The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.
Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried
2017-06-01
Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
An Electrostatic Funnel in the GABA-Binding Pathway
Lightstone, Felice C.
2016-01-01
The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953
Recognition of functional sites in protein structures.
Shulman-Peleg, Alexandra; Nussinov, Ruth; Wolfson, Haim J
2004-06-04
Recognition of regions on the surface of one protein, that are similar to a binding site of another is crucial for the prediction of molecular interactions and for functional classifications. We first describe a novel method, SiteEngine, that assumes no sequence or fold similarities and is able to recognize proteins that have similar binding sites and may perform similar functions. We achieve high efficiency and speed by introducing a low-resolution surface representation via chemically important surface points, by hashing triangles of physico-chemical properties and by application of hierarchical scoring schemes for a thorough exploration of global and local similarities. We proceed to rigorously apply this method to functional site recognition in three possible ways: first, we search a given functional site on a large set of complete protein structures. Second, a potential functional site on a protein of interest is compared with known binding sites, to recognize similar features. Third, a complete protein structure is searched for the presence of an a priori unknown functional site, similar to known sites. Our method is robust and efficient enough to allow computationally demanding applications such as the first and the third. From the biological standpoint, the first application may identify secondary binding sites of drugs that may lead to side-effects. The third application finds new potential sites on the protein that may provide targets for drug design. Each of the three applications may aid in assigning a function and in classification of binding patterns. We highlight the advantages and disadvantages of each type of search, provide examples of large-scale searches of the entire Protein Data Base and make functional predictions.
Elimination of a ligand gating site generates a supersensitive olfactory receptor.
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I
2016-06-21
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.
Elimination of a ligand gating site generates a supersensitive olfactory receptor
Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.
2016-01-01
Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zoghbi, M. E.; Altenberg, G. A.
The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less
Guo, Wei-Li; Huang, De-Shuang
2017-08-22
Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.
Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul
2008-11-21
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauch, Eva-Maria; Bernard, Steffen M.; La, David
Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less
Tuz, Karina; Li, Chen; Fang, Xuan; Raba, Daniel A.; Liang, Pingdong; Minh, David D. L.; Juárez, Oscar
2017-01-01
The sodium-dependent NADH dehydrogenase (Na+-NQR) is a key component of the respiratory chain of diverse prokaryotic species, including pathogenic bacteria. Na+-NQR uses the energy released by electron transfer between NADH and ubiquinone (UQ) to pump sodium, producing a gradient that sustains many essential homeostatic processes as well as virulence factor secretion and the elimination of drugs. The location of the UQ binding site has been controversial, with two main hypotheses that suggest that this site could be located in the cytosolic subunit A or in the membrane-bound subunit B. In this work, we performed alanine scanning mutagenesis of aromatic residues located in transmembrane helices II, IV, and V of subunit B, near glycine residues 140 and 141. These two critical glycine residues form part of the structures that regulate the site's accessibility. Our results indicate that the elimination of phenylalanine residue 211 or 213 abolishes the UQ-dependent activity, produces a leak of electrons to oxygen, and completely blocks the binding of UQ and the inhibitor HQNO. Molecular docking calculations predict that UQ interacts with phenylalanine 211 and pinpoints the location of the binding site in the interface of subunits B and D. The mutagenesis and structural analysis allow us to propose a novel UQ-binding motif, which is completely different compared with the sites of other respiratory photosynthetic complexes. These results are essential to understanding the electron transfer pathways and mechanism of Na+-NQR catalysis. PMID:28053088
Two-Dimensional Wetting of a Stepped Copper Surface
NASA Astrophysics Data System (ADS)
Lin, C.; Avidor, N.; Corem, G.; Godsi, O.; Alexandrowicz, G.; Darling, G. R.; Hodgson, A.
2018-02-01
Highly corrugated, stepped surfaces present regular 1D arrays of binding sites, creating a complex, heterogeneous environment to water. Rather than decorating the hydrophilic step sites to form 1D chains, water on stepped Cu(511) forms an extended 2D network that binds strongly to the steps but bridges across the intervening hydrophobic Cu(100) terraces. The hydrogen-bonded network contains pentamer, hexamer, and octomer water rings that leave a third of the stable Cu step sites unoccupied in order to bind water H down close to the step dipole and complete three hydrogen bonds per molecule.
Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul
2012-01-01
Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259
Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M
2005-04-19
The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.
NASA Astrophysics Data System (ADS)
Poornima, C. S.; Dean, P. M.
1995-12-01
Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.
Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis
2017-03-16
Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Band, L.; Xu, Heng; Bykov, V.
The present study demonstrates that pretreatment of rat brain membranes with (+)-cis-3-methylfentanyl ((+)-cis-MF), followed by extensive washing of the membranes, produces a wash-resistant decreasing in the binding of ({sup 3}H)-(D-ala{sup 2}, D-leu{sup 5})enkephalin to the d binding site of the opioid receptor complex ({delta}{sub cx} binding site). Intravenous administration of (+)-cis-MF (50 {mu}g/kg) to rats produced a pronounced catalepsy and also produced a wash-resistant masking of {delta}{sub cx} and {mu} binding sites in membranes prepared 120 min post-injection. Administration of 1 mg/kg i.v. of the opioid antagonist, 6-desoxy-6{beta}-fluoronaltrexone (cycloFOXY), 100 min after the injection of (+)-cis-MF (20 min prior tomore » the preparation of membranes) completely reversed the catatonia and restored masked {delta}{sub cx} binding sites to control levels. This was not observed with (+)-cycloFOXY. The implications of these and other findings for the mechanism of action of (+)-cis-MF and models of the opioid receptors are discussed.« less
A deep learning framework for modeling structural features of RNA-binding protein targets
Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang
2016-01-01
RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480
Warfield, Becka M.
2017-01-01
RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473
Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A
1997-10-28
Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.
Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang
2017-01-01
Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398
De Simone, Giuseppina; Langella, Emma; Esposito, Davide; Supuran, Claudiu T; Monti, Simona Maria; Winum, Jean-Yves; Alterio, Vincenzo
2017-12-01
Sulphamate and sulphamide derivatives have been largely investigated as carbonic anhydrase inhibitors (CAIs) by means of different experimental techniques. However, the structural determinants responsible for their different binding mode to the enzyme active site were not clearly defined so far. In this paper, we report the X-ray crystal structure of hCA II in complex with a sulphamate inhibitor incorporating a nitroimidazole moiety. The comparison with the structure of hCA II in complex with its sulphamide analogue revealed that the two inhibitors adopt a completely different binding mode within the hCA II active site. Starting from these results, we performed a theoretical study on sulphamate and sulphamide derivatives, demonstrating that electrostatic interactions with residues within the enzyme active site play a key role in determining their binding conformation. These findings open new perspectives in the design of effective CAIs using the sulphamate and sulphamide zinc binding groups as lead compounds.
Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy
NASA Astrophysics Data System (ADS)
Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.
2016-03-01
We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e
Evidence for a single class of somatostatin receptors in ground squirrel cerebral cortex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krantic, S.; Petrovic, V.M.; Quirion, R.
1989-01-01
In the present study we characterized high-affinity somatostatin (SRIF) binding sites (Kd = 2.06 +/- 0.32 nM and Bmax = 295 +/- 28 fmol/mg protein) in cerebral cortex membrane preparations of European ground squirrel using /sup 125/I-(Tyr0-D-Trp8)-SRIF14 as a radioligand. The inhibition of radioligand specific binding by SRIF14, as well as by its agonists (SRIF28, Tyr0-D-Trp8-SRIF14, SMS 201 995) was complete and monophasic, thus revealing a single population of somatostatinergic binding sites. Radioautographic analysis of /sup 125/I-(Tyr0-D-Trp8)-SRIF14 labeled brain sections confirmed the results of our biochemical study. The homogeneity of SRIF binding sites in the ground squirrel neocortex was notmore » dependent on the animal's life-cycle phase.« less
How Force Might Activate Talin's Vinculin Binding Sites: SMD Reveals a Structural Mechanism
Hytönen, Vesa P; Vogel, Viola
2008-01-01
Upon cell adhesion, talin physically couples the cytoskeleton via integrins to the extracellular matrix, and subsequent vinculin recruitment is enhanced by locally applied tensile force. Since the vinculin binding (VB) sites are buried in the talin rod under equilibrium conditions, the structural mechanism of how vinculin binding to talin is force-activated remains unknown. Taken together with experimental data, a biphasic vinculin binding model, as derived from steered molecular dynamics, provides high resolution structural insights how tensile mechanical force applied to the talin rod fragment (residues 486–889 constituting helices H1–H12) might activate the VB sites. Fragmentation of the rod into three helix subbundles is prerequisite to the sequential exposure of VB helices to water. Finally, unfolding of a VB helix into a completely stretched polypeptide might inhibit further binding of vinculin. The first events in fracturing the H1–H12 rods of talin1 and talin2 in subbundles are similar. The proposed force-activated α-helix swapping mechanism by which vinculin binding sites in talin rods are exposed works distinctly different from that of other force-activated bonds, including catch bonds. PMID:18282082
Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh
2009-04-01
Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Seleznev, Iu M; Martynov, A V; Smirnov, V N
1982-05-01
In vivo administration of propranolol considerably inhibits the isoproterenol-stimulated increase in 45Ca accumulation by the myocardium and completely eliminates the potentiation of isoproterenol effect by hydrocortisone. A significant lowering of the concentration of high affinity binding sites for calcium in the sarcolemmal membranes can be produced by propranolol in vitro. Under these conditions, the glucocorticoids do not change the sarcolemmal Ca2+-binding parameters or modulate the propranolol effect. Therefore, for the manifestation of glucocorticoid action to be brought about, the integrity of the cells is apparently required, while propranolol seems to change calcium binding by direct interaction with the sarcolemmal membranes. It is suggested that in vivo propranolol inhibition of catecholamine effect on calcium ion accumulation by the myocardium depends on the interaction with the beta-receptors and direct modulation of the concentration of high affinity binding sites for calcium ions on the surface of the sarcolemma.
Structure of the Zinc-Bound Amino-Terminal Domain of the NMDA Receptor NR2B Subunit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karakas, E.; Simorowski, N; Furukawa, H
2009-01-01
N-methyl-D-aspartate (NMDA) receptors belong to the family of ionotropic glutamate receptors (iGluRs) that mediate the majority of fast excitatory synaptic transmission in the mammalian brain. One of the hallmarks for the function of NMDA receptors is that their ion channel activity is allosterically regulated by binding of modulator compounds to the extracellular amino-terminal domain (ATD) distinct from the L-glutamate-binding domain. The molecular basis for the ATD-mediated allosteric regulation has been enigmatic because of a complete lack of structural information on NMDA receptor ATDs. Here, we report the crystal structures of ATD from the NR2B NMDA receptor subunit in the zinc-freemore » and zinc-bound states. The structures reveal the overall clamshell-like architecture distinct from the non-NMDA receptor ATDs and molecular determinants for the zinc-binding site, ion-binding sites, and the architecture of the putative phenylethanolamine-binding site.« less
Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L.; Embrey, Kevin J.; Golovanov, Alexander P.
2016-01-01
The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly 15N-labeled Ras as well as [13C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. PMID:26565026
Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M
2014-04-15
The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.
NMR assignments of juvenile hormone binding protein in complex with JH III.
Suzuki, Rintaro; Tase, Akira; Fujimoto, Zui; Shiotsuki, Takahiro; Yamazaki, Toshimasa
2009-06-01
A hemolymph juvenile hormone binding protein (JHBP) shuttles hydrophobic JH, a key hormone in regulation of the insect life cycle, from the site of the JH biosynthesis to the cells of target organs. We report complete NMR chemical shift assignments of Bombyx mori JHBP in the JH III-bound state.
Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques
2008-01-01
This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.
Darnell, James E.
2013-01-01
Several strong conclusions emerge concerning pre-mRNA processing from both old and newer experiments. The RNAPII complex is involved with pre-mRNA processing through binding of processing proteins to the CTD (carboxyl terminal domain) of the largest RNAPII subunit. These interactions are necessary for efficient processing, but whether factor binding to the CTD and delivery to splicing sites is obligatory or facilitatory is unsettled. Capping, addition of an m7Gppp residue (cap) to the initial transcribed residue of a pre-mRNA, occurs within seconds. Splicing of pre-mRNA by spliceosomes at particular sites is most likely committed during transcription by the binding of initiating processing factors and ∼50% of the time is completed in mammalian cells before completion of the primary transcript. This fact has led to an outpouring in the literature about “cotranscriptional splicing.” However splicing requires several minutes for completion and can take longer. The RNAPII complex moves through very long introns and also through regions dense with alternating exons and introns at an average rate of ∼3 kb per min and is, therefore, not likely detained at each splice site for more than a few seconds, if at all. Cleavage of the primary transcript at the 3′ end and polyadenylation occurs within 30 sec or less at recognized polyA sites, and the majority of newly polyadenylated pre-mRNA molecules are much larger than the average mRNA. Finally, it seems quite likely that the nascent RNA most often remains associated with the chromosomal locus being transcribed until processing is complete, possibly acquiring factors related to the transport of the new mRNA to the cytoplasm. PMID:23440351
Vashisht, Kapil; Verma, Sonia; Gupta, Sunita; Lynn, Andrew M; Dixit, Rajnikant; Mishra, Neelima; Valecha, Neena; Hamblin, Karleigh A; Maytum, Robin; Pandey, Kailash C; van der Giezen, Mark
2017-01-24
Charged, solvent-exposed residues at the entrance to the substrate binding site (gatekeeper residues) produce electrostatic dipole interactions with approaching substrates, and control their access by a novel mechanism called "electrostatic gatekeeper effect". This proof-of-concept study demonstrates that the nucleotide specificity can be engineered by altering the electrostatic properties of the gatekeeper residues outside the binding site. Using Blastocystis succinyl-CoA synthetase (SCS, EC 6.2.1.5), we demonstrated that the gatekeeper mutant (ED) resulted in ATP-specific SCS to show high GTP specificity. Moreover, nucleotide binding site mutant (LF) had no effect on GTP specificity and remained ATP-specific. However, via combination of the gatekeeper mutant with the nucleotide binding site mutant (ED+LF), a complete reversal of nucleotide specificity was obtained with GTP, but no detectable activity was obtained with ATP. This striking result of the combined mutant (ED+LF) was due to two changes; negatively charged gatekeeper residues (ED) favored GTP access, and nucleotide binding site residues (LF) altered ATP binding, which was consistent with the hypothesis of the "electrostatic gatekeeper effect". These results were further supported by molecular modeling and simulation studies. Hence, it is imperative to extend the strategy of the gatekeeper effect in a different range of crucial enzymes (synthetases, kinases, and transferases) to engineer substrate specificity for various industrial applications and substrate-based drug design.
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-03-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogawa, H.; Qiu, Y; Philo, J
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(-)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. Amore » new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(-) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(-) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis.« less
Ogawa, Haruo; Qiu, Yue; Philo, John S; Arakawa, Tsutomu; Ogata, Craig M; Misono, Kunio S
2010-01-01
The binding of atrial natriuretic peptide (ANP) to its receptor requires chloride, and it is chloride concentration dependent. The extracellular domain (ECD) of the ANP receptor (ANPR) contains a chloride near the ANP-binding site, suggesting a possible regulatory role. The bound chloride, however, is completely buried in the polypeptide fold, and its functional role has remained unclear. Here, we have confirmed that chloride is necessary for ANP binding to the recombinant ECD or the full-length ANPR expressed in CHO cells. ECD without chloride (ECD(−)) did not bind ANP. Its binding activity was fully restored by bromide or chloride addition. A new X-ray structure of the bromide-bound ECD is essentially identical to that of the chloride-bound ECD. Furthermore, bromide atoms are localized at the same positions as chloride atoms both in the apo and in the ANP-bound structures, indicating exchangeable and reversible halide binding. Far-UV CD and thermal unfolding data show that ECD(−) largely retains the native structure. Sedimentation equilibrium in the absence of chloride shows that ECD(−) forms a strongly associated dimer, possibly preventing the structural rearrangement of the two monomers that is necessary for ANP binding. The primary and tertiary structures of the chloride-binding site in ANPR are highly conserved among receptor-guanylate cyclases and metabotropic glutamate receptors. The chloride-dependent ANP binding, reversible chloride binding, and the highly conserved chloride-binding site motif suggest a regulatory role for the receptor bound chloride. Chloride-dependent regulation of ANPR may operate in the kidney, modulating ANP-induced natriuresis. PMID:20066666
Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.
Liaw, S. H.; Kuo, I.; Eisenberg, D.
1995-01-01
Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633
Vo, Uybach; Vajpai, Navratna; Flavell, Liz; Bobby, Romel; Breeze, Alexander L; Embrey, Kevin J; Golovanov, Alexander P
2016-01-22
The activity of Ras is controlled by the interconversion between GTP- and GDP-bound forms partly regulated by the binding of the guanine nucleotide exchange factor Son of Sevenless (Sos). The details of Sos binding, leading to nucleotide exchange and subsequent dissociation of the complex, are not completely understood. Here, we used uniformly (15)N-labeled Ras as well as [(13)C]methyl-Met,Ile-labeled Sos for observing site-specific details of Ras-Sos interactions in solution. Binding of various forms of Ras (loaded with GDP and mimics of GTP or nucleotide-free) at the allosteric and catalytic sites of Sos was comprehensively characterized by monitoring signal perturbations in the NMR spectra. The overall affinity of binding between these protein variants as well as their selected functional mutants was also investigated using intrinsic fluorescence. The data support a positive feedback activation of Sos by Ras·GTP with Ras·GTP binding as a substrate for the catalytic site of activated Sos more weakly than Ras·GDP, suggesting that Sos should actively promote unidirectional GDP → GTP exchange on Ras in preference of passive homonucleotide exchange. Ras·GDP weakly binds to the catalytic but not to the allosteric site of Sos. This confirms that Ras·GDP cannot properly activate Sos at the allosteric site. The novel site-specific assay described may be useful for design of drugs aimed at perturbing Ras-Sos interactions. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Functional Analysis of AP-2 α and μ2 Subunits
Motley, Alison M.; Berg, Nicola; Taylor, Marcus J.; Sahlender, Daniela A.; Hirst, Jennifer; Owen, David J.
2006-01-01
The AP-2 adaptor complex plays a key role in cargo recognition and clathrin-coated vesicle formation at the plasma membrane. To investigate the functions of individual binding sites and domains of the AP-2 complex in vivo, we have stably transfected HeLa cells with wild-type and mutant small interfering RNA–resistant α and μ2 subunits and then used siRNA knockdowns to deplete the endogenous proteins. Mutating the PtdIns(4,5)P2 binding site of α, the phosphorylation site of μ2, or the YXXΦ binding site of μ2 impairs AP-2 function, as assayed by transferrin uptake. In contrast, removing the C-terminal appendage domain of α, or mutating the PtdIns(4,5)P2 binding site of μ2, has no apparent effect. However, adding a C-terminal GFP tag to α renders it completely nonfunctional. These findings demonstrate that there is some functional redundancy in the binding sites of the various AP-2 subunits, because no single mutation totally abolishes function. They also help to explain why GFP-tagged AP-2 never appears to leave the plasma membrane in some live cell imaging studies. Finally, they establish a new model system that can be used both for additional structure-function analyses, and as a way of testing tagged constructs for function in vivo. PMID:17035630
Deng, Hui-Min; Li, Yong; Zhang, Jia-Ling; Liu, Lin; Feng, Qi-Li
2016-12-01
The insect exoskeleton is mainly composed of chitin filaments linked by cuticle proteins. When insects molt, the cuticle of the exoskeleton is renewed by degrading the old chitin and cuticle proteins and synthesizing new ones. In this study, chitin-binding activity of the wing disc cuticle protein BmWCP4 in Bombyx mori was studied. Sequence analysis showed that the protein had a conservative hydrophilic "R&R" chitin-binding domain (CBD). Western blotting showed that BmWCP4 was predominately expressed in the wing disc-containing epidermis during the late wandering and early pupal stages. The immunohistochemistry result showed that the BmWCP4 was mainly present in the wing disc tissues containing wing bud and trachea blast during day 2 of wandering stage. Recombinant full-length BmWCP4 protein, "R&R" CBD peptide (CBD), non-CBD peptide (BmWCP4-CBD - ), four single site-directed mutated peptides (M 1 , M 2 , M 3 and M 4 ) and four-sites-mutated peptide (M F ) were generated and purified, respectively, for in vitro chitin-binding assay. The results indicated that both the full-length protein and the "R&R" CBD peptide could bind with chitin, whereas the BmWCP4-CBD - could not bind with chitin. The single residue mutants M 1 , M 2 , M 3 and M 4 reduced but did not completely abolish the chitin-binding activity, while four-sites-mutated protein M F completely lost the chitin-binding activity. These data indicate that BmWCP4 protein plays a critical role by binding to the chitin filaments in the wing during larva-to-pupa transformation. The conserved aromatic amino acids are critical in the interaction between chitin and the cuticle protein. © 2015 Institute of Zoology, Chinese Academy of Sciences.
Williams, B A; Chervenak, M C; Toone, E J
1992-11-15
Despite years of study, a comprehensive picture of the binding of the lectin from Canavalia ensiformis, concanavalin A, to carbohydrates remains elusive. We report here studies on the interaction of concanavalin A with methyl 3,6-di-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside, the minimum carbohydrate epitope that completely fills the oligosaccharide binding site, and the two conceptual disaccharide "halves" of the trisaccharide, methyl 3-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside and methyl 6-O-(alpha-D-mannopyranosyl)-alpha-D-mannopyranoside, using titration microcalorimetry. In all cases the interaction of protein and carbohydrate is enthalpically driven, with an unfavorable entropic contribution. The choice of concentration scales has an important impact on both the magnitude and, in some cases, the sign of the entropic component of the free energy of binding. The thermodynamic data suggest binding of the two disaccharides may take place in distinct sites, as opposed to binding in a single high affinity site. In contrast to carbohydrate-antibody binding, delta Cp values were small and negative, pointing to possible differences in the motifs used by the two groups of proteins to bind carbohydrates. The thermodynamic data are interpreted in terms of solvent reorganization. Cooperativity during lectin-carbohydrate binding was also investigated. Significant cooperativity was observed only for binding of the trisaccharide, and gave a Hill plot coefficient of 1.3 for dimeric protein.
Widespread Site-Dependent Buffering of Human Regulatory Polymorphism
Kutyavin, Tanya; Stamatoyannopoulos, John A.
2012-01-01
The average individual is expected to harbor thousands of variants within non-coding genomic regions involved in gene regulation. However, it is currently not possible to interpret reliably the functional consequences of genetic variation within any given transcription factor recognition sequence. To address this, we comprehensively analyzed heritable genome-wide binding patterns of a major sequence-specific regulator (CTCF) in relation to genetic variability in binding site sequences across a multi-generational pedigree. We localized and quantified CTCF occupancy by ChIP-seq in 12 related and unrelated individuals spanning three generations, followed by comprehensive targeted resequencing of the entire CTCF–binding landscape across all individuals. We identified hundreds of variants with reproducible quantitative effects on CTCF occupancy (both positive and negative). While these effects paralleled protein–DNA recognition energetics when averaged, they were extensively buffered by striking local context dependencies. In the significant majority of cases buffering was complete, resulting in silent variants spanning every position within the DNA recognition interface irrespective of level of binding energy or evolutionary constraint. The prevalence of complex partial or complete buffering effects severely constrained the ability to predict reliably the impact of variation within any given binding site instance. Surprisingly, 40% of variants that increased CTCF occupancy occurred at positions of human–chimp divergence, challenging the expectation that the vast majority of functional regulatory variants should be deleterious. Our results suggest that, even in the presence of “perfect” genetic information afforded by resequencing and parallel studies in multiple related individuals, genomic site-specific prediction of the consequences of individual variation in regulatory DNA will require systematic coupling with empirical functional genomic measurements. PMID:22457641
Doxey, Andrew C; Cheng, Zhenyu; Moffatt, Barbara A; McConkey, Brendan J
2010-08-03
Aromatic amino acids play a critical role in protein-glycan interactions. Clusters of surface aromatic residues and their features may therefore be useful in distinguishing glycan-binding sites as well as predicting novel glycan-binding proteins. In this work, a structural bioinformatics approach was used to screen the Protein Data Bank (PDB) for coplanar aromatic motifs similar to those found in known glycan-binding proteins. The proteins identified in the screen were significantly associated with carbohydrate-related functions according to gene ontology (GO) enrichment analysis, and predicted motifs were found frequently within novel folds and glycan-binding sites not included in the training set. In addition to numerous binding sites predicted in structural genomics proteins of unknown function, one novel prediction was a surface motif (W34/W36/W192) in the tobacco pathogenesis-related protein, PR-5d. Phylogenetic analysis revealed that the surface motif is exclusive to a subfamily of PR-5 proteins from the Solanaceae family of plants, and is absent completely in more distant homologs. To confirm PR-5d's insoluble-polysaccharide binding activity, a cellulose-pulldown assay of tobacco proteins was performed and PR-5d was identified in the cellulose-binding fraction by mass spectrometry. Based on the combined results, we propose that the putative binding site in PR-5d may be an evolutionary adaptation of Solanaceae plants including potato, tomato, and tobacco, towards defense against cellulose-containing pathogens such as species of the deadly oomycete genus, Phytophthora. More generally, the results demonstrate that coplanar aromatic clusters on protein surfaces are a structural signature of glycan-binding proteins, and can be used to computationally predict novel glycan-binding proteins from 3 D structure.
Glycosylation of Cblns attenuates their receptor binding.
Rong, Yongqi; Bansal, Parmil K; Wei, Peng; Guo, Hong; Correia, Kristen; Parris, Jennifer; Morgan, James I
2018-05-18
Cbln1 is the prototype of a family (Cbln1-Cbln4) of secreted glycoproteins and is essential for normal synapse structure and function in cerebellum by bridging presynaptic Nrxn to postsynaptic Grid2. Here we report the effects of glycosylation on the in vitro receptor binding properties of Cblns. Cbln1, 2 and 4 harbor two N-linked glycosylation sites, one at the N-terminus is in a region implicated in Nrxn binding and the second is in the C1q domain, a region involved in Grid2 binding. Mutation (asparagine to glutamine) of the N-terminal site, increased neurexin binding whereas mutation of the C1q site markedly increased Grid2 binding. These mutations did not influence subunit composition of Cbln trimeric complexes (mediated through the C1q domain) nor their assembly into hexamers (mediated by the N-terminal region). Therefore, glycosylation likely masks the receptor binding interfaces of Cblns. As Cbln4 has undetectable Grid2 binding in vitro we assessed whether transgenic expression of wild type Cbln4 or its glycosylation mutants rescued the Cbln1-null phenotype in vivo. Cbln4 partially rescued and both glycosylation mutants completely rescued ataxia in cbln1-null mice. Thus Cbln4 has intrinsic Grid2 binding that is attenuated by glycosylation, and glycosylation mutants exhibit gain of function in vivo. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Bao, Haibo; Liu, Yang; Zhang, Yixi; Liu, Zewen
2017-08-01
Due to great diversity of nicotinic acetylcholine receptor (nAChR) subtypes in insects, one β subunit may be contained in numerous nAChR subtypes. In the locust Locusta migratoria, a model insect species with agricultural importance, the third β subunits (Locβ3) was identified in this study, which reveals at least three β subunits in this insect species. Imidacloprid was found to bind nAChRs in L. migratoria central nervous system at two sites with different affinities, with K d values of 0.16 and 10.31nM. The specific antisera (L1-1, L2-1 and L3-1) were raised against fusion proteins at the large cytoplasmic loop of Locβ1, Locβ2 and Locβ3 respectively. Specific immunodepletion of Locβ1 with antiserum L1-1 resulted in the selective loss of the low affinity binding site for imidacloprid, whereas the immunodepletion of Locβ3 with L3-1 caused the selective loss of the high affinity site. Dual immunodepletion with L1-1 and L3-1 could completely abolish imidacloprid binding. In contrast, the immunodepletion of Locβ2 had no significant effect on the specific [ 3 H]imidacloprid binding. Taken together, these data indicated that Locβ1 and Locβ3 were respectively contained in the low- and high-affinity binding sites for imidacloprid in L. migratoria, which is different to the previous finding in Nilaparvata lugens that Nlβ1 was in two binding sites for imidacloprid. The involvement of two β subunits separately in two binding sites may decrease the risk of imidacloprid resistance due to putative point mutations in β subunits in L. migratoria. Copyright © 2017 Elsevier B.V. All rights reserved.
Suzuki, Shunsuke; Kasai, Kentaro; Yamauchi, Kiyoshi
2015-01-01
Transthyretin (TTR) diverged from an ancestral 5-hydroxyisourate hydrolase (HIUHase) by gene duplication at some early stage of chordate evolution. To clarify how TTR had participated in the thyroid system as an extracellular thyroid hormone (TH) binding protein, TH binding properties of recombinant little skate Leucoraja erinacea TTR was investigated. At the amino acid level, skate TTR showed 37-46% identities with the other vertebrate TTRs. Because the skate TTR had a unique histidine-rich segment in the N-terminal region, it could be purified by Ni-affinity chromatography. The skate TTR was a 46-kDa homotetramer of 14.5kDa subunits, and had one order of magnitude higher affinity for 3,3',5-triiodo-l-thyronine (T3) and some halogenated phenols than for l-thyroxine. However, the skate TTR had no HIUHase activity. Ethylenediaminetetraacetic acid (EDTA) treatment inhibited [(125)I]T3 binding activity whereas the addition of Zn(2+) to the EDTA-treated TTR recovered [(125)I]T3 binding activity in a Zn(2+) concentration-dependent manner. Scatchard analysis revealed the presence of two classes of binding site for T3, with dissociation constants of 0.24 and 17nM. However, the high-affinity sites were completely abolished with 1mM EDTA, whereas the remaining low-affinity sites decreased binding capacity. The number of zinc per TTR was quantified to be 4.5-6.3. Our results suggest that skate TTR has tight Zn(2+)-binding sites, which are essential for T3 binding to at least the high-affinity sites. Zn(2+) binding to the N-terminal histidine-rich segment may play an important role in acquisition or reinforcement of TH binding ability during early evolution of TTR. Copyright © 2015 Elsevier Inc. All rights reserved.
Busby, Ben; Oashi, Taiji; Willis, Chris D.; Ackermann, Maegen A.; Kontrogianni-Konstantopoulos, Aikaterini; MacKerell, Alexander D.; Bloch, Robert J.
2012-01-01
Small ankyrin 1 (sAnk1; also Ank1.5) is an integral protein of the sarcoplasmic reticulum in skeletal and cardiac muscle cells, where it is thought to bind to the C-terminal region of obscurin, a large modular protein that surrounds the contractile apparatus. Using fusion proteins in vitro, in combination with site directed mutagenesis and surface plasmon resonance measurements, we previously showed that the binding site on sAnk1 for obscurin consists in part of six lysine and arginine residues. Here we show that four charged residues in the high affinity binding site on obscurin for sAnk1, between residues 6316-6345, consisting of three glutamates and a lysine, are necessary, but not sufficient, for this site on obscurin to bind with high affinity to sAnk1. We also identify specific complementary mutations in sAnk1 that can partially or completely compensate for the changes in binding caused by charge-switching mutations in obscurin. We used molecular modeling to develop structural models of residues 6322-6339 of obscurin bound to sAnk1. The models, based on a combination of Brownian and molecular dynamics simulations, predict that the binding site on sAnk1 for obscurin is organized as two ankyrin-like repeats, with the last α-helical segment oriented at an angle to the nearby helices, allowing lysine-6338 of obscurin to form an ionic interaction with aspartate-111 of sAnk1. This prediction was validated by double mutant cycle experiments. Our results are consistent with a model in which electrostatic interactions between specific pairs of side chains on obscurin and sAnk1 promote binding and complex formation. PMID:21333652
Wang, Qing; Wei, Xiaochao; Zhu, Tianhui; Zhang, Ming; Shen, Run; Xing, Lianping; O'Keefe, Regis J; Chen, Di
2007-04-06
BMP-2 plays an essential role in osteoblast and chondrocyte differentiation, but its signaling mechanism has not been fully defined. In the present studies, we investigated the mechanism through which BMP-2 activates the Smad6 gene. A -2006/+45 Smad6 promoter-luciferase construct was generated along with deletions and Runx2 binding site mutations to examine the role of Smad1 and Runx2 signaling following BMP-2 stimulation in osteoblasts. Transfection of Runx2 or treatment with BMP-2-stimulated promoter activity of the -2006/+45 and -1191/+45 reporters but not the -829/+45 and -374/+45 reporters. No Smad1/5 binding site is present in the -1191/-829 region of the Smad6 promoter. Mutation of the OSE2-a site (-1036/-1031) completely abolished the stimulatory effect of Runx2 as well as BMP-2 on the -2006/+45 and -1191/+45 Smad6 reporters. Gel shift and chromatin immunoprecipitation (ChIP) assays showed that Runx2 binds the OSE2-a element. ChIP assays demonstrated that Smad1 also interacts with the OSE2-a site at the Smad6 promoter through Runx2. The protein degradation of Runx2 is mediated by the E3 ubiquitin ligase Smurf1. In the present studies, we found that Smurf1 binds the OSE2-a site through Runx2 and inhibits Smad6 gene transcription. Treatment with BMP-2 and transfection of Smad1 abolished Smurf1 binding to the OSE2 site. These results show that Smad1 binding excludes Smurf1 interaction with the OSE2 site and promotes Smad6 gene transcription.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vivian, J. P.; Porter, C.; Wilce, J. A.
2006-11-01
A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less
Melnikova, Larisa; Kostyuchenko, Margarita; Parshikov, Alexander; Georgiev, Pavel; Golovnin, Anton
2018-01-01
Su(Hw) belongs to the class of proteins that organize chromosome architecture and boundaries/insulators between regulatory domains. This protein contains a cluster of 12 zinc finger domains most of which are responsible for binding to three different modules in the consensus site. Su(Hw) forms a complex with CP190 and Mod(mdg4)-67.2 proteins that binds to well-known Drosophila insulators. To understand how Su(Hw) performs its activities and binds to specific sites in chromatin, we have examined the previously described su(Hw)f mutation that disrupts the 10th zinc finger (ZF10) responsible for Su(Hw) binding to the upstream module. The results have shown that Su(Hw)f loses the ability to interact with CP190 in the absence of DNA. In contrast, complete deletion of ZF10 does not prevent the interaction between Su(Hw)Δ10 and CP190. Having studied insulator complex formation in different mutant backgrounds, we conclude that both association with CP190 and Mod(mdg4)-67.2 partners and proper organization of DNA binding site are essential for the efficient recruitment of the Su(Hw) complex to chromatin insulators.
The bacterial dicarboxylate transporter, VcINDY, uses a two-domain elevator-type mechanism
Mulligan, Christopher; Fenollar-Ferrer, Cristina; Fitzgerald, Gabriel A.; Vergara-Jaque, Ariela; Kaufmann, Desirée; Li, Yan; Forrest, Lucy R.; Mindell, Joseph A.
2016-01-01
Secondary transporters use alternating access mechanisms to couple uphill substrate movement to downhill ion flux. Most known transporters utilize a “rocking bundle” motion, where the protein moves around an immobile substrate binding site. However, the glutamate transporter homolog, GltPh, translocates its substrate binding site vertically across the membrane, an “elevator” mechanism. Here, we used the “repeat swap” approach to computationally predict the outward-facing state of the Na+/succinate transporter VcINDY, from Vibrio cholerae. Our model predicts a substantial “elevator”-like movement of vcINDY’s substrate binding site, with a vertical translation of ~15 Å and a rotation of ~43°; multiple disulfide crosslinks which completely inhibit transport provide experimental confirmation and demonstrate that such movement is essential. In contrast, crosslinks across the VcINDY dimer interface preserve transport, revealing an absence of large scale coupling between protomers. PMID:26828963
Predicting protein-binding regions in RNA using nucleotide profiles and compositions.
Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook
2017-03-14
Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .
Finkernagel, Florian; Stiewe, Thorsten; Nist, Andrea; Suske, Guntram
2015-01-01
Transcription factors are grouped into families based on sequence similarity within functional domains, particularly DNA-binding domains. The Specificity proteins Sp1, Sp2 and Sp3 are paradigmatic of closely related transcription factors. They share amino-terminal glutamine-rich regions and a conserved carboxy-terminal zinc finger domain that can bind to GC rich motifs in vitro. All three Sp proteins are ubiquitously expressed; yet they carry out unique functions in vivo raising the question of how specificity is achieved. Crucially, it is unknown whether they bind to distinct genomic sites and, if so, how binding site selection is accomplished. In this study, we have examined the genomic binding patterns of Sp1, Sp2 and Sp3 in mouse embryonic fibroblasts by ChIP-seq. Sp1 and Sp3 essentially occupy the same promoters and localize to GC boxes. The genomic binding pattern of Sp2 is different; Sp2 primarily localizes at CCAAT motifs. Consistently, re-expression of Sp2 and Sp3 mutants in corresponding knockout MEFs revealed strikingly different modes of genomic binding site selection. Most significantly, while the zinc fingers dictate genomic binding of Sp3, they are completely dispensable for binding of Sp2. Instead, the glutamine-rich amino-terminal region is sufficient for recruitment of Sp2 to its target promoters in vivo. We have identified the trimeric histone-fold CCAAT box binding transcription factor Nf-y as the major partner for Sp2-chromatin interaction. Nf-y is critical for recruitment of Sp2 to co-occupied regulatory elements. Equally, Sp2 potentiates binding of Nf-y to shared sites indicating the existence of an extensive Sp2-Nf-y interaction network. Our results unveil strikingly different recruitment mechanisms of Sp1/Sp2/Sp3 transcription factor members uncovering an unexpected layer of complexity in their binding to chromatin in vivo. PMID:25793500
Brauser, Annemarie; Schroeder, Indra; Gutsmann, Thomas; Cosentino, Cristian; Moroni, Anna; Winterhalter, Mathias
2012-01-01
One major determinant of the efficacy of antibiotics on Gram-negative bacteria is the passage through the outer membrane. During transport of the fluoroquinolone enrofloxacin through the trimeric outer membrane protein OmpF of Escherichia coli, the antibiotic interacts with two binding sites within the pore, thus partially blocking the ionic current. The modulation of one affinity site by Mg2+ reveals further details of binding sites and binding kinetics. At positive membrane potentials, the slow blocking events induced by enrofloxacin in Mg2+-free media are converted to flickery sojourns at the highest apparent current level (all three pores flickering). This indicates weaker binding in the presence of Mg2+. Analysis of the resulting amplitude histograms with β distributions revealed the rate constants of blocking (kOB) and unblocking (kBO) in the range of 1,000 to 120,000 s−1. As expected for a bimolecular reaction, kOB was proportional to blocker concentration and kBO independent of it. kOB was approximately three times lower for enrofloxacin coming from the cis side than from the trans side. The block was not complete, leading to a residual conductivity of the blocked state being ∼25% of that of the open state. Interpretation of the results has led to the following model: fast flickering as caused by interaction of Mg2+ and enrofloxacin is related to the binding site at the trans side, whereas the cis site mediates slow blocking events which are also found without Mg2+. The difference in the accessibility of the binding sites also explains the dependency of kOB on the side of enrofloxacin addition and yields a means of determining the most plausible orientation of OmpF in the bilayer. The voltage dependence suggests that the dipole of the antibiotic has to be adequately oriented to facilitate binding. PMID:22689827
Okochi, Mina; Nomura, Tomoko; Zako, Tamotsu; Arakawa, Takatoshi; Iizuka, Ryo; Ueda, Hiroshi; Funatsu, Takashi; Leroux, Michel; Yohda, Masafumi
2004-07-23
Prefoldin is a jellyfish-shaped hexameric co-chaperone of the group II chaperonins. It captures a protein folding intermediate and transfers it to a group II chaperonin for completion of folding. The manner in which prefoldin interacts with its substrates and cooperates with the chaperonin is poorly understood. In this study, we have examined the interaction between a prefoldin and a chaperonin from hyperthermophilic archaea by immunoprecipitation, single molecule observation, and surface plasmon resonance. We demonstrate that Pyrococcus prefoldin interacts most tightly with its cognate chaperonin, and vice versa, suggesting species specificity in the interaction. Using truncation mutants, we uncovered by kinetic analyses that this interaction is multivalent in nature, consistent with multiple binding sites between the two chaperones. We present evidence that both N- and C-terminal regions of the prefoldin beta sub-unit are important for molecular chaperone activity and for the interaction with a chaperonin. Our data are consistent with substrate and chaperonin binding sites on prefoldin that are different but in close proximity, which suggests a possible handover mechanism of prefoldin substrates to the chaperonin.
Heat Capacity Changes and Disorder-to-Order Transitions in Allosteric Activation.
Cressman, William J; Beckett, Dorothy
2016-01-19
Allosteric coupling in proteins is ubiquitous but incompletely understood, particularly in systems characterized by coupling over large distances. Binding of the allosteric effector, bio-5'-AMP, to the Escherichia coli biotin protein ligase, BirA, enhances the protein's dimerization free energy by -4 kcal/mol. Previous studies revealed that disorder-to-order transitions at the effector binding and dimerization sites, which are separated by 33 Å, are integral to functional coupling. Perturbations to the transition at the ligand binding site alter both ligand binding and coupled dimerization. Alanine substitutions in four loops on the dimerization surface yield a range of energetic effects on dimerization. A glycine to alanine substitution at position 142 in one of these loops results in a complete loss of allosteric coupling, disruption of the disorder-to-order transitions at both functional sites, and a decreased affinity for the effector. In this work, allosteric communication between the effector binding and dimerization surfaces in BirA was further investigated by performing isothermal titration calorimetry measurements on nine proteins with alanine substitutions in three dimerization surface loops. In contrast to BirAG142A, at 20 °C all variants bind to bio-5'-AMP with free energies indistinguishable from that measured for wild-type BirA. However, the majority of the variants exhibit altered heat capacity changes for effector binding. Moreover, the ΔCp values correlate with the dimerization free energies of the effector-bound proteins. These thermodynamic results, combined with structural information, indicate that allosteric activation of the BirA monomer involves formation of a network of intramolecular interactions on the dimerization surface in response to bio-5'-AMP binding at the distant effector binding site.
Specific minor groove solvation is a crucial determinant of DNA binding site recognition
Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.
2014-01-01
The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976
Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.; ...
2016-02-09
Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.
Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil
2006-01-01
In this study, the immunogenicities of the nontoxic HC fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type HC (HCWT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and HC antigens and provided complete protection against toxin challenge. Mutants of HC containing deletions essential for ganglioside binding elicited lower responses than HCWT. HCM115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with HCWT, consistent with lower anti-HC and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in HCM115. We conclude that the presence of the ganglioside binding site within HC may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection. PMID:16861677
Jetha, Khushboo; Theißen, Günter; Melzer, Rainer
2014-01-01
The SEPALLATA (SEP) genes of Arabidopsis thaliana encode MADS-domain transcription factors that specify the identity of all floral organs. The four Arabidopsis SEP genes function in a largely yet not completely redundant manner. Here, we analysed interactions of the SEP proteins with DNA. All of the proteins were capable of forming tetrameric quartet-like complexes on DNA fragments carrying two sequence elements termed CArG-boxes. Distances between the CArG-boxes for strong cooperative DNA-binding were in the range of 4–6 helical turns. However, SEP1 also bound strongly to CArG-box pairs separated by smaller or larger distances, whereas SEP2 preferred large and SEP4 preferred small inter-site distances for binding. Cooperative binding of SEP3 was comparatively weak for most of the inter-site distances tested. All SEP proteins constituted floral quartet-like complexes together with the floral homeotic proteins APETALA3 (AP3) and PISTILLATA (PI) on the target genes AP3 and SEP3. Our results suggest an important part of an explanation for why the different SEP proteins have largely, but not completely redundant functions in determining floral organ identity: they may bind to largely overlapping, but not identical sets of target genes that differ in the arrangement and spacing of the CArG-boxes in their cis-regulatory regions. PMID:25183521
Penicillin-binding site on the Escherichia coli cell envelope
DOE Office of Scientific and Technical Information (OSTI.GOV)
Amaral, L.; Lee, Y.; Schwarz, U.
The binding of /sup 35/S-labeled penicillin to distinct penicillin-binding proteins (PBPs) of the cell envelope obtained from the sonication of Escherichia coli was studied at different pHs ranging from 4 to 11. Experiments distinguishing the effect of pH on penicillin binding by PBP 5/6 from its effect on beta-lactamase activity indicated that although substantial binding occurred at the lowest pH, the amount of binding increased with pH, reaching a maximum at pH 10. Based on earlier studies, it is proposed that the binding at high pH involves the formation of a covalent bond between the C-7 of penicillin and freemore » epsilon amino groups of the PBPs. At pHs ranging from 4 to 8, position 1 of penicillin, occupied by sulfur, is considered to be the site that establishes a covalent bond with the sulfhydryl groups of PBP 5. The use of specific blockers of free epsilon amino groups or sulfhydryl groups indicated that wherever the presence of each had little or no effect on the binding of penicillin by PBP 5, the presence of both completely prevented binding. The specific blocker of the hydroxyl group of serine did not affect the binding of penicillin.« less
Bar-Zvi, D; Yoshida, M; Shavit, N
1985-05-31
3'-O-(4-Benzoyl)benzoyl ADP (BzADP) was used as a photoaffinity label for covalent binding of adenine nucleotide analogs to the nucleotide binding site(s) of the thermophilic bacterium PS3 ATPase (TF1). As with the CF1-ATPase (Bar-Zvi, D. and Shavit, N. (1984) Biochim. Biophys. Acta 765, 340-356) noncovalently bound BzADP is a reversible inhibitor of the TF1-ATPase. BzADP changes the kinetics of ATP hydrolysis from noncooperative to cooperative in the same way as ADP does, but, in contrast to the effect on the CF1-ATPase, it has no effect on the Vmax. In the absence of Mg2+ 1 mol BzADP binds noncovalently to TF1, while with Mg2+ 3 mol are bound. Photoactivation of BzADP results in the covalent binding of the analog to the nucleotide binding site(s) on TF1 and correlates with the inactivation of the ATPase. Complete inactivation of the TF1-ATPase occurs after covalent binding of 2 mol BzADP/mol TF1. Photoinactivation of TF1 by BzADP is prevented if excess of either ADP or ATP is present during irradiation. Analysis by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate of the Bz[3H]ADP-labeled TF1-ATPase shows that all the radioactivity is incorporated into the beta subunit.
Henry, Brian L; Connell, Justin; Liang, Aiye; Krishnasamy, Chandravel; Desai, Umesh R
2009-07-31
Antithrombin, a major regulator of coagulation and angiogenesis, is known to interact with several natural sulfated polysaccharides. Previously, we prepared sulfated low molecular weight variants of natural lignins, called sulfated dehydrogenation polymers (DHPs) (Henry, B. L., Monien, B. H., Bock, P. E., and Desai, U. R. (2007) J. Biol. Chem. 282, 31891-31899), which have now been found to exhibit interesting antithrombin binding properties. Sulfated DHPs represent a library of diverse noncarbohydrate aromatic scaffolds that possess structures completely different from heparin and heparan sulfate. Fluorescence binding studies indicate that sulfated DHPs bind to antithrombin with micromolar affinity under physiological conditions. Salt dependence of binding affinity indicates that the antithrombin-sulfated DHP interaction involves a massive 80-87% non-ionic component to the free energy of binding. Competitive binding studies with heparin pentasaccharide, epicatechin sulfate, and full-length heparin indicate that sulfated DHPs bind to both the pentasaccharide-binding site and extended heparin-binding site of antithrombin. Affinity capillary electrophoresis resolves a limited number of peaks of antithrombin co-complexes suggesting preferential binding of selected DHP structures to the serpin. Computational genetic algorithm-based virtual screening study shows that only one sulfated DHP structure, out of the 11 present in a library of plausible sequences, bound in the heparin-binding site with a high calculated score supporting selectivity of recognition. Enzyme inhibition studies indicate that only one of the three sulfated DHPs studied is a potent inhibitor of free factor VIIa in the presence of antithrombin. Overall, the chemo-enzymatic origin and antithrombin binding properties of sulfated DHPs present novel opportunities for potent and selective modulation of the serpin function, especially for inhibiting the initiation phase of hemostasis.
Shin, W; Lindahl, P A
1992-12-29
Adding 1,10-phenanthroline to carbon monoxide dehydrogenase from Clostridium thermoaceticum results in the complete loss of the NiFeC EPR signal and the CO/acetyl-CoA exchange activity. Other EPR signals characteristic of the enzyme (the gav = 1.94 and gav = 1.86 signals) and the CO oxidation activity are completely unaffected by the 1,10-phenanthroline treatment. This indicates that there are two catalytic sites on the enzyme; the NiFe complex is required for catalyzing the exchange and acetyl-CoA synthase reactions, while some other site is responsible for CO oxidation. The strength of CO binding to the NiFe complex was examined by titrating dithionite-reduced enzyme with CO. During the titration, the NiFeC EPR signal developed to a final spin intensity of 0.23 spin/alpha beta. The resulting CO titration curve (NiFeC spins/alpha beta vs CO pha beta) was fitted using two reactions: binding of CO to the oxidized NiFe complex, and reduction of the CO-bound species to a form that exhibits the NiFeC signal. Best fits yielded apparent binding constants between 6000 and 14,000 M-1 (Kd = 70-165 microM). This sizable range is due to uncertainty whether CO binds to all or only a small fraction (approximately 23%) of the NiFe complexes. Reduction of the CO-bound NiFe complex is apparently required to activate it for catalysis. The electron used for this reduction originates from the CO oxidation site, suggesting that delivery of a low-potential electron to the CO-bound NiFe complex is the physiological function of the CO oxidation reaction catalyzed by this enzyme.
Characterization of [(3)H]harmane binding to rat whole brain membranes.
Anderson, N J; Robinson, E S J; Husbands, S M; Delagrange, P; Nutt, D J; Hudson, A L
2003-12-01
This study investigates the binding of [(3)H]harmane to rat whole brain homogenates. Saturation studies revealed [(3)H]harmane labels a single, saturable, high-capacity population with high affinity. All the test compounds displaced [(3)H]harmane completely and in an apparently monophasic manner. The displacement profile of the test ligands indicated labeling of MAO-A. Given the high level of MAO-A binding, it is unlikely that a low-capacity I(2) site would be distinguishable from the total [(3)H]harmane population.
Paiardini, Alessandro; Tramonti, Angela; Schirch, Doug; Guiducci, Giulia; di Salvo, Martino Luigi; Fiascarelli, Alessio; Giorgi, Alessandra; Maras, Bruno; Cutruzzolà, Francesca; Contestabile, Roberto
2016-11-01
The cytosolic and mitochondrial isoforms of serine hydroxymethyltransferase (SHMT1 and SHMT2, respectively) are well-recognized targets of cancer research, since their activity is critical for purine and pyrimidine biosynthesis and because of their prominent role in the metabolic reprogramming of cancer cells. Here we show that 3-bromopyruvate (3BP), a potent novel anti-tumour agent believed to function primarily by blocking energy metabolism, differentially inactivates human SHMT1 and SHMT2. SHMT1 is completely inhibited by 3BP, whereas SHMT2 retains a significant fraction of activity. Site directed mutagenesis experiments on SHMT1 demonstrate that selective inhibition relies on the presence of a cysteine residue at the active site of SHMT1 (Cys204) that is absent in SHMT2. Our results show that 3BP binds to SHMT1 active site, forming an enzyme-3BP complex, before reacting with Cys204. The physiological substrate l-serine is still able to bind at the active site of the inhibited enzyme, although catalysis does not occur. Modelling studies suggest that alkylation of Cys204 prevents a productive binding of l-serine, hampering interaction between substrate and Arg402. Conversely, the partial inactivation of SHMT2 takes place without the formation of a 3BP-enzyme complex. The introduction of a cysteine residue in the active site of SHMT2 by site directed mutagenesis (A206C mutation), at a location corresponding to that of Cys204 in SHMT1, yields an enzyme that forms a 3BP-enzyme complex and is completely inactivated. This work sets the basis for the development of selective SHMT1 inhibitors that target Cys204, starting from the structure and reactivity of 3BP. Copyright © 2016 Elsevier B.V. All rights reserved.
Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E
2008-09-01
WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.
Copper Coordination in the Full-Length, Recombinant Prion Protein†
Burns, Colin S.; Aronoff-Spencer, Eliah; Legname, Giuseppe; Prusiner, Stanley B.; Antholine, William E.; Gerfen, Gary J.; Peisach, Jack; Millhauser, Glenn L.
2010-01-01
The prion protein (PrP) binds divalent copper at physiologically relevant conditions and is believed to participate in copper regulation or act as a copper-dependent enzyme. Ongoing studies aim at determining the molecular features of the copper binding sites. The emerging consensus is that most copper binds in the octarepeat domain, which is composed of four or more copies of the fundamental sequence PHGGGWGQ. Previous work from our laboratory using PrP-derived peptides, in conjunction with EPR and X-ray crystallography, demonstrated that the HGGGW segment constitutes the fundamental binding unit in the octarepeat domain [Burns et al. (2002) Biochemistry 41, 3991–4001; Aronoff-Spencer et al. (2000) Biochemistry 39, 13760–13771]. Copper coordination arises from the His imidazole and sequential deprotonated glycine amides. In this present work, recombinant, full-length Syrian hamster PrP is investigated using EPR methodologies. Four copper ions are taken up in the octarepeat domain, which supports previous findings. However, quantification studies reveal a fifth binding site in the flexible region between the octarepeats and the PrP globular C-terminal domain. A series of PrP peptide constructs show that this site involves His96 in the PrP(92–96) segment GGGTH. Further examination by X-band EPR, S-band EPR, and electron spin–echo envelope spectroscopy, demonstrates coordination by the His96 imidazole and the glycine preceding the threonine. The copper affinity for this type of binding site is highly pH dependent, and EPR studies here show that recombinant PrP loses its affinity for copper below pH 6.0. These studies seem to provide a complete profile of the copper binding sites in PrP and support the hypothesis that PrP function is related to its ability to bind copper in a pH-dependent fashion. PMID:12779334
Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim
2007-05-22
Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.
Andersen, O M; Petersen, H H; Jacobsen, C; Moestrup, S K; Etzerodt, M; Andreasen, P A; Thøgersen, H C
2001-07-01
The low-density-lipoprotein-receptor (LDLR)-related protein (LRP) is composed of several classes of domains, including complement-type repeats (CR), which occur in clusters that contain binding sites for a multitude of different ligands. Each approximately 40-residue CR domain contains three conserved disulphide linkages and an octahedral Ca(2+) cage. LRP is a scavenging receptor for ligands from extracellular fluids, e.g. alpha(2)-macroglobulin (alpha(2)M)-proteinase complexes, lipoprotein-containing particles and serine proteinase-inhibitor complexes, like the complex between urokinase-type plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1). In the present study we analysed the interaction of the uPA-PAI-1 complex with an ensemble of fragments representing a complete overlapping set of two-domain fragments accounting for the ligand-binding cluster II (CR3-CR10) of LRP. By ligand blotting, solid-state competition analysis and surface-plasmon-resonance analysis, we demonstrate binding to multiple CR domains, but show a preferential interaction between the uPA-PAI-1 complex and a two-domain fragment comprising CR domains 5 and 6 of LRP. We demonstrate that surface-exposed aspartic acid and tryptophan residues at identical positions in the two homologous domains, CR5 and CR6 (Asp(958,CR5), Asp(999,CR6), Trp(953,CR5) and Trp(994,CR6)), are critical for the binding of the complex as well as for the binding of the receptor-associated protein (RAP) - the folding chaperone/escort protein required for transport of LRP to the cell surface. Accordingly, the present work provides (1) an identification of a preferred binding site within LRP CR cluster II; (2) evidence that the uPA-PAI-1 binding site involves residues from two adjacent protein domains; and (3) direct evidence identifying specific residues as important for the binding of uPA-PAI-1 as well as for the binding of RAP.
In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.
Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj
2014-12-01
Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.
LIBRA-WA: a web application for ligand binding site detection and protein function recognition.
Toti, Daniele; Viet Hung, Le; Tortosa, Valentina; Brandi, Valentina; Polticelli, Fabio
2018-03-01
Recently, LIBRA, a tool for active/ligand binding site prediction, was described. LIBRA's effectiveness was comparable to similar state-of-the-art tools; however, its scoring scheme, output presentation, dependence on local resources and overall convenience were amenable to improvements. To solve these issues, LIBRA-WA, a web application based on an improved LIBRA engine, has been developed, featuring a novel scoring scheme consistently improving LIBRA's performance, and a refined algorithm that can identify binding sites hosted at the interface between different subunits. LIBRA-WA also sports additional functionalities like ligand clustering and a completely redesigned interface for an easier analysis of the output. Extensive tests on 373 apoprotein structures indicate that LIBRA-WA is able to identify the biologically relevant ligand/ligand binding site in 357 cases (∼96%), with the correct prediction ranking first in 349 cases (∼98% of the latter, ∼94% of the total). The earlier stand-alone tool has also been updated and dubbed LIBRA+, by integrating LIBRA-WA's improved engine for cross-compatibility purposes. LIBRA-WA and LIBRA+ are available at: http://www.computationalbiology.it/software.html. polticel@uniroma3.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Wood, Martyn D; Gillard, Michel
2017-02-01
Brivaracetam (BRV) and levetiracetam (LEV) are effective antiepileptic drugs that bind selectively to the synaptic vesicle 2A (SV2A) protein. However, BRV differs from LEV in that it exhibits more potent and complete seizure suppression in animal models including in amygdala-kindled mice, where BRV afforded nearly complete seizure suppression. This raises the possibility that aside from potency differences, BRV and LEV may interact differently with the SV2A protein, which is not apparent in radioligand-binding competition studies. In this study, we used a recently identified SV2A allosteric modulator, UCB1244283, that appears to induce conformational changes in SV2A, to probe the binding properties of labeled BRV and LEV. Radioligand binding studies were carried out using [ 3 H]BRV and [ 3 H]LEV. Studies were performed in membranes from both recombinant cells expressing human SV2A protein and human brain tissue. The modulator increased the binding of both radioligands but by different mechanisms. For [ 3 H]BRV, the increase was driven mainly by an increase in affinity, whereas for [ 3 H]LEV, the increase was due to an increase in the number of apparent binding sites. Kinetic studies confirmed this differential effect. These studies suggest that LEV and BRV may act at different binding sites or interact with different conformational states of the SV2A protein. It is possible that some of the pharmacologic differences between BRV and LEV could be due to different interactions with the SV2A protein. © 2016 The Authors. Epilepsia published by Wiley Periodicals Inc. on behalf of International League Against Epilepsy.
Cytosine arabinoside influx and nucleoside transport sites in acute leukemia.
Wiley, J S; Jones, S P; Sawyer, W H; Paterson, A R
1982-02-01
Although cytosine arabinoside (araC) can induce a remission in a majority of patients presenting with acute myeloblastic leukemia (AML), a minority fail to respond and moreover the drug has less effect in acute lymphoblastic leukemia (ALL). The carrier-mediated influx of araC into purified blasts from patients with AML, ALL, and acute undifferentiated leukemia (AUL) has been compared to that of normal lymphocytes and polymorphs. Blasts showed a larger mediated influx of araC than mature cells, since mean influxes for myeloblasts and lymphoblasts were 6- and 2.3-fold greater than polymorphs and lymphocytes, respectively. Also, the mean influx for myeloblasts was fourfold greater than the mean for lymphoblasts. The number of nucleoside transport sites was estimated for each cell type by measuring the equilibrium binding of [(3)H]nitrobenzylthioinosine (NBMPR), which inhibits nucleoside fluxes by binding with high affinity to specific sites on the transport mechanism. The mean binding site numbers for myeloblasts and lymphoblasts were 5- and 2.8-fold greater, respectively, than for the mature cells of the same maturation series. The mean number of NBMPR binding sites for myeloblasts was fourfold greater than for lymphoblasts. Patients with AUL were heterogeneous since blasts from some gave values within the myeloblastic range and others within the lymphoblastic range. The araC influx correlated closely with the number of NBMPR binding sites measured in the same cells on the same day. Transport parameters were measured on blasts from 15 patients with AML or AUL who were then treated with standard induction therapy containing araC. Eight patients entered complete remission, while seven failed therapy, among whom were the three patients with the lowest araC influx (<0.4 pmol/10(7) cells per min) and NBMPR binding (<3,000 sites/cell) for the treated group. In summary, myeloblasts have both higher araC transport rates and more nucleoside transport sites than lymphoblasts and this factor may contribute to the greater sensitivity of AML to this drug. AraC transport varied >10-fold between leukemic blasts and normal leukocytes, but transport capacity related directly to the number of nucleoside transport sites on the cell. Finally, low araC transport rates or few NBMPR binding sites on blasts were observed in a subset of patients with acute leukemia who failed to achieve remission with drug combinations containing araC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baskaran, Sulochanadevi; Chikwana, Vimbai M.; Contreras, Christopher J.
2012-12-10
Glycogen synthase is a rate-limiting enzyme in the biosynthesis of glycogen and has an essential role in glucose homeostasis. The three-dimensional structures of yeast glycogen synthase (Gsy2p) complexed with maltooctaose identified four conserved maltodextrin-binding sites distributed across the surface of the enzyme. Site-1 is positioned on the N-terminal domain, site-2 and site-3 are present on the C-terminal domain, and site-4 is located in an interdomain cleft adjacent to the active site. Mutation of these surface sites decreased glycogen binding and catalytic efficiency toward glycogen. Mutations within site-1 and site-2 reduced the V{sub max}/S{sub 0.5} for glycogen by 40- and 70-fold,more » respectively. Combined mutation of site-1 and site-2 decreased the V{sub max}/S{sub 0.5} for glycogen by >3000-fold. Consistent with the in vitro data, glycogen accumulation in glycogen synthase-deficient yeast cells ({Delta}gsy1-gsy2) transformed with the site-1, site-2, combined site-1/site-2, or site-4 mutant form of Gsy2p was decreased by up to 40-fold. In contrast to the glycogen results, the ability to utilize maltooctaose as an in vitro substrate was unaffected in the site-2 mutant, moderately affected in the site-1 mutant, and almost completely abolished in the site-4 mutant. These data show that the ability to utilize maltooctaose as a substrate can be independent of the ability to utilize glycogen. Our data support the hypothesis that site-1 and site-2 provide a 'toehold mechanism,' keeping glycogen synthase tightly associated with the glycogen particle, whereas site-4 is more closely associated with positioning of the nonreducing end during catalysis.« less
Xia, Sijing; Cartron, Michael; Morby, James; ...
2016-01-28
The site-specific immobilization of histidine-tagged proteins to patterns formed by far-field and near-field exposure of films of aminosilanes with protein-resistant photolabile protecting groups is demonstrated. After deprotection of the aminosilane, either through a mask or using a scanning near-field optical microscope, the amine terminal groups are derivatized first with glutaraldehyde and then with N-(5-amino-1-carboxypentyl)iminodiacetic acid to yield a nitrilo-triacetic-acid-terminated surface. After complexation with Ni 2+, this surface binds histidine-tagged GFP and CpcA-PEB in a site-specific fashion. The chemistry is simple and reliable and leads to extensive surface functionalization. Bright fluorescence is observed in fluorescence microscopy images of micrometer- and nanometer-scalemore » patterns. X-ray photoelectron spectroscopy is used to study quantitatively the efficiency of photodeprotection and the reactivity of the modified surfaces. The efficiency of the protein binding process is investigated quantitatively by ellipsometry and by fluorescence microscopy. We find that regions of the surface not exposed to UV light bind negligible amounts of His-tagged proteins, indicating that the oligo(ethylene glycol) adduct on the nitrophenyl protecting group confers excellent protein resistance; in contrast, exposed regions bind His-GFP very effectively, yielding strong fluorescence that is almost completely removed on treatment of the surface with imidazole, confirming a degree of site-specific binding in excess of 90%. As a result, this simple strategy offers a versatile generic route to the spatially selective site-specific immobilization of proteins at surfaces.« less
2016-01-01
The site-specific immobilization of histidine-tagged proteins to patterns formed by far-field and near-field exposure of films of aminosilanes with protein-resistant photolabile protecting groups is demonstrated. After deprotection of the aminosilane, either through a mask or using a scanning near-field optical microscope, the amine terminal groups are derivatized first with glutaraldehyde and then with N-(5-amino-1-carboxypentyl)iminodiacetic acid to yield a nitrilo-triacetic-acid-terminated surface. After complexation with Ni2+, this surface binds histidine-tagged GFP and CpcA-PEB in a site-specific fashion. The chemistry is simple and reliable and leads to extensive surface functionalization. Bright fluorescence is observed in fluorescence microscopy images of micrometer- and nanometer-scale patterns. X-ray photoelectron spectroscopy is used to study quantitatively the efficiency of photodeprotection and the reactivity of the modified surfaces. The efficiency of the protein binding process is investigated quantitatively by ellipsometry and by fluorescence microscopy. We find that regions of the surface not exposed to UV light bind negligible amounts of His-tagged proteins, indicating that the oligo(ethylene glycol) adduct on the nitrophenyl protecting group confers excellent protein resistance; in contrast, exposed regions bind His-GFP very effectively, yielding strong fluorescence that is almost completely removed on treatment of the surface with imidazole, confirming a degree of site-specific binding in excess of 90%. This simple strategy offers a versatile generic route to the spatially selective site-specific immobilization of proteins at surfaces. PMID:26820378
PDZ binding to the BAR domain of PICK1 is elucidated by coarse-grained molecular dynamics.
He, Yi; Liwo, Adam; Weinstein, Harel; Scheraga, Harold A
2011-01-07
A key regulator of α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptor traffic, PICK1 is known to interact with over 40 other proteins, including receptors, transporters and ionic channels, and to be active mostly as a homodimer. The current lack of a complete PICK1 structure determined at atomic resolution hinders the elucidation of its functional mechanisms. Here, we identify interactions between the component PDZ and BAR domains of PICK1 by calculating possible binding sites for the PDZ domain of PICK1 (PICK1-PDZ) to the homology-modeled, crescent-shaped dimer of the PICK1-BAR domain using multiplexed replica-exchange molecular dynamics (MREMD) and canonical molecular dynamics simulations with the coarse-grained UNRES force field. The MREMD results show that the preferred binding site for the single PDZ domain is the concave cavity of the BAR dimer. A second possible binding site is near the N-terminus of the BAR domain that is linked directly to the PDZ domain. Subsequent short canonical molecular dynamics simulations used to determine how the PICK1-PDZ domain moves to the preferred binding site on the BAR domain of PICK1 revealed that initial hydrophobic interactions drive the progress of the simulated binding. Thus, the concave face of the BAR dimer accommodates the PDZ domain first by weak hydrophobic interactions and then the PDZ domain slides to the center of the concave face, where more favorable hydrophobic interactions take over. Copyright © 2010 Elsevier Ltd. All rights reserved.
Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil
2006-08-01
In this study, the immunogenicities of the nontoxic H(C) fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type H(C) (H(C)WT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and H(C) antigens and provided complete protection against toxin challenge. Mutants of H(C) containing deletions essential for ganglioside binding elicited lower responses than H(C)WT. H(C)M115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with H(C)WT, consistent with lower anti-H(C) and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in H(C)M115. We conclude that the presence of the ganglioside binding site within H(C) may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection.
Isalan, M; Klug, A; Choo, Y
2001-07-01
DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.
Biochemical and genetic analysis of the Drk SH2/SH3 adaptor protein of Drosophila.
Raabe, T; Olivier, J P; Dickson, B; Liu, X; Gish, G D; Pawson, T; Hafen, E
1995-06-01
The Drk SH3-SH2-SH3 adaptor protein has been genetically identified in a screen for rate-limiting components acting downstream of the Sevenless (Sev) receptor tyrosine kinase in the developing eye of Drosophila. It provides a link between the activated Sev receptor and Sos, a guanine nucleotide release factor that activates Ras1. We have used a combined biochemical and genetic approach to study the interactions between Sev, Drk and Sos. We show that Tyr2546 in the cytoplasmic tail of Sev is required for Drk binding, probably because it provides a recognition site for the Drk SH2 domain. Interestingly, a mutation at this site does not completely block Sev function in vivo. This may suggest that Sev can signal in a Drk-independent, parallel pathway or that Drk can also bind to an intermediate docking protein. Analysis of the Drk-Sos interaction has identified a high affinity binding site for Drk SH3 domains in the Sos tail. We show that the N-terminal Drk SH3 domain is primarily responsible for binding to the tail of Sos in vitro, and for signalling to Ras in vivo.
Chang, C P; Hüsler, T; Zhao, J; Wiedmer, T; Sims, P J
1994-10-21
The CD59 antigen is a plasma membrane glycoprotein that serves as an inhibitor of the C5b-9 complex of complement. This inhibitory activity appears related to the capacity of CD59 to bind with high affinity to sites that are nascently exposed in the alpha-chain subunit of human C8, as well as within the C9b domain (amino acid residues 245-538) of human C9, during assembly of the C5b-9 complex on the target membrane (Ninomiya, H., and Sims, P. J. (1992) J. Biol. Chem. 267, 13675-13680). The CD59 binding site in C9 was first investigated by N-terminal sequencing of CD59-binding peptides generated by limited digest of the isolated C9b domain. These experiments revealed a 17-kDa fragment (starting at C9 residue Thr-320) that retained affinity for CD59, suggesting the possibility for localizing the CD59 binding site by mapping with small C9-derived peptides. Peptides spanning the entire C9b sequence were expressed in Escherichia coli and then probed with CD59. CD59 bound specifically to all peptides starting N-terminal to C9 residue 359 with C termini extending beyond residue 411. Little to no CD59 binding was observed for various C9-derived peptides that started C-terminal to residue 359 or that were truncated N-terminal to residue 411. Affinity-purified antibody against C9 residues 320-411 inhibited CD59 binding to C9 by > 50% and completely inhibited its binding to the isolated C9b domain. Little to no specific binding of CD59 was detected for peptides restricted to the putative hinge domain within C9b (residues 245-271). These results indicate that a CD59 binding site is located between residues 320 and 411 of the C9 polypeptide and suggest that the affinity of this site is principally determined by residues 359-411.
Harmaline competitively inhibits [3H]MK-801 binding to the NMDA receptor in rabbit brain.
Du, W; Aloyo, V J; Harvey, J A
1997-10-03
Harmaline, a beta-carboline derivative, is known to produce tremor through a direct activation of cells in the inferior olive. However, the receptor(s) through which harmaline acts remains unknown. It was recently reported that the tremorogenic actions of harmaline could be blocked by the noncompetitive NMDA channel blocker, MK-801. This study examined whether the blockade of harmaline's action, in the rabbit, by MK-801 was due to a pharmacological antagonism at the MK-801 binding site. This was accomplished by measurement of [3H]MK-801 binding in membrane fractions derived from tissue containing the inferior olivary nucleus and from cerebral cortex. Harmaline completely displaced saturable [3H]MK-801 binding in both the inferior olive and cortex with apparent IC50 values of 60 and 170 microM, respectively. These IC50 values are consistent with the high doses of harmaline required to produce tremor, e.g., 10-30 mg/kg. Non-linear curve fitting analysis of [3H]MK-801 saturation experiments indicated that [3H]MK-801 bound to a single site and that harmaline's displacement of [3H]MK-801 binding to the NMDA receptor was competitive as indicated by a shift in Kd but not in Bmax. In addition, a Schild plot gave a slope that was not significantly different from 1 indicating that harmaline was producing a displacement of [3H]MK-801 from its binding site within the NMDA cation channel and not through an action at the glutamate or other allosteric sites on the NMDA receptor. These findings provide in vitro evidence that the competitive blockade of harmaline-induced tremor by MK-801 occurs within the calcium channel coupled to the NMDA receptor. Our hypothesis is that harmaline produces tremor by acting as an inverse agonist at the MK-801 binding site and thus opening the cation channel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gehlert, D.R.; Gackenheimer, S.L.; Mais, D.E.
1991-05-01
We have developed a high specific activity ligand for localization of ATP-sensitive potassium channels in the brain. When brain sections were incubated with ({sup 125}I)iodoglyburide (N-(2-((((cyclohexylamino)carbonyl)amino)sulfonyl)ethyl)-5-{sup 125}I-2- methoxybenzamide), the ligand bound to a single site with a KD of 495 pM and a maximum binding site density of 176 fmol/mg of tissue. Glyburide was the most potent inhibitor of specific ({sup 125}I)iodoglyburide binding to rat forebrain sections whereas iodoglyburide and glipizide were slightly less potent. The binding was also sensitive to ATP which completely inhibited binding at concentrations of 10 mM. Autoradiographic localization of ({sup 125}I)iodoglyburide binding indicated a broadmore » distribution of the ATP-sensitive potassium channel in the brain. The highest levels of binding were seen in the globus pallidus and ventral pallidum followed by the septohippocampal nucleus, anterior pituitary, the CA2 and CA3 region of the hippocampus, ventral pallidum, the molecular layer of the cerebellum and substantia nigra zona reticulata. The hilus and dorsal subiculum of the hippocampus, molecular layer of the dentate gyrus, cerebral cortex, lateral olfactory tract nucleus, olfactory tubercle and the zona incerta contained relatively high levels of binding. A lower level of binding (approximately 3- to 4-fold) was found throughout the remainder of the brain. These results indicate that the ATP-sensitive potassium channel has a broad presence in the rat brain and that a few select brain regions are enriched in this subtype of neuronal potassium channels.« less
Kilbourn, Michael R.; Butch, Elizabeth R.; Desmond, Timothy; Sherman, Phillip; Harris, Paul E.; Frey, Kirk A.
2009-01-01
Introduction The sensitivity of the in vivo binding of [11C]dihydrotetrabenazine ([11C]DTBZ) and [11C]methylphenidate ([11C]MPH) to their respective targets, the vesicular monoamine transporter (VMAT2) and the neuronal membrane dopamine transporter (DAT), after alterations of endogenous levels of dopamine were examined in the rat brain. Methods In vivo binding of [11C]DTBZ and [11C]MPH were determined using a bolus+infusion protocol. In vitro numbers of VMAT2 binding sites were determined by autoradiography. Results Repeated dosing with α-methyl-p-tyrosine (AMPT) at doses that significantly (−75%) depleted brain tissue dopamine levels resulted in increased (+36%) in vivo [11C]DTBZ binding to VMAT2 in the striatum. The increase in binding could be completely reversed by treatment with L-DOPA/benserazide to restore dopamine levels. There were no changes in total numbers of VMAT2 binding sites as measured using in vitro autoradiography. No changes were observed for in vivo [11C]MPH binding to the DAT in the striatum following AMPT pretreatment. Conclusion These results indicate that large reductions of dopamine concentrations in the rat brain can produce modest but significant changes in binding of radioligands to the VMAT2, which can be reversed by repleneshment of dopamine using exogenous L-DOPA. PMID:20122661
Naguib, Fardos N. M.; Rais, Reem H.; Al Safarjalani, Omar N.; el Kouni, Mahmoud H.
2015-01-01
Toxoplasma gondii has an extraordinarily ability to utilize adenosine (Ado) as the primary source of all necessary purines in this parasite which lacks de novo purine biosynthesis. The activity of T. gondii adenosine kinase (TgAK, EC 2.7.1.20) is responsible for this efficient salvage of Ado in T. gondii. To fully understand this remarkable efficiency of TgAK in the utilization of Ado, complete kinetic parameters of this enzyme are necessary. Initial velocity and product inhibition studies of TgAK demonstrated that the basic mechanism of this enzyme is a hybrid random bi-uni ping-pong uni-bi. Initial velocity studies showed an intersecting pattern, consistent with substrate-enzyme-co-substrate complex formation and a binding pattern indicating that binding of the substrate interferes with the binding of the co-substrate and vice versa. Estimated kinetic parameters were KAdo = 0.002 ± 0.0002 mM, KATP = 0.05 ± 0.008 mM, and Vmax = 920 ± 35 μmol/min/mg protein. Ado exhibited substrate inhibition suggesting the presence of more than one binding site for Ado on the enzyme. ATP relieved substrate inhibition by Ado. Thus, Ado also binds to the ATP binding site. AMP was competitive with ATP, inferring that AMP binds to the same site as ATP. AMP, ADP and ATP were non-competitive with Ado, therefore, none of these nucleotides binds to the Ado binding site. Combining ATP with ADP was additive. Therefore, the binding of either ATP or ADP does not interfere with the binding of the other. It is concluded that for every ATP consumed, TgAK generates three new AMPs. These findings along with the fact that a wide range of nucleoside 5′-mono, di, and triphosphates could substitute for ATP as phosphate donors in this reaction may explain the efficient and central role played by TgAK in the utilization of Ado as the major source from which all other purines can be synthesized in T. gondii. PMID:26112826
Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T
2013-01-01
All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis.
Jõers, Priit; Lewis, Samantha C.; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J.; Jacobs, Howard T.
2013-01-01
All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965
Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla
2006-11-01
The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.
George, J; Gilburd, B; Hojnik, M; Levy, Y; Langevitz, P; Matsuura, E; Koike, T; Shoenfeld, Y
1998-04-15
Beta2-glycoprotein I (beta2GPI) is an absolute requirement for the binding of autoimmune anticardiolipin Abs (aCL) to cardiolipin (CL). We evaluated the target recognition of human beta2GPI by IgG derived from two patients with primary and two with secondary antiphospholipid syndrome. The total IgG serum fractions and beta2GPI affinity-purified IgGs were assessed by using various domain-deleted mutants (DM) of human beta2GPI (DMs: I-III, I-IV, II-V, III-V, IV-V, and V) and mouse mAbs against individual beta2GPI domains. The four IgGs bound slightly to CL in the absence of beta2GPI and showed increased binding in the beta2GPI presence. Following affinity purification of the IgGs on a beta2GPI column, reactivity toward CL was absent. DMs containing domain V inhibited the binding of biotinylated beta2GPI to CL. The addition to CL-coated plates of DM V, but not the other DMs, reduced the binding of all four IgGs. The anti-beta2GPI IgGs bound only to complete beta2GPI and DM I-IV coated on the plates. The binding to plate-adsorbed beta2GPI could be inhibited by complete beta2GPI and DM I-IV, the latter being a more efficient inhibitor. Further, the human anti-beta2GPI IgGs could compete with the binding to beta2GPI of Cof-21 mouse mAb (directed at domain IV), but not with the two other mouse mAbs. The results suggest that some "autoimmune:" beta2GPI-dependent anticardiolipin Abs recognize a beta2GPI target that is distinct from the CL-binding site in domain V. The target site for some antiphospholipid syndrome IgGs appear to reside in domain IV of beta2GPI.
Exploration of N-arylpiperazine Binding Sites of D2 Dopaminergic Receptor.
Soskic, Vukic; Sukalovic, Vladimir; Kostic-Rajacic, Sladjana
2015-01-01
The crystal structures of the D3 dopamine receptor and several other G-protein coupled receptors (GPCRs) were published in recent times. Those 3D structures are used by us and other scientists as a template for the homology modeling and ligand docking analysis of related GPCRs. Our main scientific interest lies in the field of pharmacologically active N-arylpiperazines that exhibit antipsychotic and/or antidepressant properties, and as such are dopaminergic and serotonergic receptor ligands. In this short review article we are presenting synthesis and biological data on the new N-arylpipereazine as well our results on molecular modeling of the interactions of those N-arylpiperazines with the model of D2 dopamine receptors. To obtain that model the crystal structure of the D3 dopamine receptor was used. Our results show that the N-arylpiperazines binding site consists of two pockets: one is the orthosteric binding site where the N-arylpiperazine part of the ligand is docked and the second is a non-canonical accessory binding site for N-arylpipereazine that is formed by a second extracellular loop (ecl2) of the receptor. Until now, the structure of this receptor region was unresolved in crystal structure analyses of the D3 dopamine receptor. To get a more complete picture of the ligand - receptor interaction, DFT quantum mechanical calculations on N-arylpiperazine were performed and the obtained models were used to examine those interactions.
Maung-Maung-Thwin; Gopalakrishnakone, P; Yuen, R; Tan, C H
1996-02-01
Daboiatoxin (DbTx), the PLA2 neurotoxin from Daboia russelli siamensis venom, was shown to bind specifically and saturably to rat cerebrocortical synaptosomes and synaptic membrane fragments. Two families of binding sites were detected by equilibrium binding analysis in the presence and absence of Ca2+. Scatchard analysis of biphasic plateaus revealed Kdl 5 nM and Bmax1, 6 pmoles/mg protein, and Kd2 80 nM and Bmax2 20 pmoles/mg protein, respectively, for the high- and low-affinity binding sites. The binding of 125I-DbTx to synaptosomes did not show marked dependence on Ca2+, Mg2+, Co2+ and Sr2+. Native DbTx was the only strong competitor to 125I-DbTx synaptosomal binding (IC50 12.5 nM, KI 5.5 nM). Two other crotalid PLA2 neurotoxins, crotoxin CB and mojave toxin basic subunit, and nontoxic C. Atrox PLA2 enzyme, were relatively weaker inhibitors, while two viperid PLA2 neurotoxins, ammodytoxin A and VRV PL V, were very weak inhibitors. Crotoxin CA was a poor inhibitor even at microM concentrations, whereas no inhibitory effect at all was observed with crotoxin CACB, ammodytoxin C, VRV PL VIIIa, taipoxin, beta-bungarotoxin, or with PLA2 enzymes from N. naja venom, E. schistosa venom, bee venom and porcine pancreas. All other pharmacologically active ligands examined (epinephrine, norepinephrine, histamine, choline, dopamine, serotonin, GABA, naloxone, WB-4101, atropine, hexamethonium and alpha-bun-garotoxin) also failed to interfere with 125I-DbTx binding. As those competitors that showed partial inhibition were effective only at microM concentration range compared to the Kd (5 nM) of 125I-DbTx synaptosomal binding, DbTx could well recognize a different neuronal binding site. Rabbit anti-DbTx polyclonal antisera completely blocked the specific binding. When a range of Ca2+ and K+ channels modulators were examined, Ca2+ channel blockers (omega-conotoxins GVIA and MVIIC, taicatoxin, calciseptine and nitrendiprene) did not affect the binding even at high concentrations, while charybdotoxin was the only K+ channel effector that could partially displace 125I-DbTx synaptosomal binding amongst the K+ channel blockers tested (apamin, dendrotoxin-I, iberiotoxin, MCD-peptide, 4-aminopyridine and tetraethylammonium), suggesting that neither K+ nor Ca2+ channels are associated with DbTx binding sites.
Toninello, A; Via, L D; Di Noto, V; Mancon, M
1999-12-15
This study evaluated the effect of the anticancer drug methylglyoxal-bis(guanylhydrazone) (MGBG) on the binding of the polyamine spermine to the mitochondrial membrane and its transport into the inner compartment of this organelle. Spermine binding was studied by applying a new thermodynamic treatment of ligand-receptor interactions (Di Noto et al., Macromol Theory Simul 5: 165-181, 1996). Results showed that MGBG inhibited the binding of spermine to the site competent for the first step in polyamine transport; the interaction of spermine with this site, termed S1, also mediates the inhibitory effect of the polyamine on the mitochondrial permeability transition (Dalla Via et al., Biochim Biophys Acta 1284: 247-252, 1996). In the presence of 1 mM MGBG, the binding capacity and affinity of this site were reduced by about 2.6-fold; on the contrary, the binding capacity of the S2 site, which is most likely responsible for the internalization of cytoplasmic proteins (see Dalla Via et al., reference cited above), increased by about 1.3-fold, and its binding affinity remained unaffected. MGBG also inhibited the initial rate of spermine transport in a dose-dependent manner by establishing apparently sigmoidal kinetics. Consequently, the total extent of spermine accumulation inside mitochondria was inhibited. This inhibition in transport seems to reflect a conformational change at the level of the channel protein constituting the polyamine transport system, rather than competitive inhibition at the inner active site of the channel, thereby excluding the possibility that the polyamine and drug use the same transport pathway. Furthermore, it is suggested that, in the presence of MGBG, the S2 site is able to participate in residual spermine transport. MGBG also strongly inhibits deltapH-dependent spermine efflux, resulting in a complete block in the bidirectional flux of the polyamine and its sequestration inside the matrix space. The effects of MGBG on spermine accumulation are consistent with in vivo disruption of the regulator of energy metabolism and replication of the mitochondrial genome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Rong; Pineda, Marco; Ajamian, Eunice
2009-01-15
Three catabolic enzymes, UlaD, UlaE, and UlaF, are involved in a pathway leading to fermentation of L-ascorbate under anaerobic conditions. UlaD catalyzes a {beta}-keto acid decarboxylation reaction to produce L-xylulose-5-phosphate, which undergoes successive epimerization reactions with UlaE (L-xylulose-5-phosphate 3-epimerase) and UlaF (L-ribulose-5-phosphate 4-epimerase), yielding D-xylulose-5-phosphate, an intermediate in the pentose phosphate pathway. We describe here crystallographic studies of UlaE from Escherichia coli O157:H7 that complete the structural characterization of this pathway. UlaE has a triosephosphate isomerase (TIM) barrel fold and forms dimers. The active site is located at the C-terminal ends of the parallel {beta}-strands. The enzyme binds Zn{sup 2+},more » which is coordinated by Glu155, Asp185, His211, and Glu251. We identified a phosphate-binding site formed by residues from the {beta}1/{alpha}1 loop and {alpha}3' helix in the N-terminal region. This site differs from the well-characterized phosphate-binding motif found in several TIM barrel superfamilies that is located at strands {beta}7 and {beta}8. The intrinsic flexibility of the active site region is reflected by two different conformations of loops forming part of the substrate-binding site. Based on computational docking of the L-xylulose 5-phosphate substrate to UlaE and structural similarities of the active site of this enzyme to the active sites of other epimerases, a metal-dependent epimerization mechanism for UlaE is proposed, and Glu155 and Glu251 are implicated as catalytic residues. Mutation and activity measurements for structurally equivalent residues in related epimerases supported this mechanistic proposal.« less
Modification of opiate agonist binding by pertussis toxin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abood, M.E.; Lee, N.M.; Loh, H.H.
1986-03-05
Opiate agonist binding is decreased by GTP, suggesting the possible involvement of GTP binding proteins in regulation of opiate receptor binding. This possibility was addressed by asking whether pertussis toxin treatment, which results in ADP-ribosylation and modification of G proteins, would alter opiate agonist binding. The striatum was chosen for the initial brain area to be studied, since regulation of opiate action in this area had been shown to be modified by pertussis toxin. Treatment of striatal membranes with pertussis toxin results in up to a 55% decrease in /sup 3/(H)-DADLE binding as compared with membranes treated identically without toxin.more » This corresponds to a near complete ADP-ribosylation of both G proteins in the striatal membrane. The decrease in agonist binding appears to be due to an altered affinity of the receptor for agonist as opposed to a decrease in the number of sites. This effect of pertussis toxin on opiate agonist binding demonstrates the actual involvement of G proteins in regulation of opiate receptor binding.« less
Re-engineering the zinc fingers of PRDM9 reverses hybrid sterility in mice.
Davies, Benjamin; Hatton, Edouard; Altemose, Nicolas; Hussin, Julie G; Pratto, Florencia; Zhang, Gang; Hinch, Anjali Gupta; Moralli, Daniela; Biggs, Daniel; Diaz, Rebeca; Preece, Chris; Li, Ran; Bitoun, Emmanuelle; Brick, Kevin; Green, Catherine M; Camerini-Otero, R Daniel; Myers, Simon R; Donnelly, Peter
2016-02-11
The DNA-binding protein PRDM9 directs positioning of the double-strand breaks (DSBs) that initiate meiotic recombination in mice and humans. Prdm9 is the only mammalian speciation gene yet identified and is responsible for sterility phenotypes in male hybrids of certain mouse subspecies. To investigate PRDM9 binding and its role in fertility and meiotic recombination, we humanized the DNA-binding domain of PRDM9 in C57BL/6 mice. This change repositions DSB hotspots and completely restores fertility in male hybrids. Here we show that alteration of one Prdm9 allele impacts the behaviour of DSBs controlled by the other allele at chromosome-wide scales. These effects correlate strongly with the degree to which each PRDM9 variant binds both homologues at the DSB sites it controls. Furthermore, higher genome-wide levels of such 'symmetric' PRDM9 binding associate with increasing fertility measures, and comparisons of individual hotspots suggest binding symmetry plays a downstream role in the recombination process. These findings reveal that subspecies-specific degradation of PRDM9 binding sites by meiotic drive, which steadily increases asymmetric PRDM9 binding, has impacts beyond simply changing hotspot positions, and strongly support a direct involvement in hybrid infertility. Because such meiotic drive occurs across mammals, PRDM9 may play a wider, yet transient, role in the early stages of speciation.
Kozakov, Dima; Grove, Laurie E.; Hall, David R.; Bohnuud, Tanggis; Mottarella, Scott; Luo, Lingqi; Xia, Bing; Beglov, Dmitri; Vajda, Sandor
2016-01-01
FTMap is a computational mapping server that identifies binding hot spots of macromolecules, i.e., regions of the surface with major contributions to the ligand binding free energy. To use FTMap, users submit a protein, DNA, or RNA structure in PDB format. FTMap samples billions of positions of small organic molecules used as probes and scores the probe poses using a detailed energy expression. Regions that bind clusters of multiple probe types identify the binding hot spots, in good agreement with experimental data. FTMap serves as basis for other servers, namely FTSite to predict ligand binding sites, FTFlex to account for side chain flexibility, FTMap/param to parameterize additional probes, and FTDyn to map ensembles of protein structures. Applications include determining druggability of proteins, identifying ligand moieties that are most important for binding, finding the most bound-like conformation in ensembles of unliganded protein structures, and providing input for fragment based drug design. FTMap is more accurate than classical mapping methods such as GRID and MCSS, and is much faster than the more recent approaches to protein mapping based on mixed molecular dynamics. Using 16 probe molecules, the FTMap server finds the hot spots of an average size protein in less than an hour. Since FTFlex performs mapping for all low energy conformers of side chains in the binding site, its completion time is proportionately longer. PMID:25855957
Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I; Lanciego, José L; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael
2017-01-01
The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB 2 receptors (CB 2 Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB 2 R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB 2 R. Using membrane preparations from CB 2 R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB 2 R where the synthetic cannabinoid, [ 3 H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB 2 R-selective compound, CM-157. The effect on binding to CB 2 R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the K D . CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB 2 R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities.
Martínez-Pinilla, Eva; Varani, Katia; Reyes-Resina, Irene; Angelats, Edgar; Vincenzi, Fabrizio; Ferreiro-Vera, Carlos; Oyarzabal, Julen; Canela, Enric I.; Lanciego, José L.; Nadal, Xavier; Navarro, Gemma; Borea, Pier Andrea; Franco, Rafael
2017-01-01
The mechanism of action of cannabidiol (CBD), the main non-psychotropic component of Cannabis sativa L., is not completely understood. First assumed that the compound was acting via cannabinoid CB2 receptors (CB2Rs) it is now suggested that it interacts with non-cannabinoid G-protein-coupled receptors (GPCRs); however, CBD does not bind with high affinity to the orthosteric site of any GPCR. To search for alternative explanations, we tested CBD as a potential allosteric ligand of CB2R. Radioligand and non-radioactive homogeneous binding, intracellular cAMP determination and ERK1/2 phosphorylation assays were undertaken in heterologous systems expressing the human version of CB2R. Using membrane preparations from CB2R-expressing HEK-293T (human embryonic kidney 293T) cells, we confirmed that CBD does not bind with high affinity to the orthosteric site of the human CB2R where the synthetic cannabinoid, [3H]-WIN 55,212-2, binds. CBD was, however, able to produce minor but consistent reduction in the homogeneous binding assays in living cells using the fluorophore-conjugated CB2R-selective compound, CM-157. The effect on binding to CB2R-expressing living cells was different to that exerted by the orthosteric antagonist, SR144528, which decreased the maximum binding without changing the KD. CBD at nanomolar concentrations was also able to significantly reduce the effect of the selective CB2R agonist, JWH133, on forskolin-induced intracellular cAMP levels and on activation of the MAP kinase pathway. These results may help to understand CBD mode of action and may serve to revisit its therapeutic possibilities. PMID:29109685
DOE Office of Scientific and Technical Information (OSTI.GOV)
Carr, Carolyn E.; Musiani, Francesco; Huang, Hsin-Ting
Escherichia coli RcnR (resistance to cobalt and nickel regulator, EcRcnR) is a metal-responsive repressor of the genes encoding the Ni(II) and Co(II) exporter proteins RcnAB by binding to PRcnAB. The DNA binding affinity is weakened when the cognate ions Ni(II) and Co(II) bind to EcRcnR in a six-coordinate site that features a (N/O)5S ligand donor-atom set in distinct sites: while both metal ions are bound by the N terminus, Cys35, and His64, Co(II) is additionally bound by His3. On the other hand, the noncognate Zn(II) and Cu(I) ions feature a lower coordination number, have a solvent-accessible binding site, and coordinatemore » protein ligands that do not include the N-terminal amine. A molecular model of apo-EcRcnR suggested potential roles for Glu34 and Glu63 in binding Ni(II) and Co(II) to EcRcnR. The roles of Glu34 and Glu63 in metal binding, metal selectivity, and function were therefore investigated using a structure/function approach. X-ray absorption spectroscopy was used to assess the structural changes in the Ni(II), Co(II), and Zn(II) binding sites of Glu → Ala and Glu → Cys variants at both positions. The effect of these structural alterations on the regulation of PrcnA by EcRcnR in response to metal binding was explored using LacZ reporter assays. These combined studies indicate that while Glu63 is a ligand for both metal ions, Glu34 is a ligand for Co(II) but possibly not for Ni(II). The Glu34 variants affect the structure of the cognate metal sites, but they have no effect on the transcriptional response. In contrast, the Glu63 variants affect both the structure and transcriptional response, although they do not completely abolish the function of EcRcnR. The structure of the Zn(II) site is not significantly perturbed by any of the glutamic acid variations. The spectroscopic and functional data obtained on the mutants were used to calculate models of the metal-site structures of EcRcnR bound to Ni(II), Co(II), and Zn(II). The results are interpreted in terms of a switch mechanism, in which a subset of the metal-binding ligands is responsible for the allosteric response required for DNA release.« less
Itoh, S; Yanagimoto, T; Tagawa, S; Hashimoto, H; Kitamura, R; Nakajima, Y; Okochi, T; Fujimoto, S; Uchino, J; Kamataki, T
1992-03-24
P-450IIIA7 is a form of cytochrome P-450 which was isolated from human fetal livers and termed P-450HFLa. This form has been clarified to be expressed during fetal life specifically (Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. and Kamataki, T. (1990) Biochemistry 29, 4430-4433). In the present study, we isolated five independent clones which probably corresponded to the human P-450IIIA7 gene. These clones were completely sequenced, all exons, exon-intron junctions and the 5' flanking region from the cap site to-869. Although the sequences in the coding region were completely identical to P-450IIIA7, it is possible that genomic fragments sequenced in this study encode portions of other P-450IIIA7-related genes since we could not obtain a complete overlapping set of genomic clones. Within its 5' flanking sequence, the putative binding sites of several transcriptional regulatory factors existed. Among them, it was shown that a basic transcription element binding factor (BTEB) actually interacted with the 5' flanking region of this gene.
Wood, Troy D.; Guan, Ziqiang; Borders, Charles L.; Chen, Lorenzo H.; Kenyon, George L.; McLafferty, Fred W.
1998-01-01
Phenylglyoxal is an arginine-specific reagent that inactivates creatine kinase (CK). Previous results suggest that modification of the dimeric enzyme at a single arginine residue per subunit causes complete inactivation accompanied by the loss of nucleotide binding; the actual site of modification was not identified. Here, high-resolution tandem mass spectrometry (MS/MS) was used to identify three phenylglyoxal-modified Arg residues in monomeric rabbit muscle CK. Electrospray ionizaton Fourier-transform MS of the phenylglyoxal-modified CK that had lost ≈80% activity identified three species: unmodified, once-modified (+116 Da), and twice-modified (+232 Da) enzyme in a ratio of approximately 1:4:1. MS/MS restricts the derivatized sites to P122-P212 and P283-V332, whereas MS of Lys-C digestions revealed two modified peptides, A266-K297 and G116-K137. The only Arg in A266-K297 is Arg-291 (invariant), whereas MS/MS of modified G116-K137 shows that two of the three sites Arg-129, Arg-131, or Arg-134 (all invariant) can contain the modification. The recently reported x-ray crystal structure for the octameric chicken mitochondrial CK indicates that its nucleotide triphosphate-binding site indeed contains the equivalent of R291, R129, and R131 reported here to be at the active site of rabbit muscle CK. PMID:9520370
An Aromatic Cap Seals the Substrate Binding Site in an ECF-Type S Subunit for Riboflavin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karpowich, Nathan K.; Song, Jinmei; Wang, Da-Neng
2016-06-13
ECF transporters are a family of active membrane transporters for essential micronutrients, such as vitamins and trace metals. Found exclusively in archaea and bacteria, these transporters are composed of four subunits: an integral membrane substrate-binding subunit (EcfS), a transmembrane coupling subunit (EcfT), and two ATP-binding cassette ATPases (EcfA and EcfA'). We have characterized the structural basis of substrate binding by the EcfS subunit for riboflavin from Thermotoga maritima, TmRibU. TmRibU binds riboflavin with high affinity, and the protein–substrate complex is exceptionally stable in solution. The crystal structure of riboflavin-bound TmRibU reveals an electronegative binding pocket at the extracellular surface inmore » which the substrate is completely buried. Analysis of the intermolecular contacts indicates that nearly every available substrate hydrogen bond is satisfied. A conserved aromatic residue at the extracellular end of TM5, Tyr130, caps the binding site to generate a substrate-bound, occluded state, and non-conservative mutation of Tyr130 reduces the stability of this conformation. Using a novel fluorescence binding assay, we find that an aromatic residue at this position is essential for high-affinity substrate binding. Comparison with other S subunit structures suggests that TM5 and Loop5-6 contain a dynamic, conserved motif that plays a key role in gating substrate entry and release by S subunits of ECF transporters.« less
Structural basis of Na(+)-independent and cooperative substrate/product antiport in CaiT.
Schulze, Sabrina; Köster, Stefan; Geldmacher, Ulrike; Terwisscha van Scheltinga, Anke C; Kühlbrandt, Werner
2010-09-09
Transport of solutes across biological membranes is performed by specialized secondary transport proteins in the lipid bilayer, and is essential for life. Here we report the structures of the sodium-independent carnitine/butyrobetaine antiporter CaiT from Proteus mirabilis (PmCaiT) at 2.3-A and from Escherichia coli (EcCaiT) at 3.5-A resolution. CaiT belongs to the family of betaine/carnitine/choline transporters (BCCT), which are mostly Na(+) or H(+) dependent, whereas EcCaiT is Na(+) and H(+) independent. The three-dimensional architecture of CaiT resembles that of the Na(+)-dependent transporters LeuT and BetP, but in CaiT a methionine sulphur takes the place of the Na(+) ion to coordinate the substrate in the central transport site, accounting for Na(+)-independent transport. Both CaiT structures show the fully open, inward-facing conformation, and thus complete the set of functional states that describe the alternating access mechanism. EcCaiT contains two bound butyrobetaine substrate molecules, one in the central transport site, the other in an extracellular binding pocket. In the structure of PmCaiT, a tryptophan side chain occupies the transport site, and access to the extracellular site is blocked. Binding of both substrates to CaiT reconstituted into proteoliposomes is cooperative, with Hill coefficients up to 1.7, indicating that the extracellular site is regulatory. We propose a mechanism whereby the occupied regulatory site increases the binding affinity of the transport site and initiates substrate translocation.
Structural and Kinetic Analyses of Macrophage Migration Inhibitory Factor Active Site Interactions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crichlow, G.; Lubetsky, J; Leng, L
Macrophage migration inhibitory factor (MIF) is a secreted protein expressed in numerous cell types that counters the antiinflammatory effects of glucocorticoids and has been implicated in sepsis, cancer, and certain autoimmune diseases. Interestingly, the structure of MIF contains a catalytic site resembling the tautomerase/isomerase sites of microbial enzymes. While bona fide physiological substrates remain unknown, model substrates have been identified. Selected compounds that bind in the tautomerase active site also inhibit biological functions of MIF. It had previously been shown that the acetaminophen metabolite, N-acetyl-p-benzoquinone imine (NAPQI), covalently binds to the active site of MIF. In this study, kinetic datamore » indicate that NAPQI inhibits MIF both covalently and noncovalently. The structure of MIF cocrystallized with NAPQI reveals that the NAPQI has undergone a chemical alteration forming an acetaminophen dimer (bi-APAP) and binds noncovalently to MIF at the mouth of the active site. We also find that the commonly used protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), forms a covalent complex with MIF and inhibits the tautomerase activity. Crystallographic analysis reveals the formation of a stable, novel covalent bond for PMSF between the catalytic nitrogen of the N-terminal proline and the sulfur of PMSF with complete, well-defined electron density in all three active sites of the MIF homotrimer. Conclusions are drawn from the structures of these two MIF-inhibitor complexes regarding the design of novel compounds that may provide more potent reversible and irreversible inhibition of MIF.« less
Fedele, Laura; Newcombe, Joseph; Topf, Maya; Gibb, Alasdair; Harvey, Robert J; Smart, Trevor G
2018-03-06
Genetic and bioinformatic analyses have identified missense mutations in GRIN2B encoding the NMDA receptor GluN2B subunit in autism, intellectual disability, Lennox Gastaut and West Syndromes. Here, we investigated several such mutations using a near-complete, hybrid 3D model of the human NMDAR and studied their consequences with kinetic modelling and electrophysiology. The mutants revealed reductions in glutamate potency; increased receptor desensitisation; and ablation of voltage-dependent Mg 2+ block. In addition, we provide new views on Mg 2+ and NMDA channel blocker binding sites. We demonstrate that these mutants have significant impact on excitatory transmission in developing neurons, revealing profound changes that could underlie their associated neurological disorders. Of note, the NMDAR channel mutant GluN2B V618G unusually allowed Mg 2+ permeation, whereas nearby N615I reduced Ca 2+ permeability. By identifying the binding site for an NMDAR antagonist that is used in the clinic to rescue gain-of-function phenotypes, we show that drug binding may be modified by some GluN2B disease-causing mutations.
French, Robert J.; Yoshikami, Doju; Sheets, Michael F.; Olivera, Baldomero M.
2010-01-01
Neurotoxin receptor site 1, in the outer vestibule of the conducting pore of voltage-gated sodium channels (VGSCs), was first functionally defined by its ability to bind the guanidinium-containing agents, tetrodotoxin (TTX) and saxitoxin (STX). Subsequent studies showed that peptide μ-conotoxins competed for binding at site 1. All of these natural inhibitors block single sodium channels in an all-or-none manner on binding. With the discovery of an increasing variety of μ-conotoxins, and the synthesis of numerous derivatives, observed interactions between the channel and these different ligands have become more complex. Certain μ-conotoxin derivatives block single-channel currents partially, rather than completely, thus enabling the demonstration of interactions between the bound toxin and the channel’s voltage sensor. Most recently, the relatively small μ-conotoxin KIIIA (16 amino acids) and its variants have been shown to bind simultaneously with TTX and exhibit both synergistic and antagonistic interactions with TTX. These interactions raise new pharmacological possibilities and place new constraints on the possible structures of the bound complexes of VGSCs with these toxins. PMID:20714429
NASA Astrophysics Data System (ADS)
Zhdanova, Nadezda; Shirshin, Evgeny; Fadeev, Victor; Priezzhev, Alexander
2016-04-01
Among all plasma proteins human serum albumin (HSA) is the most studied one as it is the main transport protein and can bind a wide variety of ligands especially fatty acids (FAs). The concentration of FAs bound to HSA in human blood plasma differs by three times under abnormal conditions (fasting, physical exercises or in case of social important diseases). In the present study a surfactant sodium dodecyl sulfate (SDS) was used to simulate FAs binding to HSA. It was shown that the increase of Tyr fluorescence of human blood plasma due to SDS addition can be completely explained by HSA-SDS complex formation. Binding parameters of SDS-HSA complex (average number of sites and apparent constant of complex formation) were determined from titration curves based on tyrosine (Tyr) fluorescence.
Mechanistic pathways of recognition of a solvent-inaccessible cavity of protein by a ligand
NASA Astrophysics Data System (ADS)
Mondal, Jagannath; Pandit, Subhendu; Dandekar, Bhupendra; Vallurupalli, Pramodh
One of the puzzling questions in the realm of protein-ligand recognition is how a solvent-inaccessible hydrophobic cavity of a protein gets recognized by a ligand. We address the topic by simulating, for the first time, the complete binding process of benzene from aqueous media to the well-known buried cavity of L99A T4 Lysozyme at an atomistic resolution. Our multiple unbiased microsecond-long trajectories, which were completely blind to the location of target binding site, are able to unequivocally identify the kinetic pathways along which benzene molecule meanders across the solvent and protein and ultimately spontaneously recognizes the deeply buried cavity of L99A T4 Lysozyme at an accurate precision. Our simulation, combined with analysis based on markov state model and free energy calculation, reveals that there are more than one distinct ligand binding pathways. Intriguingly, each of the identified pathways involves the transient opening of a channel of the protein prior to ligand binding. The work will also decipher rich mechanistic details on unbinding kinetics of the ligand as obtained from enhanced sampling techniques.
Mouse SLLP1, a sperm lysozyme-like protein involved in sperm-egg binding and fertilization.
Herrero, María Belén; Mandal, Arabinda; Digilio, Laura C; Coonrod, Scott A; Maier, Bernhard; Herr, John C
2005-08-01
This study demonstrates the retention of mouse sperm lysozyme-like protein (mSLLP1) in the equatorial segment of spermatozoa following the acrosome reaction and a role for mSLLP1 in sperm-egg binding and fertilization. Treatment of cumulus intact oocytes with either recmSLLP1 or its antiserum resulted in a significant (P < or = 0.05) inhibition of fertilization. Co-incubation of zona-free mouse oocytes with capacitated mouse spermatozoa in the presence of varying concentrations of anti-recmSLLP1 serum or recmSLLP1 also inhibited sperm-oolemma binding. A complete inhibition of binding and fusion of spermatozoa to the oocyte occurred at 12.5 muM concentration of recmSLLP1, while conventional chicken and human lysozymes did not block sperm-egg binding. mSLLP1 showed receptor sites in the perivitelline space as well as on the microvillar region of the egg plasma membrane. The retention of mSLLP1 in the equatorial segment of acrosome-reacted sperm, the inhibitory effects of both recmSLLP1 and antibodies to SLLP1 on in vitro fertilization with both cumulus intact and zona-free eggs, and the definition of complementary SLLP1-binding sites on the egg plasma membrane together support the hypothesis that a c lysozyme-like protein is involved in the binding of spermatozoa to the egg plasma membrane during fertilization.
Agonist activation of α7 nicotinic acetylcholine receptors via an allosteric transmembrane site
Gill, JasKiran K.; Savolainen, Mari; Young, Gareth T.; Zwart, Ruud; Sher, Emanuele; Millar, Neil S.
2011-01-01
Conventional nicotinic acetylcholine receptor (nAChR) agonists, such as acetylcholine, act at an extracellular “orthosteric” binding site located at the interface between two adjacent subunits. Here, we present evidence of potent activation of α7 nAChRs via an allosteric transmembrane site. Previous studies have identified a series of nAChR-positive allosteric modulators (PAMs) that lack agonist activity but are able to potentiate responses to orthosteric agonists, such as acetylcholine. It has been shown, for example, that TQS acts as a conventional α7 nAChR PAM. In contrast, we have found that a compound with close chemical similarity to TQS (4BP-TQS) is a potent allosteric agonist of α7 nAChRs. Whereas the α7 nAChR antagonist metyllycaconitine acts competitively with conventional nicotinic agonists, metyllycaconitine is a noncompetitive antagonist of 4BP-TQS. Mutation of an amino acid (M253L), located in a transmembrane cavity that has been proposed as being the binding site for PAMs, completely blocks agonist activation by 4BP-TQS. In contrast, this mutation had no significant effect on agonist activation by acetylcholine. Conversely, mutation of an amino acid located within the known orthosteric binding site (W148F) has a profound effect on agonist potency of acetylcholine (resulting in a shift of ∼200-fold in the acetylcholine dose-response curve), but had little effect on the agonist dose-response curve for 4BP-TQS. Computer docking studies with an α7 homology model provides evidence that both TQS and 4BP-TQS bind within an intrasubunit transmembrane cavity. Taken together, these findings provide evidence that agonist activation of nAChRs can occur via an allosteric transmembrane site. PMID:21436053
NASA Astrophysics Data System (ADS)
Ling, Irene; Taha, Mohamed; Al-Sharji, Nada A.; Abou-Zied, Osama K.
2018-04-01
The ability of human serum albumin (HSA) to bind medium-sized hydrophobic molecules is important for the distribution, metabolism, and efficacy of many drugs. Herein, the interaction between pyrene, a hydrophobic fluorescent probe, and HSA was thoroughly investigated using steady-state and time-resolved fluorescence techniques, ligand docking, and molecular dynamics (MD) simulations. A slight quenching of the fluorescence signal from Trp214 (the sole tryptophan residue in the protein) in the presence of pyrene was used to determine the ligand binding site in the protein, using Förster's resonance energy transfer (FRET) theory. The estimated FRET apparent distance between pyrene and Trp214 was 27 Å, which was closely reproduced by the docking analysis (29 Å) and MD simulation (32 Å). The highest affinity site for pyrene was found to be in subdomain IB from the docking results. The calculated equilibrium structure of the complex using MD simulation shows that the ligand is largely stabilized by hydrophobic interaction with Phe165, Phe127, and the nonpolar moieties of Tyr138 and Tyr161. The fluorescence vibronic peak ratio I1/I3 of bound pyrene inside HSA indicates the presence of polar effect in the local environment of pyrene which is less than that of free pyrene in buffer. This was clarified by the MD simulation results in which an average of 5.7 water molecules were found within 0.5 nm of pyrene in the binding site. Comparing the fluorescence signals and lifetimes of pyrene inside HSA to that free in buffer, the high tendency of pyrene to form dimer was almost completely suppressed inside HSA, indicating a high selectivity of the binding pocket toward pyrene monomer. The current results emphasize the ability of HSA, as a major carrier of several drugs and ligands in blood, to bind hydrophobic molecules in cavities other than subdomain IIA which is known to bind most hydrophobic drugs. This ability stems from the nature of the amino acids forming the binding sites of the protein that can easily adapt their shape to accommodate a variety of molecular structures.
Kocher, Olivier; Birrane, Gabriel; Tsukamoto, Kosuke; Fenske, Sara; Yesilaltay, Ayce; Pal, Rinku; Daniels, Kathleen; Ladias, John A. A.; Krieger, Monty
2010-01-01
The PDZ1 domain of the four PDZ domain-containing protein PDZK1 has been reported to bind the C terminus of the HDL receptor scavenger receptor class B, type I (SR-BI), and to control hepatic SR-BI expression and function. We generated wild-type (WT) and mutant murine PDZ1 domains, the mutants bearing single amino acid substitutions in their carboxylate binding loop (Lys14-Xaa4-Asn19-Tyr-Gly-Phe-Phe-Leu24), and measured their binding affinity for a 7-residue peptide corresponding to the C terminus of SR-BI (503VLQEAKL509). The Y20A and G21Y substitutions abrogated all binding activity. Surprisingly, binding affinities (Kd) of the K14A and F22A mutants were 3.2 and 4.0 μm, respectively, similar to 2.6 μm measured for the WT PDZ1. To understand these findings, we determined the high resolution structure of WT PDZ1 bound to a 5-residue sequence from the C-terminal SR-BI (505QEAKL509) using x-ray crystallography. In addition, we incorporated the K14A and Y20A substitutions into full-length PDZK1 liver-specific transgenes and expressed them in WT and PDZK1 knock-out mice. In WT mice, the transgenes did not alter endogenous hepatic SR-BI protein expression (intracellular distribution or amount) or lipoprotein metabolism (total plasma cholesterol, lipoprotein size distribution). In PDZK1 knock-out mice, as expected, the K14A mutant behaved like wild-type PDZK1 and completely corrected their hepatic SR-BI and plasma lipoprotein abnormalities. Unexpectedly, the 10–20-fold overexpressed Y20A mutant also substantially, but not completely, corrected these abnormalities. The results suggest that there may be an additional site(s) within PDZK1 that bind(s) SR-BI and mediate(s) productive SR-BI-PDZK1 interaction previously attributed exclusively to the canonical binding of the C-terminal SR-BI to PDZ1. PMID:20739281
DOE Office of Scientific and Technical Information (OSTI.GOV)
O Kocher; G Birrane; K Tsukamoto
2011-12-31
The PDZ1 domain of the four PDZ domain-containing protein PDZK1 has been reported to bind the C terminus of the HDL receptor scavenger receptor class B, type I (SR-BI), and to control hepatic SR-BI expression and function. We generated wild-type (WT) and mutant murine PDZ1 domains, the mutants bearing single amino acid substitutions in their carboxylate binding loop (Lys(14)-Xaa(4)-Asn(19)-Tyr-Gly-Phe-Phe-Leu(24)), and measured their binding affinity for a 7-residue peptide corresponding to the C terminus of SR-BI ((503)VLQEAKL(509)). The Y20A and G21Y substitutions abrogated all binding activity. Surprisingly, binding affinities (K(d)) of the K14A and F22A mutants were 3.2 and 4.0 ?M,more » respectively, similar to 2.6 ?M measured for the WT PDZ1. To understand these findings, we determined the high resolution structure of WT PDZ1 bound to a 5-residue sequence from the C-terminal SR-BI ((505)QEAKL(509)) using x-ray crystallography. In addition, we incorporated the K14A and Y20A substitutions into full-length PDZK1 liver-specific transgenes and expressed them in WT and PDZK1 knock-out mice. In WT mice, the transgenes did not alter endogenous hepatic SR-BI protein expression (intracellular distribution or amount) or lipoprotein metabolism (total plasma cholesterol, lipoprotein size distribution). In PDZK1 knock-out mice, as expected, the K14A mutant behaved like wild-type PDZK1 and completely corrected their hepatic SR-BI and plasma lipoprotein abnormalities. Unexpectedly, the 10-20-fold overexpressed Y20A mutant also substantially, but not completely, corrected these abnormalities. The results suggest that there may be an additional site(s) within PDZK1 that bind(s) SR-BI and mediate(s) productive SR-BI-PDZK1 interaction previously attributed exclusively to the canonical binding of the C-terminal SR-BI to PDZ1.« less
De novo active sites for resurrected Precambrian enzymes
NASA Astrophysics Data System (ADS)
Risso, Valeria A.; Martinez-Rodriguez, Sergio; Candel, Adela M.; Krüger, Dennis M.; Pantoja-Uceda, David; Ortega-Muñoz, Mariano; Santoyo-Gonzalez, Francisco; Gaucher, Eric A.; Kamerlin, Shina C. L.; Bruix, Marta; Gavira, Jose A.; Sanchez-Ruiz, Jose M.
2017-07-01
Protein engineering studies often suggest the emergence of completely new enzyme functionalities to be highly improbable. However, enzymes likely catalysed many different reactions already in the last universal common ancestor. Mechanisms for the emergence of completely new active sites must therefore either plausibly exist or at least have existed at the primordial protein stage. Here, we use resurrected Precambrian proteins as scaffolds for protein engineering and demonstrate that a new active site can be generated through a single hydrophobic-to-ionizable amino acid replacement that generates a partially buried group with perturbed physico-chemical properties. We provide experimental and computational evidence that conformational flexibility can assist the emergence and subsequent evolution of new active sites by improving substrate and transition-state binding, through the sampling of many potentially productive conformations. Our results suggest a mechanism for the emergence of primordial enzymes and highlight the potential of ancestral reconstruction as a tool for protein engineering.
Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.
1991-01-01
Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less
NASA Astrophysics Data System (ADS)
Lengyel, Iván M.; Morelli, Luis G.
2017-04-01
Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.
Iegre, Jessica; Brear, Paul; De Fusco, Claudia; Yoshida, Masao; Mitchell, Sophie L.; Rossmann, Maxim; Carro, Laura; Sore, Hannah F.
2018-01-01
CK2 is a critical cell cycle regulator that also promotes various anti-apoptotic mechanisms. Development of ATP-non-competitive inhibitors of CK2 is a very attractive strategy considering that the ATP binding site is highly conserved among other kinases. We have previously utilised a pocket outside the active site to develop a novel CK2 inhibitor, CAM4066. Whilst CAM4066 bound to this new pocket it was also interacting with the ATP site: herein, we describe an example of a CK2α inhibitor that binds completely outside the active site. This second generation αD-site binding inhibitor, compound CAM4712 (IC50 = 7 μM, GI50 = 10.0 ± 3.6 μM), has numerous advantages over the previously reported CAM4066, including a reduction in the number of rotatable bonds, the absence of amide groups susceptible to the action of proteases and improved cellular permeability. Unlike with CAM4066, there was no need to facilitate cellular uptake by making a prodrug. Moreover, CAM4712 displayed no drop off between its ability to inhibit the kinase in vitro (IC50) and the ability to inhibit cell proliferation (GI50). PMID:29732088
Glutamine 89 is a key residue in the allosteric modulation of human serine racemase activity by ATP.
Canosa, Andrea V; Faggiano, Serena; Marchetti, Marialaura; Armao, Stefano; Bettati, Stefano; Bruno, Stefano; Percudani, Riccardo; Campanini, Barbara; Mozzarelli, Andrea
2018-06-13
Serine racemase (SR) catalyses two reactions: the reversible racemisation of L-serine and the irreversible dehydration of L- and D-serine to pyruvate and ammonia. SRs are evolutionarily related to serine dehydratases (SDH) and degradative threonine deaminases (TdcB). Most SRs and TdcBs - but not SDHs - are regulated by nucleotides. SR binds ATP cooperatively and the nucleotide allosterically stimulates the serine dehydratase activity of the enzyme. A H-bond network comprising five residues (T52, N86, Q89, E283 and N316) and water molecules connects the active site with the ATP-binding site. Conservation analysis points to Q89 as a key residue for the allosteric communication, since its mutation to either Met or Ala is linked to the loss of control of activity by nucleotides. We verified this hypothesis by introducing the Q89M and Q89A point mutations in the human SR sequence. The allosteric communication between the active site and the allosteric site in both mutants is almost completely abolished. Indeed, the stimulation of the dehydratase activity by ATP is severely diminished and the binding of the nucleotide is no more cooperative. Ancestral state reconstruction suggests that the allosteric control by nucleotides established early in SR evolution and has been maintained in most eukaryotic lineages.
Randáková, Alena; Dolejší, Eva; Rudajev, Vladimír; Zimčík, Pavel; Doležal, Vladimír; El-Fakahany, Esam E; Jakubík, Jan
2015-07-01
We mutated key amino acids of the human variant of the M1 muscarinic receptor that target ligand binding, receptor activation, and receptor-G protein interaction. We compared the effects of these mutations on the action of two atypical M1 functionally preferring agonists (N-desmethylclozapine and xanomeline) and two classical non-selective orthosteric agonists (carbachol and oxotremorine). Mutations of D105 in the orthosteric binding site and mutation of D99 located out of the orthosteric binding site decreased affinity of all tested agonists that was translated as a decrease in potency in accumulation of inositol phosphates and intracellular calcium mobilization. Mutation of D105 decreased the potency of the atypical agonist xanomeline more than that of the classical agonists carbachol and oxotremorine. Mutation of the residues involved in receptor activation (D71) and coupling to G-proteins (R123) completely abolished the functional responses to both classical and atypical agonists. Our data show that both classical and atypical agonists activate hM1 receptors by the same molecular switch that involves D71 in the second transmembrane helix. The principal difference among the studied agonists is rather in the way they interact with D105 in the orthosteric binding site. Furthermore, our data demonstrate a key role of D105 in xanomeline wash-resistant binding and persistent activation of hM1 by wash-resistant xanomeline. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Iranzo, Olga; Chakraborty, Saumen; Hemmingsen, Lars; Pecoraro, Vincent L
2011-01-19
Herein we report how de novo designed peptides can be used to investigate whether the position of a metal site along a linear sequence that folds into a three-stranded α-helical coiled coil defines the physical properties of Cd(II) ions in either CdS(3) or CdS(3)O (O-being an exogenous water molecule) coordination environments. Peptides are presented that bind Cd(II) into two identical coordination sites that are located at different topological positions at the interior of these constructs. The peptide GRANDL16PenL19IL23PenL26I binds two Cd(II) as trigonal planar 3-coordinate CdS(3) structures whereas GRANDL12AL16CL26AL30C sequesters two Cd(II) as pseudotetrahedral 4-coordinate CdS(3)O structures. We demonstrate how for the first peptide, having a more rigid structure, the location of the identical binding sites along the linear sequence does not affect the physical properties of the two bound Cd(II). However, the sites are not completely independent as Cd(II) bound to one of the sites ((113)Cd NMR chemical shift of 681 ppm) is perturbed by the metalation state (apo or [Cd(pep)(Hpep)(2)](+) or [Cd(pep)(3)](-)) of the second center ((113)Cd NMR chemical shift of 686 ppm). GRANDL12AL16CL26AL30C shows a completely different behavior. The physical properties of the two bound Cd(II) ions indeed depend on the position of the metal center, having pK(a2) values for the equilibrium [Cd(pep)(Hpep)(2)](+) → [Cd(pep)(3)](-) + 2H(+) (corresponding to deprotonation and coordination of cysteine thiols) that range from 9.9 to 13.9. In addition, the L26AL30C site shows dynamic behavior, which is not observed for the L12AL16C site. These results indicate that for these systems one cannot simply assign a "4-coordinate structure" and assume certain physical properties for that site since important factors such as packing of the adjacent Leu, size of the intended cavity (endo vs exo) and location of the metal site play crucial roles in determining the final properties of the bound Cd(II).
Otero, Lisandro H.; Rojas-Altuve, Alzoray; Llarrull, Leticia I.; Carrasco-López, Cesar; Kumarasiri, Malika; Lastochkin, Elena; Fishovitz, Jennifer; Dawley, Matthew; Hesek, Dusan; Lee, Mijoon; Johnson, Jarrod W.; Fisher, Jed F.; Chang, Mayland; Mobashery, Shahriar; Hermoso, Juan A.
2013-01-01
The expression of penicillin binding protein 2a (PBP2a) is the basis for the broad clinical resistance to the β-lactam antibiotics by methicillin-resistant Staphylococcus aureus (MRSA). The high-molecular mass penicillin binding proteins of bacteria catalyze in separate domains the transglycosylase and transpeptidase activities required for the biosynthesis of the peptidoglycan polymer that comprises the bacterial cell wall. In bacteria susceptible to β-lactam antibiotics, the transpeptidase activity of their penicillin binding proteins (PBPs) is lost as a result of irreversible acylation of an active site serine by the β-lactam antibiotics. In contrast, the PBP2a of MRSA is resistant to β-lactam acylation and successfully catalyzes the dd-transpeptidation reaction necessary to complete the cell wall. The inability to contain MRSA infection with β-lactam antibiotics is a continuing public health concern. We report herein the identification of an allosteric binding domain—a remarkable 60 Å distant from the dd-transpeptidase active site—discovered by crystallographic analysis of a soluble construct of PBP2a. When this allosteric site is occupied, a multiresidue conformational change culminates in the opening of the active site to permit substrate entry. This same crystallographic analysis also reveals the identity of three allosteric ligands: muramic acid (a saccharide component of the peptidoglycan), the cell wall peptidoglycan, and ceftaroline, a recently approved anti-MRSA β-lactam antibiotic. The ability of an anti-MRSA β-lactam antibiotic to stimulate allosteric opening of the active site, thus predisposing PBP2a to inactivation by a second β-lactam molecule, opens an unprecedented realm for β-lactam antibiotic structure-based design. PMID:24085846
Euro, Liliya; Haapanen, Outi; Róg, Tomasz; Vattulainen, Ilpo; Suomalainen, Anu; Sharma, Vivek
2017-03-07
DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform in the "intrinsic processivity" subdomain of the enzyme. Our data indicate that noncatalytic mutations may disrupt replisomal interactions, thereby causing Pol γ-associated neurodegenerative disorders.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sloan, J.W.
1984-01-01
These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less
Deng, Nanjie; Cui, Di; Zhang, Bin W; Xia, Junchao; Cruz, Jeffrey; Levy, Ronald
2018-06-13
Accurately predicting absolute binding free energies of protein-ligand complexes is important as a fundamental problem in both computational biophysics and pharmaceutical discovery. Calculating binding free energies for charged ligands is generally considered to be challenging because of the strong electrostatic interactions between the ligand and its environment in aqueous solution. In this work, we compare the performance of the potential of mean force (PMF) method and the double decoupling method (DDM) for computing absolute binding free energies for charged ligands. We first clarify an unresolved issue concerning the explicit use of the binding site volume to define the complexed state in DDM together with the use of harmonic restraints. We also provide an alternative derivation for the formula for absolute binding free energy using the PMF approach. We use these formulas to compute the binding free energy of charged ligands at an allosteric site of HIV-1 integrase, which has emerged in recent years as a promising target for developing antiviral therapy. As compared with the experimental results, the absolute binding free energies obtained by using the PMF approach show unsigned errors of 1.5-3.4 kcal mol-1, which are somewhat better than the results from DDM (unsigned errors of 1.6-4.3 kcal mol-1) using the same amount of CPU time. According to the DDM decomposition of the binding free energy, the ligand binding appears to be dominated by nonpolar interactions despite the presence of very large and favorable intermolecular ligand-receptor electrostatic interactions, which are almost completely cancelled out by the equally large free energy cost of desolvation of the charged moiety of the ligands in solution. We discuss the relative strengths of computing absolute binding free energies using the alchemical and physical pathway methods.
Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers
Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.
1977-01-01
DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713
Wang, Yilong; Liu, Rongxian; Lu, Mijia; Yang, Yingzhi; Zhou, Duo; Hao, Xiaoqiang; Zhou, Dongming; Wang, Bin; Li, Jianrong; Huang, Yao-Wei; Zhao, Zhengyan
2018-05-01
The live-attenuated measles virus (MV) vaccine based on the Hu191 strain has played a significant role in controlling measles in China. However, it has considerable adverse effects that may cause public health burden. We hypothesize that the safety and efficacy of MV vaccine can be improved by altering the S-adenosylmethionine (SAM) binding site in the conserved region VI of the large polymerase protein. To test this hypothesis, we established an efficient reverse genetics system for the rMV-Hu191 strain and generated two recombinant MV-Hu191 carrying mutations in the SAM binding site. These two mutants grew to high titer in Vero cells, were genetically stable, and were significantly more attenuated in vitro and in vivo compared to the parental rMV-Hu191 vaccine strain. Importantly, both MV-Hu191 mutants triggered a higher neutralizing antibody than rMV-Hu191 vaccine and provided complete protection against MV challenge. These results demonstrate its potential for an improved MV vaccine candidate. Copyright © 2018 Elsevier Inc. All rights reserved.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Linardy, Evelyn M; Erskine, Simon M; Lima, Nicole E; Lonergan, Tina; Mokany, Elisa; Todd, Alison V
2016-01-15
Advancements in molecular biology have improved the ability to characterize disease-related nucleic acids and proteins. Recently, there has been an increasing desire for tests that can be performed outside of centralised laboratories. This study describes a novel isothermal signal amplification cascade called EzyAmp (enzymatic signal amplification) that is being developed for detection of targets at the point of care. EzyAmp exploits the ability of some restriction endonucleases to cleave substrates containing nicks within their recognition sites. EzyAmp uses two oligonucleotide duplexes (partial complexes 1 and 2) which are initially cleavage-resistant as they lack a complete recognition site. The recognition site of partial complex 1 can be completed by hybridization of a triggering oligonucleotide (Driver Fragment 1) that is generated by a target-specific initiation event. Binding of Driver Fragment 1 generates a completed complex 1, which upon cleavage, releases Driver Fragment 2. In turn, binding of Driver Fragment 2 to partial complex 2 creates completed complex 2 which when cleaved releases additional Driver Fragment 1. Each cleavage event separates fluorophore quencher pairs resulting in an increase in fluorescence. At this stage a cascade of signal production becomes independent of further target-specific initiation events. This study demonstrated that the EzyAmp cascade can facilitate detection and quantification of nucleic acid targets with sensitivity down to aM concentration. Further, the same cascade detected VEGF protein with a sensitivity of 20nM showing that this universal method for amplifying signal may be linked to the detection of different types of analytes in an isothermal format. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
The minimal structure containing the band 3 anion transport site. A 35Cl NMR study.
Falke, J J; Kanes, K J; Chan, S I
1985-10-25
35Cl NMR, which enables observation of chloride binding to the anion transport site on band 3, is used in the present study to determine the minimal structure containing the intact transport site. Removal of cytoskeletal and other nonintegral membrane proteins, or removal of the 40-kDa cytoskeletal domain of band 3, each leave the transport site intact. Similarly, cleavage of the 52-kDa transport domain into 17- and 35-kDa fragments by chymotrypsin leaves the transport site intact. Extensive proteolysis by papain reduces the integral red cell membrane proteins to their transmembrane segments. Papain treatment removes approximately 60% of the extramembrane portion of the transport domain and produces small fragments primarily in the range 3-7 kDa, with 5 kDa being most predominant. Papain treatment damages, but does not destroy, chloride binding to the transport site; thus, the minimal structure containing the transport site is composed solely of transmembrane segments. In short, the results are completely consistent with a picture in which the transport site is buried in the membrane where it is protected from proteolysis; the transmembrane segments that surround the transport site are held together by strong attractive forces within the bilayer; and the transport site is accessed by solution chloride via an anion channel leading from the transport site to the solution.
The binding of calcium ions by erythrocytes and `ghost'-cell membranes
Long, C.; Mouat, Barbara
1971-01-01
1. Washed human erythrocytes, suspended in iso-osmotic sucrose containing 2.5mm-calcium chloride, bind about 400μg-atoms of calcium/litre of packed cells. Sucrose may be replaced by other sugars. 2. Partial replacement of sucrose by iso-osmotic potassium chloride diminishes the uptake of calcium, 50% inhibition occurring at about 50mm-potassium chloride. 3. Other univalent cations behave like potassium, whereas bivalent cations are much more inhibitory. The tervalent cations, yttrium and lanthanum, however, are the most effective inhibitors of calcium uptake. 4. An approximate correlation exists between the calcium uptake and the sialic acid content of erythrocytes of various species and of human erythrocytes that have been partially depleted of sialic acid by treatment with neuraminidase. However, even after complete removal of sialic acid, human erythrocytes still bind about 140μg-atoms of calcium/litre of packed cells. 5. A Scatchard (1949) plot of calcium uptake at various Ca2+ concentrations in the suspending media shows the presence of three different binding sites on the external surface of the human erythrocyte membrane. 6. Erythrocyte `ghost' cells, the membranes of which appear to be permeable to Ca2+ ions, can bind about 1000μg-atoms of calcium per `ghost'-cell equivalent of 1 litre of packed erythrocytes. This indicates that there are also binding sites for calcium on the internal surface of the erythrocyte membrane. PMID:5124387
Mechanism of Aldolase Control of Sorting Nexin 9 Function in Endocytosis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rangarajan, Erumbi S.; Park, HaJeung; Fortin, Emanuelle
Sorting nexin 9 (SNX9) functions in a complex with the GTPase dynamin-2 at clathrin-coated pits, where it provokes fission of vesicles to complete endocytosis. Here the SNX9-dynamin-2 complex binds to clathrin and adapter protein complex 2 (AP-2) that line these pits, and this occurs through interactions of the low complexity domain (LC4) of SNX9 with AP-2. Intriguingly, localization of the SNX9-dynamin-2 complex to clathrin-coated pits is blocked by interactions with the abundant glycolytic enzyme aldolase, which also binds to the LC4 domain of SNX9. The crystal structure of the LC4 motif of human SNX9 in complex with aldolase explains themore » biochemistry and biology of this interaction, where SNX9 binds near the active site of aldolase via residues 165-171 that are also required for the interactions of SNX9 with AP-2. Accordingly, SNX9 binding to aldolase is structurally precluded by the binding of substrate to the active site. Interactions of SNX9 with aldolase are far more extensive and differ from those of the actin-nucleating factor WASP with aldolase, indicating considerable plasticity in mechanisms that direct the functions of the aldolase as a scaffold protein.« less
Autoradiography of P2x ATP receptors in the rat brain.
Balcar, V. J.; Li, Y.; Killinger, S.; Bennett, M. R.
1995-01-01
1. Binding of a P2x receptor specific radioligand, [3H]-alpha,beta-methylene adenosine triphosphate ([3H]-alpha,beta-MeATP) to sections of rat brain was reversible and association/dissociation parameters indicated that it consisted of two saturable components. Non-specific binding was very low (< 7% at 10 nM ligand concentration). 2. The binding was completely inhibited by suramin (IC50 approximately 14-26 microM) but none of the ligands specific for P2y receptors such as 2-methylthio-adenosine triphosphate (2-methyl-S-ATP) and 2-chloro-adenosine triphosphate (2-C1-ATP) nor 2-methylthio-adenosine diphosphate (2-methyl-S-ADP) a ligand for the P2 receptor on blood platelets ('P2T' type) produced strong inhibitions except for P1,P4-di(adenosine-5')tetraphosphate (Ap4A). 3. Inhibitors of Na+,K(+)-dependent adenosine triphosphatase (ATPase) ouabain, P1-ligand adenosine and an inhibitor of transport of, respectively, adenosine and cyclic nucleotides, dilazep, had no effect. 4. The highest density of P2x binding sites was found to be in the cerebellar cortex but the binding sites were present in all major brain regions, especially in areas known to receive strong excitatory innervation. Images Figure 2 PMID:7670731
Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing
Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric
2017-01-01
AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457
Prior, Lynn; Bordet, Sylvie; Trifiro, Mark A.; Mhatre, Anand; Kaufman, Morris; Pinsky, Leonard; Wrogeman, Klaus; Belsham, Denise D.; Pereira, Fred; Greenberg, Cheryl; Trapman, Jan; Brinkman, Albert O.; Chang, Chawnshang; Liao, Shutsung
1992-01-01
We have discovered two different point mutations in a single codon of the X-linked androgen-receptor (AR) gene in two pairs of unrelated families who have complete androgen insensitivity (resistance) associated with different AR phenotypes in their genital skin fibroblasts. One mutation is a C-to-T transition at a CpG sequence near the 5' terminus of exon 6; it changes the sense of codon 773 from arginine to cysteine, ablates specific androgen-binding activity at 37°C, and eliminates a unique KpnI site at the intron-exon boundary. The other mutation is a G-to-A transition that changes amino acid 773 to histidine and eliminates an SphI site. This mutant AR has a normal androgen-binding capacity at 37°C but has a reduced affinity for androgens and is thermolabile in their presence. Transient transfection of COS cells with cDNA expression vectors yielded little androgen-binding activity at 37°C from Arg773Cys and abundant activity with abnormal properties from Arg773His, thereby proving the pathogenicity of both sequence alterations. This conclusion coincides with the following facts about evolutionary preservation of the position homologous to Arg773 in the AR: it is occupied by Arg or lysine in the progesterone, glucocorticoid, and mineralocorticoid receptors, and it is within a 14-amino-acid region of their steroid-binding domains that share ∼85% amino acid identity. ImagesFigure 7Figure 2Figure 3Figure 5Figure 6Figure 8 PMID:1609793
Li de La Sierra, I M; Gallay, J; Vincent, M; Bertrand, T; Briozzo, P; Bârzu, O; Gilles, A M
2000-12-26
The conformation and dynamics of the ATP binding site of cytidine monophosphate kinase from Escherichia coli (CMPK(coli)), which catalyzes specifically the phosphate exchange between ATP and CMP, was studied using the fluorescence properties of 3'-anthraniloyl-2'-deoxy-ADP, a specific ligand of the enzyme. The spectroscopic properties of the bound fluorescent nucleotide change strongly with respect to those in aqueous solution. These changes (red shift of the absorption and excitation spectra, large increase of the excited state lifetime) are compared to those observed in different solvents. These data, as well as acrylamide quenching experiments, suggest that the anthraniloyl moiety is protected from the aqueous solvent upon binding to the ATP binding site, irrespective of the presence of CMP or CDP. The protein-bound ADP analogue exhibits a restricted fast subnanosecond rotational motion, completely blocked by CMP binding. The energy-minimized models of CMPK(coli) complexed with 3'-anthraniloyl-2'-deoxy-ADP using the crystal structures of the ligand-free protein and of its complex with CDP (PDB codes and, respectively) were compared to the crystal structure of UMP/CMP kinase from Dictyostelium discoideum complexed with substrates (PDB code ). The key residues for ATP/ADP binding to CMPK(coli) were identified as R157 and I209, their side chains sandwiching the adenine ring. Moreover, the residues involved in the fixation of the phosphate groups are conserved in both proteins. In the model, the accessibility of the fluorescent ring to the solvent should be substantial if the LID conformation remained unchanged, by contrast to the fluorescence data. These results provide the first experimental arguments about an ATP-mediated induced-fit of the LID in CMPK(coli) modulated by CMP, leading to a closed conformation of the active site, protected from water.
DOE Office of Scientific and Technical Information (OSTI.GOV)
J Fleming; J Wojciak; M Campbell
Lysophosphatidic acid (LPA) is a common product of glycerophospholipid metabolism and an important mediator of signal transduction. Aberrantly high LPA concentrations accompany multiple disease states. One potential approach for treatment of these diseases, therefore, is the therapeutic application of antibodies that recognize and bind LPA as their antigen. We have determined the X-ray crystal structure of an anti-LPA antibody (LT3015) Fab fragment in its antigen-free form to 2.15 {angstrom} resolution and in complex with two LPA isotypes (14:0 and 18:2) to resolutions of 1.98 and 2.51 {angstrom}, respectively. The variable CDR (complementarity-determining region) loops at the antigen binding site adoptmore » nearly identical conformations in the free and antigen-bound crystal structures. The crystallographic models reveal that the LT3015 antibody employs both heavy- and light-chain CDR loops to create a network of eight hydrogen bonds with the glycerophosphate head group of its LPA antigen. The head group is almost completely excluded from contact with solvent, while the hydrocarbon tail is partially solvent-exposed. In general, mutation of amino acid residues at the antigen binding site disrupts LPA binding. However, the introduction of particular mutations chosen strategically on the basis of the structures can positively influence LPA binding affinity. Finally, these structures elucidate the exquisite specificity demonstrated by an anti-lipid antibody for binding a structurally simple and seemingly unconstrained target molecule.« less
A tool for calculating binding-site residues on proteins from PDB structures.
Hu, Jing; Yan, Changhui
2009-08-03
In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.
Ryden, T A; de Mars, M; Beemon, K
1993-01-01
Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280
Novel antibody binding determinants on the capsid surface of serotype O foot-and-mouth disease virus
Asfor, Amin S.; Upadhyaya, Sasmita; Knowles, Nick J.; King, Donald P.; Paton, David J.
2014-01-01
Five neutralizing antigenic sites have been described for serotype O foot-and-mouth disease viruses (FMDV) based on monoclonal antibody (mAb) escape mutant studies. However, a mutant virus selected to escape neutralization of mAb binding at all five sites was previously shown to confer complete cross-protection with the parental virus in guinea pig challenge studies, suggesting that amino acid residues outside the mAb binding sites contribute to antibody-mediated in vivo neutralization of FMDV. Comparison of the ability of bovine antisera to neutralize a panel of serotype O FMDV identified three novel putative sites at VP2-74, VP2-191 and VP3-85, where amino acid substitutions correlated with changes in sero-reactivity. The impact of these positions was tested using site-directed mutagenesis to effect substitutions at critical amino acid residues within an infectious copy of FMDV O1 Kaufbeuren (O1K). Recovered viruses containing additional mutations at VP2-74 and VP2-191 exhibited greater resistance to neutralization with both O1K guinea pig and O BFS bovine antisera than a virus that was engineered to include only mutations at the five known antigenic sites. The changes at VP2-74 and VP3-85 are adjacent to critical amino acids that define antigenic sites 2 and 4, respectively. However VP2-191 (17 Å away from VP2-72), located at the threefold axis and more distant from previously identified antigenic sites, exhibited the most profound effect. These findings extend our knowledge of the surface features of the FMDV capsid known to elicit neutralizing antibodies, and will improve our strategies for vaccine strain selection and rational vaccine design. PMID:24584474
Baum, Bernhard; Lecker, Laura S. M.; Zoltner, Martin; Jaenicke, Elmar; Schnell, Robert; Hunter, William N.; Brenk, Ruth
2015-01-01
Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF) are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials. PMID:26249693
Dixit, Madhura P; Thakre, Prajwal P; Pannase, Akshay S; Aglawe, Manish M; Taksande, Brijesh G; Kotagale, Nandkishor R
2014-06-05
Agmatine is a cationic amine formed by decarboxylation of l-arginine by the mitochondrial enzyme arginine decarboxylase and widely distributed in mammalian brain. Although the precise function of endogenous agmatine has been largely remained unclear, its exogenous administration demonstrated beneficial effects in several neurological and psychiatric disorders. This study was planned to examine the role of imidazoline binding sites in the anticompulsive-like effect of agmatine on marble-burying behavior. Agmatine (20 and 40mg/kg, ip), mixed imidazoline I1/α2 agonists clonidine (60µg/kg, ip) and moxonidine (0.25mg/kg, ip), and imidazoline I2 agonist 2- BFI (10mg/kg, ip) showed significant inhibition of marble burying behavior in mice. In combination studies, the anticompulsive-like effect of agmatine (10mg/kg, ip) was significantly potentiated by prior administration of moxonidine (0.25mg/kg, ip) or clonidine (30µg/kg,) or 2-BFI (5mg/kg, ip). Conversely, efaroxan (1mg/kg, ip), an I1 antagonist and idazoxan (0.25mg/kg, ip), an I2 antagonist completely blocked the anticompulsive-like effect of agmatine (10mg/kg, ip). These drugs at doses used here did not influence the basal locomotor activity in experimental animals. These results clearly indicated the involvement of imidazoline binding sites in anti-compulsive-like effect of agmatine. Thus, imidazoline binding sites can be explored further as novel therapeutic target for treatment of anxiety and obsessive compulsive disorders. Copyright © 2014 Elsevier B.V. All rights reserved.
Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph
2015-10-01
Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that `close' the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an `open'more » structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. In conclusion, as a polar but almost neutral ligand, the active site-tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS.« less
Murphy, Jesse R; Donini, Stefano; Kappock, T Joseph
2015-10-01
Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that `close' the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an `open' structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site-tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS.
Fragment-Based Approaches to Enhance GTP Competitive KRAS G12C Inhibitors
During the current period we completed work on a series of guanine nucleotide mimetics and published results. As part of this we developed and...reported a novel method of measuring small molecule binding to KRAS G12C active site. We also published 2 additional manuscripts about KRAS G12C directed
Abriata, Luciano A; Vila, Alejandro J; Dal Peraro, Matteo
2014-06-01
Cupredoxins perform copper-mediated long-range electron transfer (ET) in biological systems. Their copper-binding sites have evolved to force copper ions into ET-competent systems with decreased reorganization energy, increased reduction potential, and a distinct electronic structure compared with those of non-ET-competent copper complexes. The entatic or rack-induced state hypothesis explains these special properties in terms of the strain that the protein matrix exerts on the metal ions. This idea is supported by X-ray structures of apocupredoxins displaying "closed" arrangements of the copper ligands like those observed in the holoproteins; however, it implies completely buried copper-binding atoms, conflicting with the notion that they must be exposed for copper loading. On the other hand, a recent work based on NMR showed that the copper-binding regions of apocupredoxins are flexible in solution. We have explored five cupredoxins in their "closed" apo forms through molecular dynamics simulations. We observed that prearranged ligand conformations are not stable as the X-ray data suggest, although they do form part of the dynamic landscape of the apoproteins. This translates into variable flexibility of the copper-binding regions within a rigid fold, accompanied by fluctuations of the hydrogen bonds around the copper ligands. Major conformations with solvent-exposed copper-binding atoms could allow initial binding of the copper ions. An eventual subsequent incursion to the closed state would result in binding of the remaining ligands, trapping the closed conformation thanks to the additional binding energy and the fastening of noncovalent interactions that make up the rack.
NASA Technical Reports Server (NTRS)
Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.
2000-01-01
Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase
NASA Astrophysics Data System (ADS)
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-01
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.
New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.
Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian
2016-08-05
Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.
Paris, Guillaume; Ramseyer, Christophe; Enescu, Mironel
2014-05-01
The conformational dynamics of human serum albumin (HSA) was investigated by principal component analysis (PCA) applied to three molecular dynamics trajectories of 200 ns each. The overlap of the essential subspaces spanned by the first 10 principal components (PC) of different trajectories was about 0.3 showing that the PCA based on a trajectory length of 200 ns is not completely convergent for this protein. The contributions of the relative motion of subdomains and of the subdomains (internal) distortion to the first 10 PCs were found to be comparable. Based on the distribution of the first 3 PC, 10 protein conformers are identified showing relative root mean square deviations (RMSD) between 2.3 and 4.6 Å. The main PCs are found to be delocalized over the whole protein structure indicating that the motions of different protein subdomains are coupled. This coupling is considered as being related to the allosteric effects observed upon ligand binding to HSA. On the other hand, the first PC of one of the three trajectories describes a conformational transition of the protein domain I that is close to that experimentally observed upon myristate binding. This is a theoretical support for the older hypothesis stating that changes of the protein onformation favorable to binding can precede the ligand complexation. A detailed all atoms PCA performed on the primary Sites 1 and 2 confirms the multiconformational character of the HSA binding sites as well as the significant coupling of their motions. Copyright © 2013 Wiley Periodicals, Inc.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
NASA Astrophysics Data System (ADS)
D'Aquino, J. Alejandro; Ringe, Dagmar
2006-08-01
The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.
Allosteric binding sites in Rab11 for potential drug candidates
2018-01-01
Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rosier, A.M.; Vandesande, F.; Orban, G.A.
1991-03-08
The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less
Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B
1989-01-01
The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501
Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A
1999-01-01
A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
NASA Astrophysics Data System (ADS)
Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.
2017-11-01
Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.
An asymmetric structure of the Bacillus subtilis replication terminator protein in complex with DNA.
Vivian, J P; Porter, C J; Wilce, J A; Wilce, M C J
2007-07-13
In Bacillus subtilis, the termination of DNA replication via polar fork arrest is effected by a specific protein:DNA complex formed between the replication terminator protein (RTP) and DNA terminator sites. We report the crystal structure of a replication terminator protein homologue (RTP.C110S) of B. subtilis in complex with the high affinity component of one of its cognate DNA termination sites, known as the TerI B-site, refined at 2.5 A resolution. The 21 bp RTP:DNA complex displays marked structural asymmetry in both the homodimeric protein and the DNA. This is in contrast to the previously reported complex formed with a symmetrical TerI B-site homologue. The induced asymmetry is consistent with the complex's solution properties as determined using NMR spectroscopy. Concomitant with this asymmetry is variation in the protein:DNA binding pattern for each of the subunits of the RTP homodimer. It is proposed that the asymmetric "wing" positions, as well as other asymmetrical features of the RTP:DNA complex, are critical for the cooperative binding that underlies the mechanism of polar fork arrest at the complete terminator site.
Hoggett, J G; Kellett, G L
1976-06-15
A method is described for the purification of native hexokinases P-I and P-II from yeast using preparative isoelectric focussing to separate the isozymes. The binding of glucose to hexokinase P-II, and the effect of this on the monomer--dimer association--dissociation reaction have been investigated quantitatively by a combination of titrations of intrinsic protein fluorescence and equilibrium ultracentrifugation. Association constants for the monomer-dimer reaction decreased with increasing pH, ionic strength and concentration of glucose. Saturating concentrations of glucose did not bring about complete dissociation of the enzyme showing that both sites were occupired in the dimer. At pH 8.0 and high ionic strength, where the enzyme existed as monomer, the dissociation constant of the enzyme-glucose complex was 3 X 10(-4) mol 1(-1) and was independent of the concentration of enzyme. Binding to the dimeric form at low pH and ionic strength (I=0.02 mol 1(-1), pH less than 7.5) was also independent of enzyme concentration (in the range 10-1000 mug ml-1) but was much weaker. The process could be described by a single dissociation constant, showing that the two available sites on the dimer were equivalent and non-cooperative; values of the intrinsic dissociation constant varied from 2.5 X 10(-3) mol 1(-1) at pH 7.0 to 6 X 10(-3) at pH 6.5. Under intermediate conditions (pH 7.0, ionic strength=0.15 mol 1(-1)), where monomer and dimer coexisted, the binding of glucose showed weak positive cooperatively (Hill coefficient 1.2); in addition, the binding was dependent upon the concentration of enzyme in the direction of stronger binding at lower concentrations. The results show that the phenomenon of half-sites reactivity observed in the binding of glucose to crystalline hexokinase P-II does not occur in solution; the simplest explanation of our finding the two sites to be equivalent is that the dimer results from the homologous association of two identical subunits.
Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.
2013-01-01
Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386
Human adenosine A2A receptor binds calmodulin with high affinity in a calcium-dependent manner.
Piirainen, Henni; Hellman, Maarit; Tossavainen, Helena; Permi, Perttu; Kursula, Petri; Jaakola, Veli-Pekka
2015-02-17
Understanding how ligands bind to G-protein-coupled receptors and how binding changes receptor structure to affect signaling is critical for developing a complete picture of the signal transduction process. The adenosine A2A receptor (A2AR) is a particularly interesting example, as it has an exceptionally long intracellular carboxyl terminus, which is predicted to be mainly disordered. Experimental data on the structure of the A2AR C-terminus is lacking, because published structures of A2AR do not include the C-terminus. Calmodulin has been reported to bind to the A2AR C-terminus, with a possible binding site on helix 8, next to the membrane. The biological meaning of the interaction as well as its calcium dependence, thermodynamic parameters, and organization of the proteins in the complex are unclear. Here, we characterized the structure of the A2AR C-terminus and the A2AR C-terminus-calmodulin complex using different biophysical methods, including native gel and analytical gel filtration, isothermal titration calorimetry, NMR spectroscopy, and small-angle X-ray scattering. We found that the C-terminus is disordered and flexible, and it binds with high affinity (Kd = 98 nM) to calmodulin without major conformational changes in the domain. Calmodulin binds to helix 8 of the A2AR in a calcium-dependent manner that can displace binding of A2AR to lipid vesicles. We also predicted and classified putative calmodulin-binding sites in a larger group of G-protein-coupled receptors. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Smith, Donald F; Dyve, Suzan; Minuzzi, Luciano; Jakobsen, Steen; Munk, Ole L; Marthi, Katalin; Cumming, Paul
2006-06-15
We have developed [(11)C]mirtazapine as a ligand for PET studies of antidepressant binding in living brain. However, previous studies have determined neither optimal methods for quantification of [(11)C]mirtazapine binding nor the pharmacological identity of this binding. To obtain that information, we have now mapped the distribution volume (V(d)) of [(11)C]mirtazapine relative to the arterial input in the brain of three pigs, in a baseline condition and after pretreatment with excess cold mirtazapine (3 mg/kg). Baseline V(d) ranged from 6 ml/ml in cerebellum to 18 ml/ml in frontal cortex, with some evidence for a small self-displaceable binding component in the cerebellum. Regional binding potentials (pBs) obtained by a constrained two-compartment model, using the V(d) observation in cerebellum, were consistently higher than pBs obtained by other arterial input or reference tissue methods. We found that adequate quantification of pB was obtained using the simplified reference tissue method. Concomitant PET studies with [(15)O]-water indicated that mirtazapine challenge increased CBF uniformly in cerebellum and other brain regions, supporting the use of this reference tissue for calculation of [(11)C]mirtazapine pB. Displacement by mirtazapine was complete in the cerebral cortex, but only 50% in diencephalon, suggesting the presence of multiple binding sites of differing affinities in that tissue. Competition studies with yohimbine and RX 821002 showed decreases in [(11)C]mirtazapine pB throughout the forebrain; use of the multireceptor version of the Michaelis-Menten equation indicated that 42% of [(11)C]mirtazapine binding in cortical regions is displaceable by yohimbine. Thus, PET studies confirm that [(11)C]mirtazapine affects alpha(2)-adrenoceptor binding sites in living brain. (c) 2006 Wiley-Liss, Inc.
Karki, Pratap; Webb, Anton; Smith, Keisha; Lee, Kyuwon; Son, Deok-Soo; Aschner, Michael; Lee, Eunsook
2013-01-01
Tamoxifen (TX), a selective estrogen receptor modulator, exerts antagonistic effects on breast tissue and is used to treat breast cancer. Recent evidence also suggests that it may act as an agonist in brain tissue. We reported previously that TX enhanced the expression and function of glutamate transporter 1 (GLT-1) in rat astrocytes, an effect that was mediated by TGF-α. To gain further insight into the mechanisms that mediate TX-induced up-regulation of GLT-1 (EAAT2 in humans), we investigated its effect on GLT-1 at the transcriptional level. TX phosphorylated the cAMP response element-binding protein (CREB) and recruited CREB to the GLT-1 promoter consensus site. The effect of TX on astrocytic GLT-1 was attenuated by the inhibition of PKA, the upstream activator of the CREB pathway. In addition, the effect of TX on GLT-1 promoter activity was abolished by the inhibition of the NF-κB pathway. Furthermore, TX recruited the NF-κB subunits p65 and p50 to the NF-κB binding domain of the GLT-1 promoter. Mutation of NF-κB (triple, −583/-282/-251) or CRE (-308) sites on the GLT-1 promoter led to significant repression of the promoter activity, but neither mutant completely abolished the TX-induced GLT-1 promoter activity. Mutation of both the NF-κB (-583/-282/-251) and CRE (-308) sites led to a complete abrogation of the effect of TX on GLT-1 promoter activity. Taken together, our findings establish that TX regulates GLT-1 via the CREB and NF-κB pathways. PMID:23955341
Usui, Daiki; Inaba, Satomi; Kamatari, Yuji O; Ishiguro, Naotaka; Oda, Masayuki
2017-09-02
The monoclonal antibody, G2, specifically binds to the immunogen peptide derived from the chicken prion protein, Pep18mer, and two chicken proteins derived peptides, Pep8 and Pep395; G2 binds with equal affinity to Pep18mer. The amino acid sequences of the three peptides are completely different, and so the recognition mechanism of G2 is unique and interesting. We generated a single-chain Fv (scFv) antibody of G2, and demonstrated its correct folding with an antigen binding function similar to intact G2 antibody. We also generated a Pro containing mutant of G2 scFv at residue 95 of the light chain, and analyzed its antigen binding using a surface plasmon biosensor. The mutant lost its binding ability to Pep18mer, but remained those to Pep8 and Pep395. The results clearly indicate residue 95 as being critical for multispecific antigen binding of G2 at the site generated from the junctional diversity introduced at the joints between the V and J gene segments. Copyright © 2017 Elsevier Inc. All rights reserved.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.
Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L
1997-03-11
We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.
Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok
2017-07-01
Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.
2005-01-01
The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less
Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*
Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei
2015-01-01
The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883
Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L
2013-07-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.
Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.
2013-01-01
The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967
Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordonez, E.; Thiyagarajan, S.; Cook, J.D.
2009-05-22
Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less
NASA Astrophysics Data System (ADS)
Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong
2013-08-01
The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rothman, R.B.; Jacobson, A.E.; Rice, K.C.
1987-11-01
Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suranyi-Cadotte, B.E.; Quirion, R.; Nair, N.P.V.
1985-02-25
Uptake of serotonin and /sup 3/H-imipramine binding in platelets of depressed patients were investigated simultaneously with changes in clinical state. Both V/sub max/ for serotonin uptake and B/sub max/ for /sup 3/H-imipramine binding were significantly lower in unmedicated depressed patients with respect to normal subjects. Successful treatment with imipramine led to a significant increase in B/sub max/ for /sup 3/H-imipramine binding, without significant change in V/sub max/ for serotonin uptake. B/sub max/ values increased to the normal range following complete, rather than partial clinical improvement. These data indicate that successful antidepressant treatment may increase the density of /sup 3/H-imipramine bindingmore » sites on platelets by a process which is independent of the uptake of serotonin. 29 references, 1 table.« less
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh
2013-01-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101
Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.
Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh
2013-09-01
Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.
Alqarni, Mohammed; Myint, Kyaw Zeyar; Tong, Qin; Yang, Peng; Bartlow, Patrick; Wang, Lirong; Feng, Rentian; Xie, Xiang-Qun
2014-09-26
We performed molecular modeling and docking to predict a putative binding pocket and associated ligand-receptor interactions for human cannabinoid receptor 2 (CB2). Our data showed that two hydrophobic residues came in close contact with three structurally distinct CB2 ligands: CP-55,940, SR144528 and XIE95-26. Site-directed mutagenesis experiments and subsequent functional assays implicated the roles of Valine residue at position 3.32 (V113) and Leucine residue at position 5.41 (L192) in the ligand binding function and downstream signaling activities of the CB2 receptor. Four different point mutations were introduced to the wild type CB2 receptor: V113E, V113L, L192S and L192A. Our results showed that mutation of Val113 with a Glutamic acid and Leu192 with a Serine led to the complete loss of CB2 ligand binding as well as downstream signaling activities. Substitution of these residues with those that have similar hydrophobic side chains such as Leucine (V113L) and Alanine (L192A), however, allowed CB2 to retain both its ligand binding and signaling functions. Our modeling results validated by competition binding and site-directed mutagenesis experiments suggest that residues V113 and L192 play important roles in ligand binding and downstream signaling transduction of the CB2 receptor. Copyright © 2014 Elsevier Inc. All rights reserved.
Nelson, Kjell E.; Foley, Jennifer O.; Yager, Paul
2008-01-01
We describe a novel microfluidic immunoassay method based on the diffusion of a small molecule analyte into a parallel-flowing stream containing cognate antibody. This interdiffusion results in a steady-state gradient of antibody binding site occupancy transverse to convective flow. In contrast to the diffusion immunoassay (Hatch et al. Nature Biotechnology,19:461−465 (2001)), this antibody occupancy gradient is interrogated by a sensor surface coated with a functional analog of the analyte. Antibodies with at least one unoccupied binding site may specifically bind to this functionalized surface, leading to a quantifiable change in surface coverage by the antibody. SPR imaging is used to probe the spatial distribution of antibody binding to the surface and, therefore, the outcome of the assay. We show that the pattern of antibody binding to the SPR sensing surface correlates with the concentration of a model analyte (phenytoin) in the sample stream. Using an inexpensive disposable microfluidic device, we demonstrate assays for phenytoin ranging in concentration from 75 to 1000 nM in phosphate buffer. At a total volumetric flow rate of 90 nL/sec, the assays are complete within 10 minutes. Inclusion of an additional flow stream on the side of the antibody stream opposite to that of the sample enables simultaneous calibration of the assay. This assay method is suitable for rapid quantitative detection of low-molecular weight analytes for point-of-care diagnostic instrumentation. PMID:17437332
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Prediction of Water Binding to Protein Hydration Sites with a Discrete, Semiexplicit Solvent Model.
Setny, Piotr
2015-12-08
Buried water molecules are ubiquitous in protein structures and are found at the interface of most protein-ligand complexes. Determining their distribution and thermodynamic effect is a challenging yet important task, of great of practical value for the modeling of biomolecular structures and their interactions. In this study, we present a novel method aimed at the prediction of buried water molecules in protein structures and estimation of their binding free energies. It is based on a semiexplicit, discrete solvation model, which we previously introduced in the context of small molecule hydration. The method is applicable to all macromolecular structures described by a standard all-atom force field, and predicts complete solvent distribution within a single run with modest computational cost. We demonstrate that it indicates positions of buried hydration sites, including those filled by more than one water molecule, and accurately differentiates them from sterically accessible to water but void regions. The obtained estimates of water binding free energies are in fair agreement with reference results determined with the double decoupling method.
Domain repertoires as a tool to derive protein recognition rules.
Zucconi, A; Panni, S; Paoluzi, S; Castagnoli, L; Dente, L; Cesareni, G
2000-08-25
Several approaches, some of which are described in this issue, have been proposed to assemble a complete protein interaction map. These are often based on high throughput methods that explore the ability of each gene product to bind any other element of the proteome of the organism. Here we propose that a large number of interactions can be inferred by revealing the rules underlying recognition specificity of a small number (a few hundreds) of families of protein recognition modules. This can be achieved through the construction and characterization of domain repertoires. A domain repertoire is assembled in a combinatorial fashion by allowing each amino acid position in the binding site of a given protein recognition domain to vary to include all the residues allowed at that position in the domain family. The repertoire is then searched by phage display techniques with any target of interest and from the primary structure of the binding site of the selected domains one derives rules that are used to infer the formation of complexes between natural proteins in the cell.
Abou-Zied, Osama K
2015-01-01
Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.
Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.
Pikler, G M; Webster, R A; Spelsberg, T C
1976-01-01
Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147
Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo
NASA Astrophysics Data System (ADS)
Schwartz, Rochelle D.; Kellar, Kenneth J.
1983-04-01
Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.
Substance P binding sites in the nucleus tractus solitarius of the cat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maley, B.E.; Sasek, C.A.; Seybold, V.S.
1988-11-01
Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less
Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun
2018-06-16
Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.
Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.
1991-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985
Conformational flexibility of DENV NS2B/NS3pro: from the inhibitor effect to the serotype influence
NASA Astrophysics Data System (ADS)
Piccirillo, Erika; Merget, Benjamin; Sotriffer, Christoph A.; do Amaral, Antonia T.
2016-03-01
The dengue virus (DENV) has four well-known serotypes, namely DENV1 to DENV4, which together cause 50-100 million infections worldwide each year. DENV NS2B/NS3pro is a protease recognized as a valid target for DENV antiviral drug discovery. However, NS2B/NS3pro conformational flexibility, involving in particular the NS2B region, is not yet completely understood and, hence, a big challenge for any virtual screening (VS) campaign. Molecular dynamics (MD) simulations were performed in this study to explore the DENV3 NS2B/NS3pro binding-site flexibility and obtain guidelines for further VS studies. MD simulations were done with and without the Bz-nKRR-H inhibitor, showing that the NS2B region stays close to the NS3pro core even in the ligand-free structure. Binding-site conformational states obtained from the simulations were clustered and further analysed using GRID/PCA, identifying four conformations of potential importance for VS studies. A virtual screening applied to a set of 31 peptide-based DENV NS2B/NS3pro inhibitors, taken from literature, illustrated that selective alternative pharmacophore models can be constructed based on conformations derived from MD simulations. For the first time, the NS2B/NS3pro binding-site flexibility was evaluated for all DENV serotypes using homology models followed by MD simulations. Interestingly, the number of NS2B/NS3pro conformational states differed depending on the serotype. Binding-site differences could be identified that may be crucial to subsequent VS studies.
Di Scala, Coralie; Fantini, Jacques
2017-01-01
In eukaryotic cells, cholesterol is an important regulator of a broad range of membrane proteins, including receptors, transporters, and ion channels. Understanding how cholesterol interacts with membrane proteins is a difficult task because structural data of these proteins complexed with cholesterol are scarce. Here, we describe a dual approach based on in silico studies of protein-cholesterol interactions, combined with physico-chemical measurements of protein insertion into cholesterol-containing monolayers. Our algorithm is validated through careful analysis of the effect of key mutations within and outside the predicted cholesterol-binding site. Our method is illustrated by a complete analysis of cholesterol-binding to Alzheimer's β-amyloid peptide, a protein that penetrates the plasma membrane of brain cells through a cholesterol-dependent process.
Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G
1992-05-05
Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Kawasaki, Kazuyoshi; Ogawa, Seturou
2003-01-01
NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.
A molecular dynamics study of chloride binding by the cryptand SC24
NASA Technical Reports Server (NTRS)
Owenson, B.; MacElroy, R. D.; Pohorille, A.
1988-01-01
The capture of chloride from water by the tetraprotonated form of the spherical macrotricyclic molecule SC24 was studied using molecular dynamics simulation methods. This model ionophore represents a broad class of molecules which remove ions from water. Two binding sites for the chloride were found, one inside and one outside the ligand. These sites are separated by a potential energy barrier of approximately 20 kcal mol-1. The major contribution to this barrier comes from dehydration of the chloride. The large, unfavorable dehydration effect is compensated for by an increase in electrostatic attraction between the oppositely charged chloride and cryptand, and by energetically favorable rearrangements of water structure. Additional assistance in crossing the barrier and completing the dehydration of the ion is provided by the shift of three positively charged hydrogen atoms of the cryptand towards the chloride. This structural rigidity is partially responsible for its selectivity.
Furutani, Shogo; Okuhara, Daiki; Hashimoto, Anju; Ihara, Makoto; Kai, Kenji; Hayashi, Hideo; Sattelle, David B; Matsuda, Kazuhiko
2017-10-01
Okaramines produced by Penicillium simplicissimum AK-40 activate l-glutamate-gated chloride channels (GluCls) and thus paralyze insects. However, the okaramine binding site on insect GluCls is poorly understood. Sequence alignment shows that the equivalent of residue Leucine319 of the okaramine B sensitive Bombyx mori (B. mori) GluCl is a phenylalanine in the okaramine B insensitive B. mori γ-aminobutyric acid-gated chloride channel of the same species. This residue is located in the third transmembrane (TM3) region, a location which in a nematode GluCl is close to the ivermectin binding site. The B. mori GluCl containing the L319F mutation retained its sensitivity to l-glutamate, but responses to ivermectin were reduced and those to okaramine B were completely blocked.
CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.
Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar
2017-09-01
Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Kongpichitchoke, Teeradate; Hsu, Jue-Liang; Huang, Tzou-Chi
2015-05-13
Although flavonoids have been reported for their benefits and nutraceutical potential use, the importance of their structure on their beneficial effects, especially on signal transduction mechanisms, has not been well clarified. In this study, three flavonoids, pinocembrin, naringenin, and eriodictyol, were chosen to determine the effect of hydroxyl groups on the B-ring of flavonoid structure on their antioxidant activity. In vitro assays, including DPPH scavenging activity, ROS quantification by flow cytometer, and proteins immunoblotting, and in silico analysis by molecular docking between the flavonoids and C1B domain of PKCδ phorbol ester binding site were both used to complete this study. Eriodictyol (10 μM), containing two hydroxyl groups on the B-ring, exhibited significantly higher (p < 0.05) antioxidant activity than pinocembrin and naringenin. The IC50 values of eriodictyol, naringenin, and pinocembrin were 17.4 ± 0.40, 30.2 ± 0.61, and 44.9 ± 0.57 μM, respectively. In addition, eriodictyol at 10 μM remarkably inhibited the phosphorylation of PKCδ at 63.4% compared with PMA-activated RAW264.7, whereas pinocembrin and naringenin performed inhibition activity at 76.8 and 72.6%, respectively. According to the molecular docking analysis, pinocembrin, naringenin, and eriodictyol showed -CDOCKER_energy values of 15.22, 16.95, and 21.49, respectively, reflecting that eriodictyol could bind with the binding site better than the other two flavonoids. Interestingly, eriodictyol had a remarkably different pose to bind with the kinase as a result of the two hydroxyl groups on its B-ring, which consequently contributed to greater antioxidant activity over pinocembrin and naringenin.
Chang, F. N.; Flaks, Joel G.
1972-01-01
The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236
Competitive folding of RNA structures at a termination–antitermination site
Ait-Bara, Soraya; Clerté, Caroline; Declerck, Nathalie; Margeat, Emmanuel
2017-01-01
Antitermination is a regulatory process based on the competitive folding of terminator–antiterminator structures that can form in the leader region of nascent transcripts. In the case of the Bacillus subtilis licS gene involved in β-glucosides utilization, the binding of the antitermination protein LicT to a short RNA hairpin (RAT) prevents the formation of an overlapping terminator and thereby allows transcription to proceed. Here, we monitored in vitro the competition between termination and antitermination by combining bulk and single-molecule fluorescence-based assays using labeled RNA oligonucleotide constructs of increasing length that mimic the progressive transcription of the terminator invading the antiterminator hairpin. Although high affinity binding is abolished as soon as the antiterminator basal stem is disrupted by the invading terminator, LicT can still bind and promote closing of the partially unfolded RAT hairpin. However, binding no longer occurs once the antiterminator structure has been disrupted by the full-length terminator. Based on these findings, we propose a kinetic competition model for the sequential events taking place at the termination–antitermination site, where LicT needs to capture its RAT target before completion of the terminator to remain tightly bound during RNAP pausing, before finally dissociating irreversibly from the elongated licS transcript. PMID:28235843
Cutró, Andrea C; Montich, Guillermo; Roveri, Oscar A
2015-02-01
Phloretin is a known modifier of the internal dipole potential of lipid membranes. We studied the interaction of phloretin with model lipid membranes and how it influences the membrane dipole organization using ANS as fluorescent probe. The fluorescence increase observed when ANS binds to DMPC liposomes in gel phase (13 °C) was 2.5 times larger in the presence of phloretin. This effect was due to an increase in ANS affinity, which can be related to the known capability of phloretin in decreasing the dipole potential. Conversely, when the experiments were carried out at 33 °C (liquid crystalline phase), phloretin completely inhibited the increase in ANS fluorescence. In addition, phloretin only affected the electrical properties of the membrane in the gel phase, whereas it modifies structural ones in the liquid-crystalline state. We postulate that phloretin was bound only to the DMPC interface in the gel phase decreasing the surface negative charge density without modifying the structural properties of the ANS binding sites. In the liquid-crystalline phase instead, it increased the accessibility of water to the ANS binding sites decreasing the intrinsic affinity and the fluorescence quantum yield of ANS.
Zinc-mediated Allosteric Inhibition of Caspase-6*
Velázquez-Delgado, Elih M.; Hardy, Jeanne A.
2012-01-01
Zinc and caspase-6 have independently been implicated in several neurodegenerative disorders. Depletion of zinc intracellularly leads to apoptosis by an unknown mechanism. Zinc inhibits cysteine proteases, including the apoptotic caspases, leading to the hypothesis that zinc-mediated inhibition of caspase-6 might contribute to its regulation in a neurodegenerative context. Using inductively coupled plasma optical emission spectroscopy, we observed that caspase-6 binds one zinc per monomer, under the same conditions where the zinc leads to complete loss of enzymatic activity. To understand the molecular details of zinc binding and inhibition, we performed an anomalous diffraction experiment above the zinc edge. The anomalous difference maps showed strong 5σ peaks, indicating the presence of one zinc/monomer bound at an exosite distal from the active site. Zinc was not observed bound to the active site. The zinc in the exosite was liganded by Lys-36, Glu-244, and His-287 with a water molecule serving as the fourth ligand, forming a distorted tetrahedral ligation sphere. This exosite appears to be unique to caspase-6, as the residues involved in zinc binding were not conserved across the caspase family. Our data suggest that binding of zinc at the exosite is the primary route of inhibition, potentially locking caspase-6 into the inactive helical conformation. PMID:22891250
Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine
Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.
2015-01-01
Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408
Molecular basis for the Kallmann syndrome-linked fibroblast growth factor receptor mutation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thurman, Ryan D.; Kathir, Karuppanan Muthusamy; Rajalingam, Dakshinamurthy
Highlights: Black-Right-Pointing-Pointer The structural basis of the Kallmann syndrome is elucidated. Black-Right-Pointing-Pointer Kallmann syndrome mutation (A168S) induces a subtle conformational change(s). Black-Right-Pointing-Pointer Structural interactions mediated by beta-sheet G are most perturbed. Black-Right-Pointing-Pointer Ligand (FGF)-receptor interaction(s) is completely abolished by Kallmann mutation. Black-Right-Pointing-Pointer Kallmann mutation directly affects the FGF signaling process. -- Abstract: Kallmann syndrome (KS) is a developmental disease that expresses in patients as hypogonadotropic hypogonadism and anosmia. KS is commonly associated with mutations in the extracellular D2 domain of the fibroblast growth factor receptor (FGFR). In this study, for the first time, the molecular basis for the FGFR associatedmore » KS mutation (A168S) is elucidated using a variety of biophysical experiments, including multidimensional NMR spectroscopy. Secondary and tertiary structural analysis using far UV circular dichroism, fluorescence and limited trypsin digestion assays suggest that the KS mutation induces subtle tertiary structure change in the D2 domain of FGFR. Results of isothermal titration calorimetry experiments show the KS mutation causes a 10-fold decrease in heparin binding affinity and also a complete loss in ligand (FGF-1) binding. {sup 1}H-{sup 15}N chemical perturbation data suggest that complete loss in the ligand (FGF) binding affinity is triggered by a subtle conformational change that disrupts crucial structural interactions in both the heparin and the FGF binding sites in the D2 domain of FGFR. The novel findings reported in this study are expected to provide valuable clues toward a complete understanding of the other genetic diseases linked to mutations in the FGFR.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Poat, J.A.; Cripps, H.E.; Iversen, L.L.
1988-05-01
Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less
Nakashige, Toshiki G; Stephan, Jules R; Cunden, Lisa S; Brophy, Megan Brunjes; Wommack, Andrew J; Keegan, Brenna C; Shearer, Jason M; Nolan, Elizabeth M
2016-09-21
Human calprotectin (CP, S100A8/S100A9 oligomer, MRP-8/MRP-14 oligomer) is an abundant host-defense protein that is involved in the metal-withholding innate immune response. CP coordinates a variety of divalent first-row transition metal ions, which is implicated in its antimicrobial function, and its ability to sequester nutrient Zn(II) ions from microbial pathogens has been recognized for over two decades. CP has two distinct transition-metal-binding sites formed at the S100A8/S100A9 dimer interface, including a histidine-rich site composed of S100A8 residues His17 and His27 and S100A9 residues His91 and His95. In this study, we report that CP binds Zn(II) at this site using a hexahistidine motif, completed by His103 and His105 of the S100A9 C-terminal tail and previously identified as the high-affinity Mn(II) and Fe(II) coordination site. Zn(II) binding at this unique site shields the S100A9 C-terminal tail from proteolytic degradation by proteinase K. X-ray absorption spectroscopy and Zn(II) competition titrations support the formation of a Zn(II)-His6 motif. Microbial growth studies indicate that the hexahistidine motif is important for preventing microbial Zn(II) acquisition from CP by the probiotic Lactobacillus plantarum and the opportunistic human pathogen Candida albicans. The Zn(II)-His6 site of CP expands the known biological coordination chemistry of Zn(II) and provides new insight into how the human innate immune system starves microbes of essential metal nutrients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCann, D.J.; Su, T.P.
1991-05-01
The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less
Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.
Suzuki, N; Mihashi, K
1991-01-01
The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthin, G.R.; Wolfe, B.B.
The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less
Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H
1997-02-28
The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
Atg9 establishes Atg2-dependent contact sites between the endoplasmic reticulum and phagophores.
Gómez-Sánchez, Rubén; Rose, Jaqueline; Guimarães, Rodrigo; Mari, Muriel; Papinski, Daniel; Rieter, Ester; Geerts, Willie J; Hardenberg, Ralph; Kraft, Claudine; Ungermann, Christian; Reggiori, Fulvio
2018-05-30
The autophagy-related (Atg) proteins play a key role in the formation of autophagosomes, the hallmark of autophagy. The function of the cluster composed by Atg2, Atg18, and transmembrane Atg9 is completely unknown despite their importance in autophagy. In this study, we provide insights into the molecular role of these proteins by identifying and characterizing Atg2 point mutants impaired in Atg9 binding. We show that Atg2 associates to autophagosomal membranes through lipid binding and independently from Atg9. Its interaction with Atg9, however, is key for Atg2 confinement to the growing phagophore extremities and subsequent association of Atg18. Assembly of the Atg9-Atg2-Atg18 complex is important to establish phagophore-endoplasmic reticulum (ER) contact sites. In turn, disruption of the Atg2-Atg9 interaction leads to an aberrant topological distribution of both Atg2 and ER contact sites on forming phagophores, which severely impairs autophagy. Altogether, our data shed light in the interrelationship between Atg9, Atg2, and Atg18 and highlight the possible functional relevance of the phagophore-ER contact sites in phagophore expansion. © 2018 Gómez-Sánchez et al.
Existence of three subtypes of bradykinin B2 receptors in guinea pig.
Seguin, L; Widdowson, P S; Giesen-Crouse, E
1992-12-01
We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)
Denys, A; Allain, F; Carpentier, M; Spik, G
1998-12-15
Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.
Nguyen, T V; Juorio, A V
1989-10-01
The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.
Impact of germline and somatic missense variations on drug binding sites.
Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R
2017-03-01
Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valley, Cary T.; Porter, Douglas F.; Qiu, Chen
2012-06-28
mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.
Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A
2011-05-31
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dissanayake, V.U.; Hughes, J.; Hunter, J.C.
The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less
Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki
2018-06-01
Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
McCorkle, Sean R; McCombie, WR; Dunn, John J
2011-01-01
Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205
Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph
2015-01-01
Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that ‘close’ the active site play an important role in the assembly of a catalytically competent condensation active site. CS from the thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an ‘open’ structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site–tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS. PMID:26457521
Identification of an inhibitory Zn2+ binding site on the human glycine receptor α1 subunit
Harvey, Robert J; Thomas, Philip; James, Colin H; Wilderspin, Andrew; Smart, Trevor G
1999-01-01
Whole-cell glycine-activated currents were recorded from human embryonic kidney (HEK) cells expressing wild-type and mutant recombinant homomeric glycine receptors (GlyRs) to locate the inhibitory binding site for Zn2+ ions on the human α1 subunit. Glycine-activated currents were potentiated by low concentrations of Zn2+ (<10 μm) and inhibited by higher concentrations (>100 μm) on wild-type α1 subunit GlyRs. Lowering the external pH from 7.4 to 5.4 inhibited the glycine responses in a competitive manner. The inhibition caused by Zn2+ was abolished leaving an overt potentiating effect at 10 μm Zn2+ that was exacerbated at 100 μm Zn2+. The identification of residues involved in the formation of the inhibitory binding site was also assessed using diethylpyrocarbonate (DEPC), which modifies histidines. DEPC (1 mm) abolished Zn2+-induced inhibition and also the potentiation of glycine-activated currents by Zn2+. The reduction in glycine-induced whole-cell currents in the presence of high (100 μm) concentrations of Zn2+ did not increase the rate of glycine receptor desensitisation. Systematic mutation of extracellular histidine residues in the GlyR α1 subunit revealed that mutations H107A or H109A completely abolished inhibition of glycine-gated currents by Zn2+. However, mutation of other external histidines, H210, H215 and H419, failed to prevent inhibition by Zn2+ of glycine-gated currents. Thus, H107 and H109 in the extracellular domain of the human GlyR α1 subunit are major determinants of the inhibitory Zn2+ binding site. An examination of Zn2+ co-ordination in metalloenzymes revealed that the histidine- hydrophobic residue-histidine motif found to be responsible for binding Zn2+ in the human GlyR α1 subunit is also shared by some of these enzymes. Further comparison of the structure and location of this motif with a generic model of the GlyR α1 subunit suggests that H107 and H109 participate in the formation of the inhibitory Zn2+ binding site at the apex of a β sheet in the N-terminal extracellular domain. PMID:10517800
Podjarny, A; Cachau, R E; Schneider, T; Van Zandt, M; Joachimiak, A
2004-04-01
The determination of several of aldose reductase-inhibitor complexes at subatomic resolution has revealed new structural details, including the specific interatomic contacts involved in inhibitor binding. In this article, we review the structures of the complexes of ALR2 with IDD 594 (resolution: 0.66 angstrom, IC50 (concentration of the inhibitor that produced half-maximal effect): 30 nM, space group: P2(1)), IDD 393 (resolution: 0.90 angstrom, IC50: 6 nM, space group: P1), fidarestat (resolution: 0.92 angstrom, IC50: 9 nM, space group: P2(1)) and minalrestat (resolution: 1.10 angstrom, IC50: 73 nM, space group: P1). The structures are compared and found to be highly reproductible within the same space group (root mean square (RMS) deviations: 0.15 approximately 0.3 angstrom). The mode of binding of the carboxylate inhibitors IDD 594 and IDD 393 is analysed. The binding of the carboxylate head can be accurately determined by the subatomic resolution structures, since both the protonation states and the positions of the atoms are very precisely known. The differences appear in the binding in the specificity pocket. The high-resolution structures explain the differences in IC50, which are confirmed both experimentally by mass spectrometry measures of VC50 and theoretically by free energy perturbation calculations. The binding of the cyclic imide inhibitors fidarestat and minalrestat is also described, focusing on the observation of a Cl(-) ion which binds simultaneously with fidarestat. The presence of this anion, binding also to the active site residue His110, leads to a mechanism in which the inhibitor can bind in a neutral state and then become charged inside the active site pocket. This mechanism can explain the excellent in vivo properties of cyclic imide inhibitors. In summary, the complete and detailed information supplied by the subatomic resolution structures can explain the differences in binding energy of the different inhibitors.
Interaction of a radiolabeled agonist with cardiac muscarinic cholinergic receptors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harden, T.K.; Meeker, R.B.; Martin, M.W.
The interaction of a radiolabeled muscarinic cholinergic receptor agonist, (methyl-/sup 3/H)oxotremorine acetate ((/sup 3/H)OXO), with a washed membrane preparation derived from rat heart, has been studied. In binding assays at 4 degrees C, the rate constants for association and dissociation of (/sup 3/H)OXO were 2 X 10(7) M-1 min-1 and 5 X 10(-3) min-1, respectively, Saturation binding isotherms indicated that binding was to a single population of sites with a Kd of approximately 300 pM. The density of (/sup 3/H)OXO binding sites (90-100 fmol/mg of protein) was approximately 75% of that determined for the radiolabeled receptor antagonist (/sup 3/H)quinuclidinyl benzilate.more » Both muscarinic receptor agonists and antagonists inhibited the binding of (/sup 3/H)OXO with high affinity and Hill slopes of approximately one. Guanine nucleotides completely inhibited the binding of (/sup 3/H)OXO. This effect was on the maximum binding (Bmax) of (/sup 3/H)OXO with no change occurring in the Kd; the order of potency for five nucleotides was guanosine 5'-O-(3-thio-triphosphate) greater than 5'-guanylylimidodiphosphate greater than GTP greater than or equal to guanosine/diphosphate greater than GMP. The (/sup 3/H)OXO-induced interaction of muscarinic receptors with a guanine nucleotide binding protein was stable to solubilization. That is, membrane receptors that were prelabeled with (/sup 3/H)OXO could be solubilized with digitonin, and the addition of guanine nucleotides to the soluble, (/sup 3/H)OXO-labeled complex resulted in dissociation of (/sup 3/H)OXO from the receptor. Pretreatment of membranes with relatively low concentrations of N-ethylmaleimide inhibited (/sup 3/H)OXO binding by 85% with no change in the Kd of (/sup 3/H)OXO, and with no effect on (/sup 3/H)quinuclidinyl benzilate binding.« less
Ethylene binding site affinity in ripening apples
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blankenship, S.M.; Sisler, E.C.
1993-09-01
Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less
NASA Technical Reports Server (NTRS)
D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.
2002-01-01
Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.
Functional identification and characterization of sodium binding sites in Na symporters
Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.
2013-01-01
Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baum, Bernhard; Lecker, Laura S. M.; Zoltner, Martin
Three crystal structures of recombinant P. aeruginosa FabF are reported: the apoenzyme, an active-site mutant and a complex with a fragment of a natural product inhibitor. The characterization provides reagents and new information to support antibacterial drug discovery. Bacterial infections remain a serious health concern, in particular causing life-threatening infections of hospitalized and immunocompromised patients. The situation is exacerbated by the rise in antibacterial drug resistance, and new treatments are urgently sought. In this endeavour, accurate structures of molecular targets can support early-stage drug discovery. Here, crystal structures, in three distinct forms, of recombinant Pseudomonas aeruginosa β-ketoacyl-(acyl-carrier-protein) synthase II (FabF)more » are presented. This enzyme, which is involved in fatty-acid biosynthesis, has been validated by genetic and chemical means as an antibiotic target in Gram-positive bacteria and represents a potential target in Gram-negative bacteria. The structures of apo FabF, of a C164Q mutant in which the binding site is altered to resemble the substrate-bound state and of a complex with 3-(benzoylamino)-2-hydroxybenzoic acid are reported. This compound mimics aspects of a known natural product inhibitor, platensimycin, and surprisingly was observed binding outside the active site, interacting with a symmetry-related molecule. An unusual feature is a completely buried potassium-binding site that was identified in all three structures. Comparisons suggest that this may represent a conserved structural feature of FabF relevant to fold stability. The new structures provide templates for structure-based ligand design and, together with the protocols and reagents, may underpin a target-based drug-discovery project for urgently needed antibacterials.« less
Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O
1995-01-01
Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.
Navé, Jean-François; Benveniste, Pierre
1984-01-01
The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499
Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris
2015-01-01
The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415
Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.
The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.
2003-06-01
OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally importantmore » for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sonders, M.S.; Barmettler, P.; Lee, J.A.
1990-04-25
A radiolabeled photoaffinity ligand has been developed for the N-methyl-D-aspartate (NMDA)-preferring excitatory amino acid receptor complex. (3H)3-Azido-(5S, 10R)(+)-5-methyl-10,11-dihydro-5H- dibenzo(a,d)cyclohepten-5,10-imine (3H)3-azido-MK-801 demonstrated nearly identical affinity, density of binding sites, selectivity, pH sensitivity, and pharmacological profile in reversible binding assays with guinea pig brain homogenates to those displayed by its parent compound, MK-801. When employed in a photo-labeling protocol designed to optimize specific incorporation, (3H)3-azido-MK-801 labeled a single protein band which migrated in sodium dodecyl sulfate-polyacrylamide gels with Mr = 120,000. Incorporation of tritium into this band was completely inhibited when homogenates and (3H)3-azido-MK-801 were coincubated with 10 microM phencyclidine. These datamore » suggest that the phencyclidine site of the NMDA receptor complex is at least in part comprised of a Mr = 120,000 polypeptide.« less
Autoradiographic localization of endothelin-1 binding sites in porcine skin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Y.D.; Springall, D.R.; Wharton, J.
Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less
Withey, Jeffrey H; DiRita, Victor J
2005-05-01
The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.
2004-10-28
We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Ito, Takeshi; Ninokura, Satoshi; Kitazumi, Yuki; Mezic, Katherine G.; Cress, Brady F.; Koffas, Mattheos A. G.; Morgan, Joel E.; Barquera, Blanca; Miyoshi, Hideto
2017-01-01
The Na+-pumping NADH-quinone oxidoreductase (Na+-NQR) is the first enzyme of the respiratory chain and the main ion transporter in many marine and pathogenic bacteria, including Vibrio cholerae. The V. cholerae Na+-NQR has been extensively studied, but its binding sites for ubiquinone and inhibitors remain controversial. Here, using a photoreactive ubiquinone PUQ-3 as well as two aurachin-type inhibitors [125I]PAD-1 and [125I]PAD-2 and photoaffinity labeling experiments on the isolated enzyme, we demonstrate that the ubiquinone ring binds to the NqrA subunit in the regions Leu-32–Met-39 and Phe-131–Lys-138, encompassing the rear wall of a predicted ubiquinone-binding cavity. The quinolone ring and alkyl side chain of aurachin bound to the NqrB subunit in the regions Arg-43–Lys-54 and Trp-23–Gly-89, respectively. These results indicate that the binding sites for ubiquinone and aurachin-type inhibitors are in close proximity but do not overlap one another. Unexpectedly, although the inhibitory effects of PAD-1 and PAD-2 were almost completely abolished by certain mutations in NqrB (i.e. G140A and E144C), the binding reactivities of [125I]PAD-1 and [125I]PAD-2 to the mutated enzymes were unchanged compared with those of the wild-type enzyme. We also found that photoaffinity labeling by [125I]PAD-1 and [125I]PAD-2, rather than being competitively suppressed in the presence of other inhibitors, is enhanced under some experimental conditions. To explain these apparently paradoxical results, we propose models for the catalytic reaction of Na+-NQR and its interactions with inhibitors on the basis of the biochemical and biophysical results reported here and in previous work. PMID:28298441
Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei
2012-01-01
Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Amato, R.J.; Largent, B.L.; Snowman, A.M.
1987-07-01
Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M
2013-03-19
Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.
Energetics of drug-DNA interactions.
Chaires, J B
1997-01-01
Understanding the thermodynamics of drug binding to DNA is of both practical and fundamental interest. The practical interest lies in the contribution that thermodynamics can make to the rational design process for the development of new DNA targeted drugs. Thermodynamics offer key insights into the molecular forces that drive complex formation that cannot be obtained by structural or computational studies alone. The fundamental interest in these interactions lies in what they can reveal about the general problems of parsing and predicting ligand binding free energies. For these problems, drug-DNA interactions offer several distinct advantages, among them being that the structures of many drug-DNA complexes are known at high resolution and that such structures reveal that in many cases the drug acts as a rigid body, with little conformational change upon binding. Complete thermodynamic profiles (delta G, delta H, delta S, delta Cp) for numerous drug-DNA interactions have been obtained, with the help of high-sensitivity microcalorimetry. The purpose of this article is to offer a perspective on the interpretation of these thermodynamics parameters, and in particular how they might be correlated with known structural features. Obligatory conformational changes in the DNA to accommodate intercalators and the loss of translational and rotational freedom upon complex formation both present unfavorable free energy barriers for binding. Such barriers must be overcome by favorable free energy contributions from the hydrophobic transfer of ligand from solution into the binding site, polyelectrolyte contributions from coupled ion release, and molecular interactions (hydrogen and ionic bonds, van der Waals interactions) that form within the binding site. Theoretical and semiempirical tools that allow estimates of these contributions to be made will be discussed, and their use in dissecting experimental data illustrated. This process, even at the current level of approximation, can shed considerable light on the drug-DNA binding process.
Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher
2009-01-01
GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890
Tam, S W; Cook, L
1984-01-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851
Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.
Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M
2007-05-01
The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu
2012-02-05
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lerch, Thomas F.; Chapman, Michael S.
2012-05-24
Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less
Location of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.
Locations of Bromide Ions in Tetragonal Lysozyme Crystals
NASA Technical Reports Server (NTRS)
Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.
1998-01-01
Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Discovering amino acid patterns on binding sites in protein complexes
Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng
2011-01-01
Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa
2013-01-01
Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.
Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin
Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.
2011-01-01
Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769
Stratton, Amanda; Ericksen, Matthew; Harris, Travis V; Symmonds, Nick; Silverstein, Todd P
2017-02-01
The toxicity of mercury is often attributed to its tight binding to cysteine thiolate anions in vital enzymes. To test our hypothesis that Hg(II) binding to histidine could be a significant factor in mercury's toxic effects, we studied the enzyme chymotrypsin, which lacks free cysteine thiols; we found that chymotrypsin is not only inhibited, but also denatured by Hg(II). We followed the aggregation of denatured enzyme by the increase in visible absorbance due to light scattering. Hg(II)-induced chymotrypsin precipitation increased dramatically above pH 6.5, and free imidazole inhibited this precipitation, implicating histidine-Hg(II) binding in the process of chymotrypsin denaturation/aggregation. Diethylpyrocarbonate (DEPC) blocked chymotrypsin's two histidines (his 40 and his 57 ) quickly and completely, with an IC 50 of 35 ± 6 µM. DEPC at 350 µM reduced the hydrolytic activity of chymotrypsin by 90%, suggesting that low concentrations of DEPC react with his 57 at the active site catalytic triad; furthermore, DEPC below 400 µM enhanced the Hg(II)-induced precipitation of chymotrypsin. We conclude that his 57 reacts readily with DEPC, causing enzyme inhibition and enhancement of Hg(II)-induced aggregation. Above 500 µM, DEPC inhibited Hg(II)-induced precipitation, and [DEPC] >2.5 mM completely protected chymotrypsin against precipitation. This suggests that his 40 reacts less readily with DEPC, and that chymotrypsin denaturation is caused by Hg(II) binding specifically to the his 40 residue. Finally, we show that Hg(II)-histidine binding may trigger hemoglobin aggregation as well. Because of results with these two enzymes, we suggest that metal-histidine binding may be key to understanding all heavy metal-induced protein aggregation. © 2017 The Protein Society.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.
Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.
Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes
Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte
2016-01-01
Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624
Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.
Dubois, B W; Cherian, S F; Evers, A S
1993-01-01
There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659
Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.
The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less
Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project.
Gerstein, Mark B; Lu, Zhi John; Van Nostrand, Eric L; Cheng, Chao; Arshinoff, Bradley I; Liu, Tao; Yip, Kevin Y; Robilotto, Rebecca; Rechtsteiner, Andreas; Ikegami, Kohta; Alves, Pedro; Chateigner, Aurelien; Perry, Marc; Morris, Mitzi; Auerbach, Raymond K; Feng, Xin; Leng, Jing; Vielle, Anne; Niu, Wei; Rhrissorrakrai, Kahn; Agarwal, Ashish; Alexander, Roger P; Barber, Galt; Brdlik, Cathleen M; Brennan, Jennifer; Brouillet, Jeremy Jean; Carr, Adrian; Cheung, Ming-Sin; Clawson, Hiram; Contrino, Sergio; Dannenberg, Luke O; Dernburg, Abby F; Desai, Arshad; Dick, Lindsay; Dosé, Andréa C; Du, Jiang; Egelhofer, Thea; Ercan, Sevinc; Euskirchen, Ghia; Ewing, Brent; Feingold, Elise A; Gassmann, Reto; Good, Peter J; Green, Phil; Gullier, Francois; Gutwein, Michelle; Guyer, Mark S; Habegger, Lukas; Han, Ting; Henikoff, Jorja G; Henz, Stefan R; Hinrichs, Angie; Holster, Heather; Hyman, Tony; Iniguez, A Leo; Janette, Judith; Jensen, Morten; Kato, Masaomi; Kent, W James; Kephart, Ellen; Khivansara, Vishal; Khurana, Ekta; Kim, John K; Kolasinska-Zwierz, Paulina; Lai, Eric C; Latorre, Isabel; Leahey, Amber; Lewis, Suzanna; Lloyd, Paul; Lochovsky, Lucas; Lowdon, Rebecca F; Lubling, Yaniv; Lyne, Rachel; MacCoss, Michael; Mackowiak, Sebastian D; Mangone, Marco; McKay, Sheldon; Mecenas, Desirea; Merrihew, Gennifer; Miller, David M; Muroyama, Andrew; Murray, John I; Ooi, Siew-Loon; Pham, Hoang; Phippen, Taryn; Preston, Elicia A; Rajewsky, Nikolaus; Rätsch, Gunnar; Rosenbaum, Heidi; Rozowsky, Joel; Rutherford, Kim; Ruzanov, Peter; Sarov, Mihail; Sasidharan, Rajkumar; Sboner, Andrea; Scheid, Paul; Segal, Eran; Shin, Hyunjin; Shou, Chong; Slack, Frank J; Slightam, Cindie; Smith, Richard; Spencer, William C; Stinson, E O; Taing, Scott; Takasaki, Teruaki; Vafeados, Dionne; Voronina, Ksenia; Wang, Guilin; Washington, Nicole L; Whittle, Christina M; Wu, Beijing; Yan, Koon-Kiu; Zeller, Georg; Zha, Zheng; Zhong, Mei; Zhou, Xingliang; Ahringer, Julie; Strome, Susan; Gunsalus, Kristin C; Micklem, Gos; Liu, X Shirley; Reinke, Valerie; Kim, Stuart K; Hillier, LaDeana W; Henikoff, Steven; Piano, Fabio; Snyder, Michael; Stein, Lincoln; Lieb, Jason D; Waterston, Robert H
2010-12-24
We systematically generated large-scale data sets to improve genome annotation for the nematode Caenorhabditis elegans, a key model organism. These data sets include transcriptome profiling across a developmental time course, genome-wide identification of transcription factor-binding sites, and maps of chromatin organization. From this, we created more complete and accurate gene models, including alternative splice forms and candidate noncoding RNAs. We constructed hierarchical networks of transcription factor-binding and microRNA interactions and discovered chromosomal locations bound by an unusually large number of transcription factors. Different patterns of chromatin composition and histone modification were revealed between chromosome arms and centers, with similarly prominent differences between autosomes and the X chromosome. Integrating data types, we built statistical models relating chromatin, transcription factor binding, and gene expression. Overall, our analyses ascribed putative functions to most of the conserved genome.
In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites
Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent
2017-01-01
In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biegon, A.; Rainbow, T.C.
1983-05-01
The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less
Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael
2017-01-01
The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023
Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors
NASA Astrophysics Data System (ADS)
Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír
2017-01-01
Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.
Dschietzig, Thomas; Bartsch, Cornelia; Wessler, Silja; Baumann, Gert; Stangl, Karl
2009-06-05
Relaxin peptides act in brain, reproductive and cardiovascular systems, kidneys, and connective tissue through different G protein-coupled receptors. We reported that human relaxin-2 and porcine relaxin are both agonists at the human glucocorticoid receptor (GR). Here, we investigated the possible auto-regulation of relaxin-2 gene expression via recently discovered GR-binding sites in the relaxin-2 promoter. We found that porcine relaxin increased the secretion of human relaxin-like immunoreactivity in HeLa and THP-1 cells. Silencing of GR gene expression completely abolished this effect whereas transfection of wild-type GR into naturally GR-devoid HT-29 cells established relaxin sensitivity. Relaxin was shown to stimulate CAT expression driven by different deletion constructs of the 5'-flanking region of the relaxin-2 promoter. In chromatin immunoprecipitation assays, we detected both GR and relaxin binding to the relaxin-2 promoter. Gel shift assays indicated binding of relaxin-activated GR to half-GREs located between 160 and 200 bp upstream of transcription start but not to the GRE at -900 bp. Relaxin bound to human GR and displaced established GR agonists. Immunofluorescence experiments visualized nuclear co-localization of relaxin and GR in response to relaxin. In conclusion, we have identified a positive auto-regulatory loop of human relaxin-2 expression which involves GR and relaxin/GR binding to half-GREs in the relaxin-2 promoter.
STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY
Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.
2008-01-01
The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palacios, J.M.; Chinaglia, G.; Rigo, M.
1991-02-01
Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less
Adipocyte iron regulates leptin and food intake
Gao, Yan; Li, Zhonggang; Gabrielsen, J. Scott; Simcox, Judith A.; Lee, Soh-hyun; Jones, Deborah; Cooksey, Bob; Stoddard, Gregory; Cefalu, William T.; McClain, Donald A.
2015-01-01
Dietary iron supplementation is associated with increased appetite. Here, we investigated the effect of iron on the hormone leptin, which regulates food intake and energy homeostasis. Serum ferritin was negatively associated with serum leptin in a cohort of patients with metabolic syndrome. Moreover, the same inverse correlation was observed in mice fed a high-iron diet. Adipocyte-specific loss of the iron exporter ferroportin resulted in iron loading and decreased leptin, while decreased levels of hepcidin in a murine hereditary hemochromatosis (HH) model increased adipocyte ferroportin expression, decreased adipocyte iron, and increased leptin. Treatment of 3T3-L1 adipocytes with iron decreased leptin mRNA in a dose-dependent manner. We found that iron negatively regulates leptin transcription via cAMP-responsive element binding protein activation (CREB activation) and identified 2 potential CREB-binding sites in the mouse leptin promoter region. Mutation of both sites completely blocked the effect of iron on promoter activity. ChIP analysis revealed that binding of phosphorylated CREB is enriched at these two sites in iron-treated 3T3-L1 adipocytes compared with untreated cells. Consistent with the changes in leptin, dietary iron content was also directly related to food intake, independently of weight. These findings indicate that levels of dietary iron play an important role in regulation of appetite and metabolism through CREB-dependent modulation of leptin expression. PMID:26301810
Stewart, J M; Blakely, J A; Karpowicz, P A; Kalanxhi, E; Thatcher, B J; Martin, B M
2004-03-01
We purified myoglobin from beluga whale (Delphinapterus leucas) muscle (longissimus dorsi) with size exclusion and cation exchange chromatographies. The molecular mass was determined by mass spectrometry (17,081 Da) and the isoelectric pH (9.4) by capillary isoelectric focusing. The near-complete amino acid sequence was determined and a phylogeny indicated that beluga was in the same clad as Dall's and harbor porpoises. There were consensus motifs for a phosphorylation site on the protein surface with the most likely site at serine-117. This motif was common to all cetacean myoglobins examined. Two oxygen-binding studies at 37 degrees C indicated dissociation constants (20.5 and 23.6 microM) 5.7-6.6 times larger than horse myoglobin (3.6 microM). The autoxidation rate of beluga myoglobin at 37 degrees C, pH 7.2 was 0.218+/-0.028 h(-1), 1/3 larger than reported for myoglobin of terrestrial mammals. There was no clear sequence change to explain the difference in oxygen binding or autoxidation although substitutions (N66 and T67) in an invariant rich sequence (HGNTV) distal to the heme may play a role. Structural models based on the protein sequence and constructed on topologies of known templates (horse and sperm whale crystal structures) were not adequate to assess perturbation of the heme pocket.
n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.
Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu
2014-01-01
We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.
High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them
Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha
2011-01-01
Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449
Wang, Han; Yu, Rui; Fang, Ting; Yu, Ting; Chi, Xiangyang; Zhang, Xiaopeng; Liu, Shuling; Fu, Ling; Yu, Changming; Chen, Wei
2016-09-11
Tetanus neurotoxin (TeNT) produced by Clostridium tetani is one of the most poisonous protein substances. Neutralizing antibodies against TeNT can effectively prevent and cure toxicosis. Using purified Hc fragments of TeNT (TeNT-Hc) as an antigen, three specific neutralizing antibody clones recognizing different epitopes were selected from a human immune scFv antibody phage display library. The three antibodies (2-7G, 2-2D, and S-4-7H) can effectively inhibit the binding between TeNT-Hc and differentiated PC-12 cells in vitro. Moreover, 2-7G inhibited TeNT-Hc binding to the receptor via carbohydrate-binding sites of the W pocket while 2-2D and S-4-7H inhibited binding of the R pocket. Although no single mAb completely protected mice from the toxin, they could both prolong survival when challenged with 20 LD50s (50% of the lethal dose) of TeNT. When used together, the mAbs completely neutralized 1000 LD50s/mg Ab, indicating their high neutralizing potency in vivo. Antibodies recognizing different carbohydrate-binding pockets could have higher synergistic toxin neutralization activities than those that recognize the same pockets. These results could lead to further production of neutralizing antibody drugs against TeNT and indicate that using TeNT-Hc as an antigen for screening human antibodies for TeNT intoxication therapy from human immune antibody library was convenient and effective.
Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R
1996-10-11
In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Binding Leverage as a Molecular Basis for Allosteric Regulation
Mitternacht, Simon; Berezovsky, Igor N.
2011-01-01
Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347
Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi
2016-12-15
The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.
2011-01-01
Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-01-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800
Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.
Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P
1998-11-01
The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.
Couture, Jean-François; Pereira De Jésus-Tran, Karine; Roy, Anne-Marie; Cantin, Line; Côté, Pierre-Luc; Legrand, Pierre; Luu-The, Van; Labrie, Fernand; Breton, Rock
2005-01-01
The aldo-keto reductase (AKR) human type 3 3α-hydroxysteroid dehydrogenase (h3α–HSD3, AKR1C2) plays a crucial role in the regulation of the intracellular concentrations of testosterone and 5α-dihydrotestosterone (5α-DHT), two steroids directly linked to the etiology and the progression of many prostate diseases and cancer. This enzyme also binds many structurally different molecules such as 4-hydroxynonenal, polycyclic aromatic hydrocarbons, and indanone. To understand the mechanism underlying the plasticity of its substrate-binding site, we solved the binary complex structure of h3α–HSD3-NADP(H) at 1.9 Å resolution. During the refinement process, we found acetate and citrate molecules deeply engulfed in the steroid-binding cavity. Superimposition of this structure with the h3α–HSD3-NADP(H)-testosterone/acetate ternary complex structure reveals that one of themobile loops forming the binding cavity operates a slight contraction movement against the citrate molecule while the side chains of many residues undergo numerous conformational changes, probably to create an optimal binding site for the citrate. These structural changes, which altogether cause a reduction of the substrate-binding cavity volume (from 776 Å3 in the presence of testosterone/acetate to 704 Å3 in the acetate/citratecomplex), are reminiscent of the “induced-fit” mechanism previously proposed for the aldose reductase, another member of the AKR superfamily. We also found that the replacement of residues Arg301 and Arg304, localized near the steroid-binding cavity, significantly affects the 3α–HSD activity of this enzyme toward 5α-DHT and completely abolishes its 17β–HSD activity on 4-dione. All these results have thus been used to reevaluate the binding mode of this enzyme for androgens. PMID:15929998
Position specific variation in the rate of evolution in transcription factor binding sites
Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B
2003-01-01
Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282
Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R
2003-01-01
Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471
Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.
Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F
1986-08-15
The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.
Sengupta, Raghuvir N.; Van Schie, Sabine N.S.; Giambaşu, George; Dai, Qing; Yesselman, Joseph D.; York, Darrin; Piccirilli, Joseph A.; Herschlag, Daniel
2016-01-01
Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such “off-pathway” species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2′- and 3′-deoxy (–H) and −amino (–NH2) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3′-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2′-OH making no interaction. Upon S binding, a rearrangement occurs that allows both –OH groups to contact a different active site metal ion, termed MC, to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. PMID:26567314
Sengupta, Raghuvir N; Van Schie, Sabine N S; Giambaşu, George; Dai, Qing; Yesselman, Joseph D; York, Darrin; Piccirilli, Joseph A; Herschlag, Daniel
2016-01-01
Biological catalysis hinges on the precise structural integrity of an active site that binds and transforms its substrates and meeting this requirement presents a unique challenge for RNA enzymes. Functional RNAs, including ribozymes, fold into their active conformations within rugged energy landscapes that often contain misfolded conformers. Here we uncover and characterize one such "off-pathway" species within an active site after overall folding of the ribozyme is complete. The Tetrahymena group I ribozyme (E) catalyzes cleavage of an oligonucleotide substrate (S) by an exogenous guanosine (G) cofactor. We tested whether specific catalytic interactions with G are present in the preceding E•S•G and E•G ground-state complexes. We monitored interactions with G via the effects of 2'- and 3'-deoxy (-H) and -amino (-NH(2)) substitutions on G binding. These and prior results reveal that G is bound in an inactive configuration within E•G, with the nucleophilic 3'-OH making a nonproductive interaction with an active site metal ion termed MA and with the adjacent 2'-OH making no interaction. Upon S binding, a rearrangement occurs that allows both -OH groups to contact a different active site metal ion, termed M(C), to make what are likely to be their catalytic interactions. The reactive phosphoryl group on S promotes this change, presumably by repositioning the metal ions with respect to G. This conformational transition demonstrates local rearrangements within an otherwise folded RNA, underscoring RNA's difficulty in specifying a unique conformation and highlighting Nature's potential to use local transitions of RNA in complex function. © 2015 Sengupta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Zhu, Qiyun; Biering, Scott B.; Mirza, Anne M.; Grasseschi, Brittany A.; Mahon, Paul J.; Lee, Benhur; Aguilar, Hector C.
2013-01-01
The promotion of membrane fusion by most paramyxoviruses requires an interaction between the viral attachment and fusion (F) proteins to enable receptor binding by the former to trigger the activation of the latter for fusion. Numerous studies demonstrate that the F-interactive sites on the Newcastle disease virus (NDV) hemagglutinin-neuraminidase (HN) and measles virus (MV) hemagglutinin (H) proteins reside entirely within the stalk regions of those proteins. Indeed, stalk residues of NDV HN and MV H that likely mediate the F interaction have been identified. However, despite extensive efforts, the F-interactive site(s) on the Nipah virus (NiV) G attachment glycoprotein has not been identified. In this study, we have introduced individual N-linked glycosylation sites at several positions spaced at intervals along the stalk of the NiV G protein. Five of the seven introduced sites are utilized as established by a retardation of electrophoretic mobility. Despite surface expression, ephrinB2 binding, and oligomerization comparable to those of the wild-type protein, four of the five added N-glycans completely eliminate the ability of the G protein to complement the homologous F protein in the promotion of fusion. The most membrane-proximal added N-glycan reduces fusion by 80%. However, unlike similar NDV HN and MV H mutants, the NiV G glycosylation stalk mutants retain the ability to bind F, indicating that the fusion deficiency of these mutants is not due to prevention of the G-F interaction. These findings suggest that the G-F interaction is not mediated entirely by the stalk domain of G and may be more complex than that of HN/H-F. PMID:23283956
Behera, Rabindra K; Theil, Elizabeth C
2014-06-03
Ferritin biominerals are protein-caged metabolic iron concentrates used for iron-protein cofactors and oxidant protection (Fe(2+) and O2 sequestration). Fe(2+) passage through ion channels in the protein cages, like membrane ion channels, required for ferritin biomineral synthesis, is followed by Fe(2+) substrate movement to ferritin enzyme (Fox) sites. Fe(2+) and O2 substrates are coupled via a diferric peroxo (DFP) intermediate, λmax 650 nm, which decays to [Fe(3+)-O-Fe(3+)] precursors of caged ferritin biominerals. Structural studies show multiple conformations for conserved, carboxylate residues E136 and E57, which are between ferritin ion channel exits and enzymatic sites, suggesting functional connections. Here we show that E136 and E57 are required for ferritin enzyme activity and thus are functional links between ferritin ion channels and enzymatic sites. DFP formation (Kcat and kcat/Km), DFP decay, and protein-caged hydrated ferric oxide accumulation decreased in ferritin E57A and E136A; saturation required higher Fe(2+) concentrations. Divalent cations (both ion channel and intracage binding) selectively inhibit ferritin enzyme activity (block Fe(2+) access), Mn(2+) < Co(2+) < Cu(2+) < Zn(2+), reflecting metal ion-protein binding stabilities. Fe(2+)-Cys126 binding in ferritin ion channels, observed as Cu(2+)-S-Cys126 charge-transfer bands in ferritin E130D UV-vis spectra and resistance to Cu(2+) inhibition in ferritin C126S, was unpredicted. Identifying E57 and E136 links in Fe(2+) movement from ferritin ion channels to ferritin enzyme sites completes a bucket brigade that moves external Fe(2+) into ferritin enzymatic sites. The results clarify Fe(2+) transport within ferritin and model molecular links between membrane ion channels and cytoplasmic destinations.
Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude
2017-10-01
While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
RBind: computational network method to predict RNA binding sites.
Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie
2018-04-26
Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.
Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten
2017-04-01
BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.
A novel substance P binding site in bovine adrenal medulla.
Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E
1990-05-04
Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tam, S.W.; Cook, L.
1984-09-01
The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less
Alontaga, Aileen Y.; Fenton, Aron W.
2011-01-01
The binding site for allosteric inhibitor (amino acid) is highly conserved between human liver pyruvate kinase (hL-PYK) and the rabbit muscle isozyme (rM1-PYK). To detail similarities/differences in the allosteric function of these two homologs, we quantified the binding of 45 amino acid analogues to hL-PYK and their allosteric impact on affinity for the substrate, phosphoenolpyruvate (PEP). This complements a similar study previously completed for rM1-PYK. In hL-PYK, the minimum chemical requirements for effector binding are the same as those identified for rM1-PYK (i.e. the L-2-aminopropanaldehyde substructure of the effector is primarily responsible for binding). However different regions of the effector determine the magnitude of the allosteric response in hL-PYK vs. rM1-PYK. This finding is inconsistent with the idea that allosteric pathways are conserved between homologs of a protein family. PMID:21261284
Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A
1996-01-04
In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.
Accurate and sensitive quantification of protein-DNA binding affinity.
Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J
2018-04-17
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.
Accurate and sensitive quantification of protein-DNA binding affinity
Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.
2018-01-01
Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332
Frost, L S; Lee, J S; Scraba, D G; Paranchych, W
1986-01-01
Two murine monoclonal antibodies (JEL 92 and 93) specific for adjacent epitopes on F pilin were purified and characterized. JEL 93 immunoglobulin G (IgG) and its Fab fragments were specific for the amino-terminal region and were completely reactive with a synthetic peptide representing the first eight amino acids of F pilin. The acetyl group was demonstrated to be an important part of the epitope, since an unacetylated version of the amino-terminal peptide was 100-fold less reactive with JEL 93 IgG. JEL 92 IgG reacted with the region of F pilin surrounding Met-9, represented by a tryptic peptide derived from the first 17 amino acids. This reactivity was completely abolished by cleavage of the peptide with cyanogen bromide. As shown by electron microscopy, both monoclonal antibodies bound to a vesiclelike structure at one end of purified free pili and did not bind to the sides of the pili, nor did they appear to bind to the tip. When sonication was used to break pili into shorter fragments, the number of binding sites for JEL 92 but not JEL 93 IgG increased as measured by a competitive enzyme-linked immunosorbent assay. Images PMID:2428808
Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U
2014-06-02
The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.
Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu
2014-01-01
Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Zinc is required for the catalytic activity of the human deubiquitinating isopeptidase T.
Gabriel, Jean-Marc; Lacombe, Thierry; Carobbio, Stefania; Paquet, Nicole; Bisig, Ruth; Cox, Jos A; Jaton, Jean-Claude
2002-11-19
Two recombinant human isopeptidase T isoforms, ISOT-S and ISOT-L, differing by an insertion of 23 amino acids in ISOT-L, were previously classified as thiol proteases. Both contain one Zn2+-binding site of high-affinity, which is part of a cryptic nitrilo-triacetate-resistant pocket (site 1). A second Zn2+ site (site 2) was disclosed when both isoforms of the holoenzyme were incubated with an excess of Zn2+. The firmly bound Zn2+ of site 1 could be removed either slowly by dialysis against 1,10-phenanthroline at pH 5.5 or rapidly by treatment at pH 3.0 in the presence of 6 M urea followed by gel filtration at neutral pH. Zn2+ in site 1, but not in site 2, is essential for proteolytic activity because apoproteins were inactive. Inhibition of the catalytic activity was not due to a loss of ubiquitin binding capacity. CD spectra of both isoforms disclosed no major structural differences between the apo- and holoenzymes. The reconstitution of apoenzyme with Zn2+ under nondenaturing conditions at pH 5.5 completely restored enzymatic activity, which was indistinguishable from the reconstitution carried out in urea at pH 3.0. Thus, both human ISOTs are either thiol proteases with a local structural Zn2+ or monozinc metalloproteases that might use in catalysis a Zn2+-activated hydroxide ion polarized by Cys335.
Case, S S; Huber, P; Lloyd, J A
1999-11-01
A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.
Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A
2013-01-01
Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571
Wei, Qing; La, David; Kihara, Daisuke
2017-01-01
Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .
Computational Optimization and Characterization of Molecularly Imprinted Polymers
NASA Astrophysics Data System (ADS)
Terracina, Jacob J.
Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sultatos, L.G.; Kaushik, R.
2008-08-01
The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less
The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.
Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki
2017-01-01
Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boyd, S.K.
1987-01-01
Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less
Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther
2011-05-01
The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cosman, M; Zeller, L; Lightstone, F C
2002-01-01
The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less
Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.
Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.
1993-01-01
1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620
Influence of sulfhydryl sites on metal binding by bacteria
NASA Astrophysics Data System (ADS)
Nell, Ryan M.; Fein, Jeremy B.
2017-02-01
The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.
Mougel, M; Philippe, C; Ebel, J P; Ehresmann, B; Ehresmann, C
1988-01-01
We have investigated in detail the secondary and tertiary structures of E. coli 16S rRNA binding site of protein S15 using a variety of enzymatic and chemical probes. RNase T1 and nuclease S1 were used to probe unpaired nucleotides and RNase V1 to monitor base-paired or stacked nucleotides. Bases were probed with dimethylsulfate (at A(N-1), C(N-3) and G(N-7)), with 1-cyclohexyl-3 (2-(1-methylmorpholino)-ethyl)-carboiimide-p- toluenesulfonate (at U(N-3) and G(N-1)) and with diethylpyrocarbonate (at A(N-7)). The RNA region corresponding to nucleotides 652 to 753 was tested within: (1) the complete 16S rRNA molecule; (2) a 16S rRNA fragment corresponding to nucleotides 578 to 756 obtained by transcription in vitro; (3) the S15-16S rRNA complex; (4) the S15-fragment complex. Cleavage and modification sites were detected by primer extension with reverse transcriptase. Our results show that: (1) The synthetized fragment folds into the same overall secondary structure as in the complete 16S rRNA, with the exception of the large asymmetrical internal loop (nucleotides 673-676/714-733) which is fully accessible in the fragment while it appears conformationally heterogeneous in the 16S rRNA; (2) the reactivity patterns of the S15-16S rRNA and S15-fragment complexes are identical; (3) the protein protects defined RNA regions, located in the large interior loop and in the 3'-end strand of helix [655-672]-[734-751]; (4) the protein also causes enhanced chemical reactivity and enzyme accessibility interpreted as resulting from a local conformational rearrangement, induced by S15 binding. Images PMID:2453025
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen P.
2006-10-17
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
RNA binding protein and binding site useful for expression of recombinant molecules
Mayfield, Stephen
2000-01-01
The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Acceleration of Binding Site Comparisons by Graph Partitioning.
Krotzky, Timo; Klebe, Gerhard
2015-08-01
The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
GenProBiS: web server for mapping of sequence variants to protein binding sites.
Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka
2017-07-03
Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Fikrika, H.; Ambarsari, L.; Sumaryada, T.
2016-01-01
Molecular docking simulation of catechin and its derivatives on Glucosamine-6- Phosphate Synthase (GlmS) has been performed in this research. GlmS inhibition by a particular ligand will suppress the production of bacterial cell wall and significantly reduce the population of invading bacteria. In this study, catechin derivatives i.e epicatechin, galloatechin and epigalloatechin were found to have stronger binding affinities as compared to natural ligand of GlmS, Fructose-6-Phosphate (F6P). Those three ligands were docked on the same pocket in GlmS target as F6P, with 70% binding sites similarity. Based on the docking results, gallocatechin turns out to be the most potent ligand for anti-bacterial agent with ΔG= -8.00 kcal/mol. The docking between GlmS and catechin derivatives are characterized by a constant present of a strong hydrogen bond between functional group O3 and Ser-349. This hydrogen bond most likely plays a significant role in the docking mechanism and binding modes selection. The surprising result is catechin itself exhibited a quite strong binding with GlmS (ΔG= -7.80 kcal.mol), but docked on a completely different pocket compared to other ligands. This results suggest that catechin might still have a curing effect but with a completely different pathway and mechanism as compared to its derivatives.
Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe
2011-01-01
Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967
Interaction between phloretin and the red blood cell membrane
1976-01-01
Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575
A peek into tropomyosin binding and unfolding on the actin filament.
Singh, Abhishek; Hitchcock-Degregori, Sarah E
2009-07-24
Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.
sc-PDB: a 3D-database of ligandable binding sites--10 years on.
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Ahmed, Ahmed H; Oswald, Robert E
2010-03-11
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.
Ahmed, Ahmed H.; Oswald, Robert E.
2010-01-01
Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115
Active Site and Remote Contributions to Catalysis in Methylthioadenosine Nucleosidases
Thomas, Keisha; Cameron, Scott A.; Almo, Steven C.; ...
2015-03-25
5'-Methylthioadenosine/S-adenosyl-l-homocysteine nucleosidases (MTANs) catalyze the hydrolysis of 5'-methylthioadenosine to adenine and 5-methylthioribose. The amino acid sequences of the MTANs from Vibrio cholerae (VcMTAN) and Escherichia coli (EcMTAN) are 60% identical and 75% similar. Protein structure folds and kinetic properties are similar. However, binding of transition-state analogues is dominated by favorable entropy in VcMTAN and by enthalpy in EcMTAN. Catalytic sites of VcMTAN and EcMTAN in contact with reactants differ by two residues; Ala113 and Val153 in VcMTAN are Pro113 and Ile152, respectively, in EcMTAN. Here, we mutated the VcMTAN catalytic site residues to match those of EcMTAN in anticipation ofmore » altering its properties toward EcMTAN. Inhibition of VcMTAN by transition-state analogues required filling both active sites of the homodimer. However, in the Val153Ile mutant or double mutants, transition-state analogue binding at one site caused complete inhibition. Therefore, a single amino acid, Val153, alters the catalytic site cooperativity in VcMTAN. The transition-state analogue affinity and thermodynamics in mutant VcMTAN became even more unlike those of EcMTAN, the opposite of expectations from catalytic site similarity; thus, catalytic site contacts in VcMTAN are unable to recapitulate the properties of EcMTAN. X-ray crystal structures of EcMTAN, VcMTAN, and a multiple-site mutant of VcMTAN most closely resembling EcMTAN in catalytic site contacts show no major protein conformational differences. In conclusion, the overall protein architectures of these closely related proteins are implicated in contributing to the catalytic site differences.« less
Active Site and Remote Contributions to Catalysis in Methylthioadenosine Nucleosidases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thomas, Keisha; Cameron, Scott A.; Almo, Steven C.
5'-Methylthioadenosine/S-adenosyl-l-homocysteine nucleosidases (MTANs) catalyze the hydrolysis of 5'-methylthioadenosine to adenine and 5-methylthioribose. The amino acid sequences of the MTANs from Vibrio cholerae (VcMTAN) and Escherichia coli (EcMTAN) are 60% identical and 75% similar. Protein structure folds and kinetic properties are similar. However, binding of transition-state analogues is dominated by favorable entropy in VcMTAN and by enthalpy in EcMTAN. Catalytic sites of VcMTAN and EcMTAN in contact with reactants differ by two residues; Ala113 and Val153 in VcMTAN are Pro113 and Ile152, respectively, in EcMTAN. Here, we mutated the VcMTAN catalytic site residues to match those of EcMTAN in anticipation ofmore » altering its properties toward EcMTAN. Inhibition of VcMTAN by transition-state analogues required filling both active sites of the homodimer. However, in the Val153Ile mutant or double mutants, transition-state analogue binding at one site caused complete inhibition. Therefore, a single amino acid, Val153, alters the catalytic site cooperativity in VcMTAN. The transition-state analogue affinity and thermodynamics in mutant VcMTAN became even more unlike those of EcMTAN, the opposite of expectations from catalytic site similarity; thus, catalytic site contacts in VcMTAN are unable to recapitulate the properties of EcMTAN. X-ray crystal structures of EcMTAN, VcMTAN, and a multiple-site mutant of VcMTAN most closely resembling EcMTAN in catalytic site contacts show no major protein conformational differences. In conclusion, the overall protein architectures of these closely related proteins are implicated in contributing to the catalytic site differences.« less
Kulakovskiy, Ivan V; Vorontsov, Ilya E; Yevshin, Ivan S; Sharipov, Ruslan N; Fedorova, Alla D; Rumynskiy, Eugene I; Medvedeva, Yulia A; Magana-Mora, Arturo; Bajic, Vladimir B; Papatsenko, Dmitry A; Kolpakov, Fedor A; Makeev, Vsevolod J
2018-01-04
We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.
Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta
2013-07-01
Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.
Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.
Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin
2017-09-14
U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.
Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng
2018-05-10
CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.
Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly
2014-01-01
microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.
LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.
Marshall, J C; Shakespear, R A; Odell, W D
1976-11-01
Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.
An alternate binding site for PPARγ ligands
Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.
2014-01-01
PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063
Concerted formation of macromolecular Suppressor–mutator transposition complexes
Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina
1998-01-01
Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711
Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew
2015-11-01
Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.
Oligomycin frames a common drug-binding site in the ATP synthase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric
We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less
Nisius, Britta; Gohlke, Holger
2012-09-24
Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.
Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L
2008-12-09
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.
Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.
2009-01-01
Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330
Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.
Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael
2013-01-01
Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
[3H]MK-801 binding sites in post-mortem human frontal cortex.
Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P
1989-03-29
The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.
Juárez, Oscar; Neehaul, Yashvin; Turk, Erin; Chahboun, Najat; DeMicco, Jessica M.; Hellwig, Petra; Barquera, Blanca
2012-01-01
The Na+-pumping NADH:quinone oxidoreductase (Na+-NQR) is the main entrance for electrons into the respiratory chain of many marine and pathogenic bacteria. The enzyme accepts electrons from NADH and donates them to ubiquinone, and the free energy released by this redox reaction is used to create an electrochemical gradient of sodium across the cell membrane. Here we report the role of glycine 140 and glycine 141 of the NqrB subunit in the functional binding of ubiquinone. Mutations at these residues altered the affinity of the enzyme for ubiquinol. Moreover, mutations in residue NqrB-G140 almost completely abolished the electron transfer to ubiquinone. Thus, NqrB-G140 and -G141 are critical for the binding and reaction of Na+-NQR with its electron acceptor, ubiquinone. PMID:22645140
Zhang, Shaofei; Zhu, Iris; Deng, Tao; Furusawa, Takashi; Rochman, Mark; Vacchio, Melanie S.; Bosselut, Remy; Yamane, Arito; Casellas, Rafael; Landsman, David; Bustin, Michael
2016-01-01
The activation of naïve B lymphocyte involves rapid and major changes in chromatin organization and gene expression; however, the complete repertoire of nuclear factors affecting these genomic changes is not known. We report that HMGN proteins, which bind to nucleosomes and affect chromatin structure and function, co-localize with, and maintain the intensity of DNase I hypersensitive sites genome wide, in resting but not in activated B cells. Transcription analyses of resting and activated B cells from wild-type and Hmgn−/− mice, show that loss of HMGNs dampens the magnitude of the transcriptional response and alters the pattern of gene expression during the course of B-cell activation; defense response genes are most affected at the onset of activation. Our study provides insights into the biological function of the ubiquitous HMGN chromatin binding proteins and into epigenetic processes that affect the fidelity of the transcriptional response during the activation of B cell lymphocytes. PMID:27112571
Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J
1999-09-24
We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.
Vamparys, Lydie; Laurent, Benoist; Carbone, Alessandra; Sacquin-Mora, Sophie
2016-10-01
Protein-protein interactions play a key part in most biological processes and understanding their mechanism is a fundamental problem leading to numerous practical applications. The prediction of protein binding sites in particular is of paramount importance since proteins now represent a major class of therapeutic targets. Amongst others methods, docking simulations between two proteins known to interact can be a useful tool for the prediction of likely binding patches on a protein surface. From the analysis of the protein interfaces generated by a massive cross-docking experiment using the 168 proteins of the Docking Benchmark 2.0, where all possible protein pairs, and not only experimental ones, have been docked together, we show that it is also possible to predict a protein's binding residues without having any prior knowledge regarding its potential interaction partners. Evaluating the performance of cross-docking predictions using the area under the specificity-sensitivity ROC curve (AUC) leads to an AUC value of 0.77 for the complete benchmark (compared to the 0.5 AUC value obtained for random predictions). Furthermore, a new clustering analysis performed on the binding patches that are scattered on the protein surface show that their distribution and growth will depend on the protein's functional group. Finally, in several cases, the binding-site predictions resulting from the cross-docking simulations will lead to the identification of an alternate interface, which corresponds to the interaction with a biomolecular partner that is not included in the original benchmark. Proteins 2016; 84:1408-1421. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc. © 2016 The Authors Proteins: Structure, Function, and Bioinformatics Published by Wiley Periodicals, Inc.
Characterization of β-Glucan Recognition Site on C-Type Lectin, Dectin 1
Adachi, Yoshiyuki; Ishii, Takashi; Ikeda, Yoshihiko; Hoshino, Akiyoshi; Tamura, Hiroshi; Aketagawa, Jun; Tanaka, Shigenori; Ohno, Naohito
2004-01-01
Dectin 1 is a mammalian cell surface receptor for (1→3)-β-d-glucans. Since (1→3)-β-d-glucans are commonly present on fungal cell walls, it has been suggested that dectin 1 is important for recognizing fungal invasion. In this study we tried to deduce the amino acid residues in dectin 1 responsible for β-glucan recognition. HEK293 cells transfected with mouse dectin 1 cDNA could bind to a gel-forming (1→3)-β-d-glucan, schizophyllan (SPG). The binding of SPG to a dectin 1 transfectant was inhibited by pretreatment with other β-glucans having a (1→3)-β-d-glucosyl linkage but not by pretreatment with α-glucans. Dectin 1 has a carbohydrate recognition domain (CRD) consisting of six cysteine residues that are highly conserved in C-type lectins. We prepared 32 point mutants with mutations in the CRD and analyzed their binding to SPG. Mutations at Trp221 and His223 resulted in decreased binding to β-glucan. Monoclonal antibody 4B2, a dectin- 1 monoclonal antibody which had a blocking effect on the β-glucan interaction, completely failed to bind the dectin-1 mutant W221A. A mutant with mutations in Trp221 and His223 did not have a collaborative effect on Toll-like receptor 2-mediated cellular activation in response to zymosan. These amino acid residues are distinct from residues in other sugar-recognizing peptide sequences of typical C-type lectins. These results suggest that the amino acid sequence W221-I222-H223 is critical for formation of a β-glucan binding site in the CRD of dectin 1. PMID:15213161
Hothersall, J Daniel; Torella, Rubben; Humphreys, Sian; Hooley, Monique; Brown, Alastair; McMurray, Gordon; Nickolls, Sarah A
2017-05-15
The development of G protein-biased agonists for the μ-opioid receptor (MOR) offers a clear drug discovery rationale for improved analgesia and reduced side-effects of opiate pharmacotherapy. However, our understanding of the molecular mechanisms governing ligand bias is limited, which hinders our ability to rationally design biased compounds. We have investigated the role of MOR binding site residues W320 and Y328 in controlling bias, by receptor mutagenesis. The pharmacology of a panel of ligands in a cAMP and a β-arrestin2 assay were compared between the wildtype and mutated receptors, with bias factors calculated by operational analysis using ΔΔlog(τ/K A ) values. [ 3 H]diprenorphine competition binding was used to estimate affinity changes. Introducing the mutations W320A and Y328F caused changes in pathway bias, with different patterns of change between ligands. For example, DAMGO increased relative β-arrestin2 activity at the W320A mutant, whilst its β-arrestin2 response was completely lost at Y328F. In contrast, endomorphin-1 gained activity with Y328F but lost activity at W320A, in both pathways. For endomorphin-2 there was a directional shift from cAMP bias at the wildtype towards more β-arrestin2 bias at W320A. We also observe clear uncoupling between mutation-driven changes in function and binding affinity. These findings suggest that the mutations influenced the balance of pathway activation in a ligand-specific manner, thus identifying residues in the MOR binding pocket that govern ligand bias. This increases our understanding of how ligand/receptor binding interactions can be translated into agonist-specific pathway activation. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T
2018-09-01
Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-03-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.
Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.
Rostagno, A A; Schwarzbauer, J E; Gold, L I
1999-01-01
Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513
sc-PDB: a 3D-database of ligandable binding sites—10 years on
Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther
2015-01-01
The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483
Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A
2018-05-29
Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.
2008-01-01
The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.
Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry
2014-01-01
We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.
Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando
2018-03-23
The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M
2011-01-01
Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less
NASA Astrophysics Data System (ADS)
Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh
2017-06-01
In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.
The regulation of OXPHOS by extramitochondrial calcium.
Gellerich, Frank N; Gizatullina, Zemfira; Trumbeckaite, Sonata; Nguyen, Huu P; Pallas, Thilo; Arandarcikaite, Odeta; Vielhaber, Stephan; Seppet, Enn; Striggow, Frank
2010-01-01
Despite extensive research, the regulation of mitochondrial function is still not understood completely. Ample evidence shows that cytosolic Ca2+ has a strategic task in co-ordinating the cellular work load and the regeneration of ATP by mitochondria. Currently, the paradigmatic view is that Cacyt2+ taken up by the Ca2+ uniporter activates the matrix enzymes pyruvate dehydrogenase, alpha-ketoglutarate dehydrogenase and isocitrate dehydrogenase. However, we have recently found that Ca2+ regulates the glutamate-dependent state 3 respiration by the supply of glutamate to mitochondria via aralar, a mitochondrial glutamate/aspartate carrier. Since this activation is not affected by ruthenium red, glutamate transport into mitochondria is controlled exclusively by extramitochondrial Ca2+. Therefore, this discovery shows that besides intramitochondrial also extramitochondrial Ca2+ regulates oxidative phosphorylation. This new mechanism acts as a mitochondrial "gas pedal", supplying the OXPHOS with substrate on demand. These results are in line with recent findings of Satrustegui and Palmieri showing that aralar as part of the malate-aspartate shuttle is involved in the Ca2+-dependent transport of reducing hydrogen equivalents (from NADH) into mitochondria. This review summarises results and evidence as well as hypothetical interpretations of data supporting the view that at the surface of mitochondria different regulatory Ca2+-binding sites exist and can contribute to cellular energy homeostasis. Moreover, on the basis of our own data, we propose that these surface Ca2+-binding sites may act as targets for neurotoxic proteins such as mutated huntingtin and others. The binding of these proteins to Ca2+-binding sites can impair the regulation by Ca2+, causing energetic depression and neurodegeneration. Copyright © 2010 Elsevier B.V. All rights reserved.
Katow, H; Yamamoto, Y; Sofuku, S
1997-04-01
A fibronectin-related synthetic cyclic H-Cys-Arg-Gly-Asp-Ser-Pro-Ala-Ser-Ser-Cys-OH (RGDSPASS) peptide (FR-1) binding site in the embryo of the sand dollar Clypeaster japonicus was specified using dansyl-labeled FR-1 (Dns-FR-1) and horseradish peroxidase-labeled FR-1, and an FR-1 receptor was isolated using FR-1-affinity column chromatography. The FR-1 introduced to the blastocoel of blastulae inhibited primary mesenchyme cell (PMC) migration in mesenchyme blastulae, and complete gastrulation and spicule differentiation in gastrulae. The Dns-FR-1 bound to the entire basal side of the ectoderm in mesenchyme blastulae, and then restricted to the basal side of the ectoderm at the apical tuft region and the vegetal hemisphere in early gastrulae. The cytoplasm of the archenteron also bound to Dns-FR-1. In PMC, Dns-FR-1 bound to the nucleus and cytoplasmic reticular features. In unfertilized eggs, Dns-FR-1 bound to the entire cytoplasm, particularly to the oval-shaped granules and the nuclear envelope, but only to the cytoplasm after fertilization. Relative molecular mass (Mr) of the FR-1-binding protein was 240 kDa under non-reducing conditions and 57 kDa under reducing conditions. The FR-1 receptor protein bound anti-sea urchin integrin (Spl) betaL subunit antibodies raised against the embryos of Strongylocentrotus purpuratus. Immunohistochemistry showed that the antibody binding site was similar to the histochemical distribution of Dns-FR-1. However, Mr of the FR-1 receptor is distinctively larger than that of the Spl betaL subunit.
Borgford, T J; Gray, T E; Brand, N J; Fersht, A R
1987-11-17
Some aminoacyl-tRNA synthetases of almost negligible homology do have a small region of similarity around four-residue sequence His-Ile(or Leu or Met)-Gly-His(or Asn), the HIGH sequence. The first histidine in this sequence in the tyrosyl-tRNA synthetase, His-45, has been shown to form part of a binding site for the gamma-phosphate of ATP in the transition state for the reaction as does Thr-40. Residue His-56 in the valyl-tRNA synthetase begins a HIGH sequence, and there is a threonine at position 52, one position closer to the histidine than in the tyrosyl-tRNA synthetase. The mutants Thr----Ala-52 and His----Asn-56 have been made and their complete free energy profiles for the formation of valyl adenylate determined. Difference energy diagrams have been constructed by comparison with the reaction of wild-type enzyme. The difference energy profiles are very similar to those for the mutants Thr----Ala-40 and His----Asn-45 of the tyrosyl-tRNA synthetase. Thr-52 and His-56 of the valyl-tRNA synthetase contribute little binding energy to valine, ATP, and Val-AMP. Instead, the wild-type enzyme binds the transition state and pyrophosphate some 6 kcal/mol more tightly than do the mutants. Preferential transition-state stabilization is thus an important component of catalysis by the valyl-tRNA synthetase. Further, by analogy to the tyrosyl-tRNA synthetase, the valyl-tRNA synthetase has a binding site for the gamma-phosphate of ATP in the transition state, and this is likely to be a general feature of aminoacyl-tRNA synthetases that have a HIGH region.
Behrends, Jan C
2000-01-01
T-butyl-bicyclo-phosphorothionate (TBPS) is a prototypical representative of the cage-convulsants which act through a use-dependent block of the GABAA-receptor-ionophore complex. Using current recordings from cultured neurones of rat striatum the manner was investigated in which two antagonists, bicuculline and penicillin, presumably acting at the agonist binding site and in the ionic channel, respectively, modify the rate of block by TBPS. Penicillin (5 or 10 mM) did not slow the rate of block by TBPS, but produced a significant enhancement of block rate, which, however, was inversely related to the degree of antagonism by penicillin of the GABA-induced current. Bicuculline (10 μM) reduced the rate of block by TBPS. However, this effect was 3 fold weaker than its GABA-antagonistic action. The slowing of block rate and the current antagonism exhibited a biphasic, positive-negative relationship. Co-application of bicuculline (100 μM) in a concentration that produced nearly complete antagonism and TBPS (10 μM) resulted in a marked (∼40%) reduction of subsequent GABA response amplitudes compatible with a direct, bicuculline-induced conformational change in the receptor required for the binding of and block by TBPS. The lack of protection afforded by the channel blocker penicillin as well as the lack of correlation between bicuculline antagonism of the Cl−-current and its efficiency in protecting against TBPS block is evidence against an open channel blocking mechanism for TBPS. TBPS does, therefore, not appear to gain access to its binding site via the open pore but through alternative routes regulated from the agonist binding site. PMID:10694249
Harriman, Robert W.; Shao, Ai-Ping; Wasserman, Bruce P.
1992-01-01
UDP-glucose:(1,3)-β-glucan (callose) synthase (CS) from storage tissue of red beet (Beta vulgaris L.) was strongly inhibited by the phenothiazine drug chlorpromazine (CPZ). In the absence of ultraviolet irradiation, CPZ was a noncompetitive inhibitor with 50% inhibitory concentration values for plasma membrane and solubilized CS of 100 and 90 μm, respectively. Both the Ca2+- and Mg2+- stimulated components of CS activity were affected. CPZ inhibition was partially alleviated at saturating levels of Ca2+, but not Mg2+, suggesting that CPZ interferes with the Ca2+-binding site of CS. Binding experiments with [14C]CPZ, however, showed strong non-specific partitioning of CPZ into the plasma membrane, providing evidence that perturbation of the membrane environment is probably the predominant mode of inhibition. Ultraviolet irradiation at 254 nm markedly enhanced CPZ inhibition, with complete activity loss following exposure to 4 μm CPZ for 2 min. Inhibition followed a pseudo-first order mechanism with at least three CPZ binding sites per CS complex. Under these conditions, [3H]CPZ was covalently incorporated into plasma membrane preparations by a free radical mechanism; however, polypeptide labeling profiles showed labeling to be largely nonspecific, with many polypeptides labeled even at [3H]CPZ levels as low as 1 μm, and with boiled membranes. Although CPZ is one of the most potent known inhibitors of CS, its use as a photolabel will require a homogeneous CS complex or establishment of conditions that protect against the interaction of CPZ with specific binding sites located on various polypeptide components of the CS complex. PMID:16653219
Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M
2013-10-23
Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hoffmann, Jana; Altenbuchner, Josef
2015-01-01
A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762
Middendorf, Thomas R.
2017-01-01
A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951
Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.
Mizuno, S; Ogawa, N; Mori, A
1982-12-01
Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.
Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.
Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda
2008-05-01
The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.
Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng
2014-03-01
Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.
Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.
Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry
2006-07-01
High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.
Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo
2010-01-01
The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860
Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard
2017-07-05
Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.
Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.
Streiff, John H; Jones, Keith A
2008-10-01
The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.
Crystal structure of the Candida albicans Kar3 kinesin motor domain fused to maltose-binding protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delorme, Caroline; Joshi, Monika; Allingham, John S., E-mail: allinghj@queensu.ca
2012-11-30
Highlights: Black-Right-Pointing-Pointer The Candida albicans Kar3 motor domain structure was solved as a maltose-binding protein fusion. Black-Right-Pointing-Pointer The electrostatic surface and part of the ATPase pocket of the motor domain differs markedly from other kinesins. Black-Right-Pointing-Pointer The MBP-Kar3 interface highlights a new site for intramolecular or intermolecular interactions. -- Abstract: In the human fungal pathogen Candida albicans, the Kinesin-14 motor protein Kar3 (CaKar3) is critical for normal mitotic division, nuclear fusion during mating, and morphogenic transition from the commensal yeast form to the virulent hyphal form. As a first step towards detailed characterization of this motor of potential medical significance,more » we have crystallized and determined the X-ray structure of the motor domain of CaKar3 as a maltose-binding protein (MBP) fusion. The structure shows strong conservation of overall motor domain topology to other Kar3 kinesins, but with some prominent differences in one of the motifs that compose the nucleotide-binding pocket and the surface charge distribution. The MBP and Kar3 modules are arranged such that MBP interacts with the Kar3 motor domain core at the same site where the neck linker of conventional kinesins docks during the 'ATP state' of the mechanochemical cycle. This site differs from the Kar3 neck-core interface in the recent structure of the ScKar3Vik1 heterodimer. The position of MBP is also completely distinct from the Vik1 subunit in this complex. This may suggest that the site of MBP interaction on the CaKar3 motor domain provides an interface for the neck, or perhaps a partner subunit, at an intermediate state of its motile cycle that has not yet been observed for Kinesin-14 motors.« less
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
Analysis of functional importance of binding sites in the Drosophila gap gene network model.
Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria
2015-01-01
The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.
Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E
2011-01-01
CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.
Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.
Dudev, Todor; Chang, Li-Ying; Lim, Carmay
2005-03-23
Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.
Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.
Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua
2013-11-01
The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.
Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny
2012-11-01
The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.
Vedovato, Natascia
2014-01-01
A single Na+/K+-ATPase pumps three Na+ outwards and two K+ inwards by alternately exposing ion-binding sites to opposite sides of the membrane in a conformational sequence coupled to pump autophosphorylation from ATP and auto-dephosphorylation. The larger flow of Na+ than K+ generates outward current across the cell membrane. Less well understood is the ability of Na+/K+ pumps to generate an inward current of protons. Originally noted in pumps deprived of external K+ and Na+ ions, as inward current at negative membrane potentials that becomes amplified when external pH is lowered, this proton current is generally viewed as an artifact of those unnatural conditions. We demonstrate here that this inward current also flows at physiological K+ and Na+ concentrations. We show that protons exploit ready reversibility of conformational changes associated with extracellular Na+ release from phosphorylated Na+/K+ pumps. Reversal of a subset of these transitions allows an extracellular proton to bind an acidic side chain and to be subsequently released to the cytoplasm. This back-step of phosphorylated Na+/K+ pumps that enables proton import is not required for completion of the 3 Na+/2 K+ transport cycle. However, the back-step occurs readily during Na+/K+ transport when external K+ ion binding and occlusion are delayed, and it occurs more frequently when lowered extracellular pH raises the probability of protonation of the externally accessible carboxylate side chain. The proton route passes through the Na+-selective binding site III and is distinct from the principal pathway traversed by the majority of transported Na+ and K+ ions that passes through binding site II. The inferred occurrence of Na+/K+ exchange and H+ import during the same conformational cycle of a single molecule identifies the Na+/K+ pump as a hybrid transporter. Whether Na+/K+ pump–mediated proton inflow may have any physiological or pathophysiological significance remains to be clarified. PMID:24688018
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giannopoulos, G.; Jackson, K.; Kredentser, J.
The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less
Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.
Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain
2014-11-18
Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.
Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies
NASA Astrophysics Data System (ADS)
Pang, Yuan-Ping; Kozikowski, Alan P.
1994-12-01
We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.
The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less
Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki
2016-06-01
Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Energetics and kinetics of cooperative cofilin-actin filament interactions.
Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M
2006-08-11
We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.
Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.
2008-08-19
Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less
Monobromobimane occupies a distinct xenobiotic substrate site in glutathione S-transferase π
Ralat, Luis A.; Colman, Roberta F.
2003-01-01
Monobromobimane (mBBr), functions as a substrate of porcine glutathione S-transferase π (GST π): The enzyme catalyzes the reaction of mBBr with glutathione. S-(Hydroxyethyl)bimane, a nonreactive analog of monobromobimane, acts as a competitive inhibitor with respect to mBBr as substrate but does not affect the reaction of GST π with another substrate, 1-chloro-2,4-dinitrobenzene (CDNB). In the absence of glutathione, monobromobimane inactivates GST π at pH 7.0 and 25°C as assayed using mBBr as substrate, with a lesser effect on the enzyme’s use of CDNB as substrate. These results indicate that the sites occupied by CDNB and mBBr are not identical. Inactivation is proportional to the incorporation of 2 moles of bimane/mole of subunit. Modification of GST π with mBBr does not interfere with its binding of 8-anilino-1-naphthalene sulfonate, indicating that this hydrophobic site is not the target of monobromobimane. S-Methylglutathione and S-(hydroxyethyl)bimane each yield partial protection against inactivation and decrease reagent incorporation, while glutathionyl-bimane protects completely against inactivation. Peptide analysis after trypsin digestion indicates that mBBr modifies Cys45 and Cys99 equally. Modification of Cys45 is reduced in the presence of S-methylglutathione, indicating that this residue is at or near the glutathione binding region. In contrast, modification of Cys99 is reduced in the presence of S-(hydroxyethyl)bimane, suggesting that this residue is at or near the mBBr xenobiotic substrate binding site. Modification of Cys99 can best be understood by reaction with monobromobimane while it is bound to its xenobiotic substrate site in an alternate orientation. These results support the concept that glutathione S-transferase accomplishes its ability to react with a diversity of substrates in part by harboring distinct xenobiotic substrate sites. PMID:14573868
Monobromobimane occupies a distinct xenobiotic substrate site in glutathione S-transferase pi.
Ralat, Luis A; Colman, Roberta F
2003-11-01
Monobromobimane (mBBr), functions as a substrate of porcine glutathione S-transferase pi (GST pi): The enzyme catalyzes the reaction of mBBr with glutathione. S-(Hydroxyethyl)bimane, a nonreactive analog of monobromobimane, acts as a competitive inhibitor with respect to mBBr as substrate but does not affect the reaction of GST pi with another substrate, 1-chloro-2,4-dinitrobenzene (CDNB). In the absence of glutathione, monobromobimane inactivates GST pi at pH 7.0 and 25 degrees C as assayed using mBBr as substrate, with a lesser effect on the enzyme's use of CDNB as substrate. These results indicate that the sites occupied by CDNB and mBBr are not identical. Inactivation is proportional to the incorporation of 2 moles of bimane/mole of subunit. Modification of GST pi with mBBr does not interfere with its binding of 8-anilino-1-naphthalene sulfonate, indicating that this hydrophobic site is not the target of monobromobimane. S-Methylglutathione and S-(hydroxyethyl)bimane each yield partial protection against inactivation and decrease reagent incorporation, while glutathionyl-bimane protects completely against inactivation. Peptide analysis after trypsin digestion indicates that mBBr modifies Cys45 and Cys99 equally. Modification of Cys45 is reduced in the presence of S-methylglutathione, indicating that this residue is at or near the glutathione binding region. In contrast, modification of Cys99 is reduced in the presence of S-(hydroxyethyl)bimane, suggesting that this residue is at or near the mBBr xenobiotic substrate binding site. Modification of Cys99 can best be understood by reaction with monobromobimane while it is bound to its xenobiotic substrate site in an alternate orientation. These results support the concept that glutathione S-transferase accomplishes its ability to react with a diversity of substrates in part by harboring distinct xenobiotic substrate sites.
Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC
Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei
2010-01-01
Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424
ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.
Konc, Janez; Janežič, Dušanka
2014-07-01
The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trong, I.Le; Stenkamp, R.E.; Ibarra, C.
2005-08-22
Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less
Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing
Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav
2007-01-01
In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418
Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.
Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F
1994-10-27
Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.
Anisotropic energy flow and allosteric ligand binding in albumin
NASA Astrophysics Data System (ADS)
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin.
Li, Guifeng; Magana, Donny; Dyer, R Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.
Anisotropic energy flow and allosteric ligand binding in albumin
Li, Guifeng; Magana, Donny; Dyer, R. Brian
2014-01-01
Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265
Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.
2012-01-01
An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049
Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E
2017-01-01
Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-02-06
Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-09-01
Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Morley, B J; Garner, L L
1990-06-11
Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.
NASA Astrophysics Data System (ADS)
Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie
Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.
Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales
NASA Astrophysics Data System (ADS)
Qian, Long; Kussell, Edo
The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.
Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose
Jalak, Jürgen; Väljamäe, Priit
2014-01-01
Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511
Gibbons, R. J.; Moreno, E. C.; Etherden, I.
1983-01-01
The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.
1990-01-01
Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy
Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming
2014-01-01
A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048
Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok
2012-06-01
In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.
Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.
Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E
2018-02-01
Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish
2009-06-08
The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less
Transcription through the roadblocks: the role of RNA polymerase cooperation
Epshtein, Vitaly; Toulmé, Francine; Rahmouni, A.Rachid; Borukhov, Sergei; Nudler, Evgeny
2003-01-01
During transcription, cellular RNA polymerases (RNAP) have to deal with numerous potential roadblocks imposed by various DNA binding proteins. Many such proteins partially or completely interrupt a single round of RNA chain elongation in vitro. Here we demonstrate that Escherichia coli RNAP can effectively read through the site-specific DNA-binding proteins in vitro and in vivo if more than one RNAP molecule is allowed to initiate from the same promoter. The anti-roadblock activity of the trailing RNAP does not require transcript cleavage activity but relies on forward translocation of roadblocked complexes. These results support a cooperation model of transcription whereby RNAP molecules behave as ‘partners’ helping one another to traverse intrinsic and extrinsic obstacles. PMID:12970184
Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart
1999-01-01
Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456
Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants
Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander
2013-01-01
Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254
Architecture of a Fur Binding Site: a Comparative Analysis
Lavrrar, Jennifer L.; McIntosh, Mark A.
2003-01-01
Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murphy, Jesse R.; Donini, Stefano; Kappock, T. Joseph, E-mail: kappock@purdue.edu
2015-09-23
Citrate synthase from the thermophilic euryarchaeon T. acidophilum fused to a hexahistidine tag was purified and biochemically characterized. The structure of the unliganded enzyme at 2.2 Å resolution contains tail–active site contacts in half of the active sites. Citrate synthase (CS) plays a central metabolic role in aerobes and many other organisms. The CS reaction comprises two half-reactions: a Claisen aldol condensation of acetyl-CoA (AcCoA) and oxaloacetate (OAA) that forms citryl-CoA (CitCoA), and CitCoA hydrolysis. Protein conformational changes that ‘close’ the active site play an important role in the assembly of a catalytically competent condensation active site. CS from themore » thermoacidophile Thermoplasma acidophilum (TpCS) possesses an endogenous Trp fluorophore that can be used to monitor the condensation reaction. The 2.2 Å resolution crystal structure of TpCS fused to a C-terminal hexahistidine tag (TpCSH6) reported here is an ‘open’ structure that, when compared with several liganded TpCS structures, helps to define a complete path for active-site closure. One active site in each dimer binds a neighboring His tag, the first nonsubstrate ligand known to occupy both the AcCoA and OAA binding sites. Solution data collectively suggest that this fortuitous interaction is stabilized by the crystalline lattice. As a polar but almost neutral ligand, the active site–tail interaction provides a new starting point for the design of bisubstrate-analog inhibitors of CS.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.
1988-05-01
Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less
Purification of L-( sup 3 H) Nicotine eliminates low affinity binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Romm, E.; Marks, M.J.; Collins, A.C.
1990-01-01
Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.
Binding of (/sup 3/H)Forskolin to rat brain membranes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seamon, K.B.; Vaillancourt, R.; Edwards, M.
1984-08-01
(12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less
Biophysical Fitness Landscapes for Transcription Factor Binding Sites
Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.
2014-01-01
Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228
Yokoyama, Ken Daigoro; Pollock, David D
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Nucleotide-dependent bisANS binding to tubulin.
Chakraborty, S; Sarkar, N; Bhattacharyya, B
1999-07-13
Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.
2015-01-01
The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846
Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, M.E.; Mallorga, P.; Pettibone, D.J.
1988-01-01
(/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less
Impact of disruption of secondary binding site S2 on dopamine transporter function.
Zhen, Juan; Reith, Maarten E A
2016-09-01
The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.
Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis
2011-11-14
The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.
Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter
2001-01-01
Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581
Palumbo, Michael J; Newberg, Lee A
2010-07-01
The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).
Autoradiographic demonstration of oxytocin-binding sites in the macula densa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoeckel, M.E.; Freund-Mercier, M.J.
1989-08-01
Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less
High-affinity cannabinoid binding site in brain: A possible marijuana receptor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nye, J.S.
The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less
Gillard, Michel; Chatelain, Pierre; Fuks, Bruno
2006-04-24
A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.
The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.
positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP
Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas
2010-01-01
Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350
Pharmacophore screening of the protein data bank for specific binding site chemistry.
Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu
2010-03-22
A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca
2011-01-01
The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714
Recanatini, Maurizio; Cavalli, Andrea
2011-01-01
In humans, type 1 11β-hydroxysteroid dehydrogenase (11β-HSD-1) plays a key role in the regulation of the glucocorticoids balance by converting the inactive hormone cortisone into cortisol. Numerous functional aspects of 11β-HSD-1 have been understood thanks to the availability at the Worldwide Protein Data Bank of a number of X-ray structures of the enzyme either alone or in complex with inhibitors, and to several experimental data. However at present, a complete description of the dynamic behaviour of 11β-HSD-1 upon substrate binding is missing. To this aim we firstly docked cortisone into the catalytic site of 11β-HSD-1 (both wild type and Y177A mutant), and then we used steered molecular dynamics and metadynamics to simulate its undocking. This methodology helped shedding light at molecular level on the complex relationship between the enzyme and its natural substrate. In particular, the work highlights a) the reason behind the functional dimerisation of 11β-HSD-1, b) the key role of Y177 in the cortisone binding event, c) the fine tuning of the active site degree of solvation, and d) the role of the S228-P237 loop in ligand recognition. PMID:21966510
Measso do Bonfim, Caroline; Simão Sobrinho, João; Lacerda Nogueira, Rodrigo; Salgado Kupper, Daniel; Cardoso Pereira Valera, Fabiana; Lacerda Nogueira, Maurício; Villa, Luisa Lina; Rahal, Paula; Sichero, Laura
2015-01-01
A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied. PMID:26151558
Wei, C H; Chou, W Y; Huang, S M; Lin, C C; Chang, G G
1994-06-28
Pigeon liver malic enzyme was rapidly inactivated by micromolar concentrations of ferrous sulfate in the presence of ascorbate at neutral pH and 0 or 25 degrees C. Omitting the ascorbate or replacing the ferrous ion with manganese ion did not lead to any inactivation. Manganese, magnesium, zinc, cobalt, or calcium ion at 200 molar excess over ferrous ion offered complete protection of the enzyme from Fe(2+)-induced inactivation. Ni2+ provided partial protection, while Ba2+ or imidazole was ineffective in protection. Addition of 4 mM Mn2+ or 5 mM EDTA into a partially modified enzyme stopped further inactivation of the enzyme. Inclusion of substrates (L-malate or NADP+, singly or in combination) in the incubation mixture did not affect the inactivation rate. The enzyme inactivation was demonstrated to be followed by protein cleavage. Native pigeon liver malic enzyme had a subunit M(r) of 65,000. The inactivated enzyme with residual activity of only 0.3% was cleaved into two fragments with M(r) of 31,000 and 34,000, respectively. The cleavage site was identified as the peptide bond between Asp258 and Ile259. Native pigeon liver malic enzyme was blocked at the N-terminus. Cleavage at the putative metal-binding site exposed a new N-terminus, which was identified to be at the 34-kDa fragment containing the C-terminal half of original sequence 259-557. Our results indicated that Fe2+ catalyzed a specific oxidation of pigeon liver malic enzyme at Asp258 and/or some other essential amino acid residues that caused enzyme inactivation. The modified enzyme was then affinity cleaved at the Mn(2+)-binding site.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gundlach, A.L.; Largent, B.L.; Snyder, S.H.
1986-06-01
(+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less
Rohrer, Karin M; Haug, Markus; Schwörer, Daniela; Kalbacher, Hubert; Holzer, Ursula
2014-01-01
Heat-shock protein 70 (Hsp70)–peptide complexes are involved in MHC class I-and II-restricted antigen presentation, enabling enhanced activation of T cells. As shown previously, mammalian cytosolic Hsp70 (Hsc70) molecules interact specifically with HLA-DR molecules. This interaction might be of significance as Hsp70 molecules could transfer bound antigenic peptides in a ternary complex into the binding groove of HLA-DR molecules. The present study provides new insights into the distinct interaction of Hsp70 with HLA-DR molecules. Using a quantitative binding assay, it could be demonstrated that a point mutation of amino acids alanine 406 and valine 438 in the substrate binding pocket led to reduced peptide binding compared with the wild-type Hsp70 whereas HLA-DR binding remains unaffected. The removal of the C-terminal lid neither altered the substrate binding capacity nor the Hsp70 binding characteristics to HLA-DR. A truncated variant lacking the nucleotide binding domain showed no binding interactions with HLA-DR. Furthermore, the truncated ATPase subunit of constitutively expressed Hsc70 revealed similar binding affinities to HLA-DR compared with the complete Hsc70. Hence, it can be assumed that the Hsp70–HLA-DR interaction takes place outside the peptide binding groove and is attributed to the ATPase domain of HSP70 molecules. The Hsp70-chaperoned peptides might thereby be directly transferred into the binding groove of HLA-DR, so enabling enhanced presentation of the peptide on antigen-presenting cells and leading to an improved proliferation of responding T cells as shown previously. PMID:24428437
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.
Salter, Jason D; Smith, Harold C
2018-05-23
The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
A six-year longitudinal PET study of (+)-[11C]DTBZ binding to the VMAT2 in monkey brain.
Kilbourn, Michael R; Koeppe, Robert A
2017-12-01
The longitudinal reproducibility of in vivo binding potential measures for [ 11 C]dihydrotetrabenazine ([ 11 C]DTBZ) binding to the vesicular monoamine transporter 2 (VMAT2) site in primate brain was examined using a unique dataset of repeated control PET imaging studies. Forty-one dynamic [ 11 C]DTBZ PET studies were completed in a single rhesus monkey. Imaging equipment (microPET P4), personnel, radiotracer characteristics (injected mass amounts, molar activity) and image data analysis (BP ND-Logan ) were consistent throughout the entire sequence of PET studies. Same day reproducibility of BP ND-Logan estimates of specific binding was very good (-3% and -7% changes) for two control-control sessions. Over the full 74 months, the average BP ND-Logan value for [ 11 C]DTBZ-PET studies was 4.19±0.52, for a variance of 12%. No age-dependent change in binding potentials was observed over the six-year period. If the technical variables associated with PET scanner are consistently maintained, including PET scanner, imaging procedures and radiotracer preparation, in vivo biochemistry can be reproducibly measured in the primate brain over a multi-year period of time. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.
The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, M.W.; Chen, J.P.; Wallis, C.
1992-02-26
({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M
1998-01-01
The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514
Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N
1991-11-01
The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.
Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua
2016-07-19
The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.
Barnert, R H; Zeichhardt, H; Habermehl, K O
1992-02-01
Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.
Cooperative interplay of let-7 mimic and HuR with MYC RNA.
Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A
2015-01-01
Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.
Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen
2018-06-06
Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary
2015-12-01
CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.
FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1
Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.
2007-01-01
Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863
Investigation of glucose binding sites on insulin.
Zoete, Vincent; Meuwly, Markus; Karplus, Martin
2004-05-15
Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.
James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha
2015-01-01
Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488
Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen
2017-01-01
Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946
Ochs, Kerstin; Rust, René C.; Niepmann, Michael
1999-01-01
Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840
Xenobiotic interaction with and alteration of channel catfish estrogen receptor.
Nimrod, A C; Benson, W H
1997-12-01
In teleostean in vivo studies, the vitellogenin response to environmental estrogens is not completely predicted by mammalian literature. One possible explanation for differences is heterogeneity of the estrogen receptor (ER) structure between species. Therefore, ER from channel catfish (Ictalurus punctatus) hepatic tissue was characterized by binding affinity for several compounds. Affinity was indirectly measured as potency of the chemical for inhibiting binding of radiolabeled estradiol (E2) to specific binding sites. The order of potency among therapeutic chemicals was ethinylestradiol > unlabeled E2 = diethylstilbestrol > mestranol > tamoxifen > testosterone. Unlabeled E2 had an IC50 of 2.2 nM. Several environmentally relevant chemicals were evaluated in a similar manner and the order of potency established was the o-demethylated metabolite of methoxychlor (MXC) > nonylphenol (NP) > chlordecone > MXC > o,p'-DDT > o,p'-DDE > beta-hexachlorocyclohexane. Demethylated MXC had an IC50 1000-fold greater than that of E2. Of the most potent inhibitors, NP appeared to be a competitive inhibitor for the same binding site as E2, while o-demethylated MXC had a more complex interaction with the receptor protein. ER from nonvitellogenic females was determined to have a Kd value of 1.0 to 1.3 nM. Because E2 has been reported to up-regulate teleostean ER, the hepatic ER population following in vivo xenobiotic exposure was assessed. NP significantly increased ER per milligram hepatic protein almost to the same extent as E2, but did not increase Kd to the same extent as E2.
Lee, Joanna; Daniels, Veronique; Sands, Zara A.; Lebon, Florence; Shi, Jiye; Biggin, Philip C.
2015-01-01
The putative Major Facilitator Superfamily (MFS) transporter, SV2A, is the target for levetiracetam (LEV), which is a successful anti-epileptic drug. Furthermore, SV2A knock out mice display a severe seizure phenotype and die after a few weeks. Despite this, the mode of action of LEV is not known at the molecular level. It would be extremely desirable to understand this more fully in order to aid the design of improved anti-epileptic compounds. Since there is no structure for SV2A, homology modelling can provide insight into the ligand-binding site. However, it is not a trivial process to build such models, since SV2A has low sequence identity to those MFS transporters whose structures are known. A further level of complexity is added by the fact that it is not known which conformational state of the receptor LEV binds to, as multiple conformational states have been inferred by tomography and ligand binding assays or indeed, if binding is exclusive to a single state. Here, we explore models of both the inward and outward facing conformational states of SV2A (according to the alternating access mechanism for MFS transporters). We use a sequence conservation analysis to help guide the homology modelling process and generate the models, which we assess further with Molecular Dynamics (MD). By comparing the MD results in conjunction with docking and simulation of a LEV-analogue used in radioligand binding assays, we were able to suggest further residues that line the binding pocket. These were confirmed experimentally. In particular, mutation of D670 leads to a complete loss of binding. The results shed light on the way LEV analogues may interact with SV2A and may help with the on-going design of improved anti-epileptic compounds. PMID:25692762
Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.
Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J
1988-01-01
The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.
Marcelli, M; Zoppi, S; Wilson, C M; Griffin, J E; McPhaul, M J
1994-01-01
We have investigated the basis of androgen resistance in seven unrelated individuals with complete testicular feminization or Reifenstein syndrome caused by single amino acid substitutions in the hormone-binding domain of the androgen receptor. Monolayer-binding assays of cultured genital skin fibroblasts demonstrated absent ligand binding, qualitative abnormalities of androgen binding, or a decreased amount of qualitatively normal receptor. The consequences of these mutations were examined by introducing the mutations by site-directed mutagenesis into the androgen receptor cDNA sequence and expressing the mutant cDNAs in mammalian cells. The effects of the amino acid substitutions on the binding of different androgens and on the capacity of the ligand-bound receptors to activate a reporter gene were investigated. Substantial differences were found in the responses of the mutant androgen receptors to incubation with testosterone, 5 alpha-dihydrotestosterone, and mibolerone. In several instances, increased doses of hormone or increased frequency of hormone addition to the incubation medium resulted in normal or near normal activation of a reporter gene by cells expressing the mutant androgen receptors. These studies suggest that the stability of the hormone receptor complex is a major determinant of receptor function in vivo. Images PMID:7929841
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.
2008-01-01
Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991
An additional substrate binding site in a bacterial phenylalanine hydroxylase
Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan
2014-01-01
Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686
NASA Astrophysics Data System (ADS)
Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.
2018-03-01
To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.
Keck, P C; Huston, J S
1996-01-01
Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174
Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma
2017-09-01
Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Timberman, Anthony; Yang, Rongfang; Papantones, Alex; Seitz, W. Rudolf
2018-01-01
A new type of biomimetic templated copolymer has been prepared by reverse addition fragmentation chain transfer polymerization (RAFT) in dioxane. The initial formulation includes the template fluorescein, N-isopropylacrylamide (NIPAM, 84 mol %), methacrylic acid (MAA, 5-mol %), 4-vinylpyridine (4-VP, 9 mmol %), and N,N′-methylenebis(acrylamide) (MBA, 2 mol %). PolyNIPAM is a thermosensitive polymer that comes out of aqueous solution above its lower critical solution temperature forming hydrophobic ‘crosslinks’. MAA and 4-VP interact in dioxane forming acid–base crosslinks. The excess 4-VP serves as a recognition monomer organizing around the template fluorescein to form a binding site that is held in place by the noncovalent and covalent crosslinks. The MBA is a covalent crosslinker. The RAFT agent in the resulting copolylmer was reduced to a thiol and attached to gold nanoparticles. The gold nanoparticle bound copolymer binds fluorescein completely in less than two seconds with an affinity constant greater than 108 M−1. A reference copolymer prepared with the same monomers by the same procedure binds fluorescein much more weakly. PMID:29693601
Catalytic site interactions in yeast OMP synthase.
Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R
2014-01-15
The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.
Lindner, Diana; Walther, Cornelia; Tennemann, Anja; Beck-Sickinger, Annette G
2009-01-01
The N terminus is the most variable element in G protein-coupled receptors (GPCRs), ranging from seven residues up to approximately 5900 residues. For family B and C GPCRs it is described that at least part of the ligand binding site is located within the N terminus. Here we investigated the role of the N terminus in the neuropeptide Y receptor family, which belongs to the class A of GPCRs. We cloned differentially truncated Y receptor mutants, in which the N terminus was partially or completely deleted. We found, that eight amino acids are sufficient for full ligand binding and signal transduction activity. Interestingly, we could show that no specific amino acids but rather the extension of the first transmembrane helix by any residues is sufficient for receptor activity but also for membrane integration in case of the hY(1) and the hY(4) receptors. In contrast, the complete deletion of the N terminus in the hY(2) receptors resulted in a mutant that is fully integrated in the membrane but does not bind the ligand very well and internalizes much slower compared to the wild type receptor. Interestingly, also these effects could be reverted by any N-terminal extension. Accordingly, the most important function of the N termini seems to be the stabilization of the first transmembrane helix to ensure the correct receptor structure, which obviously is essential for ligand binding, integration into the cell membrane and receptor internalization.
Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min
2006-01-01
Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).
Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muccioli, G.; Guardabassi, A.; Pattono, P.
1990-03-01
The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less
Study of DNA binding sites using the Rényi parametric entropy measure.
Krishnamachari, A; moy Mandal, Vijnan; Karmeshu
2004-04-07
Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.
SITEHOUND-web: a server for ligand binding site identification in protein structures.
Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto
2009-07-01
SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.
Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.
Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei
2016-03-01
Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.
Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H
1994-01-01
Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896
Binding site and affinity prediction of general anesthetics to protein targets using docking.
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G
2012-05-01
The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.
Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking
Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.
2012-01-01
Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968
Ravindranath, Pradeep Anand; Sanner, Michel F.
2016-01-01
Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702
Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1
Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.
2008-01-01
Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268
Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter
2006-04-15
We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.
Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C
1992-01-01
Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867
Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site
Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.
2015-01-01
Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702