti, G
2000-06-09
We have previously shown that a cell cycle-dependent nucleoprotein complex assembles in vivo on a 74 bp sequence within the human DNA replication origin associated to the Lamin B2 gene. Here, we report the identification, using a one-hybrid screen in yeast, of three proteins interacting with the 74 bp sequence. All of them, namely HOXA13, HOXC10 and HOXC13, are orthologues of the Abdominal-B gene of Drosophila melanogaster and are members of the homeogene family of developmental regulators. We describe the complete open reading frame sequence of HOXC10 and HOXC13 along with the structure of the HoxC13 gene. The specificity of binding of these two proteins to the Lamin B2 origin is confirmed by both band-shift and in vitro footprinting assays. In addition, the ability of HOXC10 and HOXC13 to increase the activity of a promoter containing the 74 bp sequence, as assayed by CAT-assay experiments, demonstrates a direct interaction of these homeoproteins with the origin sequence in mammalian cells. We also show that HOXC10 expression is cell-type-dependent and positively correlates with cell proliferation. Copyright 2000 Academic Press.
Nieto, Alma; Pérez Ishiwara, David G; Orozco, Esther; Sánchez Monroy, Virginia; Gómez García, Consuelo
2017-01-01
Transcriptional regulation of the multidrug resistance EhPgp5 gene in Entamoeba histolytica is induced by emetine stress. EhPgp5 overexpression alters the chloride-dependent currents that cause trophozoite swelling, diminishing induced programmed cell death (PCD) susceptibility. In contrast, antisense inhibition of P-glycoprotein (PGP) expression produces synchronous death of trophozoites and the enhancement of the biochemical and morphological characteristics of PCD induced by G418. Transcriptional gene regulation analysis identified a 59 bp region at position -170 to -111 bp promoter as putative emetine response elements (EREs). However, insights into transcription factors controlling EhPgp5 gene transcription are missing; to fill this knowledge gap, we used deletion studies and transient CAT activity assays. Our findings suggested an activating motif (-151 to -136 bp) that corresponds to a heat shock element (HSE). Gel-shift assays, UV-crosslinking, binding protein purification, and western blotting assays revealed proteins of 94, 66, 62, and 51 kDa binding to the EhPgp5 HSE that could be heat shock-like transcription factors that regulate the transcriptional activation of the EhPgp5 gene in the presence of emetine drug.
Protein-mediated loops in supercoiled DNA create large topological domains
Yan, Yan; Ding, Yue; Leng, Fenfei; Dunlap, David; Finzi, Laura
2018-01-01
Abstract Supercoiling can alter the form and base pairing of the double helix and directly impact protein binding. More indirectly, changes in protein binding and the stress of supercoiling also influence the thermodynamic stability of regulatory, protein-mediated loops and shift the equilibria of fundamental DNA/chromatin transactions. For example, supercoiling affects the hierarchical organization and function of chromatin in topologically associating domains (TADs) in both eukaryotes and bacteria. On the other hand, a protein-mediated loop in DNA can constrain supercoiling within a plectonemic structure. To characterize the extent of constrained supercoiling, 400 bp, lac repressor-secured loops were formed in extensively over- or under-wound DNA under gentle tension in a magnetic tweezer. The protein-mediated loops constrained variable amounts of supercoiling that often exceeded the maximum writhe expected for a 400 bp plectoneme. Loops with such high levels of supercoiling appear to be entangled with flanking domains. Thus, loop-mediating proteins operating on supercoiled substrates can establish topological domains that may coordinate gene regulation and other DNA transactions across spans in the genome that are larger than the separation between the binding sites. PMID:29538766
Oberlin, Brandon G; Dzemidzic, Mario; Tran, Stella M; Soeurt, Christina M; Albrecht, Daniel S; Yoder, Karmen K; Kareken, David A
2013-08-01
Striatal dopamine (DA) is increased by virtually all drugs of abuse, including alcohol. However, drug-associated cues are also known to provoke striatal DA transmission- a phenomenon linked to the motivated behaviors associated with addiction. To our knowledge, no one has tested if alcohol's classically conditioned flavor cues, in the absence of a significant pharmacologic effect, are capable of eliciting striatal DA release in humans. Employing positron emission tomography (PET), we hypothesized that beer's flavor alone can reduce the binding potential (BP) of [(11)C]raclopride (RAC; a reflection of striatal DA release) in the ventral striatum, relative to an appetitive flavor control. Forty-nine men, ranging from social to heavy drinking, mean age 25, with a varied family history of alcoholism underwent two [(11)C]RAC PET scans: one while tasting beer, and one while tasting Gatorade. Relative to the control flavor of Gatorade, beer flavor significantly increased self-reported desire to drink, and reduced [(11)C]RAC BP, indicating that the alcohol-associated flavor cues induced DA release. BP reductions were strongest in subjects with first-degree alcoholic relatives. These results demonstrate that alcohol-conditioned flavor cues can provoke ventral striatal DA release, absent significant pharmacologic effects, and that the response is strongest in subjects with a greater genetic risk for alcoholism. Striatal DA responses to salient alcohol cues may thus be an inherited risk factor for alcoholism.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sundaram, Kumaran; Nishimura, Riko; Senn, Joseph
2007-01-01
Osteoclast differentiation is tightly regulated by receptor activator of NF-{kappa}B ligand (RANKL) signaling. Matrix metalloproteinase-9 (MMP-9), a type IV collagenase is highly expressed in osteoclast cells and plays an important role in degradation of extracellular matrix; however, the molecular mechanisms that regulate MMP-9 gene expression are unknown. In this study, we demonstrate that RANKL signaling induces MMP-9 gene expression in osteoclast precursor cells. We further show that RANKL regulates MMP-9 gene expression through TRAF6 but not TRAF2. Interestingly, blockade of p38 MAPK activity by pharmacological inhibitor, SB203580 increases MMP-9 activity whereas ERK1/2 inhibitor, PD98059 decreases RANKL induced MMP-9 activity inmore » RAW264.7 cells. These data suggest that RANKL differentially regulates MMP-9 expression through p38 and ERK signaling pathways during osteoclast differentiation. Transient expression of MMP-9 gene (+ 1 to - 1174 bp relative to ATG start codon) promoter-luciferase reporter plasmids in RAW264.7 cells and RANKL stimulation showed significant increase (20-fold) of MMP-9 gene promoter activity; however, there is no significant change with respect to + 1 bp to - 446 bp promoter region and empty vector transfected cells. These results indicated that MMP-9 promoter sequence from - 446 bp to - 1174 bp relative to start codon is responsive to RANKL stimulation. Sequence analysis of the mouse MMP-9 gene promoter region further identified the presence of binding motif (- 1123 bp to - 1153 bp) for the nuclear factor of activated T cells 1 (NFATc1) transcription factor. Inhibition of NFATc1 using siRNA and VIVIT peptide inhibitor significantly decreased RANKL stimulation of MMP-9 activity. We further confirm by oligonucleotide pull-down assay that RANKL stimuli enhanced NFATc1 binding to MMP-9 gene promoter element. In addition, over-expression of constitutively active NFAT in RAW264.7 cells markedly increased (5-fold) MMP-9 gene promoter activity in the absence of RANKL. Taken together, our results suggest that RANKL signals through TRAF6 and that NFATc1 is a downstream effector of RANKL signaling to modulate MMP-9 gene expression during osteoclast differentiation.« less
Kupzig, Sabine; Bouyoucef-Cherchalli, Dalila; Yarwood, Sam; Sessions, Richard; Cullen, Peter J
2009-07-01
GAP1(IP4BP) is a member of the GAP1 family of Ras GTPase-activating proteins (GAPs) that includes GAP1(m), CAPRI, and RASAL. Composed of a central Ras GAP-related domain (RasGRD), surrounded by amino-terminal C2 domains and a carboxy-terminal PH/Btk domain, these proteins, with the notable exception of GAP1(m), possess an unexpected arginine finger-dependent GAP activity on the Ras-related protein Rap1 (S. Kupzig, D. Deaconescu, D. Bouyoucef, S. A. Walker, Q. Liu, C. L. Polte, O. Daumke, T. Ishizaki, P. J. Lockyer, A. Wittinghofer, and P. J. Cullen, J. Biol. Chem. 281:9891-9900, 2006). Here, we have examined the mechanism through which GAP1(IP4BP) can function as a Rap1 GAP. We show that deletion of domains on either side of the RasGRD, while not affecting Ras GAP activity, do dramatically perturb Rap1 GAP activity. By utilizing GAP1(IP4BP)/GAP1(m) chimeras, we establish that although the C2 and PH/Btk domains are required to stabilize the RasGRD, it is this domain which contains the catalytic machinery required for Rap1 GAP activity. Finally, a key residue in Rap1-specific GAPs is a catalytic asparagine, the so-called asparagine thumb. By generating a molecular model describing the predicted Rap1-binding site in the RasGRD of GAP1(IP4BP), we show that mutagenesis of individual asparagine or glutamine residues that lie in close proximity to the predicted binding site has no detectable effect on the in vivo Rap1 GAP activity of GAP1(IP4BP). In contrast, we present evidence consistent with a model in which the RasGRD of GAP1(IP4BP) functions to stabilize the switch II region of Rap1, allowing stabilization of the transition state during GTP hydrolysis initiated by the arginine finger.
Patterson, Kristine B.; Malone, Stephanie A.; Shaheen, Nicholas J.; Asher Prince, Heather M.; Dumond, Julie B.; Spacek, Melissa B.; Heidt, Paris E.; Cohen, Myron S.; Kashuba, Angela D. M.
2011-01-01
Background. Antiretroviral pharmacology in seminal plasma (SP) and rectal tissue (RT) may provide insight into antiretroviral resistance and the prevention of sexual transmission of human immunodeficiency virus (HIV). Saliva may be of utility for noninvasively measuring adherence. Methods. A pharmacokinetic study was performed in 12 HIV-negative men receiving maraviroc 300 mg twice daily for 8 days. Seven time-matched pairs of blood plasma (BP) and saliva samples were collected over 12 h on day 1 (PK1) and days 7 and 8 (PK2). One RT sample from each subject was collected during PK1 and PK2. Two SP samples were collected from each subject during PK1, and 6 SP samples were collected from each subject during PK2. Results. SP AUCs were ∼50% lower than BP. However, protein binding in SP ranged from 4% to 25%, resulting in protein-free concentrations >2-fold higher than BP. RT AUCs were 7.5- to 26-fold higher than BP. Maraviroc saliva AUCs were ∼70% lower than BP, but saliva concentrations correlated with BP (r2 = 0.58). Conclusions. More pharmacologically available maraviroc was found in SP than BP. High RT concentrations are promising for preventing rectal HIV acquisition. Saliva correlation with BP suggests that this may be useful for monitoring adherence. Clinical Trials Registration. NCT00775294. PMID:21502084
NASA Astrophysics Data System (ADS)
Ding, Yi-min; Shi, Jun-jie; Zhang, Min; Zhu, Yao-hui; Wu, Meng; Wang, Hui; Cen, Yu-lang; Guo, Wen-hui; Pan, Shu-hang
2018-07-01
Within the framework of the spin-polarized density-functional theory, we have studied the electronic and magnetic properties of InSe/black-phosphorus (BP) heterostructure doped with 3d transition-metal (TM) atoms from Sc to Zn. The calculated binding energies show that TM-atom doping in the van der Waals (vdW) gap of InSe/BP heterostructure is energetically favorable. Our results indicate that magnetic moments are induced in the Sc-, Ti-, V-, Cr-, Mn- and Co-doped InSe/BP heterostructures due to the existence of non-bonding 3d electrons. The Ni-, Cu- and Zn-doped InSe/BP heterostructures still show nonmagnetic semiconductor characteristics. Furthermore, in the Fe-doped InSe/BP heterostructure, the half-metal property is found and a high spin polarization of 100% at the Fermi level is achieved. The Cr-doped InSe/BP has the largest magnetic moment of 4.9 μB. The Sc-, Ti-, V-, Cr- and Mn-doped InSe/BP heterostructures exhibit antiferromagnetic ground state. Moreover, the Fe- and Co-doped systems display a weak ferromagnetic and paramagnetic coupling, respectively. Our studies demonstrate that the TM doping in the vdW gap of InSe/BP heterostructure is an effective way to modify its electronic and magnetic properties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less
Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi
2015-12-10
D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.
Polo-like kinase 1 inhibits DNA damage response during mitosis
Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor
2015-01-01
In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis. PMID:25607646
Polo-like kinase 1 inhibits DNA damage response during mitosis.
Benada, Jan; Burdová, Kamila; Lidak, Tomáš; von Morgen, Patrick; Macurek, Libor
2015-01-01
In response to genotoxic stress, cells protect their genome integrity by activation of a conserved DNA damage response (DDR) pathway that coordinates DNA repair and progression through the cell cycle. Extensive modification of the chromatin flanking the DNA lesion by ATM kinase and RNF8/RNF168 ubiquitin ligases enables recruitment of various repair factors. Among them BRCA1 and 53BP1 are required for homologous recombination and non-homologous end joining, respectively. Whereas mechanisms of DDR are relatively well understood in interphase cells, comparatively less is known about organization of DDR during mitosis. Although ATM can be activated in mitotic cells, 53BP1 is not recruited to the chromatin until cells exit mitosis. Here we report mitotic phosphorylation of 53BP1 by Plk1 and Cdk1 that impairs the ability of 53BP1 to bind the ubiquitinated H2A and to properly localize to the sites of DNA damage. Phosphorylation of 53BP1 at S1618 occurs at kinetochores and in cytosol and is restricted to mitotic cells. Interaction between 53BP1 and Plk1 depends on the activity of Cdk1. We propose that activity of Cdk1 and Plk1 allows spatiotemporally controlled suppression of 53BP1 function during mitosis.
A novel site-specific recombination system derived from bacteriophage phiMR11.
Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu
2008-04-04
We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.
UCP2 and 3 deletion screening and distribution in 15 pig breeds.
Li, Yanhua; Li, Hanjie; Zhao, Xingbo; Li, Ning; Wu, Changxin
2007-02-01
The uncoupling protein family is a mitochondrial anion carrier family. It plays an important role in the biological traits of animal body weight, basal metabolic rate and energy conversion. Using PCR and PCR-SSCP, we scanned the porcine uncoupling protein 2 gene (UCP2) and uncoupling protein 3 gene (UCP3) and found seven deletion sites, three in UCP2 and four in UCP3. The deletions in 15 pig breeds showed that deletion influenced weight. The genotype compounding of seven deletion sites in 15 pig breeds had significant effects on performance traits of the pig, such as body weight. We predicted the potential protein factor binding sites using the transcription factor analysis tool TFSearch version 1.3 online. Two deletions (1830 nt and 3219 nt) in UCP3 were found to change the transcriptional factor sites. The 16 bp deletion in 1830 nt added a SP1 site and a 6 bp deletion in 3219 nt removed two MZF1 sites. Seven deletion polymorphisms were covered in introns of linkage genes of UCP2 and UCP3, showing that UCPs have conservation and genetic reliability.
Meng, Xiaoli; Jenkins, Rosalind E.; Berry, Neil G.; Maggs, James L.; Farrell, John; Lane, Catherine S.; Stachulski, Andrew V.; French, Neil S.; Naisbitt, Dean J.; Pirmohamed, Munir
2011-01-01
Covalent binding to proteins to form neoantigens is thought to be central to the pathogenesis of penicillin hypersensitivity reactions. We have undertaken detailed mass spectrometric studies to define the mechanism and protein chemistry of hapten formation from benzylpenicillin (BP) and its rearrangement product, benzylpenicillenic acid (PA). Mass spectrometric analysis of human serum albumin exposed to BP and PA in vitro revealed that at low concentrations (drug protein molar ratio 0.001:1) and during short time incubations BP and PA selectively target different residues, Lys199 and Lys525, respectively. Molecular modeling showed that the selectivity was a function of noncovalent interaction before covalent modification. With increased exposure to higher concentrations of BP and PA, multiple epitopes were detected on albumin, demonstrating that the multiplicity of hapten formation is a function of time and concentration. More importantly, we have demonstrated direct evidence that PA is a hapten accounting for the diastereoisomeric BP antigen formation in albumin isolated from the blood of patients receiving penicillin. Furthermore, PA was found to be more potent than BP with respect to stimulation of T cells from patients with penicillin hypersensitivity, illustrating the functional relevance of diastereoisomeric hapten formation. PMID:21680886
4E-BP is a target of the GCN2–ATF4 pathway during Drosophila development and aging
Park, Jung-Eun; Zeng, Xiaomei
2017-01-01
Reduced amino acid availability attenuates mRNA translation in cells and helps to extend lifespan in model organisms. The amino acid deprivation–activated kinase GCN2 mediates this response in part by phosphorylating eIF2α. In addition, the cap-dependent translational inhibitor 4E-BP is transcriptionally induced to extend lifespan in Drosophila melanogaster, but through an unclear mechanism. Here, we show that GCN2 and its downstream transcription factor, ATF4, mediate 4E-BP induction, and GCN2 is required for lifespan extension in response to dietary restriction of amino acids. The 4E-BP intron contains ATF4-binding sites that not only respond to stress but also show inherent ATF4 activity during normal development. Analysis of the newly synthesized proteome through metabolic labeling combined with click chemistry shows that certain stress-responsive proteins are resistant to inhibition by 4E-BP, and gcn2 mutant flies have reduced levels of stress-responsive protein synthesis. These results indicate that GCN2 and ATF4 are important regulators of 4E-BP transcription during normal development and aging. PMID:27979906
Mu, Changkao; Song, Xiaoyan; Zhao, Jianmin; Wang, Lingling; Qiu, Limei; Zhang, Huan; Zhou, Zhi; Wang, Mengqiang; Song, Linsheng; Wang, Chunlin
2012-05-01
C-type lectins are a family of calcium-dependent carbohydrate-binding proteins. In the present study, a C-type lectin (designated as AiCTL5) was identified and characterized from Argopecten irradians. The full-length cDNA of AiCTL5 was of 673 bp, containing a 5' untranslated region (UTR) of 24 bp, a 3' UTR of 130 bp with a poly (A) tail, and an open reading frame (ORF) of 519 bp encoding a polypeptide of 172 amino acids with a putative signal peptide of 17 amino acids. A C-type lectin-like domain (CRD) containing 6 conserved cysteines and a putative glycosylation sites were identified in the deduced amino acid sequence of AiCTL5. AiCTL5 shared 11%-27.5% identity with the previous reported C-type lectin from A. irradians. The cDNA fragment encoding the mature peptide of AiCTL5 was recombined into pET-21a (+) with a C-terminal hexa-histidine tag fused in-frame, and expressed in Escherichia coli Origami (DE3). The recombinant AiCTL5 (rAiCTL5) agglutinated Gram-negative E. coli TOP10F' and Listonella anguillarum, but did not agglutinate Gram-positive bacteria Bacillus thuringiensis and Micrococcus luteus, and the agglutination could be inhibited by EDTA, indicating that AiCTL5 was a Ca(2+)-dependent lectin. rAiCTL5 exhibited a significantly strong activity to bind LPS from E. coli, which conformed to the agglutinating activity toward Gram-negative bacteria. Moreover, rAiCTL5 also agglutinated rabbit erythrocytes. These results indicated that AiCTL5 could function as a pattern recognition receptor to protect bay scallop from Gram-negative bacterial infection, and also provide evidence to understand the structural and functional diverse of lectin. Copyright © 2012 Elsevier Ltd. All rights reserved.
M2 pyruvate kinase provides a mechanism for nutrient sensing and regulation of cell proliferation
Morgan, Hugh P.; O’Reilly, Francis J.; Wear, Martin A.; O’Neill, J. Robert; Fothergill-Gilmore, Linda A.; Hupp, Ted; Walkinshaw, Malcolm D.
2013-01-01
We show that the M2 isoform of pyruvate kinase (M2PYK) exists in equilibrium between monomers and tetramers regulated by allosteric binding of naturally occurring small-molecule metabolites. Phenylalanine stabilizes an inactive T-state tetrameric conformer and inhibits M2PYK with an IC50 value of 0.24 mM, whereas thyroid hormone (triiodo-l-thyronine, T3) stabilizes an inactive monomeric form of M2PYK with an IC50 of 78 nM. The allosteric activator fructose-1,6-bisphosphate [F16BP, AC50 (concentration that gives 50% activation) of 7 μM] shifts the equilibrium to the tetrameric active R-state, which has a similar activity to that of the constitutively fully active isoform M1PYK. Proliferation assays using HCT-116 cells showed that addition of inhibitors phenylalanine and T3 both increased cell proliferation, whereas addition of the activator F16BP reduced proliferation. F16BP abrogates the inhibitory effect of both phenylalanine and T3, highlighting a dominant role of M2PYK allosteric activation in the regulation of cancer proliferation. X-ray structures show constitutively fully active M1PYK and F16BP-bound M2PYK in an R-state conformation with a lysine at the dimer-interface acting as a peg in a hole, locking the active tetramer conformation. Binding of phenylalanine in an allosteric pocket induces a 13° rotation of the protomers, destroying the peg-in-hole R-state interface. This distinct T-state tetramer is stabilized by flipped out Trp/Arg side chains that stack across the dimer interface. X-ray structures and biophysical binding data of M2PYK complexes explain how, at a molecular level, fluctuations in concentrations of amino acids, thyroid hormone, and glucose metabolites switch M2PYK on and off to provide the cell with a nutrient sensing and growth signaling mechanism. PMID:23530218
Yu, Shanshan; Yang, Hui; Chai, Yingmei; Liu, Yingying; Zhang, Qiuxia; Ding, Xinbiao; Zhu, Qian
2013-02-01
C-type lectins, as the members of pattern-recognition receptors (PRRs), play significant roles in innate immunity responses through binding to the pathogen-associated molecular patterns (PAMPs) presented on surfaces of microorganisms. In our study, a C-type lectin gene (TfCTL1) was cloned from the roughskin sculpin using expression sequence tag (EST) and rapid amplification of cDNA ends (RACE) techniques. The full-length of TfCTL1 was 696 bp, consisting of a 95 bp 5' untranslated region (UTR), a 498 bp open reading frame (ORF) encoding a 165 amino acid protein, and a 103 bp 3' UTR with a polyadenylation signal sequence AATAAA and a poly(A) tail. The deduced amino acid sequence of TfCTL1 contained a signal peptide and a single carbohydrate recognition domain (CRD) which had four conserved disulfide-bonded cysteine residues (Cys(61)-Cys(158), Cys(134)-Cys(150)) and a Ca(2+)/carbohydrate-binding site (QPD motif). Results from the qRT-PCR indicated that TfCTL1 mRNA was predominately expressed in the liver. The temporal expression of TfCTL1 was obviously up-regulated in the skin, blood, spleen and heart in time dependent manners by lipopolysaccharide (LPS) challenge, whereas in the liver, TfCTL1 was initially down-regulated from 2 h to 48 h followed by an abrupt up-regulation at 72 h. Recombinant TfCTL1 CRD purified from Escherichia coli BL21 was able to agglutinate some Gram-positive bacteria, Gram-negative bacteria and a yeast in a Ca(2+)-dependent manner. Further analysis showed that TfCTL1 can bind to several kinds of microorganisms selectively in a Ca(2+)-independent manner. These results suggested that TfCTL1 might be involved in the innate response as a PRR. Copyright © 2012 Elsevier Ltd. All rights reserved.
Blayney, Michelle J; Whitney, Spencer M; Beck, Jennifer L
2011-09-01
Ribulose bisphosphate carboxylase/oxygenase (Rubisco) is the protein that is responsible for the fixation of carbon dioxide in photosynthesis. Inhibitory sugar phosphate molecules, which can include its substrate ribulose-1,5-bisphosphate (RuBP), can bind to Rubisco catalytic sites and inhibit catalysis. These are removed by interaction with Rubisco activase (RA) via an ATP hydrolytic reaction. Here we show the first nanoESI mass spectra of the hexadecameric Rubisco and of RA from a higher plant (tobacco). The spectra of recombinant, purified RA revealed polydispersity in its oligomeric forms (up to hexamer) and that ADP was bound. ADP was removed by dialysis against a high ionic strength solution and nucleotide binding experiments showed that ADP bound more tightly to RA than AMP-PNP (a non-hydrolysable ATP analog). There was evidence that there may be two nucleotide binding sites per RA monomer. The oligomerization capacity of mutant and wild-type tobacco RA up to hexamers is analogous to the subunit stoichiometry for other AAA+ enzymes. This suggests assembly of RA into hexamers is likely the most active conformation for removing inhibitory sugar phosphate molecules from Rubisco to enable its catalytic competency. Stoichiometric binding of RuBP or carboxyarabinitol bisphosphate (CABP) to each of the eight catalytic sites of Rubisco was observed.
Cerda-Maira, Francisca A.; Kovacikova, Gabriela; Jude, Brooke A.; Skorupski, Karen
2013-01-01
The Vibrio cholerae BreR protein is a transcriptional repressor of the breAB efflux system operon, which encodes proteins involved in bile resistance. In a previous study (F. A. Cerda-Maira, C. S. Ringelberg, and R. K. Taylor, J. Bacteriol. 190:7441–7452, 2008), we used gel mobility shift assays to determine that BreR binds at two independent binding sites at the breAB promoter and a single site at its own promoter. Here it is shown, by DNase I footprinting and site-directed mutagenesis, that BreR is able to bind at a distal and a proximal site in the breAB promoter. However, only one of these sites, the proximal 29-bp site, is necessary for BreR-mediated transcriptional repression of breAB expression. In addition, it was determined that BreR represses its own expression by recognizing a 28-bp site at the breR promoter. These sites comprise regions of dyad symmetry within which residues critical for BreR function could be identified. The BreR consensus sequence AANGTANAC-N6-GTNTACNTT overlaps the −35 region at both promoters, implying that the repression of gene expression is achieved by interfering with RNA polymerase binding at these promoters. PMID:23144245
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lishanski, A.; Ostrander, E.A.; Rine, J.
1994-03-29
An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less
"Kill" the messenger: Targeting of cell-derived microparticles in lupus nephritis.
Nielsen, Christoffer T; Rasmussen, Niclas S; Heegaard, Niels H H; Jacobsen, Søren
2016-07-01
Immune complex (IC) deposition in the glomerular basement membrane (GBM) is a key early pathogenic event in lupus nephritis (LN). The clarification of the mechanisms behind IC deposition will enable targeted therapy in the future. Circulating cell-derived microparticles (MPs) have been proposed as major sources of extracellular autoantigens and ICs and triggers of autoimmunity in LN. The overabundance of galectin-3-binding protein (G3BP) along with immunoglobulins and a few other proteins specifically distinguish circulating MPs in patients with systemic lupus erythematosus (SLE), and this is most pronounced in patients with active LN. G3BP co-localizes with deposited ICs in renal biopsies from LN patients supporting a significant presence of MPs in the IC deposits. G3BP binds strongly to glomerular basement membrane proteins and integrins. Accordingly, MP surface proteins, especially G3BP, may be essential for the deposition of ICs in kidneys and thus for the ensuing formation of MP-derived electron dense structures in the GBM, and immune activation in LN. This review focuses on the notion of targeting surface molecules on MPs as an entirely novel treatment strategy in LN. By targeting MPs, a double hit may be achieved by attenuating both the autoantigenic fueling of immune complexes and the triggering of the adaptive immune system. Thereby, early pathogenic events may be blocked in contrast to current treatment strategies that primarily target and modulate later events in the cellular and humoral immune response. Copyright © 2016 Elsevier B.V. All rights reserved.
Rubin, Keith; Glazer, Steven
2017-02-01
While a number of endogenous risk factors including age and genetics are established for Alzheimer's disease (AD), identification of acquired, potentially preventable or treatable causes, remains limited. In this paper, we review three epidemiologic case studies and present extensive biologic, immunologic and anatomic evidence to support a novel hypothesis that Bordetella pertussis (BP), the bacterium better known to cause whooping cough, is an important potential cause of AD. Cross-cultural documentation of nasopharyngeal subclinical BP colonization reflecting BP-specific mucosal immunodeficiency, proximate anatomy of intranasal mucosal surfaces to central nervous system (CNS) olfactory pathways, and mechanisms by which BP and BP toxin account for all hallmark pathology of AD are reviewed, substantiating biologic plausibility. Notably, respiratory BP infection and BP toxin secreted from subclinical BP colonization can account for the initiation and accumulation of amyloid β plaques and tau tangles. Additional mechanisms consistent with the immunobiologic effects of subclinical BP colonization include microglial activation and inflammation, atrophy and neurodegeneration, excitotoxicity, distinctive anatomic distribution and sequential spread of disease, impaired glucose utilization, and other characteristic CNS pathology of AD. We conclude by assessing the evidence for causation against the Bradford Hill criteria, and advocate for further investigation into the potential role of BP in the etiology of AD. Copyright © 2016 The Author(s). Published by Elsevier GmbH.. All rights reserved.
He, Lin; Jiang, Hui; Cao, Dandan; Liu, Lihua; Hu, Songnian; Wang, Qun
2013-01-01
The accessory sex gland (ASG) is an important component of the male reproductive system, which functions to enhance the fertility of spermatozoa during male reproduction. Certain proteins secreted by the ASG are known to bind to the spermatozoa membrane and affect its function. The ASG gene expression profile in Chinese mitten crab (Eriocheir sinensis) has not been extensively studied, and limited genetic research has been conducted on this species. The advent of high-throughput sequencing technologies enables the generation of genomic resources within a short period of time and at minimal cost. In the present study, we performed de novo transcriptome sequencing to produce a comprehensive transcript dataset for the ASG of E. sinensis using Illumina sequencing technology. This analysis yielded a total of 33,221,284 sequencing reads, including 2.6 Gb of total nucleotides. Reads were assembled into 85,913 contigs (average 218 bp), or 58,567 scaffold sequences (average 292 bp), that identified 37,955 unigenes (average 385 bp). We assembled all unigenes and compared them with the published testis transcriptome from E. sinensis. In order to identify which genes may be involved in ASG function, as it pertains to modification of spermatozoa, we compared the ASG and testis transcriptome of E. sinensis. Our analysis identified specific genes with both higher and lower tissue expression levels in the two tissues, and the functions of these genes were analyzed to elucidate their potential roles during maturation of spermatozoa. Availability of detailed transcriptome data from ASG and testis in E. sinensis can assist our understanding of the molecular mechanisms involved with spermatozoa conservation, transport, maturation and capacitation and potentially acrosome activation. PMID:23342039
Dayan, Avraham; Babin, Gilad; Ganoth, Assaf; Kayouf, Nivin Samir; Nitoker Eliaz, Neta; Mukkala, Srijana; Tsfadia, Yossi; Fleminger, Gideon
2017-08-01
Titanium (Ti) and its alloys are widely used in orthodontic and orthopedic implants by virtue to their high biocompatibility, mechanical strength, and high resistance to corrosion. Biointegration of the implants with the tissue requires strong interactions, which involve biological molecules, proteins in particular, with metal oxide surfaces. An exocellular high-affinity titanium dioxide (TiO 2 )-binding protein (TiBP), purified from Rhodococcus ruber, has been previously studied in our lab. This protein was shown to be homologous with the orthologous cytoplasmic rhodococcal dihydrolipoamide dehydrogenase (rhDLDH). We have found that rhDLDH and its human homolog (hDLDH) share the TiO 2 -binding capabilities with TiBP. Intrigued by the unique TiO 2 -binding properties of hDLDH, we anticipated that it may serve as a molecular bridge between Ti-based medical structures and human tissues. The objective of the current study was to locate the region and the amino acids of the protein that mediate the protein-TiO 2 surface interaction. We demonstrated the role of acidic amino acids in the nonelectrostatic enzyme/dioxide interactions at neutral pH. The observation that the interaction of DLDH with various metal oxides is independent of their isoelectric values strengthens this notion. DLDH does not lose its enzymatic activity upon binding to TiO 2 , indicating that neither the enzyme undergoes major conformational changes nor the TiO 2 binding site is blocked. Docking predictions suggest that both rhDLDH and hDLDH bind TiO 2 through similar regions located far from the active site and the dimerization sites. The putative TiO 2 -binding regions of both the bacterial and human enzymes were found to contain a CHED (Cys, His, Glu, Asp) motif, which has been shown to participate in metal-binding sites in proteins. Copyright © 2017 John Wiley & Sons, Ltd.
Evidence for a role of eosinophils in blister formation in bullous pemphigoid.
de Graauw, E; Sitaru, C; Horn, M; Borradori, L; Yousefi, S; Simon, H-U; Simon, D
2017-07-01
Bullous pemphigoid (BP) is an autoimmune bullous disease of the skin characterized by subepidermal blister formation due to tissue-bound and circulating autoantibodies to the hemidesmosomal antigens BP180 and BP230. Although eosinophils and their toxic mediators are found abundantly in BP lesions, their role in blister formation has remained unclear. To investigate the role of eosinophils in the pathogenesis of BP with a specific focus on blister formation and to define conditions inducing dermal-epidermal separation (DES). In an ex vivo human model of BP, normal human skin cryosections were incubated with purified human peripheral blood eosinophils with or without activation in the presence or absence of BP autoantibodies, brefeldin A, diphenyleneiodonium, DNase or blocking F(ab') 2 fragments to CD16, CD18, CD32 and CD64. Dermal-epidermal separation was assessed by light microscopy studies and quantified using Fiji software. Following activation with IL-5 and in the presence of BP autoantibodies, eosinophils induced separation along the dermal-epidermal junction of ex vivo skin. Dermal-epidermal separation was significantly reduced by blocking any of the following: Fcγ receptor binding (P = 0.048), eosinophil adhesion (P = 0.046), reactive oxygen species (ROS) production (P = 0.002), degranulation (P < 0.0001) or eosinophil extracellular trap (EET) formation (P = 0.048). Our results provide evidence that IL-5-activated eosinophils directly contribute to BP blister formation in the presence of BP autoantibodies. Dermal-epidermal separation by IL-5-activated eosinophils depends on adhesion and Fcγ receptor activation, requires elevated ROS production and degranulation and involves EET formation. Thus, targeting eosinophils may be a promising therapeutic approach for BP. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Godfrey, Jodi R; Diaz, Maylen Perez; Pincus, Melanie; Kovacs-Balint, Zsofia; Feczko, Eric; Earl, Eric; Miranda-Dominguez, Oscar; Fair, Damien; Sanchez, Mar M; Wilson, Mark E; Michopoulos, Vasiliki
2018-05-01
Exposure to psychosocial stressors increases consumption of palatable, calorically dense diets (CDD) and the risk for obesity, especially in females. While consumption of an obesogenic diet and chronic stress have both been shown to decrease dopamine 2 receptor (D2R) binding and alter functional connectivity (FC) within the prefrontal cortex (PFC) and the nucleus accumbens (NAcc), it remains uncertain how social experience and dietary environment interact to affect reward pathways critical for the regulation of motivated behavior. Using positron emission tomography (PET) and resting state functional connectivity magnetic resonance neuroimaging (rs-fMRI), in female rhesus monkeys maintained in a low calorie chow (n = 18) or a dietary choice condition (chow and a CDD; n = 16) for 12 months, the current study tested the overarching hypothesis that the adverse social experience resulting from subordinate social status would interact with consumption of an obesogenic diet to increase caloric intake that would be predicted by greater cortisol, lower prefrontal D2R binding potential (D2R-BP) and lower PFC-NAcc FC. Results showed that the consequences of adverse social experience imposed by chronic social subordination vary significantly depending on the dietary environment and are associated with alterations in prefrontal D2R-BP and FC in NAcc-PFC sub-regions that predict differences in caloric intake, body weight gain, and fat accumulation. Higher levels of cortisol in the chow-only condition were associated with mild inappetence, as well as increased orbitofrontal (OFC) D2R-BP and greater FC between the NAcc and the dorsolateral PFC (dlPFC) and ventromedial PFC (vmPFC). However, increased cortisol release in females in the dietary choice condition was associated with reduced prefrontal D2R-BP, and opposite FC between the NAcc and the vmPFC and dlPFC observed in the chow-only females. Importantly, the degree of these glucocorticoid-related neuroadaptations predicted significantly more total calorie intake as well as more consumption of the CDD for females having a dietary choice, but had no relation to calorie intake in the chow-only condition. Overall, the current findings suggest that dietary environment modifies the consequences of adverse social experience on reward pathways and appetite regulation and, in an obesogenic dietary environment, may reflect impaired cognitive control of food intake. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco
2018-01-01
Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3’UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits. PMID:29608621
Smith, C T; Dang, L C; Buckholtz, J W; Tetreault, A M; Cowan, R L; Kessler, R M; Zald, D H
2017-04-11
Dopamine function is broadly implicated in multiple neuropsychiatric conditions believed to have a genetic basis. Although a few positron emission tomography (PET) studies have investigated the impact of single-nucleotide polymorphisms (SNPs) in the dopamine D2 receptor gene (DRD2) on D2/3 receptor availability (binding potential, BP ND ), these studies have often been limited by small sample size. Furthermore, the most commonly studied SNP in D2/3 BP ND (Taq1A) is not located in the DRD2 gene itself, suggesting that its linkage with other DRD2 SNPs may explain previous PET findings. Here, in the largest PET genetic study to date (n=84), we tested for effects of the C957T and -141C Ins/Del SNPs (located within DRD2) as well as Taq1A on BP ND of the high-affinity D2 receptor tracer 18 F-Fallypride. In a whole-brain voxelwise analysis, we found a positive linear effect of C957T T allele status on striatal BP ND bilaterally. The multilocus genetic scores containing C957T and one or both of the other SNPs produced qualitatively similar striatal results to C957T alone. The number of C957T T alleles predicted BP ND in anatomically defined putamen and ventral striatum (but not caudate) regions of interest, suggesting some regional specificity of effects in the striatum. By contrast, no significant effects arose in cortical regions. Taken together, our data support the critical role of C957T in striatal D2/3 receptor availability. This work has implications for a number of psychiatric conditions in which dopamine signaling and variation in C957T status have been implicated, including schizophrenia and substance use disorders.
Abiko, Kagari; Ikoma, Katsunori; Shiga, Tohru; Katoh, Chietsugu; Hirata, Kenji; Kuge, Yuji; Kobayashi, Kentaro; Tamaki, Nagara
2017-12-01
Traumatic brain injury (TBI) causes brain dysfunction in many patients. Using C-11 flumazenil (FMZ) positron emission tomography (PET), we have detected and reported the loss of neuronal integrity, leading to brain dysfunction in TBI patients. Similarly to FMZ PET, I-123 iomazenil (IMZ) single photon emission computed tomography (SPECT) is widely used to determine the distribution of the benzodiazepine receptor (BZR) in the brain cortex. The purpose of this study is to examine whether IMZ SPECT is as useful as FMZ PET for evaluating the loss of neuronal integrity in TBI patients. The subjects of this study were seven patients who suffered from neurobehavioral disability. They underwent IMZ SPECT and FMZ PET. Nondisplaceable binding potential (BP ND ) was calculated from FMZ PET images. The uptake of IMZ was evaluated on the basis of lesion-to-pons ratio (LPR). The locations of low uptake levels were visually evaluated both in IMZ SPECT and FMZ PET images. We compared FMZ BP ND and (LPR-1) of IMZ SPECT. In the visual assessment, FMZ BP ND decreased in 11 regions. In IMZ SPECT, low uptake levels were observed in eight of the 11 regions. The rate of concordance between FMZ PET and IMZ SPECT was 72.7%. The mean values IMZ (LPR-1) (1.95 ± 1.01) was significantly lower than that of FMZ BP ND (2.95 ± 0.80 mL/mL). There was good correlation between FMZ BP ND and IMZ (LPR-1) (r = 0.80). IMZ SPECT findings were almost the same as FMZ PET findings in TBI patients. The results indicated that IMZ SPECT is useful for evaluating the loss of neuronal integrity. Because IMZ SPECT can be performed in various facilities, IMZ SPECT may become widely adopted for evaluating the loss of neuronal integrity.
Chen, Qi; Yue, Fei; Li, Wenjiao; Zou, Jing; Xu, Tao; Huang, Cheng; Zhang, Ye; Song, Kun; Huang, Guanqun; Xu, Guibin; Huang, Hai; Li, Jun; Liu, Leyuan
2015-10-23
Autophagy is a cellular process that controls and executes the turnover of dysfunctional organelles and misfolded or abnormally aggregated proteins. Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) activates the initiation of autophagy. Autophagosomes migrate along acetylated microtubules to fuse with lysosomes to execute the degradation of the engulfed substrates that usually bind with sequestosome 1 (SQSTM1, p62). Microtubule-associated protein 1 light chain 3 (LC3) traces the autophagy process by converting from the LC3-I to the LC3-II isoform and serves as a major marker of autophagy flux. Potassium bisperoxo(1,10-phenanthroline)oxovanadate (bpV(phen)) is an insulin mimic and a PTEN inhibitor and has the potential to treat different diseases. Here we show that bpV(phen) enhances the ubiquitination of p62, reduces the stability of p62, disrupts the interaction between p62 and histone deacetylase 6 (HDAC6), activates the deacetylase activity of HDAC6 on α-tubulin, and impairs stable acetylated microtubules. Microtubular destabilization leads to the blockade of autophagosome-lysosome fusion and accumulation of autophagosomes. Autophagy defects lead to oxidative stress and lysosomal rupture, which trigger different types of cell death, including apoptosis and pyroptosis. The consistent results from multiple systems, including mouse and different types of mammalian cells, are different from the predicted function of bpV(phen) as a PTEN inhibitor to activate autophagy flux. In addition, levels of p62 are reduced but not elevated when autophagosomal degradation is blocked, revealing a novel function of p62 in autophagy regulation. Therefore, it is necessary to pay attention to the roles of bpV(phen) in autophagy, apoptosis, and pyroptosis when it is developed as a drug. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Pauciullo, Alfredo; Ogah, Danlami Moses; Iannaccone, Marco; Erhardt, Georg; Di Stasio, Liliana; Cosenza, Gianfranco
2018-01-01
Oxytocin is a neurohypophysial peptide linked to a wide range of biological functions, including milk ejection, temperament and reproduction. Aims of the present study were a) the characterization of the OXT (Oxytocin-neurophysin I) gene and its regulatory regions in Old and New world camelids; b) the investigation of the genetic diversity and the discovery of markers potentially affecting the gene regulation. On average, the gene extends over 814 bp, ranging between 825 bp in dromedary, 811 bp in Bactrian and 810 bp in llama and alpaca. Such difference in size is due to a duplication event of 21 bp in dromedary. The main regulatory elements, including the composite hormone response elements (CHREs), were identified in the promoter, whereas the presence of mature microRNAs binding sequences in the 3'UTR improves the knowledge on the factors putatively involved in the OXT gene regulation, although their specific biological effect needs to be still elucidated. The sequencing of genomic DNA allowed the identification of 17 intraspecific polymorphisms and 69 nucleotide differences among the four species. One of these (MF464535:g.622C>G) is responsible, in alpaca, for the loss of a consensus sequence for the transcription factor SP1. Furthermore, the same SNP falls within a CpG island and it creates a new methylation site, thus opening future possibilities of investigation to verify the influence of the novel allelic variant in the OXT gene regulation. A PCR-RFLP method was setup for the genotyping and the frequency of the allele C was 0.93 in a population of 71 alpacas. The obtained data clarify the structure of OXT gene in domestic camelids and add knowledge to the genetic variability of a genomic region, which has received little investigation so far. These findings open the opportunity for new investigations, including association studies with productive and reproductive traits.
Fazio, Patrik; Svenningsson, Per; Forsberg, Anton; Jönsson, Erik G; Amini, Nahid; Nakao, Ryuji; Nag, Sangram; Halldin, Christer; Farde, Lars; Varrone, Andrea
2015-05-01
(18)F-(E)-N-(3-iodoprop-2-enyl)-2β-carbofluoroethoxy-3β-(4'-methyl-phenyl) nortropane ((18)F-FE-PE2I) is a recently developed radioligand for the in vivo quantification of the dopamine transporter (DAT) in the striatum and substantia nigra (SN). The aim of this study was to examine the suitability of (18)F-FE-PE2I as a tool for imaging the nigrostriatal pathway in Parkinson disease (PD) with PET. Ten PD patients (9 men and 1 woman; mean age ± SD, 60 ± 9 y; Hoehn and Yahr, 1-2; Unified Parkinson Disease Rating Scale motor, 18.9 ± 6.7) and 10 controls (9 men and 1 woman; mean age ± SD, 60 ± 7 y) were included. PET measurements with (18)F-FE-PE2I were conducted for 93 min using the High-Resolution Research Tomograph. Venous blood was drawn to compare protein binding, parent fraction, and radiometabolite composition in PD patients and controls. Regions of interest for the caudate, putamen, ventral striatum, SN, and cerebellum were drawn on coregistered MR images. The outcome measure was the binding potential (BP(ND)) estimated with the simplified reference tissue model and the Logan graphical analysis, using the cerebellum as a reference region. Time stability of BP(ND) was examined to define the shortest acquisition protocol for quantitative studies. The wavelet-aided parametric imaging method was used to obtain high-resolution BP(ND) images to compare DAT availability in the striatum and SN in PD patients and control subjects. Group differences were assessed with the unpaired t test (P < 0.05). Parent, radiometabolite fractions, plasma concentration, and cerebellar uptake of (18)F-FE-PE2I did not differ significantly between PD patients and controls. Stable estimates of BP(ND) (<8% of the 93-min value) were obtained with the simplified reference tissue model using approximately 66 min of data. BP(ND) values in PD patients were significantly lower than those in controls (P < 0.05) in the caudate (2.54 ± 0.79 vs. 3.68 ± 0.56), putamen (1.39 ± 1.04 vs. 4.41 ± 0.54), ventral striatum (2.26 ± 0.93 vs. 3.30 ± 0.46), and SN (0.46 ± 0.20 vs. 0.68 ± 0.15). (18)F-FE-PE2I is clearly a suitable radioligand for DAT quantification and imaging of the nigrostriatal pathway in PD. Similar metabolism in controls and PD patients, suitability of the cerebellum as a reference region, and accuracy of quantification using approximately 66 min of PET data are advantages for noninvasive and simplified imaging protocols for PD studies. Finally, DAT loss in PD can be measured in both the striatum and the SN, supporting the utility of (18)F-FE-PE2I as an imaging tool of the nigrostriatal pathway. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.
Lafuente, M J; Gamo, F J; Gancedo, C
1996-09-01
We have determined the sequence of a 10624 bp DNA segment located in the left arm of chromosome XV of Saccharomyces cerevisiae. The sequence contains eight open reading frames (ORFs) longer than 100 amino acids. Two of them do not present significant homology with sequences found in the databases. The product of ORF o0553 is identical to the protein encoded by the gene SMF1. Internal to it there is another ORF, o0555 that is apparently expressed. The proteins encoded by ORFs o0559 and o0565 are identical to ribosomal proteins S19.e and L18 respectively. ORF o0550 encodes a protein with an RNA binding signature including RNP motifs and stretches rich in asparagine, glutamine and arginine.