Sample records for binding protein family

  1. Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

    EPA Science Inventory

    The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

  2. The neuronal calcium sensor family of Ca2+-binding proteins.

    PubMed Central

    Burgoyne, R D; Weiss, J L


    Ca(2+) plays a central role in the function of neurons as the trigger for neurotransmitter release, and many aspects of neuronal activity, from rapid modulation to changes in gene expression, are controlled by Ca(2+). These actions of Ca(2+) must be mediated by Ca(2+)-binding proteins, including calmodulin, which is involved in Ca(2+) regulation, not only in neurons, but in most other cell types. A large number of other EF-hand-containing Ca(2+)-binding proteins are known. One family of these, the neuronal calcium sensor (NCS) proteins, has a restricted expression in retinal photoreceptors or neurons and neuroendocrine cells, suggesting that they have specialized roles in these cell types. Two members of the family (recoverin and guanylate cyclase-activating protein) have established roles in the regulation of phototransduction. Despite close sequence similarities, the NCS proteins have distinct neuronal distributions, suggesting that they have different functions. Recent work has begun to demonstrate the physiological roles of members of this protein family. These include roles in the modulation of neurotransmitter release, control of cyclic nucleotide metabolism, biosynthesis of polyphosphoinositides, regulation of gene expression and in the direct regulation of ion channels. In the present review we describe the known sequences and structures of the NCS proteins, information on their interactions with target proteins and current knowledge about their cellular and physiological functions. PMID:11115393

  3. The latent transforming growth factor beta binding protein (LTBP) family.

    PubMed Central

    Oklü, R; Hesketh, R


    The transforming growth factor beta (TGFbeta) cytokines are a multi-functional family that exert a wide variety of effects on both normal and transformed mammalian cells. The secretion and activation of TGFbetas is regulated by their association with latency-associated proteins and latent TGFbeta binding proteins (LTBPs). Over the past few years, three members of the LTBP family have been identified, in addition to the protoype LTBP1 first sequenced in 1990. Three of the LTBP family are expressed in a variety of isoforms as a consequence of alternative splicing. This review summarizes the differences between the isoforms in terms of the effects on domain structure and hence possible function. The close identity between LTBPs and members of the fibrillin family, mutations in which have been linked directly to Marfan's syndrome, suggests that anomalous expression of LTBPs may be associated with disease. Recent data indicating that differential expression of LTBP1 isoforms occurs during the development of coronary heart disease is considered, together with evidence that modulation of LTBP function, and hence of TGFbeta activity, is associated with a variety of cancers. PMID:11104663

  4. A fusicoccin binding protein belongs to the family of 14-3-3 brain protein homologs.

    PubMed Central

    Korthout, H A; de Boer, A H


    The fusicoccin binding protein (FCBP) is a highly conserved plasma membrane protein present in all higher plants tested thus far. It exhibits high- and low-affinity binding for the fungal toxin fusicoccin (FC). We purified the active FCBP from a fraction highly enriched in plasma membrane by selective precipitation and anion exchange chromatography. After SDS-PAGE, the two FCBP subunits of 30 and 31 kD were detected as major bands. Amino acid sequence analysis of the 31-kD polypeptide displayed a high degree of identity with so-called 14-3-3 proteins, a class of mammalian brain proteins initially described as regulators of neurotransmitter synthesis and protein kinase C inhibitors. Thereafter, we affinity purified the 30- and 31-kD FCBP subunits, using biotinylated FC in combination with a monomeric avidin column. Immunodecoration of these 30- and 31-kD FCBP subunits with polyclonal antibodies raised against a 14-3-3 homolog from yeast confirmed the identity of the FCBP as a 14-3-3 homolog. Similar to all 14-3-3 protein homologs, the FCBP seems to exist as a dimer in native form. Thus far, the FCBP is the only 14-3-3 homolog with a receptor-like function. The conserved structure of the 14-3-3 protein family is a further indication that the FCBP plays an important role in the physiology of higher plants. PMID:7827499

  5. Stathmin family proteins display specific molecular and tubulin binding properties.


    Charbaut, E; Curmi, P A; Ozon, S; Lachkar, S; Redeker, V; Sobel, A


    Stathmin family phosphoproteins (stathmin, SCG10, SCLIP, and RB3/RB3'/RB3") are involved in signal transduction and regulation of microtubule dynamics. With the exception of stathmin, they are expressed exclusively in the nervous system, where they display different spatio-temporal and functional regulations and hence play at least partially distinct and possibly complementary roles in relation to the control of development, plasticity, and neuronal activities. At the molecular level, each possesses a specific "stathmin-like domain" and, with the exception of stathmin, various combinations of N-terminal extensions involved in their association with intracellular membrane compartments. We show here that each stathmin-like domain also displays specific biochemical and tubulin interaction properties. They are all able to sequester two alpha/beta tubulin heterodimers as revealed by their inhibitory action on tubulin polymerization and by gel filtration. However, they differ in the stabilities of the complexes formed as well as in their interaction kinetics with tubulin followed by surface plasmon resonance as follows: strong stability and slow kinetics for RB3; medium for SCG10, SCLIP, and stathmin; and weak stability and rapid kinetics for RB3'. These results suggest that the fine-tuning of their stathmin-like domains contributes to the specific functional roles of stathmin family proteins in the regulation of microtubule dynamics within the various cell types and subcellular compartments of the developing or mature nervous system. PMID:11278715

  6. A calmodulin-binding/CGCG box DNA-binding protein family involved in multiple signaling pathways in plants

    NASA Technical Reports Server (NTRS)

    Yang, Tianbao; Poovaiah, B. W.


    We reported earlier that the tobacco early ethylene-responsive gene NtER1 encodes a calmodulin-binding protein (Yang, T., and Poovaiah, B. W. (2000) J. Biol. Chem. 275, 38467-38473). Here we demonstrate that there is one NtER1 homolog as well as five related genes in Arabidopsis. These six genes are rapidly and differentially induced by environmental signals such as temperature extremes, UVB, salt, and wounding; hormones such as ethylene and abscisic acid; and signal molecules such as methyl jasmonate, H(2)O(2), and salicylic acid. Hence, they were designated as AtSR1-6 (Arabidopsis thaliana signal-responsive genes). Ca(2+)/calmodulin binds to all AtSRs, and their calmodulin-binding regions are located on a conserved basic amphiphilic alpha-helical motif in the C terminus. AtSR1 targets the nucleus and specifically recognizes a novel 6-bp CGCG box (A/C/G)CGCG(G/T/C). The multiple CGCG cis-elements are found in promoters of genes such as those involved in ethylene signaling, abscisic acid signaling, and light signal perception. The DNA-binding domain in AtSR1 is located on the N-terminal 146 bp where all AtSR1-related proteins share high similarity but have no similarity to other known DNA-binding proteins. The calmodulin-binding nuclear proteins isolated from wounded leaves exhibit specific CGCG box DNA binding activities. These results suggest that the AtSR gene family encodes a family of calmodulin-binding/DNA-binding proteins involved in multiple signal transduction pathways in plants.

  7. Comparison of ligand migration and binding in heme proteins of the globin family

    NASA Astrophysics Data System (ADS)

    Karin, Nienhaus; Ulrich Nienhaus, G.


    The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

  8. Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein family.

    PubMed Central

    Chuang, T H; Xu, X; Kaartinen, V; Heisterkamp, N; Groffen, J; Bokoch, G M


    Philadelphia chromosome-positive leukemias result from the fusion of the BCR and ABL genes, which generates a functional chimeric molecule. The Abr protein is very similar to Bcr but lacks a structural domain which may influence its biological regulatory capabilities. Both Abr and Bcr have a GTPase-activating protein (GAP) domain similar to those found in other proteins that stimulate GTP hydrolysis by members of the Rho family of GTP-binding proteins, as well as a region of homology with the guanine nucleotide dissociation-stimulating domain of the DBL oncogene product. We purified as recombinant fusion proteins the GAP- and Dbl-homology domains of both Abr and Bcr. The Dbl-homology domains of Bcr and Abr were active in stimulating GTP binding to CDC42Hs, RhoA, Rac1, and Rac2 (rank order, CDC42Hs > RhoA > Rac1 = Rac2) but were inactive toward Rap1A and Ha-Ras. Both Bcr and Abr acted as GAPs for Rac1, Rac2, and CDC42Hs but were inactive toward RhoA, Rap1A, and Ha-Ras. Each individual domain bound in a noncompetitive manner to GTP-binding protein substrates. These data suggest the multifunctional Bcr and Abr proteins might interact simultaneously and/or sequentially with members of the Rho family to regulate and coordinate cellular signaling. Images Fig. 3 PMID:7479768

  9. A mysterious family of calcium-binding proteins from parasitic worms.


    Thomas, Charlotte M; Timson, David J


    There is a family of proteins from parasitic worms which combine N-terminal EF-hand domains with C-terminal dynein light chain-like domains. Data are accumulating on the biochemistry and cell biology of these proteins. However, little is known about their functions in vivo Schistosoma mansoni expresses 13 family members (SmTAL1-SmTAL13). Three of these (SmTAL1, SmTAL2 and SmTAL3) have been subjected to biochemical analysis which demonstrated that they have different molecular properties. Although their overall folds are predicted to be similar, small changes in the EF-hand domains result in differences in their ion binding properties. Whereas SmTAL1 and SmTAL2 are able to bind calcium (and some other) ions, SmTAL3 appears to be unable to bind any divalent cations. Similar biochemical diversity has been seen in the CaBP proteins from Fasciola hepatica Four family members are known (FhCaBP1-4). All of these bind to calcium ions. However, FhCaBP4 dimerizes in the presence of calcium ions, FhCaBP3 dimerizes in the absence of calcium ions and FhCaBP2 dimerizes regardless of the prevailing calcium ion concentration. In both the SmTAL and FhCaBP families, the proteins also differ in their ability to bind calmodulin antagonists and related drugs. Interestingly, SmTAL1 interacts with praziquantel (the drug of choice for treating schistosomiasis). The pharmacological significance (if any) of this finding is unknown. PMID:27528745

  10. Identification of an iron-binding protein of the Dps family expressed by Streptococcus thermophilus.


    Nicodème, Muriel; Perrin, Clarisse; Hols, Pascal; Bracquart, Patrice; Gaillard, Jean-Luc


    Streptococcus thermophilus PB18 can grow between 20 degrees and 52 degrees C and is resistant to various stresses such as heat, acidic or cold shock. During cold shock, a protein of 21.5 kDa was previously shown to be induced in S. thermophilus. In addition to its cold-shock induction, 2D-PAGE revealed that the 21.5-kDa protein was also expressed during the stationary phase of growth. The recent access to the genome sequence of S. thermophilus LMG18311 allowed the identification of a 173-amino acid protein displaying a strong homology between the 21.5-kDa protein and members of the Dps family of proteins. Specific staining of non-denaturing polyacrylamide gel electrophoresis (ND-PAGE) followed by two-dimensional PAGE (2D-PAGE) showed that the 21.5-kDa protein was an iron-binding protein. PMID:15018103

  11. Investigating the Host Binding Signature on the Plasmodium falciparum PfEMP1 Protein Family

    PubMed Central

    Janes, Joel H.; Wang, Christopher P.; Levin-Edens, Emily; Vigan-Womas, Inès; Guillotte, Micheline; Melcher, Martin; Mercereau-Puijalon, Odile; Smith, Joseph D.


    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family plays a central role in antigenic variation and cytoadhesion of P. falciparum infected erythrocytes. PfEMP1 proteins/var genes are classified into three main subfamilies (UpsA, UpsB, and UpsC) that are hypothesized to have different roles in binding and disease. To investigate whether these subfamilies have diverged in binding specificity and test if binding could be predicted by adhesion domain classification, we generated a panel of 19 parasite lines that primarily expressed a single dominant var transcript and assayed binding against 12 known host receptors. By limited dilution cloning, only UpsB and UpsC var genes were isolated, indicating that UpsA var gene expression is rare under in vitro culture conditions. Consequently, three UpsA variants were obtained by rosette purification and selection with specific monoclonal antibodies to create a more representative panel. Binding assays showed that CD36 was the most common adhesion partner of the parasite panel, followed by ICAM-1 and TSP-1, and that CD36 and ICAM-1 binding variants were highly predicted by adhesion domain sequence classification. Binding to other host receptors, including CSA, VCAM-1, HABP1, CD31/PECAM, E-selectin, Endoglin, CHO receptor “X”, and Fractalkine, was rare or absent. Our findings identify a category of larger PfEMP1 proteins that are under dual selection for ICAM-1 and CD36 binding. They also support that the UpsA group, in contrast to UpsB and UpsC var genes, has diverged from binding to the major microvasculature receptor CD36 and likely uses other mechanisms to sequester in the microvasculature. These results demonstrate that CD36 and ICAM-1 have left strong signatures of selection on the PfEMP1 family that can be detected by adhesion domain sequence classification and have implications for how this family of proteins is specializing to exploit hosts with varying levels of anti-malaria immunity. PMID

  12. Investigating the host binding signature on the Plasmodium falciparum PfEMP1 protein family.


    Janes, Joel H; Wang, Christopher P; Levin-Edens, Emily; Vigan-Womas, Inès; Guillotte, Micheline; Melcher, Martin; Mercereau-Puijalon, Odile; Smith, Joseph D


    The Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family plays a central role in antigenic variation and cytoadhesion of P. falciparum infected erythrocytes. PfEMP1 proteins/var genes are classified into three main subfamilies (UpsA, UpsB, and UpsC) that are hypothesized to have different roles in binding and disease. To investigate whether these subfamilies have diverged in binding specificity and test if binding could be predicted by adhesion domain classification, we generated a panel of 19 parasite lines that primarily expressed a single dominant var transcript and assayed binding against 12 known host receptors. By limited dilution cloning, only UpsB and UpsC var genes were isolated, indicating that UpsA var gene expression is rare under in vitro culture conditions. Consequently, three UpsA variants were obtained by rosette purification and selection with specific monoclonal antibodies to create a more representative panel. Binding assays showed that CD36 was the most common adhesion partner of the parasite panel, followed by ICAM-1 and TSP-1, and that CD36 and ICAM-1 binding variants were highly predicted by adhesion domain sequence classification. Binding to other host receptors, including CSA, VCAM-1, HABP1, CD31/PECAM, E-selectin, Endoglin, CHO receptor "X", and Fractalkine, was rare or absent. Our findings identify a category of larger PfEMP1 proteins that are under dual selection for ICAM-1 and CD36 binding. They also support that the UpsA group, in contrast to UpsB and UpsC var genes, has diverged from binding to the major microvasculature receptor CD36 and likely uses other mechanisms to sequester in the microvasculature. These results demonstrate that CD36 and ICAM-1 have left strong signatures of selection on the PfEMP1 family that can be detected by adhesion domain sequence classification and have implications for how this family of proteins is specializing to exploit hosts with varying levels of anti-malaria immunity. PMID:21573138

  13. High mobility group nucleosome-binding family proteins promote astrocyte differentiation of neural precursor cells.


    Nagao, Motoshi; Lanjakornsiripan, Darin; Itoh, Yasuhiro; Kishi, Yusuke; Ogata, Toru; Gotoh, Yukiko


    Astrocytes are the most abundant cell type in the mammalian brain and are important for the functions of the central nervous system. Although previous studies have shown that the STAT signaling pathway or its regulators promote the generation of astrocytes from multipotent neural precursor cells (NPCs) in the developing mammalian brain, the molecular mechanisms that regulate the astrocytic fate decision have still remained largely unclear. Here, we show that the high mobility group nucleosome-binding (HMGN) family proteins, HMGN1, 2, and 3, promote astrocyte differentiation of NPCs during brain development. HMGN proteins were expressed in NPCs, Sox9(+) glial progenitors, and GFAP(+) astrocytes in perinatal and adult brains. Forced expression of either HMGN1, 2, or 3 in NPCs in cultures or in the late embryonic neocortex increased the generation of astrocytes at the expense of neurons. Conversely, knockdown of either HMGN1, 2, or 3 in NPCs suppressed astrocyte differentiation and promoted neuronal differentiation. Importantly, overexpression of HMGN proteins did not induce the phosphorylation of STAT3 or activate STAT reporter genes. In addition, HMGN family proteins did not enhance DNA demethylation and acetylation of histone H3 around the STAT-binding site of the gfap promoter. Moreover, knockdown of HMGN family proteins significantly reduced astrocyte differentiation induced by gliogenic signal ciliary neurotrophic factor, which activates the JAK-STAT pathway. Therefore, we propose that HMGN family proteins are novel chromatin regulatory factors that control astrocyte fate decision/differentiation in parallel with or downstream of the JAK-STAT pathway through modulation of the responsiveness to gliogenic signals. PMID:25069414

  14. NMR studies of a new family of DNA binding proteins: the THAP proteins.


    Gervais, Virginie; Campagne, Sébastien; Durand, Jade; Muller, Isabelle; Milon, Alain


    The THAP (THanatos-Associated Protein) domain is an evolutionary conserved C2CH zinc-coordinating domain shared with a large family of cellular factors (THAP proteins). Many members of the THAP family act as transcription factors that control cell proliferation, cell cycle progression, angiogenesis, apoptosis and epigenetic gene silencing. They recognize specific DNA sequences in the promoters of target genes and subsequently recruit effector proteins. Recent structural and functional studies have allowed getting better insight into the nuclear and cellular functions of some THAP members and the molecular mechanisms by which they recognize DNA. The present article reviews recent advances in the knowledge of the THAP domains structures and their interaction with DNA, with a particular focus on NMR. It provides the solution structure of the THAP domain of THAP11, a recently characterized human THAP protein with important functions in transcription and cell growth in colon cancer. PMID:23306615

  15. Identification and in silico analysis of helical lipid binding regions in proteins belonging to the amphitropic protein family.


    Keller, Rob C A


    The role of protein-lipid interactions is increasingly recognized to be of importance in numerous biological processes. Bioinformatics is being increasingly used as a helpful tool in studying protein-lipid interactions. Especially recently developed approaches recognizing lipid binding regions in proteins can be implemented. In this study one of those bioinformatics approaches specialized in identifying lipid binding helical regions in proteins is expanded. The approach is explored further by features which can be easily obtained manually. Some interesting examples of members of the amphitropic protein family have been investigated in order to demonstrate the additional features of this bioinformatics approach. The results in this study seem to indicate interesting characteristics of amphitropic proteins and provide insight into the mechanistic functioning and overall understanding of this intriguing class of proteins. Additionally, the results demonstrate that the presented bioinformatics approach might be either an interesting starting point in protein-lipid interactions studies or a good tool for selecting new focus points for more detailed experimental research of proteins with known overall protein-lipid binding abilities. PMID:25431407

  16. The Golgi-Associated Hook3 Protein Is a Member of a Novel Family of Microtubule-Binding Proteins

    PubMed Central

    Walenta, Jason H.; Didier, Aaron J.; Liu, Xinran; Krämer, Helmut


    Microtubules are central to the spatial organization of diverse membrane-trafficking systems. Here, we report that Hook proteins constitute a novel family of cytosolic coiled coil proteins that bind to organelles and to microtubules. The conserved NH2-terminal domains of Hook proteins mediate attachment to microtubules, whereas the more divergent COOH-terminal domains mediate the binding to organelles. Human Hook3 bound to Golgi membranes in vitro and was enriched in the cis-Golgi in vivo. Unlike other cis-Golgi–associated proteins, however, a large fraction of Hook3 maintained its juxtanuclear localization after Brefeldin A treatment, indicating a Golgi-independent mechanism for Hook3 localization. Because overexpression of Hook3 caused fragmentation of the Golgi complex, we propose that Hook3 participates in defining the architecture and localization of the mammalian Golgi complex. PMID:11238449

  17. RNA binding proteins in spermatogenesis: an in depth focus on the Musashi family

    PubMed Central

    Sutherland, Jessie M; Siddall, Nicole A; Hime, Gary R; McLaughlin, Eileen A


    Controlled gene regulation during gamete development is vital for maintaining reproductive potential. During the complex process of mammalian spermatogenesis, male germ cells experience extended periods of the inactive transcription despite heavy translational requirements for continued growth and differentiation. Hence, spermatogenesis is highly reliant on mechanisms of posttranscriptional regulation of gene expression, facilitated by RNA binding proteins (RBPs), which remain abundantly expressed throughout this process. One such group of proteins is the Musashi family, previously identified as critical regulators of testis germ cell development and meiosis in Drosophila, and also shown to be vital to sperm development and reproductive potential in the mouse. This review describes the role and function of RBPs within the scope of male germ cell development, focusing on our recent knowledge of the Musashi proteins in spermatogenesis. The functional mechanisms utilized by RBPs within the cell are outlined in depth, and the significance of sub-cellular localization and stage-specific expression in relation to the mode and impact of posttranscriptional regulation is also highlighted. We emphasize the historical role of the Musashi family of RBPs in stem cell function and cell fate determination, as originally characterized in Drosophila and Xenopus, and conclude with our current understanding of the differential roles and functions of the mammalian Musashi proteins, Musashi-1 and Musashi-2, with a primary focus on our findings in spermatogenesis. This review highlights both the essential contribution of RBPs to posttranscriptional regulation and the importance of the Musashi family as master regulators of male gamete development. PMID:25851660

  18. RNA binding proteins in spermatogenesis: an in depth focus on the Musashi family.


    Sutherland, Jessie M; Siddall, Nicole A; Hime, Gary R; McLaughlin, Eileen A


    Controlled gene regulation during gamete development is vital for maintaining reproductive potential. During the complex process of mammalian spermatogenesis, male germ cells experience extended periods of the inactive transcription despite heavy translational requirements for continued growth and differentiation. Hence, spermatogenesis is highly reliant on mechanisms of posttranscriptional regulation of gene expression, facilitated by RNA binding proteins (RBPs), which remain abundantly expressed throughout this process. One such group of proteins is the Musashi family, previously identified as critical regulators of testis germ cell development and meiosis in Drosophila, and also shown to be vital to sperm development and reproductive potential in the mouse. This review describes the role and function of RBPs within the scope of male germ cell development, focusing on our recent knowledge of the Musashi proteins in spermatogenesis. The functional mechanisms utilized by RBPs within the cell are outlined in depth, and the significance of sub-cellular localization and stage-specific expression in relation to the mode and impact of posttranscriptional regulation is also highlighted. We emphasize the historical role of the Musashi family of RBPs in stem cell function and cell fate determination, as originally characterized in Drosophila and Xenopus, and conclude with our current understanding of the differential roles and functions of the mammalian Musashi proteins, Musashi-1 and Musashi-2, with a primary focus on our findings in spermatogenesis. This review highlights both the essential contribution of RBPs to posttranscriptional regulation and the importance of the Musashi family as master regulators of male gamete development. PMID:25851660

  19. RGG boxes within the TET/FET family of RNA-binding proteins are functionally distinct.


    Chau, Bess Ling; Ng, King Pan; Li, Kim K C; Lee, Kevin A W


    The multi-functional TET (TAF15/EWS/TLS) or FET (FUS/EWS/TLS) protein family of higher organisms harbor a transcriptional-activation domain (EAD) and an RNA-binding domain (RBD). The transcriptional activation function is, however, only revealed in oncogenic TET-fusion proteins because in native TET proteins it is auto-repressed by RGG-boxes within the TET RBD. Auto-repression is suggested to involve direct cation-pi interactions between multiple Arg residues within RGG boxes and EAD aromatics. Via analysis of TET transcriptional activity in different organisms, we report herein that repression is not autonomous but instead requires additional trans-acting factors. This finding is not supportive of a proposed model whereby repression occurs via a simple intramolecular EAD/RGG-box interaction. We also show that RGG-boxes present within reiterated YGGDRGG repeats that are unique to TAF15, are defective for repression due to the conserved Asp residue. Thus, RGG boxes within TET proteins can be functionally distinguished. While our results show that YGGDRGG repeats are not involved in TAF15 auto-repression, their remarkable number and conservation strongly suggest that they may confer specialized properties to TAF15 and thus contribute to functional differentiation within the TET/FET protein family. PMID:27159574

  20. Identification of an essential Caulobacter crescentus gene encoding a member of the Obg family of GTP-binding proteins.

    PubMed Central

    Maddock, J; Bhatt, A; Koch, M; Skidmore, J


    We have identified an essential Caulobacter crescentus gene (cgtA) that encodes a member of a recently identified subfamily of GTPases (the Obg family) conserved from Bacteria to Archaea to humans. This evolutionary conservation between distantly related species suggests that this family of GTP-binding proteins possesses a fundamental, yet unknown, cellular role. In this report, we describe the isolation and sequence of the cgtA gene. The predicted CgtA protein displays striking similarity to the Obg family of small, monomeric GTP-binding proteins, both in the conserved guanine nucleotide-binding domains and throughout the N-terminal glycine-rich domain that is found in many members of the Obg family. Disruption of the cgtA gene was lethal, demonstrating that this gene is essential for cell growth. Immunoblot analysis revealed that CgtA protein levels remained constant throughout the C. crescentus cell cycle. PMID:9335292

  1. Functional characterization of spectrin-actin-binding domains in 4.1 family of proteins.


    Gimm, J Aura; An, Xiuli; Nunomura, Wataru; Mohandas, Narla


    Protein 4.1R is the prototypical member of a protein family that includes 4.1G, 4.1B, and 4.1N. 4.1R plays a crucial role in maintaining membrane mechanical integrity by binding cooperatively to spectrin and actin through its spectrin-actin-binding (SAB) domain. While the binary interaction between 4.1R and spectrin has been well characterized, the actin binding site in 4.1R remains unidentified. Moreover, little is known about the interaction of 4.1R homologues with spectrin and actin. In the present study, we showed that the 8 aa motif (LKKNFMES) within the 10 kDa spectrin-actin-binding domain of 4.1R plays a critical role in binding of 4.1R to actin. Recombinant 4.1R SAB domain peptides with mutations in this motif showed a marked decrease in their ability to form ternary complexes with spectrin and actin. Binary protein-protein interaction studies revealed that this decrease resulted from the inability of mutant SAB peptides to bind to actin filaments while affinity for spectrin was unchanged. We also documented that the 14 C-terminal residues of the 21 amino acid cassette encoded by exon 16 in conjunction with residues 27-43 encoded by exon 17 constituted a fully functional minimal spectrin-binding motif. Finally, we showed that 4.1N SAB domain was unable to form a ternary complex with spectrin and actin, while 4.1G and 4.1B SAB domains were able to form such a complex but less efficiently than 4.1R SAB. This was due to a decrease in the ability of 4.1G and 4.1B SAB domain to interact with actin but not with spectrin. These data enabled us to propose a model for the 4.1R-spectrin-actin ternary complex which may serve as a general paradigm for regulation of spectrin-based cytoskeleton interaction in various cell types. PMID:12044158

  2. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family.


    Broussard, Tyler C; Miller, Darcie J; Jackson, Pamela; Nourse, Amanda; White, Stephen W; Rock, Charles O


    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  3. Structural insights into nonvesicular lipid transport by the oxysterol binding protein homologue family.


    Tong, Junsen; Manik, Mohammad Kawsar; Yang, Huiseon; Im, Young Jun


    Sterols such as cholesterol in mammals and ergosterol in fungi are essential membrane components and play a key role in membrane function and in cell signaling. The intracellular distribution and processing of sterols and other phospholipids are in part carried out by oxysterol binding protein-related proteins (ORPs) in eukaryotes. Seven ORPs (Osh1-Osh7 proteins) in yeast have distinct functions in maintaining distribution, metabolism and signaling of intracellular lipids but they share at least one essential function. Significant progress has been made in understanding the ligand specificity and mechanism of non-vesicular lipid transport by ORPs. The unique structural features of Osh proteins explain the diversity and specificity of functions in PI(4)P-coupled lipid transport optimized in membrane contact sites. This review discusses the current advances in structural biology regarding this protein family and its potential functions, introducing them as the key players in the novel pathways of phosphoinositide-coupled directional transport of various lipids. This article is part of a Special Issue entitled: The cellular lipid landscape edited by Tim P. Levine and Anant K. Menon. PMID:26784528

  4. Disorder and structure in the Rab11 binding domain of Rab11 family interacting protein 2.


    Wei, Jie; Liu, Yuqi; Bose, Kakoli; Henry, Gillian D; Baleja, James D


    Rab11 plays a central role in plasma membrane recycling which returns cellular receptors for reuse at the cell surface. A recently identified family of Rab11 interacting proteins (FIP) includes FIP2. The C-terminal region of FIP2 is essential for colocalization with Rab11 on early endosomes and for enabling formation of higher-order oligomers. Rab11 binding and oligomerization of FIP2 are separable. Here we have determined the three-dimensional structure of the 40-residue coiled-coil oligomerization domain of FIP2 in the absence of Rab11 using NMR methods. The N-terminal half showed strong NOE cross-peaks and well-dispersed NMR resonances, whereas the C-terminal half had fewer NOE cross-peaks and less chemical shift dispersion. The 10 C-terminal residues were mostly disordered. The final structures of the dimer had favorable Ramachandran angles and a root-mean-square deviation of 0.59 +/- 0.13 A over superimposed backbone residues. The structure allows a comparison to a structure of FIP2 in complex with Rab11 that was determined crystallographically. In complex with Rab11, the C-terminal residues are not disordered but have a helical structure that predicts residual dipolar coupling constants that are incompatible with those measured on the unbound FIP2. In both structures, a histidine residue is found at the normally hydrophobic position of the heptad repeat of the coiled coil, and here we show its ionization destabilizes the coiled-coil structure. Together, these data allow us to build a model in which the binding of FIP family proteins to Rab11 can be described in terms of conformational changes and that suggests new modes of regulation. PMID:19119858

  5. Phylogenetic Distribution and Evolution of the Linked RNA-Binding and NOT1-Binding Domains in the Tristetraprolin Family of Tandem CCCH Zinc Finger Proteins

    PubMed Central

    Perera, Lalith


    In humans, the tristetraprolin or TTP family of CCCH tandem zinc finger (TZF) proteins comprises 3 members, encoded by the genes ZFP36, ZFP36L1, and ZFP36L2. These proteins have direct orthologues in essentially all vertebrates studied, with the exception of birds, which appear to lack a version of ZFP36. Additional family members are found in rodents, amphibians, and fish. In general, the encoded proteins contain 2 critical macromolecular interaction domains: the CCCH TZF domain, which is necessary for high-affinity binding to AU-rich elements in mRNA; and an extreme C-terminal domain that, in the case of TTP, interacts with NOT1, the scaffold of a large multi-protein complex that contains deadenylases. TTP and its related proteins act by first binding to AU-rich elements in mRNA, and then recruiting deadenylases to the mRNA, where they can processively remove the adenosine residues from the poly(A) tail. Highly conserved TZF domains have been found in unicellular eukaryotes such as yeasts, and these domains can bind AU-rich elements that resemble those bound by the mammalian proteins. However, certain fungi appear to lack proteins with intact TZF domains, and the TTP family proteins that are expressed in other fungi often lack the characteristic C-terminal NOT1 binding domain found in the mammalian proteins. For these reasons, we investigated the phylogenetic distribution of the relevant sequences in available databases. Both domains are present in family member proteins from most lineages of eukaryotes, suggesting their mutual presence in a common ancestor. However, the vertebrate type of NOT1-binding domain is missing in most fungi, and the TZF domain itself has disappeared or degenerated in recently evolved fungi. Nonetheless, both domains are present together in the proteins from several unicellular eukaryotes, including at least 1 fungus, and they seem to have remained together during the evolution of metazoans. PMID:24697206

  6. Protein Binding Pocket Dynamics.


    Stank, Antonia; Kokh, Daria B; Fuller, Jonathan C; Wade, Rebecca C


    The dynamics of protein binding pockets are crucial for their interaction specificity. Structural flexibility allows proteins to adapt to their individual molecular binding partners and facilitates the binding process. This implies the necessity to consider protein internal motion in determining and predicting binding properties and in designing new binders. Although accounting for protein dynamics presents a challenge for computational approaches, it expands the structural and physicochemical space for compound design and thus offers the prospect of improved binding specificity and selectivity. A cavity on the surface or in the interior of a protein that possesses suitable properties for binding a ligand is usually referred to as a binding pocket. The set of amino acid residues around a binding pocket determines its physicochemical characteristics and, together with its shape and location in a protein, defines its functionality. Residues outside the binding site can also have a long-range effect on the properties of the binding pocket. Cavities with similar functionalities are often conserved across protein families. For example, enzyme active sites are usually concave surfaces that present amino acid residues in a suitable configuration for binding low molecular weight compounds. Macromolecular binding pockets, on the other hand, are located on the protein surface and are often shallower. The mobility of proteins allows the opening, closing, and adaptation of binding pockets to regulate binding processes and specific protein functionalities. For example, channels and tunnels can exist permanently or transiently to transport compounds to and from a binding site. The influence of protein flexibility on binding pockets can vary from small changes to an already existent pocket to the formation of a completely new pocket. Here, we review recent developments in computational methods to detect and define binding pockets and to study pocket dynamics. We introduce five

  7. Orphan Nuclear Receptor NR4A1 Binds a Novel Protein Interaction Site on Anti-apoptotic B Cell Lymphoma Gene 2 Family Proteins.


    Godoi, Paulo H C; Wilkie-Grantham, Rachel P; Hishiki, Asami; Sano, Renata; Matsuzawa, Yasuko; Yanagi, Hiroko; Munte, Claudia E; Chen, Ya; Yao, Yong; Marassi, Francesca M; Kalbitzer, Hans R; Matsuzawa, Shu-Ichi; Reed, John C


    B cell lymphoma gene 2 (Bcl-2) family proteins are key regulators of programmed cell death and important targets for drug discovery. Pro-apoptotic and anti-apoptotic Bcl-2 family proteins reciprocally modulate their activities in large part through protein interactions involving a motif known as BH3 (Bcl-2 homology 3). Nur77 is an orphan member of the nuclear receptor family that lacks a BH3 domain but nevertheless binds certain anti-apoptotic Bcl-2 family proteins (Bcl-2, Bfl-1, and Bcl-B), modulating their effects on apoptosis and autophagy. We used a combination of NMR spectroscopy-based methods, mutagenesis, and functional studies to define the interaction site of a Nur77 peptide on anti-apoptotic Bcl-2 family proteins and reveal a novel interaction surface. Nur77 binds adjacent to the BH3 peptide-binding crevice, suggesting the possibility of cross-talk between these discrete binding sites. Mutagenesis of residues lining the identified interaction site on Bcl-B negated the interaction with Nur77 protein in cells and prevented Nur77-mediated modulation of apoptosis and autophagy. The findings establish a new protein interaction site with the potential to modulate the apoptosis and autophagy mechanisms governed by Bcl-2 family proteins. PMID:27129202

  8. UPF201 Archaeal Specific Family Members Reveal Structural Similarity to RNA-Binding Proteins but Low Likelyhood for RNA-Binding Function

    SciTech Connect

    Rao, K.; Burley, S; Swaminathan, S


    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  9. UPF201 Archaeal Specific Family Members Reveals Structural Similarity to RNA-Binding Proteins but Low Likelihood for RNA-Binding Function

    SciTech Connect

    Rao, K.N.; Swaminathan, S.; Burley, S. K.


    We have determined X-ray crystal structures of four members of an archaeal specific family of proteins of unknown function (UPF0201; Pfam classification: DUF54) to advance our understanding of the genetic repertoire of archaea. Despite low pairwise amino acid sequence identities (10-40%) and the absence of conserved sequence motifs, the three-dimensional structures of these proteins are remarkably similar to one another. Their common polypeptide chain fold, encompassing a five-stranded antiparallel {beta}-sheet and five {alpha}-helices, proved to be quite unexpectedly similar to that of the RRM-type RNA-binding domain of the ribosomal L5 protein, which is responsible for binding the 5S- rRNA. Structure-based sequence alignments enabled construction of a phylogenetic tree relating UPF0201 family members to L5 ribosomal proteins and other structurally similar RNA binding proteins, thereby expanding our understanding of the evolutionary purview of the RRM superfamily. Analyses of the surfaces of these newly determined UPF0201 structures suggest that they probably do not function as RNA binding proteins, and that this domain specific family of proteins has acquired a novel function in archaebacteria, which awaits experimental elucidation.

  10. Differential Binding Activity of TGF-β Family Proteins to Select TGF-β Receptors.


    Khalil, Ashraf M; Dotimas, Hyna; Kahn, Julius; Lamerdin, Jane E; Hayes, David B; Gupta, Priyanka; Franti, Michael


    Growth differentiation factor-11 (GDF11) and myostatin (MSTN) are highly related transforming growth factor-β (TGF-β) ligands with 89% amino acid sequence homology. They have different biologic activities and diverse tissue distribution patterns. However, the activities of these ligands are indistinguishable in in vitro assays. SMAD2/3 signaling has been identified as the canonical pathway for GDF11 and MSTN, However, it remains unclear which receptor heterodimer and which antagonists preferentially mediate and regulate signaling. In this study, we investigated the initiation and regulation of GDF11 and MSTN signaling at the receptor level using a novel receptor dimerization detection technology. We used the dimerization platform to link early receptor binding events to intracellular downstream signaling. This approach was instrumental in revealing differential receptor binding activity within the TGF-β family. We verified the ActR2b/ALK5 heterodimer as the predominant receptor for GDF11- and MSTN-induced SMAD2/3 signaling. We also showed ALK7 specifically mediates activin-B signaling. We verified follistatin as a potent antagonist to neutralize both SMAD2/3 signaling and receptor dimerization. More remarkably, we showed that the two related antagonists, growth and differentiation factor-associated serum protein (GASP)-1 and GASP2, differentially regulate GDF11 (and MSTN) signaling. GASP1 blocks both receptor dimerization and downstream signaling. However, GASP2 blocks only downstream signaling without interference from receptor dimerization. Our data strongly suggest that physical binding of GDF11 (and MSTN) to both ActR2b and ALK5 receptors is required for initiation of signaling. PMID:27340210

  11. The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.


    Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M


    The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs

  12. The FTMap family of web servers for determining and characterizing ligand binding hot spots of proteins

    PubMed Central

    Kozakov, Dima; Grove, Laurie E.; Hall, David R.; Bohnuud, Tanggis; Mottarella, Scott; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor


    FTMap is a computational mapping server that identifies binding hot spots of macromolecules, i.e., regions of the surface with major contributions to the ligand binding free energy. To use FTMap, users submit a protein, DNA, or RNA structure in PDB format. FTMap samples billions of positions of small organic molecules used as probes and scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots, in good agreement with experimental data. FTMap serves as basis for other servers, namely FTSite to predict ligand binding sites, FTFlex to account for side chain flexibility, FTMap/param to parameterize additional probes, and FTDyn to map ensembles of protein structures. Applications include determining druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures, and providing input for fragment based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and is much faster than the more recent approaches to protein mapping based on mixed molecular dynamics. Using 16 probe molecules, the FTMap server finds the hot spots of an average size protein in less than an hour. Since FTFlex performs mapping for all low energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957

  13. The Musashi family of RNA binding proteins: master regulators of multiple stem cell populations.


    Sutherland, Jessie M; McLaughlin, Eileen A; Hime, Gary R; Siddall, Nicole A


    In order to maintain their unlimited capacity to divide, stem cells require controlled temporal and spatial protein expression. The Musashi family of RNA-binding proteins have been shown to exhibit this necessary translational control through both repression and activation in order to regulate multiple stem cell populations. This chapter looks in depth at the initial discovery and characterisation of Musashi in the model organism Drosophila, and its subsequent emergence as a master regulator in a number of stem cell populations. Furthermore the unique roles for mammalian Musashi-1 and Musashi-2 in different stem cell types are correlated with the perceived diagnostic power of Musashi expression in specific stem cell derived oncologies. In particular the potential role for Musashi in the identification and treatment of human cancer is considered, with a focus on the role of Musashi-2 in leukaemia. Finally, the manipulation of Musashi expression is proposed as a potential avenue towards the targeted treatment of specific aggressive stem cell cancers. PMID:23696360

  14. DNA-binding and regulation mechanisms of the SIX family of retinal determination proteins.


    Hu, Shengyong; Mamedova, Aygun; Hegde, Rashmi S


    The Six/sine oculis proteins are homeodomain transcription factors that are part of the Pax/Eya/Six/Dach retinal determination cascade involved in embryonic cell fate determination. There are six mammalian Six homologues, divided into three classes on the basis of sequence homology. In the present study we examined the DNA-binding specificity and mechanisms of Six2 and Six6 toward the Trex/MEF3 consensus sequence and the core tetranucleotide ATTA commonly recognized by homeodomain proteins. The results suggest that the Six homeodomain does not bind DNA owing to the absence of a key structural feature, the basic N-terminal arm, implicated in canonical homeodomain-DNA binding. Furthermore, the DNA-binding mechanisms and DNA sequence specificity differ among these Six proteins despite the complete conservation of predicted DNA-contacting residues in their homeodomains. Inclusion of 14 amino acid residues immediately C-terminal to the homeodomain of Six6 yields a protein construct able to bind both DNA sequences tested with nanomolar affinity. However, an analogous Six2 construct remains unable to bind DNA. Furthermore, we show that the DNA-binding affinity of Six2 is increased nearly 12-fold by complex formation with the Eyes Absent tyrosine phosphatase, while Six6-DNA binding is not similarly enhanced. This phenomenon could contribute to the synergy observed between Six2 and Eyes Absent in transcriptional activation and in eye development. PMID:18293925

  15. Eubacterial SpoVG Homologs Constitute a New Family of Site-Specific DNA-Binding Proteins

    PubMed Central

    Jutras, Brandon L.; Chenail, Alicia M.; Rowland, Christi L.; Carroll, Dustin; Miller, M. Clarke; Bykowski, Tomasz; Stevenson, Brian


    A site-specific DNA-binding protein was purified from Borrelia burgdorferi cytoplasmic extracts, and determined to be a member of the highly conserved SpoVG family. This is the first time a function has been attributed to any of these ubiquitous bacterial proteins. Further investigations into SpoVG orthologues indicated that the Staphylococcus aureus protein also binds DNA, but interacts preferentially with a distinct nucleic acid sequence. Site-directed mutagenesis and domain swapping between the S. aureus and B. burgdorferi proteins identified that a 6-residue stretch of the SpoVG α-helix contributes to DNA sequence specificity. Two additional, highly conserved amino acid residues on an adjacent β-sheet are essential for DNA-binding, apparently by contacts with the DNA phosphate backbone. Results of these studies thus identified a novel family of bacterial DNA-binding proteins, developed a model of SpoVG-DNA interactions, and provide direction for future functional studies on these wide-spread proteins. PMID:23818957

  16. The Puf family of RNA-binding proteins in plants: phylogeny, structural modeling, activity and subcellular localization

    PubMed Central


    Background Puf proteins have important roles in controlling gene expression at the post-transcriptional level by promoting RNA decay and repressing translation. The Pumilio homology domain (PUM-HD) is a conserved region within Puf proteins that binds to RNA with sequence specificity. Although Puf proteins have been well characterized in animal and fungal systems, little is known about the structural and functional characteristics of Puf-like proteins in plants. Results The Arabidopsis and rice genomes code for 26 and 19 Puf-like proteins, respectively, each possessing eight or fewer Puf repeats in their PUM-HD. Key amino acids in the PUM-HD of several of these proteins are conserved with those of animal and fungal homologs, whereas other plant Puf proteins demonstrate extensive variability in these amino acids. Three-dimensional modeling revealed that the predicted structure of this domain in plant Puf proteins provides a suitable surface for binding RNA. Electrophoretic gel mobility shift experiments showed that the Arabidopsis AtPum2 PUM-HD binds with high affinity to BoxB of the Drosophila Nanos Response Element I (NRE1) RNA, whereas a point mutation in the core of the NRE1 resulted in a significant reduction in binding affinity. Transient expression of several of the Arabidopsis Puf proteins as fluorescent protein fusions revealed a dynamic, punctate cytoplasmic pattern of localization for most of these proteins. The presence of predicted nuclear export signals and accumulation of AtPuf proteins in the nucleus after treatment of cells with leptomycin B demonstrated that shuttling of these proteins between the cytosol and nucleus is common among these proteins. In addition to the cytoplasmically enriched AtPum proteins, two AtPum proteins showed nuclear targeting with enrichment in the nucleolus. Conclusions The Puf family of RNA-binding proteins in plants consists of a greater number of members than any other model species studied to date. This, along with the

  17. Reticulomics: Protein-Protein Interaction Studies with Two Plasmodesmata-Localized Reticulon Family Proteins Identify Binding Partners Enriched at Plasmodesmata, Endoplasmic Reticulum, and the Plasma Membrane.


    Kriechbaumer, Verena; Botchway, Stanley W; Slade, Susan E; Knox, Kirsten; Frigerio, Lorenzo; Oparka, Karl; Hawes, Chris


    The endoplasmic reticulum (ER) is a ubiquitous organelle that plays roles in secretory protein production, folding, quality control, and lipid biosynthesis. The cortical ER in plants is pleomorphic and structured as a tubular network capable of morphing into flat cisternae, mainly at three-way junctions, and back to tubules. Plant reticulon family proteins (RTNLB) tubulate the ER by dimerization and oligomerization, creating localized ER membrane tensions that result in membrane curvature. Some RTNLB ER-shaping proteins are present in the plasmodesmata (PD) proteome and may contribute to the formation of the desmotubule, the axial ER-derived structure that traverses primary PD. Here, we investigate the binding partners of two PD-resident reticulon proteins, RTNLB3 and RTNLB6, that are located in primary PD at cytokinesis in tobacco (Nicotiana tabacum). Coimmunoprecipitation of green fluorescent protein-tagged RTNLB3 and RTNLB6 followed by mass spectrometry detected a high percentage of known PD-localized proteins as well as plasma membrane proteins with putative membrane-anchoring roles. Förster resonance energy transfer by fluorescence lifetime imaging microscopy assays revealed a highly significant interaction of the detected PD proteins with the bait RTNLB proteins. Our data suggest that RTNLB proteins, in addition to a role in ER modeling, may play important roles in linking the cortical ER to the plasma membrane. PMID:26353761

  18. Structure of armadillo ACBP: a new member of the acyl-CoA-binding protein family

    SciTech Connect

    Costabel, Marcelo D.; Ermácora, Mario R.; Santomé, José A.; Alzari, Pedro M.; Guérin, Diego M. A.


    The X-ray structure of the tetragonal form of apo acyl-CoA-binding protein (ACBP) from the Harderian gland of the South American armadillo Chaetophractus villosus has been solved. The X-ray structure of the tetragonal form of apo acyl-CoA-binding protein (ACBP) from the Harderian gland of the South American armadillo Chaetophractus villosus has been solved. ACBP is a carrier for activated long-chain fatty acids and has been associated with many aspects of lipid metabolism. Its secondary structure is highly similar to that of the corresponding form of bovine ACBP and exhibits the unique flattened α-helical bundle (up–down–down–up) motif reported for animal, yeast and insect ACBPs. Conformational differences are located in loops and turns, although these structural differences do not suffice to account for features that could be related to the unusual biochemistry and lipid metabolism of the Harderian gland.

  19. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  20. Evasins: Therapeutic Potential of a New Family of Chemokine-Binding Proteins from Ticks

    PubMed Central

    Bonvin, Pauline; Power, Christine A.; Proudfoot, Amanda E. I.


    Blood-sucking parasites, such as ticks, remain attached to their hosts for relatively long periods of time in order to obtain their blood meal without eliciting an immune response. One mechanism used to avoid rejection is the inhibition of the recruitment of immune cells, which can be achieved by a class of chemokine-binding proteins (CKBPs) known as Evasins. We have identified three distinct Evasins produced by the salivary glands of the common brown dog tick, Rhipicephalus sanguineus. They display different selectivities for chemokines, the first two identified show a narrow selectivity profile, while the third has a broader binding spectrum. The Evasins showed efficacy in animal models of inflammatory disease. Here, we will discuss the potential of their development for therapeutic use, addressing both the advantages and disadvantages that this entails. PMID:27375615

  1. Mutation Analysis of Inhibitory Guanine Nucleotide Binding Protein Alpha (GNAI) Loci in Young and Familial Pituitary Adenomas

    PubMed Central

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli


    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15–20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas. PMID:25291362

  2. Structural and evolutionary aspects of two families of non-catalytic domains present in starch and glycogen binding proteins from microbes, plants and animals.


    Janeček, Štefan; Svensson, Birte; MacGregor, E Ann


    Starch-binding domains (SBDs) comprise distinct protein modules that bind starch, glycogen or related carbohydrates and have been classified into different families of carbohydrate-binding modules (CBMs). The present review focuses on SBDs of CBM20 and CBM48 found in amylolytic enzymes from several glycoside hydrolase (GH) families GH13, GH14, GH15, GH31, GH57 and GH77, as well as in a number of regulatory enzymes, e.g., phosphoglucan, water dikinase-3, genethonin-1, laforin, starch-excess protein-4, the β-subunit of AMP-activated protein kinase and its homologues from sucrose non-fermenting-1 protein kinase SNF1 complex, and an adaptor-regulator related to the SNF1/AMPK family, AKINβγ. CBM20s and CBM48s of amylolytic enzymes occur predominantly in the microbial world, whereas the non-amylolytic proteins containing these modules are mostly of plant and animal origin. Comparison of amino acid sequences and tertiary structures of CBM20 and CBM48 reveals the close relatedness of these SBDs and, in some cases, glycogen-binding domains (GBDs). The families CBM20 and CBM48 share both an ancestral form and the mode of starch/glycogen binding at one or two binding sites. Phylogenetic analyses demonstrate that they exhibit independent behaviour, i.e. each family forms its own part in an evolutionary tree, with enzyme specificity (protein function) being well represented within each family. The distinction between CBM20 and CBM48 families is not sharp since there are representatives in both CBM families that possess an intermediate character. These are, for example, CBM20s from hypothetical GH57 amylopullulanase (probably lacking the starch-binding site 2) and CBM48s from the GH13 pullulanase subfamily (probably lacking the starch/glycogen-binding site 1). The knowledge gained concerning the occurrence of these SBDs and GBDs through the range of taxonomy will support future experimental research. PMID:22112614

  3. The predominant calcimedins from Trypanosoma brucei comprise a family of flagellar EF-hand calcium-binding proteins.

    PubMed Central

    Wu, Y; Haghighat, N G; Ruben, L


    The cellular complement of calcimedins was identified in Trypanosoma brucei by Ca(2+)-dependent association with phenyl-Sepharose. Predominant calcimedins with molecular mass of 23-26 kDa and 44 kDa, along with minor calcimedins of 96, 120 and 230 kDa, were obtained. The trypanosome calcimedins were unrelated to vertebrate annexins, based upon antibody cross-reactivity and an inability to associate in a Ca(2+)-dependent way with phospholipid vesicles comprised of phosphatidylserine or phosphatidylethanolamine/phosphatidylcholine (1:1, w/w). Partial sequence analysis demonstrated that 44 kDa calcimedin (Tb-44) contained an EF-hand calcium-binding loop. Five CNBr/tryptic fragments exhibited a total of 93% similarity with Tb-17, a 23 kDa EF-hand protein in T. brucei. The trypanosome calcimedins appeared to comprise a family of proteins, based on sequence similarities and antibody cross-reactivity of affinity-purified anti-Tb44 with the 23-26 kDa cluster. No evidence was found for Tb-44 in the related species T. cruzi, Leishmania taraentolae or Crithidia fasciculata. Antibodies against Tb-44 were localized by immunofluorescence along the flagellum of T. brucei. Immunoblot analysis of flagella-enriched preparations demonstrated that Tb-44 and the 23-26 kDa cluster were present in this structure. We conclude that annexin family members are not among the predominant trypanosome proteins that associate with phenyl-Sepharose in a Ca(2+)-dependent way. Instead, the major trypanosome calcimedins comprise a family of flagellar EF-hand calcium-binding proteins. Images Fig. 1. Fig. 2. Fig. 3. Fig. 5. Fig. 6. PMID:1417772

  4. Whole genome identification and analysis of FK506-binding protein family genes in grapevine (Vitis vinifera L.).


    Shangguan, Lingfei; Kayesh, Emrul; Leng, Xiangpeng; Sun, Xin; Korir, Nicholas Kibet; Mu, Qian; Fang, Jinggui


    In plant and animal species FK506-binding protein (FKBP) family genes are important conserved genes and it is defined as the receptors of FK506 and rapamycin, where they work as PPIase and protein folding chaperones. FKBP have been isolated from Arabidopsis thaliana, Oryza sativa, and Zea mays. In grape, twenty-three genes containing the FK506-binding domain (FKBP_C) were first time identified by HMMER and blast research, they were classified into three groups and 17 out of the 23 genes were located on 11 chromosomes (Chr1, 3, 5, 7, 8, 14, 15, 16, 17, 18, and 19). The predicted gene expression pattern and semi-quantitative RT-PCR results revealed that five VvFKBPs were expressed in all tissues, while seven VvFKBPs were expressed only in some of the tissues, and the remaining VvFKBPs were not expressed in leaf, stem, inflorescences, flowers, and a mixture of fruit tissues (small, medium and big-sized fruits). Most of the VvFKBPs in grapevine 'Summer Black' were similar to those predicted one in 'Pinot Noir' except for VvFKBP16-4 and VvFKBPa. VvFKBP12, FaFKBP12 and PpFKBP12 were cloned from 'Summer Black', 'Sweet Charlie' and 'Xiahui 6'. Protein structure analysis confirmed that homologous genes have some differences during the process of protein structure construction. In this study, we characterized and verified 23 FKBP family genes in grapevine (Vitis vinifera L.) as well as their sub-cellular and chromosome location. The successful cloning of CDS regions and protein structural analysis of VvFKBP12, FaFKBP12, and PpFKBP12 can provide useful information for further study. PMID:23269629

  5. Members of the meis1 and pbx homeodomain protein families cooperatively bind a cAMP-responsive sequence (CRS1) from bovine CYP17.


    Bischof, L J; Kagawa, N; Moskow, J J; Takahashi, Y; Iwamatsu, A; Buchberg, A M; Waterman, M R


    The mammalian Pbx homeodomain proteins provide specificity and increased DNA binding affinity to other homeodomain proteins. A cAMP-responsive sequence (CRS1) from bovine CYP17 has previously been shown to be a binding site for Pbx1. A member of a second mammalian homeodomain family, Meis1, is now also demonstrated to be a CRS1-binding protein upon purification using CRS1 affinity chromatography. CRS1 binding complexes from Y1 adrenal cell nuclear extract contain both Pbx1 and Meis1. This is the first transcriptional regulatory element reported as a binding site for members of the Meis1 homeodomain family. Pbx1 and Meis1 bind cooperatively to CRS1, whereas neither protein can bind this element alone. Mutagenesis of the CRS1 element indicates a binding site for Meis1 adjacent to the Pbx site. All previously identified Pbx binding partners have Pbx interacting motifs that contain a tryptophan residue amino-terminal to the homeodomain that is required for cooperative binding to DNA with Pbx. Members of the Meis1 family contain one tryptophan residue amino-terminal to the homeodomain, but site-directed mutagenesis indicates that this residue is not required for cooperative CRS1 binding with Pbx. Thus, the Pbx-Meis1 interaction is unique among Pbx complexes. Meis1 also cooperatively binds CRS1 with the Pbx homologs extradenticle from Drosophila melanogaster and ceh-20 from Caenorhabditis elegans, indicating that this interaction is evolutionarily conserved. Thus, CYP17 CRS1 is a transcriptional regulatory element containing both Pbx and Meis1 binding sites, which permit these two homeodomain proteins to bind and potentially regulate cAMP-dependent transcription through this sequence. PMID:9525891

  6. The Drosophila Retinoblastoma Binding Protein 6 Family Member Has Two Isoforms and Is Potentially Involved in Embryonic Patterning

    PubMed Central

    Hull, Rodney; Oosthuysen, Brent; Cajee, Umar-Faruq; Mokgohloa, Lehlogonolo; Nweke, Ekene; Antunes, Ricardo Jorge; Coetzer, Theresa H. T.; Ntwasa, Monde


    The human retinoblastoma binding protein 6 (RBBP6) is implicated in esophageal, lung, hepatocellular and colon cancers. Furthermore, RBBP6 was identified as a strong marker for colon cancer prognosis and as a predisposing factor in familial myeloproliferative neoplasms. Functionally, the mammalian protein interacts with p53 and enhances the activity of Mdm2, the prototypical negative regulator of p53. However, since RBBP6 (known as PACT in mice) exists in multiple isoforms and pact−/− mice exhibit a more severe phenotype than mdm2−/− mutants, it must possess some Mdm2-independent functions. The function of the invertebrate homologue is poorly understood. This is complicated by the absence of the Mdm2 gene in both Drosophila and Caenorhabditis elegans. We have experimentally identified the promoter region of Snama, the Drosophila homologue, analyzed potential transcription factor binding sites and confirmed the existence of an additional isoform. Using band shift and co-immunoprecipitation assays combined with mass spectrometry, we found evidence that this gene may be regulated by, amongst others, DREF, which regulates hundreds of genes related to cell proliferation. The potential transcription factors for Snama fall into distinct functional groups, including anteroposterior embryonic patterning and nucleic acid metabolism. Significantly, previous work in mice shows that pact−/− induces an anteroposterior phenotype in embryos when rescued by simultaneous deletion of p53. Taken together, these observations indicate the significance of RBBP6 proteins in carcinogenesis and in developmental defects. PMID:25955646

  7. The AVIT protein family

    PubMed Central

    Kaser, Alexandra; Winklmayr, Martina; Lepperdinger, Günther; Kreil, Günther


    Homologues of a protein originally isolated from snake venom and frog skin secretions are present in many vertebrate species. They contain 80–90 amino acids, 10 of which are cysteines with identical spacing. Various names have been given to these proteins, such as mamba intestinal protein 1 (MIT1), Bv8 (Bombina variegata molecular mass ∼8 kDa), prokineticins and endocrine-gland vascular endothelial growth factor (EG-VEGF). Their amino-terminal sequences are identical, and so we propose that the sequence of their first four residues, AVIT, is used as a name for this family. From a comparison of the sequences, two types of AVIT proteins can be discerned. These proteins seem to be distributed widely in mammalian tissues and are known to bind to G-protein-coupled receptors. Members of this family have been shown to stimulate contraction of the guinea pig ileum, to cause hyperalgesia after injection into rats and to be active as specific growth factors. Moreover, the messenger RNA level of one of these AVIT proteins changes rhythmically in the region of the brain known as the suprachiasmatic nucleus. This shows that members of this new family of small proteins are involved in diverse biological processes. PMID:12728244

  8. Comparative binding of biotinylated neurotrophins to alpha(2)-macroglobulin family of proteins: relationship between cytokine-binding and neuro-modulatory activities of the macroglobulins.


    Skornicka, Erin L; Shi, Xiaoqing; Koo, Peter H


    Human alpha(2)-macroglobulin (alpha(2)M), pregnancy zone protein (PZP), rat alpha(1)M and acute-phase rat alpha(2)M belong to the alpha(2)M gene family of proteins, which can react covalently with nucleophilic monoamines to yield monoamine-activated (MA) macroglobulins. The MA forms of human alpha(2)M, PZP and rat alpha(2)M have been demonstrated previously to inhibit various neurotrophin-promoted neuronal activities, whereas MA-alpha(1)M is neurostimulatory and all native macroglobulins are generally inactive. The mechanism of neuromodulation is unknown, but it has been postulated that MA macroglobulins might inhibit neurons via their binding and sequestration of neurotrophins. This study employed a novel biotinylation-Western blot technique to compare the neurotrophin-binding properties of the four macroglobulins, and to correlate their binding activities with their known neuro-modulatory activities. In comparison with their respective native counterparts, human and rat MA-alpha(2)M bound slightly more NGF, but significantly less BDNF or NT-3. Native human alpha(2)M and PZP in general have no neuro-modulatory activity, but native PZP bound significantly more NGF, BDNF or NT-3 than either native alpha(2)M or MA-alpha(2)M, which is neuro-inhibitory. It is known that MA-PZP is neuro-inhibitory, but it fails to bind more NGF, BDNF, or NT-3 than native PZP. MA-alpha(1)M is the only macroglobulin known to stimulate NGF-promoted neurite outgrowth, but it bound NGF with similar affinities as native alpha(1)M and rat alpha(2)M; in addition, it bound significantly less BDNF or NT-3 than native alpha(1)M. All the bindings were non-covalent and appeared specific. In conclusion, PZP and rat macroglobulins are versatile carriers of neurotrophins with diverse binding capacities, and the neurotrophin-binding property does not appear to mediate the neuro-modulatory activity of these human and rat macroglobulins. PMID:11813239

  9. Cloning and mutational analysis of the gamma gene from Azotobacter vinelandii defines a new family of proteins capable of metallocluster binding and protein stabilization.


    Rubio, Luis M; Rangaraj, Priya; Homer, Mary J; Roberts, Gary P; Ludden, Paul W


    Dinitrogenase is a heterotetrameric (alpha(2)beta(2)) enzyme that catalyzes the reduction of dinitrogen to ammonium and contains the iron-molybdenum cofactor (FeMo-co) at its active site. Certain Azotobacter vinelandii mutant strains unable to synthesize FeMo-co accumulate an apo form of dinitrogenase (lacking FeMo-co), with a subunit composition alpha(2)beta(2)gamma(2), which can be activated in vitro by the addition of FeMo-co. The gamma protein is able to bind FeMo-co or apodinitrogenase independently, leading to the suggestion that it facilitates FeMo-co insertion into the apoenzyme. In this work, the non-nif gene encoding the gamma subunit (nafY) has been cloned, sequenced, and found to encode a NifY-like protein. This finding, together with a wealth of knowledge on the biochemistry of proteins involved in FeMo-co and FeV-co biosyntheses, allows us to define a new family of iron and molybdenum (or vanadium) cluster-binding proteins that includes NifY, NifX, VnfX, and now gamma. In vitro FeMo-co insertion experiments presented in this work demonstrate that gamma stabilizes apodinitrogenase in the conformation required to be fully activable by the cofactor. Supporting this conclusion, we show that strains containing mutations in both nafY and nifX are severely affected in diazotrophic growth and extractable dinitrogenase activity when cultured under conditions that are likely to occur in natural environments. This finding reveals the physiological importance of the apodinitrogenase-stabilizing role of which both proteins are capable. The relationship between the metal cluster binding capabilities of this new family of proteins and the ability of some of them to stabilize an apoenzyme is still an open matter. PMID:11823455

  10. Navigating into the binding pockets of the HER family protein kinases: discovery of novel EGFR inhibitor as antitumor agent.


    Liu, Wei; Ning, Jin-Feng; Meng, Qing-Wei; Hu, Jing; Zhao, Yan-Bin; Liu, Chao; Cai, Li


    The epidermal growth factor receptor (EGFR) family has been validated as a successful antitumor drug target for decades. Known EGFR inhibitors were exposed to distinct drug resistance against the various EGFR mutants within non-small-cell lung cancer (NSCLC), particularly the T790M mutation. Although so far a number of studies have been reported on the development of third-generation EGFR inhibitors for overcoming the resistance issue, the design procedure largely depends on the intuition of medicinal chemists. Here we retrospectively make a detailed analysis of the 42 EGFR family protein crystal complexes deposited in the Protein Data Bank (PDB). Based on the analysis of inhibitor binding modes in the kinase catalytic cleft, we identified a potent EGFR inhibitor (compound A-10) against drug-resistant EGFR through fragment-based drug design. This compound showed at least 30-fold more potency against EGFR T790M than the two control molecules erlotinib and gefitinib in vitro. Moreover, it could exhibit potent HER2 inhibitory activities as well as tumor growth inhibitory activity. Molecular docking studies revealed a structural basis for the increased potency and mutant selectivity of this compound. Compound A-10 may be selected as a promising candidate in further preclinical studies. In addition, our findings could provide a powerful strategy to identify novel selective kinase inhibitors on the basis of detailed kinase-ligand interaction space in the PDB. PMID:26229444

  11. Navigating into the binding pockets of the HER family protein kinases: discovery of novel EGFR inhibitor as antitumor agent

    PubMed Central

    Liu, Wei; Ning, Jin-Feng; Meng, Qing-Wei; Hu, Jing; Zhao, Yan-Bin; Liu, Chao; Cai, Li


    The epidermal growth factor receptor (EGFR) family has been validated as a successful antitumor drug target for decades. Known EGFR inhibitors were exposed to distinct drug resistance against the various EGFR mutants within non-small-cell lung cancer (NSCLC), particularly the T790M mutation. Although so far a number of studies have been reported on the development of third-generation EGFR inhibitors for overcoming the resistance issue, the design procedure largely depends on the intuition of medicinal chemists. Here we retrospectively make a detailed analysis of the 42 EGFR family protein crystal complexes deposited in the Protein Data Bank (PDB). Based on the analysis of inhibitor binding modes in the kinase catalytic cleft, we identified a potent EGFR inhibitor (compound A-10) against drug-resistant EGFR through fragment-based drug design. This compound showed at least 30-fold more potency against EGFR T790M than the two control molecules erlotinib and gefitinib in vitro. Moreover, it could exhibit potent HER2 inhibitory activities as well as tumor growth inhibitory activity. Molecular docking studies revealed a structural basis for the increased potency and mutant selectivity of this compound. Compound A-10 may be selected as a promising candidate in further preclinical studies. In addition, our findings could provide a powerful strategy to identify novel selective kinase inhibitors on the basis of detailed kinase–ligand interaction space in the PDB. PMID:26229444

  12. Structural basis of FYCO1 and MAP1LC3A interaction reveals a novel binding mode for Atg8-family proteins.


    Cheng, Xiaofang; Wang, Yingli; Gong, Yukang; Li, Faxiang; Guo, Yujiao; Hu, Shichen; Liu, Jianping; Pan, Lifeng


    FYCO1 (FYVE and coiled-coil domain containing 1) functions as an autophagy adaptor in directly linking autophagosomes with the microtubule-based kinesin motor, and plays an essential role in the microtubule plus end-directed transport of autophagic vesicles. The specific association of FYCO1 with autophagosomes is mediated by its interaction with Atg8-family proteins decorated on the outer surface of autophagosome. However, the mechanistic basis governing the interaction between FYCO1 and Atg8-family proteins is largely unknown. Here, using biochemical and structural analyses, we demonstrated that FYCO1 contains a unique LC3-interacting region (LIR), which discriminately binds to mammalian Atg8 orthologs and preferentially binds to the MAP1LC3A and MAP1LC3B. In addition to uncovering the detailed molecular mechanism underlying the FYCO1 LIR and MAP1LC3A interaction, the determined FYCO1-LIR-MAP1LC3A complex structure also reveals a unique LIR binding mode for Atg8-family proteins, and demonstrates, first, the functional relevance of adjacent sequences C-terminal to the LIR core motif for binding to Atg8-family proteins. Taken together, our findings not only provide new mechanistic insight into FYCO1-mediated transport of autophagosomes, but also expand our understanding of the interaction modes between LIR motifs and Atg8-family proteins in general. PMID:27246247

  13. Autoantibodies define a family of proteins with conserved double-stranded RNA-binding domains as well as DNA binding activity.


    Satoh, M; Shaheen, V M; Kao, P N; Okano, T; Shaw, M; Yoshida, H; Richards, H B; Reeves, W H


    Cellular responses to viral infection are signaled by double-stranded (ds) RNA, which is not found in substantial amounts in uninfected cells. Although cellular dsRNA-binding proteins have been described, their characterization is incomplete. We show that dsRNA-binding proteins are prominent autoantigens. Sera from B6 and B10.S mice with pristane-induced lupus and human autoimmune sera immunoprecipitated a novel set of 130-, 110-, 90-, 80-, and 45-kDa proteins. The proteins were all major cellular poly(IC)-binding factors. N-terminal amino acid sequences of p110 and p90 were identical and matched nuclear factor (NF) 90 and M phase phosphoprotein 4. p45 and p90 were identified as the NF45.NF90 complex, which binds the interleukin-2 promoter as well as certain highly structured viral RNAs. NF90.NF45 and M phase phosphoprotein 4 belong to a large group of proteins with conserved dsRNA-binding motifs. Besides binding dsRNA, NF90.NF45, p110, and p130 had single-stranded and dsDNA binding activity. Some sera contained autoantibodies whose binding was inhibited by poly(IC) but not single-stranded DNA or vice versa, suggesting that the DNA- and RNA-binding sites are different. These autoantibodies will be useful probes of the function of dsRNA-binding proteins. Their interaction with dsRNA, an immunological adjuvant, also could promote autoimmunity. PMID:10574923

  14. Evolutionary analysis of the global landscape of protein domain types and domain architectures associated with family 14 carbohydrate-binding modules.


    Chang, Ti-Cheng; Stergiopoulos, Ioannis


    Domain promiscuity is a powerful evolutionary force that promotes functional innovation in proteins, thus increasing proteome and organismal complexity. Carbohydrate-binding modules, in particular, are known to partake in complex modular architectures that play crucial roles in numerous biochemical and molecular processes. However, the extent, functional, and evolutionary significance of promiscuity is shrouded in mystery for most CBM families. Here, we analyzed the global promiscuity of family 14 carbohydrate-binding modules (CBM14s) and show that fusion, fission, and reorganization events with numerous other domain types interplayed incessantly in a lineage-dependent manner to likely facilitate species adaptation and functional innovation in the family. PMID:26067847

  15. The protein tyrosine phosphatases PTPRZ and PTPRG bind to distinct members of the contactin family of neural recognition molecules

    SciTech Connect

    Bouyain, Samuel; Watkins, Dara J.


    The receptor protein tyrosine phosphatases gamma (PTPRG) and zeta (PTPRZ) are expressed primarily in the nervous system and mediate cell adhesion and signaling events during development. We report here the crystal structures of the carbonic anhydrase-like domains of PTPRZ and PTPRG and show that these domains interact directly with the second and third immunoglobulin repeats of the members of the contactin (CNTN) family of neural recognition molecules. Interestingly, these receptors exhibit distinct specificities: PTPRZ binds only to CNTN1, whereas PTPRG interacts with CNTN3, 4, 5, and 6. Furthermore, we present crystal structures of the four N-terminal immunoglobulin repeats of mouse CNTN4 both alone and in complex with the carbonic anhydrase-like domain of mouse PTPRG. In these structures, the N-terminal region of CNTN4 adopts a horseshoe-like conformation found also in CNTN2 and most likely in all CNTNs. This restrained conformation of the second and third immunoglobulin domains creates a binding site that is conserved among CNTN3, 4, 5, and 6. This site contacts a discrete region of PTPRG composed primarily of an extended {beta}-hairpin loop found in both PTPRG and PTPRZ. Overall, these findings implicate PTPRG, PTPRZ and CNTNs as a group of receptors and ligands involved in the manifold recognition events that underlie the construction of neural networks.

  16. Binding Efficiency of Protein-Protein Complexes

    PubMed Central

    Day, Eric S.; Cote, Shaun M.; Whitty, Adrian


    We examine the relationship between binding affinity and interface size for reversible protein-protein interactions (PPI), using cytokines from the tumor necrosis factor (TNF) superfamily and their receptors as a test case. Using surface plasmon resonance, we measured single-site binding affinities for the large receptor TNFR1 binding to its ligands TNFα (KD = 1.4 ± 0.4 nM) and lymphotoxin-α (KD = 50 ± 10 nM), and also for the small receptor Fn14 binding to TWEAK (KD = 70 ± 10 nM). We additionally assembled data for all other TNF/TNFR family complexes for which reliable single site binding affinities have been reported. We used these values to calculate the binding efficiency – defined as binding energy per Å2 of surface area buried at the contact interface – for the nine of these complexes for which co-crystal structures are available, and compared the results to those for a set of 144 protein-protein complexes with published affinity values. The results show that the most efficient PPI complexes generate ~20 cal.mol−1/Å2 of binding energy. A minimum contact area of ~500 Å2 is required for a stable complex, required to generate sufficient interaction energy to pay the entropic cost of co-localizing two proteins from 1 M solution. The most compact and efficient TNF/TNFR complex was BAFF/BR3, which achieved ~80% of the maximum achievable binding efficiency. Other small receptors also gave high binding efficiencies, while the larger receptors generated only 44-49% of this limit despite interacting primarily through just a single small domain. The results provide new insight into how much binding energy can be generated by a PPI interface of a given size, and establish a quantitative method to predict how large a natural or engineered contact interface must be to achieve a given level of binding affinity. PMID:23088250

  17. The FTMap family of web servers for determining and characterizing ligand-binding hot spots of proteins.


    Kozakov, Dima; Grove, Laurie E; Hall, David R; Bohnuud, Tanggis; Mottarella, Scott E; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor


    FTMap is a computational mapping server that identifies binding hot spots of macromolecules-i.e., regions of the surface with major contributions to the ligand-binding free energy. To use FTMap, users submit a protein, DNA or RNA structure in PDB (Protein Data Bank) format. FTMap samples billions of positions of small organic molecules used as probes, and it scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots in good agreement with experimental data. FTMap serves as the basis for other servers, namely FTSite, which is used to predict ligand-binding sites, FTFlex, which is used to account for side chain flexibility, FTMap/param, used to parameterize additional probes and FTDyn, for mapping ensembles of protein structures. Applications include determining the druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures and providing input for fragment-based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and it is much faster than the more-recent approaches to protein mapping based on mixed molecular dynamics. By using 16 probe molecules, the FTMap server finds the hot spots of an average-size protein in <1 h. As FTFlex performs mapping for all low-energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957

  18. The porcine gene TBP10 encodes a protein homologous to the human tat-binding protein/26S protease subunit family.


    Leeb, T; Rettenberger, G; Breech, J; Hameister, H; Brenig, B


    We have cloned a porcine gene, designated TBP1O, that belongs to the Tat-binding protein/26S protease subunit family. The genomic structure of the porcine TBP1O gene was analyzed after isolation of three overlapping genomic phage lambda clones. The TBP10 gene harbors 12 exons spanning 4.5 kb of chromosomal DNA. The TBP1O gene was assigned to Chromosome (Chr) 12 by fluorescence in situ hybridization (FISH) on metaphase chromosomes. The chromosomal location was confirmed by PCR analysis of a porcine-rodent hybrid cell panel. The TBP1O protein is encoded by a 1221 nucleotide cDNA and has a molecular mass of 45.6 kDa. The predicted amino acid sequence has highest similarity to the human and bovine p45 subunit of the 26S protease and the human transcription factor TRIP1. Further similarities were detected to the slime mold protein DdTBP1O and the Schizosaccharomyces pombe and Saccharomyces cerevisiae protein SUG1. Like DdTBP1O and other members of the protein family, the porcine TBP1O harbors a leucine zipper motif in the N-terminal region and a domain characteristics of ATP-dependent proteases in the C-terminal region. PMID:8833236

  19. Characterization of a novel family of fibronectin-binding proteins with M23 peptidase domains from Treponema denticola

    PubMed Central

    Bamford, C.V.; Francescutti, T.; Cameron, C.E.; Jenkinson, H.F.; Dymock, D.


    SUMMARY Interactions with fibronectin are important in the virulence strategies of a range of disease-related bacteria. The periodontitis-associated oral spirochaete Treponema denticola expresses at least two fibronectin-binding proteins, designated Msp (major surface protein) and OppA (oligopeptide-binding protein homologue). To identify other T. denticola outer membrane fibronectin-binding proteins, the amino acid sequence of the Treponema pallidum fibronectin-binding protein Tp0155 was used to survey the T. denticola genome. Seven T. denticola genes encoding orthologous proteins were identified. All but two were expressed in Escherichia coli and purified recombinant proteins bound fibronectin. Using antibodies to the N-terminal region of Tp0155, it was demonstrated that T. denticola TDE2318, with highest homology to Tp0155, was cell surface localized. Like Tp0155, the seven T. denticola proteins contained an M23 peptidase domain and four (TDE2318, TDE2753, TDE1738, TDE1297) contained one or two LysM domains. M23 peptidases can degrade peptidoglycan whereas LysM domains recognize carbohydrate polymers. In addition, TDE1738 may act as a bacteriocin based on homology with other bacterial lysins and the presence of an adjacent gene encoding a putative immunity factor. Collectively, these results suggest that T. denticola expresses fibronectin-binding proteins associated with the cell surface that may also have cell wall modifying or lytic functions. PMID:21040511

  20. Identification and expression analysis of the SQUAMOSA promoter-binding protein (SBP)-box gene family in Prunus mume.


    Xu, Zongda; Sun, Lidan; Zhou, Yuzhen; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang


    SQUAMOSA promoter-binding protein (SBP)-box family genes encode plant-specific transcription factors that play crucial roles in plant development, especially flower and fruit development. However, little information on this gene family is available for Prunus mume, an ornamental and fruit tree widely cultivated in East Asia. To explore the evolution of SBP-box genes in Prunus and explore their functions in flower and fruit development, we performed a genome-wide analysis of the SBP-box gene family in P. mume. Fifteen SBP-box genes were identified, and 11 of them contained an miR156 target site. Phylogenetic and comprehensive bioinformatics analyses revealed that different groups of SBP-box genes have undergone different evolutionary processes and varied in their length, structure, and motif composition. Purifying selection has been the main selective constraint on both paralogous and orthologous SBP-box genes. In addition, the sequences of orthologous SBP-box genes did not diverge widely after the split of P. mume and Prunus persica. Expression analysis of P. mume SBP-box genes revealed their diverse spatiotemporal expression patterns. Three duplicated SBP-box genes may have undergone subfunctionalization in Prunus. Most of the SBP-box genes showed high transcript levels in flower buds and young fruit. The four miR156-nontargeted genes were upregulated during fruit ripening. Together, these results provide information about the evolution of SBP-box genes in Prunus. The expression analysis lays the foundation for further research on the functions of SBP-box genes in P. mume and other Prunus species, especially during flower and fruit development. PMID:25810323

  1. The type 1 human immunodeficiency virus Tat binding protein is a transcriptional activator belonging to an additional family of evolutionarily conserved genes.

    PubMed Central

    Ohana, B; Moore, P A; Ruben, S M; Southgate, C D; Green, M R; Rosen, C A


    The type 1 human immunodeficiency virus Tat protein is a powerful transcriptional activator when bound to an RNA structure (TAR) present at the extreme 5' terminus of viral mRNA. Since transcriptional activation requires binding of Tat to RNA, it has been suggested that Tat enhances initiation or elongation through a direct interaction with cellular transcription factors. Here we show through protein fusion experiments that the previously identified cellular Tat binding protein, TBP-1, although unable to bind DNA, is a strong transcriptional activator when brought into proximity of several promoter elements. Transcriptional activity depends upon the integrity of at least two highly conserved domains: one resembling a nucleotide-binding motif and the other motif common to proteins with helicase activity. Our studies further reveal that TBP-1 represents one member of a large, highly conserved gene family that encodes proteins demonstrating strong amino acid conservation across species. Finally, we identified a second family member that, although 77% similar to TBP-1, does not activate transcription from the promoters examined. This finding, together with the observation that TBP-1 does not activate each promoter examined, suggests that this gene family may encode promoter-specific transcriptional activators. Images PMID:8419915

  2. Borrelia burgdorferi EbfC defines a newly-identified, widespread family of bacterial DNA-binding proteins

    PubMed Central

    Riley, Sean P.; Bykowski, Tomasz; Cooley, Anne E.; Burns, Logan H.; Babb, Kelly; Brissette, Catherine A.; Bowman, Amy; Rotondi, Matthew; Miller, M. Clarke; DeMoll, Edward; Lim, Kap; Fried, Michael G.; Stevenson, Brian


    The Lyme disease spirochete, Borrelia burgdorferi, encodes a novel type of DNA-binding protein named EbfC. Orthologs of EbfC are encoded by a wide range of bacterial species, so characterization of the borrelial protein has implications that span the eubacterial kingdom. The present work defines the DNA sequence required for high-affinity binding by EbfC to be the 4 bp broken palindrome GTnAC, where ‘n’ can be any nucleotide. Two high-affinity EbfC-binding sites are located immediately 5′ of B. burgdorferi erp transcriptional promoters, and binding of EbfC was found to alter the conformation of erp promoter DNA. Consensus EbfC-binding sites are abundantly distributed throughout the B. burgdorferi genome, occurring approximately once every 1 kb. These and other features of EbfC suggest that this small protein and its orthologs may represent a distinctive type of bacterial nucleoid-associated protein. EbfC was shown to bind DNA as a homodimer, and site-directed mutagenesis studies indicated that EbfC and its orthologs appear to bind DNA via a novel α-helical ‘tweezer’-like structure. PMID:19208644

  3. A 1536-well Fluorescence Polarization Assay to Screen for Modulators of the MUSASHI Family of RNA-Binding Proteins

    PubMed Central

    Minuesa, Gerard; Antczak, Christophe; Shum, David; Radu, Constantin; Bhinder, Bhavneet; Li, Yueming; Djaballah, Hakim; Kharas, Michael G.


    RNA-binding proteins (RBPs) can act as stem cell modulators and oncogenic drivers, but have been largely ignored by the pharmaceutical industry as potential therapeutic targets for cancer. The MUSASHI (MSI) family has recently been demonstrated to be an attractive clinical target in the most aggressive cancers. Therefore, the discovery and development of small molecule inhibitors could provide a novel therapeutic strategy. In order to find novel compounds with MSI RNA binding inhibitory activity, we have developed a fluorescence polarization (FP) assay and optimized it for high throughput screening (HTS) in a 1536-well microtiter plate format. Using a chemical library of 6,208 compounds, we performed pilot screens, against both MSI1 and MSI2, leading to the identification of 7 molecules for MSI1, 15 for MSI2 and 5 that inhibited both. A secondary FP dose-response screen validated 3 MSI inhibitors with IC50 below 10μM. Out of the 25 compounds retested in the secondary screen only 8 demonstrated optical interference due to high fluorescence. Utilizing a SYBR-based RNA electrophoresis mobility shift assay (EMSA), we further verified MSI inhibition of the top 3 compounds. Surprisingly, even though several aminoglycosides were present in the library, they failed to demonstrate MSI inhibitor activity challenging the concept that these compounds are pan-active against RBPs. In summary, we have developed an in vitro strategy to identify MSI specific inhibitors using an FP HTS platform, which will facilitate novel drug discovery for this class of RBPs. PMID:24912481

  4. Backbone Dynamics Of Intracellular Lipid Binding Proteins

    NASA Astrophysics Data System (ADS)

    Gutiérrez-González, Luis H.


    The family of intracellular lipid binding proteins (iLBPs) comprises a group of homologous 14-15 kDa proteins that specifically bind and facilitate the transport of fatty acids, bile acids, retinoids or eicosanoids. Members of this family include several types of fatty acid binding proteins (FABPs), ileal lipid binding protein, cellular retinoic acid binding proteins and cellular retinoid binding proteins. As a contribution to understanding the structure-function relationship in this protein family, the solution structure and backbone dynamics of human epidermal-type FABP (E-FABP) determined by NMR spectroscopy are reported. Moreover, hydrogen/deuterium exchange experiments indicated a direct correlation between the stability of the hydrogen-bonding network in the β-sheet structure and the conformational exchange in the millisecond-to-microsecond time range. The features of E-FABP backbone dynamics discussed in the present study are compared with those obtained for other phylogenetically related proteins. A strong interdependence with the overall protein stability and possibly also with the ligand-binding affinity for members of the lipid-binding protein family is shown.

  5. Dynamic Conformational Change Regulates the Protein-DNA Recognition: An Investigation on Binding of a Y-Family Polymerase to Its Target DNA

    PubMed Central

    Chu, Xiakun; Liu, Fei; Maxwell, Brian A.; Wang, Yong; Suo, Zucai; Wang, Haijun; Han, Wei; Wang, Jin


    Protein-DNA recognition is a central biological process that governs the life of cells. A protein will often undergo a conformational transition to form the functional complex with its target DNA. The protein conformational dynamics are expected to contribute to the stability and specificity of DNA recognition and therefore may control the functional activity of the protein-DNA complex. Understanding how the conformational dynamics influences the protein-DNA recognition is still challenging. Here, we developed a two-basin structure-based model to explore functional dynamics in Sulfolobus solfataricus DNA Y-family polymerase IV (DPO4) during its binding to DNA. With explicit consideration of non-specific and specific interactions between DPO4 and DNA, we found that DPO4-DNA recognition is comprised of first 3D diffusion, then a short-range adjustment sliding on DNA and finally specific binding. Interestingly, we found that DPO4 is under a conformational equilibrium between multiple states during the binding process and the distributions of the conformations vary at different binding stages. By modulating the strength of the electrostatic interactions, the flexibility of the linker, and the conformational dynamics in DPO4, we drew a clear picture on how DPO4 dynamically regulates the DNA recognition. We argue that the unique features of flexibility and conformational dynamics in DPO4-DNA recognition have direct implications for low-fidelity translesion DNA synthesis, most of which is found to be accomplished by the Y-family DNA polymerases. Our results help complete the description of the DNA synthesis process for the Y-family polymerases. Furthermore, the methods developed here can be widely applied for future investigations on how various proteins recognize and bind specific DNA substrates. PMID:25188490

  6. Structural analyses of the CRISPR protein Csc2 reveal the RNA-binding interface of the type I-D Cas7 family.


    Hrle, Ajla; Maier, Lisa-Katharina; Sharma, Kundan; Ebert, Judith; Basquin, Claire; Urlaub, Henning; Marchfelder, Anita; Conti, Elena


    Upon pathogen invasion, bacteria and archaea activate an RNA-interference-like mechanism termed CRISPR (clustered regularly interspaced short palindromic repeats). A large family of Cas (CRISPR-associated) proteins mediates the different stages of this sophisticated immune response. Bioinformatic studies have classified the Cas proteins into families, according to their sequences and respective functions. These range from the insertion of the foreign genetic elements into the host genome to the activation of the interference machinery as well as target degradation upon attack. Cas7 family proteins are central to the type I and type III interference machineries as they constitute the backbone of the large interference complexes. Here we report the crystal structure of Thermofilum pendens Csc2, a Cas7 family protein of type I-D. We found that Csc2 forms a core RRM-like domain, flanked by three peripheral insertion domains: a lid domain, a Zinc-binding domain and a helical domain. Comparison with other Cas7 family proteins reveals a set of similar structural features both in the core and in the peripheral domains, despite the absence of significant sequence similarity. T. pendens Csc2 binds single-stranded RNA in vitro in a sequence-independent manner. Using a crosslinking - mass-spectrometry approach, we mapped the RNA-binding surface to a positively charged surface patch on T. pendens Csc2. Thus our analysis of the key structural and functional features of T. pendens Csc2 highlights recurring themes and evolutionary relationships in type I and type III Cas proteins. PMID:25483036

  7. The bldC Developmental Locus of Streptomyces coelicolor Encodes a Member of a Family of Small DNA-Binding Proteins Related to the DNA-Binding Domains of the MerR Family

    PubMed Central

    Hunt, Alison C.; Servín-González, Luis; Kelemen, Gabriella H.; Buttner, Mark J.


    The bldC locus, required for formation of aerial hyphae in Streptomyces coelicolor, was localized by map-based cloning to the overlap between cosmids D17 and D25 of a minimal ordered library. Subcloning and sequencing showed that bldC encodes a member of a previously unrecognized family of small (58- to 78-residue) DNA-binding proteins, related to the DNA-binding domains of the MerR family of transcriptional activators. BldC family members are found in a wide range of gram-positive and gram-negative bacteria. Constructed ΔbldC mutants were defective in differentiation and antibiotic production. They failed to form an aerial mycelium on minimal medium and showed severe delays in aerial mycelium formation on rich medium. In addition, they failed to produce the polyketide antibiotic actinorhodin, and bldC was shown to be required for normal and sustained transcription of the pathway-specific activator gene actII-orf4. Although ΔbldC mutants produced the tripyrrole antibiotic undecylprodigiosin, transcripts of the pathway-specific activator gene (redD) were reduced to almost undetectable levels after 48 h in the bldC mutant, in contrast to the bldC+ parent strain in which redD transcription continued during aerial mycelium formation and sporulation. This suggests that bldC may be required for maintenance of redD transcription during differentiation. bldC is expressed from a single promoter. S1 nuclease protection assays and immunoblotting showed that bldC is constitutively expressed and that transcription of bldC does not depend on any of the other known bld genes. The bldC18 mutation that originally defined the locus causes a Y49C substitution that results in instability of the protein. PMID:15629942

  8. Association analyses of vitamin D-binding protein gene with compression strength index variation in Caucasian nuclear families

    PubMed Central

    Xu, X.-H.; Xiong, D.-H.; Liu, X.-G.; Guo, Y.; Chen, Y.; Zhao, J.; Recker, R. R.; Deng, H.-W.


    Summary This study was conducted to test whether there exists an association between vitamin D-binding protein (DBP) gene and compression strength index (CSI) phenotype. Candidate gene association analyses were conducted in total sample, male subgroup, and female subgroup, respectively. Two single-nucleotide polymorphisms (SNPs) with significant association results were found in males, suggesting the importance of DBP gene polymorphisms on the variation in CSI especially in Caucasian males. Introduction CSI of the femoral neck (FN) is a newly developed phenotype integrating information about bone size, body size, and bone mineral density. It is considered to have the potential to improve the performance of risk assessment for hip fractures because it is based on a combination of phenotypic traits influencing hip fractures rather than a single trait. CSI is under moderate genetic determination (with a heritability of ~44% found in this study), but the relevant genetic study is still rather scarce. Methods Based on the known physiological role of DBP in bone biology and the relatively high heritability of CSI, we tested 12 SNPs of the DBP gene for association with CSI variation in 405 Caucasian nuclear families comprising 1,873 subjects from the Midwestern US. Association analyses were performed in the total sample, male and female subgroups, respectively. Results Significant associations with CSI were found with two SNPs (rs222029, P=0.0019; rs222020, P=0.0042) for the male subgroup. Haplotype-based association tests corroborated the single-SNP results. Conclusions Our findings suggest that the DBP gene might be one of the genetic factors influencing CSI phenotype in Caucasians, especially in males. PMID:19543766

  9. The CopC Family: Structural and Bioinformatic Insights into a Diverse Group of Periplasmic Copper Binding Proteins.


    Lawton, Thomas J; Kenney, Grace E; Hurley, Joseph D; Rosenzweig, Amy C


    The CopC proteins are periplasmic copper binding proteins believed to play a role in bacterial copper homeostasis. Previous studies have focused on CopCs that are part of seven-protein Cop or Pco systems involved in copper resistance. These canonical CopCs contain distinct Cu(I) and Cu(II) binding sites. Mounting evidence suggests that CopCs are more widely distributed, often present only with the CopD inner membrane protein, frequently as a fusion protein, and that the CopC and CopD proteins together function in the uptake of copper to the cytoplasm. In the methanotroph Methylosinus trichosporium OB3b, genes encoding a CopCD pair are located adjacent to the particulate methane monooxygenase (pMMO) operon. The CopC from this organism (Mst-CopC) was expressed, purified, and structurally characterized. The 1.46 Å resolution crystal structure of Mst-CopC reveals a single Cu(II) binding site with coordination somewhat different from that in canonical CopCs, and the absence of a Cu(I) binding site. Extensive bioinformatic analyses indicate that the majority of CopCs in fact contain only a Cu(II) site, with just 10% of sequences corresponding to the canonical two-site CopC. Accordingly, a new classification scheme for CopCs was developed, and detailed analyses of the sequences and their genomic neighborhoods reveal new proteins potentially involved in copper homeostasis, providing a framework for expanded models of CopCD function. PMID:27010565

  10. Chicken interferon consensus sequence-binding protein (ICSBP) and interferon regulatory factor (IRF) 1 genes reveal evolutionary conservation in the IRF gene family.

    PubMed Central

    Jungwirth, C; Rebbert, M; Ozato, K; Degen, H J; Schultz, U; Dawid, I B


    Members of the IRF family mediate transcriptional responses to interferons (IFNs) and to virus infection. So far, proteins of this family have been studied only among mammalian species. Here we report the isolation of cDNA clones encoding two members of this family from chicken, interferon consensus sequence-binding protein (ICSBP) and IRF-1. The predicted chicken ICSBP and IRF-1 proteins show high levels of sequence similarity to their corresponding human and mouse counterparts. Sequence identities in the putative DNA-binding domains of chicken and human ICSBP and IRF-1 were 97% and 89%, respectively, whereas the C-terminal regions showed identities of 64% and 51%; sequence relationships with mouse ICSBP and IRF-1 are very similar. Chicken ICSBP was found to be expressed in several embryonic tissues, and both chicken IRF-1 and ICSBP were strongly induced in chicken fibroblasts by IFN treatment, supporting the involvement of these factors in IFN-regulated gene expression. The presence of proteins homologous to mammalian IRF family members, together with earlier observations on the occurrence of functionally homologous IFN-responsive elements in chicken and mammalian genes, highlights the conservation of transcriptional mechanisms in the IFN system, a finding that contrasts with the extensive sequence and functional divergence of the IFNs. Images Fig. 3 Fig. 4 Fig. 5 PMID:7536924

  11. Alternative binding modes identified for growth and differentiation factor-associated serum protein (GASP) family antagonism of myostatin.


    Walker, Ryan G; Angerman, Elizabeth B; Kattamuri, Chandramohan; Lee, Yun-Sil; Lee, Se-Jin; Thompson, Thomas B


    Myostatin, a member of the TGF-β family of ligands, is a strong negative regulator of muscle growth. As such, it is a prime therapeutic target for muscle wasting disorders. Similar to other TGF-β family ligands, myostatin is neutralized by binding one of a number of structurally diverse antagonists. Included are the antagonists GASP-1 and GASP-2, which are unique in that they specifically antagonize myostatin. However, little is known from a structural standpoint describing the interactions of GASP antagonists with myostatin. Here, we present the First low resolution solution structure of myostatin-free and myostatin-bound states of GASP-1 and GASP-2. Our studies have revealed GASP-1, which is 100 times more potent than GASP-2, preferentially binds myostatin in an asymmetrical 1:1 complex, whereas GASP-2 binds in a symmetrical 2:1 complex. Additionally, C-terminal truncations of GASP-1 result in less potent myostatin inhibitors that form a 2:1 complex, suggesting that the C-terminal domains of GASP-1 are the primary mediators for asymmetric complex formation. Overall, this study provides a new perspective on TGF-β antagonism, where closely related antagonists can utilize different ligand-binding strategies. PMID:25657005

  12. Alternative Binding Modes Identified for Growth and Differentiation Factor-associated Serum Protein (GASP) Family Antagonism of Myostatin*

    PubMed Central

    Walker, Ryan G.; Angerman, Elizabeth B.; Kattamuri, Chandramohan; Lee, Yun-Sil; Lee, Se-Jin; Thompson, Thomas B.


    Myostatin, a member of the TGF-β family of ligands, is a strong negative regulator of muscle growth. As such, it is a prime therapeutic target for muscle wasting disorders. Similar to other TGF-β family ligands, myostatin is neutralized by binding one of a number of structurally diverse antagonists. Included are the antagonists GASP-1 and GASP-2, which are unique in that they specifically antagonize myostatin. However, little is known from a structural standpoint describing the interactions of GASP antagonists with myostatin. Here, we present the First low resolution solution structure of myostatin-free and myostatin-bound states of GASP-1 and GASP-2. Our studies have revealed GASP-1, which is 100 times more potent than GASP-2, preferentially binds myostatin in an asymmetrical 1:1 complex, whereas GASP-2 binds in a symmetrical 2:1 complex. Additionally, C-terminal truncations of GASP-1 result in less potent myostatin inhibitors that form a 2:1 complex, suggesting that the C-terminal domains of GASP-1 are the primary mediators for asymmetric complex formation. Overall, this study provides a new perspective on TGF-β antagonism, where closely related antagonists can utilize different ligand-binding strategies. PMID:25657005

  13. Cellulose binding domain proteins


    Shoseyov, O.; Shpiegl, I.; Goldstein, M.; Doi, R.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 16 figs.

  14. Cellulose binding domain proteins


    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  15. Functional characterization of a redundant Plasmodium TRAP family invasin, TRAP-like protein, by aldolase binding and a genetic complementation test.


    Heiss, Kirsten; Nie, Hui; Kumar, Sumit; Daly, Thomas M; Bergman, Lawrence W; Matuschewski, Kai


    Efficient and specific host cell entry is of exquisite importance for intracellular pathogens. Parasites of the phylum Apicomplexa are highly motile and actively enter host cells. These functions are mediated by type I transmembrane invasins of the TRAP family that link an extracellular recognition event to the parasite actin-myosin motor machinery. We systematically tested potential parasite invasins for binding to the actin bridging molecule aldolase and complementation of the vital cytoplasmic domain of the sporozoite invasin TRAP. We show that the ookinete invasin CTRP and a novel, structurally related protein, termed TRAP-like protein (TLP), are functional members of the TRAP family. Although TLP is expressed in invasive stages, targeted gene disruption revealed a nonvital role during life cycle progression. This is the first genetic analysis of TLP, encoding a redundant TRAP family invasin, in the malaria parasite. PMID:18441124

  16. YIP1 family member 4 (YIPF4) is a novel cellular binding partner of the papillomavirus E5 proteins.


    Müller, Marietta; Wasson, Christopher W; Bhatia, Ramya; Boxall, Sally; Millan, David; Goh, Grace Y S; Haas, Jürgen; Stonehouse, Nicola J; Macdonald, Andrew


    E5 proteins are amongst the least understood of the Human Papillomavirus (HPV) encoded gene products. They are small, membrane-integrated proteins known to modulate a number of critical host pathways associated with pathogenesis including growth factor receptor signaling and immune evasion. Their role in the virus life cycle is less clear, indicating a role in the productive stages of the life cycle. However, a mechanism for this is currently lacking. Here we describe the identification of a novel binding partner of E5, YIPF4 using yeast two-hybrid analysis. YIPF4 is also a poorly characterized membrane spanning protein. Mutagenesis studies implicated the transmembrane regions of each protein as important for their interaction. Binding to YIPF4 was found for all E5 proteins tested suggesting that this interaction may mediate a conserved E5 function. In normal human keratinocytes YIPF4 expression was down-regulated upon differentiation and this reduction was partially rescued in cells harbouring HPV. Despite the conserved nature of the interaction with E5, siRNA mediated depletion of YIPF4 failed to impede two well-characterized functions of E5, namely EGFR trafficking or HLA class I presentation. Continued studies of YIPF4 are warranted to determine its role in the PV life cycle. PMID:26235900

  17. YIP1 family member 4 (YIPF4) is a novel cellular binding partner of the papillomavirus E5 proteins

    PubMed Central

    Müller, Marietta; Wasson, Christopher W.; Bhatia, Ramya; Boxall, Sally; Millan, David; Goh, Grace Y.S.; Haas, Jürgen; Stonehouse, Nicola J.; Macdonald, Andrew


    E5 proteins are amongst the least understood of the Human Papillomavirus (HPV) encoded gene products. They are small, membrane-integrated proteins known to modulate a number of critical host pathways associated with pathogenesis including growth factor receptor signaling and immune evasion. Their role in the virus life cycle is less clear, indicating a role in the productive stages of the life cycle. However, a mechanism for this is currently lacking. Here we describe the identification of a novel binding partner of E5, YIPF4 using yeast two-hybrid analysis. YIPF4 is also a poorly characterized membrane spanning protein. Mutagenesis studies implicated the transmembrane regions of each protein as important for their interaction. Binding to YIPF4 was found for all E5 proteins tested suggesting that this interaction may mediate a conserved E5 function. In normal human keratinocytes YIPF4 expression was down-regulated upon differentiation and this reduction was partially rescued in cells harbouring HPV. Despite the conserved nature of the interaction with E5, siRNA mediated depletion of YIPF4 failed to impede two well-characterized functions of E5, namely EGFR trafficking or HLA class I presentation. Continued studies of YIPF4 are warranted to determine its role in the PV life cycle. PMID:26235900

  18. The Torsin-family AAA+ Protein OOC-5 Contains a Critical Disulfide Adjacent to Sensor-II That Couples Redox State to Nucleotide Binding

    PubMed Central

    Zhu, Li; Wrabl, James O.; Hayashi, Adam P.; Rose, Lesilee S.


    A subgroup of the AAA+ proteins that reside in the endoplasmic reticulum and the nuclear envelope including human torsinA, a protein mutated in hereditary dystonia, is called the torsin family of AAA+ proteins. A multiple-sequence alignment of this family with Hsp100 proteins of known structure reveals a conserved cysteine in the C-terminus of torsin proteins within the Sensor-II motif. A structural model predicts this cysteine to be a part of an intramolecular disulfide bond, suggesting that it may function as a redox sensor to regulate ATPase activity. In vitro experiments with OOC-5, a torsinA homolog from Caenorhabditis elegans, demonstrate that redox changes that reduce this disulfide bond affect the binding of ATP and ADP and cause an attendant local conformational change detected by limited proteolysis. Transgenic worms expressing an ooc-5 gene with cysteine-to-serine mutations that disrupt the disulfide bond have a very low embryo hatch rate compared with wild-type controls, indicating these two cysteines are essential for OOC-5 function. We propose that the Sensor-II in torsin family proteins is a redox-regulated sensor. This regulatory mechanism may be central to the function of OOC-5 and human torsinA. PMID:18550799

  19. Expression Analysis and Binding Assays in the Chemosensory Protein Gene Family Indicate Multiple Roles in Helicoverpa armigera.


    Li, Zhao-Qun; Zhang, Shuai; Luo, Jun-Yu; Zhu, Jing; Cui, Jin-Jie; Dong, Shuang-Lin


    Chemosensory proteins (CSPs) have been proposed to capture and transport hydrophobic chemicals to receptors on sensory neurons. We identified and cloned 24 CSP genes to better understand the physiological function of CSPs in Helicoverpa armigera. Quantitative real-time polymerase chain reaction assays indicate that CSP genes are ubiquitously expressed in adult H. armigera tissues. Broad expression patterns in adult tissues suggest that CSPs are involved in a diverse range of cellular processes, including chemosensation as well as other functions not related to chemosensation. The H. armigera CSPs that were highly transcribed in sensory organs or pheromone glands (HarmCSPs 6, 9, 18, 19), were recombinantly expressed in bacteria to explore their function. Fluorescent competitive binding assays were used to measure the binding affinities of these CSPs against 85 plant volatiles and 4 pheromone components. HarmCSP6 displays high binding affinity for pheromone components, whereas the other three proteins do not show affinities for any of the compounds tested. HarmCSP6 is expressed in numerous cells located in or close to long sensilla trichodea on the antennae of both males and females. These results suggest that HarmCSP6 may be involved in transporting female sex pheromones in H. armigera. PMID:25893790

  20. Evolution of a family of metazoan active-site-serine enzymes from penicillin-binding proteins: a novel facet of the bacterial legacy

    PubMed Central


    Background Bacterial penicillin-binding proteins and β-lactamases (PBP-βLs) constitute a large family of serine proteases that perform essential functions in the synthesis and maintenance of peptidoglycan. Intriguingly, genes encoding PBP-βL homologs occur in many metazoan genomes including humans. The emerging role of LACTB, a mammalian mitochondrial PBP-βL homolog, in metabolic signaling prompted us to investigate the evolutionary history of metazoan PBP-βL proteins. Results Metazoan PBP-βL homologs including LACTB share unique structural features with bacterial class B low molecular weight penicillin-binding proteins. The amino acid residues necessary for enzymatic activity in bacterial PBP-βL proteins, including the catalytic serine residue, are conserved in all metazoan homologs. Phylogenetic analysis indicated that metazoan PBP-βL homologs comprise four alloparalogus protein lineages that derive from α-proteobacteria. Conclusion While most components of the peptidoglycan synthesis machinery were dumped by early eukaryotes, a few PBP-βL proteins were conserved and are found in metazoans including humans. Metazoan PBP-βL homologs are active-site-serine enzymes that probably have distinct functions in the metabolic circuitry. We hypothesize that PBP-βL proteins in the early eukaryotic cell enabled the degradation of peptidoglycan from ingested bacteria, thereby maximizing the yield of nutrients and streamlining the cell for effective phagocytotic feeding. PMID:18226203

  1. The Alba protein family: Structure and function.


    Goyal, Manish; Banerjee, Chinmoy; Nag, Shiladitya; Bandyopadhyay, Uday


    Alba family proteins are small, basic, dimeric nucleic acid-binding proteins, which are widely distributed in archaea and a number of eukaryotes. This family of proteins bears the distinct features of regulation through acetylation/deacetylation, hence named as acetylation lowers binding affinity (Alba). Alba family proteins bind DNA cooperatively with no apparent sequence specificity. Besides DNA, Alba proteins also interact with diverse RNA species and associate with ribonucleo-protein complexes. Initially, Alba proteins were recognized as chromosomal proteins and supposed to be involved in the maintenance of chromatin architecture and transcription repression. However, recent studies have shown increasing evidence of functional plasticity among Alba family of proteins that widely range from genome packaging and organization, transcriptional and translational regulation, RNA metabolism, and development and differentiation processes. In recent years, Alba family proteins have attracted growing interest due to their widespread occurrence in large number of organisms. Presence in multiple copies, functional crosstalk, differential binding affinity, and posttranslational modifications are some of the key factors that might regulate the biological functions of Alba family proteins. In this review article, we present an overview of the Alba family proteins, their salient features and emphasize their functional role in different organisms reported so far. PMID:26900088

  2. EndB, a Multidomain Family 44 Cellulase from Ruminococcus flavefaciens 17, Binds to Cellulose via a Novel Cellulose-Binding Module and to Another R. flavefaciens Protein via a Dockerin Domain

    PubMed Central

    Rincón, Marco T.; McCrae, Sheila I.; Kirby, James; Scott, Karen P.; Flint, Harry J.


    The mechanisms by which cellulolytic enzymes and enzyme complexes in Ruminococcus spp. bind to cellulose are not fully understood. The product of the newly isolated cellulase gene endB from Ruminococcus flavefaciens 17 was purified as a His-tagged product after expression in Escherichia coli and found to be able to bind directly to crystalline cellulose. The ability to bind cellulose is shown to be associated with a novel cellulose-binding module (CBM) located within a region of 200 amino acids that is unrelated to known protein sequences. EndB (808 amino acids) also contains a catalytic domain belonging to glycoside hydrolase family 44 and a C-terminal dockerin-like domain. Purified EndB is also shown to bind specifically via its dockerin domain to a polypeptide of ca. 130 kDa present among supernatant proteins from Avicel-grown R. flavefaciens that attach to cellulose. The protein to which EndB attaches is a strong candidate for the scaffolding component of a cellulosome-like multienzyme complex recently identified in this species (S.-Y. Ding et al., J. Bacteriol. 183:1945–1953, 2001). It is concluded that binding of EndB to cellulose may occur both through its own CBM and potentially also through its involvement in a cellulosome complex. PMID:11571138

  3. An olive pollen protein with allergenic activity, Ole e 10, defines a novel family of carbohydrate-binding modules and is potentially implicated in pollen germination

    PubMed Central


    CBMs (carbohydrate-binding modules) are the most common non-catalytic modules associated with enzymes active in plant cell-wall hydrolysis. They have been frequently identified by amino acid sequence alignments, but only a few have been experimentally established to have a carbohydrate-binding activity. A small olive pollen protein, Ole e 10 (10 kDa), has been described as a major inducer of type I allergy in humans. In the present study, the ability of Ole e 10 to bind several polysaccharides has been analysed by affinity gel electrophoresis, which demonstrated that the protein bound 1,3-β-glucans preferentially. Analytical ultracentrifugation studies confirmed binding to laminarin, at a protein/ligand ratio of 1:1. The interaction of Ole e 10 with laminarin induced a conformational change in the protein, as detected by CD and fluorescence analyses, and an increase of 3.6 °C in the thermal denaturation temperature of Ole e 10 in the presence of the glycan. These results, and the absence of alignment of the sequence of Ole e 10 with that of any classified CBM, indicate that this pollen protein defines a novel family of CBMs, which we propose to name CBM43. Immunolocalization of Ole e 10 in mature and germinating pollen by transmission electron microscopy and confocal laser scanning microscopy demonstrated the co-localization of Ole e 10 and callose (1,3-β-glucan) in the growing pollen tube, suggesting a role for this protein in the metabolism of carbohydrates and in pollen tube wall re-formation during germination. PMID:15882149

  4. Base preferences for DNA binding by the bHLH-Zip protein USF: effects of MgCl2 on specificity and comparison with binding of Myc family members.

    PubMed Central

    Bendall, A J; Molloy, P L


    Studies of the DNA binding specificity of transcription factors belonging to the basic helix-loop-helix (bHLH) family have identified the so-called E-box, CACGTG, as being a high affinity specific binding sequence for this class of DNA binding proteins. Binding sequences for HeLa USF were selected from an initially random population of 20 bp sequences, defining the optimum USF binding sequence as R-5Y-4C-3A-2C-1G+1T+2G+3R+4Y+5. The significance of the flanking bases was further demonstrated by showing that USF and the related proteins c-Myc and Max discriminate between CACGTG-type E-boxes and that the primary means of discrimination appears to be the identity of the nucleotide at +/- 4, the presence of a T at -4 being inhibitory to binding by Myc but not by USF or Max. This suggests one mechanism by which bHLH factors are partitioned between multiple potential binding sequences in the promoters and enhancers of viral and cellular genes. It was also demonstrated that MgCl2 has a significant influence on USF DNA binding specificity. A broader range of USF binding sites was selected in the absence of MgCl2, conforming to the altered half-site consensus gTGaY. Binding studies with specific oligonucleotides demonstrated significantly improved tolerance to sequence variation at positions 1, 4, and to a lesser extent 5, of the GTGRY consensus in the absence of MgCl2. The results indicate that Mg2+ ions have an integral role in the formation of the USF-DNA complex. Images PMID:8052536

  5. Mo-CBP3, an Antifungal Chitin-Binding Protein from Moringa oleifera Seeds, Is a Member of the 2S Albumin Family

    PubMed Central

    Freire, José E. C.; Vasconcelos, Ilka M.; Moreno, Frederico B. M. B.; Batista, Adelina B.; Lobo, Marina D. P.; Pereira, Mirella L.; Lima, João P. M. S.; Almeida, Ricardo V. M.; Sousa, Antônio J. S.; Monteiro-Moreira, Ana C. O.; Oliveira, José T. A.; Grangeiro, Thalles B.


    Mo-CBP3 is a chitin-binding protein from M. oleifera seeds that inhibits the germination and mycelial growth of phytopathogenic fungi. This protein is highly thermostable and resistant to pH changes, and therefore may be useful in the development of new antifungal drugs. However, the relationship of MoCBP3 with the known families of carbohydrate-binding domains has not been established. In the present study, full-length cDNAs encoding 4 isoforms of Mo-CBP3 (Mo-CBP3-1, Mo-CBP3-2, Mo-CBP3-3 and Mo-CBP3-4) were cloned from developing seeds. The polypeptides encoded by the Mo-CBP3 cDNAs were predicted to contain 160 (Mo-CBP3-3) and 163 amino acid residues (Mo-CBP3-1, Mo-CBP3-2 and Mo-CBP3-4) with a signal peptide of 20-residues at the N-terminal region. A comparative analysis of the deduced amino acid sequences revealed that Mo-CBP3 is a typical member of the 2S albumin family, as shown by the presence of an eight-cysteine motif, which is a characteristic feature of the prolamin superfamily. Furthermore, mass spectrometry analysis demonstrated that Mo-CBP3 is a mixture of isoforms that correspond to different mRNA products. The identification of Mo-CBP3 as a genuine member of the 2S albumin family reinforces the hypothesis that these seed storage proteins are involved in plant defense. Moreover, the chitin-binding ability of Mo-CBP3 reveals a novel functionality for a typical 2S albumin. PMID:25789746

  6. Phylogenetic and Complementation Analysis of a Single-Stranded DNA Binding Protein Family from Lactococcal Phages Indicates a Non-Bacterial Origin

    PubMed Central

    Mariadassou, Mahendra; Bardowski, Jacek K.; Bidnenko, Elena


    Background The single-stranded-nucleic acid binding (SSB) protein superfamily includes proteins encoded by different organisms from Bacteria and their phages to Eukaryotes. SSB proteins share common structural characteristics and have been suggested to descend from an ancestor polypeptide. However, as other proteins involved in DNA replication, bacterial SSB proteins are clearly different from those found in Archaea and Eukaryotes. It was proposed that the corresponding genes in the phage genomes were transferred from the bacterial hosts. Recently new SSB proteins encoded by the virulent lactococcal bacteriophages (Orf14bIL67-like proteins) have been identified and characterized structurally and biochemically. Methodology/Principal Findings This study focused on the determination of phylogenetic relationships between Orf14bIL67-like proteins and other SSBs. We have performed a large scale phylogenetic analysis and pairwise sequence comparisons of SSB proteins from different phyla. The results show that, in remarkable contrast to other phage SSBs, the Orf14bIL67–like proteins form a distinct, self-contained and well supported phylogenetic group connected to the archaeal SSBs. Functional studies demonstrated that, despite the structural and amino acid sequence differences from bacterial SSBs, Orf14bIL67 protein complements the conditional lethal ssb-1 mutation of Escherichia coli. Conclusions/Significance Here we identified for the first time a group of phages encoded SSBs which are clearly distinct from their bacterial counterparts. All methods supported the recognition of these phage proteins as a new family within the SSB superfamily. Our findings suggest that unlike other phages, the virulent lactococcal phages carry ssb genes that were not acquired from their hosts, but transferred from an archaeal genome. This represents a unique example of a horizontal gene transfer between Archaea and bacterial phages. PMID:22073223

  7. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis.


    Hai, T; Hartman, M G


    The mammalian ATF/CREB family of transcription factors represents a large group of basic region-leucine zipper (bZip) proteins which was originally defined in the late 1980s by their ability to bind to the consensus ATF/CRE site 'TGACGTCA'. Over the past decade, cDNA clones encoding identical or homologous proteins have been isolated by different laboratories and given different names. These proteins can be grouped into subgroups according to their amino acid similarity. In this review, we will briefly describe the classification of these proteins with a historical perspective of their nomenclature. We will then review three members of the ATF/CREB family of proteins: ATF3, ATF4 and ATF6. We will address four issues for each protein: (a) homologous proteins and alternative names, (b) dimer formation with other bZip proteins, (c) transcriptional activity, and (d) potential physiological functions. Although the name Activating Transcription Factor (ATF) implies that they are transcriptional activators, some of these proteins are transcriptional repressors. ATF3 homodimer is a transcriptional repressor and ATF4 has been reported to be either an activator or a repressor. We will review the reports on the transcriptional activities of ATF4, and propose potential explanations for the discrepancy. Although the physiological functions of these proteins are not well understood, some clues can be gained from studies with different approaches. When the data are available, we will address the following questions. (a) How is the expression (at the mRNA level or protein level) regulated? (b) How are the transcriptional activities regulated? (c) What are the interacting proteins (other than bZip partners)? (d) What are the consequences of ectopically expressing the gene (gain-of-function) or deleting the gene (loss-of-function)? Although answers to these questions are far from being complete, together they provide clues to the functions of these ATF proteins. Despite the

  8. Evolution of Protein Binding Modes in Homooligomers

    PubMed Central

    Dayhoff, Judith E.; Shoemaker, Benjamin A.; Bryant, Stephen H.; Panchenko, Anna R.


    The evolution of protein interactions cannot be deciphered without a detailed analysis of interaction interfaces and binding modes. We performed a large-scale study of protein homooligomers in terms of their symmetry, interface sizes, and conservation of binding modes. We also focused specifically on the evolution of protein binding modes from nine families of homooligomers and mapped 60 different binding modes and oligomerization states onto the phylogenetic trees of these families. We observed a significant tendency for the same binding modes to be clustered together and conserved within clades on phylogenetic trees; this trend is especially pronounced for close homologs with 70% sequence identity or higher. Some binding modes are conserved among very distant homologs, pointing to their ancient evolutionary origin, while others are very specific for a certain phylogenetic group. Moreover, we found that the most ancient binding modes have a tendency to involve symmetrical (isologous) homodimer binding arrangements with larger interfaces, while recently evolved binding modes more often exhibit asymmetrical arrangements and smaller interfaces. PMID:19879880

  9. Murine GBP-5, a new member of the murine guanylate-binding protein family, is coordinately regulated with other GBPs in vivo and in vitro.


    Nguyen, Tam Thuan; Hu, Yan; Widney, Daniel P; Mar, Rebecca A; Smith, Jeffrey B


    A new murine member of the interferon (IFN)-inducible guanylate-binding protein (GBP) family was cloned in a search for glucocorticoid-attenuated response genes induced in the lung during endotoxemia. The full-length MuGBP-5 cDNA encodes a 590 amino acid residue protein with GTP binding motifs identical to those in human GBP-1 (HuGBP-1) and a similar isoprenylation sequence at the C-terminus. An alternatively spliced form of MuGBP-5 that lacks the second GTP binding motif and differs at the C-terminus was also identified. The MuGBP-5 gene is located on chromosome 3, near MuGBP-3 and MuGBP-2, and has a genomic organization similar to other GBP genes. To facilitate the evaluation of GBP family message expression, we constructed RNase protection assay probes for MuGBP-1, MuGBP-2, MuGBP-3, MuGBP-4/Mag-2 (macrophage activation gene-2), and MuGBP-5 and validated their use in Swiss Webster, BALB/c, and C57BL/6 mice. In BALB/c mice, all five MuGBPs were induced in multiple organs during endotoxemia, and all had a similar pattern of expression in different tissues. With minor quantitative differences, the MuGBPs also had similar patterns of response to IFN-gamma, lipopolysaccharide (LPS), interleukin-1beta (IL-1beta), and tumor necrosis factor-alpha (TNF-alpha) in RAW 264.7 and Swiss 3T3 cells. The coordinate expression of the MuGBPs suggests that they share common mechanisms of regulation. PMID:12396730

  10. Function and evolution of a gene family encoding odorant binding-like proteins in a social insect, the honey bee (Apis mellifera)

    PubMed Central

    Forêt, Sylvain; Maleszka, Ryszard


    The remarkable olfactory power of insect species is thought to be generated by a combinatorial action of two large protein families, G protein-coupled olfactory receptors (ORs) and odorant binding proteins (OBPs). In olfactory sensilla, OBPs deliver hydrophobic airborne molecules to ORs, but their expression in nonolfactory tissues suggests that they also may function as general carriers in other developmental and physiological processes. Here we used bioinformatic and experimental approaches to characterize the OBP-like gene family in a highly social insect, the Western honey bee. Comparison with other insects shows that the honey bee has the smallest set of these genes, consisting of only 21 OBPs. This number stands in stark contrast to the more than 70 OBPs in Anopheles gambiae and 51 in Drosophila melanogaster. In the honey bee as in the two dipterans, these genes are organized in clusters. We show that the evolution of their structure involved frequent intron losses. We describe a monophyletic subfamily of OBPs where the diversification of some amino acids appears to have been accelerated by positive selection. Expression profiling under a wide range of conditions shows that in the honey bee only nine OBPs are antenna-specific. The remaining genes are expressed either ubiquitously or are tightly regulated in specialized tissues or during development. These findings support the view that OBPs are not restricted to olfaction and are likely to be involved in broader physiological functions. PMID:17065610

  11. Cold Spots in Protein Binding.


    Shirian, Jason; Sharabi, Oz; Shifman, Julia M


    Understanding the energetics and architecture of protein-binding interfaces is important for basic research and could potentially facilitate the design of novel binding domains for biotechnological applications. It is well accepted that a few key residues at binding interfaces (binding hot spots) are responsible for contributing most to the free energy of binding. In this opinion article, we introduce a new concept of 'binding cold spots', or interface positions occupied by suboptimal amino acids. Such positions exhibit a potential for affinity enhancement through various mutations. We give several examples of cold spots from different protein-engineering studies and argue that identification of such positions is crucial for studies of protein evolution and protein design. PMID:27477052

  12. Deletion of the gene family of small chlorophyll-binding proteins (ScpABCDE) offsets C/N homeostasis in Synechocystis PCC 6803.


    Tibiletti, Tania; Hernández-Prieto, Miguel A; Matthijs, Hans C P; Niyogi, Krishna K; Funk, Christiane


    In the family of chlorophyll binding proteins, single helix small CAB-like proteins (SCPs) are found in all organisms performing oxygenic photosynthesis. Here, we investigated the function of these stress-inducible proteins in the cyanobacterium Synechocystis sp. PCC 6803. We compared physiological, proteome and transcriptome traits of a Photosystem I (PSI) deletion strain, which constitutively induces SCPs, and a PSI-less/ScpABCDE(-) without SCPs. The SCP mutant cells were larger in size, showed irregular thylakoid structure and differed in cell-surface morphology. Deletion of scp genes strongly affected the carbon (C) and nitrogen (N) balance, resulting in accumulation of carbohydrates and a decrease in N-rich compounds (proteins and chlorophyll). Data from transcriptomic and metabolomic experiments revealed a role of SCPs in the control of chlorophyll biosynthesis. Additionally, SCPs diminished formation of reactive oxygen species, thereby preventing damage within Photosystem II. We conclude that the lack of SCP-function to remove free chlorophyll under stress conditions has a large impact on the metabolism of the entire cell. PMID:26646103

  13. The EF-hand Ca(2+)-binding protein super-family: a genome-wide analysis of gene expression patterns in the adult mouse brain.


    Girard, F; Venail, J; Schwaller, B; Celio, M R


    In mice, 249 putative members of the superfamily of EF-hand domain Ca(2+)-binding proteins, manifesting great diversity in structure, cellular localization and functions have been identified. Three members in particular, namely, calbindin-D28K, calretinin and parvalbumin, are widely used as markers for specific neuronal subpopulations in different regions of the brain. The aim of the present study was to compile a comprehensive atlas of the gene-expression profiles of the entire EF-hand gene superfamily in the murine brain. This was achieved by a meticulous examination of the in-situ hybridization images in the Allen Brain Atlas database. Topographically, our analysis focused on the olfactory bulb, cerebral cortex (barrel cortex in the primary somatosensory area), basal ganglia, hippocampus, amygdala, thalamus, hypothalamus, cerebellum, midbrain, pons and medulla, and on clearly identifiable sub-structures within each of these areas. The expression profiles of four family-members, namely hippocalcin-like 4, neurocalcin-δ, plastin 3 and tescalcin, that have not been hitherto reported, at either the mRNA (in-situ-hybridization) or the protein (immunohistochemical) levels, are now presented for the first time. The fruit of our analysis is a document in which the gene-expression profiles of all members of the EF-hand family genes are compared, and in which future possible neuronal markers for specific cells/brain areas are identified. The assembled information could afford functional clues to investigators, conducive to further experimental pursuit. PMID:25770968

  14. Ancestral Protein Reconstruction Yields Insights into Adaptive Evolution of Binding Specificity in Solute-Binding Proteins.


    Clifton, Ben E; Jackson, Colin J


    The promiscuous functions of proteins are an important reservoir of functional novelty in protein evolution, but the molecular basis for binding promiscuity remains elusive. We used ancestral protein reconstruction to experimentally characterize evolutionary intermediates in the functional expansion of the polar amino acid-binding protein family, which has evolved to bind a variety of amino acids with high affinity and specificity. High-resolution crystal structures of an ancestral arginine-binding protein in complex with l-arginine and l-glutamine show that the promiscuous binding of l-glutamine is enabled by multi-scale conformational plasticity, water-mediated interactions, and selection of an alternative conformational substate productive for l-glutamine binding. Evolution of specialized glutamine-binding proteins from this ancestral protein was achieved by displacement of water molecules from the protein-ligand interface, reducing the entropic penalty associated with the promiscuous interaction. These results provide a structural and thermodynamic basis for the co-option of a promiscuous interaction in the evolution of binding specificity. PMID:26853627

  15. Gi/o Signaling and the Palmitoyltransferase DHHC2 Regulate Palmitate Cycling and Shuttling of RGS7 Family-binding Protein*

    PubMed Central

    Jia, Lixia; Linder, Maurine E.; Blumer, Kendall J.


    R7BP (RGS7 family-binding protein) has been proposed to function in neurons as a palmitoylation-regulated protein that shuttles heterodimeric, Gi/oα-specific GTPase-activating protein (GAP) complexes composed of Gβ5 and RGS7 (R7) isoforms between the plasma membrane and nucleus. To test this hypothesis we studied R7BP palmitoylation and localization in neuronal cells. We report that R7BP undergoes dynamic, signal-regulated palmitate turnover; the palmitoyltransferase DHHC2 mediates de novo and turnover palmitoylation of R7BP; DHHC2 silencing redistributes R7BP from the plasma membrane to the nucleus; and Gi/o signaling inhibits R7BP depalmitoylation whereas Gi/o inactivation induces nuclear accumulation of R7BP. In concert with previous evidence, our findings suggest that agonist-induced changes in palmitoylation state facilitate GAP action by (i) promoting Giα depalmitoylation to create optimal GAP substrates, and (ii) inhibiting R7BP depalmitoylation to stabilize membrane association of R7-Gβ5 GAP complexes. Regulated palmitate turnover may also enable R7BP-bound GAPs to shuttle between sites of low and high Gi/o activity or the plasma membrane and nucleus, potentially providing spatio-temporal control of signaling by Gi/o-coupled receptors. PMID:21343290

  16. Expression and characterization of maize ZBP14, a member of a new family of zinc-binding proteins.

    PubMed Central

    Robinson, K; Jones, D; Howell, S; Soneji, Y; Martin, S; Aitken, A


    A maize gene (Mz2-12), with a deduced amino acid sequence similar to that of a protein kinase C (PKC) inhibitor from bovine brain, has been expressed in Escherichia coli and the protein (ZBP14) purified to homogeneity. The bovine protein was originally identified by Walsh's group and named PKC inhibitor-1 (PKCI-1). The recombinant maize protein (ZBP14) shares characteristics of bovine PKCI-1: it has similar secondary structure, is dimeric, and has a similar affinity for zinc. However, the maize ZBP14 had very little activity as an inhibitor of mammalian brain PKC, thus precluding zinc sequestration as the mechanism of inhibition. The biological role for the maize protein in plant kinase regulation is therefore unclear. In the presence of both maize ZBP14 and 14-3-3 protein (which inhibits PKC in the absence of diacylglycerol), the effects on PKC appeared to be synergistic. Images Figure 1 PMID:7717986

  17. Restraint of the G2/M transition by the SR/RRM family mRNA shuttling binding protein SNXAHRB1 in Aspergillus nidulans.


    James, Steven W; Banta, Travis; Barra, James; Ciraku, Lorela; Coile, Clifford; Cuda, Zach; Day, Ryan; Dixit, Cheshil; Eastlack, Steven; Giang, Anh; Goode, James; Guice, Alexis; Huff, Yulon; Humbert, Sara; Kelliher, Christina; Kobie, Julie; Kohlbrenner, Emily; Mwambutsa, Faustin; Orzechowski, Amanda; Shingler, Kristin; Spell, Casey; Anglin, Sarah Lea


    Control of the eukaryotic G2/M transition by CDC2/CYCLINB is tightly regulated by protein-protein interactions, protein phosphorylations, and nuclear localization of CDC2/CYCLINB. We previously reported a screen, in Aspergillus nidulans, for extragenic suppressors of nimX2(cdc2) that resulted in the identification of the cold-sensitive snxA1 mutation. We demonstrate here that snxA1 suppresses defects in regulators of the CDK1 mitotic induction pathway, including nimX2(cdc) (2), nimE6(cyclinB), and nimT23(cdc) (25), but does not suppress G2-arresting nimA1/nimA5 mutations, the S-arresting nimE10(cyclinB) mutation, or three other G1/S phase mutations. snxA encodes the A. nidulans homolog of Saccharomyces cerevisiae Hrb1/Gbp2; nonessential shuttling messenger RNA (mRNA)-binding proteins belonging to the serine-arginine-rich (SR) and RNA recognition motif (RRM) protein family; and human heterogeneous ribonucleoprotein-M, a spliceosomal component involved in pre-mRNA processing and alternative splicing. snxA(Hrb) (1) is nonessential, its deletion phenocopies the snxA1 mutation, and its overexpression rescues snxA1 and ΔsnxA mutant phenotypes. snxA1 and a second allele isolated in this study, snxA2, are hypomorphic mutations that result from decreased transcript and protein levels, suggesting that snxA acts normally to restrain cell cycle progression. SNXA(HRB1) is predominantly nuclear, but is not retained in the nucleus during the partially closed mitosis of A. nidulans. We show that the snxA1 mutation does not suppress nimX2 by altering NIMX2(CDC2)/NIME(CYCLINB) kinase activity and that snxA1 or ΔsnxA alter localization patterns of NIME(CYCLINB) at the restrictive temperatures for snxA1 and nimX2. Together, these findings suggest a novel and previously unreported role of an SR/RRM family protein in cell cycle regulation, specifically in control of the CDK1 mitotic induction pathway. PMID:25104516

  18. Differential expression and ligand binding indicate alternative functions for zebrafish polymeric immunoglobulin receptor (pIgR) and a family of pIgR-like (PIGRL) proteins

    PubMed Central

    Kortum, Amanda N.; Rodriguez-Nunez, Ivan; Yang, Jibing; Shim, Juyoung; Runft, Donna; O’Driscoll, Marci L; Haire, Robert N.; Cannon, John P.; Turner, Poem M.; Litman, Ronda T.; Kim, Carol H.; Neely, Melody N.; Litman, Gary W.; Yoder, Jeffrey A.


    The polymeric immunoglobulin (Ig) receptor (pIgR) is an integral transmembrane glycoprotein that plays an important role in the mammalian immune response by transporting soluble polymeric Igs across mucosal epithelial cells. Single pIgR genes, which are expressed in lymphoid organs including mucosal tissues, have been identified in several teleost species. A single pigr gene has been identified on zebrafish chromosome 2 along with a large multigene family consisting of 29 pigr-like (PIGRL) genes. Full length transcripts from 10 different PIGRL genes that encode secreted and putative inhibitory membrane bound receptors have been characterized. Although PIGRL and pigr transcripts are detected in immune tissues, only PIGRL transcripts can be detected in lymphoid and myeloid cells. In contrast to pIgR which binds Igs, certain PIGRL proteins bind phospholipids. PIGRL transcript levels are increased after infection with Streptococcus iniae, suggesting a role for PIGRL genes during bacterial challenge. Transcript levels of PIGRL genes are decreased after infection with Snakehead rhabdovirus, suggesting that viral infection may suppress PIGRL function. PMID:24469064

  19. When is protein binding important?


    Heuberger, Jules; Schmidt, Stephan; Derendorf, Hartmut


    The present paper is an ode to a classic citation by Benet and Hoener (2002. Clin Pharm Ther 71(3):115-121). The now classic paper had a huge impact on drug development and the way the issue of protein binding is perceived and interpreted. Although the authors very clearly pointed out the limitations and underlying assumptions for their delineations, these are too often overlooked and the classic paper's message is misinterpreted by broadening to cases that were not intended. Some members of the scientific community concluded from the paper that protein binding is not important. This was clearly not intended by the authors, as they finished their paper with a paragraph entitled: "When is protein binding important?" Misinterpretation of the underlying assumptions in the classic work can result in major pitfalls in drug development. Therefore, we revisit the topic of protein binding with the intention of clarifying when clinically relevant changes should be considered during drug development. PMID:23650013

  20. Molecular characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) gene family from Citrus and the effect of fruit load on their expression

    PubMed Central

    Shalom, Liron; Shlizerman, Lyudmila; Zur, Naftali; Doron-Faigenboim, Adi; Blumwald, Eduardo; Sadka, Avi


    We recently identified a Citrus gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor that contained a sequence complementary to miR156. Genes of the SPL family are known to play a role in flowering regulation and phase transition. In Citrus, the mRNA levels of the gene were significantly altered by fruit load in buds; under heavy fruit load (ON-Crop trees), known to suppress next year flowering, the mRNA levels were down-regulated, while fruit removal (de-fruiting), inducing next-year flowering, resulted in its up-regulation. In the current work, we set on to study the function of the gene. We showed that the Citrus SPL was able promote flowering independently of photoperiod in Arabidopsis, while miR156 repressed its flowering-promoting activity. In order to find out if fruit load affected the expression of additional genes of the SPL family, we identified and classified all SPL members in the Citrus genome, and studied their seasonal expression patterns in buds and leaves, and in response to de-fruiting. Results showed that two additional SPL-like genes and miR172, known to be induced by SPLs in Arabidopsis, were altered by fruit load. The relationships between these factors in relation to the fruit-load effect on Citrus flowering are discussed. PMID:26074947

  1. Molecular characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) gene family from Citrus and the effect of fruit load on their expression.


    Shalom, Liron; Shlizerman, Lyudmila; Zur, Naftali; Doron-Faigenboim, Adi; Blumwald, Eduardo; Sadka, Avi


    We recently identified a Citrus gene encoding SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor that contained a sequence complementary to miR156. Genes of the SPL family are known to play a role in flowering regulation and phase transition. In Citrus, the mRNA levels of the gene were significantly altered by fruit load in buds; under heavy fruit load (ON-Crop trees), known to suppress next year flowering, the mRNA levels were down-regulated, while fruit removal (de-fruiting), inducing next-year flowering, resulted in its up-regulation. In the current work, we set on to study the function of the gene. We showed that the Citrus SPL was able promote flowering independently of photoperiod in Arabidopsis, while miR156 repressed its flowering-promoting activity. In order to find out if fruit load affected the expression of additional genes of the SPL family, we identified and classified all SPL members in the Citrus genome, and studied their seasonal expression patterns in buds and leaves, and in response to de-fruiting. Results showed that two additional SPL-like genes and miR172, known to be induced by SPLs in Arabidopsis, were altered by fruit load. The relationships between these factors in relation to the fruit-load effect on Citrus flowering are discussed. PMID:26074947

  2. Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a northern european family population

    PubMed Central


    Background Fatty acid-binding proteins (FABPs) play regulatory roles at the nexus of lipid metabolism and signaling. Dyslipidemia in clinical manifestation frequently co-occurs with obesity, insulin resistance and hypertension in the Metabolic Syndrome (MetS). Animal studies have suggested FABPs play regulatory roles in expressing MetS phenotypes. In our family cohort of Northern European descent, transcript levels in peripheral white blood cells (PWBCs) of a key FABPs, FABP3, is correlated with the MetS leading components. However, evidence supporting the functions of FABPs in humans using genetic approaches has been scarce, suggesting FABPs may be under epigenetic regulation. The objective of this study was to test the hypothesis that CpG methylation status of a key regulator of lipid homeostasis, FABP3, is a quantitative trait associated with status of MetS phenotypes in humans. Methods We used a mass-spec based quantitative method, EpiTYPER®, to profile a CpG island that extends from the promoter to the first exon of the FABP3 gene in our family-based cohort of Northern European descent (n=517). We then conducted statistical analysis of the quantitative relationship of CpG methylation and MetS measures following the variance-component association model. Heritability of each methylation and the effect of age and sex on CpG methylation were also assessed in our families. Results We find that methylation levels of individual CpG units and the regional average are heritable and significantly influenced by age and sex. Regional methylation was strongly associated with plasma total cholesterol (p=0.00028) and suggestively associated with LDL-cholesterol (p=0.00495). Methylation at individual units was significantly associated with insulin sensitivity, lipid particle sizing and diastolic blood pressure (p<0.0028, corrected for multiple testing for each trait). Peripheral white blood cell (PWBC) expression of FABP3 in a separate group of subjects (n=128) negatively

  3. Restraint of the G2/M Transition by the SR/RRM Family mRNA Shuttling Binding Protein SNXAHRB1 in Aspergillus nidulans

    PubMed Central

    James, Steven W.; Banta, Travis; Barra, James; Ciraku, Lorela; Coile, Clifford; Cuda, Zach; Day, Ryan; Dixit, Cheshil; Eastlack, Steven; Giang, Anh; Goode, James; Guice, Alexis; Huff, Yulon; Humbert, Sara; Kelliher, Christina; Kobie, Julie; Kohlbrenner, Emily; Mwambutsa, Faustin; Orzechowski, Amanda; Shingler, Kristin; Spell, Casey; Anglin, Sarah Lea


    Control of the eukaryotic G2/M transition by CDC2/CYCLINB is tightly regulated by protein–protein interactions, protein phosphorylations, and nuclear localization of CDC2/CYCLINB. We previously reported a screen, in Aspergillus nidulans, for extragenic suppressors of nimX2cdc2 that resulted in the identification of the cold-sensitive snxA1 mutation. We demonstrate here that snxA1 suppresses defects in regulators of the CDK1 mitotic induction pathway, including nimX2cdc2, nimE6cyclinB, and nimT23cdc25, but does not suppress G2-arresting nimA1/nimA5 mutations, the S-arresting nimE10cyclinB mutation, or three other G1/S phase mutations. snxA encodes the A. nidulans homolog of Saccharomyces cerevisiae Hrb1/Gbp2; nonessential shuttling messenger RNA (mRNA)-binding proteins belonging to the serine-arginine-rich (SR) and RNA recognition motif (RRM) protein family; and human heterogeneous ribonucleoprotein-M, a spliceosomal component involved in pre-mRNA processing and alternative splicing. snxAHrb1 is nonessential, its deletion phenocopies the snxA1 mutation, and its overexpression rescues snxA1 and ΔsnxA mutant phenotypes. snxA1 and a second allele isolated in this study, snxA2, are hypomorphic mutations that result from decreased transcript and protein levels, suggesting that snxA acts normally to restrain cell cycle progression. SNXAHRB1 is predominantly nuclear, but is not retained in the nucleus during the partially closed mitosis of A. nidulans. We show that the snxA1 mutation does not suppress nimX2 by altering NIMX2CDC2/NIMECYCLINB kinase activity and that snxA1 or ΔsnxA alter localization patterns of NIMECYCLINB at the restrictive temperatures for snxA1 and nimX2. Together, these findings suggest a novel and previously unreported role of an SR/RRM family protein in cell cycle regulation, specifically in control of the CDK1 mitotic induction pathway. PMID:25104516

  4. Homologues of the 24-kDa flagellar Ca(2+)-binding protein gene of Trypanosoma cruzi are present in other members of the Trypanosomatidae family.


    Maldonado, R A; Linss, J; Thomaz, N; Olson, C L; Engman, D M; Goldenberg, S


    A full-length cDNA encoding the 24-kDa flagellar Ca(2+)-binding protein (FCaBP) of the Dm28c clone of Trypanosoma cruzi was cloned and characterized. Comparison of the deduced amino acid sequence with those of the FCaBPs of other T. cruzi strains revealed greater than 97% sequence conservation. FCaBP-like genes are found in Trypanosoma conorhini, Trypanosoma freitasi, Trypanosoma lewisi, Herpetomonas megaseliae, Leptomonas seymouri, and Phytomonas serpens, but not in Crithidia deanei, Leishmania amazonensis, or Endotrypanum schaudinni: Among various T. cruzi strains, FCaBP genes are located on chromosomes of different size, although all strains possess multiple FCaBP genes organized as tandemly arranged gene families. Northern and Western blot analyses revealed that FCaBP mRNAs are produced in all organisms possessing FCaBP-hybridizing sequences, indicating that expression of FCaBP or an FCaBP-like protein is common to a number of trypanosomatid species. PMID:9225770

  5. Signal transduction by guanine nucleotide binding proteins.


    Spiegel, A M


    High affinity binding of guanine nucleotides and the ability to hydrolyze bound GTP to GDP are characteristics of an extended family of intracellular proteins. Subsets of this family include cytosolic initiation and elongation factors involved in protein synthesis, and cytoskeletal proteins such as tubulin (Hughes, S.M. (1983) FEBS Lett. 164, 1-8). A distinct subset of guanine nucleotide binding proteins is membrane-associated; members of this subset include the ras gene products (Ellis, R.W. et al. (1981) Nature 292, 506-511) and the heterotrimeric G-proteins (also termed N-proteins) (Gilman, A.G. (1984) Cell 36, 577-579). Substantial evidence indicates that G-proteins act as signal transducers by coupling receptors (R) to effectors (E). A similar function has been suggested but not proven for the ras gene products. Known G-proteins include Gs and Gi, the G-proteins associated with stimulation and inhibition, respectively, of adenylate cyclase; transducin (TD), the G-protein coupling rhodopsin to cGMP phosphodiesterase in rod photoreceptors (Bitensky, M.W. et al. (1981) Curr. Top. Membr. Transp. 15, 237-271; Stryer, L. (1986) Annu. Rev. Neurosci. 9, 87-119), and Go, a G-protein of unknown function that is highly abundant in brain (Sternweis, P.C. and Robishaw, J.D. (1984) J. Biol. Chem. 259, 13806-13813; Neer, E.J. et al. (1984) J. Biol. Chem. 259, 14222-14229). G-proteins also participate in other signal transduction pathways, notably that involving phosphoinositide breakdown. In this review, I highlight recent progress in our understanding of the structure, function, and diversity of G-proteins. PMID:2435586

  6. Landscape of protein-small ligand binding modes.


    Kasahara, Kota; Kinoshita, Kengo


    Elucidating the mechanisms of specific small-molecule (ligand) recognition by proteins is a long-standing conundrum. While the structures of these molecules, proteins and ligands, have been extensively studied, protein-ligand interactions, or binding modes, have not been comprehensively analyzed. Although methods for assessing similarities of binding site structures have been extensively developed, the methods for the computational treatment of binding modes have not been well established. Here, we developed a computational method for encoding the information about binding modes as graphs, and assessing their similarities. An all-against-all comparison of 20,040 protein-ligand complexes provided the landscape of the protein-ligand binding modes and its relationships with protein- and chemical spaces. While similar proteins in the same SCOP Family tend to bind relatively similar ligands with similar binding modes, the correlation between ligand and binding similarities was not very high (R(2)  = 0.443). We found many pairs with novel relationships, in which two evolutionally distant proteins recognize dissimilar ligands by similar binding modes (757,474 pairs out of 200,790,780 pairs were categorized into this relationship, in our dataset). In addition, there were an abundance of pairs of homologous proteins binding to similar ligands with different binding modes (68,217 pairs). Our results showed that many interesting relationships between protein-ligand complexes are still hidden in the structure database, and our new method for assessing binding mode similarities is effective to find them. PMID:27327045

  7. Adenomatous polyposis coli (APC) membrane recruitment 3, a member of the APC membrane recruitment family of APC-binding proteins, is a positive regulator of Wnt-β-catenin signalling.


    Brauburger, Katharina; Akyildiz, Senem; Ruppert, Jan G; Graeb, Michael; Bernkopf, Dominic B; Hadjihannas, Michel V; Behrens, Jürgen


    The adenomatous polyposis coli (APC) membrane recruitment (Amer) family proteins Amer1/Wilms tumour gene on the X chromosome and Amer2 are binding partners of the APC tumour suppressor protein, and act as negative regulators in the Wnt signalling cascade. So far, nothing has been known about the third member of the family, Amer3. Here we show that Amer3 binds to the armadillo repeat domain of APC, similarly to Amer1 and Amer2. Amer3 also binds to the Wnt pathway regulator conductin/axin2. Furthermore, we identified Amer1 as binding partner of Amer3. Whereas Amer1 and Amer2 are linked to the plasma membrane by an N-terminal membrane localization domain, Amer3 lacks this domain. Amer3 localizes to the cytoplasm and nucleus of epithelial cells, and this is dependent on specific nuclear import and export sequences. Functionally, exogenous Amer3 enhances the expression of a β-catenin/T-cell factor-dependent reporter gene, and knockdown of endogenous Amer3 reduces Wnt target gene expression in colorectal cancer cells. Thus, Amer3 acts as an activator of Wnt signalling, in contrast to Amer1 and Amer2, which are inhibitors, suggesting a nonredundant role of Amer proteins in the regulation of this pathway. Our data, together with those of previous studies, provide a comprehensive picture of similarities and differences within the Amer protein family. PMID:24251807

  8. The prion protein binds thiamine.


    Perez-Pineiro, Rolando; Bjorndahl, Trent C; Berjanskii, Mark V; Hau, David; Li, Li; Huang, Alan; Lee, Rose; Gibbs, Ebrima; Ladner, Carol; Dong, Ying Wei; Abera, Ashenafi; Cashman, Neil R; Wishart, David S


    Although highly conserved throughout evolution, the exact biological function of the prion protein is still unclear. In an effort to identify the potential biological functions of the prion protein we conducted a small-molecule screening assay using the Syrian hamster prion protein [shPrP(90-232)]. The screen was performed using a library of 149 water-soluble metabolites that are known to pass through the blood-brain barrier. Using a combination of 1D NMR, fluorescence quenching and surface plasmon resonance we identified thiamine (vitamin B1) as a specific prion ligand with a binding constant of ~60 μM. Subsequent studies showed that this interaction is evolutionarily conserved, with similar binding constants being seen for mouse, hamster and human prions. Various protein construct lengths, both with and without the unstructured N-terminal region in the presence and absence of copper, were examined. This indicates that the N-terminus has no influence on the protein's ability to interact with thiamine. In addition to thiamine, the more biologically abundant forms of vitamin B1 (thiamine monophosphate and thiamine diphosphate) were also found to bind the prion protein with similar affinity. Heteronuclear NMR experiments were used to determine thiamine's interaction site, which is located between helix 1 and the preceding loop. These data, in conjunction with computer-aided docking and molecular dynamics, were used to model the thiamine-binding pharmacophore and a comparison with other thiamine binding proteins was performed to reveal the common features of interaction. PMID:21848803

  9. A C-terminal motif found in the β2-adrenergic receptor, P2Y1 receptor and cystic fibrosis transmembrane conductance regulator determines binding to the Na+/H+ exchanger regulatory factor family of PDZ proteins

    PubMed Central

    Hall, Randy A.; Ostedgaard, Lynda S.; Premont, Richard T.; Blitzer, Jeremy T.; Rahman, Nadeem; Welsh, Michael J.; Lefkowitz, Robert J.


    The Na+/H+ exchanger regulatory factor (NHERF) binds to the tail of the β2-adrenergic receptor and plays a role in adrenergic regulation of Na+/H+ exchange. NHERF contains two PDZ domains, the first of which is required for its interaction with the β2 receptor. Mutagenesis studies of the β2 receptor tail revealed that the optimal C-terminal motif for binding to the first PDZ domain of NHERF is D-S/T-x-L, a motif distinct from those recognized by other PDZ domains. The first PDZ domain of NHERF-2, a protein that is 52% identical to NHERF and also known as E3KARP, SIP-1, and TKA-1, exhibits binding preferences very similar to those of the first PDZ domain of NHERF. The delineation of the preferred binding motif for the first PDZ domain of the NHERF family of proteins allows for predictions for other proteins that may interact with NHERF or NHERF-2. For example, as would be predicted from the β2 receptor tail mutagenesis studies, NHERF binds to the tail of the purinergic P2Y1 receptor, a seven-transmembrane receptor with an intracellular C-terminal tail ending in D-T-S-L. NHERF also binds to the tail of the cystic fibrosis transmembrane conductance regulator, which ends in D-T-R-L. Because the preferred binding motif of the first PDZ domain of the NHERF family of proteins is found at the C termini of a variety of intracellular proteins, NHERF and NHERF-2 may be multifunctional adaptor proteins involved in many previously unsuspected aspects of intracellular signaling. PMID:9671706

  10. Cellulose binding domain fusion proteins


    Shoseyov, O.; Yosef, K.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 16 figs.

  11. Cellulose binding domain fusion proteins


    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc A.; Doi, Roy H.


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  12. Global discovery of protein kinases and other nucleotide-binding proteins by mass spectrometry.


    Xiao, Yongsheng; Wang, Yinsheng


    Nucleotide-binding proteins, such as protein kinases, ATPases and GTP-binding proteins, are among the most important families of proteins that are involved in a number of pivotal cellular processes. However, global study of the structure, function, and expression level of nucleotide-binding proteins as well as protein-nucleotide interactions can hardly be achieved with the use of conventional approaches owing to enormous diversity of the nucleotide-binding protein family. Recent advances in mass spectrometry (MS) instrumentation, coupled with a variety of nucleotide-binding protein enrichment methods, rendered MS-based proteomics a powerful tool for the comprehensive characterizations of the nucleotide-binding proteome, especially the kinome. Here, we review the recent developments in the use of mass spectrometry, together with general and widely used affinity enrichment approaches, for the proteome-wide capture, identification and quantification of nucleotide-binding proteins, including protein kinases, ATPases, GTPases, and other nucleotide-binding proteins. The working principles, advantages, and limitations of each enrichment platform in identifying nucleotide-binding proteins as well as profiling protein-nucleotide interactions are summarized. The perspectives in developing novel MS-based nucleotide-binding protein detection platform are also discussed. © 2014 Wiley Periodicals, Inc. Mass Spec Rev 35:601-619, 2016. PMID:25376990

  13. The 2.2 Å resolution crystal structure of Bacillus cereus Nif3-family protein YqfO reveals a conserved dimetal-binding motif and a regulatory domain

    PubMed Central

    Godsey, Michael H.; Minasov, George; Shuvalova, Ludmilla; Brunzelle, Joseph S.; Vorontsov, Ivan I.; Collart, Frank R.; Anderson, Wayne F.


    YqfO of Bacillus cereus is a member of the widespread Nif3 family of proteins, which has been highlighted as an important target for structural genomics. The N- and C-terminal domains are conserved across the family and contain a dimetal-binding motif in a putative active site. YqfO contains an insert in the middle of the protein, present in a minority of bacterial family members. The structure of YqfO was determined at a resolution of 2.2 Å and reveals conservation of the putative active site. It also reveals the previously unknown structure of the insert, which despite extremely limited sequence conservation, bears great similarity to PII, CutA, and a number of other trimeric regulatory proteins. Our results suggest that this domain acts as a signal sensor to regulate the still-unknown catalytic activity of the more-conserved domains. PMID:17586767


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Basic Transcription Element Binding Protein-1 (BTEB1) functionally interacts with Progesterone Receptor (PR) to mediate progestin sensitivity of target genes in the uterine endometrium. Female mice null for the BTEB1 gene are sub-fertile, due in part, to reduced numbers of successfully implanting em...

  15. Genes encoding proteins with peritrophin A-type chitin-binding domains in Tribolium castaneum are grouped into three distinct families based on phylogeny, expression and function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study is focused on the characterization and expression of genes in the red flour beetle, Tribolium castaneum, encoding proteins that possess six-cysteine-containing chitin-binding domains (CBDs) related to the peritrophin A domain (ChtBD2). An exhaustive bioinformatics search of the genome of...

  16. RNA binding protein and binding site useful for expression of recombinant molecules


    Mayfield, Stephen


    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  17. RNA binding protein and binding site useful for expression of recombinant molecules


    Mayfield, Stephen P.


    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  18. Protein binding assay for hyaluronate

    SciTech Connect

    Lacy, B.E.; Underhill, C.B.


    A relatively quick and simple assay for hyaluronate was developed using the specific binding protein, hyaluronectin. The hyaluronectin was obtained by homogenizing the brains of Sprague-Dawley rats, and then centrifuging the homogenate. The resulting supernatant was used as a source of crude hyaluronectin. In the binding assay, the hyaluronectin was mixed with (/sup 3/H)hyaluronate, followed by an equal volume of saturated (NH/sub 4/)/sub 2/SO/sub 4/, which precipitated the hyaluronectin and any (/sup 3/H)hyaluronate associated with it, but left free (/sup 3/H)hyaluronate in solution. The mixture was then centrifuged, and the amount of bound (/sup 3/H)hyaluronate in the precipitate was determined. Using this assay, the authors found that hyaluronectin specifically bound hyaluronate, since other glycosaminoglycans failed to compete for the binding protein. In addition, the interaction between hyaluronectin and hyaluronate was of relatively high affinity, and the size of the hyaluronate did not appear to substantially alter the amount of binding. To determine the amount of hyaluronate in an unknown sample, they used a competition assay in which the binding of a set amount of (/sup 3/H)hyaluronate was blocked by the addition of unlabeled hyaluronate. By comparing the degree of competition of the unknown samples with that of known amounts of hyaluronate, it was possible to determine the amount of hyaluronate in the unknowns. They have found that this method is sensitive to 1 or less of hyaluronate, and is unaffected by the presence of proteins.

  19. The N-terminal Domain of Drosophila Gram-negative Binding Protein 3 (GNBP3) Defines a Novel Family of Fungal Pattern Recognition Receptors*

    PubMed Central

    Mishima, Yumiko; Quintin, Jessica; Aimanianda, Vishukumar; Kellenberger, Christine; Coste, Franck; Clavaud, Cecile; Hetru, Charles; Hoffmann, Jules A.; Latgé, Jean-Paul; Ferrandon, Dominique; Roussel, Alain


    Gram-negative binding protein 3 (GNBP3), a pattern recognition receptor that circulates in the hemolymph of Drosophila, is responsible for sensing fungal infection and triggering Toll pathway activation. Here, we report that GNBP3 N-terminal domain binds to fungi upon identifying long chains of β-1,3-glucans in the fungal cell wall as a major ligand. Interestingly, this domain fails to interact strongly with short oligosaccharides. The crystal structure of GNBP3-Nter reveals an immunoglobulin-like fold in which the glucan binding site is masked by a loop that is highly conserved among glucan-binding proteins identified in several insect orders. Structure-based mutagenesis experiments reveal an essential role for this occluding loop in discriminating between short and long polysaccharides. The displacement of the occluding loop is necessary for binding and could explain the specificity of the interaction with long chain structured polysaccharides. This represents a novel mechanism for β-glucan recognition. PMID:19692333

  20. Erythropoietin binding protein from mammalian serum


    Clemons, G.K.


    Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described. 11 figs.

  1. Erythropoietin binding protein from mammalian serum


    Clemons, Gisela K.


    Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described.

  2. Bacterial periplasmic sialic acid-binding proteins exhibit a conserved binding site

    SciTech Connect

    Gangi Setty, Thanuja; Cho, Christine; Govindappa, Sowmya; Apicella, Michael A.; Ramaswamy, S.


    Structure–function studies of sialic acid-binding proteins from F. nucleatum, P. multocida, V. cholerae and H. influenzae reveal a conserved network of hydrogen bonds involved in conformational change on ligand binding. Sialic acids are a family of related nine-carbon sugar acids that play important roles in both eukaryotes and prokaryotes. These sialic acids are incorporated/decorated onto lipooligosaccharides as terminal sugars in multiple bacteria to evade the host immune system. Many pathogenic bacteria scavenge sialic acids from their host and use them for molecular mimicry. The first step of this process is the transport of sialic acid to the cytoplasm, which often takes place using a tripartite ATP-independent transport system consisting of a periplasmic binding protein and a membrane transporter. In this paper, the structural characterization of periplasmic binding proteins from the pathogenic bacteria Fusobacterium nucleatum, Pasteurella multocida and Vibrio cholerae and their thermodynamic characterization are reported. The binding affinities of several mutations in the Neu5Ac binding site of the Haemophilus influenzae protein are also reported. The structure and the thermodynamics of the binding of sugars suggest that all of these proteins have a very well conserved binding pocket and similar binding affinities. A significant conformational change occurs when these proteins bind the sugar. While the C1 carboxylate has been identified as the primary binding site, a second conserved hydrogen-bonding network is involved in the initiation and stabilization of the conformational states.

  3. A Crayfish Insulin-like-binding Protein

    PubMed Central

    Rosen, Ohad; Weil, Simy; Manor, Rivka; Roth, Ziv; Khalaila, Isam; Sagi, Amir


    Across the animal kingdom, the involvement of insulin-like peptide (ILP) signaling in sex-related differentiation processes is attracting increasing attention. Recently, a gender-specific ILP was identified as the androgenic sex hormone in Crustacea. However, moieties modulating the actions of this androgenic insulin-like growth factor were yet to be revealed. Through molecular screening of an androgenic gland (AG) cDNA library prepared from the crayfish Cherax quadricarinatus, we have identified a novel insulin-like growth factor-binding protein (IGFBP) termed Cq-IGFBP. Based on bioinformatics analyses, the deduced Cq-IGFBP was shown to share high sequence homology with IGFBP family members from both invertebrates and vertebrates. The protein also includes a sequence determinant proven crucial for ligand binding, which according to three-dimensional modeling is assigned to the exposed outer surface of the protein. Recombinant Cq-IGFBP (rCq-IGFBP) protein was produced and, using a “pulldown” methodology, was shown to specifically interact with the insulin-like AG hormone of the crayfish (Cq-IAG). Particularly, using both mass spectral analysis and an immunological tool, rCq-IGFBP was shown to bind the Cq-IAG prohormone. Furthermore, a peptide corresponding to residues 23–38 of the Cq-IAG A-chain was found sufficient for in vitro recognition by rCq-IGFBP. Cq-IGFBP is the first IGFBP family member shown to specifically interact with a gender-specific ILP. Unlike their ILP ligands, IGFBPs are highly conserved across evolution, from ancient arthropods, like crustaceans, to humans. Such conservation places ILP signaling at the center of sex-related phenomena in early animal development. PMID:23775079

  4. AU-rich RNA binding proteins in hematopoiesis and leukemogenesis.


    Baou, Maria; Norton, John D; Murphy, John J


    Posttranscriptional mechanisms are now widely acknowledged to play a central role in orchestrating gene-regulatory networks in hematopoietic cell growth, differentiation, and tumorigenesis. Although much attention has focused on microRNAs as regulators of mRNA stability/translation, recent data have highlighted the role of several diverse classes of AU-rich RNA-binding protein in the regulation of mRNA decay/stabilization. AU-rich elements are found in the 3'-untranslated region of many mRNAs that encode regulators of cell growth and survival, such as cytokines and onco/tumor-suppressor proteins. These are targeted by a burgeoning number of different RNA-binding proteins. Three distinct types of AU-rich RNA binding protein (ARE poly-U-binding degradation factor-1/AUF1, Hu antigen/HuR/HuA/ELAVL1, and the tristetraprolin/ZFP36 family of proteins) are essential for normal hematopoiesis. Together with 2 further AU-rich RNA-binding proteins, nucleolin and KHSRP/KSRP, the functions of these proteins are intimately associated with pathways that are dysregulated in various hematopoietic malignancies. Significantly, all of these AU-rich RNA-binding proteins function via an interconnected network that is integrated with microRNA functions. Studies of these diverse types of RNA binding protein are providing novel insight into gene-regulatory mechanisms in hematopoiesis in addition to offering new opportunities for developing mechanism-based targeted therapeutics in leukemia and lymphoma. PMID:21917750

  5. EMSA Analysis of DNA Binding By Rgg Proteins

    PubMed Central

    LaSarre, Breah; Federle, Michael J.


    In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases).

  6. A novel zinc-binding motif found in two ubiquitous deaminase families.

    PubMed Central

    Reizer, J.; Buskirk, S.; Bairoch, A.; Reizer, A.; Saier, M. H.


    Two families of deaminases, one specific for cytidine, the other for deoxycytidylate, are shown to possess a novel zinc-binding motif, here designated ZBS. We have (1) identified the protein members of these 2 families, (2) carried out sequence analyses that allow specification of this zinc-binding motif, and (3) determined signature sequences that will allow identification of additional members of these families as their sequences become available. PMID:8061614

  7. Calcium-binding proteins and development

    NASA Technical Reports Server (NTRS)

    Beckingham, K.; Lu, A. Q.; Andruss, B. F.; McIntire, L. V. (Principal Investigator)


    The known roles for calcium-binding proteins in developmental signaling pathways are reviewed. Current information on the calcium-binding characteristics of three classes of cell-surface developmental signaling proteins (EGF-domain proteins, cadherins and integrins) is presented together with an overview of the intracellular pathways downstream of these surface receptors. The developmental roles delineated to date for the universal intracellular calcium sensor, calmodulin, and its targets, and for calcium-binding regulators of the cytoskeleton are also reviewed.

  8. Sampling the membrane: function of rhomboid-family proteins.


    Lemberg, Marius K


    Rhomboids constitute a conserved protein superfamily that specifically binds membrane proteins and directs them into various different cellular pathways ranging from regulated secretion to endoplasmic reticulum (ER)-associated degradation (ERAD). Rhomboid proteases are known to release protein domains from membranes by a cut in their membrane anchor, whereas an emerging new class of rhomboid-family proteins lacks key catalytic residues and is not proteolytically active. Recent work has shown that these rhomboid pseudoproteases, including iRhoms and derlins, bind membrane proteins to regulate their fate, but the underlying molecular mechanism is not known. This review summarizes recent advances in the molecular understanding of rhomboid-family proteins and discusses common principles in how they recognize and bind proteins in the plane of the membrane. PMID:23369641

  9. The detection of DNA-binding proteins by protein blotting.

    PubMed Central

    Bowen, B; Steinberg, J; Laemmli, U K; Weintraub, H


    A method, called "protein blotting," for the detection of DNA-binding proteins is described. Proteins are separated on an SDA-polyacrylamide gel. The gel is sandwiched between 2 nitrocellulose filters and the proteins allowed to diffuse out of the gel and onto the filters. The proteins are tightly bound to each filter, producing a replica of the original gel pattern. The replica is used to detect DNA-binding proteins, RNA-binding proteins or histone-binding proteins by incubation of the filter with [32P]DNA, [125I]RNA, or [125I] histone. Evidence is also presented that specific protein-DNA interactions may be detected by this technique; under appropriate conditions, the lac repressor binds only to DNA containing the lac operator. Strategies for the detection of specific protein-DNA interactions are discussed. Images PMID:6243775

  10. Purification of an oligo(dG).oligo(dC)-binding sea urchin nuclear protein, suGF1: a family of G-string factors involved in gene regulation during development.


    Hapgood, J; Patterton, D


    Contiguous deoxyguanosine residues (G strings) have been implicated in regulation of gene expression in several organisms via the binding of G-string factors. Regulation of expression of the chicken adult beta-globin gene may involve the interplay between binding of an erythrocyte-specific G-string factor, BGP1, and the stability of a positioned nucleosome (C. D. Lewis, S. P. Clark, G. Felsenfeld, and H. Gould, Genes Dev. 2:863-873, 1988). We have purified a 59.5-kDa nuclear protein (suGF1) from sea urchin embryos by DNA affinity chromatography. suGF1 has high binding affinity and specificity for oligo(dG).oligo(dC). The identity of the purified protein was confirmed by renaturation of sequence-specific DNA-binding activity from a sodium dodecyl sulfate-polyacrylamide gel slice and by Southwestern (DNA-protein) blotting. suGF1 binds in vitro to a G11 string present in the H1-H4 intergenic region of a sea urchin early histone gene battery. This suGF1 DNA recognition site occurs within a homopurine-homopyrimidine stretch previously shown to be incorporated into a positioned nucleosome core in vitro. DNase I footprinting shows that suGF1 protects the same base pairs on the promoter of the chicken beta A-globin gene as does BGP1. We show that a G-string cis-regulatory element of a sea urchin cell lineage-specific gene LpS1 (M. Xiang, S.-Y. Lu, M. Musso, G. Karsenty, and W. H. Klein, Development 113:1345-1355, 1991) also represents a high-affinity recognition site for suGF1. suGF1 may be a member of a family of G-string factors involved in the regulation of expression of unrelated genes during development of a number of different organisms. PMID:8289815

  11. Purification of an oligo(dG).oligo(dC)-binding sea urchin nuclear protein, suGF1: a family of G-string factors involved in gene regulation during development.

    PubMed Central

    Hapgood, J; Patterton, D


    Contiguous deoxyguanosine residues (G strings) have been implicated in regulation of gene expression in several organisms via the binding of G-string factors. Regulation of expression of the chicken adult beta-globin gene may involve the interplay between binding of an erythrocyte-specific G-string factor, BGP1, and the stability of a positioned nucleosome (C. D. Lewis, S. P. Clark, G. Felsenfeld, and H. Gould, Genes Dev. 2:863-873, 1988). We have purified a 59.5-kDa nuclear protein (suGF1) from sea urchin embryos by DNA affinity chromatography. suGF1 has high binding affinity and specificity for oligo(dG).oligo(dC). The identity of the purified protein was confirmed by renaturation of sequence-specific DNA-binding activity from a sodium dodecyl sulfate-polyacrylamide gel slice and by Southwestern (DNA-protein) blotting. suGF1 binds in vitro to a G11 string present in the H1-H4 intergenic region of a sea urchin early histone gene battery. This suGF1 DNA recognition site occurs within a homopurine-homopyrimidine stretch previously shown to be incorporated into a positioned nucleosome core in vitro. DNase I footprinting shows that suGF1 protects the same base pairs on the promoter of the chicken beta A-globin gene as does BGP1. We show that a G-string cis-regulatory element of a sea urchin cell lineage-specific gene LpS1 (M. Xiang, S.-Y. Lu, M. Musso, G. Karsenty, and W. H. Klein, Development 113:1345-1355, 1991) also represents a high-affinity recognition site for suGF1. suGF1 may be a member of a family of G-string factors involved in the regulation of expression of unrelated genes during development of a number of different organisms. Images PMID:8289815

  12. Haptenation: Chemical Reactivity and Protein Binding

    PubMed Central

    Chipinda, Itai; Hettick, Justin M.; Siegel, Paul D.


    Low molecular weight chemical (LMW) allergens are commonly referred to as haptens. Haptens must complex with proteins to be recognized by the immune system. The majority of occupationally related haptens are reactive, electrophilic chemicals, or are metabolized to reactive metabolites that form covalent bonds with nucleophilic centers on proteins. Nonelectrophilic protein binding may occur through disulfide exchange, coordinate covalent binding onto metal ions on metalloproteins or of metal allergens, themselves, to the major histocompatibility complex. Recent chemical reactivity kinetic studies suggest that the rate of protein binding is a major determinant of allergenic potency; however, electrophilic strength does not seem to predict the ability of a hapten to skew the response between Th1 and Th2. Modern proteomic mass spectrometry methods that allow detailed delineation of potential differences in protein binding sites may be valuable in predicting if a chemical will stimulate an immediate or delayed hypersensitivity. Chemical aspects related to both reactivity and protein-specific binding are discussed. PMID:21785613

  13. Calmodulin Binding Proteins and Alzheimer's Disease.


    O'Day, Danton H; Eshak, Kristeen; Myre, Michael A


    The small, calcium-sensor protein, calmodulin, is ubiquitously expressed and central to cell function in all cell types. Here the literature linking calmodulin to Alzheimer's disease is reviewed. Several experimentally-verified calmodulin-binding proteins are involved in the formation of amyloid-β plaques including amyloid-β protein precursor, β-secretase, presenilin-1, and ADAM10. Many others possess potential calmodulin-binding domains that remain to be verified. Three calmodulin binding proteins are associated with the formation of neurofibrillary tangles: two kinases (CaMKII, CDK5) and one protein phosphatase (PP2B or calcineurin). Many of the genes recently identified by genome wide association studies and other studies encode proteins that contain putative calmodulin-binding domains but only a couple (e.g., APOE, BIN1) have been experimentally confirmed as calmodulin binding proteins. At least two receptors involved in calcium metabolism and linked to Alzheimer's disease (mAchR; NMDAR) have also been identified as calmodulin-binding proteins. In addition to this, many proteins that are involved in other cellular events intimately associated with Alzheimer's disease including calcium channel function, cholesterol metabolism, neuroinflammation, endocytosis, cell cycle events, and apoptosis have been tentatively or experimentally verified as calmodulin binding proteins. The use of calmodulin as a potential biomarker and as a therapeutic target is discussed. PMID:25812852

  14. The anti-toxin ParD of plasmid RK2 consists of two structurally distinct moieties and belongs to the ribbon-helix-helix family of DNA-binding proteins.

    PubMed Central

    Oberer, Monika; Zangger, Klaus; Prytulla, Stefan; Keller, Walter


    NMR and CD spectroscopy have been used to characterize, both structurally and dynamically, the 82-amino-acid ParD protein of the post-segregational killing module of the broad-host-range plasmid RP4/RK2. ParD occurs as a dimer in solution and exercises two different control functions; an autoregulatory function by binding to its own promoter P(parDE) and a plasmid-stabilizing function by inhibiting ParE toxicity in cells that express ParD and ParE. Analysis of the secondary structure based on the chemical-shift indices, sequential nuclear Overhauser enhancements (NOEs) and (3)J(Halpha-NH) scalar coupling constants showed that the N-terminal domain of ParD consists of a short beta-ribbon followed by three alpha-helices, demonstrating that ParD contains a ribbon-helix-helix fold, a DNA-binding motif found in a family of small prokaryotic repressors. (15)N longitudinal (T(1)) and transverse (T(2)) relaxation measurements and hetero nuclear NOEs showed that ParD is divided into two separate domains, a well-ordered N-terminal domain and a very flexible C-terminal domain. An increase in secondary structure was observed upon addition of trifluoroethanol, suggested to result from the formation of structured stretches in the C-terminal part of the protein. This is the first experimental evidence that the DNA-binding domain of ParD belongs to the ribbon-helix-helix fold family, and this structural motif is proposed to be present in functionally similar antidote proteins. PMID:11743881

  15. Partial characterization of a proacrosin binding protein.


    Yi, L S; Runion, C M; Willand, J L; Polakoski, K L


    All of the acid (pH 4.0) extracted proacrosin from porcine epididymal spermatozoa was found to be tightly associated with a specific protein referred to as the binding protein. A combination of gel filterations and gel electrophoresis revealed that the binding protein is composed of a major 28 kd and a minor 29 kd protein. Both of the proteins were shown to be nonproteolytic by gelatin SDS-PAGE analysis and the amino acid composition analysis of the purified 28 kd protein revealed that it is not related to the proteolytic component of the proacrosinacrosin system. PMID:1519775

  16. Mercury-binding proteins of Mytilus edulis

    SciTech Connect

    Roesijadi, G.; Morris, J.E.; Calabrese, A.


    Mytilus edulis possesses low molecular weight, mercury-binding proteins. The predominant protein isolated from gill tissue is enriched in cysteinyl residues (8%) and possesses an amino acid composition similar to cadmium-binding proteins of mussels and oysters. Continuous exposure of mussels to 5 mercury results in spillover of mercury from these proteins to high molecular weight proteins. Antibodies to these proteins have been isolated, and development of immunoassays is presently underway. Preliminary studies to determine whether exposure of adult mussels to mercury will result in induction of mercury-binding proteins in offspring suggest that such proteins occur in larvae although additional studies are indicated for a conclusive demonstration.

  17. Natural ligand binding and transfer from liver fatty acid binding protein (LFABP) to membranes.


    De Gerónimo, Eduardo; Hagan, Robert M; Wilton, David C; Córsico, Betina


    Liver fatty acid-binding protein (LFABP) is distinctive among fatty acid-binding proteins because it binds more than one molecule of long-chain fatty acid and a variety of diverse ligands. Also, the transfer of fluorescent fatty acid analogues to model membranes under physiological ionic strength follows a different mechanism compared to most of the members of this family of intracellular lipid binding proteins. Tryptophan insertion mutants sensitive to ligand binding have allowed us to directly measure the binding affinity, ligand partitioning and transfer to model membranes of natural ligands. Binding of fatty acids shows a cooperative mechanism, while acyl-CoAs binding presents a hyperbolic behavior. Saturated fatty acids seem to have a stronger partition to protein vs. membranes, compared to unsaturated fatty acids. Natural ligand transfer rates are more than 200-fold higher compared to fluorescently-labeled analogues. Interestingly, oleoyl-CoA presents a markedly different transfer behavior compared to the rest of the ligands tested, probably indicating the possibility of specific targeting of ligands to different metabolic fates. PMID:20541621

  18. Computational Prediction of RNA-Binding Proteins and Binding Sites

    PubMed Central

    Si, Jingna; Cui, Jing; Cheng, Jin; Wu, Rongling


    Proteins and RNA interaction have vital roles in many cellular processes such as protein synthesis, sequence encoding, RNA transfer, and gene regulation at the transcriptional and post-transcriptional levels. Approximately 6%–8% of all proteins are RNA-binding proteins (RBPs). Distinguishing these RBPs or their binding residues is a major aim of structural biology. Previously, a number of experimental methods were developed for the determination of protein–RNA interactions. However, these experimental methods are expensive, time-consuming, and labor-intensive. Alternatively, researchers have developed many computational approaches to predict RBPs and protein–RNA binding sites, by combining various machine learning methods and abundant sequence and/or structural features. There are three kinds of computational approaches, which are prediction from protein sequence, prediction from protein structure, and protein-RNA docking. In this paper, we review all existing studies of predictions of RNA-binding sites and RBPs and complexes, including data sets used in different approaches, sequence and structural features used in several predictors, prediction method classifications, performance comparisons, evaluation methods, and future directions. PMID:26540053

  19. The molecular architecture of protein-protein binding sites.


    Reichmann, Dana; Rahat, Ofer; Cohen, Mati; Neuvirth, Hani; Schreiber, Gideon


    The formation of specific protein interactions plays a crucial role in most, if not all, biological processes, including signal transduction, cell regulation, the immune response and others. Recent advances in our understanding of the molecular architecture of protein-protein binding sites, which facilitates such diversity in binding affinity and specificity, are enabling us to address key questions. What is the amino acid composition of binding sites? What are interface hotspots? How are binding sites organized? What are the differences between tight and weak interacting complexes? How does water contribute to binding? Can the knowledge gained be translated into protein design? And does a universal code for binding exist, or is it the architecture and chemistry of the interface that enable diverse but specific binding solutions? PMID:17239579

  20. Characterizing the morphology of protein binding patches.


    Malod-Dognin, Noël; Bansal, Achin; Cazals, Frédéric


    Let the patch of a partner in a protein complex be the collection of atoms accounting for the interaction. To improve our understanding of the structure-function relationship, we present a patch model decoupling the topological and geometric properties. While the geometry is classically encoded by the atomic positions, the topology is recorded in a graph encoding the relative position of concentric shells partitioning the interface atoms. The topological-geometric duality provides the basis of a generic dynamic programming-based algorithm comparing patches at the shell level, which may favor topological or geometric features. On the biological side, we address four questions, using 249 cocrystallized heterodimers organized in biological families. First, we dissect the morphology of binding patches and show that Nature enjoyed the topological and geometric degrees of freedom independently while retaining a finite set of qualitatively distinct topological signatures. Second, we argue that our shell-based comparison is effective to perform atomic-level comparisons and show that topological similarity is a less stringent than geometric similarity. We also use the topological versus geometric duality to exhibit topo-rigid patches, whose topology (but not geometry) remains stable upon docking. Third, we use our comparison algorithms to infer specificity-related information amidst a database of complexes. Finally, we exhibit a descriptor outperforming its contenders to predict the binding affinities of the affinity benchmark. The softwares developed with this article are availablefrom PMID:22806945

  1. Antibacterial properties of the sperm-binding proteins and peptides of human epididymis 2 (HE2) family; salt sensitivity, structural dependence and their interaction with outer and cytoplasmic membranes of Escherichia coli.

    PubMed Central

    Yenugu, Suresh; Hamil, Katherine G; Birse, Charles E; Ruben, Steven M; French, Frank S; Hall, Susan H


    During passage through the epididymis, sperm interact with secreted epididymal proteins that promote maturation, including the acquisition of motility and fertilization competence. Viewed previously as distinct from sperm maturation, host defence capabilities are now recognized functions of the human epididymis 2 (HE2) family of sperm-binding proteins. We analysed the potent dose and time-dependent bactericidal activity of recombinant HE2alpha, HE2beta1 and HE2beta2 and found that the full-length proteins (10 microg/ml or approximately 1 microM) caused more than a 50% decrease in Escherichia coli colony forming units within 15 min. By contrast, human beta-defensin-1, at a similar concentration, required more than 90 min to exhibit similar antibacterial activity. The epididymis-specific lipocalin, LCN6, failed to kill bacteria. Higher concentrations (25-100 microg/ml) of HE2 proteins and a longer duration of treatment resulted in near total inhibition of bacterial growth. The C-terminal peptides of HE2alpha, HEbeta1 and HEbeta2 proteins exhibited antibacterial activity similar to their full-length counterparts, indicating that the antibacterial activity of HE2 proteins resides in these C-terminal regions. Antibacterial activities of HE2 proteins and peptides were slightly inhibited by NaCl concentrations of up to 150 mM, while human beta-defensin-1 activity was nearly eliminated. Reduction and alkylation of disulphide bonds in HE2 proteins and their C-terminal peptides abolished their antibacterial activity. Consistent with the ability to kill bacteria, full-length HE2 proteins and C-terminal peptides caused rapid dose-dependent permeabilization of outer and cytoplasmic E. coli membranes. A much longer exposure time was required for human beta-defensin-1-mediated permeabilization of membranes, suggesting a possible difference in mode of action compared with the HE2 antibacterial peptides. PMID:12628001

  2. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.


    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  3. Lamin-Binding Proteins in Caenorhabditis elegans.


    Dobrzynska, Agnieszka; Askjaer, Peter; Gruenbaum, Yosef


    The nuclear lamina, composed of lamins and numerous lamin-associated proteins, is required for mechanical stability, mechanosensing, chromatin organization, developmental gene regulation, mRNA transcription, DNA replication, nuclear assembly, and nuclear positioning. Mutations in lamins or lamin-binding proteins cause at least 18 distinct human diseases that affect specific tissues such as muscle, adipose, bone, nerve, or skin, and range from muscular dystrophies to lipodystrophy, peripheral neuropathy, or accelerated aging. Caenorhabditis elegans has unique advantages in studying lamin-binding proteins. These advantages include the low complexity of genes encoding lamin and lamin-binding proteins, advanced transgenic techniques, simple application of RNA interference, sophisticated genetic strategies, and a large collection of mutant lines. This chapter provides detailed and comprehensive protocols for the genetic and phenotypic analysis of lamin-binding proteins in C. elegans. PMID:26778571

  4. Two Novel Mutations in Myosin Binding Protein C Slow Causing Distal Arthrogryposis Type 2 in Two Large Han Chinese Families May Suggest Important Functional Role of Immunoglobulin Domain C2

    PubMed Central

    Li, Xuefu; Zhong, Bomeng; Han, Weitian; Zhao, Ning; Liu, Wei; Sui, Yu; Wang, Yawen; Lu, Yongping; Wang, Hong; Li, Jianxin; Jiang, Miao


    Distal arthrogryposes (DAs) are a group of disorders that mainly involve the distal parts of the limbs and at least ten different DAs have been described to date. DAs are mostly described as autosomal dominant disorders with variable expressivity and incomplete penetrance, but recently autosomal recessive pattern was reported in distal arthrogryposis type 5D. Mutations in the contractile genes are found in about 50% of all DA patients. Of these genes, mutations in the gene encoding myosin binding protein C slow MYBPC1 were recently identified in two families with distal arthrogryposis type 1B. Here, we described two large Chinese families with autosomal dominant distal arthrogryposis type 2(DA2) with incomplete penetrance and variable expressivity. Some unique overextension contractures of the lower limbs and some distinctive facial features were present in our DA2 pedigrees. We performed follow-up DNA sequencing after linkage mapping and first identified two novel MYBPC1 mutations (c.1075G>A [p.E359K] and c.956C>T [p.P319L]) responsible for these Chinese DA2 families of which one introduced by germline mosacism. Each mutation was found to cosegregate with the DA2 phenotype in each family but not in population controls. Both substitutions occur within C2 immunoglobulin domain, which together with C1 and the M motif constitute the binding site for the S2 subfragment of myosin. Our results expand the phenotypic spectrum of MYBPC1-related arthrogryposis multiplex congenita (AMC). We also proposed the possible molecular mechanisms that may underlie the pathogenesis of DA2 myopathy associated with these two substitutions in MYBPC1. PMID:25679999

  5. The liver fatty acid binding protein--comparison of cavity properties of intracellular lipid-binding proteins.


    Thompson, J; Ory, J; Reese-Wagoner, A; Banaszak, L


    The crystal and solution structures of all of the intracellular lipid binding proteins (iLBPs) reveal a common beta-barrel framework with only small local perturbations. All existing evidence points to the binding cavity and a poorly delimited 'portal' region as defining the function of each family member. The importance of local structure within the cavity appears to be its influence on binding affinity and specificity for the lipid. The portal region appears to be involved in the regulation of ligand exchange. Within the iLBP family, liver fatty acid binding protein or LFABP, has the unique property of binding two fatty acids within its internalized binding cavity rather than the commonly observed stoichiometry of one. Furthermore, LFABP will bind hydrophobic molecules larger than the ligands which will associate with other iLBPs. The crystal structure of LFABP contains two bound oleate molecules and provides the explanation for its unusual stoichiometry. One of the bound fatty acids is completely internalized and has its carboxylate interacting with an arginine and two serines. The second oleate represents an entirely new binding mode with the carboxylate on the surface of LFABP. The two oleates also interact with each other. Because of this interaction and its inner location, it appears the first oleate must be present before the second more external molecule is bound. PMID:10331654

  6. Interferon (IFN) Consensus Sequence-binding Protein, a Transcription Factor of the IFN Regulatory Factor Family, Regulates Immune Responses In Vivo through Control of Interleukin 12 Expression

    PubMed Central

    Giese, Nathalia A.; Gabriele, Lucia; Doherty, T. Mark; Klinman, Dennis M.; Tadesse-Heath, Lekidelu; Contursi, Christina; Epstein, Suzanne L.; Morse, Herbert C.


    Mice with a null mutation of the gene encoding interferon consensus sequence-binding protein (ICSBP) develop a chronic myelogenous leukemia-like syndrome and mount impaired responses to certain viral and bacterial infections. To gain a mechanistic understanding of the contributions of ICSBP to humoral and cellular immunity, we characterized the responses of control and ICSBP−/− mice to infection with influenza A (flu) and Leishmania major (L. major). Mice of both genotypes survived infections with flu, but differed markedly in the isotype distribution of antiflu antibodies. In sera of normal mice, immunoglobulin (Ig)G2a antibodies were dominant over IgG1 antibodies, a pattern indicative of a T helper cell type 1 (Th1)-driven response. In sera of ICSBP−/− mice, however, IgG1 antibodies dominated over IgG2a antibodies, a pattern indicative of a Th2-driven response. The dominance of IgG1 and IgE over IgG2a was detected in the sera of uninfected mice as well. A seeming Th2 bias of ICSBP-deficient mice was also uncovered in their inability to control infection with L. major, where resistance is known to be dependent on IL-12 and IFN-γ as components of a Th1 response. Infected ICSBP-deficient mice developed fulminant, disseminated leishmaniasis as a result of failure to mount a Th1-mediated curative response, although T cells remained capable of secreting IFN-γ and macrophages of producing nitric oxide. Compromised Th1 differentiation in ICSBP−/− mice could not be attributed to hyporesponsiveness of CD4+ T cells to interleukin (IL)-12; however, the ability of uninfected and infected ICSBP-deficient mice to produce IL-12 was markedly impaired. This indicates that ICSBP is a deciding factor in Th responses governing humoral and cellular immunity through its role in regulating IL-12 expression. PMID:9348311

  7. Recent improvements to Binding MOAD: a resource for protein-ligand binding affinities and structures.


    Ahmed, Aqeel; Smith, Richard D; Clark, Jordan J; Dunbar, James B; Carlson, Heather A


    For over 10 years, Binding MOAD (Mother of All Databases; has been one of the largest resources for high-quality protein-ligand complexes and associated binding affinity data. Binding MOAD has grown at the rate of 1994 complexes per year, on average. Currently, it contains 23,269 complexes and 8156 binding affinities. Our annual updates curate the data using a semi-automated literature search of the references cited within the PDB file, and we have recently upgraded our website and added new features and functionalities to better serve Binding MOAD users. In order to eliminate the legacy application server of the old platform and to accommodate new changes, the website has been completely rewritten in the LAMP (Linux, Apache, MySQL and PHP) environment. The improved user interface incorporates current third-party plugins for better visualization of protein and ligand molecules, and it provides features like sorting, filtering and filtered downloads. In addition to the field-based searching, Binding MOAD now can be searched by structural queries based on the ligand. In order to remove redundancy, Binding MOAD records are clustered in different families based on 90% sequence identity. The new Binding MOAD, with the upgraded platform, features and functionalities, is now equipped to better serve its users. PMID:25378330

  8. Correlated rigid modes in protein families

    NASA Astrophysics Data System (ADS)

    Striegel, D. A.; Wojtowicz, D.; Przytycka, T. M.; Periwal, V.


    A great deal of evolutionarily conserved information is contained in genomes and proteins. Enormous effort has been put into understanding protein structure and developing computational tools for protein folding, and many sophisticated approaches take structure and sequence homology into account. Several groups have applied statistical physics approaches to extracting information about proteins from sequences alone. Here, we develop a new method for sequence analysis based on first principles, in information theory, in statistical physics and in Bayesian analysis. We provide a complete derivation of our approach and we apply it to a variety of systems, to demonstrate its utility and its limitations. We show in some examples that phylogenetic alignments of amino-acid sequences of families of proteins imply the existence of a small number of modes that appear to be associated with correlated global variation. These modes are uncovered efficiently in our approach by computing a non-perturbative effective potential directly from the alignment. We show that this effective potential approaches a limiting form inversely with the logarithm of the number of sequences. Mapping symbol entropy flows along modes to underlying physical structures shows that these modes arise due to correlated compensatory adjustments. In the protein examples, these occur around functional binding pockets.

  9. Correlated rigid modes in protein families.


    Striegel, D A; Wojtowicz, D; Przytycka, T M; Periwal, V


    A great deal of evolutionarily conserved information is contained in genomes and proteins. Enormous effort has been put into understanding protein structure and developing computational tools for protein folding, and many sophisticated approaches take structure and sequence homology into account. Several groups have applied statistical physics approaches to extracting information about proteins from sequences alone. Here, we develop a new method for sequence analysis based on first principles, in information theory, in statistical physics and in Bayesian analysis. We provide a complete derivation of our approach and we apply it to a variety of systems, to demonstrate its utility and its limitations. We show in some examples that phylogenetic alignments of amino-acid sequences of families of proteins imply the existence of a small number of modes that appear to be associated with correlated global variation. These modes are uncovered efficiently in our approach by computing a non-perturbative effective potential directly from the alignment. We show that this effective potential approaches a limiting form inversely with the logarithm of the number of sequences. Mapping symbol entropy flows along modes to underlying physical structures shows that these modes arise due to correlated compensatory adjustments. In the protein examples, these occur around functional binding pockets. PMID:27063781

  10. Binding Preferences for GPIHBP1, a GPI-Anchored Protein of Capillary Endothelial Cells

    PubMed Central

    Gin, Peter; Beigneux, Anne P.; Voss, Constance; Davies, Brandon S. J.; Beckstead, Jennifer A.; Ryan, Robert O.; Bensadoun, Andre; Fong, Loren G.; Young, Stephen G.


    Objective GPIHBP1, a glycosylphosphatidylinositol-anchored Ly6 protein of capillary endothelial cells, binds lipoprotein lipase (LPL) avidly, but its ability to bind related lipase family members has never been evaluated. We sought to define the ability of GPIHBP1 to bind other lipase family members as well as other apolipoproteins and lipoproteins. Methods and Results As judged by cell-based and cell-free binding assays, LPL binds to GPIHBP1 but other members of the lipase family do not. We also examined the binding of apoAV–phospholipid disks to GPIHBP1. ApoAV binds avidly to GPIHBP1-transfected cells; this binding requires GPIHBP1’s amino-terminal acidic domain and is independent of its cysteine-rich Ly6 domain (the latter domain is essential for LPL binding). GPIHBP1-transfected cells did not bind HDL. Chylomicrons binds avidly to GPIHBP1-transfected CHO cells, but this binding is dependent on GPIHBP1’s ability to bind LPL within the cell culture medium. Conclusions GPIHBP1 binds LPL but does not bind other lipase family members. GPIHBP1 binds apoAV but did not bind apoAI or HDL. The ability of GPIHBP1-transfected CHO cells to bind chylomicrons is mediated by LPL; chylomicron binding does not occur unless GPIHBP1 first captures LPL from the cell culture medium. PMID:20966398

  11. Family 42 carbohydrate-binding modules display multiple arabinoxylan-binding interfaces presenting different ligand affinities.


    Ribeiro, Teresa; Santos-Silva, Teresa; Alves, Victor D; Dias, Fernando M V; Luís, Ana S; Prates, José A M; Ferreira, Luís M A; Romão, Maria J; Fontes, Carlos M G A


    Enzymes that degrade plant cell wall polysaccharides display a modular architecture comprising a catalytic domain bound to one or more non-catalytic carbohydrate-binding modules (CBMs). CBMs display considerable variation in primary structure and are grouped into 59 sequence-based families organized in the Carbohydrate-Active enZYme (CAZy) database. Here we report the crystal structure of CtCBM42A together with the biochemical characterization of two other members of family 42 CBMs from Clostridium thermocellum. CtCBM42A, CtCBM42B and CtCBM42C bind specifically to the arabinose side-chains of arabinoxylans and arabinan, suggesting that various cellulosomal components are targeted to these regions of the plant cell wall. The structure of CtCBM42A displays a beta-trefoil fold, which comprises 3 sub-domains designated as alpha, beta and gamma. Each one of the three sub-domains presents a putative carbohydrate-binding pocket where an aspartate residue located in a central position dominates ligand recognition. Intriguingly, the gamma sub-domain of CtCBM42A is pivotal for arabinoxylan binding, while the concerted action of beta and gamma sub-domains of CtCBM42B and CtCBM42C is apparently required for ligand sequestration. Thus, this work reveals that the binding mechanism of CBM42 members is in contrast with that of homologous CBM13s where recognition of complex polysaccharides results from the cooperative action of three protein sub-domains presenting similar affinities. PMID:20637315

  12. Affinity purification of proteins binding to GST fusion proteins.


    Swaffield, J C; Johnston, S A


    This unit describes the use of proteins fused to glutathione-S-transferase (GST fusion proteins) to affinity purify other proteins, a technique also known as GST pulldown purification. The describes a strategy in which a GST fusion protein is bound to agarose affinity beads and the complex is then used to assay the binding of a specific test protein that has been labeled with [35S]methionine by in vitro translation. However, this method can be adapted for use with other types of fusion proteins; for example, His6, biotin tags, or maltose-binding protein fusions (MBP), and these may offer particular advantages. A describes preparation of an E. coli extract that is added to the reaction mixture with purified test protein to reduce nonspecific binding. PMID:18265191

  13. Fatty Acid- and Retinoid-binding Proteins Have Distinct Binding Pockets for the Two Types of Cargo*

    PubMed Central

    Jordanova, Rositsa; Groves, Matthew R.; Kostova, Elena; Woltersdorf, Christian; Liebau, Eva; Tucker, Paul A.


    Parasitic nematodes cause serious diseases in humans, animals, and plants. They have limited lipid metabolism and are reliant on lipid-binding proteins to acquire these metabolites from their hosts. Several structurally novel families of lipid-binding proteins in nematodes have been described, including the fatty acid- and retinoid-binding protein family (FAR). In Caenorhabditis elegans, used as a model for studying parasitic nematodes, eight C. elegans FAR proteins have been described. The crystal structure of C. elegans FAR-7 is the first structure of a FAR protein, and it exhibits a novel fold. It differs radically from the mammalian fatty acid-binding proteins and has two ligand binding pockets joined by a surface groove. The first can accommodate the aliphatic chain of fatty acids, whereas the second can accommodate the bulkier retinoids. In addition to demonstrating lipid binding by fluorescence spectroscopy, we present evidence that retinol binding is positively regulated by casein kinase II phosphorylation at a conserved site near the bottom of the second pocket. far-7::GFP (green fluorescent protein) expression shows that it is localized in the head hypodermal syncytia and the excretory cell but that this localization changes under starvation conditions. In conclusion, our study provides the basic structural and functional information for investigation of inhibitors of lipid binding by FAR proteins. PMID:19828452

  14. Copper binding in the prion protein.


    Millhauser, Glenn L


    A conformational change of the prion protein is responsible for a class of neurodegenerative diseases called the transmissible spongiform encephalopathies that include mad cow disease and the human afflictions kuru and Creutzfeldt-Jakob disease. Despite the attention given to these diseases, the normal function of the prion protein in healthy tissue is unknown. Research over the past few years, however, demonstrates that the prion protein is a copper binding protein with high selectivity for Cu(2+). The structural features of the Cu(2+) binding sites have now been characterized and are providing important clues about the normal function of the prion protein and perhaps how metals or loss of protein function play a role in disease. The link between prion protein and copper may provide insight into the general, and recently appreciated, role of metals in neurodegenerative disease. PMID:14967054

  15. Memory binding and white matter integrity in familial Alzheimer's disease.


    Parra, Mario A; Saarimäki, Heini; Bastin, Mark E; Londoño, Ana C; Pettit, Lewis; Lopera, Francisco; Della Sala, Sergio; Abrahams, Sharon


    Binding information in short-term and long-term memory are functions sensitive to Alzheimer's disease. They have been found to be affected in patients who meet criteria for familial Alzheimer's disease due to the mutation E280A of the PSEN1 gene. However, only short-term memory binding has been found to be affected in asymptomatic carriers of this mutation. The neural correlates of this dissociation are poorly understood. The present study used diffusion tensor magnetic resonance imaging to investigate whether the integrity of white matter structures could offer an account. A sample of 19 patients with familial Alzheimer's disease, 18 asymptomatic carriers and 21 non-carrier controls underwent diffusion tensor magnetic resonance imaging, neuropsychological and memory binding assessment. The short-term memory binding task required participants to detect changes across two consecutive screens displaying arrays of shapes, colours, or shape-colour bindings. The long-term memory binding task was a Paired Associates Learning Test. Performance on these tasks were entered into regression models. Relative to controls, patients with familial Alzheimer's disease performed poorly on both memory binding tasks. Asymptomatic carriers differed from controls only in the short-term memory binding task. White matter integrity explained poor memory binding performance only in patients with familial Alzheimer's disease. White matter water diffusion metrics from the frontal lobe accounted for poor performance on both memory binding tasks. Dissociations were found in the genu of corpus callosum which accounted for short-term memory binding impairments and in the hippocampal part of cingulum bundle which accounted for long-term memory binding deficits. The results indicate that white matter structures in the frontal and temporal lobes are vulnerable to the early stages of familial Alzheimer's disease and their damage is associated with impairments in two memory binding functions known to

  16. Folding funnels, binding funnels, and protein function.

    PubMed Central

    Tsai, C. J.; Kumar, S.; Ma, B.; Nussinov, R.


    Folding funnels have been the focus of considerable attention during the last few years. These have mostly been discussed in the general context of the theory of protein folding. Here we extend the utility of the concept of folding funnels, relating them to biological mechanisms and function. In particular, here we describe the shape of the funnels in light of protein synthesis and folding; flexibility, conformational diversity, and binding mechanisms; and the associated binding funnels, illustrating the multiple routes and the range of complexed conformers. Specifically, the walls of the folding funnels, their crevices, and bumps are related to the complexity of protein folding, and hence to sequential vs. nonsequential folding. Whereas the former is more frequently observed in eukaryotic proteins, where the rate of protein synthesis is slower, the latter is more frequent in prokaryotes, with faster translation rates. The bottoms of the funnels reflect the extent of the flexibility of the proteins. Rugged floors imply a range of conformational isomers, which may be close on the energy landscape. Rather than undergoing an induced fit binding mechanism, the conformational ensembles around the rugged bottoms argue that the conformers, which are most complementary to the ligand, will bind to it with the equilibrium shifting in their favor. Furthermore, depending on the extent of the ruggedness, or of the smoothness with only a few minima, we may infer nonspecific, broad range vs. specific binding. In particular, folding and binding are similar processes, with similar underlying principles. Hence, the shape of the folding funnel of the monomer enables making reasonable guesses regarding the shape of the corresponding binding funnel. Proteins having a broad range of binding, such as proteolytic enzymes or relatively nonspecific endonucleases, may be expected to have not only rugged floors in their folding funnels, but their binding funnels will also behave similarly

  17. Sequence variation in ligand binding sites in proteins

    PubMed Central

    Magliery, Thomas J; Regan, Lynne


    Background The recent explosion in the availability of complete genome sequences has led to the cataloging of tens of thousands of new proteins and putative proteins. Many of these proteins can be structurally or functionally categorized from sequence conservation alone. In contrast, little attention has been given to the meaning of poorly-conserved sites in families of proteins, which are typically assumed to be of little structural or functional importance. Results Recently, using statistical free energy analysis of tetratricopeptide repeat (TPR) domains, we observed that positions in contact with peptide ligands are more variable than surface positions in general. Here we show that statistical analysis of TPRs, ankyrin repeats, Cys2His2 zinc fingers and PDZ domains accurately identifies specificity-determining positions by their sequence variation. Sequence variation is measured as deviation from a neutral reference state, and we present probabilistic and information theory formalisms that improve upon recently suggested methods such as statistical free energies and sequence entropies. Conclusion Sequence variation has been used to identify functionally-important residues in four selected protein families. With TPRs and ankyrin repeats, protein families that bind highly diverse ligands, the effect is so pronounced that sequence "hypervariation" alone can be used to predict ligand binding sites. PMID:16194281

  18. Astaxanthin binding protein in Atlantic salmon.


    Matthews, Sarah J; Ross, Neil W; Lall, Santosh P; Gill, Tom A


    The rubicund pigmentation in salmon and trout flesh is unique and is due to the deposition of dietary carotenoids, astaxanthin and canthaxanthin in the muscle. The present study was undertaken to determine which protein was responsible for pigment binding. Salmon muscle proteins were solubilized by sequential extractions with non-denaturing, low ionic strength aqueous solutions and segregated as such into six different fractions. Approximately 91% of the salmon myofibrillar proteins were solubilized under non-denaturing conditions using a protocol modified from a method described by Krishnamurthy et al. [Krishnamurthy, G., Chang, H.S., Hultin, H.O., Feng, Y., Srinivasan, S., Kelleher. S.D., 1996. Solubility of chicken breast muscle proteins in solutions of low ionic strength. J. Agric. Food Chem. 44: 408-415.] for the dissolution of avian muscle. To our knowledge, this is the first time this solubilization approach has been applied to the study of molecular interactions in myofibrillar proteins. Astaxanthin binding in each fraction was determined using an in vitro binding assay. In addition, SDS-PAGE and quantitative densitometry were used to separate and determine the relative amounts of each of the proteins in the six fractions. The results showed that alpha-actinin was the only myofibrillar protein correlating significantly (P<0.05) with astaxanthin binding. Alpha-actinin was positively identified using electrophoretic techniques and confirmed by tandem mass spectroscopy. Purified salmon alpha-actinin bound synthetic astaxanthin in a molar ratio of 1.11:1.00. The study was repeated using halibut alpha-actinin, which was found to have a molar binding ratio of astaxanthin to alpha-actinin of 0.893:1. These results suggest that the difference in pigmentation between white fish and Atlantic salmon is not due to binding capacity in the muscle, but rather differences in the metabolism or transport of pigment. PMID:16644255

  19. Sequence analysis of the AAA protein family.

    PubMed Central

    Beyer, A.


    The AAA protein family, a recently recognized group of Walker-type ATPases, has been subjected to an extensive sequence analysis. Multiple sequence alignments revealed the existence of a region of sequence similarity, the so-called AAA cassette. The borders of this cassette were localized and within it, three boxes of a high degree of conservation were identified. Two of these boxes could be assigned to substantial parts of the ATP binding site (namely, to Walker motifs A and B); the third may be a portion of the catalytic center. Phylogenetic trees were calculated to obtain insights into the evolutionary history of the family. Subfamilies with varying degrees of intra-relatedness could be discriminated; these relationships are also supported by analysis of sequences outside the canonical AAA boxes: within the cassette are regions that are strongly conserved within each subfamily, whereas little or even no similarity between different subfamilies can be observed. These regions are well suited to define fingerprints for subfamilies. A secondary structure prediction utilizing all available sequence information was performed and the result was fitted to the general 3D structure of a Walker A/GTPase. The agreement was unexpectedly high and strongly supports the conclusion that the AAA family belongs to the Walker superfamily of A/GTPases. PMID:9336829

  20. Aspects of Protein, Chemistry, Part II: Oxygen-Binding Proteins

    ERIC Educational Resources Information Center

    Nixon, J. E.


    Compares differences in function and behavior of two oxygen-binding proteins, myoglobin found in muscle and hemoglobin found in blood. Describes the mechanism of oxygen-binding and allosteric effect in hemoglobin; also describes the effect of pH on the affinity of hemoglobin for oxygen. (CS)

  1. Predicting Ca(2+)-binding sites in proteins.

    PubMed Central

    Nayal, M; Di Cera, E


    The coordination shell of Ca2+ ions in proteins contains almost exclusively oxygen atoms supported by an outer shell of carbon atoms. The bond-strength contribution of each ligating oxygen in the inner shell can be evaluated by using an empirical expression successfully applied in the analysis of crystals of metal oxides. The sum of such contributions closely approximates the valence of the bound cation. When a protein is embedded in a very fine grid of points and an algorithm is used to calculate the valence of each point representing a potential Ca(2+)-binding site, a typical distribution of valence values peaked around 0.4 is obtained. In 32 documented Ca(2+)-binding proteins, containing a total of 62 Ca(2+)-binding sites, a very small fraction of points in the distribution has a valence close to that of Ca2+. Only 0.06% of the points have a valence > or = 1.4. These points share the remarkable tendency to cluster around documented Ca2+ ions. A high enough value of the valence is both necessary (58 out of 62 Ca(2+)-binding sites have a valence > or = 1.4) and sufficient (87% of the grid points with a valence > or = 1.4 are within 1.0 A from a documented Ca2+ ion) to predict the location of bound Ca2+ ions. The algorithm can also be used for the analysis of other cations and predicts the location of Mg(2+)- and Na(+)-binding sites in a number of proteins. The valence is, therefore, a tool of pinpoint accuracy for locating cation-binding sites, which can also be exploited in engineering high-affinity binding sites and characterizing the linkage between structural components and functional energetics for molecular recognition of metal ions by proteins. Images Fig. 4 PMID:8290605

  2. Thiol Dioxygenases: Unique Families of Cupin Proteins

    PubMed Central

    Simmons, C. R.; Karplus, P. A.; Dominy, J. E.


    Proteins in the cupin superfamily have a wide range of biological functions in archaea, bacteria and eukaryotes. Although proteins in the cupin superfamily show very low overall sequence similarity, they all contain two short but partially conserved cupin sequence motifs separated by a less conserved intermotif region that varies both in length and amino acid sequence. Furthermore, these proteins all share a common architecture described as a 6-stranded β-barrel core, and this canonical cupin or “jelly roll” β-barrel is formed with cupin motif 1, the intermotif region, and cupin motif 2 each forming two of the core six β-strands in the folded protein structure. The recently obtained crystal structures of cysteine dioxygenase (CDO), with contains conserved cupin motifs, show that it has the predicted canonical cupin β-barrel fold. Although there had been no reports of CDO activity in prokaryotes, we identified a number of bacterial cupin proteins of unknown function that share low similarity with mammalian CDO and that conserve many residues in the active site pocket of CDO. Putative bacterial CDOs predicted to have CDO activity were shown to have similar substrate specificity and kinetic parameters as eukaryotic CDOs. Information gleaned from crystal structures of mammalian CDO along with sequence information for homologs shown to have CDO activity facilitated the identification of a CDO family fingerprint motif. One key feature of the CDO fingerprint motif is that the canonical metal-binding glutamate residue in cupin motif 1 is replaced by a cysteine (in mammalian CDOs) or by a glycine (bacterial CDOs). The recent report that some putative bacterial CDO homologs are actually 3-mercaptopropionate dioxygenases suggests that the CDO family may include proteins with specificities for other thiol substrates. A paralog of CDO in mammals was also identified and shown to be the other mammalian thiol dioxygenase, cysteamine dioxygenase (ADO). A tentative

  3. The stanniocalcin family of proteins.


    Wagner, Graham F; Dimattia, Gabriel E


    Stannniocalcin (STC) is a polypeptide hormone that was originally identified in bony fishes as a systemic regulator of mineral metabolism, and is best known for its regulatory effects on calcium/phosphate transport by the gills, gut and kidneys. The mammalian homolog to fish STC was discovered in 1995 and has resulted in progressively growing interest ever since as to its possible role in humans. Moreover, new discoveries in the mammalian STC field are resulting in significant reappraisals as to its role in fishes. Perhaps the most significant of these has been the discovery of a second gene encoding stanniocalcin-related protein, or STC-2, first in mammals and subsequently in fish. This review covers the comparative endocrinology of the STCs in fishes and mammals from the perspectives of structure, function and regulation. It then delves into some of the newer aspects of STC-1/STC-2 biology that have been uncovered using both classical and transgenic approaches. Of these, one of the most intriguing discoveries relates to the receptor-mediated sequestration of STC by target cell organelles. The functions of other newly discovered mammalian and fish STC variants are also discussed, as is the recent discovery of STC-related homologs in invertebrates. Based on our current state of knowledge, it is apparent that STC has an ancient lineage and that the STC family of proteins is proving to have significant roles in metabolism, reproduction and development. PMID:16902962

  4. Structural and Energetic Characterization of the Ankyrin Repeat Protein Family

    PubMed Central

    Parra, R. Gonzalo; Espada, Rocío; Verstraete, Nina; Ferreiro, Diego U.


    Ankyrin repeat containing proteins are one of the most abundant solenoid folds. Usually implicated in specific protein-protein interactions, these proteins are readily amenable for design, with promising biotechnological and biomedical applications. Studying repeat protein families presents technical challenges due to the high sequence divergence among the repeating units. We developed and applied a systematic method to consistently identify and annotate the structural repetitions over the members of the complete Ankyrin Repeat Protein Family, with increased sensitivity over previous studies. We statistically characterized the number of repeats, the folding of the repeat-arrays, their structural variations, insertions and deletions. An energetic analysis of the local frustration patterns reveal the basic features underlying fold stability and its relation to the functional binding regions. We found a strong linear correlation between the conservation of the energetic features in the repeat arrays and their sequence variations, and discuss new insights into the organization and function of these ubiquitous proteins. PMID:26691182

  5. Ice-Binding Proteins and Their Function.


    Bar Dolev, Maya; Braslavsky, Ido; Davies, Peter L


    Ice-binding proteins (IBPs) are a diverse class of proteins that assist organism survival in the presence of ice in cold climates. They have different origins in many organisms, including bacteria, fungi, algae, diatoms, plants, insects, and fish. This review covers the gamut of IBP structures and functions and the common features they use to bind ice. We discuss mechanisms by which IBPs adsorb to ice and interfere with its growth, evidence for their irreversible association with ice, and methods for enhancing the activity of IBPs. The applications of IBPs in the food industry, in cryopreservation, and in other technologies are vast, and we chart out some possibilities. PMID:27145844

  6. Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-binding Module*

    PubMed Central

    Taylor, Courtney B.; Talib, M. Faiz; McCabe, Clare; Bu, Lintao; Adney, William S.; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.


    Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3–6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function. PMID:22147693

  7. Computational Investigation of Glycosylation Effects on a Family 1 Carbohydrate-Binding Module

    SciTech Connect

    Taylor, C. B.; Talib, M. F.; McCabe, C.; Bu, L.; Adney, W. S.; Himmel, M. E.; Crowley, M. F.; Beckham, G. T.


    Carbohydrate-binding modules (CBMs) are ubiquitous components of glycoside hydrolases, which degrade polysaccharides in nature. CBMs target specific polysaccharides, and CBM binding affinity to cellulose is known to be proportional to cellulase activity, such that increasing binding affinity is an important component of performance improvement. To ascertain the impact of protein and glycan engineering on CBM binding, we use molecular simulation to quantify cellulose binding of a natively glycosylated Family 1 CBM. To validate our approach, we first examine aromatic-carbohydrate interactions on binding, and our predictions are consistent with previous experiments, showing that a tyrosine to tryptophan mutation yields a 2-fold improvement in binding affinity. We then demonstrate that enhanced binding of 3-6-fold over a nonglycosylated CBM is achieved by the addition of a single, native mannose or a mannose dimer, respectively, which has not been considered previously. Furthermore, we show that the addition of a single, artificial glycan on the anterior of the CBM, with the native, posterior glycans also present, can have a dramatic impact on binding affinity in our model, increasing it up to 140-fold relative to the nonglycosylated CBM. These results suggest new directions in protein engineering, in that modifying glycosylation patterns via heterologous expression, manipulation of culture conditions, or introduction of artificial glycosylation sites, can alter CBM binding affinity to carbohydrates and may thus be a general strategy to enhance cellulase performance. Our results also suggest that CBM binding studies should consider the effects of glycosylation on binding and function.

  8. Cellular Actions of Insulin-Like Growth Factor Binding Proteins

    PubMed Central

    Ferry, R. J.; Katz, L. E. L.; Grimberg, Adda; Cohen, P.; Weinzimer, S. A.


    The insulin-like growth factors (IGFs), insulin-like growth factor binding proteins (IGFBPs), and the IGFBP proteases are involved in the regulation of somatic growth and cellular proliferation both in vivo and in vitro. IGFs are potent mitogenic agents whose actions are determined by the availability of free IGFs to interact with the IGF receptors. IGFBPs comprise a family of proteins that bind IGFs with high affinity and specificity and thereby regulate IGF-dependent actions. IGFBPs have recently emerged as IGF-independent regulators of cell growth. Various IGFBP association proteins as well as cleavage of IGFBPs by specific proteases modulate levels of free IGFs and IGFBPs. The ubiquity and complexity of the IGF axis promise exciting discoveries and applications for the future. PMID:10226802

  9. The Binding of Plasmodium falciparum Adhesins and Erythrocyte Invasion Proteins to Aldolase Is Enhanced by Phosphorylation.


    Diaz, Suraya A; Martin, Stephen R; Howell, Steven A; Grainger, Munira; Moon, Robert W; Green, Judith L; Holder, Anthony A


    Aldolase has been implicated as a protein coupling the actomyosin motor and cell surface adhesins involved in motility and host cell invasion in the human malaria parasite Plasmodium falciparum. It binds to the cytoplasmic domain (CTD) of type 1 membrane proteins of the thrombospondin-related anonymous protein (TRAP) family. Other type 1 membrane proteins located in the apical organelles of merozoites, the form of the parasite that invades red blood cells, including apical membrane antigen 1 (AMA1) and members of the erythrocyte binding ligand (EBL) and reticulocyte binding homologue (RH) protein families have been implicated in host cell binding and invasion. Using a direct binding method we confirm that TRAP and merozoite TRAP (MTRAP) bind aldolase and show that the interaction is mediated by more than just the C-terminal six amino acid residues identified previously. Single amino acid substitutions in the MTRAP CTD abolished binding to aldolase. The CTDs of AMA1 and members of the EBL and RH protein families also bound to aldolase. MTRAP competed with AMA1 and RH4 for binding to aldolase, indicating overlapping binding sites. MTRAP CTD was phosphorylated in vitro by both calcium dependent kinase 1 (CDPK1) and protein kinase A, and this modification increased the affinity of binding to aldolase by ten-fold. Phosphorylation of the CTD of members of the EBL and RH protein families also increased their affinity for aldolase in some cases. To examine whether or not MTRAP expressed in asexual blood stage parasites is phosphorylated, it was tagged with GFP, purified and analysed, however no phosphorylation was detected. We propose that CTD binding to aldolase may be dynamically modulated by phosphorylation, and there may be competition for aldolase binding between different CTDs. The use and efficiency of alternate invasion pathways may be determined by the affinity of adhesins and cell invasion proteins for aldolase, in addition to their host ligand specificity. PMID

  10. Stretching DNA to quantify nonspecific protein binding

    NASA Astrophysics Data System (ADS)

    Goyal, Sachin; Fountain, Chandler; Dunlap, David; Family, Fereydoon; Finzi, Laura


    Nonspecific binding of regulatory proteins to DNA can be an important mechanism for target search and storage. This seems to be the case for the lambda repressor protein (CI), which maintains lysogeny after infection of E. coli. CI binds specifically at two distant regions along the viral genome and induces the formation of a repressive DNA loop. However, single-molecule imaging as well as thermodynamic and kinetic measurements of CI-mediated looping show that CI also binds to DNA nonspecifically and that this mode of binding may play an important role in maintaining lysogeny. This paper presents a robust phenomenological approach using a recently developed method based on the partition function, which allows calculation of the number of proteins bound nonspecific to DNA from measurements of the DNA extension as a function of applied force. This approach was used to analyze several cycles of extension and relaxation of λ DNA performed at several CI concentrations to measure the dissociation constant for nonspecific binding of CI (˜100 nM), and to obtain a measurement of the induced DNA compaction (˜10%) by CI.

  11. Periplasmic Binding Proteins in Thermophiles: Characterization and Potential Application of an Arginine-Binding Protein from Thermotoga maritima: A Brief Thermo-Story.


    Ausili, Alessio; Staiano, Maria; Dattelbaum, Jonathan; Varriale, Antonio; Capo, Alessandro; D'Auria, Sabato


    Arginine-binding protein from the extremophile Thermotoga maritima is a 27.7 kDa protein possessing the typical two-domain structure of the periplasmic binding proteins family. The protein is characterized by a very high specificity and affinity to bind to arginine, also at high temperatures. Due to its features, this protein could be taken into account as a potential candidate for the design of a biosensor for arginine. It is important to investigate the stability of proteins when they are used for biotechnological applications. In this article, we review the structural and functional features of an arginine-binding protein from the extremophile Thermotoga maritima with a particular eye on its potential biotechnological applications. PMID:25371336

  12. Functional interactions between polypyrimidine tract binding protein and PRI peptide ligand containing proteins.


    Coelho, Miguel B; Ascher, David B; Gooding, Clare; Lang, Emma; Maude, Hannah; Turner, David; Llorian, Miriam; Pires, Douglas E V; Attig, Jan; Smith, Christopher W J


    Polypyrimidine tract binding protein (PTBP1) is a heterogeneous nuclear ribonucleoprotein (hnRNP) that plays roles in most stages of the life-cycle of pre-mRNA and mRNAs in the nucleus and cytoplasm. PTBP1 has four RNA binding domains of the RNA recognition motif (RRM) family, each of which can bind to pyrimidine motifs. In addition, RRM2 can interact via its dorsal surface with proteins containing short peptide ligands known as PTB RRM2 interacting (PRI) motifs, originally found in the protein Raver1. Here we review our recent progress in understanding the interactions of PTB with RNA and with various proteins containing PRI ligands. PMID:27528752

  13. [Carbohydrate-binding proteins of marine invertebrates].


    Luk'ianov, P A; Chernikov, O V; Kobelev, S S; Chikalovets, I V; Molchanova, V I; Li, W


    The information on the carbohydrate specificity and molecular organization of some carbohydrate-binding proteins (lectins) of marine invertebrates is reported. Antiviral activity of some of the lectins against human immunodeficiency virus has been studied. Lectins of marine invertebrates are promising tools for studying natural glycoconjugates and cell effectors in vitro. PMID:17375673

  14. A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins

    PubMed Central

    MacPherson, Sarah; Larochelle, Marc; Turcotte, Bernard


    The trace element zinc is required for proper functioning of a large number of proteins, including various enzymes. However, most zinc-containing proteins are transcription factors capable of binding DNA and are named zinc finger proteins. They form one of the largest families of transcriptional regulators and are categorized into various classes according to zinc-binding motifs. This review focuses on one class of zinc finger proteins called zinc cluster (or binuclear) proteins. Members of this family are exclusively fungal and possess the well-conserved motif CysX2CysX6CysX5-12CysX2CysX6-8Cys. The cysteine residues bind to two zinc atoms, which coordinate folding of the domain involved in DNA recognition. The first- and best-studied zinc cluster protein is Gal4p, a transcriptional activator of genes involved in the catabolism of galactose in the budding yeast Saccharomyces cerevisiae. Since the discovery of Gal4p, many other zinc cluster proteins have been characterized; they function in a wide range of processes, including primary and secondary metabolism and meiosis. Other roles include regulation of genes involved in the stress response as well as pleiotropic drug resistance, as demonstrated in budding yeast and in human fungal pathogens. With the number of characterized zinc cluster proteins growing rapidly, it is becoming more and more apparent that they are important regulators of fungal physiology. PMID:16959962

  15. NMR Solution Structure and DNA Binding Model of the DNA Binding Domain of Competence Protein A

    PubMed Central

    Hobbs, Carey A.; Bobay, Benjamin G.; Thompson, Richele J.; Perego, Marta; Cavanagh, John


    Competence protein A (ComA) is a response regulator protein involved in the development of genetic competence in the Gram-positive spore forming bacterium Bacillus subtilis, as well as the regulation of the production of degradative enzymes and antibiotic synthesis. ComA belongs to the NarL family of proteins which are characterized by a C-terminal transcriptional activator domain that consists of a bundle of four helices, where the second and third helices (α8 and α9) form a helix-turn-helix DNA binding domain. Using NMR spectroscopy, the high resolution three-dimensional solution structure of the C-terminal DNA-binding domain of ComA (ComAC) has been determined. In addition, surface plasmon resonance and NMR protein-DNA titration experiments allowed for the analysis of the interaction of ComAC with its target DNA sequences. Combining the solution structure and biochemical data, a model of ComAC bound to the ComA recognition sequences on the srfA promoter has been developed. The model shows that for DNA binding, ComA uses the conserved helix-turn-helix motif present in other NarL family members. However, the model also reveals that ComA may use a slightly different part of the helix-turn-helix motif and there appears to be some associated domain re-orientation. These observations suggest a basis for DNA binding specificity within the NarL family. PMID:20302877

  16. Evolution of Protein-binding DNA Sequences through Competitive Binding

    NASA Astrophysics Data System (ADS)

    Peng, Weiqun; Gerland, Ulrich; Hwa, Terence; Levine, Herbert


    The dynamics of in vitro DNA evolution controlled via competitive binding of DNA sequences to proteins has been explored in a recent serial transfer experiment footnote B. Dubertret, S.Liu, Q. Ouyang, A. Libchaber, Phys. Rev. Lett. 86, 6022 (2001).. Motivated by the experiment, we investigate a continuum model for this evolution process in various parameter regimes. We establish a self-consistent mean-field evolution equation, determine its dynamical properties and finite population size corrections. In addition, we discuss the experimental implications of our results.

  17. Odorant-binding proteins in insects.


    Zhou, Jing-Jiang


    Our understanding of the molecular and biochemical mechanisms that mediate chemoreception in insects has been greatly improved after the discovery of olfactory and taste receptor proteins. However, after 50 years of the discovery of first insect sex pheromone from the silkmoth Bombyx mori, it is still unclear how hydrophobic compounds reach the dendrites of sensory neurons in vivo across aqueous space and interact with the sensory receptors. The presence of soluble polypeptides in high concentration in the lymph of chemosensilla still poses unanswered questions. More than two decades after their discovery and despite the wealth of structural and biochemical information available, the physiological function of odorant-binding proteins (OBPs) is not well understood. Here, I review the structural properties of different subclasses of insect OBPs and their binding to pheromones and other small ligands. Finally, I discuss current ideas and models on the role of such proteins in insect chemoreception. PMID:20831949

  18. Quantifying drug-protein binding in vivo.

    SciTech Connect

    Buchholz, B; Bench, G; Keating III, G; Palmblad, M; Vogel, J; Grant, P G; Hillegonds, D


    Accelerator mass spectrometry (AMS) provides precise quantitation of isotope labeled compounds that are bound to biological macromolecules such as DNA or proteins. The sensitivity is high enough to allow for sub-pharmacological (''micro-'') dosing to determine macromolecular targets without inducing toxicities or altering the system under study, whether it is healthy or diseased. We demonstrated an application of AMS in quantifying the physiologic effects of one dosed chemical compound upon the binding level of another compound in vivo at sub-toxic doses [4].We are using tissues left from this study to develop protocols for quantifying specific binding to isolated and identified proteins. We also developed a new technique to quantify nanogram to milligram amounts of isolated protein at precisions that are comparable to those for quantifying the bound compound by AMS.

  19. Disorder and function: a review of the dehydrin protein family.


    Graether, Steffen P; Boddington, Kelly F


    Dehydration proteins (dehydrins) are group 2 members of the late embryogenesis abundant (LEA) protein family. The protein architecture of dehydrins can be described by the presence of three types of conserved sequence motifs that have been named the K-, Y-, and S-segments. By definition, a dehydrin must contain at least one copy of the lysine-rich K-segment. Abiotic stresses such as drought, cold, and salinity cause the upregulation of dehydrin mRNA and protein levels. Despite the large body of genetic and protein evidence of the importance of these proteins in stress response, the in vivo protective mechanism is not fully known. In vitro experimental evidence from biochemical assays and localization experiments suggests multiple roles for dehydrins, including membrane protection, cryoprotection of enzymes, and protection from reactive oxygen species. Membrane binding by dehydrins is likely to be as a peripheral membrane protein, since the protein sequences are highly hydrophilic and contain many charged amino acids. Because of this, dehydrins in solution are intrinsically disordered proteins, that is, they have no well-defined secondary or tertiary structure. Despite their disorder, dehydrins have been shown to gain structure when bound to ligands such as membranes, and to possibly change their oligomeric state when bound to ions. We review what is currently known about dehydrin sequences and their structures, and examine the various ligands that have been shown to bind to this family of proteins. PMID:25400646

  20. Disorder and function: a review of the dehydrin protein family

    PubMed Central

    Graether, Steffen P.; Boddington, Kelly F.


    Dehydration proteins (dehydrins) are group 2 members of the late embryogenesis abundant (LEA) protein family. The protein architecture of dehydrins can be described by the presence of three types of conserved sequence motifs that have been named the K-, Y-, and S-segments. By definition, a dehydrin must contain at least one copy of the lysine-rich K-segment. Abiotic stresses such as drought, cold, and salinity cause the upregulation of dehydrin mRNA and protein levels. Despite the large body of genetic and protein evidence of the importance of these proteins in stress response, the in vivo protective mechanism is not fully known. In vitro experimental evidence from biochemical assays and localization experiments suggests multiple roles for dehydrins, including membrane protection, cryoprotection of enzymes, and protection from reactive oxygen species. Membrane binding by dehydrins is likely to be as a peripheral membrane protein, since the protein sequences are highly hydrophilic and contain many charged amino acids. Because of this, dehydrins in solution are intrinsically disordered proteins, that is, they have no well-defined secondary or tertiary structure. Despite their disorder, dehydrins have been shown to gain structure when bound to ligands such as membranes, and to possibly change their oligomeric state when bound to ions. We review what is currently known about dehydrin sequences and their structures, and examine the various ligands that have been shown to bind to this family of proteins. PMID:25400646

  1. The Protein 4.1 family: hub proteins in animals for organizing membrane proteins.


    Baines, Anthony J; Lu, Hui-Chun; Bennett, Pauline M


    Proteins of the 4.1 family are characteristic of eumetazoan organisms. Invertebrates contain single 4.1 genes and the Drosophila model suggests that 4.1 is essential for animal life. Vertebrates have four paralogues, known as 4.1R, 4.1N, 4.1G and 4.1B, which are additionally duplicated in the ray-finned fish. Protein 4.1R was the first to be discovered: it is a major mammalian erythrocyte cytoskeletal protein, essential to the mechanochemical properties of red cell membranes because it promotes the interaction between spectrin and actin in the membrane cytoskeleton. 4.1R also binds certain phospholipids and is required for the stable cell surface accumulation of a number of erythrocyte transmembrane proteins that span multiple functional classes; these include cell adhesion molecules, transporters and a chemokine receptor. The vertebrate 4.1 proteins are expressed in most tissues, and they are required for the correct cell surface accumulation of a very wide variety of membrane proteins including G-Protein coupled receptors, voltage-gated and ligand-gated channels, as well as the classes identified in erythrocytes. Indeed, such large numbers of protein interactions have been mapped for mammalian 4.1 proteins, most especially 4.1R, that it appears that they can act as hubs for membrane protein organization. The range of critical interactions of 4.1 proteins is reflected in disease relationships that include hereditary anaemias, tumour suppression, control of heartbeat and nervous system function. The 4.1 proteins are defined by their domain structure: apart from the spectrin/actin-binding domain they have FERM and FERM-adjacent domains and a unique C-terminal domain. Both the FERM and C-terminal domains can bind transmembrane proteins, thus they have the potential to be cross-linkers for membrane proteins. The activity of the FERM domain is subject to multiple modes of regulation via binding of regulatory ligands, phosphorylation of the FERM associated domain and

  2. Cadmium-binding protein (metallothionein) in carp.

    PubMed Central

    Kito, H; Ose, Y; Sato, T


    When carp (Cyprinus carpio) were exposed to 5 and 30 ppm Cd in the water, the contents of Cd-binding protein, which has low molecular weight, increased in the hepatopancreas, kidney, gills and gastrointestinal tract with the duration of exposure. This Cd-binding protein was purified from hepatopancreas, kidney, gills, and spleen of carp administered 2 mg/kg Cd (as CdCl2), intraperitoneally for 6 days. Two Cd-binding proteins were separated by DEAE-Sephadex A-25 column chromatography. These proteins had Cd-mercaptide bond, high cysteine contents (ca. 29-34%), but no aromatic amino acids or histidine. From these characteristics the Cd-binding proteins were identified as metallothionein. By using antiserum obtained from a rabbit to which carp hepatopancreas MT-II had been administered, immunological characteristics between hepatopancreas MT-I, II and kidney MT-II were studied, and a slight difference in antigenic determinant was observed among them. By immunological staining techniques with horseradish peroxidase, the localization of metallothionein was investigated. In the nontreated group, metallothionein was present in the acinar cells of hepatopancreas and renal convoluted tubules. In the Cd-treated group (2 mg/kg IP daily for 3 days), metallothionein was present in the nuclei, sinusoids, and extracellular space of hepatopancreas, in addition to the acinar cells. Carp were bred in 1 ppm Cd, 5 ppm Zn solution, and tap water for 14 days, following transfer to 15 ppm Cd solution, respectively. The survival ratio was the highest in the Zn group followed by Cd-treated and control groups. The metallothionein contents increased in hepatopancreas and kidney in the order: Zn greater than Cd greater than control group. Images FIGURE 5. FIGURE 6. PMID:3519201

  3. Biologically active protein fragments containing specific binding regions of serum albumin or related proteins

    NASA Technical Reports Server (NTRS)

    Carter, Daniel C. (Inventor)


    In accordance with the present invention, biologically active protein fragments can be constructed which contain only those specific portions of the serum albumin family of proteins such as regions known as subdomains IIA and IIIA which are primarily responsible for the binding properties of the serum albumins. The artificial serums that can be prepared from these biologically active protein fragments are advantageous in that they can be produced much more easily than serums containing the whole albumin, yet still retain all or most of the original binding potential of the full albumin proteins. In addition, since the protein fragment serums of the present invention can be made from non-natural sources using conventional recombinant DNA techniques, they are far safer than serums containing natural albumin because they do not carry the potentially harmful viruses and other contaminants that will be found in the natural substances.

  4. Genetic association analysis of ATP binding cassette protein family reveals a novel association of ABCB1 genetic variants with epilepsy risk, but not with drug-resistance.


    Balan, Shabeesh; Bharathan, Sumitha Prameela; Vellichiramal, Neetha Nanoth; Sathyan, Sanish; Joseph, Vijai; Radhakrishnan, Kurupath; Banerjee, Moinak


    Epilepsy constitutes a heterogeneous group of disorders that is characterized by recurrent unprovoked seizures due to widely different etiologies. Multidrug resistance remains a major issue in clinical epileptology, where one third of patients with epilepsy continue to have seizures. Role of efflux transporters in multidrug resistant epilepsy has been attributed to drug-resistant epilepsy although, with discrepant observation in genetic studies. These discrepancies could be attributed to variety of factors such as variable definition of the anti-epileptic drug (AED)-resistance, variable epilepsy phenotypes and ethnicities among the studies. In the present study we inquired the role of multidrug transporters ABCB1 and ABCG2 variants in determining AED-resistance and susceptibility to epilepsy in three well-characterized cohorts comprising of mesial temporal lobe epilepsy with hippocampal sclerosis (MTLE-HS) (prototype for AED-resistant epilepsy); juvenile myoclonic epilepsy (JME) (prototype for AED-responsive epilepsy); and healthy non-epileptic controls, in 738 subjects of Malayalam speaking south Indian ancestry. ABCB1 and ABCG2 variants were not found to be associated with drug resistance when AED-resistant and AED-responsive cohorts were compared. However, a significant association was observed between ABCB1 (C3435T) rs1045642 and risk of having epilepsy (MTLE-HS and JME pooled cohort; genotypic p-value = 0.0002; allelic p-value = 0.004). This association was seen persistent with MTLE-HS (genotypic p-value = 0.0008; allelic p-value = 0.004) and also with JME (genotypic p-value = 0.01; allelic p-value = 0.05) cohort individually. In-silico functional prediction indicated that ABCB1 rs1045642 has a deleterious impact on protein coding function and in splicing regulation. We conclude that the ABCB1 and ABCG2 variants do not confer to AED-resistance in the study population. However, ABCB1 rs1045642 increases vulnerability to epilepsy with greater tendency for MTLE

  5. Genetic Association Analysis of ATP Binding Cassette Protein Family Reveals a Novel Association of ABCB1 Genetic Variants with Epilepsy Risk, but Not with Drug-Resistance

    PubMed Central

    Balan, Shabeesh; Bharathan, Sumitha Prameela; Vellichiramal, Neetha Nanoth; Sathyan, Sanish; Joseph, Vijai; Radhakrishnan, Kurupath; Banerjee, Moinak


    Epilepsy constitutes a heterogeneous group of disorders that is characterized by recurrent unprovoked seizures due to widely different etiologies. Multidrug resistance remains a major issue in clinical epileptology, where one third of patients with epilepsy continue to have seizures. Role of efflux transporters in multidrug resistant epilepsy has been attributed to drug-resistant epilepsy although, with discrepant observation in genetic studies. These discrepancies could be attributed to variety of factors such as variable definition of the anti-epileptic drug (AED)-resistance, variable epilepsy phenotypes and ethnicities among the studies. In the present study we inquired the role of multidrug transporters ABCB1 and ABCG2 variants in determining AED-resistance and susceptibility to epilepsy in three well-characterized cohorts comprising of mesial temporal lobe epilepsy with hippocampal sclerosis (MTLE-HS) (prototype for AED-resistant epilepsy); juvenile myoclonic epilepsy (JME) (prototype for AED-responsive epilepsy); and healthy non-epileptic controls, in 738 subjects of Malayalam speaking south Indian ancestry. ABCB1 and ABCG2 variants were not found to be associated with drug resistance when AED-resistant and AED-responsive cohorts were compared. However, a significant association was observed between ABCB1 (C3435T) rs1045642 and risk of having epilepsy (MTLE-HS and JME pooled cohort; genotypic p-value = 0.0002; allelic p-value = 0.004). This association was seen persistent with MTLE-HS (genotypic p-value = 0.0008; allelic p-value = 0.004) and also with JME (genotypic p-value = 0.01; allelic p-value = 0.05) cohort individually. In-silico functional prediction indicated that ABCB1 rs1045642 has a deleterious impact on protein coding function and in splicing regulation. We conclude that the ABCB1 and ABCG2 variants do not confer to AED-resistance in the study population. However, ABCB1 rs1045642 increases vulnerability to epilepsy with

  6. A novel family of katanin-like 2 protein isoforms (KATNAL2), interacting with nucleotide-binding proteins Nubp1 and Nubp2, are key regulators of different MT-based processes in mammalian cells.


    Ververis, Antonis; Christodoulou, Andri; Christoforou, Maria; Kamilari, Christina; Lederer, Carsten W; Santama, Niovi


    Katanins are microtubule (MT)-severing AAA proteins with high phylogenetic conservation throughout the eukaryotes. They have been functionally implicated in processes requiring MT remodeling, such as spindle assembly in mitosis and meiosis, assembly/disassembly of flagella and cilia and neuronal morphogenesis. Here, we uncover a novel family of katanin-like 2 proteins (KATNAL2) in mouse, consisting of five alternatively spliced isoforms encoded by the Katnal2 genomic locus. We further demonstrate that in vivo these isoforms are able to interact with themselves, with each other and moreover directly and independently with MRP/MinD-type P-loop NTPases Nubp1 and Nubp2, which are integral components of centrioles, negative regulators of ciliogenesis and implicated in centriole duplication in mammalian cells. We find KATNAL2 localized on interphase MTs, centrioles, mitotic spindle, midbody and the axoneme and basal body of sensory cilia in cultured murine cells. shRNAi of Katnal2 results in inefficient cytokinesis and severe phenotypes of enlarged cells and nuclei, increased numbers of centrioles and the manifestation of aberrant multipolar mitotic spindles, mitotic defects, chromosome bridges, multinuclearity, increased MT acetylation and an altered cell cycle pattern. Silencing or stable overexpression of KATNAL2 isoforms drastically reduces ciliogenesis. In conclusion, KATNAL2s are multitasking enzymes involved in the same cell type in critically important processes affecting cytokinesis, MT dynamics, and ciliogenesis and are also implicated in cell cycle progression. PMID:26153462

  7. Invited review: Architectures and mechanisms of ATP binding cassette proteins.


    Hopfner, Karl-Peter


    ATP binding cassette (ABC) ATPases form chemo-mechanical engines and switches that function in a broad range of biological processes. Most prominently, a very large family of integral membrane NTPases-ABC transporters-catalyzes the import or export of a diverse molecules across membranes. ABC proteins are also important components of the chromosome segregation, recombination, and DNA repair machineries and regulate or catalyze critical steps of ribosomal protein synthesis. Recent structural and mechanistic studies draw interesting architectural and mechanistic parallels between diverse ABC proteins. Here, I review this state of our understanding how NTP-dependent conformational changes of ABC proteins drive diverse biological processes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 492-504, 2016. PMID:27037766

  8. Nucleolin is a calcium-binding protein.


    Gilchrist, James S C; Abrenica, Bernard; DiMario, Patrick J; Czubryt, Michael P; Pierce, Grant N


    We have purified a prominent 110-kDa protein (p110) from 1.6 M NaCl extracts of rat liver nuclei that appears to bind Ca2+. p110 was originally identified by prominent blue staining with 'Stains-All' in sodium dodecyl sulfate-polyacrylamide gels and was observed to specifically bind ruthenium red and 45Ca2+ in nitrocellulose blot overlays. In spin-dialysis studies, purified p110 saturably bound approximately 75 nmol Ca2+/mg protein at a concentration of 1 mM total Ca2+ with half-maximal binding observed at 105 microM Ca2+. With purification, p110 became increasingly susceptible to proteolytic (likely autolytic) fragmentation, although most intermediary peptides between 40 and 90 kDa retained "Stains-All", ruthenium red, and 45Ca2+ binding. N-terminal sequencing of intact p110 and a 70-kDa autolytic peptide fragment revealed a strong homology to nucleolin. Two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)/IEF revealed autolysis produced increasingly acidic peptide fragments ranging in apparent pI's from 5.5 for intact p110 to 3.5 for a 40 kDa peptide fragment. Intact p110 and several peptide fragments were immunostained with a highly specific anti-nucleolin antibody, R2D2, thus confirming the identity of this protein with nucleolin. These annexin-like Ca2+-binding characteristics of nucleolin are likely contributed by its highly acidic argyrophilic N-terminus with autolysis apparently resulting in largely selective removal of its basic C-terminal domain. Although the Ca2+-dependent functions of nucleolin are unknown, we discuss the possibility that like the structurally analogous HMG-1, its Ca2+-dependent actions may regulate chromatin structure, possibly during apoptosis. PMID:11948683

  9. Evolution of the transferrin family: conservation of residues associated with iron and anion binding.


    Lambert, Lisa A; Perri, Holly; Halbrooks, Peter J; Mason, Anne B


    The transferrin family spans both vertebrates and invertebrates. It includes serum transferrin, ovotransferrin, lactoferrin, melanotransferrin, inhibitor of carbonic anhydrase, saxiphilin, the major yolk protein in sea urchins, the crayfish protein, pacifastin, and a protein from green algae. Most (but not all) contain two domains of around 340 residues, thought to have evolved from an ancient duplication event. For serum transferrin, ovotransferrin and lactoferrin each of the duplicated lobes binds one atom of Fe (III) and one carbonate anion. With a few notable exceptions each iron atom is coordinated to four conserved amino acid residues: an aspartic acid, two tyrosines, and a histidine, while anion binding is associated with an arginine and a threonine in close proximity. These six residues in each lobe were examined for their evolutionary conservation in the homologous N- and C-lobes of 82 complete transferrin sequences from 61 different species. Of the ligands in the N-lobe, the histidine ligand shows the most variability in sequence. Also, of note, four of the twelve insect transferrins have glutamic acid substituted for aspartic acid in the N-lobe (as seen in the bacterial ferric binding proteins). In addition, there is a wide spread substitution of lysine for the anion binding arginine in the N-lobe in many organisms including all of the fish, the sea squirt and many of the unusual family members i.e., saxiphilin and the green alga protein. It is hoped that this short analysis will provide the impetus to establish the true function of some of the TF family members that clearly lack the ability to bind iron in one or both lobes and additionally clarify the evolutionary history of this important family of proteins. PMID:16111909

  10. Sterol Carrier Protein-2: Binding Protein for Endocannabinoids

    PubMed Central

    Liedhegner, Elizabeth Sabens; Vogt, Caleb D.; Sem, Daniel S.; Cunningham, Christopher W.


    The endocannabinoid (eCB) system, consisting of eCB ligands and the type 1 cannabinoid receptor (CB1R), subserves retrograde, activity-dependent synaptic plasticity in the brain. eCB signaling occurs “on-demand,” thus the processes regulating synthesis, mobilization and degradation of eCBs are also primary mechanisms for the regulation of CB1R activity. The eCBs, N-arachidonylethanolamine (AEA) and 2-arachidonoylglycerol (2-AG), are poorly soluble in water. We hypothesize that their aqueous solubility, and, therefore, their intracellular and transcellular distribution, are facilitated by protein binding. Using in silico docking studies, we have identified the nonspecific lipid binding protein, sterol carrier protein 2 (SCP-2), as a potential AEA binding protein. The docking studies predict that AEA and AM404 associate with SCP-2 at a putative cholesterol binding pocket with ΔG values of −3.6 and −4.6 kcal/mol, respectively. These values are considerably higher than cholesterol (−6.62 kcal/mol) but consistent with a favorable binding interaction. In support of the docking studies, SCP-2-mediated transfer of cholesterol in vitro is inhibited by micromolar concentrations of AEA; and heterologous expression of SCP-2 in HEK 293 cells increases time-related accumulation of AEA in a temperature-dependent fashion. These results suggest that SCP-2 facilitates cellular uptake of AEA. However, there is no effect of SCP-2 transfection on the cellular accumulation of AEA determined at equilibrium or the IC50 values for AEA, AM404 or 2-AG to inhibit steady state accumulation of radiolabelled AEA. We conclude that SCP-2 is a low affinity binding protein for AEA that can facilitate its cellular uptake but does not contribute significantly to intracellular sequestration of AEA. PMID:24510313

  11. Characterization of the betaherpesviral pUL69 protein family reveals binding of the cellular mRNA export factor UAP56 as a prerequisite for stimulation of nuclear mRNA export and for efficient viral replication.


    Zielke, Barbara; Thomas, Marco; Giede-Jeppe, Antje; Müller, Regina; Stamminger, Thomas


    UL69 of human cytomegalovirus (HCMV) encodes a pleiotropic transactivator protein and has a counterpart in every member of the Herpesviridae family thus far sequenced. However, little is known about the conservation of the functions of the nuclear phosphoprotein pUL69 in the homologous proteins of other betaherpesviruses. Therefore, eukaryotic expression vectors were constructed for pC69 of chimpanzee cytomegalovirus, pRh69 of rhesus cytomegalovirus, pM69 of murine cytomegalovirus, pU42 of human herpesvirus 6, and pU42 of elephant endotheliotropic herpesvirus. Indirect immunofluorescence experiments showed that all pUL69 homologs expressed by these vectors were localized to the cell nucleus. Coimmunoprecipitation experiments identified homodimerization as a conserved feature of all homologs, whereas heterodimerization with pUL69 was restricted to its closer relatives. Further analyses demonstrated that pC69 and pRh69 were the only two homologs that functioned, like pUL69, as viral-mRNA export factors. As we had reported recently that nucleocytoplasmic shuttling and interaction with the cellular DExD/H-box helicases UAP56 and URH49 were prerequisites for the nuclear-mRNA export activity of pUL69, the homologs were characterized with regard to these properties. Heterokaryon assays demonstrated nucleocytoplasmic shuttling for all homologs, and coimmunoprecipitation and mRNA export assays revealed that the interaction of UAP56 and/or URH49 with pC69 or pRh69 was required for mRNA export activity. Moreover, characterization of HCMV recombinants harboring mutations within the N-terminal sequence of pUL69 revealed a strong replication defect of viruses expressing pUL69 variants that were deficient in UAP56 binding. In summary, homodimerization and nucleocytoplasmic shuttling activity were identified as conserved features of betaherpesviral pUL69 homologs. UAP56 binding was shown to represent a unique characteristic of members of the genus Cytomegalovirus that is required

  12. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, J.D.; Scott-Craig, J.S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is presented. The deduced amino acid sequence is provided. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with vectors and seeds from the plants.

  13. Polynucleotides encoding TRF1 binding proteins


    Campisi, Judith; Kim, Sahn-Ho


    The present invention provides a novel telomere associated protein (Trf1-interacting nuclear protein 2 "Tin2") that hinders the binding of Trf1 to its specific telomere repeat sequence and mediates the formation of a Tin2-Trf1-telomeric DNA complex that limits telomerase access to the telomere. Also included are the corresponding nucleic acids that encode the Tin2 of the present invention, as well as mutants of Tin2. Methods of making, purifying and using Tin2 of the present invention are described. In addition, drug screening assays to identify drugs that mimic and/or complement the effect of Tin2 are presented.

  14. Shrimp arginine kinase being a binding protein of WSSV envelope protein VP31

    NASA Astrophysics Data System (ADS)

    Ma, Cuiyan; Gao, Qiang; Liang, Yan; Li, Chen; Liu, Chao; Huang, Jie


    Viral entry into the host is the earliest stage of infection in the viral life cycle in which attachment proteins play a key role. VP31 (WSV340/WSSV396), an envelope protein of white spot syndrome virus (WSSV), contains an Arg-Gly-Asp (RGD) peptide domain known as a cellular attachment site. At present, the process of VP31 interacting with shrimp host cells has not been explored. Therefore, the VP31 gene was cloned into pET30a (+), expressed in Escherichia coli strain BL21 and purified with immobilized metal ion affinity chromatography. Four gill cellular proteins of shrimp (Fenneropenaeus chinensis) were pulled down by an affinity column coupled with recombinant VP31 (rVP31), and the amino acid sequences were identified with MALDI-TOF/TOF mass spectrometry. Hemocyanin, beta-actin, arginine kinase (AK), and an unknown protein were suggested as the putative VP31 receptor proteins. SDS-PAGE showed that AK is the predominant binding protein of VP31. An i n vitro binding activity experiment indicated that recombinant AK's (rAK) binding activity with rVP31 is comparable to that with the same amount of WSSV. These results suggested that AK, as a member of the phosphagen kinase family, plays a role in WSSV infection. This is the first evidence showing that AK is a binding protein of VP31. Further studies on this topic will elucidate WSSV infection mechanism in the future.

  15. Binding of transition metals to S100 proteins.


    Gilston, Benjamin A; Skaar, Eric P; Chazin, Walter J


    The S100 proteins are a unique class of EF-hand Ca(2+) binding proteins distributed in a cell-specific, tissue-specific, and cell cycle-specific manner in humans and other vertebrates. These proteins are distinguished by their distinctive homodimeric structure, both intracellular and extracellular functions, and the ability to bind transition metals at the dimer interface. Here we summarize current knowledge of S100 protein binding of Zn(2+), Cu(2+) and Mn(2+) ions, focusing on binding affinities, conformational changes that arise from metal binding, and the roles of transition metal binding in S100 protein function. PMID:27430886

  16. Vaccinia Virus N1l Protein Resembles a B Cell Lymphoma-2 (Bcl-2) Family Protein

    SciTech Connect

    Aoyagi, M.; Zhai, D.; Jin, C.; Aleshin, A.E.; Stec, B.; Reed, J.C.; Liddington, R.C.; /Burnham Inst.


    Poxviruses encode immuno-modulatory proteins capable of subverting host defenses. The poxvirus vaccinia expresses a small 14-kDa protein, N1L, that is critical for virulence. We report the crystal structure of N1L, which reveals an unexpected but striking resemblance to host apoptotic regulators of the B cell lymphoma-2 (Bcl-2) family. Although N1L lacks detectable Bcl-2 homology (BH) motifs at the sequence level, we show that N1L binds with high affinity to the BH3 peptides of pro-apoptotic Bcl-2 family proteins in vitro, consistent with a role for N1L in modulating host antiviral defenses.

  17. Proteins of the ETS family with transcriptional repressor activity.


    Mavrothalassitis, G; Ghysdael, J


    ETS proteins form one of the largest families of signal-dependent transcriptional regulators, mediating cellular proliferation, differentiation and tumorigenesis. Most of the known ETS proteins have been shown to activate transcription. However, four ETS proteins (YAN, ERF, NET and TEL) can act as transcriptional repressors. In three cases (ERF, NET and TEL) distinct repression domains have been identified and there are indications that NET and TEL may mediate transcription via Histone Deacetylase recruitment. All four proteins appear to be regulated by MAPKs, though for YAN and ERF this regulation seems to be restricted to ERKs. YAN, ERF and TEL have been implicated in cellular proliferation although there are indications suggesting a possible involvement of YAN and TEL in differentiation as well. Other ETS-domain proteins have been shown to repress transcription in a context specific manner, and there are suggestions that the ETS DNA-binding domain may act as a transcriptional repressor. Transcriptional repression by ETS domain proteins adds an other level in the orchestrated regulation by this diverse family of transcription factors that often recognize similar if not identical binding sites on DNA and are believed to regulate critical genes in a variety of biological processes. Definitive assessment of the importance of this novel regulatory level will require the identification of ETS proteins target genes and the further analysis of transcriptional control and biological function of these proteins in defined pathways. PMID:11175368

  18. Novel Bioluminescent Binding Assays for Ligand–Receptor Interaction Studies of the Fibroblast Growth Factor Family

    PubMed Central

    Song, Ge; Shao, Xiao-Xia; Wu, Qing-Ping; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun


    We recently developed novel bioluminescent binding assays for several protein/peptide hormones to study their interactions with receptors using the so far brightest NanoLuc reporter. To validate the novel bioluminescent binding assay using a variety of protein/peptide hormones, in the present work we applied it to the fibroblast growth factor (FGF) family using the prototype member FGF2 as an example. A fully active recombinant FGF2 retaining a unique exposed cysteine (Cys) residue was chemically conjugated with an engineered NanoLuc carrying a unique exposed Cys residue at the C-terminus via formation of an intermolecular disulfide linkage. The NanoLuc-conjugated FGF2 (FGF2-Luc) retained high binding affinity to the overexpressed FGFR1 and the endogenous FGF receptor with the calculated dissociation constants of 161 ± 21 pM (n = 3) and 25 ± 4 pM (n = 3), respectively. In competition binding assays using FGF2-Luc as a tracer, receptor-binding potencies of wild-type or mutant FGF2s were accurately quantified. Thus, FGF2-Luc represents a novel non-radioactive tracer for the quantitative measurement of ligand–receptor interactions in the FGF family. These data suggest that the novel bioluminescent binding assay can be applied to a variety of protein/peptide hormones for ligand–receptor interaction studies. PMID:27414797

  19. Novel Bioluminescent Binding Assays for Ligand-Receptor Interaction Studies of the Fibroblast Growth Factor Family.


    Song, Ge; Shao, Xiao-Xia; Wu, Qing-Ping; Xu, Zeng-Guang; Liu, Ya-Li; Guo, Zhan-Yun


    We recently developed novel bioluminescent binding assays for several protein/peptide hormones to study their interactions with receptors using the so far brightest NanoLuc reporter. To validate the novel bioluminescent binding assay using a variety of protein/peptide hormones, in the present work we applied it to the fibroblast growth factor (FGF) family using the prototype member FGF2 as an example. A fully active recombinant FGF2 retaining a unique exposed cysteine (Cys) residue was chemically conjugated with an engineered NanoLuc carrying a unique exposed Cys residue at the C-terminus via formation of an intermolecular disulfide linkage. The NanoLuc-conjugated FGF2 (FGF2-Luc) retained high binding affinity to the overexpressed FGFR1 and the endogenous FGF receptor with the calculated dissociation constants of 161 ± 21 pM (n = 3) and 25 ± 4 pM (n = 3), respectively. In competition binding assays using FGF2-Luc as a tracer, receptor-binding potencies of wild-type or mutant FGF2s were accurately quantified. Thus, FGF2-Luc represents a novel non-radioactive tracer for the quantitative measurement of ligand-receptor interactions in the FGF family. These data suggest that the novel bioluminescent binding assay can be applied to a variety of protein/peptide hormones for ligand-receptor interaction studies. PMID:27414797

  20. MICAL-Family Proteins: Complex Regulators of the Actin Cytoskeleton

    PubMed Central

    Giridharan, Sai Srinivas Panapakkam


    Abstract Significance: The molecules interacting with CasL (MICAL) family members participate in a multitude of activities, including axonal growth cone repulsion, membrane trafficking, apoptosis, and bristle development in flies. An interesting feature of MICAL proteins is the presence of an N-terminal flavo-mono-oxygenase domain. This mono-oxygenase domain generates redox potential with which MICALs can either oxidize proteins or produce reactive oxygen species (ROS). Actin is one such protein that is affected by MICAL function, leading to dramatic cytoskeletal rearrangements. This review describes the MICAL-family members, and discusses their mechanisms of actin-binding and regulation of actin cytoskeleton organization. Recent Advances: Recent studies show that MICALs directly induce oxidation of actin molecules, leading to actin depolymerization. ROS production by MICALs also causes oxidation of collapsin response mediator protein-2, a microtubule assembly promoter, which subsequently undergoes phosphorylation. Critical Issues: MICAL proteins oxidize proteins through two mechanisms: either directly by oxidizing methionine residues or indirectly via the production of ROS. It remains unclear whether MICAL proteins employ both mechanisms or whether the activity of MICAL-family proteins might vary with different substrates. Future Directions: The identification of additional substrates oxidized by MICAL will shed new light on MICAL protein function. Additional directions include expanding studies toward the MICAL-like homologs that lack flavin adenine dinucleotide domains and oxidation activity. Antioxid. Redox Signal. 20, 2059–2073. PMID:23834433

  1. Interactome map uncovers phosphatidylserine transport by oxysterol-binding proteins.


    Maeda, Kenji; Anand, Kanchan; Chiapparino, Antonella; Kumar, Arun; Poletto, Mattia; Kaksonen, Marko; Gavin, Anne-Claude


    The internal organization of eukaryotic cells into functionally specialized, membrane-delimited organelles of unique composition implies a need for active, regulated lipid transport. Phosphatidylserine (PS), for example, is synthesized in the endoplasmic reticulum and then preferentially associates--through mechanisms not fully elucidated--with the inner leaflet of the plasma membrane. Lipids can travel via transport vesicles. Alternatively, several protein families known as lipid-transfer proteins (LTPs) can extract a variety of specific lipids from biological membranes and transport them, within a hydrophobic pocket, through aqueous phases. Here we report the development of an integrated approach that combines protein fractionation and lipidomics to characterize the LTP-lipid complexes formed in vivo. We applied the procedure to 13 LTPs in the yeast Saccharomyces cerevisiae: the six Sec14 homology (Sfh) proteins and the seven oxysterol-binding homology (Osh) proteins. We found that Osh6 and Osh7 have an unexpected specificity for PS. In vivo, they participate in PS homeostasis and the transport of this lipid to the plasma membrane. The structure of Osh6 bound to PS reveals unique features that are conserved among other metazoan oxysterol-binding proteins (OSBPs) and are required for PS recognition. Our findings represent the first direct evidence, to our knowledge, for the non-vesicular transfer of PS from its site of biosynthesis (the endoplasmic reticulum) to its site of biological activity (the plasma membrane). We describe a new subfamily of OSBPs, including human ORP5 and ORP10, that transfer PS and propose new mechanisms of action for a protein family that is involved in several human pathologies such as cancer, dyslipidaemia and metabolic syndrome. PMID:23934110

  2. Systematic discovery of Xist RNA binding proteins

    PubMed Central

    Chu, Ci; Zhang, Qiangfeng Cliff; da Rocha, Simão Teixeira; Flynn, Ryan A.; Bharadwaj, Maheetha; Calabrese, J. Mauro; Magnuson, Terry; Heard, Edith; Chang, Howard Y.


    Summary Noncoding RNAs (ncRNAs) function with associated proteins to effect complex structural and regulatory outcomes. To reveal the composition and dynamics of specific noncoding RNA- protein complexes (RNPs) in vivo, we developed comprehensive identification of RNA-binding proteins by mass spectrometry (ChIRP-MS). ChIRP-MS analysis of four ncRNAs captures key protein interactors, including a U1-specific link to the 3′ RNA processing machinery. Xist, an essential lncRNA for X-chromosome inactivation (XCI), interacts with 81 proteins from chromatin modification, nuclear matrix, and RNA remodeling pathways. The Xist RNA-protein particle assembles in two steps coupled with the transition from pluripotency to differentiation. Specific interactors include HnrnpK that participates in Xist-mediated gene silencing and histone modifications, but not Xist localization and Drosophila Split ends homolog Spen that interacts via the A-repeat domain of Xist and is required for gene silencing. Thus, Xist lncRNA engages with proteins in a modular and developmentally controlled manner to coordinate chromatin spreading and silencing. PMID:25843628

  3. Systematic discovery of Xist RNA binding proteins.


    Chu, Ci; Zhang, Qiangfeng Cliff; da Rocha, Simão Teixeira; Flynn, Ryan A; Bharadwaj, Maheetha; Calabrese, J Mauro; Magnuson, Terry; Heard, Edith; Chang, Howard Y


    Noncoding RNAs (ncRNAs) function with associated proteins to effect complex structural and regulatory outcomes. To reveal the composition and dynamics of specific noncoding RNA-protein complexes (RNPs) in vivo, we developed comprehensive identification of RNA binding proteins by mass spectrometry (ChIRP-MS). ChIRP-MS analysis of four ncRNAs captures key protein interactors, including a U1-specific link to the 3' RNA processing machinery. Xist, an essential lncRNA for X chromosome inactivation (XCI), interacts with 81 proteins from chromatin modification, nuclear matrix, and RNA remodeling pathways. The Xist RNA-protein particle assembles in two steps coupled with the transition from pluripotency to differentiation. Specific interactors include HnrnpK, which participates in Xist-mediated gene silencing and histone modifications but not Xist localization, and Drosophila Split ends homolog Spen, which interacts via the A-repeat domain of Xist and is required for gene silencing. Thus, Xist lncRNA engages with proteins in a modular and developmentally controlled manner to coordinate chromatin spreading and silencing. PMID:25843628

  4. Targeting the inhibitor of Apoptosis Protein BIR3 binding domains.


    Jaquith, James B


    The Inhibitor of Apoptosis Proteins (IAPs) play a critical role in the regulation of cellular apoptosis and cytokine signaling. IAP family members include XIAP, cIAP1, cIAP2, NAIP, survivin, Apollon/Bruce, ML-IAP/livin and TIAP. The IAPs have been targeted using both antisense oligonucleotides and small molecule inhibitors. Several research teams have advanced compounds that bind the highly conserved BIR3 domains of the IAPs into clinical trials, as single agents and in combination with standard of care. This patent review highlights the medicinal chemistry strategies that have been applied to the development of clinical compounds. PMID:24998289

  5. Cation specific binding with protein surface charges.


    Hess, Berk; van der Vegt, Nico F A


    Biological organization depends on a sensitive balance of noncovalent interactions, in particular also those involving interactions between ions. Ion-pairing is qualitatively described by the law of "matching water affinities." This law predicts that cations and anions (with equal valence) form stable contact ion pairs if their sizes match. We show that this simple physical model fails to describe the interaction of cations with (molecular) anions of weak carboxylic acids, which are present on the surfaces of many intra- and extracellular proteins. We performed molecular simulations with quantitatively accurate models and observed that the order K(+) < Na(+) < Li(+) of increasing binding affinity with carboxylate ions is caused by a stronger preference for forming weak solvent-shared ion pairs. The relative insignificance of contact pair interactions with protein surfaces indicates that thermodynamic stability and interactions between proteins in alkali salt solutions is governed by interactions mediated through hydration water molecules. PMID:19666545

  6. Copper-binding protein in Mimulus guttatus

    SciTech Connect

    Robinson, N.J.; Thurman, D.A.


    A Cu-binding protein has been purified from the roots of Mimulus guttatus using gel permeation chromatography on Sephadex G-75 and anion exchange chromatography on DEAE Biogel A. The protein has similar properties to putative metallothioneins (MTS) purified from other angiosperms. Putative MT was estimated by measuring the relative percentage incorporation of (/sup 35/S) into fractions containing the protein after HPLC on SW 3000-gel. In the roots of both Cu-tolerant and non tolerant plants synthesis of putative MT is induced by increased Cu concentration in the nutrient solution. The relative percentage incorporation of (/sup 35/S) into putative MT is significantly higher in extracts from the roots of Cu-tolerant than non tolerant M. guttatus after growth in 1 Cu suggesting involvement in the mechanism of tolerance. 22 refs., 2 figs., 1 tab.

  7. The ADF/cofilin family: actin-remodeling proteins

    PubMed Central

    Maciver, Sutherland K; Hussey, Patrick J


    The ADF/cofilins are a family of actin-binding proteins expressed in all eukaryotic cells so far examined. Members of this family remodel the actin cytoskeleton, for example during cytokinesis, when the actin-rich contractile ring shrinks as it contracts through the interaction of ADF/cofilins with both monomeric and filamentous actin. The depolymerizing activity is twofold: ADF/cofilins sever actin filaments and also increase the rate at which monomers leave the filament's pointed end. The three-dimensional structure of ADF/cofilins is similar to a fold in members of the gelsolin family of actin-binding proteins in which this fold is typically repeated three or six times; although both families bind polyphosphoinositide lipids and actin in a pH-dependent manner, they share no obvious sequence similarity. Plants and animals have multiple ADF/cofilin genes, belonging in vertebrates to two types, ADF and cofilins. Other eukaryotes (such as yeast, Acanthamoeba and slime moulds) have a single ADF/cofilin gene. Phylogenetic analysis of the ADF/cofilins reveals that, with few exceptions, their relationships reflect conventional views of the relationships between the major groups of organisms. PMID:12049672

  8. DNA and RNA Quadruplex-Binding Proteins

    PubMed Central

    Brázda, Václav; Hároníková, Lucia; Liao, Jack C. C.; Fojta, Miroslav


    Four-stranded DNA structures were structurally characterized in vitro by NMR, X-ray and Circular Dichroism spectroscopy in detail. Among the different types of quadruplexes (i-Motifs, minor groove quadruplexes, G-quadruplexes, etc.), the best described are G-quadruplexes which are featured by Hoogsteen base-paring. Sequences with the potential to form quadruplexes are widely present in genome of all organisms. They are found often in repetitive sequences such as telomeric ones, and also in promoter regions and 5' non-coding sequences. Recently, many proteins with binding affinity to G-quadruplexes have been identified. One of the initially portrayed G-rich regions, the human telomeric sequence (TTAGGG)n, is recognized by many proteins which can modulate telomerase activity. Sequences with the potential to form G-quadruplexes are often located in promoter regions of various oncogenes. The NHE III1 region of the c-MYC promoter has been shown to interact with nucleolin protein as well as other G-quadruplex-binding proteins. A number of G-rich sequences are also present in promoter region of estrogen receptor alpha. In addition to DNA quadruplexes, RNA quadruplexes, which are critical in translational regulation, have also been predicted and observed. For example, the RNA quadruplex formation in telomere-repeat-containing RNA is involved in interaction with TRF2 (telomere repeat binding factor 2) and plays key role in telomere regulation. All these fundamental examples suggest the importance of quadruplex structures in cell processes and their understanding may provide better insight into aging and disease development. PMID:25268620

  9. DNA and RNA quadruplex-binding proteins.


    Brázda, Václav; Hároníková, Lucia; Liao, Jack C C; Fojta, Miroslav


    Four-stranded DNA structures were structurally characterized in vitro by NMR, X-ray and Circular Dichroism spectroscopy in detail. Among the different types of quadruplexes (i-Motifs, minor groove quadruplexes, G-quadruplexes, etc.), the best described are G-quadruplexes which are featured by Hoogsteen base-paring. Sequences with the potential to form quadruplexes are widely present in genome of all organisms. They are found often in repetitive sequences such as telomeric ones, and also in promoter regions and 5' non-coding sequences. Recently, many proteins with binding affinity to G-quadruplexes have been identified. One of the initially portrayed G-rich regions, the human telomeric sequence (TTAGGG)n, is recognized by many proteins which can modulate telomerase activity. Sequences with the potential to form G-quadruplexes are often located in promoter regions of various oncogenes. The NHE III1 region of the c-MYC promoter has been shown to interact with nucleolin protein as well as other G-quadruplex-binding proteins. A number of G-rich sequences are also present in promoter region of estrogen receptor alpha. In addition to DNA quadruplexes, RNA quadruplexes, which are critical in translational regulation, have also been predicted and observed. For example, the RNA quadruplex formation in telomere-repeat-containing RNA is involved in interaction with TRF2 (telomere repeat binding factor 2) and plays key role in telomere regulation. All these fundamental examples suggest the importance of quadruplex structures in cell processes and their understanding may provide better insight into aging and disease development. PMID:25268620

  10. Identification of DNA-binding and protein-binding proteins using enhanced graph wavelet features.


    Zhu, Yuan; Zhou, Weiqiang; Dai, Dao-Qing; Yan, Hong


    Interactions between biomolecules play an essential role in various biological processes. For predicting DNA-binding or protein-binding proteins, many machine-learning-based techniques have used various types of features to represent the interface of the complexes, but they only deal with the properties of a single atom in the interface and do not take into account the information of neighborhood atoms directly. This paper proposes a new feature representation method for biomolecular interfaces based on the theory of graph wavelet. The enhanced graph wavelet features (EGWF) provides an effective way to characterize interface feature through adding physicochemical features and exploiting a graph wavelet formulation. Particularly, graph wavelet condenses the information around the center atom, and thus enhances the discrimination of features of biomolecule binding proteins in the feature space. Experiment results show that EGWF performs effectively for predicting DNA-binding and protein-binding proteins in terms of Matthew's correlation coefficient (MCC) score and the area value under the receiver operating characteristic curve (AUC). PMID:24334394

  11. Protein function annotation using protein domain family resources.


    Das, Sayoni; Orengo, Christine A


    As a result of the genome sequencing and structural genomics initiatives, we have a wealth of protein sequence and structural data. However, only about 1% of these proteins have experimental functional annotations. As a result, computational approaches that can predict protein functions are essential in bridging this widening annotation gap. This article reviews the current approaches of protein function prediction using structure and sequence based classification of protein domain family resources with a special focus on functional families in the CATH-Gene3D resource. PMID:26434392

  12. Computational Study on Hemoglobin Protein Family

    NASA Astrophysics Data System (ADS)

    Craciun, Dana; Isvoran, Adriana; Avram, Nicolae M.


    We have analyzed 19 proteins belonging to hemoglobin protein family: 3 for plants, 4 for invertebrates and the others for vertebrates. For every protein we have determined the following parameters: the fractal dimension of its backbone, the fractal dimension of its surface, the radius of gyration, the area of its molecular surface and the area of the surface of its cavities. At global level, we did not notice significant differences for the fractal parameters for proteins belonging to different organisms and it underlines that all these proteins perform the same biological function. We have obtained different values of the local and global surface fractal dimensions reflecting distinct roughness of protein pockets in comparison to the entire surface, also in good correlation with the biological function. The geometric characteristics are distinct for the three investigated families of proteins.

  13. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.


    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  14. Competitive protein binding assay for piritrexim

    SciTech Connect

    Woolley, J.L. Jr.; Ringstad, J.L.; Sigel, C.W. )


    A competitive protein binding assay for piritrexim (PTX, 1) that makes use of a commercially available radioassay kit for methotrexate has been developed. After it is selectively extracted from plasma, PTX competes with ({sup 125}I)methotrexate for binding to dihydrofolate reductase isolated from Lactobacillus casei. Free drug is separated from bound drug by adsorption to dextran-coated charcoal. Piritrexim is measurable over a range of 0.01 to 10.0 micrograms/mL in plasma with a coefficient of variation less than 15%. The limit of sensitivity of the assay is approximately 2 ng/mL. An excellent correlation between this assay and a previously published HPLC method was found.

  15. Mutational Insights into the Roles of Amino Acid Residues in Ligand Binding for Two Closely Related Family 16 Carbohydrate Binding Modules

    SciTech Connect

    Su, Xiaoyun; Agarwal, Vinayak; Dodd, Dylan; Bae, Brian; Mackie, Roderick I.; Nair, Satish K.; Cann, Isaac K.O.


    Carbohydrate binding modules (CBMs) are specialized proteins that bind to polysaccharides and oligosaccharides. Caldanaerobius polysaccharolyticus Man5ACBM16-1/CBM16-2 bind to glucose-, mannose-, and glucose/mannose-configured substrates. The crystal structures of the two proteins represent the only examples in CBM family 16, and studies that evaluate the roles of amino acid residues in ligand binding in this family are lacking. In this study, we probed the roles of amino acids (selected based on CBM16-1/ligand co-crystal structures) on substrate binding. Two tryptophan (Trp-20 and Trp-125) and two glutamine (Gln-81 and Gln-93) residues are shown to be critical in ligand binding. Additionally, several polar residues that flank the critical residues also contribute to ligand binding. The CBM16-1 Q121E mutation increased affinity for all substrates tested, whereas the Q21G and N97R mutants exhibited decreased substrate affinity. We solved CBM/substrate co-crystal structures to elucidate the molecular basis of the increased substrate binding by CBM16-1 Q121E. The Gln-121, Gln-21, and Asn-97 residues can be manipulated to fine-tune ligand binding by the Man5A CBMs. Surprisingly, none of the eight residues investigated was absolutely conserved in CBM family 16. Thus, the critical residues in the Man5A CBMs are either not essential for substrate binding in the other members of this family or the two CBMs are evolutionarily distinct from the members available in the current protein database. Man5A is dependent on its CBMs for robust activity, and insights from this study should serve to enhance our understanding of the interdependence of its catalytic and substrate binding modules.

  16. Amyloid beta a4 precursor protein-binding family B member 1 (FE65) interactomics revealed synaptic vesicle glycoprotein 2A (SV2A) and sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (SERCA2) as new binding proteins in the human brain.


    Nensa, Fabian M; Neumann, Martin H D; Schrötter, Andreas; Przyborski, Andre; Mastalski, Thomas; Susdalzew, Sergej; Looβe, Christina; Helling, Stefan; El Magraoui, Fouzi; Erdmann, Ralf; Meyer, Helmut E; Uszkoreit, Julian; Eisenacher, Martin; Suh, Jaehong; Guénette, Suzanne Y; Röhner, Nelli; Kögel, Donat; Theiss, Carsten; Marcus, Katrin; Müller, Thorsten


    FE65 is a cytosolic adapter protein and an important binding partner of amyloid precursor protein. Dependent on Thr668 phosphorylation in amyloid precursor protein, which influences amyloidogenic amyloid precursor protein processing, FE65 undergoes nuclear translocation, thereby transmitting a signal from the cell membrane to the nucleus. As this translocation may be relevant in Alzheimer disease, and as FE65 consists of three protein-protein interaction domains able to bind and affect a variety of other proteins and downstream signaling pathways, the identification of the FE65 interactome is of central interest in Alzheimer disease research. In this study, we identified 121 proteins as new potential FE65 interacting proteins in a pulldown/mass spectrometry approach using human post-mortem brain samples as protein pools for recombinantly expressed FE65. Co-immunoprecipitation assays further validated the interaction of FE65 with the candidates SV2A and SERCA2. In parallel, we investigated the whole cell proteome of primary hippocampal neurons from FE65/FE65L1 double knockout mice. Notably, the validated FE65 binding proteins were also found to be differentially abundant in neurons derived from the FE65 knockout mice relative to wild-type control neurons. SERCA2 is an important player in cellular calcium homeostasis, which was found to be up-regulated in double knockout neurons. Indeed, knock-down of FE65 in HEK293T cells also evoked an elevated sensitivity to thapsigargin, a stressor specifically targeting the activity of SERCA2. Thus, our results suggest that FE65 is involved in the regulation of intracellular calcium homeostasis. Whereas transfection of FE65 alone caused a typical dot-like phenotype in the nucleus, co-transfection of SV2A significantly reduced the percentage of FE65 dot-positive cells, pointing to a possible role for SV2A in the modulation of FE65 intracellular targeting. Given that SV2A has a signaling function at the presynapse, its effect on

  17. Regulation of Pluripotency by RNA Binding Proteins

    PubMed Central

    Ye, Julia; Blelloch, Robert


    Establishment, maintenance, and exit from pluripotency require precise coordination of a cell’s molecular machinery. Substantial headway has been made in deciphering many aspects of this elaborate system, particularly with respect to epigenetics, transcription, and noncoding RNAs. Less attention has been paid to posttranscriptional regulatory processes such as alternative splicing, RNA processing and modification, nuclear export, regulation of transcript stability, and translation. Here, we introduce the RNA binding proteins that enable the posttranscriptional regulation of gene expression, summarizing current and ongoing research on their roles at different regulatory points and discussing how they help script the fate of pluripotent stem cells. PMID:25192462

  18. Gene encoding herbicide safener binding protein

    SciTech Connect

    Walton, Jonathan D.; Scott-Craig, John S.


    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  19. Overlapping functions of the yeast oxysterol-binding protein homologues.

    PubMed Central

    Beh, C T; Cool, L; Phillips, J; Rine, J


    The Saccharomyces cerevisiae genome encodes seven homologues of the mammalian oxysterol-binding protein (OSBP), a protein implicated in lipid trafficking and sterol homeostasis. To determine the functions of the yeast OSBP gene family (OSH1-OSH7), we used a combination of genetics, genomics, and sterol lipid analysis to characterize OSH deletion mutants. All 127 combinations and permutations of OSH deletion alleles were constructed. Individual OSH genes were not essential for yeast viability, but the elimination of the entire gene family was lethal. Thus, the family members shared an essential function. In addition, the in vivo depletion of all Osh proteins disrupted sterol homeostasis. Like mutants that affect ergosterol production, the viable combinations of OSH deletion alleles exhibited specific sterol-related defects. Although none of the single OSH deletion mutants was defective for growth, gene expression profiles revealed that each mutant had a characteristic molecular phenotype. Therefore, each gene performed distinct nonessential functions and contributed to a common essential function. Our findings indicated that OSH genes performed a multitude of nonessential roles defined by specific subsets of the genes and that most shared at least one essential role potentially linked to changes in sterol lipid levels. PMID:11238399

  20. Integrated Protein Array Screening and High Throughput Validation of 70 Novel Neural Calmodulin-binding Proteins*

    PubMed Central

    O'Connell, David J.; Bauer, Mikael C.; O'Brien, John; Johnson, Winifred M.; Divizio, Catherine A.; O'Kane, Sara L.; Berggård, Tord; Merino, Alejandro; Åkerfeldt, Karin S.; Linse, Sara; Cahill, Dolores J.


    Calmodulin is an essential regulator of intracellular processes in response to extracellular stimuli mediated by a rise in Ca2+ ion concentration. To profile protein-protein interactions of calmodulin in human brain, we probed a high content human protein array with fluorophore-labeled calmodulin in the presence of Ca2+. This protein array contains 37,200 redundant proteins, incorporating over 10,000 unique human neural proteins from a human brain cDNA library. We designed a screen to find high affinity (KD ≤ 1 μm) binding partners of calmodulin and identified 76 human proteins from all intracellular compartments of which 72 are novel. We measured the binding kinetics of 74 targets with calmodulin using a high throughput surface plasmon resonance assay. Most of the novel calmodulin-target complexes identified have low dissociation rates (koff ≤ 10−3 s−1) and high affinity (KD ≤ 1 μm), consistent with the design of the screen. Many of the identified proteins are known to assemble in neural tissue, forming assemblies such as the spectrin scaffold and the postsynaptic density. We developed a microarray of the identified target proteins with which we can characterize the biochemistry of calmodulin for all targets in parallel. Four novel targets were verified in neural cells by co-immunoprecipitation, and four were selected for exploration of the calmodulin-binding regions. Using synthetic peptides and isothermal titration calorimetry, calmodulin binding motifs were identified in the potassium voltage-gated channel Kv6.1 (residues 474–493), calmodulin kinase-like vesicle-associated protein (residues 302–316), EF-hand domain family member A2 (residues 202–216), and phosphatidylinositol-4-phosphate 5-kinase, type I, γ (residues 400–415). PMID:20068228

  1. Computational Design of DNA-Binding Proteins.


    Thyme, Summer; Song, Yifan


    Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering. PMID:27094297

  2. S100 protein family in human cancer

    PubMed Central

    Chen, Hongyan; Xu, Chengshan; Jin, Qing’e; Liu, Zhihua


    S100 protein family has been implicated in multiple stages of tumorigenesis and progression. Among the S100 genes, 22 are clustered at chromosome locus 1q21, a region frequently rearranged in cancers. S100 protein possesses a wide range of intracellular and extracellular functions such as regulation of calcium homeostasis, cell proliferation, apoptosis, cell invasion and motility, cytoskeleton interactions, protein phosphorylation, regulation of transcriptional factors, autoimmunity, chemotaxis, inflammation and pluripotency. Many lines of evidence suggest that altered expression of S100 proteins was associated with tumor progression and prognosis. Therefore, S100 proteins might also represent potential tumor biomarkers and therapeutic targets. In this review, we summarize the evidence connecting S100 protein family and cancer and discuss the mechanisms by which S100 exerts its diverse functions. PMID:24660101

  3. Measuring Binding Affinity of Protein-Ligand Interaction Using Spectrophotometry: Binding of Neutral Red to Riboflavin-Binding Protein

    ERIC Educational Resources Information Center

    Chenprakhon, Pirom; Sucharitakul, Jeerus; Panijpan, Bhinyo; Chaiyen, Pimchai


    The dissociation constant, K[subscript d], of the binding of riboflavin-binding protein (RP) with neutral red (NR) can be determined by titrating RP to a fixed concentration of NR. Upon adding RP to the NR solution, the maximum absorption peak of NR shifts to 545 nm from 450 nm for the free NR. The change of the absorption can be used to determine…

  4. TIM-family proteins inhibit HIV-1 release

    PubMed Central

    Li, Minghua; Ablan, Sherimay D.; Miao, Chunhui; Zheng, Yi-Min; Fuller, Matthew S.; Rennert, Paul D.; Maury, Wendy; Johnson, Marc C.; Freed, Eric O.; Liu, Shan-Lu


    Accumulating evidence indicates that T-cell immunoglobulin (Ig) and mucin domain (TIM) proteins play critical roles in viral infections. Herein, we report that the TIM-family proteins strongly inhibit HIV-1 release, resulting in diminished viral production and replication. Expression of TIM-1 causes HIV-1 Gag and mature viral particles to accumulate on the plasma membrane. Mutation of the phosphatidylserine (PS) binding sites of TIM-1 abolishes its ability to block HIV-1 release. TIM-1, but to a much lesser extent PS-binding deficient mutants, induces PS flipping onto the cell surface; TIM-1 is also found to be incorporated into HIV-1 virions. Importantly, TIM-1 inhibits HIV-1 replication in CD4-positive Jurkat cells, despite its capability of up-regulating CD4 and promoting HIV-1 entry. In addition to TIM-1, TIM-3 and TIM-4 also block the release of HIV-1, as well as that of murine leukemia virus (MLV) and Ebola virus (EBOV); knockdown of TIM-3 in differentiated monocyte-derived macrophages (MDMs) enhances HIV-1 production. The inhibitory effects of TIM-family proteins on virus release are extended to other PS receptors, such as Axl and RAGE. Overall, our study uncovers a novel ability of TIM-family proteins to block the release of HIV-1 and other viruses by interaction with virion- and cell-associated PS. Our work provides new insights into a virus-cell interaction that is mediated by TIMs and PS receptors. PMID:25136083

  5. Comparative analysis of rigidity across protein families.


    Wells, S A; Jimenez-Roldan, J E; Römer, R A


    We present a comparative study in which 'pebble game' rigidity analysis is applied to multiple protein crystal structures, for each of six different protein families. We find that the main-chain rigidity of a protein structure at a given hydrogen bond energy cutoff is quite sensitive to small structural variations, and conclude that the hydrogen bond constraints in rigidity analysis should be chosen so as to form and test specific hypotheses about the rigidity of a particular protein. Our comparative approach highlights two different characteristic patterns ('sudden' or 'gradual') for protein rigidity loss as constraints are removed, in line with recent results on the rigidity transitions of glassy networks. PMID:19773604

  6. Amyloid Beta A4 Precursor Protein-binding Family B Member 1 (FE65) Interactomics Revealed Synaptic Vesicle Glycoprotein 2A (SV2A) and Sarcoplasmic/Endoplasmic Reticulum Calcium ATPase 2 (SERCA2) as New Binding Proteins in the Human Brain*

    PubMed Central

    Nensa, Fabian M.; Neumann, Martin H. D.; Schrötter, Andreas; Przyborski, Andre; Mastalski, Thomas; Susdalzew, Sergej; Looβe, Christina; Helling, Stefan; El Magraoui, Fouzi; Erdmann, Ralf; Meyer, Helmut E.; Uszkoreit, Julian; Eisenacher, Martin; Suh, Jaehong; Guénette, Suzanne Y.; Röhner, Nelli; Kögel, Donat; Theiss, Carsten; Marcus, Katrin; Müller, Thorsten


    FE65 is a cytosolic adapter protein and an important binding partner of amyloid precursor protein. Dependent on Thr668 phosphorylation in amyloid precursor protein, which influences amyloidogenic amyloid precursor protein processing, FE65 undergoes nuclear translocation, thereby transmitting a signal from the cell membrane to the nucleus. As this translocation may be relevant in Alzheimer disease, and as FE65 consists of three protein–protein interaction domains able to bind and affect a variety of other proteins and downstream signaling pathways, the identification of the FE65 interactome is of central interest in Alzheimer disease research. In this study, we identified 121 proteins as new potential FE65 interacting proteins in a pulldown/mass spectrometry approach using human post-mortem brain samples as protein pools for recombinantly expressed FE65. Co-immunoprecipitation assays further validated the interaction of FE65 with the candidates SV2A and SERCA2. In parallel, we investigated the whole cell proteome of primary hippocampal neurons from FE65/FE65L1 double knockout mice. Notably, the validated FE65 binding proteins were also found to be differentially abundant in neurons derived from the FE65 knockout mice relative to wild-type control neurons. SERCA2 is an important player in cellular calcium homeostasis, which was found to be up-regulated in double knockout neurons. Indeed, knock-down of FE65 in HEK293T cells also evoked an elevated sensitivity to thapsigargin, a stressor specifically targeting the activity of SERCA2. Thus, our results suggest that FE65 is involved in the regulation of intracellular calcium homeostasis. Whereas transfection of FE65 alone caused a typical dot-like phenotype in the nucleus, co-transfection of SV2A significantly reduced the percentage of FE65 dot-positive cells, pointing to a possible role for SV2A in the modulation of FE65 intracellular targeting. Given that SV2A has a signaling function at the presynapse, its effect on

  7. Ligand configurational entropy and protein binding.


    Chang, Chia-en A; Chen, Wei; Gilson, Michael K


    The restriction of a small molecule's motion on binding to a protein causes a loss of configurational entropy, and thus a penalty in binding affinity. Some energy models used in computer-aided ligand design neglect this entropic penalty, whereas others account for it based on an expected drop in the number of accessible rotamers upon binding. However, the validity of the physical assumptions underlying the various approaches is largely unexamined. The present study addresses this issue by using Mining Minima calculations to analyze the association of amprenavir with HIV protease. The computed loss in ligand configurational entropy is large, contributing approximately 25 kcal/mol (4.184 kJ/kcal) to DeltaG degrees. Most of this loss results from narrower energy wells in the bound state, rather than a drop in the number of accessible rotamers. Coupling among rotation/translation and internal degrees of freedom complicates the decomposition of the entropy change into additive terms. The results highlight the potential to gain affinity by designing conformationally restricted ligands and have implications for the formulation of energy models for ligand scoring. PMID:17242351

  8. Ligand configurational entropy and protein binding

    PubMed Central

    Chang, Chia-en A.; Chen, Wei; Gilson, Michael K.


    The restriction of a small molecule's motion on binding to a protein causes a loss of configurational entropy, and thus a penalty in binding affinity. Some energy models used in computer-aided ligand design neglect this entropic penalty, whereas others account for it based on an expected drop in the number of accessible rotamers upon binding. However, the validity of the physical assumptions underlying the various approaches is largely unexamined. The present study addresses this issue by using Mining Minima calculations to analyze the association of amprenavir with HIV protease. The computed loss in ligand configurational entropy is large, contributing ∼25 kcal/mol (4.184 kJ/kcal) to ΔG°. Most of this loss results from narrower energy wells in the bound state, rather than a drop in the number of accessible rotamers. Coupling among rotation/translation and internal degrees of freedom complicates the decomposition of the entropy change into additive terms. The results highlight the potential to gain affinity by designing conformationally restricted ligands and have implications for the formulation of energy models for ligand scoring. PMID:17242351

  9. Alternative polyadenylation and RNA-binding proteins.


    Erson-Bensan, Ayse Elif


    Our understanding of the extent of microRNA-based gene regulation has expanded in an impressive pace over the past decade. Now, we are beginning to better appreciate the role of 3'-UTR (untranslated region) cis-elements which harbor not only microRNA but also RNA-binding protein (RBP) binding sites that have significant effect on the stability and translational rate of mRNAs. To add further complexity, alternative polyadenylation (APA) emerges as a widespread mechanism to regulate gene expression by producing shorter or longer mRNA isoforms that differ in the length of their 3'-UTRs or even coding sequences. Resulting shorter mRNA isoforms generally lack cis-elements where trans-acting factors bind, and hence are differentially regulated compared with the longer isoforms. This review focuses on the RBPs involved in APA regulation and their action mechanisms on APA-generated isoforms. A better understanding of the complex interactions between APA and RBPs is promising for mechanistic and clinical implications including biomarker discovery and new therapeutic approaches. PMID:27208003

  10. The modular architecture of protein-protein binding interfaces.


    Reichmann, D; Rahat, O; Albeck, S; Meged, R; Dym, O; Schreiber, G


    Protein-protein interactions are essential for life. Yet, our understanding of the general principles governing binding is not complete. In the present study, we show that the interface between proteins is built in a modular fashion; each module is comprised of a number of closely interacting residues, with few interactions between the modules. The boundaries between modules are defined by clustering the contact map of the interface. We show that mutations in one module do not affect residues located in a neighboring module. As a result, the structural and energetic consequences of the deletion of entire modules are surprisingly small. To the contrary, within their module, mutations cause complex energetic and structural consequences. Experimentally, this phenomenon is shown on the interaction between TEM1-beta-lactamase and beta-lactamase inhibitor protein (BLIP) by using multiple-mutant analysis and x-ray crystallography. Replacing an entire module of five interface residues with Ala created a large cavity in the interface, with no effect on the detailed structure of the remaining interface. The modular architecture of binding sites, which resembles human engineering design, greatly simplifies the design of new protein interactions and provides a feasible view of how these interactions evolved. PMID:15618400

  11. Phosfinder: a web server for the identification of phosphate-binding sites on protein structures.


    Parca, Luca; Mangone, Iolanda; Gherardini, Pier Federico; Ausiello, Gabriele; Helmer-Citterich, Manuela


    Phosfinder is a web server for the identification of phosphate binding sites in protein structures. Phosfinder uses a structural comparison algorithm to scan a query structure against a set of known 3D phosphate binding motifs. Whenever a structural similarity between the query protein and a phosphate binding motif is detected, the phosphate bound by the known motif is added to the protein structure thus representing a putative phosphate binding site. Predicted binding sites are then evaluated according to (i) their position with respect to the query protein solvent-excluded surface and (ii) the conservation of the binding residues in the protein family. The server accepts as input either the PDB code of the protein to be analyzed or a user-submitted structure in PDB format. All the search parameters are user modifiable. Phosfinder outputs a list of predicted binding sites with detailed information about their structural similarity with known phosphate binding motifs, and the conservation of the residues involved. A graphical applet allows the user to visualize the predicted binding sites on the query protein structure. The results on a set of 52 apo/holo structure pairs show that the performance of our method is largely unaffected by ligand-induced conformational changes. Phosfinder is available at PMID:21622655

  12. Expression and localization of X11 family proteins in neurons.


    Motodate, Rika; Saito, Yuhki; Hata, Saori; Suzuki, Toshiharu


    The X11/Mint family of proteins comprises X11/X11α/Mint1, X11L/X11β/Mint2, and X11L2/X11γ/Mint3. Each of these molecules is an adaptor protein that contains a phosphotyrosine interaction/binding (PI/PTB) and two PDZ domains in its carboxy-terminal region. X11/Mint family members associate with a broad spectrum of membrane proteins, including Alzheimer's β-amyloid precursor protein (APP), alcadeins, and low density lipoprotein receptor proteins, as well as various cytoplasmic proteins including Arf, kalirin-7, and Munc18. In particular, X11 and X11L are thought to play various roles in the regulation of neural functions in brain. Nevertheless, the protein levels and respective localization of individual family members remain controversial. We analyzed the protein levels of X11 and X11L in the corresponding single- and double-knockout mice. X11 and X11L did not exhibit obvious changes of their protein levels when the other was absent, especially in cerebrum in which they were widely co-expressed. In cerebellum, X11 and X11L localized in characteristic patterns in various types of neurons, and X11 protein level increased without an obvious ectopic localization in X11L-knockout mice. Interestingly, only X11L protein existed specifically in brain, whereas, contrary to the accepted view, X11 protein was detected at the highest levels in brain but was also strongly detected in pancreas, testis, and paranephros. Together, our results indicate that both X11 and X11L exert largely in brain neurons, but X11 may also function in peripheral tissues. PMID:27268412

  13. Prednisolone protein binding in renal transplant patients.

    PubMed Central

    Reece, P A; Disney, A P; Stafford, I; Shastry, J C


    Prednisolone pharmacokinetics and protein binding characteristics were studied in 10 renal transplant patients with various degrees of renal function (serum creatinine: 80-380 mumol/l) who received their usual oral maintenance dose of prednisolone (0.18 +/- 0.04 mg/kg). Plasma was assayed for prednisolone and hydrocortisone by h.p.l.c. and free prednisolone concentrations were determined in each sample by a rapid ultrafiltration technique. Free prednisolone area under curve (AUCu) ranged from 101 to 436 ng ml-1 h and was 6.3 to 15.0% of total prednisolone AUC. The fraction AUCu/AUC was closely related to serum albumin and creatinine concentrations determined at the time of study (multilinear regression correlation coefficient r2 = 0.830, P less than 0.0001); elevated serum creatinine and low albumin concentrations were associated with a higher % free. These results suggest that much of the variability in prednisolone protein binding could be attributed to inter-patient variability in serum albumin and creatinine concentrations. Total prednisolone concentrations would be potentially misleading in any comparisons made between patient groups with different renal function. PMID:3899153

  14. Variant-specific surface proteins of Giardia lamblia are zinc-binding proteins.

    PubMed Central

    Nash, T E; Mowatt, M R


    Giardia lamblia undergoes surface antigenic variation. The variant-specific surface proteins (VSPs) are a distinct family of cysteine-rich proteins. Characteristically, cysteine residues occur mostly as CXXC tetrapeptides. Four of the reported five VSPs contain a putative metal-binding domain that resembles other metal-binding motifs; the fifth is closely related but lacks an essential histidine. Three different native VSPs bound Zn2+. Co2+, Cu2+, and Cd2+ inhibited Zn2+ binding. Analysis of recombinant VSP fusion proteins showed that the putative binding motif bound Zn2+. Surprisingly, peptide fragments from other regions of the VSP contain numerous CXXCXnCXXC motifs that also bound Zn2+. Analysis of deduced amino acid sequences showed well-conserved CXXC spacing in three out of five VSPs, suggesting conservation of structure despite amino acid sequence divergence. The function of VSPs is unknown, but by binding Zn2+ or other metals in the intestine, VSPs may contribute to Zn2+ malnutrition or inhibition of metal-dependent intestinal enzymes, which would lead to malabsorption, a well-known consequence of giardiasis. Images Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8516291

  15. The APOBEC Protein Family: United by Structure, Divergent in Function.


    Salter, Jason D; Bennett, Ryan P; Smith, Harold C


    The APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of proteins have diverse and important functions in human health and disease. These proteins have an intrinsic ability to bind to both RNA and single-stranded (ss) DNA. Both function and tissue-specific expression varies widely for each APOBEC protein. We are beginning to understand that the activity of APOBEC proteins is regulated through genetic alterations, changes in their transcription and mRNA processing, and through their interactions with other macromolecules in the cell. Loss of cellular control of APOBEC activities leads to DNA hypermutation and promiscuous RNA editing associated with the development of cancer or viral drug resistance, underscoring the importance of understanding how APOBEC proteins are regulated. PMID:27283515

  16. Immunoglobulin VH clan and family identity predicts variable domain structure and may influence antigen binding.

    PubMed Central

    Kirkham, P M; Mortari, F; Newton, J A; Schroeder, H W


    Mammalian immunoglobulin VH families can be grouped into three distinct clans based upon sequence conservation in two of the three framework (FR) intervals. Through replacement/silent site substitution analysis, molecular modeling and mathematical evaluation of known immunoglobulin crystal structures, we demonstrate that this conservation reflects preservation of protein sequence and structure. Each clan contains a characteristic FR 1 interval that is solvent-exposed and structurally separated from the antigen binding site. Families within a clan contain their own unique FR 3 interval that is capable of either influencing the conformation of the antigen binding site or interacting directly with antigen. Our results provide a structural context for theories that address differential use of VH families in the immune response. Images PMID:1537339

  17. Arylfluorosulfates Inactivate Intracellular Lipid Binding Protein(s) through Chemoselective SuFEx Reaction with a Binding Site Tyr Residue.


    Chen, Wentao; Dong, Jiajia; Plate, Lars; Mortenson, David E; Brighty, Gabriel J; Li, Suhua; Liu, Yu; Galmozzi, Andrea; Lee, Peter S; Hulce, Jonathan J; Cravatt, Benjamin F; Saez, Enrique; Powers, Evan T; Wilson, Ian A; Sharpless, K Barry; Kelly, Jeffery W


    Arylfluorosulfates have appeared only rarely in the literature and have not been explored as probes for covalent conjugation to proteins, possibly because they were assumed to possess high reactivity, as with other sulfur(VI) halides. However, we find that arylfluorosulfates become reactive only under certain circumstances, e.g., when fluoride displacement by a nucleophile is facilitated. Herein, we explore the reactivity of structurally simple arylfluorosulfates toward the proteome of human cells. We demonstrate that the protein reactivity of arylfluorosulfates is lower than that of the corresponding aryl sulfonyl fluorides, which are better characterized with regard to proteome reactivity. We discovered that simple hydrophobic arylfluorosulfates selectively react with a few members of the intracellular lipid binding protein (iLBP) family. A central function of iLBPs is to deliver small-molecule ligands to nuclear hormone receptors. Arylfluorosulfate probe 1 reacts with a conserved tyrosine residue in the ligand-binding site of a subset of iLBPs. Arylfluorosulfate probes 3 and 4, featuring a biphenyl core, very selectively and efficiently modify cellular retinoic acid binding protein 2 (CRABP2), both in vitro and in living cells. The X-ray crystal structure of the CRABP2-4 conjugate, when considered together with binding site mutagenesis experiments, provides insight into how CRABP2 might activate arylfluorosulfates toward site-specific reaction. Treatment of breast cancer cells with probe 4 attenuates nuclear hormone receptor activity mediated by retinoic acid, an endogenous client lipid of CRABP2. Our findings demonstrate that arylfluorosulfates can selectively target single iLBPs, making them useful for understanding iLBP function. PMID:27191344

  18. Isolation of a Thiamine-binding Protein from Rice Germ and Distribution of Similar Proteins.


    Shimizu, M; Yoshida, T; Toda, T; Iwashima, A; Mitsunaga, T


    A thiamine-binding protein was purified from rice germ (Oryza sativa L.) by extraction, salting-out with ammonium sulfate, and column chromatography. From the results of molecular mass, Kd and Bmax values for thiamine-binding, binding specificity for thiamine phosphates and analog, the protein was suggested to be identical to the thiamine-binding protein in rice bran. The thiamine-binding protein w as more efficiently purified from rice germ than from rice bran. The protein was rich in glutamic acid (and/or glutamine) and glycine. The protein did not show immunological similarity to thiamine-binding proteins in buckwheat and sesame seeds. However proteins similar to the thiamine-binding protein from rice germ existed in gramineous seeds. They were suggested to have thiamine-binding activity and to be of the same molecular mass as the thiamine-binding protein. PMID:27299548

  19. Crystal Structures of the Tryptophan Repressor binding Protein WrbA and complexes with Flavin Mononucleotide

    SciTech Connect

    Gorman,J.; Shapiro, L.


    The tryptophan repressor binding protein WrbA binds to the tryptophan repressor protein TrpR. Although the biological role of WrbA remains unclear, it has been proposed to function in enhancing the stability of TrpR-DNA complexes. Sequence database analysis has identified WrbA as a founding member of a flavodoxin-like family of proteins. Here we present crystal structures of WrbA from Deinococcus radiodurans and Pseudomonas aeruginosa and their complexes with flavin mononucleotide. The protomer structure is similar to that of previously determined long-chain flavodoxins; however, each contains a conserved inserted region unique to the WrbA family. Interestingly, each WrbA protein forms a homotetramer with 222 symmetry, unique among flavodoxin-like proteins, in which each protomer binds one flavin mononucleotide cofactor molecule.

  20. Flies expand the repertoire of protein structures that bind ice

    PubMed Central

    Basu, Koli; Graham, Laurie A.; Campbell, Robert L.; Davies, Peter L.


    An antifreeze protein (AFP) with no known homologs has been identified in Lake Ontario midges (Chironomidae). The midge AFP is expressed as a family of isoforms at low levels in adults, which emerge from fresh water in spring before the threat of freezing temperatures has passed. The 9.1-kDa major isoform derived from a preproprotein precursor is glycosylated and has a 10-residue tandem repeating sequence xxCxGxYCxG, with regularly spaced cysteines, glycines, and tyrosines comprising one-half its 79 residues. Modeling and molecular dynamics predict a tightly wound left-handed solenoid fold in which the cysteines form a disulfide core to brace each of the eight 10-residue coils. The solenoid is reinforced by intrachain hydrogen bonds, side-chain salt bridges, and a row of seven stacked tyrosines on the hydrophobic side that forms the putative ice-binding site. A disulfide core is also a feature of the similar-sized beetle AFP that is a β-helix with seven 12-residue coils and a comparable circular dichroism spectrum. The midge and beetle AFPs are not homologous and their ice-binding sites are radically different, with the latter comprising two parallel arrays of outward-pointing threonines. However, their structural similarities is an amazing example of convergent evolution in different orders of insects to cope with change to a colder climate and provide confirmation about the physical features needed for a protein to bind ice. PMID:25561557

  1. A calmodulin binding protein from Arabidopsis is induced by ethylene and contains a DNA-binding motif

    NASA Technical Reports Server (NTRS)

    Reddy, A. S.; Reddy, V. S.; Golovkin, M.


    Calmodulin (CaM), a key calcium sensor in all eukaryotes, regulates diverse cellular processes by interacting with other proteins. To isolate CaM binding proteins involved in ethylene signal transduction, we screened an expression library prepared from ethylene-treated Arabidopsis seedlings with 35S-labeled CaM. A cDNA clone, EICBP (Ethylene-Induced CaM Binding Protein), encoding a protein that interacts with activated CaM was isolated in this screening. The CaM binding domain in EICBP was mapped to the C-terminus of the protein. These results indicate that calcium, through CaM, could regulate the activity of EICBP. The EICBP is expressed in different tissues and its expression in seedlings is induced by ethylene. The EICBP contains, in addition to a CaM binding domain, several features that are typical of transcription factors. These include a DNA-binding domain at the N terminus, an acidic region at the C terminus, and nuclear localization signals. In database searches a partial cDNA (CG-1) encoding a DNA-binding motif from parsley and an ethylene up-regulated partial cDNA from tomato (ER66) showed significant similarity to EICBP. In addition, five hypothetical proteins in the Arabidopsis genome also showed a very high sequence similarity with EICBP, indicating that there are several EICBP-related proteins in Arabidopsis. The structural features of EICBP are conserved in all EICBP-related proteins in Arabidopsis, suggesting that they may constitute a new family of DNA binding proteins and are likely to be involved in modulating gene expression in the presence of ethylene.

  2. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein.


    Sawicka, Kirsty; Bushell, Martin; Spriggs, Keith A; Willis, Anne E


    PTB (polypyrimidine-tract-binding protein) is a ubiquitous RNA-binding protein. It was originally identified as a protein with a role in splicing but it is now known to function in a large number of diverse cellular processes including polyadenylation, mRNA stability and translation initiation. Specificity of PTB function is achieved by a combination of changes in the cellular localization of this protein (its ability to shuttle from the nucleus to the cytoplasm is tightly controlled) and its interaction with additional proteins. These differences in location and trans-acting factor requirements account for the fact that PTB acts both as a suppressor of splicing and an activator of translation. In the latter case, the role of PTB in translation has been studied extensively and it appears that this protein is required for an alternative form of translation initiation that is mediated by a large RNA structural element termed an IRES (internal ribosome entry site) that allows the synthesis of picornaviral proteins and cellular proteins that function to control cell growth and cell death. In the present review, we discuss how PTB regulates these disparate processes. PMID:18631133

  3. Microplate-Based Characterization of Protein-Phosphoinositide Binding Interactions Using a Synthetic Biotinylated Headgroup Analogue

    PubMed Central

    Gong, Denghuang; Smith, Matthew D.; Manna, Debasis; Bostic, Heidi E.; Cho, Wonhwa; Best, Michael D.


    Membrane lipids act as important regulators of a litany of important physiological and pathophysiological events. Many of them act as site-specific ligands for cytosolic proteins in binding events that recruit receptors to the cell surface and control both protein function and subcellular localization. Phosphatidylinositol phosphates (PIPns) are a family of signaling lipids that regulate numerous cellular processes by interacting with a myriad of protein binding modules. Characterization of PIPn-binding proteins has been hampered by the lack of a rapid and convenient quantitative assay. Herein, microplate-based detection is presented as an effective approach to characterizing protein-PIPn binding interactions at the molecular level. With this assay, the binding of proteins to isolated PIPn headgroups is detected with high sensitivity using a platform that is amenable to high-throughput screening. In the studies described herein, biotinylated PI-(4,5)-P2 headgroup analogue 1 was designed, synthesized and immobilized onto 96-well streptavidin-coated microplates to study receptor binding. This assay was used to characterize the binding of the PH domain of β-spectrin to this headgroup. The high affinity interaction that was detected for surface association (Kd, surf = 6 nM ±3), demonstrates that receptor binding modules can form high affinity interactions with lipid headgroups outside of a membrane environment. The results also indicate the feasibility of the assay for rapid characterization of PIPn-binding proteins as well as the promise for high-throughput analysis of protein-PIPn binding interactions. Finally, this assay was also employed to characterize the inhibition of the binding of receptors to the PIPn-derivatized microplates using solution phase competitors. This showcases the viability of this assay for rapid screening of inhibitors of PIPn-binding proteins. PMID:19182890

  4. Closing of the nucleotide pocket of kinesin-family motors upon binding to microtubules.


    Naber, Nariman; Minehardt, Todd J; Rice, Sarah; Chen, Xiaoru; Grammer, Jean; Matuska, Marija; Vale, Ronald D; Kollman, Peter A; Car, Roberto; Yount, Ralph G; Cooke, Roger; Pate, Edward


    We have used adenosine diphosphate analogs containing electron paramagnetic resonance (EPR) spin moieties and EPR spectroscopy to show that the nucleotide-binding site of kinesin-family motors closes when the motor.diphosphate complex binds to microtubules. Structural analyses demonstrate that a domain movement in the switch 1 region at the nucleotide site, homologous to domain movements in the switch 1 region in the G proteins [heterotrimeric guanine nucleotide-binding proteins], explains the EPR data. The switch movement primes the motor both for the free energy-yielding nucleotide hydrolysis reaction and for subsequent conformational changes that are crucial for the generation of force and directed motion along the microtubule. PMID:12730601

  5. Identification of VPS13C as a Galectin-12-Binding Protein That Regulates Galectin-12 Protein Stability and Adipogenesis

    PubMed Central

    Yang, Ri-Yao; Xue, Huiting; Yu, Lan; Velayos-Baeza, Antonio; Monaco, Anthony P.; Liu, Fu-Tong


    Galectin-12, a member of the galectin family of β-galactoside-binding animal lectins, is preferentially expressed in adipocytes and required for adipocyte differentiation in vitro. This protein was recently found to regulate lipolysis, whole body adiposity, and glucose homeostasis in vivo. Here we identify VPS13C, a member of the VPS13 family of vacuolar protein sorting-associated proteins highly conserved throughout eukaryotic evolution, as a major galectin-12-binding protein. VPS13C is upregulated during adipocyte differentiation, and is required for galectin-12 protein stability. Knockdown of Vps13c markedly reduces the steady-state levels of galectin-12 by promoting its degradation through primarily the lysosomal pathway, and impairs adipocyte differentiation. Our studies also suggest that VPS13C may have a broader role in protein quality control. The regulation of galectin-12 stability by VPS13C could potentially be exploited for therapeutic intervention of obesity and related metabolic diseases. PMID:27073999

  6. Structural delineation of stem-loop RNA binding by human TAF15 protein.


    Kashyap, Maruthi; Ganguly, Akshay Kumar; Bhavesh, Neel Sarovar


    Human TATA binding protein associated factor 2 N (TAF15) and Fused in sarcoma (FUS) are nucleic acid binding proteins belonging to the conserved FET family of proteins. They are involved in diverse processes such as pre-mRNA splicing, mRNA transport, and DNA binding. The absence of information regarding the structural mechanism employed by the FET family in recognizing and discriminating their cognate and non-cognate RNA targets has hampered the attainment of consensus on modes of protein-RNA binding for this family. Our study provides a molecular basis of this RNA recognition using a combination of solution-state NMR spectroscopy, calorimetry, docking and molecular dynamics simulation. Analysis of TAF15-RRM solution structure and its binding with stem-loop RNA has yielded conclusive evidence of a non-canonical mode of RNA recognition. Rather than classical stacking interactions that occur across nitrogen bases and aromatic amino acids on ribonucleoprotein sites, moderate-affinity hydrogen bonding network between the nitrogen bases in the stem-loop RNA and a concave face on the RRM surface primarily mediate TAF15-RRM RNA interaction. We have compared the binding affinities across a set of single-stranded RNA oligonucleotides to conclusively establish that RNA binding is dependent upon structural elements in the RNA rather than sequence. PMID:26612539

  7. Structural delineation of stem-loop RNA binding by human TAF15 protein

    PubMed Central

    Kashyap, Maruthi; Ganguly, Akshay Kumar; Bhavesh, Neel Sarovar


    Human TATA binding protein associated factor 2 N (TAF15) and Fused in sarcoma (FUS) are nucleic acid binding proteins belonging to the conserved FET family of proteins. They are involved in diverse processes such as pre-mRNA splicing, mRNA transport, and DNA binding. The absence of information regarding the structural mechanism employed by the FET family in recognizing and discriminating their cognate and non-cognate RNA targets has hampered the attainment of consensus on modes of protein-RNA binding for this family. Our study provides a molecular basis of this RNA recognition using a combination of solution-state NMR spectroscopy, calorimetry, docking and molecular dynamics simulation. Analysis of TAF15-RRM solution structure and its binding with stem-loop RNA has yielded conclusive evidence of a non-canonical mode of RNA recognition. Rather than classical stacking interactions that occur across nitrogen bases and aromatic amino acids on ribonucleoprotein sites, moderate-affinity hydrogen bonding network between the nitrogen bases in the stem-loop RNA and a concave face on the RRM surface primarily mediate TAF15-RRM RNA interaction. We have compared the binding affinities across a set of single-stranded RNA oligonucleotides to conclusively establish that RNA binding is dependent upon structural elements in the RNA rather than sequence. PMID:26612539

  8. Structure and ligand-binding properties of the biogenic amine-binding protein from the saliva of a blood-feeding insect vector of Trypanosoma cruzi

    PubMed Central

    Xu, Xueqing; Chang, Bianca W.; Mans, Ben J.; Ribeiro, Jose M. C.; Andersen, John F.


    Proteins that bind small-molecule mediators of inflammation and hemostasis are essential for blood-feeding by arthropod vectors of infectious disease. In ticks and triatomine insects, the lipocalin protein family is greatly expanded and members have been shown to bind biogenic amines, eicosanoids and ADP. These compounds are potent mediators of platelet activation, inflammation and vascular tone. In this paper, the structure of the amine-binding protein (ABP) from Rhodnius prolixus, a vector of the trypanosome that causes Chagas disease, is described. ABP binds the biogenic amines serotonin and norepinephrine with high affinity. A complex with tryptamine shows the presence of a binding site for a single ligand molecule in the central cavity of the β-barrel structure. The cavity contains significant additional volume, suggesting that this protein may have evolved from the related nitrophorin proteins, which bind a much larger heme ligand in the central cavity. PMID:23275168

  9. Structural neighboring property for identifying protein-protein binding sites

    PubMed Central


    Background The protein-protein interaction plays a key role in the control of many biological functions, such as drug design and functional analysis. Determination of binding sites is widely applied in molecular biology research. Therefore, many efficient methods have been developed for identifying binding sites. In this paper, we calculate structural neighboring property through Voronoi diagram. Using 6,438 complexes, we study local biases of structural neighboring property on interface. Results We propose a novel statistical method to extract interacting residues, and interacting patches can be clustered as predicted interface residues. In addition, structural neighboring property can be adopted to construct a new energy function, for evaluating docking solutions. It includes new statistical property as well as existing energy items. Comparing to existing methods, our approach improves overall Fnat value by at least 3%. On Benchmark v4.0, our method has average Irmsd value of 3.31Å and overall Fnat value of 63%, which improves upon Irmsd of 3.89 Å and Fnat of 49% for ZRANK, and Irmsd of 3.99Å and Fnat of 46% for ClusPro. On the CAPRI targets, our method has average Irmsd value of 3.46 Å and overall Fnat value of 45%, which improves upon Irmsd of 4.18 Å and Fnat of 40% for ZRANK, and Irmsd of 5.12 Å and Fnat of 32% for ClusPro. Conclusions Experiments show that our method achieves better results than some state-of-the-art methods for identifying protein-protein binding sites, with the prediction quality improved in terms of CAPRI evaluation criteria. PMID:26356630

  10. Phosphorylation of spore coat proteins by a family of atypical protein kinases.


    Nguyen, Kim B; Sreelatha, Anju; Durrant, Eric S; Lopez-Garrido, Javier; Muszewska, Anna; Dudkiewicz, Małgorzata; Grynberg, Marcin; Yee, Samantha; Pogliano, Kit; Tomchick, Diana R; Pawłowski, Krzysztof; Dixon, Jack E; Tagliabracci, Vincent S


    The modification of proteins by phosphorylation occurs in all life forms and is catalyzed by a large superfamily of enzymes known as protein kinases. We recently discovered a family of secretory pathway kinases that phosphorylate extracellular proteins. One member, family with sequence similarity 20C (Fam20C), is the physiological Golgi casein kinase. While examining distantly related protein sequences, we observed low levels of identity between the spore coat protein H (CotH), and the Fam20C-related secretory pathway kinases. CotH is a component of the spore in many bacterial and eukaryotic species, and is required for efficient germination of spores in Bacillus subtilis; however, the mechanism by which CotH affects germination is unclear. Here, we show that CotH is a protein kinase. The crystal structure of CotH reveals an atypical protein kinase-like fold with a unique mode of ATP binding. Examination of the genes neighboring cotH in B. subtilis led us to identify two spore coat proteins, CotB and CotG, as CotH substrates. Furthermore, we show that CotH-dependent phosphorylation of CotB and CotG is required for the efficient germination of B. subtilis spores. Collectively, our results define a family of atypical protein kinases and reveal an unexpected role for protein phosphorylation in spore biology. PMID:27185916

  11. RNA Bind-n-Seq: Measuring the Binding Affinity Landscape of RNA-Binding Proteins.


    Lambert, Nicole J; Robertson, Alex D; Burge, Christopher B


    RNA-binding proteins (RBPs) coordinate post-transcriptional control of gene expression, often through sequence-specific recognition of primary transcripts or mature messenger RNAs. Hundreds of RBPs are encoded in the human genome, most with undefined or incompletely defined biological roles. Understanding the function of these factors will require the identification of each RBP's distinct RNA binding specificity. RNA Bind-n-Seq (RBNS) is a high-throughput, cost-effective in vitro method capable of resolving sequence and secondary structure preferences of RBPs. Dissociation constants can also be inferred from RBNS data when provided with additional experimental information. Here, we describe the experimental procedures to perform RBNS and discuss important parameters of the method and ways that the experiment can be tailored to the specific RBP under study. Additionally, we present the conceptual framework and execution of the freely available RBNS computational pipeline and describe the outputs of the pipeline. Different approaches to quantify binding specificity, quality control metrics, and estimation of binding constants are also covered. PMID:26068750

  12. Affinity regression predicts the recognition code of nucleic acid binding proteins

    PubMed Central

    Pelossof, Raphael; Singh, Irtisha; Yang, Julie L.; Weirauch, Matthew T.; Hughes, Timothy R.; Leslie, Christina S.


    Predicting the affinity profiles of nucleic acid-binding proteins directly from the protein sequence is a major unsolved problem. We present a statistical approach for learning the recognition code of a family of transcription factors (TFs) or RNA-binding proteins (RBPs) from high-throughput binding assays. Our method, called affinity regression, trains on protein binding microarray (PBM) or RNA compete experiments to learn an interaction model between proteins and nucleic acids, using only protein domain and probe sequences as inputs. By training on mouse homeodomain PBM profiles, our model correctly identifies residues that confer DNA-binding specificity and accurately predicts binding motifs for an independent set of divergent homeodomains. Similarly, learning from RNA compete profiles for diverse RBPs, our model can predict the binding affinities of held-out proteins and identify key RNA-binding residues. More broadly, we envision applying our method to model and predict biological interactions in any setting where there is a high-throughput ‘affinity’ readout. PMID:26571099

  13. Molecular cloning of bullfrog saxiphilin: a unique relative of the transferrin family that binds saxitoxin.

    PubMed Central

    Morabito, M A; Moczydlowski, E


    Plasma and tissue of certain vertebrates contain a protein called saxiphilin that specifically binds the neurotoxin saxitoxin with nanomolar affinity. We describe the isolation of a cDNA clone of saxiphilin from liver of the North American bullfrog (Rana catesbeiana). The cDNA sequence encodes a protein that is evolutionarily related to members of the transferrin family of Fe(3+)-binding proteins. Pairwise sequence alignment of saxiphilin with various transferrins reveals amino acid identity as high as 51% and predicts 14 disulfide bonds that are highly conserved. The larger size of saxiphilin (91 kDa) versus serum transferrin (approximately 78 kDa) is primarily due to a unique insertion of 144 residues. This insertion contains a 49-residue domain classified as a type 1 repetitive element of thyroglobulin, which is shared by a variety of membrane, secreted, and extracellular matrix proteins. Saxiphilin also differs from transferrins in 9 of 10 highly conserved amino acids in the two homologous Fe3+/HCO3-binding sites of transferrin. Identification of saxiphilin implies that transferrin-like proteins comprise a diverse superfamily with functions other than iron binding. Images PMID:8146142

  14. Plant Cytosolic Acyl-CoA-Binding Proteins.


    Ye, Zi-Wei; Chye, Mee-Len


    A gene family encoding six members of acyl-CoA-binding proteins (ACBP) exists in Arabidopsis and they are designated as AtACBP1-AtACBP6. They have been observed to play pivotal roles in plant lipid metabolism, consistent to the abilities of recombinant AtACBP in binding different medium- and long-chain acyl-CoA esters in vitro. While AtACBP1 and AtACBP2 are membrane-associated proteins with ankyrin repeats and AtACBP3 contains a signaling peptide for targeting to the apoplast, AtACBP4, AtACBP5 and AtACBP6 represent the cytosolic forms in the AtACBP family. They were verified to be subcellularly localized in the cytosol using diverse experimental methods, including cell fractionation followed by western blot analysis, immunoelectron microscopy and confocal laser-scanning microscopy using autofluorescence-tagged fusions. AtACBP4 (73.2 kDa) and AtACBP5 (70.1 kDa) are the largest, while AtACBP6 (10.4 kDa) is the smallest. Their binding affinities to oleoyl-CoA esters suggested that they can potentially transfer oleoyl-CoA esters from the plastids to the endoplasmic reticulum, facilitating the subsequent biosynthesis of non-plastidial membrane lipids in Arabidopsis. Recent studies on ACBP, extended from a dicot (Arabidopsis) to a monocot, revealed that six ACBP are also encoded in rice (Oryza sativa). Interestingly, three small rice ACBP (OsACBP1, OsACBP2 and OsACBP3) are present in the cytosol in comparison to one (AtACBP6) in Arabidopsis. In this review, the combinatory and distinct roles of the cytosolic AtACBP are discussed, including their functions in pollen and seed development, light-dependent regulation and substrate affinities to acyl-CoA esters. PMID:26662549

  15. Oligosaccharide Binding Proteins from Bifidobacterium longum subsp. infantis Reveal a Preference for Host Glycans

    PubMed Central

    Garrido, Daniel; Kim, Jae Han; German, J. Bruce; Raybould, Helen E.; Mills, David A.


    Bifidobacterium longum subsp. infantis (B. infantis) is a common member of the infant intestinal microbiota, and it has been characterized by its foraging capacity for human milk oligosaccharides (HMO). Its genome sequence revealed an overabundance of the Family 1 of solute binding proteins (F1SBPs), part of ABC transporters and associated with the import of oligosaccharides. In this study we have used the Mammalian Glycan Array to determine the specific affinities of these proteins. This was correlated with binding protein expression induced by different prebiotics including HMO. Half of the F1SBPs in B. infantis were determined to bind mammalian oligosaccharides. Their affinities included different blood group structures and mucin oligosaccharides. Related to HMO, other proteins were specific for oligomers of lacto-N-biose (LNB) and polylactosamines with different degrees of fucosylation. Growth on HMO induced the expression of specific binding proteins that import HMO isomers, but also bind blood group and mucin oligosaccharides, suggesting coregulated transport mechanisms. The prebiotic inulin induced other family 1 binding proteins with affinity for intestinal glycans. Most of the host glycan F1SBPs in B. infantis do not have homologs in other bifidobacteria. Finally, some of these proteins were found to be adherent to intestinal epithelial cells in vitro. In conclusion, this study represents further evidence for the particular adaptations of B. infantis to the infant gut environment, and helps to understand the molecular mechanisms involved in this process. PMID:21423604

  16. Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

    PubMed Central

    Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna


    The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

  17. Glycan Masking of Plasmodium vivax Duffy Binding Protein for Probing Protein Binding Function and Vaccine Development

    PubMed Central

    Janes, Joel; Gurumoorthy, Sairam; Gibson, Claire; Melcher, Martin; Chitnis, Chetan E.; Wang, Ruobing; Schief, William R.; Smith, Joseph D.


    Glycan masking is an emerging vaccine design strategy to focus antibody responses to specific epitopes, but it has mostly been evaluated on the already heavily glycosylated HIV gp120 envelope glycoprotein. Here this approach was used to investigate the binding interaction of Plasmodium vivax Duffy Binding Protein (PvDBP) and the Duffy Antigen Receptor for Chemokines (DARC) and to evaluate if glycan-masked PvDBPII immunogens would focus the antibody response on key interaction surfaces. Four variants of PVDBPII were generated and probed for function and immunogenicity. Whereas two PvDBPII glycosylation variants with increased glycan surface coverage distant from predicted interaction sites had equivalent binding activity to wild-type protein, one of them elicited slightly better DARC-binding-inhibitory activity than wild-type immunogen. Conversely, the addition of an N-glycosylation site adjacent to a predicted PvDBP interaction site both abolished its interaction with DARC and resulted in weaker inhibitory antibody responses. PvDBP is composed of three subdomains and is thought to function as a dimer; a meta-analysis of published PvDBP mutants and the new DBPII glycosylation variants indicates that critical DARC binding residues are concentrated at the dimer interface and along a relatively flat surface spanning portions of two subdomains. Our findings suggest that DARC-binding-inhibitory antibody epitope(s) lie close to the predicted DARC interaction site, and that addition of N-glycan sites distant from this site may augment inhibitory antibodies. Thus, glycan resurfacing is an attractive and feasible tool to investigate protein structure-function, and glycan-masked PvDBPII immunogens might contribute to P. vivax vaccine development. PMID:23853575

  18. Identification and isoprenylation of plant GTP-binding proteins.


    Biermann, B; Randall, S K; Crowell, D N


    To identify isoprenylated plant GTP-binding proteins, Arabidopsis thaliana and Nicotiana tabacum cDNA expression libraries were screened for cDNA-encoded proteins capable of binding [32P]GTP in vitro. ATGB2, an Arabidopsis homologue of the GTP-binding protein Rab2, was found to bind GTP in vitro and to be a substrate for a geranylgeranyl:protein transferase (GGTase) present in plant extracts. The carboxyl terminus of this protein contains a -GCCG sequence, which has not previously been shown to be recognized by any prenyl:protein transferase (PTase), but which most closely resembles that isoprenylated by the type II GGTase (-XXCC, -XCXC, or -CCXX). In vitro geranylgeranylation of an Arabidopsis Rab1 protein containing a carboxyl-terminal-CCGQ sequence confirmed the presence of a type II GGTase-like activity in plant extracts. Several other proteins were also identified by in vitro GTP binding, including Arabidopsis and tobacco homologues of Rab11, ARF (ADP-ribosylation factor) and Sar proteins, as well as a novel 22 kDa Arabidopsis protein (ATG81). This 22 kDa protein had consensus GTP-binding motifs and bound GTP with high specificity, but its structure was not closely related to that of any known GTP-binding protein (it most resembled proteins within the ARF/Sar and G protein alpha-subunit superfamilies). PMID:8843944

  19. Protein Function Annotation By Local Binding Site Surface Similarity

    PubMed Central

    Spitzer, Russell; Cleves, Ann E.; Varela, Rocco; Jain, Ajay N.


    Hundreds of protein crystal structures exist for proteins whose function cannot be confidently determined from sequence similarity. Surflex-PSIM, a previously reported surface-based protein similarity algorithm, provides an alternative method for hypothesizing function for such proteins. The method now supports fully automatic binding site detection and is fast enough to screen comprehensive databases of protein binding sites. The binding site detection methodology was validated on apo/holo cognate protein pairs, correctly identifying 91% of ligand binding sites in holo structures and 88% in apo structures where corresponding sites existed. For correctly detected apo binding sites, the cognate holo site was the most similar binding site 87% of the time. PSIM was used to screen a set of proteins that had poorly characterized functions at the time of crystallization, but were later biochemically annotated. Using a fully automated protocol, this set of 8 proteins was screened against approximately 60,000 ligand binding sites from the PDB. PSIM correctly identified functional matches that pre-dated query protein biochemical annotation for five out of the eight query proteins. A panel of twelve currently unannotated proteins was also screened, resulting in a large number of statistically significant binding site matches, some of which suggest likely functions for the poorly characterized proteins. PMID:24166661

  20. RNA-binding protein nucleolin in disease.


    Abdelmohsen, Kotb; Gorospe, Myriam


    Nucleolin is a multifunctional protein localized primarily in the nucleolus, but also found in the nucleoplasm, cytoplasm and cell membrane. It is involved in several aspects of DNA metabolism, and participates extensively in RNA regulatory mechanisms, including transcription, ribosome assembly, mRNA stability and translation, and microRNA processing. Nucleolin's implication in disease is linked to its ability to associate with target RNAs via its four RNA-binding domains and its arginine/glycin-rich domain. By modulating the post-transcriptional fate of target mRNAs, which typically bear AU-rich and/or G-rich elements, nucleolin has been linked to cellular events that influence disease, notably cell proliferation and protection against apoptotic death. Through its diverse RNA functions, nucleolin is increasingly implicated in pathological processes, particularly cancer and viral infection. Here, we review the RNA-binding activities of nucleolin, its influence on gene expression patterns, and its impact upon diseases. We also discuss the rising interest in targeting nucleolin therapeutically. PMID:22617883

  1. RNA-binding protein nucleolin in disease

    PubMed Central

    Abdelmohsen, Kotb; Gorospe, Myriam


    Nucleolin is a multifunctional protein localized primarily in the nucleolus, but also found in the nucleoplasm, cytoplasm and cell membrane. It is involved in several aspects of DNA metabolism, and participates extensively in RNA regulatory mechanisms, including transcription, ribosome assembly, mRNA stability and translation, and microRNA processing. Nucleolin’s implication in disease is linked to its ability to associate with target RNAs via its four RNA-binding domains and its arginine/glycin-rich domain. By modulating the post-transcriptional fate of target mRNAs, which typically bear AU-rich and/or G-rich elements, nucleolin has been linked to cellular events that influence disease, notably cell proliferation and protection against apoptotic death. Through its diverse RNA functions, nucleolin is increasingly implicated in pathological processes, particularly cancer and viral infection. Here, we review the RNA-binding activities of nucleolin, its influence on gene expression patterns, and its impact upon diseases. We also discuss the rising interest in targeting nucleolin therapeutically. PMID:22617883

  2. Latent TGF-β-binding proteins

    PubMed Central

    Robertson, Ian B.; Horiguchi, Masahito; Zilberberg, Lior; Dabovic, Branka; Hadjiolova, Krassimira; Rifkin, Daniel B.


    The LTBPs (or latent transforming growth factor β binding proteins) are important components of the extracellular matrix (ECM) that interact with fibrillin microfibrils and have a number of different roles in microfibril biology. There are four LTBPs isoforms in the human genome (LTBP-1, -2, -3, and -4), all of which appear to associate with fibrillin and the biology of each isoform is reviewed here. The LTBPs were first identified as forming latent complexes with TGFβ by covalently binding the TGFβ propeptide (LAP) via disulfide bonds in the endoplasmic reticulum. LAP in turn is cleaved from the mature TGFβ precursor in the trans golgi network but LAP and TGFβ remain strongly bound through non-covalent interactions. LAP, TGFβ, and LTBP together form the large latent complex (LLC). LTBPs were originally thought to primarily play a role in maintaining TGFβ latency and targeting the latent growth factor to the extracellular matrix (ECM), but it has also been shown that LTBP-1 participates in TGFβ activation by integrins and may also regulate activation by proteases and other factors. LTBP-3 appears to have a role in skeletal formation including tooth development. As well as having important functions in TGFβ regulation, TGFβ-independent activities have recently been identified for LTBP-2 and LTBP-4 in stabilizing microfibril bundles and regulating elastic fiber assembly. PMID:25960419

  3. Acyl-CoA-Binding Proteins (ACBPs) in Plant Development.


    Lung, Shiu-Cheung; Chye, Mee-Len


    Acyl-CoA-binding proteins (ACBPs) play a pivotal role in fatty acid metabolism because they can transport medium- and long-chain acyl-CoA esters. In eukaryotic cells, ACBPs are involved in intracellular trafficking of acyl-CoA esters and formation of a cytosolic acyl-CoA pool. In addition to these ubiquitous functions, more specific non-redundant roles of plant ACBP subclasses are implicated by the existence of multigene families with variable molecular masses, ligand specificities, functional domains (e.g. protein-protein interaction domains), subcellular locations and gene expression patterns. In this chapter, recent progress in the characterization of ACBPs from the model dicot plant, Arabidopsis thaliana, and the model monocot, Oryza sativa, and their emerging roles in plant growth and development are discussed. The functional significance of respective members of the plant ACBP families in various developmental and physiological processes such as seed development and germination, stem cuticle formation, pollen development, leaf senescence, peroxisomal fatty acid β-oxidation and phloem-mediated lipid transport is highlighted. PMID:27023243

  4. Cellular retinol-binding protein and retinoic acid-binding protein in rat testes: effect of retinol depletion.


    Ong, D E; Tsai, C H; Chytil, F


    Testes of rats contain two cellular binding proteins of interest in vitamin A metabolism. One protein binds retinoic acid with high specificity; the other binds retinol with high specificity. When the cellular retinol-binding protein was partially purified from rat testes, it exhibited fluorescence excitation and emission spectra similar to that of all-trans-retinol in hexane. Exposure of this preparation to UV light destroyed this fluorescence but spectra identical to the original were obtained after addition of retinol. Hexane extracts of the binding protein had fluorescence spectra identical to all-trans-retinol, suggesting that this compound is bound to the protein in vivo. Extracts of testes from retinol depleted rats were submitted to gel filtration but failed to show a retinol-like fluorescence at the elution position of retinol binding protein. This fluorescence was observed in the preparations from pair fed control animals. However, after addition of all-trans-retinol to the extracts from the depleted rats, fluorescence at that elution position was observed. This indicates that in testes of retinol depleted rats the cellular retinol binding protein is present but without bound retinol, in contrast to the non-depleted rats where 30-43% of the binding protein had bound retinol. The amounts of cellular retinol binding protein and retinoic acid binding protein in testes, as determined by sucrose gradient centrifugation, were found to be similar for retinol depleted and pair fed control rats. PMID:942996

  5. How Does Confinement Change Ligand-Receptor Binding Equilibrium? Protein Binding in Nanopores and Nanochannels.


    Tagliazucchi, Mario; Szleifer, Igal


    We present systematic studies for the binding of small model proteins to ligands attached to the inner walls of long nanochannels and short nanopores by polymeric tethers. Binding of proteins to specific ligands inside nanometric channels and pores leads to changes in their ionic conductance, which have been exploited in sensors that quantify the concentration of the proteins in solution. The theoretical predictions presented in this work are aimed to provide a fundamental understanding of protein binding under geometrically confined environments and to guide the design of this kind of nanochannel-based sensors. The theory predicts that the fraction of the channel volume filled by bound proteins is a nonmonotonic function of the channel radius, the length of the tethers, the surface density of the ligands and the size of the proteins. Notably, increasing the density of ligands, decreasing the size of the channel or increasing the size of the protein may lead to a decrease of the fraction of the channel volume filled by bound proteins. These results are explained from the incomplete binding of proteins to the ligands due to repulsive protein-protein and protein-ligand steric interactions. Our work suggests strategies to optimize the change in conductance due to protein binding, for example: (i) proteins much smaller than the radius of the channel may effectively block the channel if tethers of appropriate length are used, and (ii) a large decrease in conductance upon protein binding can be achieved if the channel and the protein are oppositely charged. PMID:26368839

  6. Detection of secondary binding sites in proteins using fragment screening

    PubMed Central

    Ludlow, R. Frederick; Verdonk, Marcel L.; Saini, Harpreet K.; Tickle, Ian J.; Jhoti, Harren


    Proteins need to be tightly regulated as they control biological processes in most normal cellular functions. The precise mechanisms of regulation are rarely completely understood but can involve binding of endogenous ligands and/or partner proteins at specific locations on a protein that can modulate function. Often, these additional secondary binding sites appear separate to the primary binding site, which, for example for an enzyme, may bind a substrate. In previous work, we have uncovered several examples in which secondary binding sites were discovered on proteins using fragment screening approaches. In each case, we were able to establish that the newly identified secondary binding site was biologically relevant as it was able to modulate function by the binding of a small molecule. In this study, we investigate how often secondary binding sites are located on proteins by analyzing 24 protein targets for which we have performed a fragment screen using X-ray crystallography. Our analysis shows that, surprisingly, the majority of proteins contain secondary binding sites based on their ability to bind fragments. Furthermore, sequence analysis of these previously unknown sites indicate high conservation, which suggests that they may have a biological function, perhaps via an allosteric mechanism. Comparing the physicochemical properties of the secondary sites with known primary ligand binding sites also shows broad similarities indicating that many of the secondary sites may be druggable in nature with small molecules that could provide new opportunities to modulate potential therapeutic targets. PMID:26655740

  7. Sensory properties of the PII signalling protein family.


    Forchhammer, Karl; Lüddecke, Jan


    PII signalling proteins constitute one of the largest families of signalling proteins in nature. An even larger superfamily of trimeric sensory proteins with the same architectural principle as PII proteins appears in protein structure databases. Large surface-exposed flexible loops protrude from the intersubunit faces, where effector molecules are bound that tune the conformation of the loops. Via this mechanism, PII proteins control target proteins in response to cellular ATP/ADP levels and the 2-oxoglutarate status, thereby coordinating the cellular carbon/nitrogen balance. The antagonistic (ATP versus ADP) and synergistic (2-oxoglutarate and ATP) mode of effector molecule binding is further affected by PII -receptor interaction, leading to a highly sophisticated signalling network organized by PII . Altogether, it appears that PII is a multitasking information processor that, depending on its interaction environment, differentially transmits information on the energy status and the cellular 2-oxoglutarate level. In addition to the basic mode of PII function, several bacterial PII proteins may transmit a signal of the cellular glutamine status via covalent modification. Remarkably, during the evolution of plant chloroplasts, glutamine signalling by PII proteins was re-established by acquisition of a short sequence extension at the C-terminus. This plant-specific C-terminus makes the interaction of plant PII proteins with one of its targets, the arginine biosynthetic enzyme N-acetyl-glutamate kinase, glutamine-dependent. PMID:26527104

  8. Improving Binding Affinity and Selectivity of Computationally Designed Ligand-Binding Proteins Using Experiments.


    Tinberg, Christine E; Khare, Sagar D


    The ability to de novo design proteins that can bind small molecules has wide implications for synthetic biology and medicine. Combining computational protein design with the high-throughput screening of mutagenic libraries of computationally designed proteins is emerging as a general approach for creating binding proteins with programmable binding modes, affinities, and selectivities. The computational step enables the creation of a binding site in a protein that otherwise does not (measurably) bind the intended ligand, and targeted mutagenic screening allows for validation and refinement of the computational model as well as provides orders-of-magnitude increases in the binding affinity. Deep sequencing of mutagenic libraries can provide insights into the mutagenic binding landscape and enable further affinity improvements. Moreover, in such a combined computational-experimental approach where the binding mode is preprogrammed and iteratively refined, selectivity can be achieved (and modulated) by the placement of specified amino acid side chain groups around the ligand in defined orientations. Here, we describe the experimental aspects of a combined computational-experimental approach for designing-using the software suite Rosetta-proteins that bind a small molecule of choice and engineering, using fluorescence-activated cell sorting and high-throughput yeast surface display, high affinity and ligand selectivity. We illustrated the utility of this approach by performing the design of a selective digoxigenin (DIG)-binding protein that, after affinity maturation, binds DIG with picomolar affinity and high selectivity over structurally related steroids. PMID:27094290

  9. Multimerization of Glycosylphosphatidylinositol-anchored High Density Lipoprotein-binding Protein 1 (GPIHBP1) and Familial Chylomicronemia from a Serine-to-Cysteine Substitution in GPIHBP1 Ly6 Domain*

    PubMed Central

    Plengpanich, Wanee; Young, Stephen G.; Khovidhunkit, Weerapan; Bensadoun, André; Karnman, Hirankorn; Ploug, Michael; Gårdsvoll, Henrik; Leung, Calvin S.; Adeyo, Oludotun; Larsson, Mikael; Muanpetch, Suwanna; Charoen, Supannika; Fong, Loren G.; Niramitmahapanya, Sathit; Beigneux, Anne P.


    GPIHBP1, a glycosylphosphatidylinositol-anchored glycoprotein of microvascular endothelial cells, binds lipoprotein lipase (LPL) within the interstitial spaces and transports it across endothelial cells to the capillary lumen. The ability of GPIHBP1 to bind LPL depends on the Ly6 domain, a three-fingered structure containing 10 cysteines and a conserved pattern of disulfide bond formation. Here, we report a patient with severe hypertriglyceridemia who was homozygous for a GPIHBP1 point mutation that converted a serine in the GPIHBP1 Ly6 domain (Ser-107) to a cysteine. Two hypertriglyceridemic siblings were homozygous for the same mutation. All three homozygotes had very low levels of LPL in the preheparin plasma. We suspected that the extra cysteine in GPIHBP1-S107C might prevent the trafficking of the protein to the cell surface, but this was not the case. However, nearly all of the GPIHBP1-S107C on the cell surface was in the form of disulfide-linked dimers and multimers, whereas wild-type GPIHBP1 was predominantly monomeric. An insect cell GPIHBP1 expression system confirmed the propensity of GPIHBP1-S107C to form disulfide-linked dimers and to form multimers. Functional studies showed that only GPIHBP1 monomers bind LPL. In keeping with that finding, there was no binding of LPL to GPIHBP1-S107C in either cell-based or cell-free binding assays. We conclude that an extra cysteine in the GPIHBP1 Ly6 motif results in multimerization of GPIHBP1, defective LPL binding, and severe hypertriglyceridemia. PMID:24847059

  10. Multimerization of glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1) and familial chylomicronemia from a serine-to-cysteine substitution in GPIHBP1 Ly6 domain.


    Plengpanich, Wanee; Young, Stephen G; Khovidhunkit, Weerapan; Bensadoun, André; Karnman, Hirankorn; Ploug, Michael; Gårdsvoll, Henrik; Leung, Calvin S; Adeyo, Oludotun; Larsson, Mikael; Muanpetch, Suwanna; Charoen, Supannika; Fong, Loren G; Niramitmahapanya, Sathit; Beigneux, Anne P


    GPIHBP1, a glycosylphosphatidylinositol-anchored glycoprotein of microvascular endothelial cells, binds lipoprotein lipase (LPL) within the interstitial spaces and transports it across endothelial cells to the capillary lumen. The ability of GPIHBP1 to bind LPL depends on the Ly6 domain, a three-fingered structure containing 10 cysteines and a conserved pattern of disulfide bond formation. Here, we report a patient with severe hypertriglyceridemia who was homozygous for a GPIHBP1 point mutation that converted a serine in the GPIHBP1 Ly6 domain (Ser-107) to a cysteine. Two hypertriglyceridemic siblings were homozygous for the same mutation. All three homozygotes had very low levels of LPL in the preheparin plasma. We suspected that the extra cysteine in GPIHBP1-S107C might prevent the trafficking of the protein to the cell surface, but this was not the case. However, nearly all of the GPIHBP1-S107C on the cell surface was in the form of disulfide-linked dimers and multimers, whereas wild-type GPIHBP1 was predominantly monomeric. An insect cell GPIHBP1 expression system confirmed the propensity of GPIHBP1-S107C to form disulfide-linked dimers and to form multimers. Functional studies showed that only GPIHBP1 monomers bind LPL. In keeping with that finding, there was no binding of LPL to GPIHBP1-S107C in either cell-based or cell-free binding assays. We conclude that an extra cysteine in the GPIHBP1 Ly6 motif results in multimerization of GPIHBP1, defective LPL binding, and severe hypertriglyceridemia. PMID:24847059

  11. Minimalistic predictor of protein binding energy: contribution of solvation factor to protein binding.


    Choi, Jeong-Mo; Serohijos, Adrian W R; Murphy, Sean; Lucarelli, Dennis; Lofranco, Leo L; Feldman, Andrew; Shakhnovich, Eugene I


    It has long been known that solvation plays an important role in protein-protein interactions. Here, we use a minimalistic solvation-based model for predicting protein binding energy to estimate quantitatively the contribution of the solvation factor in protein binding. The factor is described by a simple linear combination of buried surface areas according to amino-acid types. Even without structural optimization, our minimalistic model demonstrates a predictive power comparable to more complex methods, making the proposed approach the basis for high throughput applications. Application of the model to a proteomic database shows that receptor-substrate complexes involved in signaling have lower affinities than enzyme-inhibitor and antibody-antigen complexes, and they differ by chemical compositions on interfaces. Also, we found that protein complexes with components that come from the same genes generally have lower affinities than complexes formed by proteins from different genes, but in this case the difference originates from different interface areas. The model was implemented in the software PYTHON, and the source code can be found on the Shakhnovich group webpage: PMID:25692584

  12. Photoaffinity labeling of retinoic acid-binding proteins.

    PubMed Central

    Bernstein, P S; Choi, S Y; Ho, Y C; Rando, R R


    Retinoid-binding proteins are essential mediators of vitamin A function in vertebrate organisms. They solubilize and stabilize retinoids, and they direct the intercellular and intracellular trafficking, transport, and metabolic function of vitamin A compounds in vision and in growth and development. Although many soluble retinoid-binding proteins and receptors have been purified and extensively characterized, relatively few membrane-associated enzymes and other proteins that interact with retinoids have been isolated and studied, due primarily to their inherent instabilities during purification. In an effort to identify and purify previously uncharacterized retinoid-binding proteins, it is shown that radioactively labeled all-trans-retinoic acid can be used as a photoaffinity labeling reagent to specifically tag two known retinoic acid-binding proteins, cellular retinoic acid-binding protein and albumin, in complex mixtures of cytosolic proteins. Additionally, a number of other soluble and membrane-associated proteins that bind all-trans-[11,12-3H]retinoic acid with high specificity are labeled utilizing the same photoaffinity techniques. Most of these labeled proteins have molecular weights that do not correspond to any known retinoid-binding proteins. Thus, photoaffinity labeling with all-trans-retinoic acid and related photoactivatable retinoids is a method that should prove extremely useful in the identification and purification of novel soluble and membrane-associated retinoid-binding proteins from ocular and nonocular tissues. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7846032

  13. Sequence similarity between the erythrocyte binding domain of the Plasmodium vivax Duffy binding protein and the V3 loop of HIV-1 strain MN reveals a functional heparin binding motif involved in binding to the Duffy antigen receptor for chemokines

    PubMed Central


    Background The HIV surface glycoprotein gp120 (SU, gp120) and the Plasmodium vivax Duffy binding protein (PvDBP) bind to chemokine receptors during infection and have a site of amino acid sequence similarity in their binding domains that often includes a heparin binding motif (HBM). Infection by either pathogen has been found to be inhibited by polyanions. Results Specific polyanions that inhibit HIV infection and bind to the V3 loop of X4 strains also inhibited DBP-mediated infection of erythrocytes and DBP binding to the Duffy Antigen Receptor for Chemokines (DARC). A peptide including the HBM of PvDBP had similar affinity for heparin as RANTES and V3 loop peptides, and could be specifically inhibited from heparin binding by the same polyanions that inhibit DBP binding to DARC. However, some V3 peptides can competitively inhibit RANTES binding to heparin, but not the PvDBP HBM peptide. Three other members of the DBP family have an HBM sequence that is necessary for erythrocyte binding, however only the protein which binds to DARC, the P. knowlesi alpha protein, is inhibited by heparin from binding to erythrocytes. Heparitinase digestion does not affect the binding of DBP to erythrocytes. Conclusion The HBMs of DBPs that bind to DARC have similar heparin binding affinities as some V3 loop peptides and chemokines, are responsible for specific sulfated polysaccharide inhibition of parasite binding and invasion of red blood cells, and are more likely to bind to negative charges on the receptor than cell surface glycosaminoglycans. PMID:22122911

  14. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins.


    Figueroa-Angulo, Elisa E; Calla-Choque, Jaeson S; Mancilla-Olea, Maria Inocente; Arroyo, Rossana


    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  15. DNA Shape versus Sequence Variations in the Protein Binding Process.


    Chen, Chuanying; Pettitt, B Montgomery


    The binding process of a protein with a DNA involves three stages: approach, encounter, and association. It has been known that the complexation of protein and DNA involves mutual conformational changes, especially for a specific sequence association. However, it is still unclear how the conformation and the information in the DNA sequences affects the binding process. What is the extent to which the DNA structure adopted in the complex is induced by protein binding, or is instead intrinsic to the DNA sequence? In this study, we used the multiscale simulation method to explore the binding process of a protein with DNA in terms of DNA sequence, conformation, and interactions. We found that in the approach stage the protein can bind both the major and minor groove of the DNA, but uses different features to locate the binding site. The intrinsic conformational properties of the DNA play a significant role in this binding stage. By comparing the specific DNA with the nonspecific in unbound, intermediate, and associated states, we found that for a specific DNA sequence, ∼40% of the bending in the association forms is intrinsic and that ∼60% is induced by the protein. The protein does not induce appreciable bending of nonspecific DNA. In addition, we proposed that the DNA shape variations induced by protein binding are required in the early stage of the binding process, so that the protein is able to approach, encounter, and form an intermediate at the correct site on DNA. PMID:26840719

  16. VASP: A Volumetric Analysis of Surface Properties Yields Insights into Protein-Ligand Binding Specificity

    PubMed Central

    Chen, Brian Y.; Honig, Barry


    Many algorithms that compare protein structures can reveal similarities that suggest related biological functions, even at great evolutionary distances. Proteins with related function often exhibit differences in binding specificity, but few algorithms identify structural variations that effect specificity. To address this problem, we describe the Volumetric Analysis of Surface Properties (VASP), a novel volumetric analysis tool for the comparison of binding sites in aligned protein structures. VASP uses solid volumes to represent protein shape and the shape of surface cavities, clefts and tunnels that are defined with other methods. Our approach, inspired by techniques from constructive solid geometry, enables the isolation of volumetrically conserved and variable regions within three dimensionally superposed volumes. We applied VASP to compute a comparative volumetric analysis of the ligand binding sites formed by members of the steroidogenic acute regulatory protein (StAR)-related lipid transfer (START) domains and the serine proteases. Within both families, VASP isolated individual amino acids that create structural differences between ligand binding cavities that are known to influence differences in binding specificity. Also, VASP isolated cavity subregions that differ between ligand binding cavities which are essential for differences in binding specificity. As such, VASP should prove a valuable tool in the study of protein-ligand binding specificity. PMID:20814581

  17. Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase.

    PubMed Central

    Leberer, E; Wu, C; Leeuw, T; Fourest-Lieuvin, A; Segall, J E; Thomas, D Y


    Ste20p from Saccharomyces cerevisiae belongs to the Ste20p/p65PAK family of protein kinases which are highly conserved from yeast to man and regulate conserved mitogen-activated protein kinase pathways. Ste20p fulfills multiple roles in pheromone signaling, morphological switching and vegetative growth and binds Cdc42p, a Rho-like small GTP binding protein required for polarized morphogenesis. We have analyzed the functional consequences of mutations that prevent binding of Cdc42p to Ste20p. The complete amino-terminal, non-catalytic half of Ste20p, including the conserved Cdc42p binding domain, was dispensable for heterotrimeric G-protein-mediated pheromone signaling. However, the Cdc42p binding domain was necessary for filamentous growth in response to nitrogen starvation and for an essential function that Ste20p shares with its isoform Cla4p during vegetative growth. Moreover, the Cdc42p binding domain was required for cell-cell adhesion during conjugation. Subcellular localization of wild-type and mutant Ste20p fused to green fluorescent protein showed that the Cdc42p binding domain is needed to direct localization of Ste20p to regions of polarized growth. These results suggest that Ste20p is regulated in different developmental pathways by different mechanisms which involve heterotrimeric and small GTP binding proteins. PMID:9009270

  18. The factor H binding protein of Neisseria meningitidis interacts with xenosiderophores in vitro.


    Veggi, Daniele; Gentile, Maria A; Cantini, Francesca; Lo Surdo, Paola; Nardi-Dei, Vincenzo; Seib, Kate L; Pizza, Mariagrazia; Rappuoli, Rino; Banci, Lucia; Savino, Silvana; Scarselli, Maria


    The factor H binding protein (fHbp) is a key virulence factor of Neisseria meningitidis that confers to the bacterium the ability to resist killing by human serum. The determination of its three-dimensional structure revealed that the carboxyl terminus of the protein folds into an eight-stranded β barrel. The structural similarity of this part of the protein to lipocalins provided the rationale for exploring the ability of fHbp to bind siderophores. We found that fHbp was able to bind in vitro siderophores belonging to the cathecolate family and mapped the interaction site by nuclear magnetic resonance. Our results indicated that the enterobactin binding site was distinct from the site involved in binding to human factor H and stimulates new hypotheses about possible multiple activities of fHbp. PMID:23121397

  19. Distinct binding and immunogenic properties of the gonococcal homologue of meningococcal factor h binding protein.


    Jongerius, Ilse; Lavender, Hayley; Tan, Lionel; Ruivo, Nicola; Exley, Rachel M; Caesar, Joseph J E; Lea, Susan M; Johnson, Steven; Tang, Christoph M


    Neisseria meningitidis is a leading cause of sepsis and meningitis. The bacterium recruits factor H (fH), a negative regulator of the complement system, to its surface via fH binding protein (fHbp), providing a mechanism to avoid complement-mediated killing. fHbp is an important antigen that elicits protective immunity against the meningococcus and has been divided into three different variant groups, V1, V2 and V3, or families A and B. However, immunisation with fHbp V1 does not result in cross-protection against V2 and V3 and vice versa. Furthermore, high affinity binding of fH could impair immune responses against fHbp. Here, we investigate a homologue of fHbp in Neisseria gonorrhoeae, designated as Gonococcal homologue of fHbp (Ghfp) which we show is a promising vaccine candidate for N. meningitidis. We demonstrate that Gfhp is not expressed on the surface of the gonococcus and, despite its high level of identity with fHbp, does not bind fH. Substitution of only two amino acids in Ghfp is sufficient to confer fH binding, while the corresponding residues in V3 fHbp are essential for high affinity fH binding. Furthermore, immune responses against Ghfp recognise V1, V2 and V3 fHbps expressed by a range of clinical isolates, and have serum bactericidal activity against N. meningitidis expressing fHbps from all variant groups. PMID:23935503

  20. Two Pfam protein families characterized by a crystal structure of protein lpg2210 from Legionella pneumophila

    PubMed Central


    Background Every genome contains a large number of uncharacterized proteins that may encode entirely novel biological systems. Many of these uncharacterized proteins fall into related sequence families. By applying sequence and structural analysis we hope to provide insight into novel biology. Results We analyze a previously uncharacterized Pfam protein family called DUF4424 [Pfam:PF14415]. The recently solved three-dimensional structure of the protein lpg2210 from Legionella pneumophila provides the first structural information pertaining to this family. This protein additionally includes the first representative structure of another Pfam family called the YARHG domain [Pfam:PF13308]. The Pfam family DUF4424 adopts a 19-stranded beta-sandwich fold that shows similarity to the N-terminal domain of leukotriene A-4 hydrolase. The YARHG domain forms an all-helical domain at the C-terminus. Structure analysis allows us to recognize distant similarities between the DUF4424 domain and individual domains of M1 aminopeptidases and tricorn proteases, which form massive proteasome-like capsids in both archaea and bacteria. Conclusions Based on our analyses we hypothesize that the DUF4424 domain may have a role in forming large, multi-component enzyme complexes. We suggest that the YARGH domain may play a role in binding a moiety in proximity with peptidoglycan, such as a hydrophobic outer membrane lipid or lipopolysaccharide. PMID:24004689

  1. FIGfams : yet another set of protein families.

    SciTech Connect

    Meyer, F.; Overbeek, R.; Rodriguez, A.; Mathematics and Computer Science; Univ. of Chicago; Fellowship for the Interpretation of Genomes


    We present FIGfams, a new collection of over 100,000 protein families that are the product of manual curation and close strain comparison. Using the Subsystem approach the manual curation is carried out, ensuring a previously unattained degree of throughput and consistency. FIGfams are based on over 950,000 manually annotated proteins and across many hundred Bacteria and Archaea. Associated with each FIGfam is a two-tiered, rapid, accurate decision procedure to determine family membership for new proteins. FIGfams are freely available under an open source license. These can be downloaded at The web site for FIGfams is

  2. Structural Plasticity Underpins Promiscuous Binding of the Prosurvival Protein A1

    SciTech Connect

    Smits,C.; Czabotar, P.; Hinds, M.; Day, C.


    Apoptotic pathways are regulated by protein-protein interactions. Interaction of the BH3 domains of proapoptotic Bcl-2 family proteins with the hydrophobic groove of prosurvival proteins is critical. Whereas some BH3 domains bind in a promiscuous manner, others exhibit considerable selectivity and the sequence characteristics that distinguish these activities are unclear. In this study, crystal structures of complexes between the prosurvival protein A1 and the BH3 domains from Puma, Bmf, Bak, and Bid have been solved. The structure of A1 is similar to that of other prosurvival proteins, although features, such as an acidic patch in the binding groove, may allow specific therapeutic modulation of apoptosis. Significant conformational plasticity was observed in the intermolecular interactions and these differences explain some of the variation in affinity. This study, in combination with published data, suggests that interactions between conserved residues demarcate optimal binding.

  3. Partial characterization of GTP-binding proteins in Neurospora

    SciTech Connect

    Hasunuma, K.; Miyamoto-Shinohara, Y.; Furukawa, K.


    Six fractions of GTP-binding proteins separated by gel filtration of a mycelial extract containing membrane components of Neurospora crassa were partially characterized. (/sup 35/S)GTP gamma S bound to GTP-binding protein was assayed by repeated treatments with a Norit solution and centrifugation. The binding of (/sup 35/S)GTP gamma S to GTP-binding proteins was competitively prevented in the presence of 0.1 to 1 mM GTP but not in the presence of ATP. These GTP-binding proteins fractionated by the gel column had Km values of 20, 7, 4, 4, 80 and 2 nM. All six fractions of these GTP-binding proteins showed the capacity to be ADP-ribosylated by pertussis toxin.

  4. Dot-blot assay for heparin-binding proteins

    SciTech Connect

    Hirose, N.; Krivanek, M.; Jackson, R.L.; Cardin, A.D.


    A method for the detection and quantitation of picomole amounts of heparin-binding proteins is described. Proteins are first spotted on nitrocellulose and then incubated with /sup 125/I-heparin. Binding of heparin to the proteins is detected by radioautography and quantitated by scanning densitometry; proteins are quantitated by densitometric analysis of the amido black stained nitrocellulose. Heparin-binding was time-dependent and sensitive to the presence of metal ions, urea, and detergents (anionic, nonionic, and zwitterionic). The divalent cations Ca/sup 2 +/ and Mg/sup 2 +/ and the zwitterionic detergent 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate increased heparin binding whereas NaCl, urea, sodium dodecylsulfate, and La3+ decreased binding. This assay is applicable to the identification and characterization of a variety of heparin-binding proteins.

  5. Identification of fibrinogen-binding proteins of Aspergillus fumigatus using proteomic approach.


    Upadhyay, Santosh Kumar; Gautam, Poonam; Pandit, Hrishikesh; Singh, Yogendra; Basir, Seemi Farhat; Madan, Taruna


    Aspergillus fumigatus, the main etiological agent for various forms of human aspergillosis, gets access to the respiratory system of human host by inhalation of airborne conidia. These conidia possibly adhere to extracellular matrix (ECM) proteins. Among the ECM proteins involved in adherence, fibrinogen is thought to be crucial. Here, we studied whether A. fumigatus three-week culture filtrate (3wcf) proteins promote binding of A. fumigatus to ECM proteins and promote fungal growth. We observed that incubation of ECM with 3wcf proteins led to dose- and time-dependent increase in adherence of conidia to the ECM. In order to identify the catalogue of fibrinogen-binding A. fumigatus proteins, we carried out fibrinogen affinity blotting using two-dimensional gel electrophoresed 3wcf proteins. A total of 15 fibrinogen-binding protein spots corresponding to 7 unique proteins were identified in 3wcf using matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF-TOF). Among these, 4 proteins, namely, beta-glucosidase, alpha-mannosidase, pectate lyase A and oryzin precursor were predicted to have cell wall or extracellular localization, whereas amidase family protein and two hypothetical proteins did not display the signal sequence. This study reports seven novel fibrinogen-binding proteins of A. fumigatus, some of which could be further explored for targeting the adhesion phenomenon as antifungal strategy. PMID:21870122

  6. The transthyretin-related protein: structural investigation of a novel protein family.


    Lundberg, Erik; Bäckström, Stefan; Sauer, Uwe H; Sauer-Eriksson, A Elisabeth


    The transthyretin-related protein (TRP) family comprises proteins predicted to be structurally related to the homotetrameric transport protein transthyretin (TTR). The function of TRPs is not yet fully established, but recent data suggest that they are involved in purine catabolism. We have determined the three-dimensional structure of the Escherichia coli TRP in two crystal forms; one at 1.65 A resolution in the presence of zinc, and the other at 2.1 A resolution in the presence of zinc and bromide. The structures revealed five zinc-ion-binding sites per monomer. Of these, the zinc ions bound at sites I and II are coordinated in tetrahedral geometries to the side chains of residues His9, His96, His98, Ser114, and three water molecules at the putative ligand-binding site. Of these four residues, His9, His98, and Ser114 are conserved. His9 and His98 bind the central zinc (site I) together with two water molecules. The side chain of His98 also binds to the zinc ion at site II. Bromide ions bind at site I only, replacing one of the water molecules coordinated to the zinc ion. The C-terminal four amino acid sequence motif Y-[RK]-G-[ST] constitutes the signature sequence of the TRP family. Two Tyr111 residues form direct hydrogen bonds to each other over the tetramer interface at the area, which in TTR constitutes the rear part of its thyroxine-binding channel. The putative substrate/ligand-binding channel of TRP is consequently shallower and broader than its counterpart in TTR. PMID:16723258

  7. Electrophilicities and Protein Covalent Binding of Demethylation Metabolites of Colchicine.


    Guo, Xiucai; Lin, Dongju; Li, Weiwei; Wang, Kai; Peng, Ying; Zheng, Jiang


    Colchicine, an alkaloid existing in plants of Liliaceous colchicum, has been widely used in the treatment of gout and familial Mediterranean fever. The administration of colchicine was found to cause liver injury in humans. The mechanisms of colchicine-induced liver toxicity remain unknown. The objectives of this study were to determine the electrophilicities of demethylation metabolites of colchicine and investigate the protein adductions derived from the reactive metabolites of colchicine. Four demethylated colchicine (1-, 2-, 3-, and 10-DMCs), namely, M1-M4, were detected in colchicine-fortified microsomal incubations. Four N-acetyl cysteine (NAC) conjugates (M5-M8) derived from colchicine were detected in the microsomes in the presence of NAC. M5 and M6 were derived from 10-DMC. M7 resulted from the reaction of 2-DMC or 3-DMC with NAC, and M8 originated from 10-DMC. Microsomal protein covalent binding was observed after exposure to colchicine. Two cysteine adducts (CA-1 and CA-2) derived from 10-DMC were found in proteolytically digested microsomal protein samples after incubation with colchicine. The findings allow us to define the chemical property of demethylation metabolites of colchicine and the interaction between protein and the reactive metabolites of colchicine generated in situ. PMID:26845511

  8. On the Entropy of Protein Families

    NASA Astrophysics Data System (ADS)

    Barton, John P.; Chakraborty, Arup K.; Cocco, Simona; Jacquin, Hugo; Monasson, Rémi


    Proteins are essential components of living systems, capable of performing a huge variety of tasks at the molecular level, such as recognition, signalling, copy, transport, ... The protein sequences realizing a given function may largely vary across organisms, giving rise to a protein family. Here, we estimate the entropy of those families based on different approaches, including Hidden Markov Models used for protein databases and inferred statistical models reproducing the low-order (1- and 2-point) statistics of multi-sequence alignments. We also compute the entropic cost, that is, the loss in entropy resulting from a constraint acting on the protein, such as the mutation of one particular amino-acid on a specific site, and relate this notion to the escape probability of the HIV virus. The case of lattice proteins, for which the entropy can be computed exactly, allows us to provide another illustration of the concept of cost, due to the competition of different folds. The relevance of the entropy in relation to directed evolution experiments is stressed.

  9. The Extended Family of Protein Tyrosine Phosphatases.


    Alonso, Andrés; Nunes-Xavier, Caroline E; Bayón, Yolanda; Pulido, Rafael


    In higher eukaryotes, the Tyr phosphorylation status of cellular proteins results from the coordinated action of Protein Tyrosine Kinases (PTKs) and Protein Tyrosine Phosphatases (PTPs). PTPs have emerged as highly regulated enzymes with diverse substrate specificity, and proteins with Tyr-dephosphorylation or Tyr-dephosphorylation-like properties can be clustered as the PTPome. This includes proteins from the PTP superfamily, which display a Cys-based catalytic mechanism, as well as enzymes from other gene families (Asp-based phosphatases, His-based phosphatases) that have converged in protein Tyr-dephosphorylation-related functions by using non-Cys-based catalytic mechanisms. Within the Cys-based members of the PTPome, classical PTPs dephosphorylate specific phosphoTyr (pTyr) residues from protein substrates, whereas VH1-like dual-specificity PTPs dephosphorylate pTyr, pSer, and pThr residues, as well as nonproteinaceous substrates, including phosphoinositides and phosphorylated carbohydrates. In addition, several PTPs have impaired catalytic activity as a result of amino acid substitutions at their active sites, but retain regulatory functions related with pTyr signaling. As a result of their relevant biological activity, many PTPs are linked to human disease, including cancer, neurodevelopmental, and metabolic diseases, making these proteins important drug targets and molecular markers in the clinic. Here, a brief overview on the biochemistry and physiology of the different groups of proteins that belong to the mammalian PTPome is presented. PMID:27514797

  10. TIGRFAMS: The TIGRFAMs database of protein families

    DOE Data Explorer

    TIGRFAMs are protein families based on Hidden Markov Models or HMMs. Use this page to see the curated seed alignmet for each TIGRFam, the full alignment of all family members and the cutoff scores for inclusion in each of the TIGRFAMs. Also use this page to search through the TIGRFAMs and HMMs for text in the TIGRFAMs Text Search or search for specific sequences in the TIGRFAMs Sequence Search.[Copied from the Overview at] See also TIGRFAMs ordered by the roles they play at

  11. Convergent evolution among immunoglobulin G-binding bacterial proteins.

    PubMed Central

    Frick, I M; Wikström, M; Forsén, S; Drakenberg, T; Gomi, H; Sjöbring, U; Björck, L


    Protein G, a bacterial cell-wall protein with high affinity for the constant region of IgG (IgGFc) antibodies, contains homologous repeats responsible for the interaction with IgGFc. A synthetic peptide corresponding to an 11-amino acid-long sequence in the COOH-terminal region of the repeats was found to bind to IgGFc and block the interaction with protein G. Moreover, two other IgGFc-binding bacterial proteins (proteins A and H), which do not contain any sequences homologous to the peptide, were also inhibited in their interactions with IgGFc by the peptide. Finally, a decapeptide based on a sequence in IgGFc blocked the binding of all three proteins to IgGFc. This unusually clear example of convergent evolution emphasizes the complexity of protein-protein interactions and suggests that bacterial surface-protein interaction with host protein adds selective advantages to the microorganism. Images PMID:1528858

  12. The different ligand-binding modes of relaxin family peptide receptors RXFP1 and RXFP2.


    Scott, Daniel J; Rosengren, K Johan; Bathgate, Ross A D


    Relaxin and insulin-like peptide 3 (INSL3) are peptide hormones with a number of important physiological roles in reproduction, regulation of extracellular matrix turnover, and cardiovascular function. Relaxin and INSL3 mediate their actions through the closely related G-protein coupled receptors, relaxin family peptide receptors 1 and 2 (RXFP1 and RXFP2), respectively. These receptors have large extracellular domains (ECD) that contain high-affinity ligand-binding sites within their 10 leucine-rich repeat (LRR)-containing modules. Although relaxin can bind and activate both RXFP1 and RXFP2, INSL3 can only bind and activate RXFP2. To investigate whether this difference is related to the nature of the high-affinity ECD binding site or to differences in secondary binding sites involving the receptor transmembrane (TM) domain, we created a suite of constructs with RXFP1/2 chimeric ECD attached to single TM helices. We show that by changing as little as one LRR, representing four amino acid substitutions, we were able to engineer a high-affinity INSL3-binding site into the ECD of RXFP1. Molecular modeling of the INSL3-RXFP2 interaction based on extensive experimental data highlights the differences in the binding mechanisms of relaxin and INSL3 to the ECD of their cognate receptors. Interestingly, when the engineered RXFP1/2 ECD were introduced into full-length RXFP1 constructs, INSL3 exhibited only low affinity and efficacy on these receptors. These results highlight critical differences both in the ECD binding and in the coordination of the ECD-binding site with the TM domain, and provide new mechanistic insights into the binding and activation events of RXFP1 and RXFP2 by their native hormone ligands. PMID:22973049

  13. Cloning and characterisation of a nuclear, site specific ssDNA binding protein.


    Smidt, M P; Russchen, B; Snippe, L; Wijnholds, J; Ab, G


    Estradiol inducible, liver-specific expression of the apoVLDL II gene is mediated through the estrogen receptor and a variety of other DNA-binding proteins. In the present study we report the cloning and characterisation of a single-strand DNA binding protein that interacts with the lower strand of a complex regulatory site, which includes the major estrogen responsive element and a site that resembles the rat albumin site D (apoVLDL II site D). Based on its binding specificity determined with electro-mobility shift assays, the protein is named single-strand D-box binding factor (ssDBF). Analysis of the deduced 302 amino acid sequence revealed that the protein belongs to the heteronuclear ribonucleoprotein A/B family (hnRNP A/B) and resembles other known eukaryotic single-strand DNA binding proteins. Transient transfection experiments in a chicken liver cell-line showed that the protein represses estrogen-induced transcription. A protein with similar binding characteristics is present in liver nuclear extract. The relevance of the occurrence of this protein to the expression of the apoVLDL II gene is discussed. PMID:7630716

  14. Multifunctionality and mechanism of ligand binding in a mosquito antiinflammatory protein

    SciTech Connect

    Calvo, Eric; Mans, Ben J.; Ribeiro, José M.C.; Andersen, John F.


    The mosquito D7 salivary proteins are encoded by a multigene family related to the arthropod odorant-binding protein (OBP) superfamily. Forms having either one or two OBP domains are found in mosquito saliva. Four single-domain and one two-domain D7 proteins from Anopheles gambiae and Aedes aegypti (AeD7), respectively, were shown to bind biogenic amines with high affinity and with a stoichiometry of one ligand per protein molecule. Sequence comparisons indicated that only the C-terminal domain of AeD7 is homologous to the single-domain proteins from A. gambiae, suggesting that the N-terminal domain may bind a different class of ligands. Here, we describe the 3D structure of AeD7 and examine the ligand-binding characteristics of the N- and C-terminal domains. Isothermal titration calorimetry and ligand complex crystal structures show that the N-terminal domain binds cysteinyl leukotrienes (cysLTs) with high affinities (50-60 nM) whereas the C-terminal domain binds biogenic amines. The lipid chain of the cysLT binds in a hydrophobic pocket of the N-terminal domain, whereas binding of norepinephrine leads to an ordering of the C-terminal portion of the C-terminal domain into an alpha-helix that, along with rotations of Arg-176 and Glu-268 side chains, acts to bury the bound ligand.

  15. Moesin, ezrin, and p205 are actin-binding proteins associated with neutrophil plasma membranes.

    PubMed Central

    Pestonjamasp, K; Amieva, M R; Strassel, C P; Nauseef, W M; Furthmayr, H; Luna, E J


    Actin-binding proteins in bovine neutrophil plasma membranes were identified using blot overlays with 125I-labeled F-actin. Along with surface-biotinylated proteins, membranes were enriched in major actin-binding polypeptides of 78, 81, and 205 kDa. Binding was specific for F-actin because G-actin did not bind. Further, unlabeled F-actin blocked the binding of 125I-labeled F-actin whereas other acidic biopolymers were relatively ineffective. Binding also was specifically inhibited by myosin subfragment 1, but not by CapZ or plasma gelsolin, suggesting that the membrane proteins, like myosin, bind along the sides of the actin filaments. The 78- and 81-kDa polypeptides were identified as moesin and ezrin, respectively, by co-migration on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoprecipitation with antibodies specific for moesin and ezrin. Although not present in detectable amounts in bovine neutrophils, radixin (a third and closely related member of this gene family) also bound 125I-labeled F-actin on blot overlays. Experiments with full-length and truncated bacterial fusion proteins localized the actin-binding site in moesin to the extreme carboxy terminus, a highly conserved sequence. Immunofluorescence micrographs of permeabilized cells and cell "footprints" showed moesin co-localization with actin at the cytoplasmic surface of the plasma membrane, consistent with a role as a membrane-actin-linking protein. Images PMID:7612961

  16. Fused protein domains inhibit DNA binding by LexA.

    PubMed Central

    Golemis, E A; Brent, R


    Many studies of transcription activation employ fusions of activation domains to DNA binding domains derived from the bacterial repressor LexA and the yeast activator GAL4. Such studies often implicitly assume that DNA binding by the chimeric proteins is equivalent to that of the protein donating the DNA binding moiety. To directly investigate this issue, we compared operator binding by a series of LexA-derivative proteins to operator binding by native LexA, by using both in vivo and in vitro assays. We show that operator binding by many proteins such as LexA-Myc, LexA-Fos, and LexA-Bicoid is severely impaired, while binding of other LexA-derivative proteins, such as those that carry bacterially encoded acidic sequences ("acid blobs"), is not. Our results also show that DNA binding by LexA derivatives that contain the LexA carboxy-terminal dimerization domain (amino acids 88 to 202) is considerably stronger than binding by fusions that lack it and that heterologous dimerization motifs cannot substitute for the LexA88-202 function. These results suggest the need to reevaluate some previous studies of activation that employed LexA derivatives and modifications to recent experimental approaches that use LexA and GAL4 derivatives to detect and study protein-protein interactions. Images PMID:1620111

  17. Adaptive Evolution of Eel Fluorescent Proteins from Fatty Acid Binding Proteins Produces Bright Fluorescence in the Marine Environment

    PubMed Central

    Gruber, David F.; Gaffney, Jean P.; Mehr, Shaadi; DeSalle, Rob; Sparks, John S.; Platisa, Jelena; Pieribone, Vincent A.


    We report the identification and characterization of two new members of a family of bilirubin-inducible fluorescent proteins (FPs) from marine chlopsid eels and demonstrate a key region of the sequence that serves as an evolutionary switch from non-fluorescent to fluorescent fatty acid-binding proteins (FABPs). Using transcriptomic analysis of two species of brightly fluorescent Kaupichthys eels (Kaupichthys hyoproroides and Kaupichthys n. sp.), two new FPs were identified, cloned and characterized (Chlopsid FP I and Chlopsid FP II). We then performed phylogenetic analysis on 210 FABPs, spanning 16 vertebrate orders, and including 163 vertebrate taxa. We show that the fluorescent FPs diverged as a protein family and are the sister group to brain FABPs. Our results indicate that the evolution of this family involved at least three gene duplication events. We show that fluorescent FABPs possess a unique, conserved tripeptide Gly-Pro-Pro sequence motif, which is not found in non-fluorescent fatty acid binding proteins. This motif arose from a duplication event of the FABP brain isoforms and was under strong purifying selection, leading to the classification of this new FP family. Residues adjacent to the motif are under strong positive selection, suggesting a further refinement of the eel protein’s fluorescent properties. We present a phylogenetic reconstruction of this emerging FP family and describe additional fluorescent FABP members from groups of distantly related eels. The elucidation of this class of fish FPs with diverse properties provides new templates for the development of protein-based fluorescent tools. The evolutionary adaptation from fatty acid-binding proteins to fluorescent fatty acid-binding proteins raises intrigue as to the functional role of bright green fluorescence in this cryptic genus of reclusive eels that inhabit a blue, nearly monochromatic, marine environment. PMID:26561348

  18. Calmodulin Binding Proteins and Alzheimer’s Disease

    PubMed Central

    O’Day, Danton H.; Eshak, Kristeen; Myre, Michael A.


    Abstract The small, calcium-sensor protein, calmodulin, is ubiquitously expressed and central to cell function in all cell types. Here the literature linking calmodulin to Alzheimer’s disease is reviewed. Several experimentally-verified calmodulin-binding proteins are involved in the formation of amyloid-β plaques including amyloid-β protein precursor, β-secretase, presenilin-1, and ADAM10. Many others possess potential calmodulin-binding domains that remain to be verified. Three calmodulin binding proteins are associated with the formation of neurofibrillary tangles: two kinases (CaMKII, CDK5) and one protein phosphatase (PP2B or calcineurin). Many of the genes recently identified by genome wide association studies and other studies encode proteins that contain putative calmodulin-binding domains but only a couple (e.g., APOE, BIN1) have been experimentally confirmed as calmodulin binding proteins. At least two receptors involved in calcium metabolism and linked to Alzheimer’s disease (mAchR; NMDAR) have also been identified as calmodulin-binding proteins. In addition to this, many proteins that are involved in other cellular events intimately associated with Alzheimer’s disease including calcium channel function, cholesterol metabolism, neuroinflammation, endocytosis, cell cycle events, and apoptosis have been tentatively or experimentally verified as calmodulin binding proteins. The use of calmodulin as a potential biomarker and as a therapeutic target is discussed. PMID:25812852

  19. Odorant binding proteins: a biotechnological tool for odour control.


    Silva, Carla; Matamá, Teresa; Azoia, Nuno G; Mansilha, Catarina; Casal, Margarida; Cavaco-Paulo, Artur


    The application of an odorant binding protein for odour control and fragrance delayed release from a textile surface was first explored in this work. Pig OBP-1 gene was cloned and expressed in Escherichia coli, and the purified protein was biochemically characterized. The IC₅₀ values (concentrations of competitor that caused a decay of fluorescence to half-maximal intensity) were determined for four distinct fragrances, namely, citronellol, benzyl benzoate, citronellyl valerate and ethyl valerate. The results showed a strong binding of citronellyl valerate, citronellol and benzyl benzoate to the recombinant protein, while ethyl valerate displayed weaker binding. Cationized cotton substrates were coated with porcine odorant binding protein and tested for their capacity to retain citronellol and to mask the smell of cigarette smoke. The immobilized protein delayed the release of citronellol when compared to the untreated cotton. According to a blind evaluation of 30 assessors, the smell of cigarette smoke, trapped onto the fabrics' surface, was successfully attenuated by porcine odorant binding protein (more than 60 % identified the weakest smell intensity after protein exposure compared to β-cyclodextrin-treated and untreated cotton fabrics). This work demonstrated that porcine odorant binding protein can be an efficient solution to prevent and/or remove unpleasant odours trapped on the large surface of textiles. Its intrinsic properties make odorant binding proteins excellent candidates for controlled release systems which constitute a new application for this class of proteins. PMID:24092006

  20. Protein Binding: Do We Ever Learn?▿

    PubMed Central

    Zeitlinger, Markus A.; Derendorf, Hartmut; Mouton, Johan W.; Cars, Otto; Craig, William A.; Andes, David; Theuretzbacher, Ursula


    Although the influence of protein binding (PB) on antibacterial activity has been reported for many antibiotics and over many years, there is currently no standardization for pharmacodynamic models that account for the impact of protein binding of antimicrobial agents in vitro. This might explain the somewhat contradictory results obtained from different studies. Simple in vitro models which compare the MIC obtained in protein-free standard medium versus a protein-rich medium are prone to methodological pitfalls and may lead to flawed conclusions. Within in vitro test systems, a range of test conditions, including source of protein, concentration of the tested antibiotic, temperature, pH, electrolytes, and supplements may influence the impact of protein binding. As new antibiotics with a high degree of protein binding are in clinical development, attention and action directed toward the optimization and standardization of testing the impact of protein binding on the activity of antibiotics in vitro become even more urgent. In addition, the quantitative relationship between the effects of protein binding in vitro and in vivo needs to be established, since the physiological conditions differ. General recommendations for testing the impact of protein binding in vitro are suggested. PMID:21537013

  1. Sequence similarity between the erythrocyte binding domain 1 of the Plasmodium vivax Duffy binding protein and the V3 loop of HIV-1 strain MN reveals binding residues for the Duffy Antigen Receptor for Chemokines

    PubMed Central


    Background The surface glycoprotein (SU, gp120) of the human immunodeficiency virus (HIV) must bind to a chemokine receptor, CCR5 or CXCR4, to invade CD4+ cells. Plasmodium vivax uses the Duffy Binding Protein (DBP) to bind the Duffy Antigen Receptor for Chemokines (DARC) and invade reticulocytes. Results Variable loop 3 (V3) of HIV-1 SU and domain 1 of the Plasmodium vivax DBP share a sequence similarity. The site of amino acid sequence similarity was necessary, but not sufficient, for DARC binding and contained a consensus heparin binding site essential for DARC binding. Both HIV-1 and P. vivax can be blocked from binding to their chemokine receptors by the chemokine, RANTES and its analog AOP-RANTES. Site directed mutagenesis of the heparin binding motif in members of the DBP family, the P. knowlesi alpha, beta and gamma proteins abrogated their binding to erythrocytes. Positively charged residues within domain 1 are required for binding of P. vivax and P. knowlesi erythrocyte binding proteins. Conclusion A heparin binding site motif in members of the DBP family may form part of a conserved erythrocyte receptor binding pocket. PMID:21281498

  2. Therapeutic and analytical applications of arsenic binding to proteins.


    Chen, Beibei; Liu, Qingqing; Popowich, Aleksandra; Shen, Shengwen; Yan, Xiaowen; Zhang, Qi; Li, Xing-Fang; Weinfeld, Michael; Cullen, William R; Le, X Chris


    Arsenic binding to proteins plays a pivotal role in the health effects of arsenic. Further knowledge of arsenic binding to proteins will advance the development of bioanalytical techniques and therapeutic drugs. This review summarizes recent work on arsenic-based drugs, imaging of cellular events, capture and purification of arsenic-binding proteins, and biosensing of arsenic. Binding of arsenic to the promyelocytic leukemia fusion oncoprotein (PML-RARα) is a plausible mode of action leading to the successful treatment of acute promyelocytic leukemia (APL). Identification of other oncoproteins critical to other cancers and the development of various arsenicals and targeted delivery systems are promising approaches to the treatment of other types of cancers. Techniques for capture, purification, and identification of arsenic-binding proteins make use of specific binding between trivalent arsenicals and the thiols in proteins. Biarsenical probes, such as FlAsH-EDT2 and ReAsH-EDT2, coupled with tetracysteine tags that are genetically incorporated into the target proteins, are used for site-specific fluorescence labelling and imaging of the target proteins in living cells. These allow protein dynamics and protein-protein interactions to be studied. Arsenic affinity chromatography is useful for purification of thiol-containing proteins, and its combination with mass spectrometry provides a targeted proteomic approach for studying the interactions between arsenicals and proteins in cells. Arsenic biosensors evolved from the knowledge of arsenic resistance and arsenic binding to proteins in bacteria, and have now been developed into analytical techniques that are suitable for the detection of arsenic in the field. Examples in the four areas, arsenic-based drugs, imaging of cellular events, purification of specific proteins, and arsenic biosensors, demonstrate important therapeutic and analytical applications of arsenic protein binding. PMID:25356501

  3. Odorant-Binding Protein: Localization to Nasal Glands and Secretions

    NASA Astrophysics Data System (ADS)

    Pevsner, Jonathan; Sklar, Pamela B.; Snyder, Solomon H.


    An odorant-binding protein (OBP) was isolated from bovine olfactory and respiratory mucosa. We have produced polyclonal antisera to this protein and report its immunohistochemical localization to mucus-secreting glands of the olfactory and respiratory mucosa. Although OBP was originally isolated as a pyrazine binding protein, both rat and bovine OBP also bind the odorants [3H]methyldihydrojasmonate and 3,7-dimethyl-octan-1-ol as well as 2-isobutyl-3-[3H]methoxypyrazine. We detect substantial odorant-binding activity attributable to OBP in secreted rat nasal mucus and tears but not in saliva, suggesting a role for OBP in transporting or concentrating odorants.

  4. Folding dynamics of a family of beta-sheet proteins

    NASA Astrophysics Data System (ADS)

    Rousseau, Denis


    Fatty acid binding proteins (FABP) consist of ten anti-parallel beta strands and two small alpha helices. The beta strands are arranged into two nearly orthogonal five-strand beta sheets that surround the interior cavity, which binds unsaturated long-chain fatty acids. In the brain isoform (BFABP), these are very important for the development of the central nervous system and neuron differentiation. Furthermore, BFABP is implicated in the pathogenesis of a variety of human diseases including cancer and neuronal degenerative disorders. In this work, site-directed spin labeling combined with EPR techniques have been used to study the folding mechanism of BFABP. In the first series of studies, we labeled the two Cys residues at position 5 and 80 in the wild type protein with an EPR spin marker; in addition, two singly labeled mutants at positions 5 and 80 in the C80A and C5A mutants, respectively, were also produced and used as controls. The changes in the distances between the two residues were examined by a pulsed EPR method, DEER (Double Electron Electron Resonance), as a function of guanidinium hydrochloride concentration. The results were compared with those from CW EPR, circular dichroism and fluorescence measurements, which provide the information regarding sidechain mobility, secondary structure and tertiary structure, respectively. The results will be discussed in the context of the folding mechanism of the family of fatty acid binding proteins.

  5. Characterization of Aryl Hydrocarbon Receptor Interacting Protein (AIP) Mutations in Familial Isolated Pituitary Adenoma Families

    PubMed Central

    Igreja, Susana; Chahal, Harvinder S; King, Peter; Bolger, Graeme B; Srirangalingam, Umasuthan; Guasti, Leonardo; Chapple, J Paul; Trivellin, Giampaolo; Gueorguiev, Maria; Guegan, Katie; Stals, Karen; Khoo, Bernard; Kumar, Ajith V; Ellard, Sian; Grossman, Ashley B; Korbonits, Márta


    Familial isolated pituitary adenoma (FIPA) is an autosomal dominant condition with variable genetic background and incomplete penetrance. Germline mutations of the aryl hydrocarbon receptor interacting protein (AIP) gene have been reported in 15–40% of FIPA patients. Limited data are available on the functional consequences of the mutations or regarding the regulation of the AIP gene. We describe a large cohort of FIPA families and characterize missense and silent mutations using minigene constructs, luciferase and β-galactosidase assays, as well as in silico predictions. Patients with AIP mutations had a lower mean age at diagnosis (23.6±11.2 years) than AIP mutation-negative patients (40.4±14.5 years). A promoter mutation showed reduced in vitro activity corresponding to lower mRNA expression in patient samples. Stimulation of the protein kinase A-pathway positively regulates the AIP promoter. Silent mutations led to abnormal splicing resulting in truncated protein or reduced AIP expression. A two-hybrid assay of protein–protein interaction of all missense variants showed variable disruption of AIP-phosphodiesterase-4A5 binding. In summary, exonic, promoter, splice-site, and large deletion mutations in AIP are implicated in 31% of families in our FIPA cohort. Functional characterization of AIP changes is important to identify the functional impact of gene sequence variants. Hum Mutat 31:1–11, 2010. © 2010 Wiley-Liss, Inc. PMID:20506337

  6. Actin binding proteins, spermatid transport and spermiation*

    PubMed Central

    Qian, Xiaojing; Mruk, Dolores D.; Cheng, Yan-Ho; Tang, Elizabeth I.; Han, Daishu; Lee, Will M.; Wong, Elissa W. P.; Cheng, C. Yan


    The transport of germ cells across the seminiferous epithelium is composed of a series of cellular events during the epithelial cycle essential to the completion of spermatogenesis. Without the timely transport of spermatids during spermiogenesis, spermatozoa that are transformed from step 19 spermatids in the rat testis fail to reach the luminal edge of the apical compartment and enter the tubule lumen at spermiation, thereby entering the epididymis for further maturation. Step 19 spermatids and/or sperms that remain in the epithelium will be removed by the Sertoli cell via phagocytosis to form phagosomes and be degraded by lysosomes, leading to subfertility and/or infertility. However, the biology of spermatid transport, in particular the final events that lead to spermiation remain elusive. Based on recent data in the field, we critically evaluate the biology of spermiation herein by focusing on the actin binding proteins (ABPs) that regulate the organization of actin microfilaments at the Sertoli-spermatid interface, which is crucial for spermatid transport during this event. The hypothesis we put forth herein also highlights some specific areas of research that can be pursued by investigators in the years to come. PMID:24735648

  7. Selective polyamine-binding proteins. Spermine binding by an androgen-sensitive phosphoprotein.


    Liang, T; Mezzetti, G; Chen, C; Liao, S


    Rat ventral prostate contains an acidic protein which can bind spermine selectively. The relative binding affinities of various aliphatic amines for the protein are, in decreasing order, spermine greater than thermine greater than greater than putrecine greater than 1,10-diaminodecane, cadaverine and 1,12-diaminododecane. The binding protein has an isoelectric point at pH 4.3 and a sedimentation coefficient of 3 S. Its molecular weight is approx. 30 000. Histones and nuclear chromatin preparations of the prostate can interact with the binding protein. The spermine-binding activity of the purified prostate protein can be inactivated by treatment with intestinal alkaline phosphatases. The phosphatase treated preparation can then be reactivated by beef heart protein kinase in the presence of cyclic AMP and ATP. The spermine-binding activity of the prostate cytosol protein fraction decreases after castration, but increases very rapidly after the castrated rats are injected with 5alpha-dihydrotestosterone. This finding raises the possibility that, in the postate, certain androgen actions may be dependent on the androgen-induced increase in the acidic protein binding of polyamines and their translocation to a functional cellular site such as nuclear chromatin. In the prostate cytosol, spermine also binds to 4-S tRNAs and to a unique RNA which has a sedimentation coefficient of 1.5 S. PMID:28786

  8. Clinical relevance of drug binding to plasma proteins

    NASA Astrophysics Data System (ADS)

    Ascenzi, Paolo; Fanali, Gabriella; Fasano, Mauro; Pallottini, Valentina; Trezza, Viviana


    Binding to plasma proteins highly influences drug efficacy, distribution, and disposition. Serum albumin, the most abundant protein in plasma, is a monomeric multi-domain macromolecule that displays an extraordinary ligand binding capacity, providing a depot and carrier for many endogenous and exogenous compounds, such as fatty acids and most acidic drugs. α-1-Acid glycoprotein, the second main plasma protein, is a glycoprotein physiologically involved in the acute phase reaction and is the main carrier for basic and neutral drugs. High- and low-density lipoproteins play a limited role in drug binding and are natural drug delivery system only for few lipophilic drugs or lipid-based formulations. Several factors influence drug binding to plasma proteins, such as pathological conditions, concurrent administration of drugs, sex, and age. Any of these factors, in turn, influences drug efficacy and toxicity. Here, biochemical, biomedical, and biotechnological aspects of drug binding to plasma proteins are reviewed.

  9. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)


    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  10. Mutation analysis of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A.

    PubMed Central

    Goldstein, M A; Doi, R H


    Cellulose-binding protein A (CbpA) has been previously shown to mediate the interaction between crystalline cellulose substrates and the cellulase enzyme complex of Clostridium cellulovorans. CbpA contains a family III cellulose-binding domain (CBD) which, when expressed independently, binds specifically to crystalline cellulose. A series of N- and C-terminal deletions and a series of small internal deletions of the CBD were created to determine whether the entire region previously described as a CBD is required for the cellulose-binding function. The N- and C-terminal deletions reduced binding affinity by 10- to 100-fold. Small internal deletions of the CBD resulted in substantial reduction of CBD function. Some, but not all, point mutations throughout the sequence had significant disruptive effects on the binding ability of the CBD. Thus, mutations in any region of the CBD had effects on the binding of the fragment to cellulose. The results indicate that the entire 163-amino-acid region of the CBD is required for maximal binding to crystalline cellulose. Images PMID:7961505

  11. Sec1/Munc18 protein Vps33 binds to SNARE domains and the quaternary SNARE complex

    PubMed Central

    Lobingier, Braden T.; Merz, Alexey J.


    Soluble N-ethylmaleimide–sensitive factor attachment protein receptor (SNARE) proteins catalyze membrane fusion events in the secretory and endolysosomal systems, and all SNARE-mediated fusion processes require cofactors of the Sec1/Munc18 (SM) family. Vps33 is an SM protein and subunit of the Vps-C complexes HOPS (homotypic fusion and protein sorting) and CORVET (class C core vacuole/endosome tethering), which are central regulators of endocytic traffic. Here we present biochemical studies of interactions between Saccharomyces cerevisiae vacuolar SNAREs and the HOPS holocomplex or Vps33 alone. HOPS binds the N-terminal Habc domain of the Qa-family SNARE Vam3, but Vps33 is not required for this interaction. Instead, Vps33 binds the SNARE domains of Vam3, Vam7, and Nyv1. Vps33 directly binds vacuolar quaternary SNARE complexes, and the affinity of Vps33 for SNARE complexes is greater than for individual SNAREs. Through targeted mutational analyses, we identify missense mutations of Vps33 that produce a novel set of defects, including cargo missorting and the loss of Vps33-HOPS association. Together these data suggest a working model for membrane docking: HOPS associates with N-terminal domains of Vam3 and Vam7 through Vps33-independent interactions, which are followed by binding of Vps33, the HOPS SM protein, to SNARE domains and finally to the quaternary SNARE complex. Our results also strengthen the hypothesis that SNARE complex binding is a core attribute of SM protein function. PMID:23051737

  12. In Situ Quantification of Protein Binding to the Plasma Membrane

    PubMed Central

    Smith, Elizabeth M.; Hennen, Jared; Chen, Yan; Mueller, Joachim D.


    This study presents a fluorescence-based assay that allows for direct measurement of protein binding to the plasma membrane inside living cells. An axial scan through the cell generates a fluorescence intensity profile that is analyzed to determine the membrane-bound and cytoplasmic concentrations of a peripheral membrane protein labeled by the enhanced green fluorescent protein (EGFP). The membrane binding curve is constructed by mapping those concentrations for a population of cells with a wide range of protein expression levels, and a fit of the binding curve determines the number of binding sites and the dissociation coefficient. We experimentally verified the technique, using myosin-1C-EGFP as a model system and fit its binding curve. Furthermore, we studied the protein-lipid interactions of the membrane binding domains from lactadherin and phospholipase C-δ1 to evaluate the feasibility of using competition binding experiments to identify specific lipid-protein interactions in living cells. Finally, we applied the technique to determine the lipid specificity, the number of binding sites, and the dissociation coefficient of membrane binding for the Gag matrix domain of human T-lymphotropic virus type 1, which provides insight into early assembly steps of the retrovirus. PMID:26039166

  13. Protein-protein binding affinities by pulse proteolysis: application to TEM-1/BLIP protein complexes.


    Hanes, Melinda S; Ratcliff, Kathleen; Marqusee, Susan; Handel, Tracy M


    Efficient methods for quantifying dissociation constants have become increasingly important for high-throughput mutagenesis studies in the postgenomic era. However, experimentally determining binding affinity is often laborious, requires large amounts of purified protein, and utilizes specialized equipment. Recently, pulse proteolysis has been shown to be a robust and simple method to determine the dissociation constants for a protein-ligand pair based on the increase in thermodynamic stability upon ligand binding. Here, we extend this technique to determine binding affinities for a protein-protein complex involving the β-lactamase TEM-1 and various β-lactamase inhibitor protein (BLIP) mutants. Interaction with BLIP results in an increase in the denaturation curve midpoint, C(m), of TEM-1, which correlates with the rank order of binding affinities for several BLIP mutants. Hence, pulse proteolysis is a simple, effective method to assay for mutations that modulate binding affinity in protein-protein complexes. From a small set (n = 4) of TEM-1/BLIP mutant complexes, a linear relationship between energy of stabilization (dissociation constant) and ΔC(m) was observed. From this "calibration curve," accurate dissociation constants for two additional BLIP mutants were calculated directly from proteolysis-derived ΔC(m) values. Therefore, in addition to qualitative information, armed with knowledge of the dissociation constants from the WT protein and a limited number of mutants, accurate quantitation of binding affinities can be determined for additional mutants from pulse proteolysis. Minimal sample requirements and the suitability of impure protein preparations are important advantages that make pulse proteolysis a powerful tool for high-throughput mutagenesis binding studies. PMID:20669180

  14. The CCN Family Proteins: Modulators of Bone Development and Novel Targets in Bone-Associated Tumors

    PubMed Central

    Chen, Po-Chun; Cheng, Hsu-Chen; Yang, Shun-Fa; Tang, Chih-Hsin


    The CCN family of proteins is composed of six extracellular matrix-associated proteins that play crucial roles in skeletal development, wound healing, fibrosis, and cancer. Members of the CCN family share four conserved cysteine-rich modular domains that trigger signal transduction in cell adhesion, migration, proliferation, differentiation, and survival through direct binding to specific integrin receptors and heparan sulfate proteoglycans. In the present review, we discuss the roles of the CCN family proteins in regulating resident cells of the bone microenvironment. In vertebrate development, the CCN family plays a critical role in osteo/chondrogenesis and vasculo/angiogenesis. These effects are regulated through signaling via integrins, bone morphogenetic protein, vascular endothelial growth factor, Wnt, and Notch via direct binding to CCN family proteins. Due to the important roles of CCN family proteins in skeletal development, abnormal expression of CCN proteins is related to the tumorigenesis of primary bone tumors such as osteosarcoma, Ewing sarcoma, and chondrosarcoma. Additionally, emerging studies have suggested that CCN proteins may affect progression of secondary metastatic bone tumors by moderating the bone microenvironment. CCN proteins could therefore serve as potential therapeutic targets for drug development against primary and metastatic bone tumors. PMID:24551846

  15. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.


    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin


    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. PMID

  16. Structure and ligand-binding properties of the biogenic amine-binding protein from the saliva of a blood-feeding insect vector of Trypanosoma cruzi

    SciTech Connect

    Xu, Xueqing; Chang, Bianca W.; Ribeiro, Jose M. C.; Andersen, John F.


    Biogenic amine-binding proteins mediate the anti-inflammatory and antihemostatic activities of blood-feeding insect saliva. The structure of the amine-binding protein from R. prolixus reveals the interaction of biogenic amine ligands with the protein. Proteins that bind small-molecule mediators of inflammation and hemostasis are essential for blood-feeding by arthropod vectors of infectious disease. In ticks and triatomine insects, the lipocalin protein family is greatly expanded and members have been shown to bind biogenic amines, eicosanoids and ADP. These compounds are potent mediators of platelet activation, inflammation and vascular tone. In this paper, the structure of the amine-binding protein (ABP) from Rhodnius prolixus, a vector of the trypanosome that causes Chagas disease, is described. ABP binds the biogenic amines serotonin and norepinephrine with high affinity. A complex with tryptamine shows the presence of a binding site for a single ligand molecule in the central cavity of the β-barrel structure. The cavity contains significant additional volume, suggesting that this protein may have evolved from the related nitrophorin proteins, which bind a much larger heme ligand in the central cavity.

  17. Odorant-binding proteins from a primitive termite.


    Ishida, Yuko; Chiang, Vicky P; Haverty, Michael I; Leal, Walter S


    Hitherto, odorant-binding proteins (OBPs) have been identified from insects belonging to more highly evolved insect orders (Lepidoptera, Coleoptera, Diptera, Hymenoptera, and Hemiptera), whereas only chemosensory proteins have been identified from more primitive species, such as orthopteran and phasmid species. Here, we report for the first time the isolation and cloning of odorant-binding proteins from a primitive termite species, the dampwood termite. Zootermopsis nevadensis nevadensis (Isoptera: Termopsidae). A major antennae-specific protein was detected by native PAGE along with four other minor proteins, which were also absent in the extract from control tissues (hindlegs). Multiple cDNA cloning led to the full characterization of the major antennae-specific protein (ZnevOBP1) and to the identification of two other antennae-specific cDNAs, encoding putative odorant-binding proteins (ZnevOBP2 and ZnevOBP3). N-terminal amino acid sequencing of the minor antennal bands and cDNA cloning showed that olfaction in Z. n. nevadensis may involve multiple odorant-binding proteins. Database searches suggest that the OBPs from this primitive termite are homologues of the pheromone-binding proteins from scarab beetles and antennal-binding proteins from moths. PMID:12449514

  18. Evolutionary history of selenocysteine incorporation from the perspective of SECIS binding proteins

    PubMed Central

    Donovan, Jesse; Copeland, Paul R


    Background The co-translational incorporation of selenocysteine into nascent polypeptides by recoding the UGA stop codon occurs in all domains of life. In eukaryotes, this event requires at least three specific factors: SECIS binding protein 2 (SBP2), a specific translation elongation factor (eEFSec), selenocysteinyl tRNA, and a cis-acting selenocysteine insertion sequence (SECIS) element in selenoprotein mRNAs. While the phylogenetic relationships of selenoprotein families and the evolution of selenocysteine usage are well documented, the evolutionary history of SECIS binding proteins has not been explored. Results In this report we present a phylogeny of the eukaryotic SECIS binding protein family which includes SBP2 and a related protein we herein term SBP2L. Here we show that SBP2L is an SBP2 paralogue in vertebrates and is the only form of SECIS binding protein in invertebrate deuterostomes, suggesting a key role in Sec incorporation in these organisms, but an SBP2/SBP2L fusion protein is unable to support Sec incorporation in vitro. An in-depth phylogenetic analysis of the conserved L7Ae RNA binding domain suggests an ancestral relationship with ribosomal protein L30. In addition, we describe the emergence of a motif upstream of the SBP2 RNA binding domain that shares significant similarity with a motif within the pseudouridine synthase Cbf5. Conclusion Our analysis suggests that SECIS binding proteins arose once in evolution but diverged significantly in multiple lineages. In addition, likely due to a gene duplication event in the early vertebrate lineage, SBP2 and SBP2L are paralogous in vertebrates. PMID:19744324

  19. Search for Amyloid-Binding Proteins by Affinity Chromatography

    PubMed Central

    Calero, Miguel; Rostagno, Agueda; Ghiso, Jorge


    ‘Amyloid binging proteins’ is a generic term used to designate proteins that interact with different forms of amyloidogenic peptides or proteins and that, as a result, may modulate their physiological and pathological functions by altering solubility, transport, clearance, degradation, and fibril formation. We describe a simple affinity chromatography protocol to isolate and characterize amyloid-binding proteins based on the use of sequential elution steps that may provide further information on the type of binding interaction. As an example, we depict the application of this protocol to the study of Alzheimer’s amyloid β (Aβ) peptide-binding proteins derived from human plasma. Biochemical analysis of the proteins eluted under different conditions identified serum amyloid P component (SAP) and apolipoprotein J (clusterin) as the main plasma Aβ-binding proteins while various apolipoproteins (apoA-IV, apoE, and apoA-I), as well as albumin (HSA) and fibulin were identified as minor contributors. PMID:22528093

  20. Anticalins small engineered binding proteins based on the lipocalin scaffold.


    Gebauer, Michaela; Skerra, Arne


    Anticalins are a novel class of small, robust proteins with designed ligand-binding properties derived from the natural lipocalin scaffold. Due to their compact molecular architecture, comprising a single polypeptide chain, they provide several benefits as protein therapeutics, such as high target specificity, good tissue penetration, low immunogenicity, tunable plasma half-life, efficient Escherichia coli expression, and suitability for furnishing with additional effector functions via genetic fusion or chemical conjugation. The lipocalins are a widespread family of proteins that naturally serve in many organisms, including humans, for the transport, storage, or sequestration of small biological compounds like vitamins and hormones. Their fold is dominated by an eight-stranded antiparallel β-barrel, which is open to the solvent at one end. There, four loops connect the β-strands in a pairwise manner and, altogether, they form the entry to a ligand-binding site. This loop region can be engineered via site-directed random mutagenesis in combination with genetic library selection techniques to yield "Anticalins" with exquisite specificities-and down to picomolar affinities-for prescribed molecular targets of either hapten or antigen type. Several Anticalins directed against medically relevant disease targets have been successfully engineered and can be applied, for example, for the blocking of soluble signaling factors or cell surface receptors or for tissue-specific drug targeting. While natural lipocalins were already subject to clinical studies in the past, a first Anticalin has completed Phase I trials in 2011, thus paving the way for the broad application of Anticalins as a promising novel class of biopharmaceuticals. PMID:22230569

  1. Influence of a Mannan Binding Family 32 Carbohydrate Binding Module on the Activity of the Appended Mannanase

    PubMed Central

    Mizutani, Kimiya; Fernandes, Vânia O.; Karita, Shuichi; Luís, Ana S.; Sakka, Makiko; Kimura, Tetsuya; Jackson, Adam; Zhang, Xiaoyang; Fontes, Carlos M. G. A.


    In general, cellulases and hemicellulases are modular enzymes in which the catalytic domain is appended to one or more noncatalytic carbohydrate binding modules (CBMs). CBMs, by concentrating the parental enzyme at their target polysaccharide, increase the capacity of the catalytic module to bind the substrate, leading to a potentiation in catalysis. Clostridium thermocellum hypothetical protein Cthe_0821, defined here as C. thermocellum Man5A, is a modular protein comprising an N-terminal signal peptide, a family 5 glycoside hydrolase (GH5) catalytic module, a family 32 CBM (CBM32), and a C-terminal type I dockerin module. Recent proteomic studies revealed that Cthe_0821 is one of the major cellulosomal enzymes when C. thermocellum is cultured on cellulose. Here we show that the GH5 catalytic module of Cthe_0821 displays endomannanase activity. C. thermocellum Man5A hydrolyzes soluble konjac glucomannan, soluble carob galactomannan, and insoluble ivory nut mannan but does not attack the highly galactosylated mannan from guar gum, suggesting that the enzyme prefers unsubstituted β-1,4-mannoside linkages. The CBM32 of C. thermocellum Man5A displays a preference for the nonreducing ends of mannooligosaccharides, although the protein module exhibits measurable affinity for the termini of β-1,4-linked glucooligosaccharides such as cellobiose. CBM32 potentiates the activity of C. thermocellum Man5A against insoluble mannans but has no significant effect on the capacity of the enzyme to hydrolyze soluble galactomannans and glucomannans. The product profile of C. thermocellum Man5A is affected by the presence of CBM32. PMID:22562994

  2. Influence of a mannan binding family 32 carbohydrate binding module on the activity of the appended mannanase.


    Mizutani, Kimiya; Fernandes, Vânia O; Karita, Shuichi; Luís, Ana S; Sakka, Makiko; Kimura, Tetsuya; Jackson, Adam; Zhang, Xiaoyang; Fontes, Carlos M G A; Gilbert, Harry J; Sakka, Kazuo


    In general, cellulases and hemicellulases are modular enzymes in which the catalytic domain is appended to one or more noncatalytic carbohydrate binding modules (CBMs). CBMs, by concentrating the parental enzyme at their target polysaccharide, increase the capacity of the catalytic module to bind the substrate, leading to a potentiation in catalysis. Clostridium thermocellum hypothetical protein Cthe_0821, defined here as C. thermocellum Man5A, is a modular protein comprising an N-terminal signal peptide, a family 5 glycoside hydrolase (GH5) catalytic module, a family 32 CBM (CBM32), and a C-terminal type I dockerin module. Recent proteomic studies revealed that Cthe_0821 is one of the major cellulosomal enzymes when C. thermocellum is cultured on cellulose. Here we show that the GH5 catalytic module of Cthe_0821 displays endomannanase activity. C. thermocellum Man5A hydrolyzes soluble konjac glucomannan, soluble carob galactomannan, and insoluble ivory nut mannan but does not attack the highly galactosylated mannan from guar gum, suggesting that the enzyme prefers unsubstituted β-1,4-mannoside linkages. The CBM32 of C. thermocellum Man5A displays a preference for the nonreducing ends of mannooligosaccharides, although the protein module exhibits measurable affinity for the termini of β-1,4-linked glucooligosaccharides such as cellobiose. CBM32 potentiates the activity of C. thermocellum Man5A against insoluble mannans but has no significant effect on the capacity of the enzyme to hydrolyze soluble galactomannans and glucomannans. The product profile of C. thermocellum Man5A is affected by the presence of CBM32. PMID:22562994

  3. Nramp defines a family of membrane proteins.

    PubMed Central

    Cellier, M; Privé, G; Belouchi, A; Kwan, T; Rodrigues, V; Chia, W; Gros, P


    Nramp (natural resistance-associated macrophage protein) is a newly identified family of integral membrane proteins whose biochemical function is unknown. We report on the identification of Nramp homologs from the fly Drosophila melanogaster, the plant Oryza sativa, and the yeast Saccharomyces cerevisiae. Optimal alignment of protein sequences required insertion of very few gaps and revealed remarkable sequence identity of 28% (yeast), 40% (plant), and 55% (fly) with the mammalian proteins (46%, 58%, and 73% similarity), as well as a common predicted transmembrane topology. This family is defined by a highly conserved hydrophobic core encoding 10 transmembrane segments. Other features of this hydrophobic core include several invariant charged residues, helical periodicity of sequence conservation suggesting conserved and nonconserved faces for several transmembrane helices, a consensus transport signature on the intracytoplasmic face of the membrane, and structural determinants previously described in ion channels. These characteristics suggest that the Nramp polypeptides form part of a group of transporters or channels that act on as yet unidentified substrates. Images Fig. 1 PMID:7479731

  4. The actin binding protein adseverin regulates osteoclastogenesis.


    Hassanpour, Siavash; Jiang, Hongwei; Wang, Yongqiang; Kuiper, Johannes W P; Glogauer, Michael


    Adseverin (Ads), a member of the Gelsolin superfamily of actin binding proteins, regulates the actin cytoskeleton architecture by severing and capping existing filamentous actin (F-actin) strands and nucleating the assembly of new F-actin filaments. Ads has been implicated in cellular secretion, exocytosis and has also been shown to regulate chondrogenesis and megakaryoblastic leukemia cell differentiation. Here we report for the first time that Ads is involved in regulating osteoclastogenesis (OCG). Ads is induced during OCG downstream of RANK-ligand (RANKL) stimulation and is highly expressed in mature osteoclasts. The D5 isoform of Ads is not involved in regulating OCG, as its expression is not induced in response to RANKL. Three clonal Ads knockdown RAW264.7 (RAW) macrophage cell lines with varying degrees of Ads expression and OCG deficiency were generated. The most drastic OCG defect was noted in the clonal cell line with the greatest degree of Ads knockdown as indicated by a lack of TRAcP staining and multinucleation. RNAi mediated knockdown of Ads in osteoclast precursors resulted in distinct morphological changes characterized by altered F-actin distribution and increased filopodia formation. Ads knockdown precursor cells experienced enhanced migration while fusion of knockdown precursors cells was limited. Transient reintroduction of de novo Ads back into the knockdown system was capable of rescuing TRAcP expression but not osteoclast multinucleation most likely due to the transient nature of Ads expression. This preliminary study allows us to conclude that Ads is a RANKL induced early regulator of OCG with a potential role in pre-osteoclast differentiation and fusion. PMID:25275604

  5. The Actin Binding Protein Adseverin Regulates Osteoclastogenesis

    PubMed Central

    Wang, Yongqiang; Kuiper, Johannes W. P.; Glogauer, Michael


    Adseverin (Ads), a member of the Gelsolin superfamily of actin binding proteins, regulates the actin cytoskeleton architecture by severing and capping existing filamentous actin (F-actin) strands and nucleating the assembly of new F-actin filaments. Ads has been implicated in cellular secretion, exocytosis and has also been shown to regulate chondrogenesis and megakaryoblastic leukemia cell differentiation. Here we report for the first time that Ads is involved in regulating osteoclastogenesis (OCG). Ads is induced during OCG downstream of RANK-ligand (RANKL) stimulation and is highly expressed in mature osteoclasts. The D5 isoform of Ads is not involved in regulating OCG, as its expression is not induced in response to RANKL. Three clonal Ads knockdown RAW264.7 (RAW) macrophage cell lines with varying degrees of Ads expression and OCG deficiency were generated. The most drastic OCG defect was noted in the clonal cell line with the greatest degree of Ads knockdown as indicated by a lack of TRAcP staining and multinucleation. RNAi mediated knockdown of Ads in osteoclast precursors resulted in distinct morphological changes characterized by altered F-actin distribution and increased filopodia formation. Ads knockdown precursor cells experienced enhanced migration while fusion of knockdown precursors cells was limited. Transient reintroduction of de novo Ads back into the knockdown system was capable of rescuing TRAcP expression but not osteoclast multinucleation most likely due to the transient nature of Ads expression. This preliminary study allows us to conclude that Ads is a RANKL induced early regulator of OCG with a potential role in pre-osteoclast differentiation and fusion. PMID:25275604

  6. Concentration-dependent Cu(II) binding to prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Lu, Wenchang; Bernholc, Jerry


    The prion protein plays a causative role in several neurodegenerative diseases, including mad cow disease in cattle and Creutzfeldt-Jakob disease in humans. The normal function of the prion protein is unknown, but it has been linked to its ability to bind copper ions. Experimental evidence suggests that copper can be bound in three distinct modes depending on its concentration, but only one of those binding modes has been fully characterized experimentally. Using a newly developed hybrid DFT/DFT method [1], which combines Kohn-Sham DFT with orbital-free DFT, we have examined all the binding modes and obtained their detailed binding geometries and copper ion binding energies. Our results also provide explanation for experiments, which have found that when the copper concentration increases the copper binding mode changes, surprisingly, from a stronger to a weaker one. Overall, our results indicate that prion protein can function as a copper buffer. 1. Hodak, Lu, Bernholc, JCP, in press.

  7. Molecular basis of the interaction between the antiapoptotic Bcl-2 family proteins and the proapoptotic protein ASPP2

    PubMed Central

    Katz, Chen; Benyamini, Hadar; Rotem, Shahar; Lebendiker, Mario; Danieli, Tsafi; Iosub, Anat; Refaely, Hadar; Dines, Monica; Bronner, Vered; Bravman, Tsafrir; Shalev, Deborah E.; Rüdiger, Stefan; Friedler, Assaf


    We have characterized the molecular basis of the interaction between ASPP2 and Bcl-2, which are key proteins in the apoptotic pathway. The C-terminal ankyrin repeats and SH3 domain of ASPP2 (ASPP2Ank-SH3) mediate its interactions with the antiapoptotic protein Bcl-2. We used biophysical and computational methods to identify the interaction sites of Bcl-2 and its homologues with ASPP2. Using peptide array screening, we found that ASPP2Ank-SH3 binds two homologous sites in all three Bcl proteins tested: (i) the conserved BH4 motif, and (ii) a binding site for proapoptotic regulators. Quantitative binding studies revealed that binding of ASPP2Ank-SH3 to the Bcl-2 family members is selective at two levels: (i) interaction with Bcl-2-derived peptides is the tightest compared to peptides from the other family members, and (ii) within Bcl-2, binding of ASPP2Ank-SH3 to the BH4 domain is tightest. Sequence alignment of the ASPP2-binding peptides combined with binding studies of mutated peptides revealed that two nonconserved positions where only Bcl-2 contains positively charged residues account for its tighter binding. The experimental binding results served as a basis for docking analysis, by which we modeled the complexes of ASPP2Ank-SH3 with the full-length Bcl proteins. Using peptide arrays and quantitative binding studies, we found that Bcl-2 binds three loops in ASPP2Ank-SH3 with similar affinity, in agreement with our predicted model. Based on our results, we propose a mechanism in which ASPP2 induces apoptosis by inhibiting functional sites of the antiapoptotic Bcl-2 proteins. PMID:18719108

  8. Structural Similarities between Thiamin-Binding Protein and Thiaminase-I Suggest a Common Ancestor

    SciTech Connect

    Soriano, Erika V.; Rajashankar, Kanagalaghatta R.; Hanes, Jeremiah W.; Bale, Shridhar; Begley, Tadhg P.; Ealick, Steven E.


    ATP-binding cassette (ABC) transporters are responsible for the transport of a wide variety of water-soluble molecules and ions into prokaryotic cells. In Gram-negative bacteria, periplasmic-binding proteins deliver ions or molecules such as thiamin to the membrane-bound ABC transporter. The gene for the thiamin-binding protein tbpA has been identified in both Escherichia coli and Salmonella typhimurium. Here we report the crystal structure of TbpA from E. coli with bound thiamin monophosphate. The structure was determined at 2.25 {angstrom} resolution using single-wavelength anomalous diffraction experiments, despite the presence of nonmerohedral twinning. The crystal structure shows that TbpA belongs to the group II periplasmic-binding protein family. Equilibrium binding measurements showed similar dissociation constants for thiamin, thiamin monophosphate, and thiamin pyrophosphate. Analysis of the binding site by molecular modeling demonstrated how TbpA binds all three forms of thiamin. A comparison of TbpA and thiaminase-I, a thiamin-degrading enzyme, revealed structural similarity between the two proteins, especially in domain 1, suggesting that the two proteins evolved from a common ancestor.

  9. A Universal Stress Protein (USP) in Mycobacteria Binds cAMP

    PubMed Central

    Banerjee, Arka; Adolph, Ramona S.; Gopalakrishnapai, Jayashree; Kleinboelting, Silke; Emmerich, Christiane; Steegborn, Clemens; Visweswariah, Sandhya S.


    Mycobacteria are endowed with rich and diverse machinery for the synthesis, utilization, and degradation of cAMP. The actions of cyclic nucleotides are generally mediated by binding of cAMP to conserved and well characterized cyclic nucleotide binding domains or structurally distinct cGMP-specific and -regulated cyclic nucleotide phosphodiesterase, adenylyl cyclase, and E. coli transcription factor FhlA (GAF) domain-containing proteins. Proteins with cyclic nucleotide binding and GAF domains can be identified in the genome of mycobacterial species, and some of them have been characterized. Here, we show that a significant fraction of intracellular cAMP is bound to protein in mycobacterial species, and by using affinity chromatography techniques, we identify specific universal stress proteins (USP) as abundantly expressed cAMP-binding proteins in slow growing as well as fast growing mycobacteria. We have characterized the biochemical and thermodynamic parameters for binding of cAMP, and we show that these USPs bind cAMP with a higher affinity than ATP, an established ligand for other USPs. We determined the structure of the USP MSMEG_3811 bound to cAMP, and we confirmed through structure-guided mutagenesis, the residues important for cAMP binding. This family of USPs is conserved in all mycobacteria, and we suggest that they serve as “sinks” for cAMP, making this second messenger available for downstream effectors as and when ATP levels are altered in the cell. PMID:25802331

  10. Cooperative binding modes of Cu(II) in prion protein

    NASA Astrophysics Data System (ADS)

    Hodak, Miroslav; Chisnell, Robin; Lu, Wenchang; Bernholc, Jerry


    The misfolding of the prion protein, PrP, is responsible for a group of neurodegenerative diseases including mad cow disease and Creutzfeldt-Jakob disease. It is known that the PrP can efficiently bind copper ions; four high-affinity binding sites located in the octarepeat region of PrP are now well known. Recent experiments suggest that at low copper concentrations new binding modes, in which one copper ion is shared between two or more binding sites, are possible. Using our hybrid Thomas-Fermi/DFT computational scheme, which is well suited for simulations of biomolecules in solution, we investigate the geometries and energetics of two, three and four binding sites cooperatively binding one copper ion. These geometries are then used as inputs for classical molecular dynamics simulations. We find that copper binding affects the secondary structure of the PrP and that it stabilizes the unstructured (unfolded) part of the protein.

  11. RNA binding by Hfq and ring-forming (L)Sm proteins

    PubMed Central

    Weichenrieder, Oliver


    The eukaryotic Sm and the Sm-like (LSm) proteins form a large family that includes LSm proteins in archaea and the Hfq proteins in bacteria. Commonly referred to as the (L)Sm protein family, the various members play important roles in RNA processing, decay, and riboregulation. Particularly interesting from a structural point of view is their ability to assemble into doughnut-shaped rings, which allows them to bind preferentially the uridine-rich 3′-end of RNA oligonucleotides. With an emphasis on Hfq, this review compares the RNA-binding properties of the various (L)Sm rings that were recently co-crystallized with RNA substrates, and it discusses how these properties relate to physiological function. PMID:24828406

  12. Function of RNA-binding protein Musashi-1 in stem cells

    SciTech Connect

    Okano, Hideyuki . E-mail:; Kawahara, Hironori; Toriya, Masako; Nakao, Keio; Shibata, Shinsuke; Imai, Takao


    Musashi is an evolutionarily conserved family of RNA-binding proteins that is preferentially expressed in the nervous system. The first member of the Musashi family was identified in Drosophila. This protein plays an essential role in regulating the asymmetric cell division of ectodermal precursor cells known as sensory organ precursor cells through the translational regulation of target mRNA. In the CNS of Drosophila larvae, however, Musashi is expressed in proliferating neuroblasts and likely has a different function. Its probable mammalian homologue, Musashi-1, is a neural RNA-binding protein that is strongly expressed in fetal and adult neural stem cells (NSCs). Mammalian Musashi-1 augments Notch signaling through the translational repression of its target mRNA, m-Numb, thereby contributing to the self-renewal of NSCs. In addition to its functions in NSCs, the role of mammalian Musashi-1 protein in epithelial stem cells, including intestinal and mammary gland stem cells, is attracting increasing interest.

  13. Identification of lipids and lipid-binding proteins in phloem exudates from Arabidopsis thaliana

    PubMed Central

    Guelette, Brandon S.; Benning, Urs F.; Hoffmann-Benning, Susanne


    The phloem plays a crucial role in assimilate and nutrient transport, pathogen response, and plant growth and development. Yet, few species have yielded pure phloem exudate and, if proteins need to be analysed, those species may not have sequenced genomes, making identification difficult. The enrichment of Arabidopsis thaliana phloem exudate in amounts large enough to allow for metabolite and protein analysis is described. Using this method, it was possible to identify 65 proteins present in the Arabidopsis phloem exudate. The majority of these proteins could be grouped by response to pathogens, stress, or hormones, carbon metabolism, protein interaction, modification, and turnover, and transcription factors. It was also possible to detect 11 proteins that play a role in lipid/fatty acid metabolism (aspartic protease, putative 3-β-hydroxysteroid dehydrogenase, UDP-sulphoquinovose synthase/SQD1, lipase, PIG-P-like protein: phosphatidylinositol-N-acetylglucosaminyltransferase), storage (glycine-rich protein), binding (annexin, lipid-associated family protein, GRP17/oleosin), and/or signalling (annexin, putative lipase, PIG-P-like protein). Along with putative lipid-binding proteins, several lipids and fatty acids could be identified. Only a few examples exist of lipids (jasmonic acid, oxylipins) or lipid-binding proteins (DIR1, acyl-CoA-binding protein) in the phloem. Finding hydrophobic compounds in an aqueous environment is not without precedence in biological systems: human blood contains a variety of lipids, many of which play a significant role in human health. In blood, lipids are transported while bound to proteins. The present findings of lipids and lipid-binding proteins in phloem exudates suggest that a similar long-distance lipid signalling exists in plants and may play an important role in plant growth and development. PMID:22442409

  14. PAT proteins, an ancient family of lipid droplet proteins that regulate cellular lipid stores.


    Bickel, Perry E; Tansey, John T; Welte, Michael A


    The PAT family of lipid droplet proteins includes 5 members in mammals: perilipin, adipose differentiation-related protein (ADRP), tail-interacting protein of 47 kDa (TIP47), S3-12, and OXPAT. Members of this family are also present in evolutionarily distant organisms, including insects, slime molds and fungi. All PAT proteins share sequence similarity and the ability to bind intracellular lipid droplets, either constitutively or in response to metabolic stimuli, such as increased lipid flux into or out of lipid droplets. Positioned at the lipid droplet surface, PAT proteins manage access of other proteins (lipases) to the lipid esters within the lipid droplet core and can interact with cellular machinery important for lipid droplet biogenesis. Genetic variations in the gene for the best-characterized of the mammalian PAT proteins, perilipin, have been associated with metabolic phenotypes, including type 2 diabetes mellitus and obesity. In this review, we discuss how the PAT proteins regulate cellular lipid metabolism both in mammals and in model organisms. PMID:19375517

  15. ErpC, a member of the complement regulator-acquiring family of surface proteins from Borrelia burgdorferi, possesses an architecture previously unseen in this protein family

    PubMed Central

    Caesar, Joseph J. E.; Johnson, Steven; Kraiczy, Peter; Lea, Susan M.


    Borrelia burgdorferi is a spirochete responsible for Lyme disease, the most commonly occurring vector-borne disease in Europe and North America. The bacterium utilizes a set of proteins, termed complement regulator-acquiring surface proteins (CRASPs), to aid evasion of the human complement system by recruiting and presenting complement regulator factor H on its surface in a manner that mimics host cells. Presented here is the atomic resolution structure of a member of this protein family, ErpC. The structure provides new insights into the mechanism of recruitment of factor H and other factor H-related proteins by acting as a molecular mimic of host glycosaminoglycans. It also describes the architecture of other CRASP proteins belonging to the OspE/F-related paralogous protein family and suggests that they have evolved to bind specific complement proteins, aiding survival of the bacterium in different hosts. PMID:23722838

  16. A large family of anti-activators accompanying XylS/AraC family regulatory proteins.


    Santiago, Araceli E; Yan, Michael B; Tran, Minh; Wright, Nathan; Luzader, Deborah H; Kendall, Melissa M; Ruiz-Perez, Fernando; Nataro, James P


    AraC Negative Regulators (ANR) suppress virulence genes by directly down-regulating AraC/XylS members in Gram-negative bacteria. In this study, we sought to investigate the distribution and molecular mechanisms of regulatory function for ANRs among different bacterial pathogens. We identified more than 200 ANRs distributed in diverse clinically important gram negative pathogens, including Vibrio spp., Salmonella spp., Shigella spp., Yersinia spp., Citrobacter spp., enterotoxigenic (ETEC) and enteroaggregative E. coli (EAEC), and members of the Pasteurellaceae. By employing a bacterial two hybrid system, pull down assays and surface plasmon resonance (SPR) analysis, we demonstrate that Aar (AggR-activated regulator), a prototype member of the ANR family in EAEC, binds with high affinity to the central linker domain of AraC-like member AggR. ANR-AggR binding disrupted AggR dimerization and prevented AggR-DNA binding. ANR homologs of Vibrio cholerae, Citrobacter rodentium, Salmonella enterica and ETEC were capable of complementing Aar activity by repressing aggR expression in EAEC strain 042. ANR homologs of ETEC and Vibrio cholerae bound to AggR as well as to other members of the AraC family, including Rns and ToxT. The predicted proteins of all ANR members exhibit three highly conserved predicted α-helices. Site-directed mutagenesis studies suggest that at least predicted α-helices 2 and 3 are required for Aar activity. In sum, our data strongly suggest that members of the novel ANR family act by directly binding to their cognate AraC partners. PMID:27038276

  17. N-Acetylgalactosaminyltransferase 14, a novel insulin-like growth factor binding protein-3 binding partner

    SciTech Connect

    Wu, Chen; Yao, Guangyin; Zou, Minji; Chen, Guangyu; Wang, Min; Liu, Jingqian; Wang, Jiaxi; Xu, Donggang . E-mail:


    Insulin-like growth factor binding protein-3 (IGFBP-3) is known to inhibit cell proliferation and induce apoptosis in IGF-dependent and IGF-independent manners, but the mechanism underlying IGF-independent effects is not yet clear. In a yeast two-hybrid assay, IGFBP-3 was used as the bait to screen a human fetal liver cDNA library for it interactors that may potentially mediate IGFBP-3-regulated functions. N-Acetylgalactosaminyltransferase 14 (GalNAc-T14), a member of the GalNAc-Tases family, was identified as a novel IGFBP-3 binding partner. This interaction involved the ricin-type beta-trefoil domain of GalNAc-T14. The interaction between IGFBP-3 and GalNAc-T14 was reconfirmed in vitro and in vivo, using GST pull-down, co-immunoprecipitation and mammalian two-hybrid assays. Our findings may provide new clues for further study on the mechanism behind the IGF-independent effects of IGFBP-3 promoting apoptosis. The role of GalNAc-T14 as an intracellular mediator of the effects of IGFBP-3 need to be verified in future studies.

  18. Activities of the Sex-lethal protein in RNA binding and protein:protein interactions.

    PubMed Central

    Samuels, M; Deshpande, G; Schedl, P


    The Drosophila sex determination gene Sex-lethal (Sxl) controls its own expression, and the expression of downstream target genes such as transformer , by regulating pre-mRNA splicing and mRNA translation. Sxl codes an RNA-binding protein that consists of an N-terminus of approximately 100 amino acids, two 90 amino acid RRM domains, R1 and R2, and an 80 amino acid C-terminus. In the studies reported here we have examined the functional properties of the different Sxl protein domains in RNA binding and in protein:protein interactions. The two RRM domains are responsible for RNA binding. Specificity in the recognition of target RNAs requires both RRM domains, and proteins which consist of the single domains or duplicated domains have anomalous RNA recognition properties. Moreover, the length of the linker between domains can affect RNA recognition properties. Our results indicate that the two RRM domains mediate Sxl:Sxl protein interactions, and that these interactions probably occur both in cis and trans. We speculate that cis interactions between R1 and R2 play a role in RNA recognition by the Sxl protein, while trans interactions stabilize complex formation on target RNAs that contain two or more closely spaced binding sites. Finally, we show that the interaction of Sxl with the snRNP protein Snf is mediated by the R1 RRM domain. PMID:9592147

  19. Salt modulates the stability and lipid binding affinity of the adipocyte lipid-binding proteins

    NASA Technical Reports Server (NTRS)

    Schoeffler, Allyn J.; Ruiz, Carmen R.; Joubert, Allison M.; Yang, Xuemei; LiCata, Vince J.


    Adipocyte lipid-binding protein (ALBP or aP2) is an intracellular fatty acid-binding protein that is found in adipocytes and macrophages and binds a large variety of intracellular lipids with high affinity. Although intracellular lipids are frequently charged, biochemical studies of lipid-binding proteins and their interactions often focus most heavily on the hydrophobic aspects of these proteins and their interactions. In this study, we have characterized the effects of KCl on the stability and lipid binding properties of ALBP. We find that added salt dramatically stabilizes ALBP, increasing its Delta G of unfolding by 3-5 kcal/mol. At 37 degrees C salt can more than double the stability of the protein. At the same time, salt inhibits the binding of the fluorescent lipid 1-anilinonaphthalene-8-sulfonate (ANS) to the protein and induces direct displacement of the lipid from the protein. Thermodynamic linkage analysis of the salt inhibition of ANS binding shows a nearly 1:1 reciprocal linkage: i.e. one ion is released from ALBP when ANS binds, and vice versa. Kinetic experiments show that salt reduces the rate of association between ANS and ALBP while simultaneously increasing the dissociation rate of ANS from the protein. We depict and discuss the thermodynamic linkages among stability, lipid binding, and salt effects for ALBP, including the use of these linkages to calculate the affinity of ANS for the denatured state of ALBP and its dependence on salt concentration. We also discuss the potential molecular origins and potential intracellular consequences of the demonstrated salt linkages to stability and lipid binding in ALBP.

  20. Guardian of Genetic Messenger-RNA-Binding Proteins

    PubMed Central

    Anji, Antje; Kumari, Meena


    RNA in cells is always associated with RNA-binding proteins that regulate all aspects of RNA metabolism including RNA splicing, export from the nucleus, RNA localization, mRNA turn-over as well as translation. Given their diverse functions, cells express a variety of RNA-binding proteins, which play important roles in the pathologies of a number of diseases. In this review we focus on the effect of alcohol on different RNA-binding proteins and their possible contribution to alcohol-related disorders, and discuss the role of these proteins in the development of neurological diseases and cancer. We further discuss the conventional methods and newer techniques that are employed to identify RNA-binding proteins. PMID:26751491

  1. Purification of a Zn-binding phloem protein with sequence identity to chitin-binding proteins.

    PubMed Central

    Taylor, K C; Albrigo, L G; Chase, C D


    In citrus blight, a decline disorder of unknown etiology, the tree canopy exhibits symptoms of Zn deficiency while Zn accumulates in the trunk phloem. We have purified a Zn-binding protein (ZBP) from phloem tissue of healthy and blight-affected citrus (Citrus sinensis [L.] Osbeck on Citrus jambhiri [L.]). The molecular weight of the ZBP was estimated to be 5000 by size-exclusion chromatography and sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Ion-exchange chromatography at pH 8.0 demonstrated the 5-kD ZBP to be anionic. A partial N-terminal amino acid sequence revealed a cysteine-, glycine-rich domain with 45 to 80% identity with the chitin-binding domain of hevein, wheat germ agglutinin, and several class I chitinases. That the abundance of this protein increased 2.5-fold in association with Zn accumulation in the phloem is characteristic of citrus blight. Tissue mass changes of the phloem suggests that altered tissue structure accompanies blight. Phloem accumulation of the 5-kD ZBP may be in response to wounding or other stress of blight-affected citrus. PMID:8742339

  2. Predicting binding within disordered protein regions to structurally characterised peptide-binding domains.


    Khan, Waqasuddin; Duffy, Fergal; Pollastri, Gianluca; Shields, Denis C; Mooney, Catherine


    Disordered regions of proteins often bind to structured domains, mediating interactions within and between proteins. However, it is difficult to identify a priori the short disordered regions involved in binding. We set out to determine if docking such peptide regions to peptide binding domains would assist in these predictions.We assembled a redundancy reduced dataset of SLiM (Short Linear Motif) containing proteins from the ELM database. We selected 84 sequences which had an associated PDB structures showing the SLiM bound to a protein receptor, where the SLiM was found within a 50 residue region of the protein sequence which was predicted to be disordered. First, we investigated the Vina docking scores of overlapping tripeptides from the 50 residue SLiM containing disordered regions of the protein sequence to the corresponding PDB domain. We found only weak discrimination of docking scores between peptides involved in binding and adjacent non-binding peptides in this context (AUC 0.58).Next, we trained a bidirectional recurrent neural network (BRNN) using as input the protein sequence, predicted secondary structure, Vina docking score and predicted disorder score. The results were very promising (AUC 0.72) showing that multiple sources of information can be combined to produce results which are clearly superior to any single source.We conclude that the Vina docking score alone has only modest power to define the location of a peptide within a larger protein region known to contain it. However, combining this information with other knowledge (using machine learning methods) clearly improves the identification of peptide binding regions within a protein sequence. This approach combining docking with machine learning is primarily a predictor of binding to peptide-binding sites, and is not intended as a predictor of specificity of binding to particular receptors. PMID:24019881

  3. Members of the thrombospondin gene family bind stromal interaction molecule 1 and regulate calcium channel activity

    PubMed Central

    Duquette, Mark; Nadler, Monica; Okuhara, Dayne; Thompson, Jill; Shuttleworth, Trevor; Lawler, Jack


    The thrombospondins (TSPs) are a family of matricellular proteins that regulate cellular phenotype through interactions with a myriad of other proteins and proteoglycans. We have identified a novel interaction of the members of the TSP gene family with stromal interaction molecule 1 (STIM1). This association is robust since it is preserved in Triton X-100, can be detected with multiple anti-TSP-1 and anti-STIM1 antibodies, and is detected in a wide range of cell types. We have also found that STIM1 co-immunoprecipitates with TSP-4 and cartilage oligomeric matrix protein (COMP), and that a recombinant version of the N-terminal domain of STIM1 binds to the signature domain of TSP-1 and COMP. The association of the TSPs with STIM1 is observed in both the presence and absence of calcium indicating that the calcium-dependent conformation of the signature domain of TSPs is not required for binding. Thus, this interaction could occur in the ER under conditions of normal or low calcium concentration. Furthermore, we observed that the expression of COMP in HEK 293 cells decreases STIM1-mediated calcium release activated calcium (CRAC) channel currents and increases arachidonic acid calcium (ARC) channel currents. These data indicate that the TSPs regulate STIM1 function and participate in the reciprocal regulation of two channels that mediate calcium entry into the cell. PMID:24845346

  4. A pollen-specific novel calmodulin-binding protein with tetratricopeptide repeats

    NASA Technical Reports Server (NTRS)

    Safadi, F.; Reddy, V. S.; Reddy, A. S.


    Calcium is essential for pollen germination and pollen tube growth. A large body of information has established a link between elevation of cytosolic Ca(2+) at the pollen tube tip and its growth. Since the action of Ca(2+) is primarily mediated by Ca(2+)-binding proteins such as calmodulin (CaM), identification of CaM-binding proteins in pollen should provide insights into the mechanisms by which Ca(2+) regulates pollen germination and tube growth. In this study, a CaM-binding protein from maize pollen (maize pollen calmodulin-binding protein, MPCBP) was isolated in a protein-protein interaction-based screening using (35)S-labeled CaM as a probe. MPCBP has a molecular mass of about 72 kDa and contains three tetratricopeptide repeats (TPR) suggesting that it is a member of the TPR family of proteins. MPCBP protein shares a high sequence identity with two hypothetical TPR-containing proteins from Arabidopsis. Using gel overlay assays and CaM-Sepharose binding, we show that the bacterially expressed MPCBP binds to bovine CaM and three CaM isoforms from Arabidopsis in a Ca(2+)-dependent manner. To map the CaM-binding domain several truncated versions of the MPCBP were expressed in bacteria and tested for their ability to bind CaM. Based on these studies, the CaM-binding domain was mapped to an 18-amino acid stretch between the first and second TPR regions. Gel and fluorescence shift assays performed with CaM and a CaM-binding synthetic peptide further confirmed MPCBP binding to CaM. Western, Northern, and reverse transcriptase-polymerase chain reaction analysis have shown that MPCBP expression is specific to pollen. MPCBP was detected in both soluble and microsomal proteins. Immunoblots showed the presence of MPCBP in mature and germinating pollen. Pollen-specific expression of MPCBP, its CaM-binding properties, and the presence of TPR motifs suggest a role for this protein in Ca(2+)-regulated events during pollen germination and growth.

  5. Identification of AOSC-binding proteins in neurons

    NASA Astrophysics Data System (ADS)

    Liu, Ming; Nie, Qin; Xin, Xianliang; Geng, Meiyu


    Acidic oligosaccharide sugar chain (AOSC), a D-mannuronic acid oligosaccharide, derived from brown algae polysaccharide, has been completed Phase I clinical trial in China as an anti-Alzheimer’s Disease (AD) drug candidate. The identification of AOSC-binding protein(s) in neurons is very important for understanding its action mechanism. To determine the binding protein(s) of AOSC in neurons mediating its anti-AD activities, confocal microscopy, affinity chromatography, and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis were used. Confocal microscopy analysis shows that AOSC binds to SH-SY5Y cells in concentration-, time-, and temperature-dependent fashions. The AOSC binding proteins were purified by affinity chromatography and identified by LC-MS/MS analysis. The results showed that there are 349 proteins binding AOSC, including clathrin, adaptor protein-2 (AP-2) and amyloid precursor protein (APP). These results suggest that the binding/entrance of AOSC to neurons is probably responsible for anti-AD activities.

  6. Echinococcus granulosus fatty acid binding proteins subcellular localization.


    Alvite, Gabriela; Esteves, Adriana


    Two fatty acid binding proteins, EgFABP1 and EgFABP2, were isolated from the parasitic platyhelminth Echinococcus granulosus. These proteins bind fatty acids and have particular relevance in flatworms since de novo fatty acids synthesis is absent. Therefore platyhelminthes depend on the capture and intracellular distribution of host's lipids and fatty acid binding proteins could participate in lipid distribution. To elucidate EgFABP's roles, we investigated their intracellular distribution in the larval stage by a proteomic approach. Our results demonstrated the presence of EgFABP1 isoforms in cytosolic, nuclear, mitochondrial and microsomal fractions, suggesting that these molecules could be involved in several cellular processes. PMID:26873273

  7. Poly(A)-binding proteins are required for diverse biological processes in metazoans.


    Smith, Richard W P; Blee, Tajekesa K P; Gray, Nicola K


    PABPs [poly(A)-binding proteins] bind to the poly(A) tail of eukaryotic mRNAs and are conserved in species ranging from yeast to human. The prototypical cytoplasmic member, PABP1, is a multifunctional RNA-binding protein with roles in global and mRNA-specific translation and stability, consistent with a function as a central regulator of mRNA fate in the cytoplasm. More limited insight into the molecular functions of other family members is available. However, the consequences of disrupting PABP function in whole organisms is less clear, particularly in vertebrates, and even more so in mammals. In the present review, we discuss current and emerging knowledge with respect to the functions of PABP family members in whole animal studies which, although incomplete, already underlines their biological importance and highlights the need for further intensive research in this area. PMID:25110030

  8. Poly(A)-binding proteins are required for diverse biological processes in metazoans

    PubMed Central

    Smith, Richard W.P.; Blee, Tajekesa K.P.; Gray, Nicola K.


    PABPs [poly(A)-binding proteins] bind to the poly(A) tail of eukaryotic mRNAs and are conserved in species ranging from yeast to human. The prototypical cytoplasmic member, PABP1, is a multifunctional RNA-binding protein with roles in global and mRNA-specific translation and stability, consistent with a function as a central regulator of mRNA fate in the cytoplasm. More limited insight into the molecular functions of other family members is available. However, the consequences of disrupting PABP function in whole organisms is less clear, particularly in vertebrates, and even more so in mammals. In the present review, we discuss current and emerging knowledge with respect to the functions of PABP family members in whole animal studies which, although incomplete, already underlines their biological importance and highlights the need for further intensive research in this area. PMID:25110030

  9. Physiological Functions of APP Family Proteins

    PubMed Central

    Müller, Ulrike C.; Zheng, Hui


    Biochemical and genetic evidence establishes a central role of the amyloid precursor protein (APP) in Alzheimer disease (AD) pathogenesis. Biochemically, deposition of the β-amyloid (Aβ) peptides produced from proteolytic processing of APP forms the defining pathological hallmark of AD; genetically, both point mutations and duplications of wild-type APP are linked to a subset of early onset of familial AD (FAD) and cerebral amyloid angiopathy. As such, the biological functions of APP and its processing products have been the subject of intense investigation, and the past 20+ years of research have met with both excitement and challenges. This article will review the current understanding of the physiological functions of APP in the context of APP family members. PMID:22355794

  10. Heparin binding preference and structures in the fibroblast growth factor family parallel their evolutionary diversification

    PubMed Central

    Jiang, Chao; Wilkinson, Mark C.


    The interaction of a large number of extracellular proteins with heparan sulfate (HS) regulates their transport and effector functions, but the degree of molecular specificity underlying protein–polysaccharide binding is still debated. The 15 paracrine fibroblast growth factors (FGFs) are one of the paradigms for this interaction. Here, we measure the binding preferences of six FGFs (FGF3, FGF4, FGF6, FGF10, FGF17, FGF20) for a library of modified heparins, representing structures in HS, and model glycosaminoglycans, using differential scanning fluorimetry. This is complemented by the identification of the lysine residues in the primary and secondary binding sites of the FGFs by a selective labelling approach. Pooling these data with previous sets provides good coverage of the FGF phylogenetic tree, deduced from amino acid sequence alignment. This demonstrates that the selectivity of the FGFs for binding structures in sulfated polysaccharides and the pattern of secondary binding sites on the surface of FGFs follow the phylogenetic relationship of the FGFs, and so are likely to be the result of the natural selection pressures that led to the expansion of the FGF family in the course of the evolution of more complex animal body plans. PMID:27030175

  11. Active Site and Laminarin Binding in Glycoside Hydrolase Family 55*

    PubMed Central

    Bianchetti, Christopher M.; Takasuka, Taichi E.; Deutsch, Sam; Udell, Hannah S.; Yik, Eric J.; Bergeman, Lai F.; Fox, Brian G.


    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100–10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  12. Active site and laminarin binding in glycoside hydrolase family 55.


    Bianchetti, Christopher M; Takasuka, Taichi E; Deutsch, Sam; Udell, Hannah S; Yik, Eric J; Bergeman, Lai F; Fox, Brian G


    The Carbohydrate Active Enzyme (CAZy) database indicates that glycoside hydrolase family 55 (GH55) contains both endo- and exo-β-1,3-glucanases. The founding structure in the GH55 is PcLam55A from the white rot fungus Phanerochaete chrysosporium (Ishida, T., Fushinobu, S., Kawai, R., Kitaoka, M., Igarashi, K., and Samejima, M. (2009) Crystal structure of glycoside hydrolase family 55 β-1,3-glucanase from the basidiomycete Phanerochaete chrysosporium. J. Biol. Chem. 284, 10100-10109). Here, we present high resolution crystal structures of bacterial SacteLam55A from the highly cellulolytic Streptomyces sp. SirexAA-E with bound substrates and product. These structures, along with mutagenesis and kinetic studies, implicate Glu-502 as the catalytic acid (as proposed earlier for Glu-663 in PcLam55A) and a proton relay network of four residues in activating water as the nucleophile. Further, a set of conserved aromatic residues that define the active site apparently enforce an exo-glucanase reactivity as demonstrated by exhaustive hydrolysis reactions with purified laminarioligosaccharides. Two additional aromatic residues that line the substrate-binding channel show substrate-dependent conformational flexibility that may promote processive reactivity of the bound oligosaccharide in the bacterial enzymes. Gene synthesis carried out on ∼30% of the GH55 family gave 34 active enzymes (19% functional coverage of the nonredundant members of GH55). These active enzymes reacted with only laminarin from a panel of 10 different soluble and insoluble polysaccharides and displayed a broad range of specific activities and optima for pH and temperature. Application of this experimental method provides a new, systematic way to annotate glycoside hydrolase phylogenetic space for functional properties. PMID:25752603

  13. Structural insights into the DNA-binding specificity of E2F family transcription factors

    PubMed Central

    Morgunova, Ekaterina; Yin, Yimeng; Jolma, Arttu; Dave, Kashyap; Schmierer, Bernhard; Popov, Alexander; Eremina, Nadejda; Nilsson, Lennart; Taipale, Jussi


    The mammalian cell cycle is controlled by the E2F family of transcription factors. Typical E2Fs bind to DNA as heterodimers with the related dimerization partner (DP) proteins, whereas the atypical E2Fs, E2F7 and E2F8 contain two DNA-binding domains (DBDs) and act as repressors. To understand the mechanism of repression, we have resolved the structure of E2F8 in complex with DNA at atomic resolution. We find that the first and second DBDs of E2F8 resemble the DBDs of typical E2F and DP proteins, respectively. Using molecular dynamics simulations, biochemical affinity measurements and chromatin immunoprecipitation, we further show that both atypical and typical E2Fs bind to similar DNA sequences in vitro and in vivo. Our results represent the first crystal structure of an E2F protein with two DBDs, and reveal the mechanism by which atypical E2Fs can repress canonical E2F target genes and exert their negative influence on cell cycle progression. PMID:26632596

  14. Structural architecture and interplay of the nucleotide- and erythrocyte binding domain of the reticulocyte binding protein Py235 from Plasmodium yoelii.


    Grüber, Ardina; Manimekalai, Malathy S S; Preiser, Peter R; Grüber, Gerhard


    Human malaria is caused by the cyclical invasion of the host's red blood cells (RBCs) by the invasive form of the parasite, the merozoite. The invasion of the RBC involves a range of parasite ligand receptor interactions, a process which is under intensive investigation. Two protein families are known to be important in the recognition and invasion of the human erythrocyte, the erythrocyte-binding like (EBL) proteins and the reticulocyte binding like proteins, of which the Py235 family in Plasmodium yoelii is a member. Recently the nucleotide binding domain (NBD94), that plays a role in ATP sensing, and the erythrocyte binding domain (EBD) of Py235, called EBD(1-194), have been identified. Binding of ATP leads to conformational changes within Py235 from P. yoelli and results in enhanced binding of the protein to the RBC. Structural features of these domains have been obtained, providing the platform to discuss how the structural architecture creates the basis for an interplay of the sensing NBD and the EBD domain in Py235. In analogy to the receptor-mediated ligand-dimerization model of the EBL proteins PvDBP and PfEBA-175 from Plasmodium vivax and Plasmodium falciparum, respectively, we hypothesise that Py235 of P. yoelii binds via its EBD(1-194) domain to the RBC receptor, thereby inducing dimerization of the Py235-receptor complex. PMID:22878128

  15. Ligand Binding Ensembles Determine Graded Agonist Efficacies at a G Protein-coupled Receptor.


    Bock, Andreas; Bermudez, Marcel; Krebs, Fabian; Matera, Carlo; Chirinda, Brian; Sydow, Dominique; Dallanoce, Clelia; Holzgrabe, Ulrike; De Amici, Marco; Lohse, Martin J; Wolber, Gerhard; Mohr, Klaus


    G protein-coupled receptors constitute the largest family of membrane receptors and modulate almost every physiological process in humans. Binding of agonists to G protein-coupled receptors induces a shift from inactive to active receptor conformations. Biophysical studies of the dynamic equilibrium of receptors suggest that a portion of receptors can remain in inactive states even in the presence of saturating concentrations of agonist and G protein mimetic. However, the molecular details of agonist-bound inactive receptors are poorly understood. Here we use the model of bitopic orthosteric/allosteric (i.e. dualsteric) agonists for muscarinic M2 receptors to demonstrate the existence and function of such inactive agonist·receptor complexes on a molecular level. Using all-atom molecular dynamics simulations, dynophores (i.e. a combination of static three-dimensional pharmacophores and molecular dynamics-based conformational sampling), ligand design, and receptor mutagenesis, we show that inactive agonist·receptor complexes can result from agonist binding to the allosteric vestibule alone, whereas the dualsteric binding mode produces active receptors. Each agonist forms a distinct ligand binding ensemble, and different agonist efficacies depend on the fraction of purely allosteric (i.e. inactive) versus dualsteric (i.e. active) binding modes. We propose that this concept may explain why agonist·receptor complexes can be inactive and that adopting multiple binding modes may be generalized also to small agonists where binding modes will be only subtly different and confined to only one binding site. PMID:27298318

  16. ADAR Proteins: Double-stranded RNA and Z-DNA Binding Domains

    PubMed Central

    Barraud, Pierre; Allain, Frédéric H.-T


    Adenosine deaminases acting on RNA (ADARs) catalyze adenosine to inosine editing within double-stranded RNA (dsRNA) substrates. Inosine is read as a guanine by most cellular processes and therefore these changes create codons for a different amino acid, stop codons or even a new splice-site allowing protein diversity generated from a single gene. We are reviewing here the current structural and molecular knowledge on RNA editing by the ADAR family of protein. We focus especially on two types of nucleic acid binding domains present in ADARs, namely the double-stranded RNA and Z-DNA binding domains. PMID:21728134

  17. Pathophysiological role of guanylate-binding proteins in gastrointestinal diseases

    PubMed Central

    Britzen-Laurent, Nathalie; Herrmann, Christian; Naschberger, Elisabeth; Croner, Roland S; Stürzl, Michael


    Guanylate-binding proteins (GBPs) are interferon-stimulated factors involved in the defense against cellular pathogens and inflammation. These proteins, particularly GBP-1, the most prominent member of the family, have been established as reliable markers of interferon-γ-activated cells in various diseases, including colorectal carcinoma (CRC) and inflammatory bowel diseases (IBDs). In CRC, GBP-1 expression is associated with a Th1-dominated angiostatic micromilieu and is correlated with a better outcome. Inhibition of tumor growth by GBP-1 is the result of its strong anti-angiogenic activity as well as its direct anti-tumorigenic effect on tumor cells. In IBD, GBP-1 mediates the anti-proliferative effects of interferon-γ on intestinal epithelial cells. In addition, it plays a protective role on the mucosa by preventing cell apoptosis, by inhibiting angiogenesis and by regulating the T-cell receptor signaling. These functions rely to a large extent on the ability of GBP-1 to interact with and remodel the actin cytoskeleton.

  18. Pathophysiological role of guanylate-binding proteins in gastrointestinal diseases.


    Britzen-Laurent, Nathalie; Herrmann, Christian; Naschberger, Elisabeth; Croner, Roland S; Stürzl, Michael


    Guanylate-binding proteins (GBPs) are interferon-stimulated factors involved in the defense against cellular pathogens and inflammation. These proteins, particularly GBP-1, the most prominent member of the family, have been established as reliable markers of interferon-γ-activated cells in various diseases, including colorectal carcinoma (CRC) and inflammatory bowel diseases (IBDs). In CRC, GBP-1 expression is associated with a Th1-dominated angiostatic micromilieu and is correlated with a better outcome. Inhibition of tumor growth by GBP-1 is the result of its strong anti-angiogenic activity as well as its direct anti-tumorigenic effect on tumor cells. In IBD, GBP-1 mediates the anti-proliferative effects of interferon-γ on intestinal epithelial cells. In addition, it plays a protective role on the mucosa by preventing cell apoptosis, by inhibiting angiogenesis and by regulating the T-cell receptor signaling. These functions rely to a large extent on the ability of GBP-1 to interact with and remodel the actin cytoskeleton. PMID:27605879

  19. The human "magnesome": detecting magnesium binding sites on human proteins

    PubMed Central


    Background Magnesium research is increasing in molecular medicine due to the relevance of this ion in several important biological processes and associated molecular pathogeneses. It is still difficult to predict from the protein covalent structure whether a human chain is or not involved in magnesium binding. This is mainly due to little information on the structural characteristics of magnesium binding sites in proteins and protein complexes. Magnesium binding features, differently from those of other divalent cations such as calcium and zinc, are elusive. Here we address a question that is relevant in protein annotation: how many human proteins can bind Mg2+? Our analysis is performed taking advantage of the recently implemented Bologna Annotation Resource (BAR-PLUS), a non hierarchical clustering method that relies on the pair wise sequence comparison of about 14 millions proteins from over 300.000 species and their grouping into clusters where annotation can safely be inherited after statistical validation. Results After cluster assignment of the latest version of the human proteome, the total number of human proteins for which we can assign putative Mg binding sites is 3,751. Among these proteins, 2,688 inherit annotation directly from human templates and 1,063 inherit annotation from templates of other organisms. Protein structures are highly conserved inside a given cluster. Transfer of structural properties is possible after alignment of a given sequence with the protein structures that characterise a given cluster as obtained with a Hidden Markov Model (HMM) based procedure. Interestingly a set of 370 human sequences inherit Mg2+ binding sites from templates sharing less than 30% sequence identity with the template. Conclusion We describe and deliver the "human magnesome", a set of proteins of the human proteome that inherit putative binding of magnesium ions. With our BAR-hMG, 251 clusters including 1,341 magnesium binding protein structures

  20. Using Centromere Mediated Genome Elimination to Elucidate the Functional Redundancy of Candidate Telomere Binding Proteins in Arabidopsis thaliana.


    Fulcher, Nick; Riha, Karel


    Proteins that bind to telomeric DNA form the key structural and functional constituents of telomeres. While telomere binding proteins have been described in the majority of organisms, their identity in plants remains unknown. Several protein families containing a telomere binding motif known as the telobox have been previously described in Arabidopsis thaliana. Nonetheless, functional evidence for their involvement at telomeres has not been obtained, likely due to functional redundancy. Here we performed genetic analysis on the TRF-like family consisting of six proteins (TRB1, TRP1, TRFL1, TRFL2, TRFL4, and TRF9) which have previously shown to bind telomeric DNA in vitro. We used haploid genetics to create multiple knock-out plants deficient for all six proteins of this gene family. These plants did not exhibit changes in telomere length, or phenotypes associated with telomere dysfunction. This data demonstrates that this telobox protein family is not involved in telomere maintenance in Arabidopsis. Phylogenetic analysis in major plant lineages revealed early diversification of telobox proteins families indicating that telomere function may be associated with other telobox proteins. PMID:26779251

  1. Using Centromere Mediated Genome Elimination to Elucidate the Functional Redundancy of Candidate Telomere Binding Proteins in Arabidopsis thaliana

    PubMed Central

    Fulcher, Nick; Riha, Karel


    Proteins that bind to telomeric DNA form the key structural and functional constituents of telomeres. While telomere binding proteins have been described in the majority of organisms, their identity in plants remains unknown. Several protein families containing a telomere binding motif known as the telobox have been previously described in Arabidopsis thaliana. Nonetheless, functional evidence for their involvement at telomeres has not been obtained, likely due to functional redundancy. Here we performed genetic analysis on the TRF-like family consisting of six proteins (TRB1, TRP1, TRFL1, TRFL2, TRFL4, and TRF9) which have previously shown to bind telomeric DNA in vitro. We used haploid genetics to create multiple knock-out plants deficient for all six proteins of this gene family. These plants did not exhibit changes in telomere length, or phenotypes associated with telomere dysfunction. This data demonstrates that this telobox protein family is not involved in telomere maintenance in Arabidopsis. Phylogenetic analysis in major plant lineages revealed early diversification of telobox proteins families indicating that telomere function may be associated with other telobox proteins. PMID:26779251

  2. Niobium Uptake and Release by Bacterial Ferric Ion Binding Protein

    PubMed Central

    Shi, Yanbo; Harvey, Ian; Campopiano, Dominic; Sadler, Peter J.


    Ferric ion binding proteins (Fbps) transport FeIII across the periplasm and are vital for the virulence of many Gram negative bacteria. Iron(III) is tightly bound in a hinged binding cleft with octahedral coordination geometry involving binding to protein side chains (including tyrosinate residues) together with a synergistic anion such as phosphate. Niobium compounds are of interest for their potential biological activity, which has been little explored. We have studied the binding of cyclopentadienyl and nitrilotriacetato NbV complexes to the Fbp from Neisseria gonorrhoeae by UV-vis spectroscopy, chromatography, ICP-OES, mass spectrometry, and Nb K-edge X-ray absorption spectroscopy. These data suggest that NbV binds strongly to Fbp and that a dinuclear NbV centre can be readily accommodated in the interdomain binding cleft. The possibility of designing niobium-based antibiotics which block iron uptake by pathogenic bacteria is discussed. PMID:20445753

  3. Paramagnetic Ligand Tagging To Identify Protein Binding Sites

    PubMed Central


    Transient biomolecular interactions are the cornerstones of the cellular machinery. The identification of the binding sites for low affinity molecular encounters is essential for the development of high affinity pharmaceuticals from weakly binding leads but is hindered by the lack of robust methodologies for characterization of weakly binding complexes. We introduce a paramagnetic ligand tagging approach that enables localization of low affinity protein–ligand binding clefts by detection and analysis of intermolecular protein NMR pseudocontact shifts, which are invoked by the covalent attachment of a paramagnetic lanthanoid chelating tag to the ligand of interest. The methodology is corroborated by identification of the low millimolar volatile anesthetic interaction site of the calcium sensor protein calmodulin. It presents an efficient route to binding site localization for low affinity complexes and is applicable to rapid screening of protein–ligand systems with varying binding affinity. PMID:26289584

  4. The Potassium Binding Protein Kbp Is a Cytoplasmic Potassium Sensor.


    Ashraf, Khuram U; Josts, Inokentijs; Mosbahi, Khedidja; Kelly, Sharon M; Byron, Olwyn; Smith, Brian O; Walker, Daniel


    Escherichia coli possesses a number of specific K(+) influx and efflux systems that maintain an appropriate intracellular K(+) concentration. Although regulatory mechanisms have been identified for a number of these transport systems, the exact mechanism through which K(+) concentration is sensed in the cell remains unknown. In this work we show that Kbp (K(+) binding protein, formerly YgaU), a soluble 16-kDa cytoplasmic protein from Escherichia coli, is a highly specific K(+) binding protein and is required for normal growth in the presence of high levels of external K(+). Kbp binds a single potassium ion with high specificity over Na(+) and other metal ions found in biological systems, although, in common with K(+) transporters, it also binds Rb(+) and Cs(+). Dissection of the K(+) binding determinants of Kbp suggests a mechanism through which Kbp is able to sense changes in K(+) concentration over the relevant range of intracellular K(+) concentrations. PMID:27112601

  5. Gene Models, Expression Repertoire, and Immune Response of Plasmodium vivax Reticulocyte Binding Proteins

    PubMed Central

    Hietanen, Jenni; Chim-ong, Anongruk; Chiramanewong, Thanprakorn; Gruszczyk, Jakub; Roobsoong, Wanlapa; Sattabongkot, Jetsumon


    Members of the Plasmodium vivax reticulocyte binding protein (PvRBP) family are believed to mediate specific invasion of reticulocytes by P. vivax. In this study, we performed molecular characterization of genes encoding members of this protein family. Through cDNA sequencing, we constructed full-length gene models and verified genes that are protein coding and those that are pseudogenes. We also used quantitative PCR to measure their in vivo transcript abundances in clinical P. vivax isolates. Like genes encoding related invasion ligands of P. falciparum, Pvrbp expression levels vary broadly across different parasite isolates. Through antibody measurements, we found that host immune pressure may be the driving force behind the distinctly high diversity of one of the family members, PvRBP2c. Mild yet significant negative correlation was found between parasitemia and the PvRBP2b antibody level, suggesting that antibodies to the protein may interfere with invasion. PMID:26712206

  6. Human ATP-binding cassette (ABC) transporter family

    PubMed Central


    There exist four fundamentally different classes of membrane-bound transport proteins: ion channels; transporters; aquaporins; and ATP-powered pumps. ATP-binding cassette (ABC) transporters are an example of ATP-dependent pumps. ABC transporters are ubiquitous membrane-bound proteins, present in all prokaryotes, as well as plants, fungi, yeast and animals. These pumps can move substrates in (influx) or out (efflux) of cells. In mammals, ABC transporters are expressed predominantly in the liver, intestine, blood-brain barrier, blood-testis barrier, placenta and kidney. ABC proteins transport a number of endogenous substrates, including inorganic anions, metal ions, peptides, amino acids, sugars and a large number of hydrophobic compounds and metabolites across the plasma membrane, and also across intracellular membranes. The human genome contains 49 ABC genes, arranged in eight subfamilies and named via divergent evolution. That ABC genes are important is underscored by the fact that mutations in at least I I of these genes are already known to cause severe inherited diseases (eg cystic fibrosis and X-linked adrenoleukodystrophy [X-ALD]). ABC transporters also participate in the movement of most drugs and their metabolites across cell surface and cellular organelle membranes; thus, defects in these genes can be important in terms of cancer therapy, pharmacokinetics and innumerable pharmacogenetic disorders. PMID:19403462

  7. The RNA binding site of bacteriophage MS2 coat protein.

    PubMed Central

    Peabody, D S


    The coat protein of the RNA bacteriophage MS2 binds a specific stem-loop structure in viral RNA to accomplish encapsidation of the genome and translational repression of replicase synthesis. In order to identify the structural components of coat protein required for its RNA binding function, a series of repressor-defective mutants has been isolated. To ensure that the repressor defects were due to substitution of binding site residues, the mutant coat proteins were screened for retention of the ability to form virus-like particles. Since virus assembly presumably requires native structure, this approach eliminated mutants whose repressor defects were secondary consequences of protein folding or stability defects. Each of the variant coat proteins was purified and its ability to bind operator RNA in vitro was measured. DNA sequence analysis identified the nucleotide and amino acid substitutions responsible for reduced RNA binding affinity. Localization of the substituted sites in the three-dimensional structure of coat protein reveals that amino acid residues on three adjacent strands of the coat protein beta-sheet are required for translational repression and RNA binding. The sidechains of the affected residues form a contiguous patch on the interior surface of the viral coat. Images PMID:8440248

  8. Exchange Kinetics of a Hydrophobic Ligand Binding Protein

    NASA Astrophysics Data System (ADS)

    Vaughn, Jeff; Stone, Martin


    Conformational fluctuations of proteins are thought to be important for determining the functional roles in biological activity. In some cases, the rates of these conformational changes may be directly correlated to, for example, the rates of catalysis or ligand binding. We are studying the role of conformational fluctuations in the binding of small volatile hydrophobic pheromones by the mouse major urinary proteins (MUPs). Communication among mice occurs, in part, with the MUP-1 protein. This urinary protein binds pheromones as a way to increase the longevity of the pheromone in an extracellular environment. Of interest is that the crystal structure of MUP-1 with a pheromone ligand shows the ligand to be completely occluded from the solvent with no obvious pathway to enter or exit. This suggests that conformational exchange of the protein may be required for ligand binding and release to occur. We hypothesize that the rate of conformational exchange may be a limiting factor determining the rate of ligand association and dissociation. By careful measurement of the on- and off-rates of ligand binding and the rates of conformational changes of the protein, a more defined picture of the interplay between protein structure and function can be obtained. To this end, heteronuclear saturation transfer, ^15N-exchange and ^15N dynamics experiments have been employed to probe the kinetics of ligand binding to MUP-1.

  9. General RNA binding proteins render translation cap dependent.

    PubMed Central

    Svitkin, Y V; Ovchinnikov, L P; Dreyfuss, G; Sonenberg, N


    Translation in rabbit reticulocyte lysate is relatively independent of the presence of the mRNA m7G cap structure and the cap binding protein, eIF-4E. In addition, initiation occurs frequently at spurious internal sites. Here we show that a critical parameter which contributes to cap-dependent translation is the amount of general RNA binding proteins in the extract. Addition of several general RNA binding proteins, such as hnRNP A1, La autoantigen, pyrimidine tract binding protein (hnRNP I/PTB) and the major core protein of cytoplasmic mRNP (p50), rendered translation in a rabbit reticulocyte lysate cap dependent. These proteins drastically inhibited the translation of an uncapped mRNA, but had no effect on translation of a capped mRNA. Based on these and other results, we suggest that one function of general mRNA binding proteins in the cytoplasm is to promote ribosome binding by a 5' end, cap-mediated mechanism, and prevent spurious initiations at aberrant translation start sites. Images PMID:9003790

  10. PBX and MEIS as Non-DNA-Binding Partners in Trimeric Complexes with HOX Proteins

    PubMed Central

    Shanmugam, Kandavel; Green, Nancy C.; Rambaldi, Isabel; Saragovi, H. Uri; Featherstone, Mark S.


    HOX, PBX, and MEIS transcription factors bind DNA through a homeodomain. PBX proteins bind DNA cooperatively as heterodimers with MEIS family members and also with HOX proteins from paralog groups 1 to 10. MEIS proteins cooperatively bind DNA with ABD-B class HOX proteins of groups 9 and 10. Here, we examine aspects of dimeric and higher-order interactions between these three homeodomain classes. The most significant results can be summarized as follows. (i) Most of PBX N terminal to the homeodomain is required for efficient cooperative binding with HOXD4 and HOXD9. (ii) MEIS and PBX proteins form higher-order complexes on a heterodimeric binding site. (iii) Although MEIS does not cooperatively bind DNA with ANTP class HOX proteins, it does form a trimer as a non-DNA-binding partner with DNA-bound PBX-HOXD4. (iv) The N terminus of HOXD4 negatively regulates trimer formation. (v) MEIS forms a similar trimer with DNA-bound PBX-HOXD9. (vi) A related trimer (where MEIS is a non-DNA-binding partner) is formed on a transcriptional promoter within the cell. (vii) We observe an additional trimer class involving non-DNA-bound PBX and DNA-bound MEIS-HOXD9 or MEIS-HOXD10 heterodimers that is enhanced by mutation of the PBX homeodomain. (viii) In this latter trimer, PBX is likely to contact both MEIS and HOXD9/D10. (ix) The stability of DNA binding by all trimers is enhanced relative to the heterodimers. These findings suggest novel functions for PBX and MEIS in modulating the function of DNA-bound MEIS-HOX and PBX-HOX heterodimers, respectively. PMID:10523646

  11. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms.


    Chou, Shan-Ho; Galperin, Michael Y


    Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  12. Diversity of Cyclic Di-GMP-Binding Proteins and Mechanisms

    PubMed Central


    ABSTRACT Cyclic di-GMP (c-di-GMP) synthetases and hydrolases (GGDEF, EAL, and HD-GYP domains) can be readily identified in bacterial genome sequences by using standard bioinformatic tools. In contrast, identification of c-di-GMP receptors remains a difficult task, and the current list of experimentally characterized c-di-GMP-binding proteins is likely incomplete. Several classes of c-di-GMP-binding proteins have been structurally characterized; for some others, the binding sites have been identified; and for several potential c-di-GMP receptors, the binding sites remain to be determined. We present here a comparative structural analysis of c-di-GMP-protein complexes that aims to discern the common themes in the binding mechanisms that allow c-di-GMP receptors to bind it with (sub)micromolar affinities despite the 1,000-fold excess of GTP. The available structures show that most receptors use their Arg and Asp/Glu residues to bind c-di-GMP monomers, dimers, or tetramers with stacked guanine bases. The only exception is the EAL domains that bind c-di-GMP monomers in an extended conformation. We show that in c-di-GMP-binding signature motifs, Arg residues bind to the O-6 and N-7 atoms at the Hoogsteen edge of the guanine base, while Asp/Glu residues bind the N-1 and N-2 atoms at its Watson-Crick edge. In addition, Arg residues participate in stacking interactions with the guanine bases of c-di-GMP and the aromatic rings of Tyr and Phe residues. This may account for the presence of Arg residues in the active sites of every receptor protein that binds stacked c-di-GMP. We also discuss the implications of these structural data for the improved understanding of the c-di-GMP signaling mechanisms. PMID:26055114

  13. Granzyme A binding to target cell proteins. Granzyme A binds to and cleaves nucleolin in vitro.


    Pasternack, M S; Bleier, K J; McInerney, T N


    The physiologic substrates of cytotoxic T lymphocyte granule-associated serine esterases (referred to hereafter as proteases or "granzymes"), and the role of these enzymes in cell-mediated activity remain unclear. We have developed an assay for possible ligands of the trypsin-like dimeric serine protease granzyme A based on Western immunoblotting techniques. This protein-binding assay demonstrates the selective binding of granzyme A to several proteins present in the target cell P815. The binding specificity is preserved when enzyme binding is performed in the presence of excess competing proteins, including such cationic species as lysozyme and RNase. Enzyme binding is inhibited, however, by heat or detergent inactivation of granzyme A. Subcellular fractionation of target cells shows that the nuclear fraction contains most granzyme A binding reactivity, which is recovered in the nuclear salt wash fraction. A protein with Mr = 100,000 and two closely migrating proteins with Mr = 35,000 and 38,000 are the predominant reactive moieties, and the N-terminal sequence of the 100-kDa protein confirmed that this protein was murine nucleolin. Incubation of granzyme A with nucleolin generates a discrete proteolytic cleavage product of Mr = 88,000. Since nucleolin is known to shuttle between nucleus and cytoplasm, the interaction of granzyme A and nucleolin may be important in the process of apoptosis which accompanies cytotoxic T lymphocyte-mediated lysis of target cells. PMID:1860869

  14. The Sec1p/Munc18 protein Vps45p binds its cognate SNARE proteins via two distinct modes.


    Carpp, Lindsay N; Ciufo, Leonora F; Shanks, Scott G; Boyd, Alan; Bryant, Nia J


    Sec1p/Munc18 (SM) proteins are essential for SNARE-mediated membrane trafficking. The formulation of unifying hypotheses for the function of the SM protein family has been hampered by the observation that two of its members bind their cognate syntaxins (Sxs) in strikingly different ways. The SM protein Vps45p binds its Sx Tlg2p in a manner analogous to that captured by the Sly1p-Sed5p crystal structure, whereby the NH2-terminal peptide of the Sx inserts into a hydrophobic pocket on the outer face of domain I of the SM protein. In this study, we report that although this mode of interaction is critical for the binding of Vps45p to Tlg2p, the SM protein also binds Tlg2p-containing SNARE complexes via a second mode that involves neither the NH2 terminus of Tlg2p nor the region of Vps45p that facilitates this interaction. Our findings point to the possibility that SM proteins interact with their cognate SNARE proteins through distinct mechanisms at different stages in the SNARE assembly/disassembly cycle. PMID:16769821

  15. Cell-Binding Assays for Determining the Affinity of Protein-Protein Interactions: Technologies and Considerations.


    Hunter, S A; Cochran, J R


    Determining the equilibrium-binding affinity (Kd) of two interacting proteins is essential not only for the biochemical study of protein signaling and function but also for the engineering of improved protein and enzyme variants. One common technique for measuring protein-binding affinities uses flow cytometry to analyze ligand binding to proteins presented on the surface of a cell. However, cell-binding assays require specific considerations to accurately quantify the binding affinity of a protein-protein interaction. Here we will cover the basic assumptions in designing a cell-based binding assay, including the relevant equations and theory behind determining binding affinities. Further, two major considerations in measuring binding affinities-time to equilibrium and ligand depletion-will be discussed. As these conditions have the potential to greatly alter the Kd, methods through which to avoid or minimize them will be provided. We then outline detailed protocols for performing direct- and competitive-binding assays against proteins displayed on the surface of yeast or mammalian cells that can be used to derive accurate Kd values. Finally, a comparison of cell-based binding assays to other types of binding assays will be presented. PMID:27586327

  16. Ice-shell purification of ice-binding proteins.


    Marshall, Craig J; Basu, Koli; Davies, Peter L


    Ice-affinity purification is a simple and efficient method of purifying to homogeneity both natural and recombinant ice-binding proteins. The purification involves the incorporation of ice-binding proteins into slowly-growing ice and the exclusion of other proteins and solutes. In previous approaches, the ice was grown around a hollow brass finger through which coolant was circulated. We describe here an easily-constructed apparatus that employs ice affinity purification that not only shortens the time for purification from 1-2 days to 1-2 h, but also enhances yield and purity. In this apparatus, the surface area for the separation was increased by extracting the ice-binding proteins into an ice-shell formed inside a rotating round-bottom flask partially submerged in a sub-zero bath. In principle, any ice-binding compound can be recovered from liquid solution, and the method is readily scalable. PMID:27025155

  17. Erythrocyte Protein 4.1 Binds and Regulates Myosin

    NASA Astrophysics Data System (ADS)

    Pasternack, Gary R.; Racusen, Richard H.


    Myosin was recently identified in erythrocytes and was shown to partition both with membrane and cytosolic fractions, suggesting that it may be loosely bound to membranes [Fowler, V. M., Davis, J. Q. & Bennett, V. (1985) J. Cell Biol. 100, 47-55, and Wong, A. J., Kiehart, D. P. & Pollard, T. D. (1985) J. Biol. Chem. 260, 46-49]; however, the molecular basis for this binding was unclear. The present studies employed immobilized monomeric myosin to examine the interaction of myosin with erythrocyte protein 4.1. In human erythrocytes, protein 4.1 binds to integral membrane proteins and mediates spectrin-actin assembly. Protein 4.1 binds to rabbit skeletal muscle myosin with a Kd = 140 nM and a stoichiometry consistent with 1:1 binding. Heavy meromyosin competes for protein 4.1 binding with Ki = 36-54 nM; however, the S1 fragment (the myosin head) competes less efficiently. Affinity chromatography of partial chymotryptic digests of protein 4.1 on immobilized myosin identified a 10-kDa domain of protein 4.1 as the myosin-binding site. In functional studies, protein 4.1 partially inhibited the actin-activated Mg2+-ATPase activity of rabbit skeletal muscle myosin with Ki = 51 nM. Liver cytosolic and erythrocyte myosins preactivated with myosin light-chain kinase were similarly inhibited by protein 4.1. These studies show that protein 4.1 binds, modulates, and thus may regulate myosin. This interaction might serve to generate the contractile forces involved in Mg2+-ATP-dependent shape changes in erythrocytes and may additionally serve as a model for myosin organization and regulation in non-muscle cells.

  18. Theoretical studies of protein-protein and protein-DNA binding rates

    NASA Astrophysics Data System (ADS)

    Alsallaq, Ramzi A.

    Proteins are folded chains of amino acids. Some of the amino acids (e.g. Lys, Arg, His, Asp, and Glu) carry charges under physiological conditions. Proteins almost always function through binding to other proteins or ligands, for example barnase is a ribonuclease protein, found in the bacterium Bacillus amyloliquefaceus. Barnase degrades RNA by hydrolysis. For the bacterium to inhibit the potentially lethal action of Barnase within its own cell it co-produces another protein called barstar which binds quickly, and tightly, to barnase. The biological function of this binding is to block the active site of barnase. The speeds (rates) at which proteins associate are vital to many biological processes. They span a wide range (from less than 103 to 108 M-1s-1 ). Rates greater than ˜ 106 M -1s-1 are typically found to be manifestations of enhancements by long-range electrostatic interactions between the associating proteins. A different paradigm appears in the case of protein binding to DNA. The rate in this case is enhanced through attractive surface potential that effectively reduces the dimensionality of the available search space for the diffusing protein. This thesis presents computational and theoretical models on the rate of association of ligands/proteins to other proteins or DNA. For protein-protein association we present a general strategy for computing protein-protein rates of association. The main achievements of this strategy is the ability to obtain a stringent reaction criteria based on the landscape of short-range interactions between the associating proteins, and the ability to compute the effect of the electrostatic interactions on the rates of association accurately using the best known solvers for Poisson-Boltzmann equation presently available. For protein-DNA association we present a mathematical model for proteins targeting specific sites on a circular DNA topology. The main achievements are the realization that a linear DNA with reflecting ends

  19. Genome-Wide Prediction and Validation of Peptides That Bind Human Prosurvival Bcl-2 Proteins

    PubMed Central

    DeBartolo, Joe; Taipale, Mikko; Keating, Amy E.


    Programmed cell death is regulated by interactions between pro-apoptotic and prosurvival members of the Bcl-2 family. Pro-apoptotic family members contain a weakly conserved BH3 motif that can adopt an alpha-helical structure and bind to a groove on prosurvival partners Bcl-xL, Bcl-w, Bcl-2, Mcl-1 and Bfl-1. Peptides corresponding to roughly 13 reported BH3 motifs have been verified to bind in this manner. Due to their short lengths and low sequence conservation, BH3 motifs are not detected using standard sequence-based bioinformatics approaches. Thus, it is possible that many additional proteins harbor BH3-like sequences that can mediate interactions with the Bcl-2 family. In this work, we used structure-based and data-based Bcl-2 interaction models to find new BH3-like peptides in the human proteome. We used peptide SPOT arrays to test candidate peptides for interaction with one or more of the prosurvival proteins Bcl-xL, Bcl-w, Bcl-2, Mcl-1 and Bfl-1. For the 36 most promising array candidates, we quantified binding to all five human receptors using direct and competition binding assays in solution. All 36 peptides showed evidence of interaction with at least one prosurvival protein, and 22 peptides bound at least one prosurvival protein with a dissociation constant between 1 and 500 nM; many peptides had specificity profiles not previously observed. We also screened the full-length parent proteins of a subset of array-tested peptides for binding to Bcl-xL and Mcl-1. Finally, we used the peptide binding data, in conjunction with previously reported interactions, to assess the affinity and specificity prediction performance of different models. PMID:24967846

  20. The protein that binds to DNA base J in trypanosomatids has features of a thymidine hydroxylase.


    Yu, Zhong; Genest, Paul-André; ter Riet, Bas; Sweeney, Kate; DiPaolo, Courtney; Kieft, Rudo; Christodoulou, Evangelos; Perrakis, Anastassis; Simmons, Jana M; Hausinger, Robert P; van Luenen, Henri G A M; Rigden, Daniel J; Sabatini, Robert; Borst, Piet


    Trypanosomatids contain an unusual DNA base J (beta-d-glucosylhydroxymethyluracil), which replaces a fraction of thymine in telomeric and other DNA repeats. To determine the function of base J, we have searched for enzymes that catalyze J biosynthesis. We present evidence that a protein that binds to J in DNA, the J-binding protein 1 (JBP1), may also catalyze the first step in J biosynthesis, the conversion of thymine in DNA into hydroxymethyluracil. We show that JBP1 belongs to the family of Fe(2+) and 2-oxoglutarate-dependent dioxygenases and that replacement of conserved residues putatively involved in Fe(2+) and 2-oxoglutarate-binding inactivates the ability of JBP1 to contribute to J synthesis without affecting its ability to bind to J-DNA. We propose that JBP1 is a thymidine hydroxylase responsible for the local amplification of J inserted by JBP2, another putative thymidine hydroxylase. PMID:17389644

  1. Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling

    PubMed Central

    Lisse, Thomas S.; Hewison, Martin; Adams, John S.


    Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as “vitamin D or estrogen response element-binding proteins”, behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. PMID:21236284

  2. Leukocyte Protease Binding to Nucleic Acids Promotes Nuclear Localization and Cleavage of Nucleic Acid Binding Proteins

    PubMed Central

    Thomas, Marshall P.; Whangbo, Jennifer; McCrossan, Geoffrey; Deutsch, Aaron; Martinod, Kimberly; Walch, Michael; Lieberman, Judy


    Killer lymphocyte granzyme (Gzm) serine proteases induce apoptosis of pathogen-infected cells and tumor cells. Many known Gzm substrates are nucleic acid binding proteins, and the Gzms accumulate in the target cell nucleus by an unknown mechanism. Here we show that human Gzms bind to DNA and RNA with nanomolar affinity. Gzms cleave their substrates most efficiently when both are bound to nucleic acids. RNase treatment of cell lysates reduces Gzm cleavage of RNA binding protein (RBP) targets, while adding RNA to recombinant RBP substrates increases in vitro cleavage. Binding to nucleic acids also influences Gzm trafficking within target cells. Pre-incubation with competitor DNA and DNase treatment both reduce Gzm nuclear localization. The Gzms are closely related to neutrophil proteases, including neutrophil elastase (NE) and cathepsin G (CATG). During neutrophil activation, NE translocates to the nucleus to initiate DNA extrusion into neutrophil extracellular traps (NETs), which bind NE and CATG. These myeloid cell proteases, but not digestive serine proteases, also bind DNA strongly and localize to nuclei and NETs in a DNA-dependent manner. Thus, high affinity nucleic acid binding is a conserved and functionally important property specific to leukocyte serine proteases. Furthermore, nucleic acid binding provides an elegant and simple mechanism to confer specificity of these proteases for cleavage of nucleic acid binding protein substrates that play essential roles in cellular gene expression and cell proliferation. PMID:24771851

  3. Therapeutic potential of vitamin D-binding protein.


    Gomme, Peter T; Bertolini, Joseph


    Vitamin D-binding protein (DBP) is a multi-functional plasma protein with many important functions. These include transport of vitamin D metabolites, control of bone development, binding of fatty acids, sequestration of actin and a range of less-defined roles in modulating immune and inflammatory responses. Exploitation of the unique properties of DBP could enable the development of important therapeutic agents for the treatment of a variety of diseases. PMID:15245906

  4. Plasma protein binding of nitroxynil in several species.


    Alvinerie, M; Floc'h, R; Galtier, P


    The binding of nitroxynil to total plasma proteins of cows, sheep and rabbits was characterized using equilibrium dialysis. The data indicate clearly that nitroxynil was highly (97-98%) bound to plasma protein of each animal. This linear binding would be due to the particular power exerted by serum albumin. The results are in good agreement with known pharmacokinetic properties of nitroxynil in domestic species. PMID:1920604

  5. Subcellular distribution of small GTP binding proteins in pancreas: Identification of small GTP binding proteins in the rough endoplasmic reticulum

    SciTech Connect

    Nigam, S.K. )


    Subfractionation of a canine pancreatic homogenate was performed by several differential centrifugation steps, which gave rise to fractions with distinct marker profiles. Specific binding of guanosine 5{prime}-({gamma}-({sup 35}S)thio)triphosphate (GTP({gamma}-{sup 35}S)) was assayed in each fraction. Enrichment of GTP({gamma}-{sup 35}S) binding was greatest in the interfacial smooth microsomal fraction, expected to contain Golgi and other smooth vesicles. There was also marked enrichment in the rough microsomal fraction. Electron microscopy and marker protein analysis revealed the rough microsomes (RMs) to be highly purified rough endoplasmic reticulum (RER). The distribution of small (low molecular weight) GTP binding proteins was examined by a ({alpha}-{sup 32}P)GTP blot-overlay assay. Several apparent GTP binding proteins of molecular masses 22-25 kDa were detected in various subcellular fractions. In particular, at least two such proteins were found in the Golgi-enriched and RM fractions, suggesting that these small GTP binding proteins were localized to the Golgi and RER. To more precisely localize these proteins to the RER, native RMs and RMs stripped of ribosomes by puromycin/high salt were subjected to isopycnic centrifugation. The total GTP({gamma}-{sup 35}S) binding, as well as the small GTP binding proteins detected by the ({alpha}-{sup 32}P)GTP blot overlay, distributed into fractions of high sucrose density, as did the RER marker ribophorin I. Consistent with a RER localization, when the RMS were stripped of ribosomes and subjected to isopycnic centrifugation, the total GTP({gamma}-{sup 35}S) binding and the small GTP binding proteins detected in the blot-overlay assay shifted to fractions of lighter sucrose density along with the RER marker.

  6. Avidin related protein 2 shows unique structural and functional features among the avidin protein family

    PubMed Central

    Hytönen, Vesa P; Määttä, Juha AE; Kidron, Heidi; Halling, Katrin K; Hörhä, Jarno; Kulomaa, Tuomas; Nyholm, Thomas KM; Johnson, Mark S; Salminen, Tiina A; Kulomaa, Markku S; Airenne, Tomi T


    Background The chicken avidin gene family consists of avidin and several avidin related genes (AVRs). Of these gene products, avidin is the best characterized and is known for its extremely high affinity for D-biotin, a property that is utilized in numerous modern life science applications. Recently, the AVR genes have been expressed as recombinant proteins, which have shown different biotin-binding properties as compared to avidin. Results In the present study, we have employed multiple biochemical methods to better understand the structure-function relationship of AVR proteins focusing on AVR2. Firstly, we have solved the high-resolution crystal structure of AVR2 in complex with a bound ligand, D-biotin. The AVR2 structure reveals an overall fold similar to the previously determined structures of avidin and AVR4. Major differences are seen, especially at the 1–3 subunit interface, which is stabilized mainly by polar interactions in the case of AVR2 but by hydrophobic interactions in the case of AVR4 and avidin, and in the vicinity of the biotin binding pocket. Secondly, mutagenesis, competitive dissociation analysis and differential scanning calorimetry were used to compare and study the biotin-binding properties as well as the thermal stability of AVRs and avidin. These analyses pinpointed the importance of residue 109 for biotin binding and stability of AVRs. The I109K mutation increased the biotin-binding affinity of AVR2, whereas the K109I mutation decreased the biotin-binding affinity of AVR4. Furthermore, the thermal stability of AVR2(I109K) increased in comparison to the wild-type protein and the K109I mutation led to a decrease in the thermal stability of AVR4. Conclusion Altogether, this study broadens our understanding of the structural features determining the ligand-binding affinities and stability as well as the molecular evolution within the protein family. This novel information can be applied to further develop and improve the tools already

  7. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.


    Liu, Peng; Stajich, Jason E


    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. PMID:25819009

  8. A core viral protein binds host nucleosomes to sequester immune danger signals.


    Avgousti, Daphne C; Herrmann, Christin; Kulej, Katarzyna; Pancholi, Neha J; Sekulic, Nikolina; Petrescu, Joana; Molden, Rosalynn C; Blumenthal, Daniel; Paris, Andrew J; Reyes, Emigdio D; Ostapchuk, Philomena; Hearing, Patrick; Seeholzer, Steven H; Worthen, G Scott; Black, Ben E; Garcia, Benjamin A; Weitzman, Matthew D


    Viral proteins mimic host protein structure and function to redirect cellular processes and subvert innate defenses. Small basic proteins compact and regulate both viral and cellular DNA genomes. Nucleosomes are the repeating units of cellular chromatin and play an important part in innate immune responses. Viral-encoded core basic proteins compact viral genomes, but their impact on host chromatin structure and function remains unexplored. Adenoviruses encode a highly basic protein called protein VII that resembles cellular histones. Although protein VII binds viral DNA and is incorporated with viral genomes into virus particles, it is unknown whether protein VII affects cellular chromatin. Here we show that protein VII alters cellular chromatin, leading us to hypothesize that this has an impact on antiviral responses during adenovirus infection in human cells. We find that protein VII forms complexes with nucleosomes and limits DNA accessibility. We identified post-translational modifications on protein VII that are responsible for chromatin localization. Furthermore, proteomic analysis demonstrated that protein VII is sufficient to alter the protein composition of host chromatin. We found that protein VII is necessary and sufficient for retention in the chromatin of members of the high-mobility-group protein B family (HMGB1, HMGB2 and HMGB3). HMGB1 is actively released in response to inflammatory stimuli and functions as a danger signal to activate immune responses. We showed that protein VII can directly bind HMGB1 in vitro and further demonstrated that protein VII expression in mouse lungs is sufficient to decrease inflammation-induced HMGB1 content and neutrophil recruitment in the bronchoalveolar lavage fluid. Together, our in vitro and in vivo results show that protein VII sequesters HMGB1 and can prevent its release. This study uncovers a viral strategy in which nucleosome binding is exploited to control extracellular immune signaling. PMID:27362237

  9. Binding of fluorescent lanthanides to rat liver mitochondrial membranes and calcium ion-binding proteins.


    Mikkelsen, R B; Wallach, D F


    (1) Tb3+ binding to mitochondrial membranes can be monitored by enhanced ion fluorescence at 545 nm with excitation at 285 nm. At low protein concentrations (less than 30 mug/ml) no inner filter effects are observed. (2) This binding is localized at the external surface of the inner membrane and is unaffected by inhibitors of respiration or oxidative phosphorylation. (3) A soluble Ca2+ binding protein isolated according to Lehninger, A.L. ((1971) Biochem. Biophys. Res. Commun. 42, 312-317) also binds Tb3+ with enhanced ion fluorescence upon excitation at 285 nm. The excitation spectrum of the isolated protein and of the intact mitochondria are indicative of an aromatic amino acid at the cation binding site. (4) Further characterization of the Tb3+-protein interaction revealed that there is more than one binding site per protein molecule and that these sites are clustered (less than 20 A). Neuraminidase treatment or organic solvent extraction of the protein did not affect fluorescent Tb3+ binding. (5) pH dependency studies of Tb3+ binding to the isolated protein or intact mitochondria demonstrated the importance of an ionizable group of pK greater than 6. At pH less than 7.5 the amount of Tb3+ bound to the isolated protein decreased with increase in pH as monitored by Tb3+ fluorescence. With intact mitochondria the opposite occurred with a large increase in Tb3+ fluorescence at higher pH. This increase was not observed when the mitochondria were preincubated with antimycin A and rotenone. PMID:6061

  10. The ARF-like 2 (ARL2)-binding protein, BART. Purification, cloning, and initial characterization.


    Sharer, J D; Kahn, R A


    ARF-like proteins (ARLs) comprise a functionally distinct group of incompletely characterized members in the ARF family of RAS-related GTPases. We took advantage of the GTP binding characteristics of human ARL2 to develop a specific, high affinity binding assay that allowed the purification of a novel ARL2-binding protein. A 19-kDa protein (BART, Binder of Arl Two) was identified and purified from bovine brain homogenate. BART binding is specific to ARL2.GTP with high affinity but does not interact with ARL2.GDP or activated ARF or RHO proteins. Based on peptide sequences of purified bovine BART, the human cDNA sequence was determined. The 489-base pair BART open reading frame encodes a novel 163-amino acid protein with a predicted molecular mass of 18,822 Da. Recombinant BART was found to bind ARL2.GTP in a manner indistinguishable from native BART. Northern and Western analyses indicated BART is expressed in all tissues sampled. The lack of detectable membrane association of ARL2 or BART upon activation of ARL2 is suggestive of actions quite distinct from those of the ARFs. The lack of ARL2 GTPase-activating protein activity in BART led us to conclude that the specific interaction with ARL2.GTP is most consistent with BART being the first identified ARL2-specific effector. PMID:10488091

  11. 21 CFR 866.5765 - Retinol-binding protein immunological test system.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement...

  12. 21 CFR 866.5765 - Retinol-binding protein immunological test system.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement...

  13. 21 CFR 866.5765 - Retinol-binding protein immunological test system.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement...

  14. 21 CFR 866.5765 - Retinol-binding protein immunological test system.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement...

  15. 21 CFR 866.5765 - Retinol-binding protein immunological test system.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Retinol-binding protein immunological test system....5765 Retinol-binding protein immunological test system. (a) Identification. A retinol-binding protein... the retinol-binding protein that binds and transports vitamin A in serum and urine. Measurement...

  16. The solution structure of the pentatricopeptide repeat protein PPR10 upon binding atpH RNA

    PubMed Central

    Gully, Benjamin S.; Cowieson, Nathan; Stanley, Will A.; Shearston, Kate; Small, Ian D.; Barkan, Alice; Bond, Charles S.


    The pentatricopeptide repeat (PPR) protein family is a large family of RNA-binding proteins that is characterized by tandem arrays of a degenerate 35-amino-acid motif which form an α-solenoid structure. PPR proteins influence the editing, splicing, translation and stability of specific RNAs in mitochondria and chloroplasts. Zea mays PPR10 is amongst the best studied PPR proteins, where sequence-specific binding to two RNA transcripts, atpH and psaJ, has been demonstrated to follow a recognition code where the identity of two amino acids per repeat determines the base-specificity. A recently solved ZmPPR10:psaJ complex crystal structure suggested a homodimeric complex with considerably fewer sequence-specific protein–RNA contacts than inferred previously. Here we describe the solution structure of the ZmPPR10:atpH complex using size-exclusion chromatography-coupled synchrotron small-angle X-ray scattering (SEC-SY-SAXS). Our results support prior evidence that PPR10 binds RNA as a monomer, and that it does so in a manner that is commensurate with a canonical and predictable RNA-binding mode across much of the RNA–protein interface. PMID:25609698

  17. Membrane topology and DNA-binding ability of the Streptococcal CpsA protein.


    Hanson, Brett R; Lowe, Beth A; Neely, Melody N


    Many streptococcal pathogens require a polysaccharide capsule for survival in the host during systemic infection. The highly conserved CpsA protein is proposed to be a transcriptional regulator of capsule production in streptococci, although the regulatory mechanism is unknown. Hydropathy plots of CpsA predict an integral membrane protein with 3 transmembrane domains and only 27 cytoplasmic residues, whereas other members of the LytR_cpsA_psr protein family are predicted to have a single transmembrane domain. This unique topology, with the short cytoplasmic domain, membrane localization, and large extracellular domain, suggests a novel mechanism of transcriptional regulation. Therefore, to determine the actual membrane topology of CpsA, specific protein domains were fused to beta-galactosidase or alkaline phosphatase. Enzymatic assays confirmed that the predicted membrane topology for CpsA is correct. To investigate how this integral membrane protein may be functioning in regulation of capsule transcription, purified full-length and truncated forms of CpsA were used in electrophoretic mobility shift assays to characterize the ability to bind the capsule operon promoter. Assays revealed that full-length, purified CpsA protein binds specifically to DNA containing the capsule promoter region. Furthermore, the large extracellular domain is not required for DNA binding, but all cytoplasmic regions of CpsA are necessary and sufficient for specific binding to the capsule operon promoter. This is the first demonstration of a member of this protein family interacting with its target DNA. Taken together, CpsA, as well as other members of the LytR_cpsA_psr protein family, appears to utilize a unique mechanism of transcriptional regulation. PMID:21097630

  18. Being a binding site: characterizing residue composition of binding sites on proteins.


    Iván, Gábor; Szabadka, Zoltán; Grolmusz, Vince


    The Protein Data Bank contains the description of more than 45,000 three-dimensional protein and nucleic-acid structures today. Started to exist as the computer-readable depository of crystallographic data complementing printed articles, the proper interpretation of the content of the individual files in the PDB still frequently needs the detailed information found in the citing publication. This fact implies that the fully automatic processing of the whole PDB is a very hard task. We first cleaned and re-structured the PDB data, then analyzed the residue composition of the binding sites in the whole PDB for frequency and for hidden association rules. Main results of the paper: (i) the cleaning and repairing algorithm (ii) redundancy elimination from the data (iii) application of association rule mining to the cleaned non-redundant data set. We have found numerous significant relations of the residue-composition of the ligand binding sites on protein surfaces, summarized in two figures. One of the classical data-mining methods for exploring implication-rules, the association-rule mining, is capable to find previously unknown residue-set preferences of bind ligands on protein surfaces. Since protein-ligand binding is a key step in enzymatic mechanisms and in drug discovery, these uncovered preferences in the study of more than 19,500 binding sites may help in identifying new binding protein-ligand pairs. PMID:18305831

  19. Crystallization and preliminary X-ray diffraction analysis of human phosphate-binding protein

    SciTech Connect

    Contreras-Martel, Carlos; Carpentier, Philippe; Morales, Renaud; Renault, Frédérique; Chesne-Seck, Marie-Laure; Rochu, Daniel; Masson, Patrick; Fontecilla-Camps, Juan Carlos; Chabrière, Eric


    The purification, detergent-exchange protocol and crystallization conditions that led to the discovery of HPBP are reported. HPBP is a new human apoprotein that is absent from the genomic database and is the first phosphate transporter characterized in human plasma. Human phosphate-binding protein (HPBP) was serendipitously discovered by crystallization and X-ray crystallography. HPBP belongs to a eukaryotic protein family named DING that is systematically absent from the genomic database. This apoprotein of 38 kDa copurifies with the HDL-associated apoprotein paraoxonase (PON1) and binds inorganic phosphate. HPBP is the first identified transporter capable of binding phosphate ions in human plasma. Thus, it may be regarded as a predictor of phosphate-related diseases such as atherosclerosis. In addition, HPBP may be a potential therapeutic protein for the treatment of such diseases. Here, the purification, detergent-exchange protocol and crystallization conditions that led to the discovery of HPBP are reported.

  20. Protein-DNA binding in high-resolution

    PubMed Central

    Mahony, Shaun; Pugh, B. Franklin


    Recent advances in experimental and computational methodologies are enabling ultra-high resolution genome-wide profiles of protein-DNA binding events. For example, the ChIP-exo protocol precisely characterizes protein-DNA crosslinking patterns by combining chromatin immunoprecipitation (ChIP) with 5′ → 3′ exonuclease digestion. Similarly, deeply sequenced chromatin accessibility assays (e.g. DNase-seq and ATACseq) enable the detection of protected footprints at protein-DNA binding sites. With these techniques and others, we have the potential to characterize the individual nucleotides that interact with transcription factors, nucleosomes, RNA polymerases, and other regulatory proteins in a particular cellular context. In this review, we explain the experimental assays and computational analysis methods that enable high-resolution profiling of protein-DNA binding events. We discuss the challenges and opportunities associated with such approaches. PMID:26038153

  1. Identification of Immunodominant B-cell Epitope Regions of Reticulocyte Binding Proteins in Plasmodium vivax by Protein Microarray Based Immunoscreening.


    Han, Jin-Hee; Li, Jian; Wang, Bo; Lee, Seong-Kyun; Nyunt, Myat Htut; Na, Sunghun; Park, Jeong-Hyun; Han, Eun-Taek


    Plasmodium falciparum can invade all stages of red blood cells, while Plasmodium vivax can invade only reticulocytes. Although many P. vivax proteins have been discovered, their functions are largely unknown. Among them, P. vivax reticulocyte binding proteins (PvRBP1 and PvRBP2) recognize and bind to reticulocytes. Both proteins possess a C-terminal hydrophobic transmembrane domain, which drives adhesion to reticulocytes. PvRBP1 and PvRBP2 are large (> 326 kDa), which hinders identification of the functional domains. In this study, the complete genome information of the P. vivax RBP family was thoroughly analyzed using a prediction server with bioinformatics data to predict B-cell epitope domains. Eleven pvrbp family genes that included 2 pseudogenes and 9 full or partial length genes were selected and used to express recombinant proteins in a wheat germ cell-free system. The expressed proteins were used to evaluate the humoral immune response with vivax malaria patients and healthy individual serum samples by protein microarray. The recombinant fragments of 9 PvRBP proteins were successfully expressed; the soluble proteins ranged in molecular weight from 16 to 34 kDa. Evaluation of the humoral immune response to each recombinant PvRBP protein indicated a high antigenicity, with 38-88% sensitivity and 100% specificity. Of them, N-terminal parts of PvRBP2c (PVX_090325-1) and PvRBP2 like partial A (PVX_090330-1) elicited high antigenicity. In addition, the PvRBP2-like homologue B (PVX_116930) fragment was newly identified as high antigenicity and may be exploited as a potential antigenic candidate among the PvRBP family. The functional activity of the PvRBP family on merozoite invasion remains unknown. PMID:26323838

  2. Binding of CCAAT displacement protein CDP to adenovirus packaging sequences.


    Erturk, Ece; Ostapchuk, Philomena; Wells, Susanne I; Yang, Jihong; Gregg, Keqin; Nepveu, Alain; Dudley, Jaquelin P; Hearing, Patrick


    Adenovirus (Ad) type 5 DNA packaging is initiated in a polar fashion from the left end of the genome. The packaging process is dependent upon the cis-acting packaging domain located between nucleotides 194 and 380. Seven A/T-rich repeats have been identified within this domain that direct packaging. A1, A2, A5, and A6 are the most important repeats functionally and share a bipartite sequence motif. Several lines of evidence suggest that there is a limiting trans-acting factor(s) that plays a role in packaging. Two cellular activities that bind to minimal packaging domains in vitro have been previously identified. These binding activities are P complex, an uncharacterized protein(s), and chicken ovalbumin upstream promoter transcription factor (COUP-TF). In this work, we report that a third cellular protein, octamer-1 protein (Oct-1), binds to minimal packaging domains. In vitro binding analyses and in vivo packaging assays were used to examine the relevance of these DNA binding activities to Ad DNA packaging. The results of these experiments reveal that COUP-TF and Oct-1 binding does not play a functional role in Ad packaging, whereas P-complex binding directly correlates with packaging function. We demonstrate that P complex contains the cellular protein CCAAT displacement protein (CDP) and that full-length CDP is found in purified virus particles. In addition to cellular factors, previous evidence indicates that viral factors play a role in the initiation of viral DNA packaging. We propose that CDP, in conjunction with one or more viral proteins, binds to the packaging sequences of Ad to initiate the encapsidation process. PMID:12743282

  3. High-throughput analysis of protein-DNA binding affinity.


    Franco-Zorrilla, José M; Solano, Roberto


    Sequence-specific protein-DNA interactions mediate most regulatory processes underlying gene expression, such as transcriptional regulation by transcription factors (TFs) or chromatin organization. Current knowledge about DNA-binding specificities of TFs is based mostly on low- to medium-throughput methodologies that are time-consuming and often fail to identify DNA motifs recognized by a TF with lower affinity but retaining biological relevance. The use of protein-binding microarrays (PBMs) offers a high-throughput alternative for the identification of protein-DNA specificities. PBM consists in an array of pseudorandomized DNA sequences that are optimized to include all the possible 10- or 11-mer DNA sequences, allowing the determination of binding specificities of most eukaryotic TFs. PBMs that can be synthesized by several manufacturing companies as single-stranded DNA are converted into double-stranded in a simple primer extension reaction. The protein of interest fused to an epitope tag is then incubated onto the PBM, and specific DNA-protein complexes are revealed in a series of immunological reactions coupled to a fluorophore. After scanning and quantifying PBMs, specific DNA motifs recognized by the protein are identified with ready-to-use scripts, generating comprehensive but accessible information about the DNA-binding specificity of the protein. This chapter describes detailed procedures for preparation of double-stranded PBMs, incubation with recombinant protein, and detection of protein-DNA complexes. Finally, we outline some cues for evaluating the biological role of DNA motifs obtained in vitro. PMID:24057393

  4. Computational evaluation of protein – small molecule binding

    PubMed Central

    Guvench, Olgun; MacKerell, Alexander D.


    Determining protein – small molecule binding affinity is a key component of present-day rational drug discovery. To circumvent the time, labor, and materials costs associated with experimental protein – small molecule binding assays, a variety of structure-based computational methods have been developed for determining protein – small molecule binding affinities. These methods can be placed in one of two classes: accurate but slow (Class 1), and fast but approximate (Class 2). Class 1 methods, which explicitly take into account protein flexibility and include an atomic-level description of solvation, are capable of quantitatively reproducing experimental protein – small molecule absolute binding free energies. However, Class 1 computational requirements make screening thousands to millions of small molecules against a protein, as required for rational drug design, infeasible for the foreseeable future. Class 2 methods, on the other hand, are sufficiently fast to perform such inhibitor screening, yet they suffer from limited descriptions of protein flexibility and solvation, which in turn limit their ability to select and rank-order small molecules by computed binding affinities. This review presents an overview of Class 1 and Class 2 methods, avenues of research in Class 2 methods aimed at bringing them closer to Class 1 accuracy, and intermediate approaches that incorporate features of both Class 1 and Class 2 methods. PMID:19162472

  5. Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product

    NASA Astrophysics Data System (ADS)

    Rustgi, Anil K.; Dyson, Nicholas; Bernards, Rene


    THE proteins encoded by the myc gene family are involved in the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms1. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/helix-loop-helix and a leucine zipper motif, respectively. These motifs are involved both in DNA binding and in protein dimerization2-5. In addition, myc protein family members share several regions of highly conserved amino acids in their amino termini that are essential for transformation6,7. We report here that an N-terminal domain present in both the c-myc and N-myc proteins mediates binding to the retinoblastoma gene product, pRb. We show that the human papilloma virus E7 protein competes with c-myc for binding to pRb, indicating that these proteins share overlapping binding sites on pRb. Furthermore, a mutant Rb protein from a human tumour cell line that carried a 35-amino-acid deletion in its C terminus failed to bind to c-myc. Our results suggest that c-myc and pRb cooperate through direct binding to control cell proliferation.

  6. The variant STEVOR protein of Plasmodium falciparum is a red cell binding protein important for merozoite invasion and rosetting

    PubMed Central

    Niang, Makhtar; Bei, Amy Kristine; Madnani, Kripa Gopal; Pelly, Shaaretha; Dankwa, Selasi; Kanjee, Usheer; Gunalan, Karthigayan; Amaladoss, Anburaj; Yeo, Kim Pin; Bob, Ndeye Sakha; Malleret, Benoit; Duraisingh, Manoj; Preiser, Peter Rainer


    Summary Variant surface antigens play an important role in the pathogenesis of Plasmodium falciparum malaria. To date, intensive work has mainly focused on the role in parasite virulence of the P. falciparum Erythrocyte Membrane Protein 1 (PfEMP1) encoded by the var multigene family. Two other multigene families coding for STEVOR and RIFIN have recently also been shown to be expressed in the invasive merozoite as well as on the surface of the infected erythrocyte, implicating them as potential parasite virulence factors. Here we report that STEVOR is an erythrocyte-binding protein recognizing Glycophorin C on the red blood cell (RBC) surface. STEVOR expression on the RBC leads to PfEMP1-independent rosette formation, while antibodies targeting STEVOR in the merozoite can effectively inhibit invasion. Our results suggest a novel role of STEVOR in enabling infected erythrocytes at the schizont stage to bind uninfected erythrocytes to form rosettes, thereby protecting released merozoites from immune detection. PMID:25011110

  7. Lipid A binding proteins in macrophages detected by ligand blotting

    SciTech Connect

    Hampton, R.Y.; Golenbock, D.T.; Raetz, C.R.H.


    Endotoxin (LPS) stimulates a variety of eukaryotic cells. These actions are involved in the pathogenesis of Gram-negative septicemia. The site of action of the LPS toxic moiety, lipid A (LA), is unclear. Their laboratory has previously identified a bioactive LA precursor lipid IV/sub A/, which can be enzymatically labeled with /sup 32/P/sub i/ (10/sup 9/ dpm/nmole) and purified (99%). They now show that this ligand binds to specific proteins immobilized on nitrocellulose (NC) from LPS-sensitive RAW 264.7 cultured macrophages. NC blots were incubated with (/sup 32/P)-IV/sub A/ in a buffer containing BSA, NaCl, polyethylene glycol, and azide. Binding was assessed using autoradiography or scintillation counting. Dot blot binding of the radioligand was inhibited by excess cold IV/sub A/, LA, or ReLPS but not by phosphatidylcholine, cardiolipin, phosphatidylinositol, or phosphatidic acid. Binding was trypsin-sensitive and dependent on protein concentration. Particulate macrophage proteins were subjected to SDS-PAGE and then electroblotted onto NC. Several discrete binding proteins were observed. Identical treatment of fetal bovine serum or molecular weight standards revealed no detectable binding. By avoiding high nonspecific binding of intact membranes, this ligand blotting assay may be useful in elucidating the molecular actions of LPS.

  8. Metal-binding proteins as metal pollution indicators

    SciTech Connect

    Hennig, H.F.


    The fact that metal-binding proteins are a consequence of elevated metal concentration in organisms is well known. What has been overlooked is that the presence of these proteins provides a unique opportunity to reformulate the criteria of metal pollution. The detoxification effect of metal-binding proteins in animals from polluted areas has been cited, but there have been only very few studies relating metal-binding proteins to pollution. This lack is due partly to the design of most experiments, which were aimed at isolation of metal-binding proteins and hence were of too short duration to allow for correlation to adverse physiological effects on the organism. In this study metal-binding proteins were isolated and characterized from five different marine animals (rock lobster, Jasus lalandii; hermit crab, Diogenes brevirostris; sandshrimp, Palaemon pacificus; black mussel, Choromytilus meridionalis; and limpet, Patella granularis). These animals were kept under identical metal-enriched conditions, hence eliminating differences in method and seasons. The study animals belonged to different phyla; varied in size, mass, age, behavior, food requirements and life stages; and accumulated metals at different rates. It is possible to link unseasonal moulting in crustacea, a known physiological effect due to a metal-enriched environment, to the production of the metal-binding protein without evidence of obvious metal body burden. Thus a new concept of pollution is defined: the presence of metal-binding proteins confirms toxic metal pollution. This concept was then tested under field conditions in the whelk Bullia digitalis and in metal-enriched grass.

  9. A bacterial ATP-dependent, enhancer binding protein that activates the housekeeping RNA polymerase

    PubMed Central

    Bowman, William C.; Kranz, Robert G.


    A commonly accepted view of gene regulation in bacteria that has emerged over the last decade is that promoters are transcriptionally activated by one of two general mechanisms. The major type involves activator proteins that bind to DNA adjacent to where the RNA polymerase (RNAP) holoenzyme binds, usually assisting in recruitment of the RNAP to the promoter. This holoenzyme uses the housekeeping ς70 or a related factor, which directs the core RNAP to the promoter and assists in melting the DNA near the RNA start site. A second type of mechanism involves the alternative sigma factor (called ς54 or ςN) that directs RNAP to highly conserved promoters. In these cases, an activator protein with an ATPase function oligomerizes at tandem sites far upstream from the promoter. The nitrogen regulatory protein (NtrC) from enteric bacteria has been the model for this family of activators. Activation of the RNAP/ς54 holoenzyme to form the open complex is mediated by the activator, which is tethered upstream. Hence, this class of protein is sometimes called the enhancer binding protein family or the NtrC class. We describe here a third system that has properties of each of these two types. The NtrC enhancer binding protein from the photosynthetic bacterium, Rhodobacter capsulatus, is shown in vitro to activate the housekeeping RNAP/ς70 holoenzyme. Transcriptional activation by this NtrC requires ATP binding but not hydrolysis. Oligomerization at distant tandem binding sites on a supercoiled template is also necessary. Mechanistic and evolutionary questions of these systems are discussed. PMID:9637689

  10. Elucidation of Nonadditive Effects in Protein-Ligand Binding Energies: Thrombin as a Case Study.


    Calabrò, Gaetano; Woods, Christopher J; Powlesland, Francis; Mey, Antonia S J S; Mulholland, Adrian J; Michel, Julien


    Accurate predictions of free energies of binding of ligands to proteins are challenging partly because of the nonadditivity of protein-ligand interactions; i.e., the free energy of binding is the sum of numerous enthalpic and entropic contributions that cannot be separated into functional group contributions. In principle, molecular simulations methodologies that compute free energies of binding do capture nonadditivity of protein-ligand interactions, but efficient protocols are necessary to compute well-converged free energies of binding that clearly resolve nonadditive effects. To this end, an efficient GPU-accelerated implementation of alchemical free energy calculations has been developed and applied to two congeneric series of ligands of the enzyme thrombin. The results show that accurate binding affinities are computed across the two congeneric series and positive coupling between nonpolar R(1) substituents and a X = NH3(+) substituent is reproduced, albeit with a weaker trend than experimentally observed. By contrast, a docking methodology completely fails to capture nonadditive effects. Further analysis shows that the nonadditive effects are partly due to variations in the strength of a hydrogen-bond between the X = NH3(+) ligands family and thrombin residue Gly216. However, other partially compensating interactions occur across the entire binding site, and no single interaction dictates the magnitude of the nonadditive effects for all the analyzed protein-ligand complexes. PMID:27248478

  11. HMP Binding Protein ThiY and HMP-P Synthase THI5 Are Structural Homologues

    SciTech Connect

    Bale, Shridhar; Rajashankar, Kanagalaghatta R.; Perry, Kay; Begley, Tadhg P.; Ealick, Steven E.


    The ATP-binding cassette transporter system ThiXYZ transports N-formyl-4-amino-5-(aminomethyl)-2-methylpyrimidine (FAMP), a thiamin salvage pathway intermediate, into cells. FAMP is then converted to 4-amino-5-(hydroxymethyl)-2-methylpyrimidine (HMP) and recycled into the thiamin biosynthetic pathway. ThiY is the periplasmic substrate binding protein of the ThiXYZ system and delivers the substrate FAMP to the transmembrane domain. We report the crystal structure of Bacillus halodurans ThiY with FAMP bound at 2.4 {angstrom} resolution determined by single-wavelength anomalous diffraction phasing. The crystal structure reveals that ThiY belongs to the group II periplasmic binding protein family. The closest structural homologues of ThiY are periplasmic binding proteins involved in alkanesulfonate/nitrate and bicarbonate transport. ThiY is also structurally homologous to thiamin binding protein (TbpA) and to thiaminase-I. THI5 is responsible for the synthesis of 4-amino-5-(hydroxymethyl)-2-methylpyrimidine phosphate in the thiamin biosynthetic pathway of eukaryotes and is approximately 25% identical in sequence with ThiY. A homology model of Saccharomyces cerevisiae THI5 was generated on the basis of the structure of ThiY. Many features of the thiamin pyrimidine binding site are shared between ThiY and THI5, suggesting a common ancestor.

  12. A major integral protein of the plant plasma membrane binds flavin.


    Lorenz, Astrid; Kaldenhoff, Ralf; Hertel, Rainer


    Abundant flavin binding sites have been found in membranes of plants and fungi. With flavin mononucleotide-agarose affinity columns, riboflavin-binding activity from microsomes of Cucurbita pepoL. hypocotyls was purified and identified as a specific PIP1-homologous protein of the aquaporin family. Sequences such as gi|2149955 in Phaseolus vulgaris, PIP1b of Arabidopsis thaliana, and NtAQP1 of tobacco are closely related. The identification as a riboflavin-binding protein was confirmed by binding tests with an extract of Escherichia coli cells expressing the tobacco NtAQP1 as well as leaves of transgenic tobacco plants that overexpress NtAQP1 or were inhibited in PIP1 expression by antisense constructs. When binding was assayed in the presence of dithionite, the reduced flavin formed a relatively stable association with the protein. Upon dilution under oxidizing conditions, the adduct was resolved, and free flavin reappeared with a half time of about 30 min. Such an association can also be induced photochemically, with oxidized flavin by blue light at 450 nm, in the presence of an electron donor. Several criteria, localization in the plasma membrane, high abundance, affinity to roseoflavin, and photochemistry, argue for a role of the riboflavin-binding protein PIP1 as a photoreceptor. PMID:12768338

  13. Functional and receptor binding characterization of recombinant murine macrophage inflammatory protein 2: sequence analysis and mutagenesis identify receptor binding epitopes.

    PubMed Central

    Jerva, L. F.; Sullivan, G.; Lolis, E.


    Murine macrophage inflammatory protein-2 (MIP-2), a member of the alpha-chemokine family, is one of several proteins secreted by cells in response to lipopolysaccharide. Many of the alpha-chemokines, such as interleukin-8, gro-alpha/MGSA, and neutrophil activating peptide-2 (NAP-2), are associated with neutrophil activation and chemotaxis. We describe the expression, purification, and characterization of murine MIP-2 from Pichia pastoris. Circular dichroism spectroscopy reveals that MIP-2 exhibits a highly ordered secondary structure consistent with the alpha/beta structures of other chemokines. Recombinant MIP-2 is chemotactic for human and murine neutrophils and up-regulates cell surface expression of Mac-1. MIP-2 binds to human and murine neutrophils with dissociation constants of 6.4 nM and 2.9 nM, respectively. We further characterize the binding of MIP-2 to the human types A and B IL-8 receptors and the murine homologue of the IL-8 receptor. MIP-2 displays low-affinity binding to the type A IL-8 receptor (Kd > 120 nM) and high-affinity binding to the type B IL-8 receptor (Kd 5.7 nM) and the murine receptor (Kd 6.8 nM). The three-dimensional structure of IL-8 and sequence analysis of six chemokines (IL-8, gro-alpha, NAP-2, ENA-78, KC, and MIP-2) that display high-affinity binding to the IL-8 type B receptor are used to identify an extended N-terminal surface that interacts with this receptor. Two mutants of MIP-2 establish that this region is also involved in binding and activating the murine homologue of the IL-8 receptor. Differences in the sequence between IL-8 and related chemokines identify a unique hydrophobic/aromatic region surrounded by charged residues that is likely to impart specificity to IL-8 for binding to the type A receptor. PMID:9260277

  14. A Correlation between Protein Function and Ligand Binding Profiles

    PubMed Central

    Shortridge, Matthew D.; Bokemper, Michael; Copeland, Jennifer C.; Stark, Jaime L.; Powers, Robert


    We report that proteins with the same function bind the same set of small molecules from a standardized chemical library. This observation led to a quantifiable and rapidly adaptable method for protein functional analysis using experimentally-derived ligand binding profiles. Ligand binding is measured using a high-throughput NMR ligand affinity screen with a structurally diverse chemical library. The method was demonstrated using a set of 19 proteins with a range of functions. A statistically significant similarity in ligand binding profiles was only observed between the two functionally identical albumins and between the five functionally similar amylases. This new approach is independent of sequence, structure or evolutionary information, and therefore, extends our ability to analyze and functionally annotate novel genes. PMID:21366353

  15. Binding profile of spiramycin to oviducal proteins of laying hens.


    Furusawa, N


    In vitro protein binding of spiramycin (SP) in the plasma and oviducts of laying hens was studied. The data for SP were compared with those for oxytetracycline (OTC), sulphadimidine (SDD), sulphamonomethoxine (SMM) and sulphaquinoxaline (SQ). The two oviduct segments, magnum (M) and isthmus plus shell gland (IS), were collected. The soluble (cell sap) fractions from the magnum (M-S9) and the isthmus plus shell gland (IS-S9) were used as samples. Plasma protein binding was highest for SQ (81.4%) (P < 0.01), and lowest for SDD (30.9%) (P < 0.01). No M-S9 protein binding of OTC was found. The IS-S9 protein binding of SP (60.4%) was very much higher than those of OTC (0.8%), SDD (4.1%), SMM (4.0%) and SQ (12.3%) (P < 0.01). Biological half-lives of these drugs in egg albumen were directly correlated to the extent of their binding to IS proteins. Of plasma, M-S9 and IS-S9, variation in SP concentration in the ranges from 1 to 20 micrograms/ml did not alter the binding properties of the drug. PMID:11199206

  16. Detecting O2 binding sites in protein cavities

    PubMed Central

    Kitahara, Ryo; Yoshimura, Yuichi; Xue, Mengjun; Kameda, Tomoshi; Mulder, Frans A. A.


    Internal cavities are important elements in protein structure, dynamics, stability and function. Here we use NMR spectroscopy to investigate the binding of molecular oxygen (O2) to cavities in a well-studied model for ligand binding, the L99A mutant of T4 lysozyme. On increasing the O2 concentration to 8.9 mM, changes in 1H, 15N, and 13C chemical shifts and signal broadening were observed specifically for backbone amide and side chain methyl groups located around the two hydrophobic cavities of the protein. O2-induced longitudinal relaxation enhancements for amide and methyl protons could be adequately accounted for by paramagnetic dipolar relaxation. These data provide the first experimental demonstration that O2 binds specifically to the hydrophobic, and not the hydrophilic cavities, in a protein. Molecular dynamics simulations visualized the rotational and translational motions of O2 in the cavities, as well as the binding and egress of O2, suggesting that the channel consisting of helices D, E, G, H, and J could be the potential gateway for ligand binding to the protein. Due to strong paramagnetic relaxation effects, O2 gas-pressure NMR measurements can detect hydrophobic cavities when populated to as little as 1%, and thereby provide a general and highly sensitive method for detecting oxygen binding in proteins. PMID:26830762

  17. Binding Preferences, Surface Attachment, Diffusivity, and Orientation of a Family 1 Carbohydrate-Binding Module on Cellulose

    SciTech Connect

    Nimlos, M. R.; Beckham, G. T.; Matthews, J. F.; Bu, L.; Himmel, M. E.; Crowley, M. F.


    Cellulase enzymes often contain carbohydrate-binding modules (CBMs) for binding to cellulose. The mechanisms by which CBMs recognize specific surfaces of cellulose and aid in deconstruction are essential to understand cellulase action. The Family 1 CBM from the Trichoderma reesei Family 7 cellobiohydrolase, Cel7A, is known to selectively bind to hydrophobic surfaces of native cellulose. It is most commonly suggested that three aromatic residues identify the planar binding face of this CBM, but several recent studies have challenged this hypothesis. Here, we use molecular simulation to study the CBM binding orientation and affinity on hydrophilic and hydrophobic cellulose surfaces. Roughly 43 {mu}s of molecular dynamics simulations were conducted, which enables statistically significant observations. We quantify the fractions of the CBMs that detach from crystal surfaces or diffuse to other surfaces, the diffusivity along the hydrophobic surface, and the overall orientation of the CBM on both hydrophobic and hydrophilic faces. The simulations demonstrate that there is a thermodynamic driving force for the Cel7A CBM to bind preferentially to the hydrophobic surface of cellulose relative to hydrophilic surfaces. In addition, the simulations demonstrate that the CBM can diffuse from hydrophilic surfaces to the hydrophobic surface, whereas the reverse transition is not observed. Lastly, our simulations suggest that the flat faces of Family 1 CBMs are the preferred binding surfaces. These results enhance our understanding of how Family 1 CBMs interact with and recognize specific cellulose surfaces and provide insights into the initial events of cellulase adsorption and diffusion on cellulose.

  18. Assessing Energetic Contributions to Binding from a Disordered Region in a Protein-Protein Interaction

    SciTech Connect

    S Cho; C Swaminathan; D Bonsor; M Kerzic; R Guan; J Yang; C Kieke; P Anderson; D Kranz; et al.


    Many functional proteins are at least partially disordered prior to binding. Although the structural transitions upon binding of disordered protein regions can influence the affinity and specificity of protein complexes, their precise energetic contributions to binding are unknown. Here, we use a model protein-protein interaction system in which a locally disordered region has been modified by directed evolution to quantitatively assess the thermodynamic and structural contributions to binding of disorder-to-order transitions. Through X-ray structure determination of the protein binding partners before and after complex formation and isothermal titration calorimetry of the interactions, we observe a correlation between protein ordering and binding affinity for complexes along this affinity maturation pathway. Additionally, we show that discrepancies between observed and calculated heat capacities based on buried surface area changes in the protein complexes can be explained largely by heat capacity changes that would result solely from folding the locally disordered region. Previously developed algorithms for predicting binding energies of protein-protein interactions, however, are unable to correctly model the energetic contributions of the structural transitions in our model system. While this highlights the shortcomings of current computational methods in modeling conformational flexibility, it suggests that the experimental methods used here could provide training sets of molecular interactions for improving these algorithms and further rationalizing molecular recognition in protein-protein interactions.

  19. Identification of a novel family of carbohydrate-binding modules with broad ligand specificity

    PubMed Central

    Duan, Cheng-Jie; Feng, Yu-Liang; Cao, Qi-Long; Huang, Ming-Yue; Feng, Jia-Xun


    Most enzymes that act on carbohydrates include non-catalytic carbohydrate-binding modules (CBMs) that recognize and target carbohydrates. CBMs bring their appended catalytic modules into close proximity with the target substrate and increase the hydrolytic rate of enzymes acting on insoluble substrates. We previously identified a novel CBM (CBMC5614-1) at the C-terminus of endoglucanase C5614-1 from an uncultured microorganism present in buffalo rumen. In the present study, that the functional region of CBMC5614-1 involved in ligand binding was localized to 134 amino acids. Two representative homologs of CBMC5614-1, sharing the same ligand binding profile, targeted a range of β-linked polysaccharides that adopt very different conformations. Targeted substrates included soluble and insoluble cellulose, β-1,3/1,4-mixed linked glucans, xylan, and mannan. Mutagenesis revealed that three conserved aromatic residues (Trp-380, Tyr-411, and Trp-423) play an important role in ligand recognition and targeting. These results suggest that CBMC5614-1 and its homologs form a novel CBM family (CBM72) with a broad ligand-binding specificity. CBM72 members can provide new insight into CBM-ligand interactions and may have potential in protein engineering and biocatalysis. PMID:26765840

  20. Functional conservation of suppressors of cytokine signaling proteins between teleosts and mammals: Atlantic salmon SOCS1 binds to JAK/STAT family members and suppresses type I and II IFN signaling.


    Skjesol, Astrid; Liebe, Theresa; Iliev, Dimitar B; Thomassen, Ernst I S; Tollersrud, Linn Greiner; Sobhkhez, Mehrdad; Lindenskov Joensen, Lisbeth; Secombes, Christopher J; Jørgensen, Jorunn B


    Suppressor of cytokine signaling (SOCS) proteins are crucially involved in the control of inflammatory responses through their impact on various signaling pathways including the JAK/STAT pathway. Although all SOCS protein family members are identified in teleost fish, their functional properties in non-mammalian vertebrates have not been extensively studied. To gain further insight into SOCS functions in bony fish, we have identified and characterized the Atlantic salmon (Salmo salar) SOCS1, SOCS2 and CISH genes. These genes exhibited sequence conservation with their mammalian counterparts and they were ubiquitously expressed. SOCS1 in mammalian species has been recognized as a key negative regulator of interferon (IFN) signaling and recent data for the two model fish Tetraodon (Tetraodon nigroviridis) and zebrafish (Danio rerio) suggest that these functions are conserved from teleost to mammals. In agreement with this we here demonstrate a strong negative regulatory activity of salmon SOCS1 on type I and type II IFN signaling, while SOCS2a and b and CISH only moderately affected IFN responses. SOCS1 also inhibited IFNγ-induced nuclear localization of STAT1 and a direct interaction between SOCS1 and STAT1 and between SOCS1 and the Tyk2 kinase was found. Using SOCS1 mutants lacking either the KIR domain or the ESS, SH2 and SOCS box domains showed that all domains affected the ability of SOCS1 to inhibit IFN-mediated signaling. These results are the first to demonstrate that SOCS1 is a potent inhibitor of IFN-mediated JAK-STAT signaling in teleost fish. PMID:24582990

  1. Dynamics of cellular retinoic acid binding protein I on multiple time scales with implications for ligand binding.


    Krishnan, V V; Sukumar, M; Gierasch, L M; Cosman, M


    Cellular retinoic acid binding protein I (CRABPI) belongs to the family of intracellular lipid binding proteins (iLBPs), all of which bind a hydrophobic ligand within an internal cavity. The structures of several iLBPs reveal minimal structural differences between the apo (ligand-free) and holo (ligand-bound) forms, suggesting that dynamics must play an important role in the ligand recognition and binding processes. Here, a variety of nuclear magnetic resonance (NMR) spectroscopy methods were used to systematically study the dynamics of both apo and holo CRABPI at various time scales. Translational and rotational diffusion constant measurements were used to study the overall motions of the proteins. Both apo and holo forms of CRABPI tend to self-associate at high (1.2 mM) concentrations, while at low concentrations (0.2 mM), they are predominantly monomeric. Rapid amide exchange rate and laboratory frame relaxation rate measurements at two spectrometer field strengths (500 and 600 MHz) were used to probe the internal motions of the individual residues. Several residues in the apo form, notably within the ligand recognition region, exhibit millisecond time scale motions that are significantly arrested in the holo form. In contrast, no significant differences in the high-frequency motions were observed between the two forms. These results provide direct experimental evidence for dynamics-induced ligand recognition and binding at a specifically defined time scale. They also exemplify the importance of dynamics in providing a more comprehensive understanding of how a protein functions. PMID:10924105

  2. Mapping the Ligand-Binding Region of Borrelia hermsii Fibronectin-Binding Protein

    PubMed Central

    Brenner, Christiane; Bomans, Katharina; Habicht, Jüri; Simon, Markus M.; Wallich, Reinhard


    Many pathogenic microorganisms express fibronectin-binding molecules that facilitate their adherence to the extracellular matrix and/or entry into mammalian cells. We have previously described a Borrelia recurrentis gene, cihC that encodes a 40-kDa surface receptor for both, fibronectin and the complement inhibitors C4bp and C1-Inh. We now provide evidence for the expression of a group of highly homologues surface proteins, termed FbpA, in three B. hermsii isolates and two tick-borne relapsing fever spirochetes, B. parkeri and B. turicatae. When expressed in Escherichia coli or B. burgdorferi, four out of five proteins were shown to selectively bind fibronectin, whereas none of five proteins were able to bind the human complement regulators, C4bp and C1-Inh. By applying deletion mutants of the B. hermsii fibronectin-binding proteins a putative high-affinity binding site for fibronectin was mapped to its central region. In addition, the fibronectin-binding proteins of B. hermsii were found to share sequence homology with BBK32 of the Lyme disease spirochete B. burgdorferi with similar function suggesting its involvement in persistence and/or virulence of relapsing fever spirochetes. PMID:23658828

  3. Perturbation Approaches for Exploring Protein Binding Site Flexibility to Predict Transient Binding Pockets.


    Kokh, Daria B; Czodrowski, Paul; Rippmann, Friedrich; Wade, Rebecca C


    Simulations of the long-time scale motions of a ligand binding pocket in a protein may open up new perspectives for the design of compounds with steric or chemical properties differing from those of known binders. However, slow motions of proteins are difficult to access using standard molecular dynamics (MD) simulations and are thus usually neglected in computational drug design. Here, we introduce two nonequilibrium MD approaches to identify conformational changes of a binding site and detect transient pockets associated with these motions. The methods proposed are based on the rotamerically induced perturbation (RIP) MD approach, which employs perturbation of side-chain torsional motion for initiating large-scale protein movement. The first approach, Langevin-RIP (L-RIP), entails a series of short Langevin MD simulations, each starting with perturbation of one of the side-chains lining the binding site of interest. L-RIP provides extensive sampling of conformational changes of the binding site. In less than 1 ns of MD simulation with L-RIP, we observed distortions of the α-helix in the ATP binding site of HSP90 and flipping of the DFG loop in Src kinase. In the second approach, RIPlig, a perturbation is applied to a pseudoligand placed in different parts of a binding pocket, which enables flexible regions of the binding site to be identified in a small number of 10 ps MD simulations. The methods were evaluated for four test proteins displaying different types and degrees of binding site flexibility. Both methods reveal all transient pocket regions in less than a total of 10 ns of simulations, even though many of these regions remained closed in 100 ns conventional MD. The proposed methods provide computationally efficient tools to explore binding site flexibility and can aid in the functional characterization of protein pockets, and the identification of transient pockets for ligand design. PMID:27399277

  4. Detergent binding as a sensor of hydrophobicity and polar interactions in the binding cavities of proteins.


    Peyre, Véronique; Lair, Virginie; André, Virginie; le Maire, Guerric; Kragh-Hansen, Ulrich; le Maire, Marc; Møller, Jesper V


    To evaluate the role of hydrophobic and electrostatic or other polar interactions for protein-ligand binding, we studied the interaction of human serum albumin (HSA) and beta-lactoglobulin with various aliphatic (C10-C14) cationic and zwitterionic detergents. We find that cationic detergents, at levels that do not cause unfolding, interact with a single site on beta-lactoglobulin and with two primary and five to six secondary sites on HSA with an affinity that is approximately the same as that with which zwitterionic (dimethylamineoxide) detergents interact, suggesting the absence of significant electrostatic interactions in the high-affinity binding of these compounds. The binding affinity for all of the groups of compounds was dependent upon hydrocarbon chain length, suggesting the predominant role of hydrophobic forces, supported by polar interactions at the protein surface. A distinct correlation between the binding energy and the propensity for micelle formation within the group of cationic or noncharged (nonionic and zwitterionic) detergents indicated that the critical micellar concentration (CMC) for each of these detergent groups, rather than the absolute length of the hydrocarbon chain, can be used to compare their hydrophobicities during their interaction with protein. Intrinsic fluorescence data suggest that the two primary binding sites on serum albumin for the zwitterionic and cationic compounds are located in the C-terminal part of the albumin molecule, possibly in the Sudlow II binding region. Comparisons with previous binding data on anionic amphiphiles emphasize the important contribution of ion bond formation and other polar interactions in the binding of fatty acids and dodecyl sulfate (SDS) by HSA but not by beta-lactoglobulin. Electrostatic interactions by cationic detergents played a significant role in destabilizing the protein structure at high binding levels, with beta-lactoglobulin being more susceptible to unfolding than HSA. Zwitterionic

  5. Studies on the spermatogenic sulfogalactolipid binding protein SLIP 1

    SciTech Connect

    Lingwood, C.; Nutikka, A. )


    We have purified the testicular sulfogalactolipid binding protein SLIP 1 and shown by photoaffinity labeling that it contains an ATP binding site. Purified SLIP 1 was fluorescently labeled and shown to retain specific sulfogalactolipid binding function. This probe was used to investigate the topology of SLIP 1 binding sites on testicular germ cells. The binding pattern precisely coincided with the previously demonstrated asymmetric surface domains of sulfogalactoglycerolipid (SGG). Occasionally these SGG-containing, SLIP 1-binding cell surface domains exactly coincided with structural features on the cell surface as detected by differential interference contrast microscopy. These results demonstrate that SLIP 1/SGG interactions could provide an effective intercellular communication network between testicular germ cells within the seminiferous tubule.

  6. Solid-binding Proteins for Modification of Inorganic Substrates

    NASA Astrophysics Data System (ADS)

    Coyle, Brandon Laurence

    Robust and simple strategies to directly functionalize graphene- and diamond-based nanostructures with proteins are of considerable interest for biologically driven manufacturing, biosensing and bioimaging. In this work, we identify a new set of carbon binding peptides that vary in overall hydrophobicity and charge, and engineer two of these sequences (Car9 and Car15) within the framework of various proteins to exploit their binding ability. In addition, we conducted a detailed analysis of the mechanisms that underpin the interaction of the fusion proteins with carbon and silicon surfaces. Through these insights, we were able to develop proteins suitable for dispersing graphene flakes and carbon nanotubes in aqueous solutions, while retaining protein activity. Additionally, our investigation into the mechanisms of adhesion for our carbon binding peptides inspired a cheap, disposable protein purification system that is more than 10x cheaper than commonly used His-tag protein purification. Our results emphasize the importance of understanding both bulk and molecular recognition events when exploiting the adhesive properties of solid-binding peptides and proteins in technological applications.

  7. Theoretical studies of binding of mannose-binding protein to monosaccharides

    NASA Astrophysics Data System (ADS)

    Aida-Hyugaji, Sachiko; Takano, Keiko; Takada, Toshikazu; Hosoya, Haruo; Kojima, Naoya; Mizuochi, Tsuguo; Inoue, Yasushi


    Binding properties of mannose-binding protein (MBP) to monosaccharides are discussed based on ab initio molecular orbital calculations for cluster models constructed. The calculated binding energies indicate that MBP has an affinity for N-acetyl- D-glucosamine, D-mannose, L-fucose, and D-glucose rather than D-galactose and N-acetyl- D-galactosamine, which is consistent with the biochemical experimental results. Electrostatic potential surfaces at the binding site of four monosaccharides having binding properties matched well with that of MBP. A vacant frontier orbital was found to be localized around the binding site of MBP, suggesting that MBP-monosaccharide interaction may occur through electrostatic and orbital interactions.

  8. Cholesterol-binding viral proteins in virus entry and morphogenesis.


    Schroeder, Cornelia


    Up to now less than a handful of viral cholesterol-binding proteins have been characterized, in HIV, influenza virus and Semliki Forest virus. These are proteins with roles in virus entry or morphogenesis. In the case of the HIV fusion protein gp41 cholesterol binding is attributed to a cholesterol recognition consensus (CRAC) motif in a flexible domain of the ectodomain preceding the trans-membrane segment. This specific CRAC sequence mediates gp41 binding to a cholesterol affinity column. Mutations in this motif arrest virus fusion at the hemifusion stage and modify the ability of the isolated CRAC peptide to induce segregation of cholesterol in artificial membranes.Influenza A virus M2 protein co-purifies with cholesterol. Its proton translocation activity, responsible for virus uncoating, is not cholesterol-dependent, and the transmembrane channel appears too short for integral raft insertion. Cholesterol binding may be mediated by CRAC motifs in the flexible post-TM domain, which harbours three determinants of binding to membrane rafts. Mutation of the CRAC motif of the WSN strain attenuates virulence for mice. Its affinity to the raft-non-raft interface is predicted to target M2 protein to the periphery of lipid raft microdomains, the sites of virus assembly. Its influence on the morphology of budding virus implicates M2 as factor in virus fission at the raft boundary. Moreover, M2 is an essential factor in sorting the segmented genome into virus particles, indicating that M2 also has a role in priming the outgrowth of virus buds.SFV E1 protein is the first viral type-II fusion protein demonstrated to directly bind cholesterol when the fusion peptide loop locks into the target membrane. Cholesterol binding is modulated by another, proximal loop, which is also important during virus budding and as a host range determinant, as shown by mutational studies. PMID:20213541

  9. Visual short-term memory binding deficit in familial Alzheimer's disease

    PubMed Central

    Liang, Yuying; Pertzov, Yoni; Nicholas, Jennifer M.; Henley, Susie M.D.; Crutch, Sebastian; Woodward, Felix; Leung, Kelvin; Fox, Nick C.; Husain, Masud


    Long-term episodic memory deficits in Alzheimer's disease (AD) are well characterised but, until recently, short-term memory (STM) function has attracted far less attention. We employed a recently-developed, delayed reproduction task which requires participants to reproduce precisely the remembered location of items they had seen only seconds previously. This paradigm provides not only a continuous measure of localization error in memory, but also an index of relational binding by determining the frequency with which an object is misplaced to the location of one of the other items held in memory. Such binding errors in STM have previously been found on this task to be sensitive to medial temporal lobe (MTL) damage in focal lesion cases. Twenty individuals with pathological mutations in presenilin 1 or amyloid precursor protein genes for familial Alzheimer's disease (FAD) were tested together with 62 healthy controls. Participants were assessed using the delayed reproduction memory task, a standard neuropsychological battery and structural MRI. Overall, FAD mutation carriers were worse than controls for object identity as well as in gross localization memory performance. Moreover, they showed greater misbinding of object identity and location than healthy controls. Thus they would often mislocalize a correctly-identified item to the location of one of the other items held in memory. Significantly, asymptomatic gene carriers – who performed similarly to healthy controls on standard neuropsychological tests – had a specific impairment in object-location binding, despite intact memory for object identity and location. Consistent with the hypothesis that the hippocampus is critically involved in relational binding regardless of memory duration, decreased hippocampal volume across FAD participants was significantly associated with deficits in object-location binding but not with recall precision for object identity or localization. Object-location binding may

  10. Population shift of binding pocket size and dynamic correlation analysis shed new light on the anticooperative mechanism of PII protein

    PubMed Central

    Ma, Cheng-Wei; Lüddecke, Jan; Forchhammer, Karl; Zeng, An-Ping


    PII protein is one of the largest families of signal transduction proteins in archaea, bacteria, and plants, controlling key processes of nitrogen assimilation. An intriguing characteristic for many PII proteins is that the three ligand binding sites exhibit anticooperative allosteric regulation. In this work, PII protein from Synechococcus elongatus, a model for cyanobacteria and plant PII proteins, is utilized to reveal the anticooperative mechanism upon binding of 2-oxoglutarate (2-OG). To this end, a method is proposed to define the binding pocket size by identifying residues that contribute greatly to the binding of 2-OG. It is found that the anticooperativity is realized through population shift of the binding pocket size in an asymmetric manner. Furthermore, a new algorithm based on the dynamic correlation analysis is developed and utilized to discover residues that mediate the anticooperative process with high probability. It is surprising to find that the T-loop, which is believed to be responsible for mediating the binding of PII with its target proteins, also takes part in the intersubunit signal transduction process. Experimental results of PII variants further confirmed the influence of T-loop on the anticooperative regulation, especially on binding of the third 2-OG. These discoveries extend our understanding of the PII T-loop from being essential in versatile binding of target protein to signal-mediating in the anticooperative allosteric regulation. Proteins 2014; 82:1048–1059. PMID:24218085

  11. Detergent activation of the binding protein in the folate radioassay

    SciTech Connect

    Hansen, S.I.; Holm, J.; Lyngbye, J.


    A minor cow's whey protein associated with ..beta..-lactoglobulin is used as binding protein in the competitive radioassay for serum and erythrocyte folate. Seeking to optimize the assay, we tested the performance of binder solutions of increasing purity. The folate binding protein was isolated from cow's whey by means of CM-Sepharose CL-6B cation-exchange chromatography, and further purified on a methotrexate-AH-Sepharose 4B affinity matrix. In contrast to ..beta..-lactoglobulin, the purified protein did not bind folate unless the detergents cetyltrimethylammonium (10 mmol/Ll) or Triton X-100 (1 g/L) were present. Such detergent activation was not needed in the presence of serum. There seems to be a striking analogy between these phenomena and the well-known reactivation of certain purified membrane-derived enzymes by surfactants (lipids/detergents).

  12. DNA-binding proteins in plant mitochondria: implications for transcription.


    Gualberto, José M; Kühn, Kristina


    The structural complexity of plant mitochondrial genomes correlates with the variety of single-strand DNA-binding proteins found in plant mitochondria. Most of these are plant-specific and have roles in homologous recombination and genome maintenance. Mitochondrial nucleoids thus differ fundamentally between plants and yeast or animals, where the principal nucleoid protein is a DNA-packaging protein that binds double-stranded DNA. Major transcriptional cofactors identified in mitochondria of non-plant species are also seemingly absent from plants. This article reviews current knowledge on plant mitochondrial DNA-binding proteins and discusses that those may affect the accessibility and conformation of transcription start sites, thus functioning as transcriptional modulators without being dedicated transcription factors. PMID:24561574

  13. Liver takes up retinol-binding protein from plasma

    SciTech Connect

    Gjoen, T.; Bjerkelund, T.; Blomhoff, H.K.; Norum, K.R.; Berg, T.; Blomhoff, R.


    Retinol is transported in plasma bound to a specific transport protein, retinol-binding protein. We prepared /sup 125/I-tyramine cellobiose-labeled rat retinol-binding protein and studied its tissue uptake 1, 5, and 24 h after intravenous injection into rats. The liver was the organ containing most radioactivity at all time points studied. After 5 and 24 h, 30 and 22% of the injected dose were recovered in liver, respectively. After separating the liver into parenchymal and nonparenchymal cells in the 5-h group, we found that both cell fractions contained approximately the same amount of radioactivity (per gram of liver). Most of the retinol-binding protein radioactivity in the nonparenchymal cell fraction was in the stellate cells. The implication of these results for a possible transfer mechanism for retinol between parenchymal and stellate cells is discussed.

  14. Structure and ligand-binding mechanism of a cysteinyl leukotriene-binding protein from a blood-feeding disease vector

    PubMed Central

    Jablonka, Willy; Pham, Van; Nardone, Glenn; Gittis, Apostolos; Silva-Cardoso, Lívia; Atella, Georgia C.; Ribeiro, José M.C.; Andersen, John F.


    Blood-feeding disease vectors mitigate the negative effects of hemostasis and inflammation through the binding of small-molecule agonists of these processes by salivary proteins. In this study, a lipocalin protein family member (LTBP1) from the saliva of Rhodnius prolixus, a vector of the pathogen Trypanosoma cruzi, is shown to sequester cysteinyl leukotrienes during feeding to inhibit immediate inflammatory responses. Calorimetric binding experiments showed that LTBP1 binds leukotrienes C4 (LTC4) and D4 (LTD4) and E4 (LTE4) but not biogenic amines, adenosine diphosphate or other eicosanoid compounds. Crystal structures of ligand-free LTBP1 and its complexes with LTC4 and LTD4 reveal a conformational change during binding that brings Tyr 114 into close contact with the ligand. LTC4 is cleaved in the complex leaving free glutathione, and a C20 fatty acid. Chromatographic analysis of bound ligands showed only intact LTC4, suggesting that cleavage could be radiation-mediated. PMID:27124118

  15. Structure and Ligand-Binding Mechanism of a Cysteinyl Leukotriene-Binding Protein from a Blood-Feeding Disease Vector.


    Jablonka, Willy; Pham, Van; Nardone, Glenn; Gittis, Apostolos; Silva-Cardoso, Lívia; Atella, Georgia C; Ribeiro, José M C; Andersen, John F


    Blood-feeding disease vectors mitigate the negative effects of hemostasis and inflammation through the binding of small-molecule agonists of these processes by salivary proteins. In this study, a lipocalin protein family member (LTBP1) from the saliva of Rhodnius prolixus, a vector of the pathogen Trypanosoma cruzi, is shown to sequester cysteinyl leukotrienes during feeding to inhibit immediate inflammatory responses. Calorimetric binding experiments showed that LTBP1 binds leukotrienes C4 (LTC4), D4 (LTD4), and E4 (LTE4) but not biogenic amines, adenosine diphosphate, or other eicosanoid compounds. Crystal structures of ligand-free LTBP1 and its complexes with LTC4 and LTD4 reveal a conformational change during binding that brings Tyr114 into close contact with the ligand. LTC4 is cleaved in the complex, leaving free glutathione and a C20 fatty acid. Chromatographic analysis of bound ligands showed only intact LTC4, suggesting that cleavage could be radiation-mediated. PMID:27124118

  16. High structural resolution hydroxyl radical protein footprinting reveals an extended Robo1-heparin binding interface.


    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W; Linhardt, Robert J; Sharp, Joshua S


    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  17. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.


    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  18. Antibiotic binding of STY3178, a yfdX protein from Salmonella Typhi

    PubMed Central

    Saha, Paramita; Manna, Camelia; Das, Santasabuj; Ghosh, Mahua


    The yfdX family proteins are known for long time to occur in various virulent bacteria including their multidrug resistant (MDR) strains, without any direct assigned function for them. However, yfdX protein along with other proteins involved in acid tolerance response is reported to be up regulated by the multidrug response regulatory system in E. coli. Hence, molecular and functional characterization of this protein is important for understanding of key cellular processes in bacterial cells. Here we study STY3178, a yfdX protein from a MDR strain of typhoid fever causing Salmonella Typhi. Our experimental results indicate that STY3178 is a helical protein existing in a trimeric oligomerization state in solution. We also observe many small antibiotics, like ciprofloxacin, rifampin and ampicillin viably interact with this protein. The dissociation constants from the quenching of steady state fluorescence and isothermal titration calorimetry show that ciprofloxacin binding is stronger than rifampin followed by ampicillin. PMID:26892637

  19. Marsupial and monotreme serum immunoglobulin binding by proteins A, G and L and anti-kangaroo antibody.


    Vaz, Paola K; Hartley, Carol A; Browning, Glenn F; Devlin, Joanne M


    Serological studies are often conducted to examine exposure to infectious agents in wildlife populations. However, specific immunological reagents for wildlife species are seldom available and can limit the study of infectious diseases in these animals. This study examined the ability of four commercially available immunoglobulin-binding reagents to bind serum immunoglobulins from 17 species within the Marsupialia and Monotremata. Serum samples were assessed for binding, using immunoblots and ELISAs (Enzyme-linked immunosorbent assays), to three microbially-derived proteins - staphylococcal protein A, streptococcal protein G and peptostreptococcal protein L. Additionally, an anti-kangaroo antibody was included for comparison. The inter- and intra-familial binding patterns of the reagents to serum immunoglobulins varied and evolutionary distance between animal species was not an accurate predictor of the ability of reagents to bind immunoglobulins. Results from this study can be used to inform the selection of appropriate immunological reagents in future serological studies in these clades. PMID:26523413

  20. Characterization of membrane-bound small GTP-binding proteins from Nicotiana tabacum.

    PubMed Central

    Haizel, T; Merkle, T; Turck, F; Nagy, F


    We have cloned nine cDNAs encoding small GTP-binding proteins from leaf cDNA libraries of tobacco (Nicotiana tabacum). These cDNAs encode distinct proteins (22-25 kD) that display different levels of identity with members of the mammalian Rab family: Nt-Rab6 with Rab6 (83%), Nt-Rab7a-c with Rab7 (63-70%), and Nt-Rab11a-e with Rab11 (53-69%). Functionally important regions of these proteins, including the "effector binding" domain, the C-terminal Cys residues for membrane attachment, and the four regions involved in GTP-binding and hydrolysis, are highly conserved. Northern and western blot analyses show that these genes are expressed, although at slightly different levels, in all plant tissues examined. We demonstrate that the plant Rab5, Rab6, and Rab11 proteins, similar to their mammalian and yeast counterparts, are tightly bound to membranes and that they exhibit different solubilization characteristics. Furthermore, we show that the yeast GTPase-activating protein Gyp6, shown to be specifically required to control the GTP hydrolysis of the yeast Ypt6 protein, could interact with tobacco GTP-binding proteins. It increases in vitro the GTP hydrolysis rate of the wild-type Nt-Rab7 protein. In addition, it also increases, at different levels, the GTP hydrolysis rates of a Nt-Rab7m protein with a Rab6 effector domain and of two other chimaeric Nt-Rab6/Nt-Rab7 proteins. However, it does not interact with the wild-type Nt-Rab6 protein, which is most similar to the yeast Ypt6 protein. PMID:7784525

  1. Mitochondrial single-stranded DNA-binding proteins: in search for new functions.


    Tomáska, L; Nosek, J; Kucejová, B


    During the evolution of the eukaryotic cell, genes encoding proteins involved in the metabolism of mitochondrial DNA (mtDNA) have been transferred from the endosymbiont into the host genome. Mitochondrial single-stranded DNA-binding (mtSSB) proteins serve as an excellent argument supporting this aspect of the endosymbiotic theory. The crystal structure of the human mtSSB, together with an abundance of biochemical and genetic data, revealed several exciting features of mtSSB proteins and enabled a detailed comparison with their prokaryotic counterparts. Moreover, identification of a novel member of the mtSSB family, mitochondrial telomere-binding protein of the yeast Candida parapsilosis, has raised interesting questions regarding mtDNA metabolism and evolution. PMID:11308016

  2. Phylogenetic analysis of the ATP-binding cassette transporter family in three mosquito species.


    Lu, Hong; Xu, Yongyu; Cui, Feng


    The ATP-binding cassette (ABC) transporter family functions in the ATP-dependent transportation of various substrates across biological membranes. ABC proteins participate in various biological processes and insecticide resistance in insects, and are divided into eight subfamilies (A-H). Mosquitoes are important vectors of human diseases, but the mechanism by which the ABC transporter family evolves in mosquitoes is unknown. In this study, we classified and compared the ABC transporter families of three mosquitoes, namely, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus. The three mosquitoes have 55, 69, and 70 ABC genes, respectively. The C. p. quinquefasciatus had approximately 40% and 65% expansion in the ABCG subfamily, mainly in ABCG1/G4, compared with the two other mosquito species. The ABCB, ABCD, ABCE, and ABCF subfamilies were conserved in the three mosquito species. The C. p. quinquefasciatus transcriptomes during development showed that the ABCG and ABCC genes were mainly highly expressed at the egg and pupal stages. The pigment-transport relative brown, white, and scarlet, as well as the ABCF subfamily, were highly expressed at the egg stage. The highly expressed genes in larvae included three ABCA3 genes. The majority of the highly expressed genes in adults were ABCG1/4 genes. These results provided insights into the evolution of the ABC transporter family in mosquitoes. PMID:27521922

  3. CLIPZ: a database and analysis environment for experimentally determined binding sites of RNA-binding proteins

    PubMed Central

    Khorshid, Mohsen; Rodak, Christoph; Zavolan, Mihaela


    The stability, localization and translation rate of mRNAs are regulated by a multitude of RNA-binding proteins (RBPs) that find their targets directly or with the help of guide RNAs. Among the experimental methods for mapping RBP binding sites, cross-linking and immunoprecipitation (CLIP) coupled with deep sequencing provides transcriptome-wide coverage as well as high resolution. However, partly due to their vast volume, the data that were so far generated in CLIP experiments have not been put in a form that enables fast and interactive exploration of binding sites. To address this need, we have developed the CLIPZ database and analysis environment. Binding site data for RBPs such as Argonaute 1-4, Insulin-like growth factor II mRNA-binding protein 1-3, TNRC6 proteins A-C, Pumilio 2, Quaking and Polypyrimidine tract binding protein can be visualized at the level of the genome and of individual transcripts. Individual users can upload their own sequence data sets while being able to limit the access to these data to specific users, and analyses of the public and private data sets can be performed interactively. CLIPZ, available at, aims to provide an open access repository of information for post-transcriptional regulatory elements. PMID:21087992

  4. PRBP: Prediction of RNA-Binding Proteins Using a Random Forest Algorithm Combined with an RNA-Binding Residue Predictor.


    Ma, Xin; Guo, Jing; Xiao, Ke; Sun, Xiao


    The prediction of RNA-binding proteins is an incredibly challenging problem in computational biology. Although great progress has been made using various machine learning approaches with numerous features, the problem is still far from being solved. In this study, we attempt to predict RNA-binding proteins directly from amino acid sequences. A novel approach, PRBP predicts RNA-binding proteins using the information of predicted RNA-binding residues in conjunction with a random forest based method. For a given protein, we first predict its RNA-binding residues and then judge whether the protein binds RNA or not based on information from that prediction. If the protein cannot be identified by the information associated with its predicted RNA-binding residues, then a novel random forest predictor is used to determine if the query protein is a RNA-binding protein. We incorporated features of evolutionary information combined with physicochemical features (EIPP) and amino acid composition feature to establish the random forest predictor. Feature analysis showed that EIPP contributed the most to the prediction of RNA-binding proteins. The results also showed that the information from the RNA-binding residue prediction improved the overall performance of our RNA-binding protein prediction. It is anticipated that the PRBP method will become a useful tool for identifying RNA-binding proteins. A PRBP Web server implementation is freely available at PMID:26671809

  5. The Cre-Binding Protein Dcreb-a Is Required for Drosophila Embryonic Development

    PubMed Central

    Rose, R. E.; Gallaher, N. M.; Andrew, D. J.; Goodman, R. H.; Smolik, S. M.


    We have previously described the cloning of a cyclic AMP response-element (CRE)-binding protein, dCREB-A, in Drosophila melanogaster that is similar to the mammalian CRE-binding protein CREB. dCREB-A is a member of the bZIP family of transcription factors, shows specific binding to the (CRE), and can activate transcription in cell culture. In this report, we describe the gene structure for dCREB-A, protein expression patterns throughout development and the necessary role for this gene in embryogenesis. The 4.5-kb transcript is encoded in six exons that are distributed over 21 kb of DNA. There are seven start sites and no TATA consensus sequences upstream. The dCREB-A protein is expressed in the nuclei of the embryonic salivary gland, proventriculus and stomadeum. Late in embryogenesis, tracheal cell nuclei and specific nuclei within the segments show staining with anti-dCREB-A antibodies. In adult female ovaries, dCREB-A is expressed in the stage 9 through stage 11 follicle cell nuclei. Null mutations of the dCREB-A gene give rise to animals that no longer express dCREB-A protein and die late in embryogenesis before or at hatching. The absolute requirement of dCREB-A for embryogenesis demonstrates a nonredundant function for a CRE-binding protein that will be useful in studying the role of specific signal transduction cascades in development. PMID:9178009

  6. The RNA-binding protein repertoire of Arabidopsis thaliana.


    Marondedze, Claudius; Thomas, Ludivine; Serrano, Natalia L; Lilley, Kathryn S; Gehring, Chris


    RNA-binding proteins (RBPs) have essential roles in determining the fate of RNA from synthesis to decay and have been studied on a protein-by-protein basis, or computationally based on a number of well-characterised RNA-binding domains. Recently, high-throughput methods enabled the capture of mammalian RNA-binding proteomes. To gain insight into the role of Arabidopsis thaliana RBPs at the systems level, we have employed interactome capture techniques using cells from different ecotypes grown in cultures and leaves. In vivo UV-crosslinking of RNA to RBPs, oligo(dT) capture and mass spectrometry yielded 1,145 different proteins including 550 RBPs that either belong to the functional category 'RNA-binding', have known RNA-binding domains or have orthologs identified in mammals, C. elegans, or S. cerevisiae in addition to 595 novel candidate RBPs. We noted specific subsets of RBPs in cultured cells and leaves and a comparison of Arabidopsis, mammalian, C. elegans, and S. cerevisiae RBPs reveals a common set of proteins with a role in intermediate metabolism, as well as distinct differences suggesting that RBPs are also species and tissue specific. This study provides a foundation for studies that will advance our understanding of the biological significance of RBPs in plant developmental and stimulus specific responses. PMID:27405932

  7. Mercury-binding proteins from the marine mussel, Mytilus edulis

    SciTech Connect

    Roesijadi, G.


    The marine mussel, Mytilus edulis, possesses low molecular weight, metal-binding proteins which can be induced by and, in turn, bind mercury when individuals are exposed to low, but elevated concentrations of mercury as HgCl/sub 2/. Induction of the proteins by exposure of mussels to copper, cadmium, or mercury is associated with enhanced tolerance to mercury toxicity. Mercury-binding proteins isolated from gills of mussels occur as two molecular weight variants of about 20-25 and 10-12 kdaltons, respectively, on Sephadex G-75. These have been designated as HgBP/sub 20/ and HgBP/sub 10/ following the nomenclature used for cadmium-binding proteins. HgBP/sub 20/ represents the primary mercury-binding species. Separation of HgBP/sub 20/ by anion-exchange high-performance liquid chromatography resulted in the resolution of six peaks, indicating a more complex situation than was evident from DEAE-cellulose separations. Although not completely purified, these also contain cysteine- and glycine-rich proteins.

  8. Transduction proteins of olfactory receptor cells: identification of guanine nucleotide binding proteins and protein kinase C

    SciTech Connect

    Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.


    The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the ..cap alpha.. subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single ..beta.. subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the ..cap alpha.. subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub s..cap alpha../ relative to G/sub ichemically bond/ and G/sub ochemically bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with (/sup 125/I)protein. Immunohistochemical studies using an antiserum against the ..beta.. subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the ..cap alpha.. subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C oc